WorldWideScience

Sample records for malate synthases showed

  1. Phosphorylation of glyoxysomal malate synthase from castor oil seed endosperm and cucumber cotyledon

    Yang, Y.P; Randall, D.D.

    1989-01-01

    Glyoxysomal malate synthase (MS) was purified to apparent homogeneity from 3-d germinating castor oil seed endosperm by a relatively simple procedure including two sucrose density gradient centrifugations. Antibodies raised to the caster oil seed MS crossreacted with MS from cucumber cotyledon. MS was phosphorylated in both tissues in an MgATP dependent reaction. The phosphorylation pattern was similar for both enzymes and both enzymes were inhibited by NaF, NaMo, (NH 4 )SO 4 , glyoxylate and high concentration of MgCl 2 (60 mM), but was not inhibited by NaCl and malate. Further characterization of the phosphorylation of MS from castor oil seed endosperms showed that the 5S form of MS is the form which is labelled by 32 P. The addition of exogenous alkaline phosphatase to MS not only decreased enzyme activity, but could also dephosphorylate phospho-MS. The relationship between dephosphorylation of MS and the decrease of MS activity is currently under investigation

  2. Post-irradiation inactivation, protection, and repair of the sulfhydryl enzyme malate synthase

    Durchschlag, H.; Zipper, P.

    1985-01-01

    Malate synthase from baker's yeast, a trimeric sulfhydryl enzyme with one essential sulfhydryl group per subunit, was inactivated by 2 kGy X-irradiation in air-saturated aqueous solution (enzyme concentration: 0.5 mg/ml). The radiation induced changes of enzymic activity were registered at about 0,30,60 h after irradiation. To elucidate the role of OH - , O 2 , and H 2 O 2 in the X-ray inactivation of the enzyme, experiments were performed in the absence of presence of different concentrations of specific additives (formate, superoxide dismutase, catalase). These additives were added to malate synthase solutions before or after X-irradiation. Moreover, repairs of inactivated malate synthase were initiated at about 0 or 30 h after irradiation by means of the sulfhydryl agent dithiothreitol. Experiments yielded the following results: 1. Irradiation of malate synthase in the absence of additives inactivated the enzyme immediately to a residual activity Asub(r)=3% (corresponding to a D 37 =0.6 kGy), and led to further slow inactivation in the post-irradiation phase. Repairs, initiated at different times after irradiation, restored enzymic activity considerably. The repair initiated at t=0 led to Asub(r)=21%; repairs started later on resulted in somewhat lower activities. The decay of reparability, however, was found to progress more slowly than post-irradiation inactivation itself. After completion of repair the activities of repaired samples did not decrease significantly. 2. The presence of specific additives during irradiation caused significant protective effects against primary inactivation. The protection by formate was very pronounced (e.g., Asub(r)=72% and D 37 =6 kGy for 100 mM formate). The presence of catalytic amounts of superoxide dismutase and/or catalase exhibited only minor effects, depending on the presence and concentration of formate. (orig.)

  3. Systematic replacement of lysine with glutamine and alanine in Escherichia coli malate synthase G: effect on crystallization

    Anstrom, David M.; Colip, Leslie; Moshofsky, Brian; Hatcher, Eric; Remington, S. James

    2005-01-01

    Alanine and glutamine mutations were made to the same 15 lysine positions on the surface of E. coli malate synthase G and the impact on crystallization observed. The results support lysine replacement for improvement of crystallization and provide insight into site selection and type of amino-acid replacement. Two proposals recommend substitution of surface lysine residues as a means to improve the quality of protein crystals. In proposal I, substitution of lysine by alanine has been suggested to improve crystallization by reducing the entropic cost of ordering flexible side chains at crystal contacts. In proposal II, substitution of lysine by residues more commonly found in crystal contacts, such as glutamine, has been proposed to improve crystallization. 15 lysine residues on the surface of Escherichia coli malate synthase G, distributed over a variety of secondary structures, were individually mutated to both alanine and glutamine. For 28 variants, detailed studies of the effect on enzymatic activity and crystallization were conducted. This has permitted direct comparison of the relative effects of the two types of mutations. While none of the variants produced crystals suitable for X-ray structural determination, small crystals were obtained in a wide variety of conditions, in support of the general approach. Glutamine substitutions were found to be more effective than alanine in producing crystals, in support of proposal II. Secondary structure at the site of mutation does not appear to play a major role in determining the rate of success

  4. Crystal structures of a halophilic archaeal malate synthase from Haloferax volcanii and comparisons with isoforms A and G

    2011-01-01

    Background Malate synthase, one of the two enzymes unique to the glyoxylate cycle, is found in all three domains of life, and is crucial to the utilization of two-carbon compounds for net biosynthetic pathways such as gluconeogenesis. In addition to the main isoforms A and G, so named because of their differential expression in E. coli grown on either acetate or glycolate respectively, a third distinct isoform has been identified. These three isoforms differ considerably in size and sequence conservation. The A isoform (MSA) comprises ~530 residues, the G isoform (MSG) is ~730 residues, and this third isoform (MSH-halophilic) is ~430 residues in length. Both isoforms A and G have been structurally characterized in detail, but no structures have been reported for the H isoform which has been found thus far only in members of the halophilic Archaea. Results We have solved the structure of a malate synthase H (MSH) isoform member from Haloferax volcanii in complex with glyoxylate at 2.51 Å resolution, and also as a ternary complex with acetyl-coenzyme A and pyruvate at 1.95 Å. Like the A and G isoforms, MSH is based on a β8/α8 (TIM) barrel. Unlike previously solved malate synthase structures which are all monomeric, this enzyme is found in the native state as a trimer/hexamer equilibrium. Compared to isoforms A and G, MSH displays deletion of an N-terminal domain and a smaller deletion at the C-terminus. The MSH active site is closely superimposable with those of MSA and MSG, with the ternary complex indicating a nucleophilic attack on pyruvate by the enolate intermediate of acetyl-coenzyme A. Conclusions The reported structures of MSH from Haloferax volcanii allow a detailed analysis and comparison with previously solved structures of isoforms A and G. These structural comparisons provide insight into evolutionary relationships among these isoforms, and also indicate that despite the size and sequence variation, and the truncated C-terminal domain of the H

  5. A chimeric protein of aluminum-activated malate transporter generated from wheat and Arabidopsis shows enhanced response to trivalent cations.

    Sasaki, Takayuki; Tsuchiya, Yoshiyuki; Ariyoshi, Michiyo; Ryan, Peter R; Yamamoto, Yoko

    2016-07-01

    TaALMT1 from wheat (Triticum aestivum) and AtALMT1 from Arabidopsis thaliana encode aluminum (Al)-activated malate transporters, which confer acid-soil tolerance by releasing malate from roots. Chimeric proteins from TaALMT1 and AtALMT1 (Ta::At, At::Ta) were previously analyzed in Xenopus laevis oocytes. Those studies showed that Al could activate malate efflux from the Ta::At chimera but not from At::Ta. Here, functions of TaALMT1, AtALMT1 and the chimeric protein Ta::At were compared in cultured tobacco BY-2 cells. We focused on the sensitivity and specificity of their activation by trivalent cations. The activation of malate efflux by Al was at least two-fold greater in the chimera than the native proteins. All proteins were also activated by lanthanides (erbium, ytterbium, gadolinium, and lanthanum), but the chimera again released more malate than TaALMT1 or AtALMT1. In Xenopus oocytes, Al, ytterbium, and erbium activated inward currents from the native TaALMT1 and the chimeric protein, but gadolinium only activated currents from the chimera. Lanthanum inhibited currents from both proteins. These results demonstrated that function of the chimera protein was altered compared to the native proteins and was more responsive to a range of trivalent cations when expressed in plant cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. The malate synthase of Paracoccidioides brasiliensis is a linked surface protein that behaves as an anchorless adhesin

    Pereira Maristela

    2009-12-01

    Full Text Available Abstract Background The pathogenic fungus Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis (PCM. This is a pulmonary mycosis acquired by inhalation of fungal airborne propagules that can disseminate to several organs and tissues leading to a severe form of the disease. Adhesion and invasion to host cells are essential steps involved in the internalization and dissemination of pathogens. Inside the host, P. brasiliensis may use the glyoxylate cycle for intracellular survival. Results Here, we provide evidence that the malate synthase of P. brasiliensis (PbMLS is located on the fungal cell surface, and is secreted. PbMLS was overexpressed in Escherichia coli, and polyclonal antibody was obtained against this protein. By using Confocal Laser Scanning Microscopy, PbMLS was detected in the cytoplasm and in the cell wall of the mother, but mainly of budding cells of the P. brasiliensis yeast phase. PbMLSr and its respective polyclonal antibody produced against this protein inhibited the interaction of P. brasiliensis with in vitro cultured epithelial cells A549. Conclusion These observations indicated that cell wall-associated PbMLS could be mediating the binding of fungal cells to the host, thus contributing to the adhesion of fungus to host tissues and to the dissemination of infection, behaving as an anchorless adhesin.

  7. Electrophoretic and chemical studies on the X-ray damage of malate synthase

    Durchschlag, H.; Zipper, P.

    1981-01-01

    1) Both X-irradiation and treatment with H 2 O 2 caused a decrease of total and an increase of available sulfhydryl groups of the enzyme and led to a loss of enzymic activity. The presence of dithiothreitol turned out to be able to protect the enzyme against X-ray or H 2 O 2 induced inactivation. Moreover, addition of dithiothreitol after X-irradiation or H 2 O 2 treatment allowed a considerable repair of enzymic activity. 2) Polyacrylamide gel disc electrophoreses of X-irradiated enzyme solutions, performed in the presence of sodium dodecyl sulfate, showed the occurrence of covalently cross-linked subunits (preferably dimers and trimers) and of various definite fragments. Electrophoreses in the absence of the denaturant indicated the occurrence of enzyme aggregation. The effects were more pronounced with increasing X-ray doses. The electrophoreses also clearly reflected a radioprotection by dithiothreitol against cross-linking, but not against fragmentation. Addition of excess of 2-mercaptoethanol or of dithiothreitol to the X-irradiated enzyme clearly demonstrated that part of the covalent cross-links were disulfide bridges; the aggregates themselves, however, were held together primarily by non-covalent bonds. Blocking of exposed enzyme sulfhydryls by means of Ellman's reagent prevented both covalent cross-linking and enzyme aggregation. 3) Similar electrophoretic patterns as found for the X-irradiated enzyme were obtained for the unirradiated enzyme after treatment with H 2 O 2 . The similarity of the electropherograms, as well as the reversible diminution of enzymic activity and the loss of sulfhydryls in the presence of H 2 O 2 , suggest an involvement of H 2 O 2 in the radiation damage of the enzyme. It seems plausible that oxidation reactions are responsible for the effects caused by X-irradiation or H 2 O 2 treatment. (orig./AJ)

  8. Type 2 Diabetic Rats on Diet Supplemented With Chromium Malate Show Improved Glycometabolism, Glycometabolism-Related Enzyme Levels and Lipid Metabolism

    Feng, Weiwei; Zhao, Ting; Mao, Guanghua; Wang, Wei; Feng, Yun; Li, Fang; Zheng, Daheng; Wu, Huiyu; Jin, Dun; Yang, Liuqing; Wu, Xiangyang

    2015-01-01

    Our previous study showed that chromium malate improved the regulation of blood glucose in mice with alloxan-induced diabetes. The present study was designed to evaluate the effect of chromium malate on glycometabolism, glycometabolism-related enzymes and lipid metabolism in type 2 diabetic rats. Our results showed that fasting blood glucose, serum insulin level, insulin resistance index and C-peptide level in the high dose group had a significant downward trend when compared with the model group, chromium picolinate group and chromium trichloride group. The hepatic glycogen, glucose-6-phosphate dehydrogenase, glucokinase, Glut4, phosphor-AMPKβ1 and Akt levels in the high dose group were significantly higher than those of the model, chromium picolinate and chromium trichloride groups. Chromium malate in a high dose group can significantly increase high density lipoprotein cholesterol level while decreasing the total cholesterol, low density lipoprotein cholesterol and triglyceride levels when compared with chromium picolinate and chromium trichloride. The serum chromium content in chromium malate and chromium picolinate group is significantly higher than that of the chromium trichloride group. The results indicated that the curative effects of chromium malate on glycometabolism, glycometabolism-related enzymes and lipid metabolism changes are better than those of chromium picolinate and chromium trichloride. Chromium malate contributes to glucose uptake and transport in order to improved glycometabolism and glycometabolism-related enzymes. PMID:25942313

  9. The crystal structures of the tri-functional Chloroflexus aurantiacus and bi-functional Rhodobacter sphaeroides malyl-CoA lyases and comparison with CitE-like superfamily enzymes and malate synthases.

    Zarzycki, Jan; Kerfeld, Cheryl A

    2013-11-09

    Malyl-CoA lyase (MCL) is a promiscuous carbon-carbon bond lyase that catalyzes the reversible cleavage of structurally related Coenzyme A (CoA) thioesters. This enzyme plays a crucial, multifunctional role in the 3-hydroxypropionate bi-cycle for autotrophic CO2 fixation in Chloroflexus aurantiacus. A second, phylogenetically distinct MCL from Rhodobacter sphaeroides is involved in the ethylmalonyl-CoA pathway for acetate assimilation. Both MCLs belong to the large superfamily of CitE-like enzymes, which includes the name-giving β-subunit of citrate lyase (CitE), malyl-CoA thioesterases and other enzymes of unknown physiological function. The CitE-like enzyme superfamily also bears sequence and structural resemblance to the malate synthases. All of these different enzymes share highly conserved catalytic residues, although they catalyze distinctly different reactions: C-C bond formation and cleavage, thioester hydrolysis, or both (the malate synthases). Here we report the first crystal structures of MCLs from two different phylogenetic subgroups in apo- and substrate-bound forms. Both the C. aurantiacus and the R. sphaeroides MCL contain elaborations on the canonical β8/α8 TIM barrel fold and form hexameric assemblies. Upon ligand binding, changes in the C-terminal domains of the MCLs result in closing of the active site, with the C-terminal domain of one monomer forming a lid over and contributing side chains to the active site of the adjacent monomer. The distinctive features of the two MCL subgroups were compared to known structures of other CitE-like superfamily enzymes and to malate synthases, providing insight into the structural subtleties that underlie the functional versatility of these enzymes. Although the C. aurantiacus and the R. sphaeroides MCLs have divergent primary structures (~37% identical), their tertiary and quaternary structures are very similar. It can be assumed that the C-C bond formation catalyzed by the MCLs occurs as proposed for

  10. Small-angle X-ray scattering studies on the X-ray induced aggregation of ribonnuclease, lactate dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase and serum albumin. A comparison with malate synthase

    Zipper, P.; Gatterer, H.G.; Schutz, J.; Durchschlag, H.

    1980-01-01

    The X-ray induced aggregation of ribonuclease, lactate dehydrogenase (LDH), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and serum albumin in aqueous solution was monitored in situ by means of small-angle X-ray scattering. Measurements carried out with ribonuclease, LDH and serum albumin in the absence of dithiothreitol (DTT) and with GAPDH in the presence of 0.2mM DTT established the following series for the rates of aggregation of the proteins under these conditions: ribonuclease >LDH> >GAPDH> serum albumin. Within six hours from the beginning of irradiation (i.e. about the time required for the exposure of one complete scattering curve under the conditions of our experiments) the following increases of R tilde resulted: ribonuclease 9%, LDH 7%, GAPDH 4%, serum albumin <1%. Changes of R tilde exceeding 1% are, of course, too high to be tolerated in conventional scattering experiments. Measurements carried out with LDH and GAPDH in the presence of 2mM DTT established a strong protective effect of DTT against the X-ray induced aggregation of these enzymes. The initial increase of R tilde upon irradiation of LDH and GAPDH in the presence of 2mM DTT was found to be even lower than the increase of R tilde observed when serum albumin was irradiated in the absence of DTT. However, the observed decrease of anti x of LDH and GAPDH at the early stages of irradiation suggested the occurrence of fragmentation of the enzymes as another consequence of radiation damage. This finding is discussed in context with the results from previous scattering experiments and electrophoretic studies on malate synthase. (author)

  11. The Arabidopsis vacuolar malate channel is a member of the ALMT family.

    Kovermann, Peter; Meyer, Stefan; Hörtensteiner, Stefan; Picco, Cristiana; Scholz-Starke, Joachim; Ravera, Silvia; Lee, Youngsook; Martinoia, Enrico

    2007-12-01

    In plants, malate is a central metabolite and fulfills a large number of functions. Vacuolar malate may reach very high concentrations and fluctuate rapidly, whereas cytosolic malate is kept at a constant level allowing optimal metabolism. Recently, a vacuolar malate transporter (Arabidopsis thaliana tonoplast dicarboxylate transporter, AttDT) was identified that did not correspond to the well-characterized vacuolar malate channel. We therefore hypothesized that a member of the aluminum-activated malate transporter (ALMT) gene family could code for a vacuolar malate channel. Using GFP fusion constructs, we could show that AtALMT9 (A. thaliana ALMT9) is targeted to the vacuole. Promoter-GUS fusion constructs demonstrated that this gene is expressed in all organs, but is cell-type specific as GUS activity in leaves was detected nearly exclusively in mesophyll cells. Patch-clamp analysis of an Atalmt9 T-DNA insertion mutant exhibited strongly reduced vacuolar malate channel activity. In order to functionally characterize AtALMT9 as a malate channel, we heterologously expressed this gene in tobacco and in oocytes. Overexpression of AtALMT9-GFP in Nicotiana benthamiana leaves strongly enhanced the malate current densities across the mesophyll tonoplasts. Functional expression of AtALMT9 in Xenopus oocytes induced anion currents, which were clearly distinguishable from endogenous oocyte currents. Our results demonstrate that AtALMT9 is a vacuolar malate channel. Deletion mutants for AtALMT9 exhibit only slightly reduced malate content in mesophyll protoplasts and no visible phenotype, indicating that AttDT and the residual malate channel activity are sufficient to sustain the transport activity necessary to regulate the cytosolic malate homeostasis.

  12. A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

    Gaoyi Cao

    Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

  13. Transgenic alfalfa (Medicago sativa) with increased sucrose phosphate synthase activity shows enhanced growth when grown under N2-fixing conditions.

    Gebril, Sayed; Seger, Mark; Villanueva, Fabiola Muro; Ortega, Jose Luis; Bagga, Suman; Sengupta-Gopalan, Champa

    2015-10-01

    Overexpression of SPS in alfalfa is accompanied by early flowering, increased plant growth and an increase in elemental N and protein content when grown under N2-fixing conditions. Sucrose phosphate synthase (SPS; EC 2.3.1.14) is the key enzyme in the synthesis of sucrose in plants. The outcome of overexpression of SPS in different plants using transgenic approaches has been quite varied, but the general consensus is that increased SPS activity is associated with the production of new sinks and increased sink strength. In legumes, the root nodule is a strong C sink and in this study our objective was to see how increasing SPS activity in a legume would affect nodule number and function. Here we have transformed alfalfa (Medicago sativa, cv. Regen SY), with a maize SPS gene driven by the constitutive CaMV35S promoter. Our results showed that overexpression of SPS in alfalfa, is accompanied by an increase in nodule number and mass and an overall increase in nitrogenase activity at the whole plant level. The nodules exhibited an increase in the level of key enzymes contributing to N assimilation including glutamine synthetase and asparagine synthetase. Moreover, the stems of the transformants showed higher level of the transport amino acids, Asx, indicating increased export of N from the nodules. The transformants exhibited a dramatic increase in growth both of the shoots and roots, and earlier flowering time, leading to increased yields. Moreover, the transformants showed an increase in elemental N and protein content. The overall conclusion is that increased SPS activity improves the N status and plant performance, suggesting that the availability of more C in the form of sucrose enhances N acquisition and assimilation in the nodules.

  14. Imidazopyridine-Based Fatty Acid Synthase Inhibitors That Show Anti-HCV Activity and in Vivo Target Modulation.

    Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S

    2013-01-10

    Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.

  15. (−-Epigallocatechin 3-Gallate Synthetic Analogues Inhibit Fatty Acid Synthase and Show Anticancer Activity in Triple Negative Breast Cancer

    Joan Crous-Masó

    2018-05-01

    Full Text Available (−-Epigallocatechin 3-gallate (EGCG is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN, which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination to be further characterized in vitro and in vivo.

  16. (-)-Epigallocatechin 3-Gallate Synthetic Analogues Inhibit Fatty Acid Synthase and Show Anticancer Activity in Triple Negative Breast Cancer.

    Crous-Masó, Joan; Palomeras, Sònia; Relat, Joana; Camó, Cristina; Martínez-Garza, Úrsula; Planas, Marta; Feliu, Lidia; Puig, Teresa

    2018-05-11

    (-)-Epigallocatechin 3-gallate (EGCG) is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN), which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC) cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination) to be further characterized in vitro and in vivo.

  17. Long noncoding RNA MALAT1 as a potential novel biomarker in digestive system cancers: a meta-analysis.

    Song, Wei; Zhang, Run J; Zou, Shu B

    2016-08-01

    Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), a newly discovered long non-coding RNA (lncRNA), has been reported to be overexpressed in various cancers. However, the clinical value of MALAT1 in digestive system cancers is unclear. This study was designed to investigate the potential value of MALAT1 as a prognostic biomarker in digestive system cancers. We searched the Medline, Embase and Cochrane Library databases. All studies that explored the correlation between lncRNA MALAT1 expression and survival in digestive system tumors were selected. A quantitative meta-analysis was performed for the correlation between lncRNA MALAT1 expression and survival in digestive system tumors. Five studies were eligible for analysis, which included 547 patients. Meta-analysis showed that high expression of MALAT1 could predict poor overall survival (OS) in digestive system cancers (pooled HR: 1.85, 95% CI: 1.41-2.43, Pdigestive system cancers.

  18. Aluminum-Activated Malate Transporters Can Facilitate GABA Transport.

    Ramesh, Sunita A; Kamran, Muhammad; Sullivan, Wendy; Chirkova, Larissa; Okamoto, Mamoru; Degryse, Fien; McLaughlin, Michael; Gilliham, Matthew; Tyerman, Stephen D

    2018-05-01

    Plant aluminum-activated malate transporters (ALMTs) are currently classified as anion channels; they are also known to be regulated by diverse signals, leading to a range of physiological responses. Gamma-aminobutyric acid (GABA) regulation of anion flux through ALMT proteins requires a specific amino acid motif in ALMTs that shares similarity with a GABA binding site in mammalian GABA A receptors. Here, we explore why TaALMT1 activation leads to a negative correlation between malate efflux and endogenous GABA concentrations ([GABA] i ) in both wheat ( Triticum aestivum ) root tips and in heterologous expression systems. We show that TaALMT1 activation reduces [GABA] i because TaALMT1 facilitates GABA efflux but GABA does not complex Al 3+ TaALMT1 also leads to GABA transport into cells, demonstrated by a yeast complementation assay and via 14 C-GABA uptake into TaALMT1 -expressing Xenopus laevis oocytes; this was found to be a general feature of all ALMTs we examined. Mutation of the GABA motif (TaALMT1 F213C ) prevented both GABA influx and efflux, and resulted in no correlation between malate efflux and [GABA] i We conclude that ALMTs are likely to act as both GABA and anion transporters in planta. GABA and malate appear to interact with ALMTs in a complex manner to regulate each other's transport, suggestive of a role for ALMTs in communicating metabolic status. © 2018 American Society of Plant Biologists. All rights reserved.

  19. Transgenic tobacco overexpressing Brassica juncea HMG-CoA synthase 1 shows increased plant growth, pod size and seed yield.

    Pan Liao

    Full Text Available Seeds are very important not only in the life cycle of the plant but they represent food sources for man and animals. We report herein a mutant of 3-hydroxy-3-methylglutaryl-coenzyme A synthase (HMGS, the second enzyme in the mevalonate (MVA pathway that can improve seed yield when overexpressed in a phylogenetically distant species. In Brassica juncea, the characterisation of four isogenes encoding HMGS has been previously reported. Enzyme kinetics on recombinant wild-type (wt and mutant BjHMGS1 had revealed that S359A displayed a 10-fold higher enzyme activity. The overexpression of wt and mutant (S359A BjHMGS1 in Arabidopsis had up-regulated several genes in sterol biosynthesis, increasing sterol content. To quickly assess the effects of BjHMGS1 overexpression in a phylogenetically more distant species beyond the Brassicaceae, wt and mutant (S359A BjHMGS1 were expressed in tobacco (Nicotiana tabacum L. cv. Xanthi of the family Solanaceae. New observations on tobacco OEs not previously reported for Arabidopsis OEs included: (i phenotypic changes in enhanced plant growth, pod size and seed yield (more significant in OE-S359A than OE-wtBjHMGS1 in comparison to vector-transformed tobacco, (ii higher NtSQS expression and sterol content in OE-S359A than OE-wtBjHMGS1 corresponding to greater increase in growth and seed yield, and (iii induction of NtIPPI2 and NtGGPPS2 and downregulation of NtIPPI1, NtGGPPS1, NtGGPPS3 and NtGGPPS4. Resembling Arabidopsis HMGS-OEs, tobacco HMGS-OEs displayed an enhanced expression of NtHMGR1, NtSMT1-2, NtSMT2-1, NtSMT2-2 and NtCYP85A1. Overall, increased growth, pod size and seed yield in tobacco HMGS-OEs were attributed to the up-regulation of native NtHMGR1, NtIPPI2, NtSQS, NtSMT1-2, NtSMT2-1, NtSMT2-2 and NtCYP85A1. Hence, S359A has potential in agriculture not only in improving phytosterol content but also seed yield, which may be desirable in food crops. This work further demonstrates HMGS function in plant

  20. Photosynthetic metabolism of malate and aspartate in Flaveria trinervia a C4 dicot

    Moore, B.A.

    1986-01-01

    C 4 species are known to vary in their apparent relative use of malate and aspartate to mediate carbon flux through the C 4 cycle. These studies investigate some of the adjustments in photosynthetic carbon metabolism that occur during a dark to light transition and during expansion of leaves of Flaveria trinervia, a C 4 dicot. Enzyme localization studies with isolated leaf mesophyll and bundle sheath protoplasts, indicated that both C 4 acids are formed in the mesophyll chloroplast, and that aspartate is metabolized to malate in the bundle sheath chloroplast prior to decaroxylation there. During photosynthetic induction, the partitioning of 14 CO 2 between malate and aspartate showed a single oscillation of increased aspartate labelling after 5 min of illumination. Turnover of [4-14C] (malate plus aspartate) was slow initially during illumination, prior to establishment of active pools of C 4 cycle metabolites

  1. The novel oral glucan synthase inhibitor SCY-078 shows in vitro activity against sessile and planktonic Candida spp.

    Marcos-Zambrano, Laura Judith; Gómez-Perosanz, Marta; Escribano, Pilar; Bouza, Emilio; Guinea, Jesús

    2017-07-01

    We studied the antifungal activity of SCY-078 (an orally bioavailable 1,3-β -d- glucan synthesis inhibitor), micafungin and fluconazole against the planktonic and sessile forms of 178 Candida and non- Candida isolates causing fungaemia in patients recently admitted to a large European hospital. The in vitro activity of SCY-078, micafungin and fluconazole against the planktonic form of the isolates was assessed using EUCAST EDef 7.3 and CLSI M27-A3. Antibiofilm activity was assessed using the XTT reduction assay. SCY-078 and micafungin showed potent in vitro activity against Candida and non- Candida isolates. The in vitro activity of both drugs was similar, but SYC-078 displayed significantly lower MIC values than micafungin against Candida parapsilosis and non- Candida isolates, whereas micafungin displayed significantly lower MIC values for the remaining species ( P  Candida glabrata , in which the micafungin sessile MIC values were significantly lower ( P  Candida isolates in both sessile and planktonic forms is comparable to that of micafungin. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Role of malate transporter in lipid accumulation of oleaginous fungus Mucor circinelloides.

    Zhao, Lina; Cánovas-Márquez, José T; Tang, Xin; Chen, Haiqin; Chen, Yong Q; Chen, Wei; Garre, Victoriano; Song, Yuanda; Ratledge, Colin

    2016-02-01

    Fatty acid biosynthesis in oleaginous fungi requires the supply of reducing power, NADPH, and the precursor of fatty acids, acetyl-CoA, which is generated in the cytosol being produced by ATP: citrate lyase which requires citrate to be, transported from the mitochondrion by the citrate/malate/pyruvate transporter. This transporter, which is within the mitochondrial membrane, transports cytosolic malate into the mitochondrion in exchange for mitochondrial citrate moving into the cytosol (Fig. 1). The role of malate transporter in lipid accumulation in oleaginous fungi is not fully understood, however. Therefore, the expression level of the mt gene, coding for a malate transporter, was manipulated in the oleaginous fungus Mucor circinelloides to analyze its effect on lipid accumulation. The results showed that mt overexpression increased the lipid content for about 70 % (from 13 to 22 % dry cell weight, CDW), whereas the lipid content in mt knockout mutant decreased about 27 % (from 13 to 9.5 % CDW) compared with the control strain. Furthermore, the extracellular malate concentration was decreased in the mt overexpressing strain and increased in the mt knockout strain compared with the wild-type strain. This work suggests that the malate transporter plays an important role in regulating lipid accumulation in oleaginous fungus M. circinelloides.

  3. The metabolism of malate by cultured rat brain astrocytes

    McKenna, M.C.; Tildon, J.T.; Couto, R.; Stevenson, J.H.; Caprio, F.J. (Department of Pediatrics, University of Maryland School of Medicine, Baltimore (USA))

    1990-12-01

    Since malate is known to play an important role in a variety of functions in the brain including energy metabolism, the transfer of reducing equivalents and possibly metabolic trafficking between different cell types; a series of biochemical determinations were initiated to evaluate the rate of 14CO2 production from L-(U-14C)malate in rat brain astrocytes. The 14CO2 production from labeled malate was almost totally suppressed by the metabolic inhibitors rotenone and antimycin A suggesting that most of malate metabolism was coupled to the electron transport system. A double reciprocal plot of the 14CO2 production from the metabolism of labeled malate revealed biphasic kinetics with two apparent Km and Vmax values suggesting the presence of more than one mechanism of malate metabolism in these cells. Subsequent experiments were carried out using 0.01 mM and 0.5 mM malate to determine whether the addition of effectors would differentially alter the metabolism of high and low concentrations of malate. Effectors studied included compounds which could be endogenous regulators of malate metabolism and metabolic inhibitors which would provide information regarding the mechanisms regulating malate metabolism. Both lactate and aspartate decreased 14CO2 production from malate equally. However, a number of effectors were identified which selectively altered the metabolism of 0.01 mM malate including aminooxyacetate, furosemide, N-acetylaspartate, oxaloacetate, pyruvate and glucose, but had little or no effect on the metabolism of 0.5 mM malate. In addition, alpha-ketoglutarate and succinate decreased 14CO2 production from 0.01 mM malate much more than from 0.5 mM malate. In contrast, a number of effectors altered the metabolism of 0.5 mM malate more than 0.01 mM. These included methionine sulfoximine, glutamate, malonate, alpha-cyano-4-hydroxycinnamate and ouabain.

  4. Quininium Malates: Partial Chiral Discrimination via Diastereomeric ...

    Quinine was employed as a resolving agent for racemic malic acid. The resultant product was a quininium salt containing 75 % of the D-malate anion. Quinine was also crystallized with pure L- and D-malic acids and the structures of the resulting diastereomeric salts were elucidated. The crystal packings were analyzed in ...

  5. Fumarate to Malate Conversion in Infarcted Porcine Heart – a Pilot Study

    Søvsø Szocska Hansen, Esben; Tougaard, Rasmus Stilling; Nielsen, Per Mose

    2017-01-01

    Hyperpolarized MR may be a key tool for investigation cardiac metabolism and cardiac treatment response. [1,4- 13C2]Fumarate is an emerging and interesting candidate for measuring and visualizing cardiac injury after ischemia. In this study we showed an initial step for imaging cardiac cell death...... in a large animal model with [1,4- 13C2]malate. The [1,4- 13C2]malate signal correlated well with increased 13C-lactate signal and 13C-alanine absence. Overall, this shows increased metabolism in the infarcted area and ongoing necrosis....

  6. la phosphoglucoisomerase et la malate deshydrogenase

    AISA

    dimérique du cycle de Krebs qui catalyse la réaction suivante: Malate + NAD MDH Oxaloacétate +. NADH. Dans les cellules du maïs, les formes cytosoliques sont codées par deux loci, les formes mitochondriales par 3 loci (Newton et. Schwartz, 1980). L'acide ascorbique inhibe préférentiellement les formes du cytosol.

  7. Evidence for catabolite degradation in the glucose-dependent inactivation of yeast cytoplasmic malate dehydrogenase

    Neeff, J.; Haegele, E.; Nauhaus, J.; Heer, U.; Mecke, D.

    1978-01-01

    The cytoplasmic malate dehydrogenase of Saccharomyces cerevisiae was radioactively labeled during its synthesis on a glucose-free derepression medium. After purification a sensitive radioimmunoassay for this enzyme could be developed. The assay showed that after the physiological, glucose-dependent 'catabolite inactivation' of cytoplasmic malate dehydrogenase an inactive enzyme protein is immunologically not detectable. Together with the irreversibility of this reaction in vivo this finding strongly suggests a proteolytic mechanism of enzyme inactivation. For this process the term 'catabolite degradation' is used. (orig.) [de

  8. Evaluation of 90-day Repeated Dose Oral Toxicity, Glycometabolism, Learning and Memory Ability, and Related Enzyme of Chromium Malate Supplementation in Sprague-Dawley Rats.

    Feng, Weiwei; Wu, Huiyu; Li, Qian; Zhou, Zhaoxiang; Chen, Yao; Zhao, Ting; Feng, Yun; Mao, Guanghua; Li, Fang; Yang, Liuqing; Wu, Xiangyang

    2015-11-01

    Our previous study showed that chromium malate improved the regulation of blood glucose in mice with alloxan-induced diabetes. The present study was designed to evaluate the 90-day oral toxicity of chromium malate in Sprague-Dawley rats. The present study inspected the effect of chromium malate on glycometabolism, glycometabolism-related enzymes, lipid metabolism, and learning and memory ability in metabolically healthy Sprague-Dawley rats. The results showed that all rats survived and pathological, toxic, feces, and urine changes were not observed. Chromium malate did not cause measurable damage on liver, brain, and kidney. The fasting blood glucose, serum insulin, insulin resistance index, C-peptide, hepatic glycogen, glucose-6-phosphate dehydrogenase, glucokinase, total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, and triglyceride levels of normal rats in chromium malate groups had no significant change when compared with control group and chromium picolinate group under physiologically relevant conditions. The serum and organ content of Cr in chromium malate groups had no significant change compared with control group. No significant changes were found in morris water maze test and superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and true choline esterase (TChE) activity. The results indicated that supplementation with chromium malate did not cause measurable toxicity and has no obvious effect on glycometabolism and related enzymes, learning and memory ability, and related enzymes and lipid metabolism of female and male rats. The results of this study suggest that chromium malate is safe for human consumption.

  9. Development of antimigraine transdermal delivery systems of pizotifen malate.

    Serna-Jiménez, C E; del Rio-Sancho, S; Calatayud-Pascual, M A; Balaguer-Fernández, C; Femenía-Font, A; López-Castellano, A; Merino, V

    2015-08-15

    The aim of this study was to develop and evaluate a transdermal delivery system of pizotifen malate. Pizotifen is frequently used in the preventive treatment of migraine, but is also indicated in eating disorders. In the course of the project, the effects of chemical enhancers such as ethanol, 1,8-cineole, limonene, azone and different fatty acids (decanoic, decenoic, dodecanoic, linoleic and oleic acids) were determined, first using a pizotifen solution. Steady state flux, diffusion and partition parameters were estimated by fitting the Scheuplein equation to the data obtained. Among the chemical enhancers studied, decenoic acid showed the highest enhancement activity, which seemed to be due to the length of its alkyl chain and unsaturation at the 9th carbon. The influence of iontophoresis and the involvement of electrotransport in said process was determined. The absorption profile obtained with iontophoresis was similar to that obtained with fatty acids and terpenes, though skin deposition of the drug was lower with the former. Transdermal delivery systems (TDS) of pizotifen were manufactured by including chemical enhancers, decenoic acid or oleic acid, and were subsequently characterized. When the results obtained with solutions were compared with those obtained with the TDS, a positive enhancement effect was observed with the latter with respect to the partitioning and diffusion of the drug across the skin. Our findings endorse the suitability of our TDS for delivering therapeutic amounts of pizotifen malate. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Malate and fumarate extend lifespan in Caenorhabditis elegans.

    Clare B Edwards

    Full Text Available Malate, the tricarboxylic acid (TCA cycle metabolite, increased lifespan and thermotolerance in the nematode C. elegans. Malate can be synthesized from fumarate by the enzyme fumarase and further oxidized to oxaloacetate by malate dehydrogenase with the accompanying reduction of NAD. Addition of fumarate also extended lifespan, but succinate addition did not, although all three intermediates activated nuclear translocation of the cytoprotective DAF-16/FOXO transcription factor and protected from paraquat-induced oxidative stress. The glyoxylate shunt, an anabolic pathway linked to lifespan extension in C. elegans, reversibly converts isocitrate and acetyl-CoA to succinate, malate, and CoA. The increased longevity provided by malate addition did not occur in fumarase (fum-1, glyoxylate shunt (gei-7, succinate dehydrogenase flavoprotein (sdha-2, or soluble fumarate reductase F48E8.3 RNAi knockdown worms. Therefore, to increase lifespan, malate must be first converted to fumarate, then fumarate must be reduced to succinate by soluble fumarate reductase and the mitochondrial electron transport chain complex II. Reduction of fumarate to succinate is coupled with the oxidation of FADH2 to FAD. Lifespan extension induced by malate depended upon the longevity regulators DAF-16 and SIR-2.1. Malate supplementation did not extend the lifespan of long-lived eat-2 mutant worms, a model of dietary restriction. Malate and fumarate addition increased oxygen consumption, but decreased ATP levels and mitochondrial membrane potential suggesting a mild uncoupling of oxidative phosphorylation. Malate also increased NADPH, NAD, and the NAD/NADH ratio. Fumarate reduction, glyoxylate shunt activity, and mild mitochondrial uncoupling likely contribute to the lifespan extension induced by malate and fumarate by increasing the amount of oxidized NAD and FAD cofactors.

  11. Occurrence of the malate-aspartate shuttle in various tumor types.

    Greenhouse, W V; Lehninger, A L

    1976-04-01

    The activity of the malate-aspartate shuttle for the reoxidation of cytoplasmic reduced nicotinamide adenine dinucleotide (NADH) by mitochondria was assessed in six lines of rodent ascites tumor cells (two strains of Ehrlich ascites carcinoma, Krebs II carcinoma, Novikoff hepatoma, AS-30D hepatoma, and L1210 mouse leukemia). All the tumor cells examined showed mitochondrial reoxidation of cytoplasmic NADH, as evidenced by the accumulation of pyruvate when the cells were incubated aerobically with L-lactate. Reoxidation of cytoplasmic NADH thus generated was completely inhibited by the transaminase inhibitor aminooxyacetate. The involvement of the respiratory chain in the reoxidation of cytoplasmic NADH was demonstrated by the action of cyanide, rotenone, and antimycin A, which strongly inhibited the formation of pyruvate from added L-lactate. Compounds that inhibit the carrier-mediated entry of malate into mitochondria, such as butylmalonate, benzenetricarboxylate, and iodobenzylmalonate, also inhibited the accumulation of pyruvate from added L-lactate by the tumor cells. The maximal rate of the malate-aspartate shuttle was established by addtion of arsenite to inhibit the mitochondrial oxidation of the pyruvate formed from added lactate. The capacity of the various tumor lines for the reoxidation of cytoplasmic NADH via the malate-aspartate shuttle approaches 20% of the total respiratory rate of the cells and thus appears to be sufficient to account for the mitochondrial reoxidation of that fraction of glycolytic NADH not reoxidized by pyruvate and lactate dehydrognenase in the cytoplasm.

  12. Altered Expression of a Malate-Permeable Anion Channel, OsALMT4, Disrupts Mineral Nutrition1[OPEN

    Delhaize, Emmanuel

    2017-01-01

    Aluminum-activated malate transporters (ALMTs) form a family of anion channels in plants, but little is known about most of its members. This study examined the function of OsALMT4 from rice (Oryza sativa). We show that OsALMT4 is expressed in roots and shoots and that the OsALMT4 protein localizes to the plasma membrane. Transgenic rice lines overexpressing (OX) OsALMT4 released malate from the roots constitutively and had 2-fold higher malate concentrations in the xylem sap than nulls, indicating greater concentrations of malate in the apoplast. OX lines developed brown necrotic spots on the leaves that did not appear on nulls. These symptoms were not associated with altered concentrations of any mineral element in the leaves, although the OX lines had higher concentrations of Mn and B in their grain compared with nulls. While total leaf Mn concentrations were not different between the OX and null lines, Mn concentrations in the apoplast were greater in the OX plants. The OX lines also displayed increased expression of Mn transporters and were more sensitive to Mn toxicity than null plants. We showed that the growth of wild-type rice was unaffected by 100 µm Mn in hydroponics but, when combined with 1 mm malate, this concentration inhibited growth. We conclude that increasing OsALMT4 expression affected malate efflux and compartmentation within the tissues, which increased Mn concentrations in the apoplast of leaves and induced the toxicity symptoms. This study reveals new links between malate transport and mineral nutrition. PMID:29101278

  13. Action of sulphite on plant malate dehydrogenase

    Ziegler, I.

    1974-01-01

    SO/sub 3//sup 2 -/ acts on NAD- and NADP-dependent malate dehydrogenase in several ways. Firstly, SO/sub 3//sup 2 -/ favours the appearance of low MW species (65000 and 39000 daltons) in Sephadex gel chromatography. Secondly, the enzyme from which is obtained by gel chromatography with dithioerythritol plus nucleotide cofactor is changed in the presence of SO/sub 3//sup 2 -/. This is indicated by the appearance of a linear reaction (instead of curvilinear), and by the abolition of the biphasic sigmoidal kinetics on varying substrate and cofactor concentrations. Thus the inhibition of initial velocity at high substrate or cofactor concentrations is even more marked than at lower ones. Thirdly, SO/sub 3//sup 2 -/ strongly reduces the activity in substrate saturating conditions.

  14. BoALMT1, an Al-Induced Malate Transporter in Cabbage, Enhances Aluminum Tolerance in Arabidopsis thaliana

    Lei Zhang

    2018-01-01

    Full Text Available Aluminum (Al is present in approximately 50% of the arable land worldwide and is regarded as the main limiting factor of crop yield on acidic soil. Al-induced root malate efflux plays an important role in the Al tolerance of plants. Here, the aluminum induced malate transporter BoALMT1 (KF322104 was cloned from cabbage (Brassica oleracea. BoALMT1 showed higher expression in roots than in shoots. The expression of BoALMT1 was specifically induced by Al treatment, but not the trivalent cations lanthanum (La, cadmium (Cd, zinc (Zn, or copper (Cu. Subcellular localization studies were performed in onion epidermal cells and revealed that BoALMT1 was localized at the plasma membrane. Scanning Ion-selective Electrode Technique was used to analyze H+ flux. Xenopus oocytes and Arabidopsis thaliana expressing BoALMT1 excreted more H+ under Al treatment. Overexpressing BoALMT1 in transgenic Arabidopsis resulted in enhanced Al tolerance and increased malate secretion. The results suggested that BoALMT1 functions as an Al-resistant gene and encodes a malate transporter. Expressing BoALMT1 in Xenopus oocytes or A. thaliana indicated that BoALMT1 could increase malate secretion and H+ efflux to resist Al tolerance.

  15. The BnALMT1 Protein That is an Aluminum-Activated Malate Transporter is Localized in the Plasma Membrane

    Ligaba, Ayalew; Katsuhara, Maki; Sakamoto, Wataru; Matsumoto, Hideaki

    2007-01-01

    We have previously reported that Al-induces citrate and malate efflux from P-sufficient and P-deficient plants of rape (Brassica napus L.) and that P-deficiency alone could not induce this response. Further investigation showed that the transcript of two genes designated BnALMT1 and BnALMT2 is accumulated in roots by Al-treatment. Transgenic tobacco cells (Nicotiana tabacum) and Xenopus laevis oocytes expressing the BnALMT1 and BnALMT2 proteins released more malate than control cells in the p...

  16. BoALMT1, an Al-Induced Malate Transporter in Cabbage, Enhances Aluminum Tolerance in Arabidopsis thaliana

    Zhang, Lei; Wu, Xin-Xin; Wang, Jinfang; Qi, Chuandong; Wang, Xiaoyun; Wang, Gongle; Li, Mingyue; Li, Xingsheng; Guo, Yang-Dong

    2018-01-01

    Aluminum (Al) is present in approximately 50% of the arable land worldwide and is regarded as the main limiting factor of crop yield on acidic soil. Al-induced root malate efflux plays an important role in the Al tolerance of plants. Here, the aluminum induced malate transporter BoALMT1 (KF322104) was cloned from cabbage (Brassica oleracea). BoALMT1 showed higher expression in roots than in shoots. The expression of BoALMT1 was specifically induced by Al treatment, but not the trivalent catio...

  17. Immobilization of malate dehydrogenase on carbon nanotubes for development of malate biosensor.

    Ruhal, A; Rana, J S; Kumar, S; Kumar, A

    2012-12-22

    An amperometric malic acid biosensor was developed by immobilizing malate dehydrogenase on multi-walled carbon nanotubes (MWCNT) coated on screen printed carbon electrode. The screen printed carbon electrode is made up of three electrodes viz., carbon as working, platinum as counter and silver as reference electrode. Detection of L-malic acid concentration provides important information about the ripening and shelf life of the fruits. The NADP specific malate dehydrogenase was immobilized on carboxylated multiwalled carbon nanotubes using cross linker EDC [1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide] on screen printed carbon electrode. An amperometric current was measured by differential pulse voltammetry (DPV) which increases with increasing concentrations of malic acid at fixed concentration of NADP. Enzyme electrode was characterized by scanning electron microscopy (SEM) and Fourier transform infrared (FTIR) spectroscopy. The detection limit of malic acid by the sensor was 60 - 120 μM and sensitivity of the sensor was 60 μM with a response time of 60s. The usual detection methods of malic acid are nonspecific, time consuming and less sensitive. However, an amperometric malic acid nanosensor is quick, specific and more sensitive for detection of malic acid in test samples.

  18. Benzalacetone Synthase

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  19. Magnitude of malate-aspartate reduced nicotinamide adenine dinucleotide shuttle activity in intact respiring tumor cells.

    Greenhouse, W V; Lehninger, A L

    1977-11-01

    Measurements of respiration, CO2 and lactate production, and changes in the levels of various key metabolites of the glycolytic sequence and tricarboxylic acid cycle were made on five lines of rodent ascites tumor cells (two strains of Ehrlich ascites tumor cells, Krebs II carcinoma, AS-30D carcinoma, and L1210 cells) incubated aerobically in the presence of uniformly labeled D-[14C]glucose. From these data, as well as earlier evidence demonstrating that the reduced nicotinamide adenine dinucleotide (NADH) shuttle in these cells requires a transaminase step and is thus identified as the malate-aspartate shuttle (W.V.V. Greenhouse and A.L. Lehninger, Cancer Res., 36: 1392-1396, 1976), metabolic flux diagrams were constructed for the five cell lines. These diagrams show the relative rates of glycolysis, the tricarboxylic acid cycle, electron transport, and the malate-aspartate shuttle in these tumors. Large amounts of cytosolic NADH were oxidized by the mitochondrial respiratory chain via the NADH shuttle, comprising anywhere from about 20 to 80% of the total flow of reducing equivalents to oxygen in these tumors. Calculations of the sources of energy for adenosine triphosphate synthesis indicated that on the average about one-third of the respiratory adenosine triphosphate is generated by electron flow originating from cytosolic NADH via the malate-aspartate shuttle.

  20. Catalytic properties of thermophilic lactate dehydrogenase and halophilic malate dehydrogenase at high temperature and low water activity.

    Hecht, K; Wrba, A; Jaenicke, R

    1989-07-15

    Thermophilic lactate dehydrogenases from Thermotoga maritima and Bacillus stearothermophilus are stable up to temperature limits close to the optimum growth temperature of their parent organisms. Their catalytic properties are anomalous in that Km shows a drastic increase with increasing temperature. At low temperatures, the effect levels off. Extreme halophilic malate dehydrogenase from Halobacterium marismortui exhibits a similar anomaly. Increasing salt concentration (NaCl) leads to an optimum curve for Km, oxaloacctate while Km, NADH remains constant. Previous claims that the activity of halophilic malate dehydrogenase shows a maximum at 1.25 M NaCl are caused by limiting substrate concentration; at substrate saturation, specific activity of halophilic malate dehydrogenase reaches a constant value at ionic strengths I greater than or equal to 1 M. Non-halophilic (mitochondrial) malate dehydrogenase shows Km characteristics similar to those observed for the halophilic enzyme. The drastic decrease in specific activity of the mitochondrial enzyme at elevated salt concentrations is caused by the salt-induced increase in rigidity of the enzyme, rather than gross structural changes.

  1. Effects of L-malate on physical stamina and activities of enzymes related to the malate-aspartate shuttle in liver of mice.

    Wu, J L; Wu, Q P; Huang, J M; Chen, R; Cai, M; Tan, J B

    2007-01-01

    L-malate, a tricarboxylic acid cycle (TCA) intermediate, plays an important role in transporting NADH from cytosol to mitochondria for energy production and may be involved in the beneficial effects of improving physical stamina. In the present study, we investigated the effects of L-malate on the performance of forced swimming time and blood biochemical parameters related to fatigue - blood urea nitrogen (BUN), glucose (Glc), creatine kinase (CK),total protein (TP) and lactic acid (LA). To investigate the effects of L-malate on the malate-aspartate shuttle and energy metabolism in mice, the activities of enzymes related to the malate-aspartate shuttle were measured. L-malate was orally administered to mice continuously for 30 days using a feeding atraumatic needle. The swimming time was increased by 26.1 % and 28.5 %, respectively, in the 0.210 g/kg and 0.630 g/kg L-malate-treated group compared with the control group. There were no differences in the concentrations of Glc, BUN and TP between the L-malate-treated groups and the control groups. However, the levels of CK were significantly decreased in the L-malate-treated groups. The results predict a potential benefit of L-malate for improving physical stamina and minimizing muscle damage during swimming exercise. The activities of cytosolic and mitochondrial malate dehydrogenase were significantly elevated in the L-malate-treated group compared with the control group. These enzymatic activities may be useful indicators for evaluating changes affecting the malate-aspartate shuttle and energy metabolism in the liver of mice.

  2. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance.

    Liu, Jiping; Magalhaes, Jurandir V; Shaff, Jon; Kochian, Leon V

    2009-02-01

    Aluminum-activated root malate and citrate exudation play an important role in plant Al tolerance. This paper characterizes AtMATE, a homolog of the recently discovered sorghum and barley Al-tolerance genes, shown here to encode an Al-activated citrate transporter in Arabidopsis. Together with the previously characterized Al-activated malate transporter, AtALMT1, this discovery allowed us to examine the relationship in the same species between members of the two gene families for which Al-tolerance genes have been identified. AtMATE is expressed primarily in roots and is induced by Al. An AtMATE T-DNA knockdown line exhibited very low AtMATE expression and Al-activated root citrate exudation was abolished. The AtALMT1 AtMATE double mutant lacked both Al-activated root malate and citrate exudation and showed greater Al sensitivity than the AtALMT1 mutant. Therefore, although AtALMT1 is a major contributor to Arabidopsis Al tolerance, AtMATE also makes a significant but smaller contribution. The expression patterns of AtALMT1 and AtMATE and the profiles of Al-activated root citrate and malate exudation are not affected by the presence or absence of the other gene. These results suggest that AtALMT1-mediated malate exudation and AtMATE-mediated citrate exudation evolved independently to confer Al tolerance in Arabidopsis. However, a link between regulation of expression of the two transporters in response to Al was identified through work on STOP1, a transcription factor that was previously shown to be necessary for AtALMT1 expression. Here we show that STOP1 is also required for AtMATE expression and Al-activated citrate exudation.

  3. Enzymatic urea adaptation: lactate and malate dehydrogenase in elasmobranchs

    Lagana, G.; Bellocco, E.; Mannucci, C.; Leuzzi, U.; Tellone, E.; Kotyk, Arnošt; Galtieri, A.

    2006-01-01

    Roč. 55, č. 6 (2006), s. 675-688 ISSN 0862-8408 Institutional research plan: CEZ:AV0Z50110509 Keywords : elasmobranchs * lactate dehydrogenase * malate dehydrogenase Subject RIV: CE - Biochemistry Impact factor: 2.093, year: 2006

  4. The vacuolar channel VvALMT9 mediates malate and tartrate accumulation in berries of Vitis vinifera.

    De Angeli, Alexis; Baetz, Ulrike; Francisco, Rita; Zhang, Jingbo; Chaves, Maria Manuela; Regalado, Ana

    2013-08-01

    Vitis vinifera L. represents an economically important fruit species. Grape and wine flavour is made from a complex set of compounds. The acidity of berries is a major parameter in determining grape berry quality for wine making and fruit consumption. Despite the importance of malic and tartaric acid (TA) storage and transport for grape berry acidity, no vacuolar transporter for malate or tartrate has been identified so far. Some members of the aluminium-activated malate transporter (ALMT) anion channel family from Arabidopsis thaliana have been shown to be involved in mediating malate fluxes across the tonoplast. Therefore, we hypothesised that a homologue of these channels could have a similar role in V. vinifera grape berries. We identified homologues of the Arabidopsis vacuolar anion channel AtALMT9 through a TBLASTX search on the V. vinifera genome database. We cloned the closest homologue of AtALMT9 from grape berry cDNA and designated it VvALMT9. The expression profile revealed that VvALMT9 is constitutively expressed in berry mesocarp tissue and that its transcription level increases during fruit maturation. Moreover, we found that VvALMT9 is targeted to the vacuolar membrane. Using patch-clamp analysis, we could show that, besides malate, VvALMT9 mediates tartrate currents which are higher than in its Arabidopsis homologue. In summary, in the present study we provide evidence that VvALMT9 is a vacuolar malate channel expressed in grape berries. Interestingly, in V. vinifera, a tartrate-producing plant, the permeability of the channel is apparently adjusted to TA.

  5. An InDel in the Promoter of Al-ACTIVATED MALATE TRANSPORTER9 Selected during Tomato Domestication Determines Fruit Malate Contents and Aluminum Tolerance[OPEN

    Wang, Xin; Hu, Tixu; Zhang, Fengxia; Wang, Bing; Li, Changxin; Yang, Tianxia; Li, Hanxia; Lu, Yongen; Ye, Zhibiao

    2017-01-01

    Deciphering the mechanism of malate accumulation in plants would contribute to a greater understanding of plant chemistry, which has implications for improving flavor quality in crop species and enhancing human health benefits. However, the regulation of malate metabolism is poorly understood in crops such as tomato (Solanum lycopersicum). Here, we integrated a metabolite-based genome-wide association study with linkage mapping and gene functional studies to characterize the genetics of malate accumulation in a global collection of tomato accessions with broad genetic diversity. We report that TFM6 (tomato fruit malate 6), which corresponds to Al-ACTIVATED MALATE TRANSPORTER9 (Sl-ALMT9 in tomato), is the major quantitative trait locus responsible for variation in fruit malate accumulation among tomato genotypes. A 3-bp indel in the promoter region of Sl-ALMT9 was linked to high fruit malate content. Further analysis indicated that this indel disrupts a W-box binding site in the Sl-ALMT9 promoter, which prevents binding of the WRKY transcription repressor Sl-WRKY42, thereby alleviating the repression of Sl-ALMT9 expression and promoting high fruit malate accumulation. Evolutionary analysis revealed that this highly expressed Sl-ALMT9 allele was selected for during tomato domestication. Furthermore, vacuole membrane-localized Sl-ALMT9 increases in abundance following Al treatment, thereby elevating malate transport and enhancing Al resistance. PMID:28814642

  6. Altered Expression of the Malate-Permeable Anion Channel OsALMT4 Reduces the Growth of Rice Under Low Radiance

    Jie Liu; Jie Liu; Muyun Xu; Gonzalo M. Estavillo; Emmanuel Delhaize; Rosemary G. White; Meixue Zhou; Peter R. Ryan

    2018-01-01

    We examined the function of OsALMT4 in rice (Oryza sativa L.) which is a member of the aluminum-activated malate transporter family. Previous studies showed that OsALMT4 localizes to the plasma membrane and that expression in transgenic rice lines results in a constitutive release of malate from the roots. Here, we show that OsALMT4 is expressed widely in roots, shoots, flowers, and grain but not guard cells. Expression was also affected by ionic and osmotic stress, light and to the hormones ...

  7. Tingkat Kerentanan Aedes aegypti (Linn. terhadap Malation di Provinsi Sumatera Selatan

    Lasbudi P. Ambarita

    2015-07-01

    Full Text Available AbstractDengue vector control program in Indonesia and also South Sumatera Province has been using malathion quite long enough. The extensive use of chemical in dengue vector control can lead to development of resistance. This study aims to determine the susceptibility of Aedes aegypti against malathion in 11 district of South Sumatera Province. Larva or pupae were collected with entomology survey kit and colonized until first generation (F1 that were used for bioassay. This test was conducted according to WHO adult susceptibility bioassay procedure.Twenty five blood-fed mosquitoes were exposed to insecticide impregnated paper in each of 4 WHO test kits and 1 control tube. Aedes aegypti from all study sites were still susceptible to operational dose of malathion (5%after 1 hour exposure. The estimated resistance ratio (ERR of knockdown time (KT to operasional dose of malathion is about 1,02 – 1,27 for KT50 and 0,96 – 1,24 for KT95. The susceptibility test of adult mosquitoes to diagnostic dose (0,8% of malathion showed a variety of susceptibility after 24 hours. Strain of 7 districts showed resistance, 3 districts toleran and 1 district still susceptible. The detection of resistance can actually help public health personnel to formulate appropriate steps in encountering the reduction in effectiveness of vector control efforts.Keywords : Aedes aegypti, Malathion, Susceptibility, South SumateraAbstrakProgram pengendalian vektor DBD di Indonesia termasuk di Provinsi Sumatera Selatan telah cukup lama menggunakan malation dengan konsentrasi 5%. Penggunaan satu jenis insektisida kimiawi secara ekstensif dapat memicu perkembangan resistensi. Penelitian ini bertujuan untuk menentukan status kerentanan Aedes aegypti terhadap malation dari 11 kabupaten/kota di Provinsi Sumatera Selatan. Larva atau pupa dikumpulkan menggunakan alat survei entomologi dan selanjutnyadipelihara hingga mendapatkan generasi pertama (F1 yang akan digunakan pada uji

  8. An InDel in the promoter of Al-activated malate transporter 9 selected during tomato domestication determines fruit malate content and aluminum tolerance

    Deciphering the mechanism of malate accumulation in plants would contribute to a greater understanding of plant chemistry, which has implications for improving flavor quality in crop species and enhancing human health benefits. However, the regulation of malate metabolism is poorly understood in cro...

  9. Rewiring the reductive tricarboxylic acid pathway and L-malate transport pathway of Aspergillus oryzae for overproduction of L-malate.

    Liu, Jingjing; Xie, Zhipeng; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Chen, Jian; Liu, Long

    2017-07-10

    Aspergillus oryzae finds wide application in the food, feed, and wine industries, and is an excellent cell factory platform for production of organic acids. In this work, we achieved the overproduction of L-malate by rewiring the reductive tricarboxylic acid (rTCA) pathway and L-malate transport pathway of A. oryzae NRRL 3488. First, overexpression of native pyruvate carboxylase and malate dehydrogenase in the rTCA pathway improved the L-malate titer from 26.1gL -1 to 42.3gL -1 in shake flask culture. Then, the oxaloacetate anaplerotic reaction was constructed by heterologous expression of phosphoenolpyruvate carboxykinase and phosphoenolpyruvate carboxylase from Escherichia coli, increasing the L-malate titer to 58.5gL -1 . Next, the export of L-malate from the cytoplasm to the external medium was strengthened by overexpression of a C4-dicarboxylate transporter gene from A. oryzae and an L-malate permease gene from Schizosaccharomyces pombe, improving the L-malate titer from 58.5gL -1 to 89.5gL -1 . Lastly, guided by transcription analysis of the expression profile of key genes related to L-malate synthesis, the 6-phosphofructokinase encoded by the pfk gene was identified as a potential limiting step for L-malate synthesis. Overexpression of pfk with the strong sodM promoter increased the L-malate titer to 93.2gL -1 . The final engineered A. oryzae strain produced 165gL -1 L-malate with a productivity of 1.38gL -1 h -1 in 3-L fed-batch culture. Overall, we constructed an efficient L-malate producer by rewiring the rTCA pathway and L-malate transport pathway of A. oryzae NRRL 3488, and the engineering strategy adopted here may be useful for the construction of A. oryzae cell factories to produce other organic acids. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Induction of long noncoding RNA MALAT1 in hypoxic mice

    Lelli A

    2015-10-01

    Full Text Available Aurelia Lelli,1,2,* Karen A Nolan,1,2,* Sara Santambrogio,1,2 Ana Filipa Gonçalves,1,2 Miriam J Schönenberger,1,2 Anna Guinot,1,2 Ian J Frew,1,2 Hugo H Marti,3 David Hoogewijs,1,2,4 Roland H Wenger1,2 1Institute of Physiology and Zurich Center for Human Physiology (ZIHP, University of Zurich, Zurich, Switzerland; 2National Center of Competence in Research "Kidney.CH", Zurich, Switzerland; 3Institute of Physiology and Pathophysiology, University of Heidelberg, Heidelberg, Germany; 4Institute of Physiology, University of Duisburg-Essen, Essen, Germany *These authors contributed equally to this work Abstract: Long thought to be “junk DNA”, in recent years it has become clear that a substantial fraction of intergenic genomic DNA is actually transcribed, forming long noncoding RNA (lncRNA. Like mRNA, lncRNA can also be spliced, capped, and polyadenylated, affecting a multitude of biological processes. While the molecular mechanisms underlying the function of lncRNAs have just begun to be elucidated, the conditional regulation of lncRNAs remains largely unexplored. In genome-wide studies our group and others recently found hypoxic transcriptional induction of a subset of lncRNAs, whereof nuclear-enriched abundant/autosomal transcript 1 (NEAT1 and metastasis-associated lung adenocarcinoma transcript 1 (MALAT1 appear to be the lncRNAs most ubiquitously and most strongly induced by hypoxia in cultured cells. Hypoxia-inducible factor (HIF-2 rather than HIF-1 seems to be the preferred transcriptional activator of these lncRNAs. For the first time, we also found strong induction primarily of MALAT1 in organs of mice exposed to inspiratory hypoxia. Most abundant hypoxic levels of MALAT1 lncRNA were found in kidney and testis. In situ hybridization revealed that the hypoxic induction in the kidney was confined to proximal rather than distal tubular epithelial cells. Direct oxygen-dependent regulation of MALAT1 lncRNA was confirmed using isolated primary

  11. The plant homolog to the human sodium/dicarboxylic cotransporter is the vacuolar malate carrier.

    Emmerlich, Vera; Linka, Nicole; Reinhold, Thomas; Hurth, Marco A; Traub, Michaela; Martinoia, Enrico; Neuhaus, H Ekkehard

    2003-09-16

    Malate plays a central role in plant metabolism. It is an intermediate in the Krebs and glyoxylate cycles, it is the store for CO2 in C4 and crassulacean acid metabolism plants, it protects plants from aluminum toxicity, it is essential for maintaining the osmotic pressure and charge balance, and it is therefore involved in regulation of stomatal aperture. To fulfil many of these roles, malate has to be accumulated within the large central vacuole. Many unsuccessful efforts have been made in the past to identify the vacuolar malate transporter; here, we describe the identification of the vacuolar malate transporter [A. thaliana tonoplast dicarboxylate transporter (AttDT)]. This transporter exhibits highest sequence similarity to the human sodium/dicarboxylate cotransporter. Independent T-DNA [portion of the Ti (tumor-inducing) plasmid that is transferred to plant cells] Arabidopsis mutants exhibit substantially reduced levels of leaf malate, but respire exogenously applied [14C]malate faster than the WT. An AttDT-GFP fusion protein was localized to vacuole. Vacuoles isolated from Arabidopsis WT leaves exhibited carbonylcyanide m-chlorophenylhydrazone and citrate inhibitable malate transport, which was not stimulated by sodium. Vacuoles isolated from mutant plants import [14C]-malate at strongly reduced rates, confirming that this protein is the vacuolar malate transporter.

  12. Decarboxylation of Malate in the Crassulacean Acid Metabolism Plant Bryophyllum (Kalanchoe) fedtschenkoi (Role of NAD-Malic Enzyme).

    Cook, R. M.; Lindsay, J. G.; Wilkins, M. B.; Nimmo, H. G.

    1995-01-01

    The role of NAD-malic enzyme (NAD-ME) in the Crassulacean acid metabolism plant Bryophyllum (Kalanchoe) fedtschenkoi was investigated using preparations of intact and solubilized mitochondria from fully expanded leaves. Intact, coupled mitochondria isolated during the day or night did not differ in their ability to take up [14C]malic acid from the surrounding medium or to respire using malate or succinate as substrate. However, intact mitochondria isolated from plants during the day decarboxylated added malate to pyruvate significantly faster than mitochondria isolated from plants at night. NAD-ME activity in solubilized mitochondrial extracts showed hysteretic kinetics and was stimulated by a number of activators, including acetyl-coenzyme A, fructose-1,6-bisphosphate, and sulfate ions. In the absence of these effectors, reaction progress curves were nonlinear, with a pronounced acceleration phase. The lag period before a steady-state rate was reached in assays of mitochondrial extracts decreased during the photoperiod and increased slowly during the period of darkness. However, these changes in the kinetic properties of the enzyme could not account for the changes in the rate of decarboxylation of malate by intact mitochondria. Gel-filtration experiments showed that mitochondrial extracts contained three forms of NAD-ME with different molecular weights. The relative proportions of the three forms varied somewhat throughout the light/dark cycle, but this did not account for the changes in the kinetics behavior of the enzyme during the diurnal cycle. PMID:12228671

  13. Correlation between myocardial malate/aspartate shuttle activity and EAAT1 protein expression in hyper- and hypothyroidism.

    Ralphe, J Carter; Bedell, Kurt; Segar, Jeffrey L; Scholz, Thomas D

    2005-05-01

    In the heart, elevated thyroid hormone leads to upregulation of metabolic pathways associated with energy production and development of hypertrophy. The malate/aspartate shuttle, which transfers cytosolic-reducing equivalents into the cardiac mitochondria, is increased 33% in hyperthyroid rats. Within the shuttle, the aspartate-glutamate carrier is rate limiting. The excitatory amino acid transporter type 1 (EAAT1) functions as a glutamate carrier in the malate/aspartate shuttle. In this study, we hypothesize that EAAT1 is regulated by thyroid hormone. Adult rats were injected with triiodothyronine (T3) or saline over a period of 8-9 days or provided with propylthiouracil (PTU) in their drinking water for 2 mo. Steady-state mRNA levels of EAAT1 and aralar1 and citrin (both cardiac mitochondrial aspartate-glutamate transporters) were determined by Northern blot analysis and normalized to 18S rRNA. A spectrophotometric assay of maximal malate/aspartate shuttle activity was performed on isolated cardiac mitochondria from PTU-treated and control animals. Protein lysates from mitochondria were separated by SDS-PAGE and probed with a human anti-EAAT1 IgG. Compared with control, EAAT1 mRNA levels (arbitrary units) were increased nearly threefold in T3-treated (3.1 +/- 0.5 vs. 1.1 +/- 0.2; P Hyperthyroidism in rats is related to an increase in cardiac expression of EAAT1 mRNA and protein. The 49% increase in EAAT1 mitochondrial protein level shows that malate/aspartate shuttle activity increased in hyperthyroid rat cardiac mitochondria. Although hypothyroidism resulted in a decrease in EAAT1 mRNA, neither the EAAT1 protein level nor shuttle activity was affected. EAAT1 regulation by thyroid hormone may facilitate increased metabolic demands of the cardiomyocyte during hyperthyroidism and impact cardiac function in hyperthyroidism.

  14. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  15. Alternative oxidase pathway optimizes photosynthesis during osmotic and temperature stress by regulating cellular ROS, malate valve and antioxidative systems

    DINAKAR eCHALLABATHULA

    2016-02-01

    Full Text Available The present study reveals the importance of alternative oxidase (AOX pathway in optimizing photosynthesis under osmotic and temperature stress conditions in the mesophyll protoplasts of Pisum sativum. The responses of photosynthesis and respiration were monitored at saturating light intensity of 1000 µmoles m-2 s-1 at 25 oC under a range of sorbitol concentrations from 0.4 M to 1.0M to induce hyper-osmotic stress and by varying the temperature of the thermo-jacketed pre-incubation chamber from 25 oC to 10 oC to impose sub-optimal temperature stress. Compared to controls (0.4 M sorbitol and 25 OC, the mesophyll protoplasts showed remarkable decrease in NaHCO3-dependent O2 evolution (indicator of photosynthetic carbon assimilation, under both hyper-osmotic (1.0 M sorbitol and sub-optimal temperature stress conditions (10 OC, while the decrease in rates of respiratory O2 uptake were marginal. The capacity of AOX pathway increased significantly in parallel to increase in intracellular pyruvate and reactive oxygen species (ROS levels under both hyper-osmotic stress and sub-optimal temperature stress under the background of saturating light. The ratio of redox couple (Malate/OAA related to malate valve increased in contrast to the ratio of redox couple (GSH/GSSG related to antioxidative system during hyper-osmotic stress. Nevertheless, the ratio of GSH/GSSG decreased in the presence of sub-optimal temperature, while the ratio of Malate/OAA showed no visible changes. Also, the redox ratios of pyridine nucleotides increased under hyper-osmotic (NADH/NAD and sub-optimal temperature (NADPH/NADP stresses, respectively. However, upon restriction of AOX pathway by using salicylhydroxamic acid (SHAM, the observed changes in NaHCO3 dependent O2 evolution, cellular ROS, redox ratios of Malate/OAA, NAD(PH/NAD(P and GSH/GSSG were further aggravated under stress conditions with concomitant modulations in NADP-MDH and antioxidant enzymes. Taken together, the

  16. [A case of respiratory dyskinesia due to clebopride malate].

    Kawasaki, H; Yamamoto, M; Okayasu, H; Wakayama, Y

    1991-08-01

    Clebopride malate is therapeutically used for the treatment of peptic ulcer. This drug has potent antidopaminergic activity that causes acute dystonic reaction, parkinsonism and tardive dyskinesia as adverse effects. Here, we have reported an 86-year-old man who developed abnormal involuntary movement of respiratory muscles and lower limb muscles after this drug had been given for four months. This involuntary movement appeared spontaneously at resting state and disappeared during sleep. Surface EMG demonstrated a synchronous grouping discharge in m. orbicularis oris, m. sternocleidomastoideus and m. interstales which synchronized with diaphragmatic movement on cinefluorography. Involuntary movement of the lower limbs was synchronous bilaterally and had little relationship with diaphragmatic movement. This involuntary movement was irregular not only in rhythm but also in duration. According to this irregular nature, we diagnosed this involuntary movement as respiratory dyskinesia with limb dyskinesia that belongs to tardive dyskinesia. After cessation of clebopride malate limb dyskinesia disappeared rapidly and respiratory dyskinesia markedly decreased. We emphasize that respiratory dyskinesia should be differentiated from psychogenic hyperventilation as easily misdiagnosed on initial examination.

  17. Inhibition of several enzymes by gold compounds. II. beta-Glucuronidase, acid phosphatase and L-malate dehydrogenase by sodium thiomalatoraurate (I), sodium thiosulfatoaurate (I) and thioglucosoaurate (I).

    Lee, M T; Ahmed, T; Haddad, R; Friedman, M E

    1989-01-01

    Bovine liver beta-D-glucuronide glucuronohydrolase, EC 3.2.1.32), wheat germ acid phosphatase (orthophosphoric monoesterphosphohydrolase, EC 3.1.3.2) and bovine liver L-malate dehydrogenase (L-malate: NAD oxidoreductase, EC 1.1.1.37) were inhibited by a series of gold (I) complexes that have been used as anti-inflammatory drugs. Both sodium thiosulfatoaurate (I) (Na AuTs) and sodium thiomalatoraurate (NaAuTM) effectively inhibited all three enzymes, while thioglucosoaurate (I) (AuTG) only inhibited L-malate dehydrogenase. The equilibrium constants (K1) ranged from nearly 4000 microM for the NaAuTM-beta-glucuronidase interaction to 24 microM for the NaAuTS-beta-glucuronidase interaction. The rate of covalent bond formation (kp) ranged from 0.00032 min-1 for NaAuTM-beta-glucuronidase formation to 1.7 min-1 for AuTG-L-malate dehydrogenase formation. The equilibrium data shows that the gold (I) drugs bind by several orders lower than the gold (III) compounds, suggesting a significantly stronger interaction between the more highly charged gold ion and the enzyme. Yet the rate of covalent bond formation depends as much on the structure of the active site as upon the lability of the gold-ligand bond. It was also observed that the more effective the gold inhibition the more toxic the compound.

  18. Altered Expression of the Malate-Permeable Anion Channel OsALMT4 Reduces the Growth of Rice Under Low Radiance

    Jie Liu

    2018-05-01

    Full Text Available We examined the function of OsALMT4 in rice (Oryza sativa L. which is a member of the aluminum-activated malate transporter family. Previous studies showed that OsALMT4 localizes to the plasma membrane and that expression in transgenic rice lines results in a constitutive release of malate from the roots. Here, we show that OsALMT4 is expressed widely in roots, shoots, flowers, and grain but not guard cells. Expression was also affected by ionic and osmotic stress, light and to the hormones ABA, IAA, and salicylic acid. Malate efflux from the transgenic plants over-expressing OsALMT4 was inhibited by niflumate and salicylic acid. Growth of transgenic lines with either increased OsALMT4 expression or reduced expression was measured in different environments. Light intensity caused significant differences in growth between the transgenic lines and controls. When day-time light was reduced from 700 to 300 μmol m-2s-1 independent transgenic lines with either increased or decreased OsALMT4 expression accumulated less biomass compared to their null controls. This response was not associated with differences in photosynthetic capacity, stomatal conductance or sugar concentrations in tissues. We propose that by disrupting malate fluxes across the plasma membrane carbon partitioning and perhaps signaling are affected which compromises growth under low light. We conclude that OsALMT4 is expressed widely in rice and facilitates malate efflux from different cell types. Altering OsALMT4 expression compromises growth in low-light environments.

  19. Isoform expression in the multiple soluble malate dehydrogenase of Hoplias malabaricus (Erythrinidae, Characiformes

    M. R. Aquino-Silva

    Full Text Available Kinetic properties and thermal stabilities of Hoplias malabaricus liver and skeletal muscle unfractionated malate dehydrogenase (MDH, EC 1.1.1.37 and its isolated isoforms were analyzed to further study the possible sMDH-A* locus duplication evolved from a recent tandem duplication. Both A (A1 and A2 and B isoforms had similar optima pH (7.5-8.0. While Hoplias A isoform could not be characterized as thermostable, B could as thermolabile. A isoforms differed from B isoform in having higher Km values for oxaloacetate. The possibly duplicated A2 isoform showed higher substrate affinity than the A1. Hoplias duplicated A isoforms may influence the direction of carbon flow between glycolisis and gluconeogenesis.

  20. Isoform expression in the multiple soluble malate dehydrogenase of Hoplias malabaricus (Erythrinidae, Characiformes

    Aquino-Silva M. R.

    2003-01-01

    Full Text Available Kinetic properties and thermal stabilities of Hoplias malabaricus liver and skeletal muscle unfractionated malate dehydrogenase (MDH, EC 1.1.1.37 and its isolated isoforms were analyzed to further study the possible sMDH-A* locus duplication evolved from a recent tandem duplication. Both A (A1 and A2 and B isoforms had similar optima pH (7.5-8.0. While Hoplias A isoform could not be characterized as thermostable, B could as thermolabile. A isoforms differed from B isoform in having higher Km values for oxaloacetate. The possibly duplicated A2 isoform showed higher substrate affinity than the A1. Hoplias duplicated A isoforms may influence the direction of carbon flow between glycolisis and gluconeogenesis.

  1. Effects of Al(III and Nano-Al13 Species on Malate Dehydrogenase Activity

    Rong Fu Chen

    2011-05-01

    Full Text Available The effects of different aluminum species on malate dehydrogenase (MDH activity were investigated by monitoring amperometric i-t curves for the oxidation of NADH at low overpotential using a functionalized multi-wall nanotube (MWNT modified glass carbon electrode (GCE. The results showed that Al(III and Al13 can activate the enzymatic activity of MDH, and the activation reaches maximum levels as the Al(III and Al13 concentration increase. Our study also found that the effects of Al(III and Al13 on the activity of MDH depended on the pH value and aluminum speciation. Electrochemical and circular dichroism spectra methods were applied to study the effects of nano-sized aluminum compounds on biomolecules.

  2. Effects of Al(III) and nano-Al13 species on malate dehydrogenase activity.

    Yang, Xiaodi; Cai, Ling; Peng, Yu; Li, Huihui; Chen, Rong Fu; Shen, Ren Fang

    2011-01-01

    The effects of different aluminum species on malate dehydrogenase (MDH) activity were investigated by monitoring amperometric i-t curves for the oxidation of NADH at low overpotential using a functionalized multi-wall nanotube (MWNT) modified glass carbon electrode (GCE). The results showed that Al(III) and Al(13) can activate the enzymatic activity of MDH, and the activation reaches maximum levels as the Al(III) and Al(13) concentration increase. Our study also found that the effects of Al(III) and Al(13) on the activity of MDH depended on the pH value and aluminum speciation. Electrochemical and circular dichroism spectra methods were applied to study the effects of nano-sized aluminum compounds on biomolecules.

  3. Modeling the vacuolar storage of malate shed lights on pre- and post-harvest fruit acidity.

    Etienne, Audrey; Génard, Michel; Lobit, Philippe; Bugaud, Christophe

    2014-11-18

    Malate is one of the most important organic acids in many fruits and its concentration plays a critical role in organoleptic properties. Several studies suggest that malate accumulation in fruit cells is controlled at the level of vacuolar storage. However, the regulation of vacuolar malate storage throughout fruit development, and the origins of the phenotypic variability of the malate concentration within fruit species remain to be clarified. In the present study, we adapted the mechanistic model of vacuolar storage proposed by Lobit et al. in order to study the accumulation of malate in pre and postharvest fruits. The main adaptation concerned the variation of the free energy of ATP hydrolysis during fruit development. Banana fruit was taken as a reference because it has the particularity of having separate growth and post-harvest ripening stages, during which malate concentration undergoes substantial changes. Moreover, the concentration of malate in banana pulp varies greatly among cultivars which make possible to use the model as a tool to analyze the genotypic variability. The model was calibrated and validated using data sets from three cultivars with contrasting malate accumulation, grown under different fruit loads and potassium supplies, and harvested at different stages. The model predicted the pre and post-harvest dynamics of malate concentration with fairly good accuracy for the three cultivars (mean RRMSE = 0.25-0.42). The sensitivity of the model to parameters and input variables was analyzed. According to the model, vacuolar composition, in particular potassium and organic acid concentrations, had an important effect on malate accumulation. The model suggested that rising temperatures depressed malate accumulation. The model also helped distinguish differences in malate concentration among the three cultivars and between the pre and post-harvest stages by highlighting the probable importance of proton pump activity and particularly of the free

  4. Heat inactivation of leaf phosphoenolpyruvate carboxylase: Protection by aspartate and malate in C4 plants.

    Rathnam, C K

    1978-01-01

    The activity of phosphoenolpyruvate (PEP) carboxylase EC 4.1.1.31 in leaf extracts of Eleusine indica L. Gaertn., a C4 plant, exhibited a temperature optimum of 35-37° C with a complete loss of activity at 50° C. However, the enzyme was protected effectively from heat inactivation up to 55° C by L-aspartate. Activation energies (Ea) for the enzyme in the presence of aspartate were 2.5 times lower than that of the control enzyme. Arrhenius plots of PEP carboxylase activity (±aspartate) showed a break in the slope around 17-20° C with a 3-fold increase in the Ea below the break. The discontinuity in the slopes was abolished by treating the enzyme extracts with Triton X-100, suggesting that PEP carboxylase in C4 plants is associated with lipid and may be a membrane bound enzyme. Depending upon the species, the major C4 acid formed during photosynthesis (malate or aspartate) was found to be more protective than the minor C4 acid against the heat inactivation of their PEP carboxylase. Oxaloacetate, the reaction product, was less effective compared to malate or aspartate. Several allosteric inhibitors of PEP carboxylase were found to be moderately to highly effective in protecting the C4 enzyme while its activators showed no significant effect. PEP carboxylase from C3 species was not protected from thermal inactivation by the C4 acids. The physiological significance of these results is discussed in relation to the high temperature tolerance of C4 plants.

  5. D-malate production by permeabilized Pseudomonas pseudoalcaligenes; optimization of conversion and biocatalyst productivity.

    Michielsen, M J; Frielink, C; Wijffels, R H; Tramper, J; Beeftink, H H

    2000-04-14

    For the development of a continuous process for the production of solid D-malate from a Ca-maleate suspension by permeabilized Pseudomonas pseudoalcaligenes, it is important to understand the effect of appropriate process parameters on the stability and activity of the biocatalyst. Previously, we quantified the effect of product (D-malate2 -) concentration on both the first-order biocatalyst inactivation rate and on the biocatalytic conversion rate. The effects of the remaining process parameters (ionic strength, and substrate and Ca2 + concentration) on biocatalyst activity are reported here. At (common) ionic strengths below 2 M, biocatalyst activity was unaffected. At high substrate concentrations, inhibition occurred. Ca2+ concentration did not affect biocatalyst activity. The kinetic parameters (both for conversion and inactivation) were determined as a function of temperature by fitting the complete kinetic model, featuring substrate inhibition, competitive product inhibition and first-order irreversible biocatalyst inactivation, at different temperatures simultaneously through three extended data sets of substrate concentration versus time. Temperature affected both the conversion and inactivation parameters. The final model was used to calculate the substrate and biocatalyst costs per mmol of product in a continuous system with biocatalyst replenishment and biocatalyst recycling. Despite the effect of temperature on each kinetic parameter separately, the overall effect of temperature on the costs was found to be negligible (between 293 and 308 K). Within pertinent ranges, the sum of the substrate and biocatalyst costs per mmol of product was calculated to decrease with the influent substrate concentration and the residence time. The sum of the costs showed a minimum as a function of the influent biocatalyst concentration.

  6. The plant homolog to the human sodium/dicarboxylic cotransporter is the vacuolar malate carrier

    Emmerlich, Vera; Linka, Nicole; Reinhold, Thomas; Hurth, Marco A.; Traub, Michaela; Martinoia, Enrico; Neuhaus, H. Ekkehard

    2003-01-01

    Malate plays a central role in plant metabolism. It is an intermediate in the Krebs and glyoxylate cycles, it is the store for CO2 in C4 and crassulacean acid metabolism plants, it protects plants from aluminum toxicity, it is essential for maintaining the osmotic pressure and charge balance, and it is therefore involved in regulation of stomatal aperture. To fulfil many of these roles, malate has to be accumulated within the large central vacuole. Many unsuccessful efforts have been made in ...

  7. Processes of malate catabolism during the anaerobic metabolism of grape berries

    Flanzy, C.; Andre, P.; Buret, M.; Chambroy, Y.; Garcia, P.

    1976-01-01

    In order to precise malate fate during the anaerobic metabolism of grape, malate- 3 - 14 C was injected into Carignan berries kept in darkness at 35 0 C under carbon dioxide atmosphere. The injection of labelled malate was effected in presence or not of non-labelled oxalate which inhibits malic enzyme (EC I.I.I.40). The analyses of the samples fixed after 3 and 7 days anaerobiosis concerned the titration of various substrates, organic acids, amino-acids and glycolysis products, and the measuring of the NADP + -malic enzyme (EC I.I.I.40) and malate dehydrogenase (EC I.I.I.40). Radioactivity is mainly observed in ethanol, amino-butyrate the non-separated group glycerate-shikimate and succinate. Malic enzyme acts in the first sequence of a process leading from malate to ethanol. Alanin synthesis seems to be stimulated in presence of oxalate. The results obtained and some hypotheses presented in the literature induce to suggest a utilization scheme for malate in the anaerobic metabolism of grape [fr

  8. Prognostic value of long non-coding RNA MALAT1 in cancer patients.

    Wu, Yihua; Lu, Wei; Xu, Jinming; Shi, Yu; Zhang, Honghe; Xia, Dajing

    2016-01-01

    Metastasis associated in lung adenocarcinoma transcript 1 (MALAT1) was identified to be the first long non-coding RNA as a biomarker of independent prognostic value for early stage non-small cell lung cancer patient survival. In recent years, the association between upregulated tissue MALAT1 level and incidence of various cancers including bladder cancer, colorectal cancer, and renal cancer has been widely discussed. The aim of our present study was to assess the potential prognostic value of MALAT1 in various human cancers. PubMed, Embase, Ovid, and Cochrane Library databases were systematically searched, and eligible studies evaluating the prognostic value of MALAT1 in various cancers were included. Finally, 11 studies encompassing 1216 participants reporting with sufficient data were enrolled in the current meta-analysis. The pooled hazard ratio (HR) was 2.05 (95 % confidence interval (CI) 1.64-2.55, p < 0.01) for overall survival (OS) and 2.66 (95 % CI 1.86-3.80, p < 0.01) for disease-free survival (DFS). In conclusion, high tissue MALAT1 level was associated with an inferior clinical outcome in various cancers, suggesting that MALAT1 might serve as a potential prognostic biomarker for various cancers.

  9. The Association between Abnormal Long Noncoding RNA MALAT-1 Expression and Cancer Lymph Node Metastasis: A Meta-Analysis

    Jun Wang

    2016-01-01

    Full Text Available Previous studies have investigated that the expression levels of MALAT-1 were higher in cancerous tissues than matched histologically normal tissues. And, to some extent, overexpression of MALAT-1 was inclined to lymph node metastasis. This meta-analysis collected all relevant articles and explored the association between MALAT-1 expression levels and lymph node metastasis. We searched PubMed, EmBase, Web of Science, Cochrane Library, and OVID to address the level of MALAT-1 expression in cancer cases and noncancerous controls (accessed February 2015. And 8 studies comprising 696 multiple cancer patients were included to assess this association. The odds ratio (OR and its corresponding 95% confidence interval (CI were calculated to assess the strength of the association using Stata 12.0 version software. The results revealed there was a significant difference in the incidence of lymph node metastasis between high MALAT-1 expression group and low MALAT-1 expression group (OR = 1.94, 95% CI 1.15–3.28, P=0.013 random-effects model. Subgroup analysis indicated that MALAT-1 high expression had an unfavorable impact on lymph node metastasis in Chinese patients (OR = 1.87, 95% CI 1.01–2.46. This study demonstrated that the incidence of lymph node metastasis in patients detected with high MALAT-1 expression was higher than that in patients with low MALAT-1 expression in China.

  10. Cellular distribution, purification and electrophoretic properties of malate dehydrogenase in Trichuris ovis and inhibition by benzimidazoles and pyrimidine derivatives.

    Sanchez-Moreno, M; Ortega, J E; Valero, A

    1989-12-01

    High levels of malate dehydrogenase were found in Trichuris ovis. Two molecular forms of the enzyme, of different cellular location and electrophoretic pattern, were isolated and purified. The activity of soluble malate dehydrogenase was greater than that of mitochondrial malate dehydrogenase. Both forms also displayed different electrophoretic profiles in comparison with purified extracts from goat (Capra hircus) liver. Substrate concentration directly affected enzyme activity. Host and parasite malate dehydrogenase activity were both inhibited by a series of benzimidazoles and pyrimidine-derived compounds, some of which markedly reduced parasite enzyme activity, but not host enzyme activity. Percentage inhibition by some pyrimidine derivatives was greater than that produced by benzimidazoles.

  11. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long

    2014-01-01

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus

  12. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  13. Mutation in the peroxin-coding gene PEX22 contributing to high malate production in Saccharomyces cerevisiae.

    Negoro, Hiroaki; Sakamoto, Mitsuru; Kotaka, Atsushi; Matsumura, Kengo; Hata, Yoji

    2018-02-01

    Saccharomyces cerevisiae produces organic acids such as succinate, acetate, and malate during alcoholic fermentation. Since malate contributes to the pleasant taste of sake (a Japanese alcoholic beverage), various methods for breeding high-malate-producing yeast strains have been developed. Here, a high-malate-producing yeast strain F-701H was isolated. This mutant was sensitive to dimethyl succinate (DMS) and harbored a nonsense mutation in the peroxin gene PEX22, which was identified as the cause of high malate production by comparative genome analysis. This mutation, which appeared to cause Pex22p dysfunction, was sufficient to confer increased malate productivity and DMS sensitivity to yeast cells. Next, we investigated the mechanism by which this mutation led to high malate production in yeast cells. Peroxins, such as Pex22p, maintain peroxisomal biogenesis. Analysis of 29 PEX disruptants revealed an increased malate production by deletion of the genes encoding peroxins responsible for importing proteins (containing peroxisomal targeting signal 1, PTS1) into the peroxisomal matrix, and those responsible for the assembly of peroxins themselves in the peroxisomal membrane. A defect in peroxisomal malate dehydrogenase (Mdh3p), harboring endogenous PTS1, inhibited the high malate-producing phenotype in the PEX22 mutant. Moreover, Mdh3p, which was normally sorted to the peroxisomal matrix, was potentially mislocalized to the cytosol in the PEX22 mutant. This suggested that an increase in malate production resulted from the mislocalization of Mdh3p from the peroxisome to the cytoplasm due to the loss of peroxin-mediated transportation. Thus, the present study revealed a novel mechanism for organic acid productions in yeast during sake brewing. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. Immunological response and protection of mice immunized with plasmid encoding Toxoplasma gondii glycolytic enzyme malate dehydrogenase.

    Hassan, I A; Wang, S; Xu, L; Yan, R; Song, X; XiangRui, L

    2014-12-01

    Toxoplasma gondii Malate dehydrogenase (TgMDH) plays an important role as part of the energy production cycle. In this investigation, immunological changes and protection efficiency of this protein delivered as a DNA vaccine have been evaluated. Mice were intramuscularly immunized with pTgMDH, followed by challenge with virulent T. gondii RH strain, 2 weeks after the booster immunization. Compared to the control groups, the results showed that pTgMDH has stimulated specific humoral response as demonstrated by significant high titers of total IgG and subclasses IgG1 and IgG2a , beside IgA and IgM, but not IgE. Analysis of cytokine profiles revealed significant increases of IFN-γ, IL-4 and IL-17, while no significant changes were detected in TGF-β1. In cell-mediated response, both T lymphocytes subpopulations CD4(+) and CD8(+) were positively recruited as significant percentages were recorded in response to immunization with TgMDH. Significant long survival rate, 17 days, has been observed in the TgMDH vaccinated group, in contrast with control groups which died within 8-9 days after challenge. These results demonstrated that TgMDH could induce significant immunological responses leading to a considerable level of protection against acute toxoplasmosis infection. © 2014 John Wiley & Sons Ltd.

  15. Prognostic value of long noncoding RNA MALAT1 in digestive system malignancies.

    Zhai, Hui; Li, Xiao-Mei; Maimaiti, Ailifeire; Chen, Qing-Jie; Liao, Wu; Lai, Hong-Mei; Liu, Fen; Yang, Yi-Ning

    2015-01-01

    MALAT1, a newly discovered long noncoding RNA (lncRNA), has been reported to be highly expressed in many types of cancers. This meta-analysis summarizes its potential prognostic value in digestive system malignancies. A quantitative meta-analysis was performed through a systematic search in PubMed, Cochrane Library, Web of Science and Chinese National Knowledge Infrastructure (CNKI) for eligible papers on the prognostic impact of MALAT1 in digestive system malignancies from inception to Apr. 25, 2015. Pooled hazard ratios (HRs) with 95% confidence interval (95% CI) were calculated to summarize the effect. Five studies were included in the study, with a total of 527 patients. A significant association was observed between MALAT1 abundance and poor overall survival (OS) of patients with digestive system malignancies, with pooled hazard ratio (HR) of 7.68 (95% confidence interval [CI]: 4.32-13.66, Pdigestive system malignancies.

  16. Systemic Sunitinib Malate Treatment for Advanced Juxtapapillary Retinal Hemangioblastomas Associated with von Hippel-Lindau Disease.

    Knickelbein, Jared E; Jacobs-El, Naima; Wong, Wai T; Wiley, Henry E; Cukras, Catherine A; Meyerle, Catherine B; Chew, Emily Y

    2017-01-01

    To describe the clinical course of advanced juxtapapillary retinal capillary hemangioblastomas (RCH) associated with von Hippel-Lindau (VHL) disease treated with systemic sunitinib malate, an agent that inhibits both anti-vascular endothelial growth factor and anti-platelet-derived growth factor signaling. Observational case review. Three patients with advanced VHL-related juxtapapillary RCH treated with systemic sunitinib malate. Patient 1 was followed routinely every 4 months while on systemic sunitinib prescribed by her oncologist for metastatic pancreatic neuroendocrine and kidney tumors. Patients 2 and 3 were part of a prospective clinical trial evaluating the use of systemic sunitinib for ocular VHL lesions during a period of 9 months. Visual acuity, size of RCH, and degree of exudation were recorded at each visit. Optical coherence tomography (OCT) and fluorescein angiography were also obtained at some visits. Visual acuity, size of RCH, and degree of exudation. Three patients with advanced VHL-associated juxtapapillary RCH were treated with systemic sunitinib malate. While none of the patients lost vision during therapy, treatment with sunitinib malate did not improve visual acuity or reduce the size of RCH. Improvements in RCH-associated retinal edema were observed in two patients. All patients experienced multiple adverse effects, including thyroid toxicity, thrombocytopenia, nausea, fatigue, jaundice, and muscle aches. Two of the three patients had to discontinue treatment prematurely and the third required dose reduction. Systemic sunitinib malate may be useful in slowing progression of ocular disease from VHL-associated RCH. However, significant systemic adverse effects limited its use in this small series, and systemic sunitinib malate may not be safe for treatment of RCH when used at the doses described in this report. Further studies are required to determine if this medication used at lower doses with different treatment strategies, other

  17. microRNA-9 targets the long non-coding RNA MALAT1 for degradation in the nucleus

    Leucci, Eleonora; Patella, Francesca; Waage, Johannes

    2013-01-01

    -coding RNAs. Here we report that microRNA-9 (miR-9) regulates the expression of the Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT-1), one of the most abundant and conserved long non-coding RNAs. Intriguingly, we find that miR-9 targets AGO2-mediated regulation of MALAT1 in the nucleus. Our...

  18. FUNCTIONAL-ANALYSIS OF THE N-TERMINAL PREPEPTIDES OF WATERMELON MITOCHONDRIAL AND GLYOXYSOMAL MALATE-DEHYDROGENASES

    LEHNERER, M; KEIZERGUNNIK, [No Value; VEENHUIS, M; GIETL, C

    1994-01-01

    Mitochondrial and glyoxysomal malate dehydrogenase (mMDH; gMDH; L-malate : NAD(+) oxidoreductase; EC 1.1.1.37) of watermelon (Citrullus vulgaris) cotyledons are synthesized with N-terminal cleavable presequences which are shown to specify sorting of the two proteins. The two presequences differ in

  19. Mutational analysis of the N-terminal topogenic signal of watermelon glyoxysomal malate dehydrogenase using the heterologous host Hansenula polymorpha

    Gietl, Christine; Faber, Klaas Nico; Klei, Ida J. van der; Veenhuis, Marten

    1994-01-01

    We have studied the significance of the N-terminal presequence of watermelon (Citrullus vulgaris) glyoxysomal malate dehydrogenase [gMDH; (S)-malate:NAD+ oxidoreductase; EC 1.1.1.37] in microbody targeting. The yeast Hansenula polymorpha was used as heterologous host for the in vivo expression of

  20. Permeabilization and lysis of Pseudomonas pseudoalcaligenes cells by triton X-100 for efficient production of D-malate

    Werf, M.J. van der; Hartmans, S.; Tweel, W.J.J. van den

    1995-01-01

    Pseudomonas pseudoalcaligenes can only form d-malate from maleate after incubation of the cells with a solvent or a detergent. The effect of the detergent Triton X-100 on d-malate production was studied in more detail. The longer the cells were incubated with Triton X-100, the higher was the

  1. Metabolic engineering of Aspergillus oryzae for efficient production of l-malate directly from corn starch.

    Liu, Jingjing; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Liu, Long

    2017-11-20

    l-Malate, an important chemical building block, has been widely applied in the food, pharmaceutical, and bio-based materials industries. In previous work, we engineered Aspergillus oryzae by rewiring the reductive tricarboxylic acid pathway to produce l-malate from glucose. To decrease the production cost, here, we further engineered A. oryzae to efficiently produce l-malate directly from corn starch with simultaneous liquefaction-saccharification and fermentation. First, a promoter PN5 was constructed by quintuple tandem of the 97-bp fragment containing the cis-element of the glucoamylase gene promoter (PglaA), and with the promoter PN5, the transcriptional level of glaA gene increased by 25-45%. Then, by co-overexpression of glaA, a-amylase (amyB) and a-glucosidase (agdA) genes with the promoter PN5, the l-malate titer increased from 55.5g/L to 72.0g/L with 100g/L corn starch in shake flask. In addition, to reduce the concentration of byproducts succinate and fumarate, a fumarase from Saccharomyces cerevisiae, which facilitated the transformation of fumarate to l-malate, was overexpressed. As a result, the concentration of succinate and fumarate decreased from 12.6 and 1.29g/L to 7.8 and 0.59g/L, and the l-malate titer increased from 72.0g/L to 78.5g/L. Finally, we found that the addition of glucose at the initial fermentation stage facilitated the cell growth and l-malate synthesis, and the l-malate titer further increased to 82.3g/L by co-fermentation of 30g/L glucose and 70g/L corn starch, with a productivity of 1.18g/L/h and a yield of 0.82g/g total carbon sources. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. L-malate enhances the gene expression of carried proteins and antioxidant enzymes in liver of aged rats.

    Zeng, X; Wu, J; Wu, Q; Zhang, J

    2015-01-01

    Previous studies in our laboratory reported L-malate as a free radical scavenger in aged rats. To investigate the antioxidant mechanism of L-malate in the mitochondria, we analyzed the change in gene expression of two malate-aspartate shuttle (MAS)-related carried proteins (AGC, aspartate/glutamate carrier and OMC, oxoglutarate/malate carrier) in the inner mitochondrial membrane, and three antioxidant enzymes (CAT, SOD, and GSH-Px) in the mitochondria. The changes in gene expression of these proteins and enzymes were examined by real-time RT-PCR in the heart and liver of aged rats treated with L-malate. L-malate was orally administered in rats continuously for 30 days using a feeding atraumatic needle. We found that the gene expression of OMC and GSH-Px mRNA in the liver increased by 39 % and 38 %, respectively, in the 0.630 g/kg L-malate treatment group than that in the control group. The expression levels of SOD mRNA in the liver increased by 39 %, 56 %, and 78 % in the 0.105, 0.210, and 0.630 g/kg L-malate treatment groups, respectively. No difference were observed in the expression levels of AGC, OMC, CAT, SOD, and GSH-Px mRNAs in the heart of rats between the L-malate treatment and control groups. These results predicted that L-malate may increase the antioxidant capacity of mitochondria by enhancing the expression of mRNAs involved in the MAS and the antioxidant enzymes.

  3. Effect of Punica granatum fruit peel on glucose-6-phosphate dehydrogenase and malate dehydrogenase in amphistome Gastrothylax indicus.

    Aggarwal, Rama; Bagai, Upma

    2017-03-01

    Increasing anthelmintic resistance and the impact of conventional anthelmintics on the environment, it is important to look for alternative strategies against helminth parasite in sheep. Important lipogenic enzymes like glucose-6-phosphate dehydrogenase (G-6-PDH) and malate dehydrogenase (MDH) show subcellular distribution pattern. Activity of G-6-PDH was largely restricted to cytosolic fraction while MDH was found in both cytosolic and mitochondrial fraction in Gastrothylax indicus. Following in vitro treatment with ethanolic and aqueous extracts of Punica granatum fruit peel and commercial anthelmintic, albendazole G-6-PDH activity was decreased by 19-32 %, whereas MDH was suppressed by 24-41 %, compared to the respective control. Albendazole was quite effective when compared with negative control and both the extracts. The results indicate that phytochemicals of plant may act as potential vermifuge or vermicide.

  4. Utilization of L-aspartate, L-malate and fumarate by Pasteurella multocida

    Hoefer, M.; Flossmann, K.D. (Akademie der Landwirtschaftswissenschaften der DDR, Jena. Inst. fuer Bakterielle Tierseuchenforschung)

    1981-01-01

    Strains of Pasteurella multocida use L-aspartate, L-malate and furmarate, respectively, as substrates for production of succinic acid which accumulates in the medium. As was established by studies with /sup 14/C- and /sup 3/H-labelled substrates, the degradation of these substances proceeds analogously via the citric acid cycle.

  5. Utilization of L-aspartate, L-malate and fumarate by Pasteurella multocida

    Hoefer, M.; Flossmann, K.D.

    1981-01-01

    Strains of Pasteurella multocida use L-aspartate, L-malate and furmarate, respectively, as substrates for production of succinic acid which accumulates in the medium. As was established by studies with 14 C- and 3 H-labelled substrates, the degradation of these substances proceeds analogously via the citric acid cycle. (author)

  6. Watermelon glyoxysomal malate dehydrogenase is sorted to peroxisomes of the methylotrophic yeast, Hansenula polymorpha

    Klei, I.J. van der; Faber, K.N.; Keizer-Gunnink, I.; Gietl, C.; Harder, W.; Veenhuis, M.

    1993-01-01

    We have studied the fate of the watermelon (Citrullus vulgaris Schrad.) glyoxysomal enzyme, malate dehydrogenase (gMDH), after synthesis in the methylotrophic yeast, Hansenula polymorpha. The gene encoding the precursor form of gMDH (pre-gMDH) was cloned in an H. polymorpha expression vector

  7. Hybrid polyketide synthases

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  8. An Arabidopsis callose synthase

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  9. Monoterpene synthases from common sage (Salvia officinalis)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  10. The varied functions of aluminium-activated malate transporters–much more than aluminium resistance

    Palmer, Antony J.; Baker, Alison; Muench, Stephen P.

    2016-01-01

    The ALMT (aluminium-activated malate transporter) family comprises a functionally diverse but structurally similar group of ion channels. They are found ubiquitously in plant species, expressed throughout different tissues, and located in either the plasma membrane or tonoplast. The first family member identified was TaALMT1, discovered in wheat root tips, which was found to be involved in aluminium resistance by means of malate exudation into the soil. However, since this discovery other family members have been shown to have many other functions such as roles in stomatal opening, general anionic homoeostasis, and in economically valuable traits such as fruit flavour. Recent evidence has also shown that ALMT proteins can act as key molecular actors in GABA (γ-aminobutyric acid) signalling, the first evidence that GABA can act as a signal transducer in plants. PMID:27284052

  11. The varied functions of aluminium-activated malate transporters-much more than aluminium resistance.

    Palmer, Antony J; Baker, Alison; Muench, Stephen P

    2016-06-15

    The ALMT (aluminium-activated malate transporter) family comprises a functionally diverse but structurally similar group of ion channels. They are found ubiquitously in plant species, expressed throughout different tissues, and located in either the plasma membrane or tonoplast. The first family member identified was TaALMT1, discovered in wheat root tips, which was found to be involved in aluminium resistance by means of malate exudation into the soil. However, since this discovery other family members have been shown to have many other functions such as roles in stomatal opening, general anionic homoeostasis, and in economically valuable traits such as fruit flavour. Recent evidence has also shown that ALMT proteins can act as key molecular actors in GABA (γ-aminobutyric acid) signalling, the first evidence that GABA can act as a signal transducer in plants. © 2016 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  12. Analysis of copper and uranyl malates by potentiometry, polarimetry and spectrophotometry

    Khalil, I; Petit-Ramel, M M; Chapelet-Barbier, C [Lyon-1 Univ., 69 (France)

    1978-07-15

    The stability and optical constants of the copper malates (CuH/sub 2/Mal)/sup +/, (CuHMal), (CuH/sub 2/Mal/sub 2/)/sup 2 -/, (CuMal)/sup -/, (Cu/sub 2/Mal/sub 2/)/sup 2 -/, and (CuHsub(-1)Mal)/sup 2 -/ have been fitted by a pit-mapping method, which also gives their confidence limits, from potentiometric, visible spectroscopic and polarimetric measurements.

  13. Cytosolic malate dehydrogenase regulates RANKL-mediated osteoclastogenesis via AMPK/c-Fos/NFATc1 signaling

    Oh, Se Jeong [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Gu, Dong Ryun [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Jin, Su Hyun [Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Park, Keun Ha [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Lee, Seoung Hoon, E-mail: leesh2@wku.ac.kr [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Wonkwang Institute of Biomaterials and Implant, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of)

    2016-06-17

    Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.

  14. Cytosolic malate dehydrogenase regulates RANKL-mediated osteoclastogenesis via AMPK/c-Fos/NFATc1 signaling

    Oh, Se Jeong; Gu, Dong Ryun; Jin, Su Hyun; Park, Keun Ha; Lee, Seoung Hoon

    2016-01-01

    Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.

  15. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  16. Akkumulation von L-Malat und D-Lactat in Arabidopsis thaliana und Laccase/HBT-vermittelte Delignifizierung von Spartina alterniflora und Phragmites australis

    Heil, Alexander

    2016-01-01

    The current work contains two projects "Accumulation of L-malate and D-lactate in Arabidopsis thaliana" (A) "Laccase/HBT mediated delignification of Spartina alterniflora and Phragmites australis" (B). In project A, L-malate and D-lactate accumulated in A. thaliana plants. The accumulation of L-malate is carried out by modification of the plant metabolism with the enzymes PEPC, MDH and the tonoplast dicarboxylate transporter (TDT). Gene pepci2 (Hydrilla verticillata), mdh5 (Zea mays) and tdt ...

  17. Long Non-Coding RNA MALAT1 Mediates Transforming Growth Factor Beta1-Induced Epithelial-Mesenchymal Transition of Retinal Pigment Epithelial Cells.

    Shuai Yang

    Full Text Available To study the role of long non-coding RNA (lncRNA MALAT1 in transforming growth factor beta 1 (TGF-β1-induced epithelial-mesenchymal transition (EMT of retinal pigment epithelial (RPE cells.ARPE-19 cells were cultured and exposed to TGF-β1. The EMT of APRE-19 cells is confirmed by morphological change, as well as the increased expression of alpha-smooth muscle actin (αSMA and fibronectin, and the down-regulation of E-cadherin and Zona occludin-1(ZO-1 at both mRNA and protein levels. The expression of lncRNA MALAT1 in RPE cells were detected by quantitative real-time PCR. Knockdown of MALAT1 was achieved by transfecting a small interfering RNA (SiRNA. The effect of inhibition of MALAT1 on EMT, migration, proliferation, and TGFβ signalings were observed. MALAT1 expression was also detected in primary RPE cells incubated with proliferative vitreoretinopathy (PVR vitreous samples.The expression of MALAT1 is significantly increased in RPE cells incubated with TGFβ1. MALAT1 silencing attenuates TGFβ1-induced EMT, migration, and proliferation of RPE cells, at least partially through activating Smad2/3 signaling. MALAT1 is also significantly increased in primary RPE cells incubated with PVR vitreous samples.LncRNA MALAT1 is involved in TGFβ1-induced EMT of human RPE cells and provides new understandings for the pathogenesis of PVR.

  18. Determination of malation, methidathion, and chlorpyrifos ethyl pesticides using acetylcholinesterase biosensor based on Nafion/Ag@rGO-NH_2 nanocomposites

    Guler, Muhammet; Turkoglu, Vedat; Basi, Zehra

    2017-01-01

    Herein, a facile electrochemical acetylcholinesterase (EC 3.1.1.7; AChE) biosensor based on nafion (NA) and Ag nanoparticles supported on amine functionalized reduced graphene oxide (rGO-NH_2) was developed. The Ag@rGO-NH_2 nanocomposite was characterized using Fourier transform infrared spectroscopy (FT-IR), transmission electron microscopy (TEM), and X-ray diffraction (XRD). After being optimized, the biosensor exhibited excellent electrochemical response to the oxidation of thiocholine, the hydrolysis product of acetylthiocholine chloride (ATCl) catalyzed by AChE. An apparent Michealis-Menten value of 20.5 μM was obtained. Under optimized conductions, the biosensor detected malation, methidathion, and chlorpyrifos ethyl in the linear range from 0.0063 to 0.077 μg/mL, from 0.012 to 0.105 μg/mL, and from 0.021 to 0.122 μg/mL, respectively. The detection limit (LoD) was 4.5 ng/mL for malation, 9.5 ng/mL for methidathion, and 14 ng/mL for chlorpyrifos ethyl. Also, the NA/Ag@rGO-NH_2/AChE/GCE biosensor showed god sensitivity, stability and repeatability, which provides a promising tool for the detection of organophosphate pesticides.

  19. Malate-aspartate shuttle and exogenous NADH/cytochrome c electron transport pathway as two independent cytosolic reducing equivalent transfer systems.

    Abbrescia, Daniela Isabel; La Piana, Gianluigi; Lofrumento, Nicola Elio

    2012-02-15

    In mammalian cells aerobic oxidation of glucose requires reducing equivalents produced in glycolytic phase to be channelled into the phosphorylating respiratory chain for the reduction of molecular oxygen. Data never presented before show that the oxidation rate of exogenous NADH supported by the malate-aspartate shuttle system (reconstituted in vitro with isolated liver mitochondria) is comparable to the rate obtained on activation of the cytosolic NADH/cytochrome c electron transport pathway. The activities of these two reducing equivalent transport systems are independent of each other and additive. NADH oxidation induced by the malate-aspartate shuttle is inhibited by aminooxyacetate and by rotenone and/or antimycin A, two inhibitors of the respiratory chain, while the NADH/cytochrome c system remains insensitive to all of them. The two systems may simultaneously or mutually operate in the transfer of reducing equivalents from the cytosol to inside the mitochondria. In previous reports we suggested that the NADH/cytochrome c system is expected to be functioning in apoptotic cells characterized by the presence of cytochrome c in the cytosol. As additional new finding the activity of reconstituted shuttle system is linked to the amount of α-ketoglutarate generated inside the mitochondria by glutamate dehydrogenase rather than by aspartate aminotransferase. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Glutamine and ornithine alpha-ketoglutarate supplementation on malate dehydrogenases expression in hepatectomized rats

    Guimarães Filho, Artur; Cunha, Rodrigo Maranguape Silva da; Vasconcelos, Paulo Roberto Leitão de; Guimarães, Sergio Botelho

    2014-01-01

    PURPOSE: To evaluate the relative gene expression (RGE) of cytosolic (MDH1) and mitochondrial (MDH2) malate dehydrogenases enzymes in partially hepatectomized rats after glutamine (GLN) or ornithine alpha-ketoglutarate (OKG) suplementation. METHODS: One-hundred and eight male Wistar rats were randomly distributed into six groups (n=18): CCaL, GLNL and OKGL and fed calcium caseinate (CCa), GLN and OKG, 0.5g/Kg by gavage, 30 minutes before laparotomy. CCaH, GLNH and OKGH groups were likewise fe...

  1. Citrate, malate and alkali content in commonly consumed diet sodas: implications for nephrolithiasis treatment.

    Eisner, Brian H; Asplin, John R; Goldfarb, David S; Ahmad, Ardalanejaz; Stoller, Marshall L

    2010-06-01

    Citrate is a known inhibitor of calcium stone formation. Dietary citrate and alkali intake may have an effect on citraturia. Increasing alkali intake also increases urine pH, which can help prevent uric acid stones. We determined citrate, malate and total alkali concentrations in commonly consumed diet sodas to help direct dietary recommendations in patients with hypocitraturic calcium or uric acid nephrolithiasis. Citrate and malate were measured in a lemonade beverage commonly used to treat hypocitraturic calcium nephrolithiasis and in 15 diet sodas. Anions were measured by ion chromatography. The pH of each beverage was measured to allow calculation of the unprotonated anion concentration using the known pK of citric and malic acid. Total alkali equivalents were calculated for each beverage. Statistical analysis was done using Pearson's correlation coefficient. Several sodas contained an amount of citrate equal to or greater than that of alkali and total alkali as a lemonade beverage commonly used to treat hypocitraturic calcium nephrolithiasis (6.30 mEq/l citrate as alkali and 6.30 as total alkali). These sodas were Diet Sunkist Orange, Diet 7Up, Sprite Zero, Diet Canada Dry Ginger Ale, Sierra Mist Free, Diet Orange Crush, Fresca and Diet Mountain Dew. Colas, including Caffeine Free Diet Coke, Coke Zero, Caffeine Free Diet Pepsi and Diet Coke with Lime, had the lowest total alkali (less than 1.0 mEq/l). There was no significant correlation between beverage pH and total alkali content. Several commonly consumed diet sodas contain moderate amounts of citrate as alkali and total alkali. This information is helpful for dietary recommendations in patients with calcium nephrolithiasis, specifically those with hypocitraturia. It may also be useful in patients with low urine pH and uric acid stones. Beverage malate content is also important since malate ingestion increases the total alkali delivered, which in turn augments citraturia and increases urine pH. Copyright

  2. Calcium signaling in brain mitochondria: interplay of malate aspartate NADH shuttle and calcium uniporter/mitochondrial dehydrogenase pathways.

    Contreras, Laura; Satrústegui, Jorgina

    2009-03-13

    Ca2+ signaling in mitochondria has been mainly attributed to Ca2+ entry to the matrix through the Ca2+ uniporter and activation of mitochondrial matrix dehydrogenases. However, mitochondria can also sense increases in cytosolic Ca2+ through a mechanism that involves the aspartate-glutamate carriers, extramitochondrial Ca2+ activation of the NADH malate-aspartate shuttle (MAS). Both pathways are linked through the shared substrate alpha-ketoglutarate (alphaKG). Here we have studied the interplay between the two pathways under conditions of Ca2+ activation. We show that alphaKG becomes limiting when Ca2+ enters in brain or heart mitochondria, but not liver mitochondria, resulting in a drop in alphaKG efflux through the oxoglutarate carrier and in a drop in MAS activity. Inhibition of alphaKG efflux and MAS activity by matrix Ca2+ in brain mitochondria was fully reversible upon Ca2+ efflux. Because of their differences in cytosolic calcium concentration requirements, the MAS and Ca2+ uniporter-mitochondrial dehydrogenase pathways are probably sequentially activated during a Ca2+ transient, and the inhibition of MAS at the center of the transient may provide an explanation for part of the increase in lactate observed in the stimulated brain in vivo.

  3. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  4. Serum long non coding RNA MALAT-1 protected by exosomes is up-regulated and promotes cell proliferation and migration in non-small cell lung cancer.

    Zhang, Rui; Xia, Yuhong; Wang, Zhixin; Zheng, Jie; Chen, Yafei; Li, Xiaoli; Wang, Yu; Ming, Huaikun

    2017-08-19

    Circulating lncRNAs have been defined as a novel biomarker for non-small cell lung cancer (NSCLC), MALAT-1 was first identified lncRNA that was related to lung cancer metastasis. However, the relationship between exosomal lncRNAs and the diagnosis and prognosis of NSCLC was poorly understood. The aim of this study is to evaluate the clinical significance of serum exosomal MALAT-1 as a biomarker in the metastasis of NSCLC. In this study, we firstly isolated the exosomes from healthy subjects and NSCLC patients. Then we measured the expression levels of MALAT-1 contained in exosomes, and found that exosomal MALAT-1 was highly expressed in NSCLC patients, more importantly, the levels of exosomal MALAT-1 were positively associated with tumor stage and lymphatic metastasis. In addition, we decreased MALAT-1 expression by short hairpin RNA and conducted a series of assays including MTT, cell cycle, colony formation, wound-healing scratch and Annexin/V PI by flow cytometry in human lung cancer cell lines. These in vitro studies demonstrated that serum exosome-derived long noncoding RNA MALAT-1 promoted the tumor growth and migration, and prevented tumor cells from apoptosis in lung cancer cell lines. Taken together, this study shed a light on utilizing MALAT-1 in exosomes as a non-invasive serum-based tumor biomarker for diagnosis and prognosis of NSCLC. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Enhancement of malate-production and increase in sensitivity to dimethyl succinate by mutation of the VID24 gene in Saccharomyces cerevisiae.

    Negoro, Hiroaki; Kotaka, Atsushi; Matsumura, Kengo; Tsutsumi, Hiroko; Hata, Yoji

    2016-06-01

    Malate in sake (a Japanese alcoholic beverage) is an important component for taste that is produced by yeasts during alcoholic fermentation. To date, many researchers have developed methods for breeding high-malate-producing yeasts; however, genes responsible for the high-acidity phenotype are not known. We determined the mutated gene involved in high malate production in yeast, isolated as a sensitive mutant to dimethyl succinate. In the comparative whole genome analysis between high-malate-producing strain and its parent strain, one of the non-synonymous substitutions was identified in the VID24 gene. The mutation of VID24 resulted in enhancement of malate-productivity and sensitivity to dimethyl succinate. The mutation appeared to lead to a deficiency in Vid24p function. Furthermore, disruption of cytoplasmic malate dehydrogenase (Mdh2p) gene in the VID24 mutant inhibited the high-malate-producing phenotype. Vid24p is known as a component of the multisubunit ubiquitin ligase and participates in the degradation of gluconeogenic enzymes such as Mdh2p. We suggest that the enhancement of malate-productivity results from an accumulation of Mdh2p due to the loss of Vid24p function. These findings propose a novel mechanism for the regulation of organic acid production in yeast cells by the component of ubiquitin ligase, Vid24p. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. Structure of halophilic malate dehydrogenase in multimolar KCl solutions from neutron scattering and ultracentrifugation

    Calmettes, P.

    1987-01-01

    The structure and solvent interactions of malate dehydrogenase from Halobacterium marismortui in multimolar KCl solvents are found to be similar to those in multimolar NaCl solvents reported previously (G. Zaccai, E. Wachtel and H. Eisenberg, J. Mol. Biol. 190 (1986) 97). KCl rather than NaCl is predominant in physiological medium. At salt concentrations up to about 3.0 M, the protein (a dimer of M 87000 g/mol) can be considered to occupy an invariant volume in which it is associated with about 4100 molecules of water and about 520 molecules of salt. At very low resolution, the enzyme particle appears to have a compact protein core and protruding protein parts in interaction with the water and salt components, structural features that are not observed in non-halophilic mitochondrial malate dehydrogenase. The above conclusions were drawn from the analysis of neutron scattering and ultracentrifugation data, and the complementarity of these approaches is discussed extensively. 24 refs.; 7 figs.; 4 tabs

  7. [Effect of L-arginine and the nitric oxide synthase blocker L-NNA on calcium capacity in rat liver mitochondria with differing resistance to hypoxia].

    Kurhaliuk, N M; Ikkert, O V; Vovkanych, L S; Horyn', O V; Hal'kiv, M O; Hordiĭ, S K

    2001-01-01

    The effect of L-arginine and blockator of nitric oxide synthase L-NNA on processes of calcium mitochondrial capacity in liver with different resistance to hypoxia in the experiments with Wistar rats has been studied using the followrng substrates of energy support: succinic, alpha-ketoglutaric acids, alpha-ketolutarate and inhibitor succinatedehydrogenase malonate. As well we used substrates mixtures combination providing for activation of aminotransferase mechanism: glutamate and piruvate, glutamate and malate. It has been shown that L-arginine injection increases calcium mitochondrial capacity of low resistant rats using as substrates the succinate and alpha-ketoglutarate to control meanings of high resistance rats. Effects of donors nitric oxide on this processes limit NO-synthase inhibitor L-NNA.

  8. Are phloem-derived amino acids the origin of the elevated malate concentration in the xylem sap following mineral N starvation in soybean?

    Vitor, Simone C; do Amarante, Luciano; Sodek, Ladaslav

    2018-05-16

    A substantial increase in malate in the xylem sap of soybean subjected to mineral N starvation originates mainly from aspartate, a prominent amino acid of the phloem. A substantial increase in xylem malate was found when non-nodulated soybean plants were transferred to a N-free medium. Nodulated plants growing in the absence of mineral N and, therefore, dependent on symbiotic N 2 fixation also contained elevated concentrations of malate in the xylem sap. When either nitrate or ammonium was supplied, malate concentrations in the xylem sap were low, both for nodulated and non-nodulated plants. Evidence was obtained that the elevated malate concentration of the xylem was derived from amino acids supplied by the phloem. Aspartate was a prominent component of the phloem sap amino acids and, therefore, a potential source of malate. Supplying the roots of intact plants with 13 C-aspartate revealed that malate of the xylem sap was readily labelled under N starvation. A hypothetical scheme is proposed whereby aspartate supplied by the phloem is metabolised in the roots and the products of this metabolism cycled back to the shoot. Under N starvation, aspartate metabolism is diverted from asparagine synthesis to supply N for the synthesis of other amino acids via transaminase activity. The by-product of aspartate transaminase activity, oxaloacetate, is transformed to malate and its export accounts for much of the elevated concentration of malate found in the xylem sap. This mechanism represents a new additional role for malate during mineral N starvation of soybean, beyond that of charge balance.

  9. The Tomato Terpene Synthase Gene Family1[W][OA

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  10. Impaired Malate and Fumarate Accumulation Due to the Mutation of the Tonoplast Dicarboxylate Transporter Has Little Effects on Stomatal Behavior.

    Medeiros, David B; Barros, Kallyne A; Barros, Jessica Aline S; Omena-Garcia, Rebeca P; Arrivault, Stéphanie; Sanglard, Lílian M V P; Detmann, Kelly C; Silva, Willian Batista; Daloso, Danilo M; DaMatta, Fábio M; Nunes-Nesi, Adriano; Fernie, Alisdair R; Araújo, Wagner L

    2017-11-01

    Malate is a central metabolite involved in a multiplicity of plant metabolic pathways, being associated with mitochondrial metabolism and playing significant roles in stomatal movements. Vacuolar malate transport has been characterized at the molecular level and is performed by at least one carrier protein and two channels in Arabidopsis ( Arabidopsis thaliana ) vacuoles. The absence of the Arabidopsis tonoplast Dicarboxylate Transporter (tDT) in the tdt knockout mutant was associated previously with an impaired accumulation of malate and fumarate in leaves. Here, we investigated the consequences of this lower accumulation on stomatal behavior and photosynthetic capacity as well as its putative metabolic impacts. Neither the stomatal conductance nor the kinetic responses to dark, light, or high CO 2 were highly affected in tdt plants. In addition, we did not observe any impact on stomatal aperture following incubation with abscisic acid, malate, or citrate. Furthermore, an effect on photosynthetic capacity was not observed in the mutant lines. However, leaf mitochondrial metabolism was affected in the tdt plants. Levels of the intermediates of the tricarboxylic acid cycle were altered, and increases in both light and dark respiration were observed. We conclude that manipulation of the tonoplastic organic acid transporter impacted mitochondrial metabolism, while the overall stomatal and photosynthetic capacity were unaffected. © 2017 American Society of Plant Biologists. All Rights Reserved.

  11. Closing plant stomata requires a homolog of an aluminum-activated malate transporter.

    Sasaki, Takayuki; Mori, Izumi C; Furuichi, Takuya; Munemasa, Shintaro; Toyooka, Kiminori; Matsuoka, Ken; Murata, Yoshiyuki; Yamamoto, Yoko

    2010-03-01

    Plant stomata limit both carbon dioxide uptake and water loss; hence, stomatal aperture is carefully set as the environment fluctuates. Aperture area is known to be regulated in part by ion transport, but few of the transporters have been characterized. Here we report that AtALMT12 (At4g17970), a homolog of the aluminum-activated malate transporter (ALMT) of wheat, is expressed in guard cells of Arabidopsis thaliana. Loss-of-function mutations in AtALMT12 impair stomatal closure induced by ABA, calcium and darkness, but do not abolish either the rapidly activated or the slowly activated anion currents previously identified as being important for stomatal closure. Expressed in Xenopus oocytes, AtALMT12 facilitates chloride and nitrate currents, but not those of organic solutes. Therefore, we conclude that AtALMT12 is a novel class of anion transporter involved in stomatal closure.

  12. The lncRNA Malat1 Is Dispensable for Mouse Development but Its Transcription Plays a cis-Regulatory Role in the Adult

    Bin Zhang

    2012-07-01

    Full Text Available Genome-wide studies have identified thousands of long noncoding RNAs (lncRNAs lacking protein-coding capacity. However, most lncRNAs are expressed at a very low level, and in most cases there is no genetic evidence to support their in vivo function. Malat1 (metastasis associated lung adenocarcinoma transcript 1 is among the most abundant and highly conserved lncRNAs, and it exhibits an uncommon 3′-end processing mechanism. In addition, its specific nuclear localization, developmental regulation, and dysregulation in cancer are suggestive of it having a critical biological function. We have characterized a Malat1 loss-of-function genetic model that indicates that Malat1 is not essential for mouse pre- and postnatal development. Furthermore, depletion of Malat1 does not affect global gene expression, splicing factor level and phosphorylation status, or alternative pre-mRNA splicing. However, among a small number of genes that were dysregulated in adult Malat1 knockout mice, many were Malat1 neighboring genes, thus indicating a potential cis-regulatory role of Malat1 gene transcription.

  13. Primary structure of the light-dependent regulatory site of corn NADP-malate dehydrogenase

    Decottignies, P.; Schmitter, J.M.; Miginiac-Maslow, M.; Le Marechal, P.; Jacquot, J.P.; Gadal, P.

    1988-08-25

    The light-activated NADP-malate dehydrogenase (NADP-MDH) catalyzes the reduction of oxaloacetate to malate in higher plant chloroplasts. This enzyme is regulated in vivo by the ferredoxin-thioredoxin system through redox reactions. NADP-MDH has been photoactivated in vitro in a chloroplast system reconstituted from the pure protein components and thylakoid membranes. Photoactivation was accompanied by the appearance of new thiol groups (followed by (14C)iodoacetate incorporation). 14C-Carboxymethylated NADP-MDH has been purified from the incubation mixture and its amino-terminal sequence analyzed. Two (14C)carboxymethylcysteines were identified at positions 10 and 15 after light activation, while they were not detected in the dark-treated protein. In addition, the analysis of the tryptic digest of light-activated (14C)carboxymethylated NADP-MDH revealed that the radioactive label was mostly incorporated in Cys10 and Cys15, indicating that these 2 residues play a major role in the light activation mechanism. Moreover, an activation model, in which photoreduced thio-redoxin was replaced by the dithiol reductant dithio-threitol, has been developed. When NADP-MDH was activated in this way, the same sulfhydryls were found to be labeled, and alternatively, they did not incorporate any radioactivity when dithiothreitol reduction was performed after carboxymethylation in denaturating conditions. These results indicate that activation (by light or by dithiothreitol) proceeds on each subunit by reduction of a disulfide bridge located at the amino terminus of the enzyme between Cys10 and Cys15.

  14. Primary structure of the light-dependent regulatory site of corn NADP-malate dehydrogenase

    Decottignies, P.; Schmitter, J.M.; Miginiac-Maslow, M.; Le Marechal, P.; Jacquot, J.P.; Gadal, P.

    1988-01-01

    The light-activated NADP-malate dehydrogenase (NADP-MDH) catalyzes the reduction of oxaloacetate to malate in higher plant chloroplasts. This enzyme is regulated in vivo by the ferredoxin-thioredoxin system through redox reactions. NADP-MDH has been photoactivated in vitro in a chloroplast system reconstituted from the pure protein components and thylakoid membranes. Photoactivation was accompanied by the appearance of new thiol groups (followed by [14C]iodoacetate incorporation). 14C-Carboxymethylated NADP-MDH has been purified from the incubation mixture and its amino-terminal sequence analyzed. Two [14C]carboxymethylcysteines were identified at positions 10 and 15 after light activation, while they were not detected in the dark-treated protein. In addition, the analysis of the tryptic digest of light-activated [14C]carboxymethylated NADP-MDH revealed that the radioactive label was mostly incorporated in Cys10 and Cys15, indicating that these 2 residues play a major role in the light activation mechanism. Moreover, an activation model, in which photoreduced thio-redoxin was replaced by the dithiol reductant dithio-threitol, has been developed. When NADP-MDH was activated in this way, the same sulfhydryls were found to be labeled, and alternatively, they did not incorporate any radioactivity when dithiothreitol reduction was performed after carboxymethylation in denaturating conditions. These results indicate that activation (by light or by dithiothreitol) proceeds on each subunit by reduction of a disulfide bridge located at the amino terminus of the enzyme between Cys10 and Cys15

  15. Maize ZmALMT2 is a root anion transporter that mediates constitutive root malate efflux.

    Ligaba, Ayalew; Maron, Lyza; Shaff, Jon; Kochian, Leon; Piñeros, Miguel

    2012-07-01

    Root efflux of organic acid anions underlies a major mechanism of plant aluminium (Al) tolerance on acid soils. This efflux is mediated by transporters of the Al-activated malate transporter (ALMT) or the multi-drug and toxin extrusion (MATE) families. ZmALMT2 was previously suggested to be involved in Al tolerance based on joint association-linkage mapping for maize Al tolerance. In the current study, we functionally characterized ZmALMT2 by heterologously expressing it in Xenopus laevis oocytes and transgenic Arabidopsis. In oocytes, ZmALMT2 mediated an Al-independent electrogenic transport product of organic and inorganic anion efflux. Ectopic overexpression of ZmALMT2 in an Al-hypersensitive Arabidopsis KO/KD line lacking the Al tolerance genes, AtALMT1 and AtMATE, resulted in Al-independent constitutive root malate efflux which partially restored the Al tolerance phenotype. The lack of correlation between ZmALMT2 expression and Al tolerance (e.g., expression not localized to the root tip, not up-regulated by Al, and higher in sensitive versus tolerance maize lines) also led us to question ZmALMT2's role in Al tolerance. The functional properties of the ZmALMT2 transporter presented here, along with the gene expression data, suggest that ZmALMT2 is not involved in maize Al tolerance but, rather, may play a role in mineral nutrient acquisition and transport. Published 2011. This article is a U.S. Government work and is in the public domain in the USA.

  16. Synthesis, growth, structural and optical studies of a new organic three dimensional framework: 4-(aminocarbonyl)pyridine 4-(aminocarbonyl)pyridinium hydrogen L-malate

    Vijayalakshmi, A. [Department of Chemistry, RMK. Engineering College, Kavaraipettai 601206 (India); Vidyavathy, B., E-mail: vidyavathybalraj@gmail.com [Department of Chemistry,Velammal Engineering College, Chennai 600066 (India); Peramaiyan, G. [Institute of Physics, Academia Sinica, Taipei 11529, Taiwan (China); Vinitha, G. [Department of Physics, VIT University, Chennai 600127 (India)

    2017-02-15

    4-(aminocarbonyl)pyridine 4-(aminocarbonyl)pyridinium hydrogen L-malate [(4ACP)(4ACP).(LM)] a new organic nonlinear optical (NLO) crystal was grown by the slow evaporation method. Single crystal X-ray diffraction analysis revealed that the [(4ACP)(4ACP).(LM)] crystal belongs to monoclinic crystal system, space group P2{sub 1}/n, with a three dimensional network. Thermogravimetry (TG) and differential thermal (DT) analyses showed that [(4ACP)(4ACP).(LM)] is thermally stable up to 165 °C. The optical transmittance window and the lower cut-off wavelength of [(4ACP)(4ACP).(LM)] were found out by UV–vis–NIR spectral study. The molecular structure of [(4ACP)(4ACP).(LM)] was further confirmed by FTIR spectral studies. The relative dielectric permittivity and dielectric loss were determined as function of frequency and temperature. The third order nonlinear optical property of [(4ACP)(4ACP).(LM)] was studied by the Z-scan technique using a 532 nm diode pumped CW Nd:YAG laser. Nonlinear refractive index, nonlinear absorption coefficient and third order nonlinear susceptibility of the grown crystal were found to be 7.38×10{sup −8} cm{sup 2}/W, 0.08×10{sup −4} cm/W and 5.36×10{sup −6} esu, respectively. The laser damage threshold value is found to be 1.75 GW/cm{sup 2} - Graphical abstract: In the crystal structure of the title complex, the asymmetric unit contains one hydrogen L-malate anion, 4-(aminocarbonyl)pyridinium cation and a neutral isonicotinamide molecule. It is stabilized by intermolecular N-H…O, C-H…O and O-H…O hydrogen bonds which generate a three dimensional network.

  17. Th2-related immune responses by the Brucella abortus cellular antigens, malate dehydrogenase, elongation factor, and arginase.

    Im, Young Bin; Shim, Soojin; Park, Woo Bin; Kim, Suk; Yoo, Han Sang

    2017-09-01

    Brucellosis is an important zoonotic disease caused by Brucella species. The disease is difficult to control due to the intracellular survival of the bacterium and the lack of precise understanding of pathogenesis. Despite of continuous researches on the pathogenesis of Brucella spp. infection, there is still question on the pathogenesis, especially earlier immune response in the bacterial infection. Malate dehydrogenase (MDH), elongation factor (Tsf), and arginase (RocF), which showed serological reactivity, were purified after gene cloning, and their immune modulating activities were then analyzed in a murine model. Cytokine production profiles were investigated by stimulating RAW 264.7 cells and naïve splenocytes with the three recombinant proteins. Also, immune responses were analyzed by ELISA and an ELIspot assay after immunizing mice with the three proteins. Only TNF-α was produced in stimulated RAW 264.7 cells, whereas Th1-related cytokines, IFN-γ and IL-2, were induced in naïve splenocytes. In contrast, Th2-type immune response was more strongly induced in antigen-secreting cells in the splenocytes obtained 28 days after immunizing mice with the three proteins, as were IgM and IgG. The induction of Th2-related antibody, IgG1, was higher than the Th1-related antibody, IgG2a, in immunized mice. These results suggest that the three proteins strongly induce Th2-type immune response in vivo, even though Th1-related cytokines were produced in vitro. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....

  19. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  20. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  1. Low pH, Aluminum, and Phosphorus Coordinately Regulate Malate Exudation through GmALMT1 to Improve Soybean Adaptation to Acid Soils1[W][OA

    Liang, Cuiyue; Piñeros, Miguel A.; Tian, Jiang; Yao, Zhufang; Sun, Lili; Liu, Jiping; Shaff, Jon; Coluccio, Alison; Kochian, Leon V.; Liao, Hong

    2013-01-01

    Low pH, aluminum (Al) toxicity, and low phosphorus (P) often coexist and are heterogeneously distributed in acid soils. To date, the underlying mechanisms of crop adaptation to these multiple factors on acid soils remain poorly understood. In this study, we found that P addition to acid soils could stimulate Al tolerance, especially for the P-efficient genotype HN89. Subsequent hydroponic studies demonstrated that solution pH, Al, and P levels coordinately altered soybean (Glycine max) root growth and malate exudation. Interestingly, HN89 released more malate under conditions mimicking acid soils (low pH, +P, and +Al), suggesting that root malate exudation might be critical for soybean adaptation to both Al toxicity and P deficiency on acid soils. GmALMT1, a soybean malate transporter gene, was cloned from the Al-treated root tips of HN89. Like root malate exudation, GmALMT1 expression was also pH dependent, being suppressed by low pH but enhanced by Al plus P addition in roots of HN89. Quantitative real-time PCR, transient expression of a GmALMT1-yellow fluorescent protein chimera in Arabidopsis protoplasts, and electrophysiological analysis of Xenopus laevis oocytes expressing GmALMT1 demonstrated that GmALMT1 encodes a root cell plasma membrane transporter that mediates malate efflux in an extracellular pH-dependent and Al-independent manner. Overexpression of GmALMT1 in transgenic Arabidopsis, as well as overexpression and knockdown of GmALMT1 in transgenic soybean hairy roots, indicated that GmALMT1-mediated root malate efflux does underlie soybean Al tolerance. Taken together, our results suggest that malate exudation is an important component of soybean adaptation to acid soils and is coordinately regulated by three factors, pH, Al, and P, through the regulation of GmALMT1 expression and GmALMT1 function. PMID:23341359

  2. Low pH, aluminum, and phosphorus coordinately regulate malate exudation through GmALMT1 to improve soybean adaptation to acid soils.

    Liang, Cuiyue; Piñeros, Miguel A; Tian, Jiang; Yao, Zhufang; Sun, Lili; Liu, Jiping; Shaff, Jon; Coluccio, Alison; Kochian, Leon V; Liao, Hong

    2013-03-01

    Low pH, aluminum (Al) toxicity, and low phosphorus (P) often coexist and are heterogeneously distributed in acid soils. To date, the underlying mechanisms of crop adaptation to these multiple factors on acid soils remain poorly understood. In this study, we found that P addition to acid soils could stimulate Al tolerance, especially for the P-efficient genotype HN89. Subsequent hydroponic studies demonstrated that solution pH, Al, and P levels coordinately altered soybean (Glycine max) root growth and malate exudation. Interestingly, HN89 released more malate under conditions mimicking acid soils (low pH, +P, and +Al), suggesting that root malate exudation might be critical for soybean adaptation to both Al toxicity and P deficiency on acid soils. GmALMT1, a soybean malate transporter gene, was cloned from the Al-treated root tips of HN89. Like root malate exudation, GmALMT1 expression was also pH dependent, being suppressed by low pH but enhanced by Al plus P addition in roots of HN89. Quantitative real-time PCR, transient expression of a GmALMT1-yellow fluorescent protein chimera in Arabidopsis protoplasts, and electrophysiological analysis of Xenopus laevis oocytes expressing GmALMT1 demonstrated that GmALMT1 encodes a root cell plasma membrane transporter that mediates malate efflux in an extracellular pH-dependent and Al-independent manner. Overexpression of GmALMT1 in transgenic Arabidopsis, as well as overexpression and knockdown of GmALMT1 in transgenic soybean hairy roots, indicated that GmALMT1-mediated root malate efflux does underlie soybean Al tolerance. Taken together, our results suggest that malate exudation is an important component of soybean adaptation to acid soils and is coordinately regulated by three factors, pH, Al, and P, through the regulation of GmALMT1 expression and GmALMT1 function.

  3. Pengaruh Pengasapan (Thermal Fogging Insektisida Piretroid (Malation 95% Terhadap Nyamuk Aedes aegypti dan Culex quinquefasciatus di Pemukiman

    Hasan Boesri

    2013-02-01

    Full Text Available Abstracts. The evaluation of piretroid insecticide (active ingredient Malation 95% was con­ducted in Sub district Tengarang, Semarang Segency, Central Java Province. The insecti­cide was applied using thermal fogging method for dosages of 125, 250, 375, 500 and 625 ml/ha (diluted in diesel to 10 litters. The evaluation of the efficacy was conducted against two mosquito species, Aedes aegypti (the main dengue haemorrhagic fever and Culex quinquefasciatus (the urban lymphatic fil­ariasis vector. Result of the evaluation was revealed that dosages of 500 and 625 ml/ha were effective against both tested mosquito species indoor and outdoor.Key Word: Aedes aegypti, Culex quinquefasciatus, insecticide Piretroid (Malation 95%, thermal fogging.

  4. Long Non-Coding RNA Malat-1 Is Dispensable during Pressure Overload-Induced Cardiac Remodeling and Failure in Mice.

    Tim Peters

    Full Text Available Long non-coding RNAs (lncRNAs are a class of RNA molecules with diverse regulatory functions during embryonic development, normal life, and disease in higher organisms. However, research on the role of lncRNAs in cardiovascular diseases and in particular heart failure is still in its infancy. The exceptionally well conserved nuclear lncRNA Metastasis associated in lung adenocarcinoma transcript 1 (Malat-1 is a regulator of mRNA splicing and highly expressed in the heart. Malat-1 modulates hypoxia-induced vessel growth, activates ERK/MAPK signaling, and scavenges the anti-hypertrophic microRNA-133. We therefore hypothesized that Malat-1 may act as regulator of cardiac hypertrophy and failure during cardiac pressure overload induced by thoracic aortic constriction (TAC in mice.Absence of Malat-1 did not affect cardiac hypertrophy upon pressure overload: Heart weight to tibia length ratio significantly increased in WT mice (sham: 5.78±0.55, TAC 9.79±1.82 g/mm; p<0.001 but to a similar extend also in Malat-1 knockout (KO mice (sham: 6.21±1.12, TAC 8.91±1.74 g/mm; p<0.01 with no significant difference between genotypes. As expected, TAC significantly reduced left ventricular fractional shortening in WT (sham: 38.81±6.53%, TAC: 23.14±11.99%; p<0.01 but to a comparable degree also in KO mice (sham: 37.01±4.19%, TAC: 25.98±9.75%; p<0.05. Histological hallmarks of myocardial remodeling, such as cardiomyocyte hypertrophy, increased interstitial fibrosis, reduced capillary density, and immune cell infiltration, did not differ significantly between WT and KO mice after TAC. In line, the absence of Malat-1 did not significantly affect angiotensin II-induced cardiac hypertrophy, dysfunction, and overall remodeling. Above that, pressure overload by TAC significantly induced mRNA levels of the hypertrophy marker genes Nppa, Nppb and Acta1, to a similar extend in both genotypes. Alternative splicing of Ndrg2 after TAC was apparent in WT (isoform ratio

  5. Pre-ischemic mitochondrial substrate constraint by inhibition of malate-aspartate shuttle preserves mitochondrial function after ischemia-reperfusion

    Jespersen, Nichlas Riise; Yokota, Takashi; Støttrup, Nicolaj Brejnholt

    2017-01-01

    KEY POINTS: Pre-ischaemic administration of aminooxiacetate (AOA), an inhibitor of the malate-aspartate shuttle (MAS), provides cardioprotection against ischaemia-reperfusion injury. The underlying mechanism remains unknown. We examined whether transient inhibition of the MAS during ischaemia......, but not IPC, reduced the myocardial interstitial concentration of tricarboxylic acid cycle intermediates at the onset of reperfusion. The results obtained in the present study demonstrate that metabolic regulation by inhibition of the MAS at the onset of reperfusion may be beneficial for the preservation...... of mitochondrial function during late reperfusion in an IR-injured heart. ABSTRACT: Mitochondrial dysfunction plays a central role in ischaemia-reperfusion (IR) injury. Pre-ischaemic administration of aminooxyacetate (AOA), an inhibitor of the malate-aspartate shuttle (MAS), provides cardioprotection against IR...

  6. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Lather, Amit; Sharma, Sunil; Khatkar, Anurag

    2018-01-01

    Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding

  7. The Membrane Topology of ALMT1, an Aluminum-Activated Malate Transport Protein in Wheat (Triticum aestivum)

    Motoda, Hirotoshi; Sasaki, Takayuki; Kano, Yoshio; Ryan, Peter R; Delhaize, Emmanuel; Matsumoto, Hideaki; Yamamoto, Yoko

    2007-01-01

    The wheat ALMT1 gene encodes an aluminum (Al)-activated malate transport protein which confers Al-resistance. We investigated the membrane topology of this plasma-membrane localized protein with immunocytochemical techniques. Several green fluorescent protein (GFP)-fused and histidine (His)-tagged chimeras of ALMT1 were prepared based on a computer-predicted secondary structure and transiently expressed in cultured mammalian cells. Antibodies raised to polypeptide epitopes of ALMT1 were used ...

  8. The long non-coding RNA MALAT1 promotes the migration and invasion of hepatocellular carcinoma by sponging miR-204 and releasing SIRT1.

    Hou, Zhouhua; Xu, Xuwen; Zhou, Ledu; Fu, Xiaoyu; Tao, Shuhui; Zhou, Jiebin; Tan, Deming; Liu, Shuiping

    2017-07-01

    Increasing evidence supports the significance of long non-coding RNA in cancer development. Several recent studies suggest the oncogenic activity of long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) in hepatocellular carcinoma. In this study, we explored the molecular mechanisms by which MALAT1 modulates hepatocellular carcinoma biological behaviors. We found that microRNA-204 was significantly downregulated in sh-MALAT1 HepG2 cell and 15 hepatocellular carcinoma tissues by quantitative real-time polymerase chain reaction analysis. Through bioinformatic screening, luciferase reporter assay, RNA-binding protein immunoprecipitation, and RNA pull-down assay, we identified microRNA-204 as a potential interacting partner for MALAT1. Functionally, wound-healing and transwell assays revealed that microRNA-204 significantly inhibited the migration and invasion of hepatocellular carcinoma cells. Notably, sirtuin 1 was recognized as a direct downstream target of microRNA-204 in HepG2 cells. Moreover, si-SIRT1 significantly inhibited cell invasion and migration process. These data elucidated, by sponging and competitive binding to microRNA-204, MALAT1 releases the suppression on sirtuin 1, which in turn promotes hepatocellular carcinoma migration and invasion. This study reveals a novel mechanism by which MALAT1 stimulates hepatocellular carcinoma progression and justifies targeting metastasis-associated lung adenocarcinoma transcript 1 as a potential therapy for hepatocellular carcinoma.

  9. Long non-coding RNA MALAT1 acts as a competing endogenous RNA to promote malignant melanoma growth and metastasis by sponging miR-22.

    Luan, Wenkang; Li, Lubo; Shi, Yan; Bu, Xuefeng; Xia, Yun; Wang, Jinlong; Djangmah, Henry Siaw; Liu, Xiaohui; You, Yongping; Xu, Bin

    2016-09-27

    Long non-coding RNAs (lncRNAs) are involved in tumorigenesis. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), an lncRNAs, is associated with the growth and metastasis of many human tumors, but its biological roles in malignant melanoma remain unclear. In this study, the aberrant up-regulation of MALAT1 was detected in melanoma. We determined that MALAT1 promotes melanoma cells proliferation, invasion and migration by sponging miR-22. MiR-22 was decreased and acted as a tumor suppressor in melanoma, and MMP14 and Snail were the functional targets of miR-22. Furthermore, MALAT1 could modulate MMP14 and Snail by operating as a competing endogenous RNA (ceRNA) for miR-22. The effects of MALAT1 in malignant melanoma is verified using a xenograft model. This finding elucidates a new mechanism for MALAT1 in melanoma development and provides a potential target for melanoma therapeutic intervention.

  10. Functional Characterization of Sesquiterpene Synthase from Polygonum minus

    Su-Fang Ee

    2014-01-01

    Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

  11. Producing biofuels using polyketide synthases

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  12. Glutamine and ornithine alpha-ketoglutarate supplementation on malate dehydrogenases expression in hepatectomized rats.

    Guimarães Filho, Artur; Cunha, Rodrigo Maranguape Silva da; Vasconcelos, Paulo Roberto Leitão de; Guimarães, Sergio Botelho

    2014-06-01

    To evaluate the relative gene expression (RGE) of cytosolic (MDH1) and mitochondrial (MDH2) malate dehydrogenases enzymes in partially hepatectomized rats after glutamine (GLN) or ornithine alpha-ketoglutarate (OKG) suplementation. One-hundred and eight male Wistar rats were randomly distributed into six groups (n=18): CCaL, GLNL and OKGL and fed calcium caseinate (CCa), GLN and OKG, 0.5 g/Kg by gavage, 30 minutes before laparotomy. CCaH, GLNH and OKGH groups were likewise fed 30 minutes before 70% partial hepatectomy. Blood and liver samples were collected three, seven and 14 days after laparotomy/hepatectomy for quantification of MDH1/MDH2 enzymes using the real-time polymerase chain reaction (PCR) methodology. Relative enzymes expression was calculated by the 2-(ΔΔC)T method using the threshold cycle (CT) value for normalization. MDH1/MDH2 RGE was not different in hepatectomized rats treated with OKG compared to rats treated with CCa. However, MDH1/MDH2 RGE was greater on days 3 (321:1/26.48:1) and 7 (2.12:1/2.48:1) while MDH2 RGE was greater on day 14 (7.79:1) in hepatectomized rats treated with GLN compared to control animals. Glutamine has beneficial effects in liver regeneration in rats by promoting an up-regulation of the MDH1 and MDH2 relative gene expression.

  13. Calcium absorption from apple and orange juice fortified with calcium citrate malate (CCM).

    Andon, M B; Peacock, M; Kanerva, R L; De Castro, J A

    1996-06-01

    Determine calcium (Ca) absorption from Ca fortified orange and apple juice. Absorbability was assessed by measuring 45Ca absorption in healthy women (mean age 57 years, n = 57/group) and whole body 47Ca retention in adult female beagle dogs (n = 6/group) and young adult male rats (n = 6/group). Women received 6.24 mmol (250 mg) Ca as calcium citrate malate fortified orange juice (CCM-OJ) or apple juice (CCM-AJ). Dogs received 3.12 mmol (125 mg) Ca as CCM-OJ or CCM-AJ. Rats were administered 0.15 mmol (6 mg) Ca as either milk, CCM-OJ, or CCM-AJ. Additional 47Ca whole body retention experiments in rats measured the effects of differences in the carbohydrate and organic acid contents of the juices on Ca absorption. Mean +/- SEM percent Ca fractional absorption was greater (p composition of Ca fortified juices, we found that the greater fructose and lower organic acid content of apple juice accounted for its greater Ca absorbability. CCM fortified versions of orange and apple juice have high Ca absorbability and are potentially important vehicles for increasing dietary Ca intake. The greater Ca absorption from CCM-AJ compared with CCM-OJ is accounted for by differences in the carbohydrate and organic acid content of the juices. These data suggest that by modifying common beverage ingredients, products with even greater Ca absorbability could be formulated.

  14. Regulation of human cerebrospinal fluid malate dehydrogenase 1 in sporadic Creutzfeldt-Jakob disease patients.

    Schmitz, Matthias; Llorens, Franc; Pracht, Alexander; Thom, Tobias; Correia, Ângela; Zafar, Saima; Ferrer, Isidre; Zerr, Inga

    2016-11-14

    The identification of reliable diagnostic biomarkers in differential diagnosis of neurodegenerative diseases is an ongoing topic. A previous two-dimensional proteomic study on cerebrospinal fluid (CSF) revealed an elevated level of an enzyme, mitochondrial malate dehydrogenase 1 (MDH1), in sporadic Creutzfeldt-Jakob disease (sCJD) patients. Here, we could demonstrate the expression of MDH1 in neurons as well as in the neuropil. Its levels are lower in sCJD brains than in control brains. An examination of CSF-MDH1 in sCJD patients by ELISA revealed a significant elevation of CSF-MDH1 levels in sCJD patients (independently from the PRNP codon 129 MV genotype or the prion protein scrapie (PrP Sc ) type) in comparison to controls. In combination with total tau (tau), CSF-MDH1 detection exhibited a high diagnostic accuracy for sCJD diagnosis with a sensitivity of 97.5% and a specificity of 95.6%. A correlation study of MDH1 level in CSF with other neurodegenerative marker proteins revealed a significant positive correlation between MDH1 concentration with tau, 14-3-3 and neuron specific enolase level. In conclusion, our study indicated the potential of MDH1 in combination with tau as an additional biomarker in sCJD improving diagnostic accuracy of tau markedly.

  15. High Performance Liquid Chromatographic Analysis of Almotriptan Malate in Bulk and Tablets

    Chandra Bala Sekaran

    2013-02-01

    Full Text Available Purpose: A simple RP-HPLC method has been developed and validated for the determination of almotriptan malate (ATM in bulk and tablets. Methods: Chromatographic separation of ATM was achieved by using a Thermo Scientific C18 column. A Mobile phase containing a mixture of methanol, water and acetic acid (4:8:0.1 v/v was pumped at the flow rate of 1 mL/min. Detection was performed at 227 nm. According to ICH guidelines, the method was validated. Results: The calibration curve was linear in the concentration range 5–60 μg/mL for the ATM with regression coefficient 0.9999. The method was precise with RSD <1.2%. Excellent recoveries of 99.60 - 100.80% proved the accuracy of the method. The limits of detection and quantification were found to be 0.025 and 0.075 μg/mL, respectively. Conclusion: The method was successfully applied for the quantification of ATM in tablets with acceptable accuracy and precision.

  16. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  17. Nitric oxide synthase gene G298 allele

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  18. Threonine phosphorylation of rat liver glycogen synthase

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  19. Improvement in the quality of hematopoietic prostaglandin D synthase crystals in a microgravity environment

    Tanaka, Hiroaki; Tsurumura, Toshiharu; Aritake, Kosuke; Furubayashi, Naoki; Takahashi, Sachiko; Yamanaka, Mari; Hirota, Erika; Sano, Satoshi; Sato, Masaru; Kobayashi, Tomoyuki; Tanaka, Tetsuo; Inaka, Koji; Urade, Yoshihiro

    2011-01-01

    Crystals of hematopoietic prostaglandin D synthase grown in microgravity show improved quality. Human hematopoietic prostaglandin synthase, one of the better therapeutic target enzymes for allergy and inflammation, was crystallized with 22 inhibitors and in three inhibitor-free conditions in microgravity. Most of the space-grown crystals showed better X-ray diffraction patterns than the terrestrially grown ones, indicating the advantage of a microgravity environment on protein crystallization, especially in the case of this protein

  20. Isolation and functional characterization of a τ-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia.

    Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis

    2014-01-01

    In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.

  1. Glycogen Synthase Kinase-3β

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...

  2. Crystal structure of riboflavin synthase

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  3. The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

    Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

    2016-01-01

    Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

  4. Pengaruh Pengasapan (Thermal Fogging Insektisida Piretroid (Malation 95% Terhadap Nyamuk Aedes aegypti dan Culex quinquefasciatus di Pemukiman

    Hasan Boesri

    2009-12-01

    Full Text Available The evaluation of piretroid insecticide (active ingredient Malation 95% was con-ducted in Sub district Tengarang, Semarang Segency, Central Java Province. The insecti-cide was applied using thermal fogging method for dosages of 125, 250, 375, 500 and 625 ml/ha (diluted in diesel to 10 litters. The evaluation of the efficacy was conducted against two mosquito species, Aedes aegypti (the main dengue haemorrhagic fever and Culex quinquefasciatus (the urban lymphatic fil-ariasis vector. Result of the evaluation was revealed that dosages of 500 and 625 ml/ha were effective against both tested mosquito species indoor and outdoor.

  5. Endothelial nitric oxide synthase gene polymorphisms associated ...

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  6. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

    1986-01-01

    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  7. Conjugated fatty acids and methane production by rumen microbes when incubated with linseed oil alone or mixed with fish oil and/or malate.

    Li, Xiang Z; Gao, Qing S; Yan, Chang G; Choi, Seong H; Shin, Jong S; Song, Man K

    2015-08-01

    We hypothesized that manipulating metabolism with fish oil and malate as a hydrogen acceptor would affect the biohydrogenation process of α-linolenic acid by rumen microbes. This study was to examine the effect of fish oil and/or malate on the production of conjugated fatty acids and methane (CH4 ) by rumen microbes when incubated with linseed oil. Linseed oil (LO), LO with fish oil (LO-FO), LO with malate (LO-MA), or LO with fish oil and malate (LO-FO-MA) was added to diluted rumen fluid, respectively. The LO-MA and LO-FO-MA increased pH and propionate concentration compared to the other treatments. LO-MA and LO-FO-MA reduced CH4 production compared to LO. LO-MA and LO-FO-MA increased the contents of c9,t11-conjugated linoleic acid (CLA) and c9,t11,c15-conjugated linolenic acid (CLnA) compared to LO. The content of malate was rapidly reduced while that of lactate was reduced in LO-MA and LO-FO-MA from 3 h incubation time. The fold change of the quantity of methanogen related to total bacteria was decreased at both 3 h and 6 h incubation times in all treatments compared to the control. Overall data indicate that supplementation of combined malate and/or fish oil when incubated with linseed oil, could depress methane generation and increase production of propionate, CLA and CLnA under the conditions of the current in vitro study. © 2015 Japanese Society of Animal Science.

  8. Terpene synthases from Cannabis sativa.

    Judith K Booth

    Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  9. Terpene synthases from Cannabis sativa.

    Booth, Judith K; Page, Jonathan E; Bohlmann, Jörg

    2017-01-01

    Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  10. Dynamics of meso and thermo citrate synthases with implicit solvation

    Cordeiro, J. M. M.

    The dynamics of hydration of meso and thermo citrate synthases has been investigated using the EEF1 methodology implemented with the CHARMM program. The native enzymes are composed of two identical subunits, each divided into a small and large domain. The dynamics behavior of both enzymes at 30°C and 60°C has been compared. The results of simulations show that during the hydration process, each subunit follows a different pathway of hydration, in spite of the identical sequence. The hydrated structures were compared with the crystalline structure, and the root mean square deviation (RMSD) of each residue along the trajectory was calculated. The regions with larger and smaller mobility were identified. In particular, helices belonging to the small domain are more mobile than those of the large domain. In contrast, the residues that constitute the active site show a much lower displacement compared with the crystalline structure. Hydration free energy calculations point out that Thermoplasma acidophilum citrate synthase (TCS) is more stable than chicken citrate synthase (CCS), at high temperatures. Such result has been ascribed to the higher number of superficial charges in the thermophilic homologue, which stabilizes the enzyme, while the mesophilic homologue denatures. These results are in accord with the experimental found that TCS keeps activity at temperatures farther apart from the catalysis regular temperature than the CCS.

  11. AtALMT1, which encodes a malate transporter, is identified as one of several genes critical for aluminum tolerance in Arabidopsis

    Hoekenga, Owen A.; Maron, Lyza G.; Piñeros, Miguel A.; Cançado, Geraldo M. A.; Shaff, Jon; Kobayashi, Yuriko; Ryan, Peter R.; Dong, Bei; Delhaize, Emmanuel; Sasaki, Takayuki; Matsumoto, Hideaki; Yamamoto, Yoko; Koyama, Hiroyuki; Kochian, Leon V.

    2006-01-01

    Aluminum (Al) tolerance in Arabidopsis is a genetically complex trait, yet it is mediated by a single physiological mechanism based on Al-activated root malate efflux. We investigated a possible molecular determinant for Al tolerance involving a homolog of the wheat Al-activated malate transporter, ALMT1. This gene, named AtALMT1 (At1g08430), was the best candidate from the 14-memberAtALMT family to be involved with Al tolerance based on expression patterns and genomic location. Physiological...

  12. Ammonium intensifies CAM photosynthesis and counteracts drought effects by increasing malate transport and antioxidant capacity in Guzmania monostachia.

    Pereira, Paula Natália; Gaspar, Marília; Smith, J Andrew C; Mercier, Helenice

    2018-04-09

    Guzmania monostachia (Bromeliaceae) is a tropical epiphyte capable of up-regulating crassulacean acid metabolism (CAM) in its photosynthetic tissues in response to changing nutrient and water availability. Previous studies have shown that under drought there is a gradient of increasing CAM expression from the basal (youngest) to the apical (oldest) portion of the leaves, and additionally that nitrogen deficiency can further increase CAM intensity in the leaf apex of this bromeliad. The present study investigated the inter-relationships between nitrogen source (nitrate and/or ammonium) and water deficit in regulating CAM expression in G. monostachia leaves. The highest CAM activity was observed under ammonium nutrition in combination with water deficit. This was associated with enhanced activity of the key enzyme phosphoenolpyruvate carboxylase, elevated rates of ATP- and PPi-dependent proton transport at the vacuolar membrane in the presence of malate, and increased transcript levels of the vacuolar malate channel-encoding gene, ALMT. Water deficit was consistently associated with higher levels of total soluble sugars, which were maximal under ammonium nutrition, as were the activities of several antioxidant enzymes (superoxide dismutase, catalase, ascorbate peroxidase, and glutathione reductase). Thus, ammonium nutrition, whilst associated with the highest degree of CAM induction in G. monostachia, also mitigates the effects of water deficit by osmotic adjustment and can limit oxidative damage in the leaves of this bromeliad under conditions that may be typical of its epiphytic habitat.

  13. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

    2017-05-01

    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  14. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  15. Mechanism of Action and Inhibition of dehydrosqualene Synthase

    F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield

    2011-12-31

    'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.

  16. Longevity in vivo of primary cell wall cellulose synthases.

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  17. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Abir U Igamberdiev

    2015-01-01

    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  18. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-01-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

  19. The Eucalyptus terpene synthase gene family.

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  20. Posttranscriptional silencing of the lncRNA MALAT1 by miR-217 inhibits the epithelial–mesenchymal transition via enhancer of zeste homolog 2 in the malignant transformation of HBE cells induced by cigarette smoke extract

    Lu, Lu; Luo, Fei; Liu, Yi; Liu, Xinlu; Shi, Le; Lu, Xiaolin; Liu, Qizhan

    2015-01-01

    Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study investigated the effects of an miRNA (miR-217) on levels of an lncRNA (MALAT1) and examined the role of these factors in the epithelial–mesenchymal transition (EMT) induced by cigarette smoke extract (CSE) in human bronchial epithelial (HBE) cells. In these cells, CSE caused decreases of miR-217 levels and increases in lncRNA MALAT1 levels. Over-expression of miR-217 with a mimic attenuated the CSE-induced increase of MALAT1 levels, and reduction of miR-217 levels by an inhibitor enhanced expression of MALAT1. Moreover, the CSE-induced increase of MALAT1 expression was blocked by an miR-217 mimic, indicating that miR-217 negatively regulates MALAT1 expression. Knockdown of MALAT1 reversed CSE-induced increases of EZH2 (enhancer of zeste homolog 2) and H3K27me3 levels. In addition to the alteration from epithelial to spindle-like mesenchymal morphology, chronic exposure of HBE cells to CSE increased the levels of EZH2, H3K27me3, vimentin, and N-cadherin and decreased E-cadherin levels, effects that were reversed by MALAT1 siRNA or EZH2 siRNA. The results indicate that miR-217 regulation of EZH2/H3K27me3 via MALAT1 is involved in CSE-induced EMT and malignant transformation of HBE cells. The posttranscriptional silencing of MALAT1 by miR-217 provides a link, through EZH2, between ncRNAs and the EMT and establishes a mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure decreases miR-217 levels and increases MALAT1 levels. • miR-217 negatively regulates MALAT1 expression. • MALAT1, via EZH2, is involved in the EMT of CSE-transformed HBE cells.

  1. Functional, structural and phylogenetic analysis of domains underlying the Al-sensitivity of the aluminium-activated malate/anion transporter, TaALMT1

    TaALMT1 (Triticum aestivum Aluminum Activated Malate Transporter) is the founding member of a novel gene family of anion transporters (ALMTs) that mediate the efflux of organic acids. A small subgroup of root-localized ALMTs, including TaALMT1, is physiologically associated with in planta aluminum (...

  2. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  3. Combination of long noncoding RNA MALAT1 and carcinoembryonic antigen for the diagnosis of malignant pleural effusion caused by lung cancer.

    Wang, Wan-Wei; Zhou, Xi-Lei; Song, Ying-Jian; Yu, Chang-Hua; Zhu, Wei-Guo; Tong, Yu-Suo

    2018-01-01

    Long noncoding RNAs (lncRNAs) are present in body fluids, but their potential as tumor biomarkers has never been investigated in malignant pleural effusion (MPE) caused by lung cancer. The aim of this study was to assess the clinical significance of lncRNAs in pleural effusion, which could potentially serve as diagnostic and predictive markers for lung cancer-associated MPE (LC-MPE). RNAs from pleural effusion were extracted in 217 cases of LC-MPE and 132 cases of benign pleural effusion (BPE). Thirty-one lung cancer-associated lncRNAs were measured using quantitative real-time polymerase chain reaction (qRT-PCR). The level of carcinoembryonic antigen (CEA) was also determined. The receiver operating characteristic (ROC) curves and the area under the ROC curve (AUC) were established to evaluate the sensitivity and specificity of the identified lncRNAs and other biomarkers. The correlations between baseline pleural effusion lncRNAs expression and response to chemotherapy were also analyzed. Three lncRNAs ( MALAT1 , H19 , and CUDR ) were found to have potential as diagnostic markers in LC-MPE. The AUCs for MALAT1 , H19 , CUDR , and CEA were 0.891, 0.783, 0.824, and 0.826, respectively. Using a logistic model, the combination of MALAT1 and CEA (AUC, 0.924) provided higher sensitivity and accuracy in predicting LC-MPE than CEA (AUC, 0.826) alone. Moreover, baseline MALAT1 expression in pleural fluid was inversely correlated with chemotherapy response in patients with LC-MPE. Pleural effusion lncRNAs were effective in differentiating LC-MPE from BPE. The combination of MALAT1 and CEA was more effective for LC-MPE diagnosis.

  4. The contribution of stored malate and citrate to the substrate requirements of metabolism of ripening peach (Prunus persica L. Batsch) flesh is negligible. Implications for the occurrence of phosphoenolpyruvate carboxykinase and gluconeogenesis.

    Famiani, Franco; Farinelli, Daniela; Moscatello, Stefano; Battistelli, Alberto; Leegood, Richard C; Walker, Robert P

    2016-04-01

    The first aim of this study was to determine the contribution of stored malate and citrate to the substrate requirements of metabolism in the ripening flesh of the peach (Prunus persica L. Batsch) cultivar Adriatica. In the flesh, stored malate accumulated before ripening could contribute little or nothing to the net substrate requirements of metabolism. This was because there was synthesis and not dissimilation of malate throughout ripening. Stored citrate could potentially contribute a very small amount (about 5.8%) of the substrate required by metabolism when the whole ripening period was considered, and a maximum of about 7.5% over the latter part of ripening. The second aim of this study was to investigate why phosphoenolpyruvate carboxykinase (PEPCK) an enzyme utilised in gluconeogenesis from malate and citrate is present in peach flesh. The occurrence and localisation of enzymes utilised in the metabolism of malate, citrate and amino acids were determined in peach flesh throughout its development. Phosphoenolpyruvate carboxylase (essential for the synthesis of malate and citrate) was present in the same cells and at the same time as PEPCK and NADP-malic enzyme (both utilised in the dissimilation of malate and citrate). A hypothesis is presented to explain the presence of these enzymes and to account for the likely occurrence of gluconeogenesis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  5. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  6. Oxaloacetate-to-malate conversion by mineral photoelectrochemistry: implications for the viability of the reductive tricarboxylic acid cycle in prebiotic chemistry

    Guzman, Marcelo I.; Martin, Scot T.

    2008-10-01

    The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.

  7. Sphingomyelin synthases regulate protein trafficking and secretion.

    Marimuthu Subathra

    Full Text Available Sphingomyelin synthases (SMS1 and 2 represent a class of enzymes that transfer a phosphocholine moiety from phosphatidylcholine onto ceramide thus producing sphingomyelin and diacylglycerol (DAG. SMS1 localizes at the Golgi while SMS2 localizes both at the Golgi and the plasma membrane. Previous studies from our laboratory showed that modulation of SMS1 and, to a lesser extent, of SMS2 affected the formation of DAG at the Golgi apparatus. As a consequence, down-regulation of SMS1 and SMS2 reduced the localization of the DAG-binding protein, protein kinase D (PKD, to the Golgi. Since PKD recruitment to the Golgi has been implicated in cellular secretion through the trans golgi network (TGN, the effect of down-regulation of SMSs on TGN-to-plasma membrane trafficking was studied. Down regulation of either SMS1 or SMS2 significantly retarded trafficking of the reporter protein vesicular stomatitis virus G protein tagged with GFP (VSVG-GFP from the TGN to the cell surface. Inhibition of SMSs also induced tubular protrusions from the trans Golgi network reminiscent of inhibited TGN membrane fission. Since a recent study demonstrated the requirement of PKD activity for insulin secretion in beta cells, we tested the function of SMS in this model. Inhibition of SMS significantly reduced insulin secretion in rat INS-1 cells. Taken together these results provide the first direct evidence that both enzymes (SMS1 and 2 are capable of regulating TGN-mediated protein trafficking and secretion, functions that are compatible with PKD being a down-stream target for SMSs in the Golgi.

  8. Cloning and expression of pineapple sucrosephosphate synthase ...

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  9. Endothelial nitric oxide synthase gene polymorphisms associated ...

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  10. Fatty acid synthase inhibitors isolated from Punica granatum L

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)

    2012-05-15

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  11. Fatty acid synthase inhibitors isolated from Punica granatum L

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng

    2012-01-01

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  12. HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

    PORRA, R J; ROSS, B D

    1965-03-01

    1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

  13. Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

    Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

    2016-04-01

    Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Increased and Altered Fragrance of Tobacco Plants after Metabolic Engineering Using Three Monoterpene Synthases from Lemon

    Lücker, Joost; Schwab, Wilfried; van Hautum, Bianca; Blaas, Jan; van der Plas, Linus H. W.; Bouwmeester, Harro J.; Verhoeven, Harrie A.

    2004-01-01

    Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one plant by crossings, we show that it is possible to increase the amount and alter the composition of the blend of monoterpenoids produced in tobacco plants. The transgenic tobacco plant line with the three introduced monoterpene synthases is emitting β-pinene, limonene, and γ-terpinene and a number of side products of the introduced monoterpene synthases, from its leaves and flowers, in addition to the terpenoids emitted by wild-type plants. The results show that there is a sufficiently high level of substrate accessible for the introduced enzymes. PMID:14718674

  15. Isolation, characterization, and mechanistic studies of (-)-alpha-gurjunene synthase from Solidago canadensis.

    Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A

    1999-04-15

    The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.

  16. Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile

    S. Saeidnia

    2014-04-01

    Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.

  17. Identification of a novel CoA synthase isoform, which is primarily expressed in Brain

    Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.

    2006-01-01

    CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation

  18. Effects of acetoacetyl-CoA synthase expression on production of farnesene in Saccharomyces cerevisiae

    Tippmann, Stefan; Ferreira, Raphael; Siewers, Verena

    2017-01-01

    to overcome the thermodynamic constraint imposed on the first reaction, in which acetoacetyl-CoA is produced from two moles of acetyl-CoA by acetoacetyl-CoA thiolase. Recently, a novel acetoacetyl-CoA synthase (nphT7) has been identified from Streptomyces sp. strain CL190, which catalyzes the irreversible...... functionality of the bypass was limited by the efficiency of acetoacetyl-CoA synthase (nphT7). Besides modulation of the expression level, which could be used as a means to partially restore the phenotype, nphT7 from Streptomyces glaucescens showed clearly higher efficiency compared to Streptomyces sp. strain...

  19. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  20. Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure

    Krath, B N; Hove-Jensen, B

    2001-01-01

    Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....

  1. Short-lived long non-coding RNAs as surrogate indicators for chemical exposure and LINC00152 and MALAT1 modulate their neighboring genes.

    Hidenori Tani

    Full Text Available Whole transcriptome analyses have revealed a large number of novel long non-coding RNAs (lncRNAs. Although accumulating evidence demonstrates that lncRNAs play important roles in regulating gene expression, the detailed mechanisms of action of most lncRNAs remain unclear. We previously reported that a novel class of lncRNAs with a short half-life (t1/2 < 4 h in HeLa cells, termed short-lived non-coding transcripts (SLiTs, are closely associated with physiological and pathological functions. In this study, we focused on 26 SLiTs and nuclear-enriched abundant lncRNA, MALAT1(t1/2 of 7.6 h in HeLa cells in neural stem cells (NSCs derived from human induced pluripotent stem cells, and identified four SLiTs (TUG1, GAS5, FAM222-AS1, and SNHG15 that were affected by the following typical chemical stresses (oxidative stress, heavy metal stress and protein synthesis stress. We also found the expression levels of LINC00152 (t1/2 of 2.1 h in NSCs, MALAT1 (t1/2 of 1.8 h in NSCs, and their neighboring genes were elevated proportionally to the chemical doses. Moreover, we confirmed that the overexpression of LINC00152 or MALAT1 upregulated the expressions of their neighboring genes even in the absence of chemical stress. These results reveal that LINC00152 and MALAT1 modulate their neighboring genes, and thus provide a deeper understanding of the functions of lncRNAs.

  2. Aberrant KDM5B expression promotes aggressive breast cancer through MALAT1 overexpression and downregulation of hsa-miR-448

    Bamodu, Oluwaseun Adebayo; Huang, Wen-Chien; Lee, Wei-Hwa; Wu, Alexander; Wang, Liang Shun; Hsiao, Michael; Yeh, Chi-Tai; Chao, Tsu-Yi

    2016-01-01

    Triple negative breast cancers (TNBC) possess cell dedifferentiation characteristics, carry out activities connate to those of cancer stem cells (CSCs) and are associated with increased metastasis, as well as, poor clinical prognosis. The regulatory mechanism of this highly malignant phenotype is still poorly characterized. Accruing evidence support the role of non-coding RNAs (ncRNAs) as potent regulators of CSC and metastatic gene expression, with their dysregulation implicated in tumorigenesis and disease progression. In this study, we investigated TNBC metastasis, metastasis-associated genes and potential inhibitory mechanisms using bioinformatics, tissue microarray analyses, immunoblotting, polymerase chain reaction, loss and gain of gene function assays and comparative analyses of data obtained. Compared with other breast cancer types, the highly metastatic MDA-MB-231 cells concurrently exhibited increased expression levels of Lysine-specific demethylase 5B protein (KDM5B) and long non-coding RNA (lncRNA), MALAT1, suggesting their functional association. KDM5B-silencing in the TNBC cells correlated with the upregulation of hsa-miR-448 and led to suppression of MALAT1 expression with decreased migration, invasion and clonogenic capacity in vitro, as well as, poor survival in vivo. This projects MALAT1 as a mediator of KDM5B oncogenic potential and highlights the critical role of this microRNA, lncRNA and histone demethylase in cancer cell motility and metastatic colonization. Increased expression of KDM5B correlating with disease progression and poor clinical outcome in breast cancer was reversed by hsa-miR-448. Our findings demonstrate the critical role of KDM5B and its negative regulator hsa-miR-448 in TNBC metastasis and progression. Hsa-miR-448 disrupting KDM5B-MALAT1 signalling axis and associated activities in TNBC cells, projects it as a putative therapeutic factor for selective eradication of TNBC cells

  3. Show-Bix &

    2014-01-01

    The anti-reenactment 'Show-Bix &' consists of 5 dias projectors, a dial phone, quintophonic sound, and interactive elements. A responsive interface will enable the Dias projectors to show copies of original dias slides from the Show-Bix piece ”March på Stedet”, 265 images in total. The copies are...

  4. Polyketide synthases from poison hemlock (Conium maculatum L.).

    Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko

    2015-11-01

    Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.

  5. Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

    Roman eGangl

    2015-09-01

    Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

  6. A domain-based approach for analyzing the function of aluminum-activated malate transporters from wheat (Triticum aestivum) and Arabidopsis thaliana in Xenopus oocytes.

    Sasaki, Takayuki; Tsuchiya, Yoshiyuki; Ariyoshi, Michiyo; Ryan, Peter R; Furuichi, Takuya; Yamamoto, Yoko

    2014-12-01

    Wheat and Arabidopsis plants respond to aluminum (Al) ions by releasing malate from their root apices via Al-activated malate transporter. Malate anions bind with the toxic Al ions and contribute to the Al tolerance of these species. The genes encoding the transporters in wheat and Arabidopsis, TaALMT1 and AtALMT1, respectively, were expressed in Xenopus laevis oocytes and characterized electrophysiologically using the two-electrode voltage clamp system. The Al-activated currents generated by malate efflux were detected for TaALMT1 but not for AtALMT1. Chimeric proteins were generated by swapping the N- and C-terminal halves of TaALMT1 and AtALMT1 (Ta::At and At::Ta). When these chimeras were characterized in oocytes, Al-activated malate efflux was detected for the Ta::At chimera but not for At::Ta, suggesting that the N-terminal half of TaALMT1 is necessary for function in oocytes. An additional chimera, Ta(48)::At, generated by swapping 17 residues from the N-terminus of AtALMT1 with the equivalent 48 residues from TaALMT1, was sufficient to support transport activity. This 48 residue region includes a helical region with a putative transmembrane domain which is absent in AtALMT1. The deletion of this domain from Ta(48)::At led to the complete loss of transport activity. Furthermore, truncations and a deletion at the C-terminal end of TaALMT1 indicated that a putative helical structure in this region was also required for transport function. This study provides insights into the structure-function relationships of Al-activated ALMT proteins by identifying specific domains on the N- and C-termini of TaALMT1 that are critical for basal transport function and Al responsiveness in oocytes. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  7. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  8. Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

    Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

    2017-02-01

    Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  9. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  10. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  11. Talking with TV shows

    Sandvik, Kjetil; Laursen, Ditte

    2014-01-01

    User interaction with radio and television programmes is not a new thing. However, with new cross-media production concepts such as X Factor and Voice, this is changing dramatically. The second-screen logic of these productions encourages viewers, along with TV’s traditional one-way communication...... mode, to communicate on interactive (dialogue-enabling) devices such as laptops, smartphones and tablets. Using the TV show Voice as our example, this article shows how the technological and situational set-up of the production invites viewers to engage in new ways of interaction and communication...

  12. Talk Show Science.

    Moore, Mitzi Ruth

    1992-01-01

    Proposes having students perform skits in which they play the roles of the science concepts they are trying to understand. Provides the dialog for a skit in which hot and cold gas molecules are interviewed on a talk show to study how these properties affect wind, rain, and other weather phenomena. (MDH)

  13. Obesity in show cats.

    Corbee, R J

    2014-12-01

    Obesity is an important disease with a high prevalence in cats. Because obesity is related to several other diseases, it is important to identify the population at risk. Several risk factors for obesity have been described in the literature. A higher incidence of obesity in certain cat breeds has been suggested. The aim of this study was to determine whether obesity occurs more often in certain breeds. The second aim was to relate the increased prevalence of obesity in certain breeds to the official standards of that breed. To this end, 268 cats of 22 different breeds investigated by determining their body condition score (BCS) on a nine-point scale by inspection and palpation, at two different cat shows. Overall, 45.5% of the show cats had a BCS > 5, and 4.5% of the show cats had a BCS > 7. There were significant differences between breeds, which could be related to the breed standards. Most overweight and obese cats were in the neutered group. It warrants firm discussions with breeders and cat show judges to come to different interpretations of the standards in order to prevent overweight conditions in certain breeds from being the standard of beauty. Neutering predisposes for obesity and requires early nutritional intervention to prevent obese conditions. Journal of Animal Physiology and Animal Nutrition © 2014 Blackwell Verlag GmbH.

  14. Honored Teacher Shows Commitment.

    Ratte, Kathy

    1987-01-01

    Part of the acceptance speech of the 1985 National Council for the Social Studies Teacher of the Year, this article describes the censorship experience of this honored social studies teacher. The incident involved the showing of a videotape version of the feature film entitled "The Seduction of Joe Tynan." (JDH)

  15. Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

    Berta Alquézar

    2017-08-01

    Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.

  16. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  17. The energy show

    1988-01-01

    The Energy Show is a new look at the problems of world energy, where our supplies come from, now and in the future. The programme looks at how we need energy to maintain our standards of living. Energy supply is shown as the complicated set of problems it is - that Fossil Fuels are both raw materials and energy sources, that some 'alternatives' so readily suggested as practical options are in reality a long way from being effective. (author)

  18. Combined inactivation of the Clostridium cellulolyticum lactate and malate dehydrogenase genes substantially increases ethanol yield from cellulose and switchgrass fermentations

    Li, Yongchao [ORNL; Tschaplinski, Timothy J [ORNL; Engle, Nancy L [ORNL; Hamilton, Choo Yieng [ORNL; Rodriguez, Jr., Miguel [ORNL; Liao, James C [ORNL; Schadt, Christopher Warren [ORNL; Guss, Adam M [ORNL; Yang, Yunfeng [ORNL; Graham, David E [ORNL

    2012-01-01

    Background: The model bacterium Clostridium cellulolyticum efficiently hydrolyzes crystalline cellulose and hemicellulose, using cellulosomes to degrade lignocellulosic biomass. Although it imports and ferments both pentose and hexose sugars to produce a mixture of ethanol, acetate, lactate, H2 and CO2, the proportion of ethanol is low, which impedes its use in consolidated bioprocessing for biofuels. Therefore genetic engineering will likely be required to improve the ethanol yield. Random mutagenesis, plasmid transformation, and heterologous expression systems have previously been developed for C. cellulolyticum, but targeted mutagenesis has not been reported for this organism. Results: The first targeted gene inactivation system was developed for C. cellulolyticum, based on a mobile group II intron originating from the Lactococcus lactis L1.LtrB intron. This markerless mutagenesis system was used to disrupt both the paralogous L-lactate dehydrogenase (Ccel_2485; ldh) and L-malate dehydrogenase (Ccel_0137; mdh) genes, distinguishing the overlapping substrate specificities of these enzymes. Both mutations were then combined in a single strain. This double mutant produced 8.5-times more ethanol than wild-type cells growing on crystalline cellulose. Ethanol constituted 93% of the major fermentation products (by molarity), corresponding to a molar ratio of ethanol to organic acids of 15, versus 0.18 in wild-type cells. During growth on acid-pretreated switchgrass, the double mutant also produced four-times as much ethanol as wild-type cells. Detailed metabolomic analyses identified increased flux through the oxidative branch of the mutant s TCA pathway. Conclusions: The efficient intron-based gene inactivation system produced the first gene-targeted mutations in C. cellulolyticum. As a key component of the genetic toolbox for this bacterium, markerless targeted mutagenesis enables functional genomic research in C. cellulolyticum and rapid genetic engineering to

  19. Cellulose synthases: new insights from crystallography and modeling.

    Slabaugh, Erin; Davis, Jonathan K; Haigler, Candace H; Yingling, Yaroslava G; Zimmer, Jochen

    2014-02-01

    Detailed information about the structure and biochemical mechanisms of cellulose synthase (CelS) proteins remained elusive until a complex containing the catalytic subunit (BcsA) of CelS from Rhodobacter sphaeroides was crystalized. Additionally, a 3D structure of most of the cytosolic domain of a plant CelS (GhCESA1 from cotton, Gossypium hirsutum) was produced by computational modeling. This predicted structure contributes to our understanding of how plant CelS proteins may be similar and different as compared with BcsA. In this review, we highlight how these structures impact our understanding of the synthesis of cellulose and other extracellular polysaccharides. We show how the structures can be used to generate hypotheses for experiments testing mechanisms of glucan synthesis and translocation in plant CelS. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Heme A synthase in bacteria depends on one pair of cysteinyls for activity.

    Lewin, Anna; Hederstedt, Lars

    2016-02-01

    Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer

    Abu-Soud, Husam M.; Stuehr, Dennis J.

    1993-11-01

    Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.

  2. Sequence analysis of cereal sucrose synthase genes and isolation ...

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  3. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  4. Localization of nitric oxide synthase in human skeletal muscle

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...

  5. Showing Value (Editorial

    Denise Koufogiannakis

    2009-06-01

    Full Text Available When Su Cleyle and I first decided to start Evidence Based Library and Information Practice, one of the things we agreed upon immediately was that the journal be open access. We knew that a major obstacle to librarians using the research literature was that they did not have access to the research literature. Although Su and I are both academic librarians who can access a wide variety of library and information literature from our institutions, we belong to a profession where not everyone has equal access to the research in our field. Without such access to our own body of literature, how can we ever hope for practitioners to use research evidence in their decision making? It would have been contradictory to the principles of evidence based library and information practice to do otherwise.One of the specific groups we thought could use such an open access venue for discovering research literature was school librarians. School librarians are often isolated and lacking access to the research literature that may help them prove to stakeholders the importance of their libraries and their role within schools. Certainly, school libraries have been in decline and the use of evidence to show value is needed. As Ken Haycock noted in his 2003 report, The Crisis in Canada’s School Libraries: The Case for Reform and Reinvestment, “Across the country, teacher-librarians are losing their jobs or being reassigned. Collections are becoming depleted owing to budget cuts. Some principals believe that in the age of the Internet and the classroom workstation, the school library is an artifact” (9. Within this context, school librarians are looking to our research literature for evidence of the impact that school library programs have on learning outcomes and student success. They are integrating that evidence into their practice, and reflecting upon what can be improved locally. They are focusing on students and showing the impact of school libraries and

  6. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Carbon isotope composition of intermediates of the starch-malate sequence and level of the crassulacean acid metabolism in leaves of Kalanchoe blossfeldiana Tom Thumb.

    Deleens, E; Garnier-Dardart, J; Queiroz, O

    1979-09-01

    Isotype analyses were performed on biochemical fractions isolated from leaves of Kalanchoe blossfeldiana Tom Thumb. during aging under long days or short days. Irrespective of the age or photoperiodic conditions, the intermediates of the starch-malate sequence (starch, phosphorylated compounds and organic acids) have a level of (13)C higher than that of soluble sugars, cellulose and hemicellulose. In short days, the activity of the crassulacean acid metabolism pathway is predominant as compared to that of C3 pathway: leaves accumulate organic acids, rich in (13)C. In long days, the activity of the crassulacean acid metabolism pathway increases as the leaves age, remaining, however, relatively low as compared to that of C3 pathway: leaves accumulate soluble sugars, poor in (13)C. After photoperiodic change (long days→short days), isotopic modifications of starch and organic acids suggest evidence for a lag phase in the establishment of the crassulacean acid metabolism pathway specific to short days. The relative proportions of carbon from a C3-origin (RuBPC acitivity as strong discriminating step, isotope discrimination in vivo=20‰) or C4-origin (PEPC activity as weak discriminating step, isotope discrimination in vivo=4‰) present in the biochemical fractions were calculated from their δ(13)C values. Under long days, 30 to 70% versus 80 to 100% under short days, of the carbon of the intermediates linked to the starch-malate sequence, or CAM pathway (starch, phosphorylated compounds and organic acids), have a C4-origin. Products connected to the C3 pathway (free sugars, cellulose, hemicellulose) have 0 to 50% of their carbon, arising from reuptake of the C4 from malate, under long days versus 30 to 70% under short days.

  8. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  9. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.

    Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae

    2017-11-15

    Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  10. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

    Mei Lan Jin

    2017-11-01

    Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  11. Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit.

    Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo

    2014-09-01

    Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  13. Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

    Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

    2017-03-01

    This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

  14. Acute citrulline malate supplementation improves upper- and lower-body submaximal weightlifting exercise performance in resistance-trained females.

    Glenn, Jordan M; Gray, Michelle; Wethington, Lauren N; Stone, Matthew S; Stewart, Rodger W; Moyen, Nicole E

    2017-03-01

    Citrulline malate (CM) is a nonessential amino acid that increases exercise performance in males. However, based on physiological differences between genders, these results cannot be extrapolated to females. Therefore, the purpose of this investigation was to evaluate effects of acute CM supplementation on upper- and lower-body weightlifting performance in resistance-trained females. Fifteen females (23 ± 3 years) completed two randomized, double-blind trials consuming either CM (8 g dextrose + 8 g CM) or a placebo (8 g dextrose). One hour after supplement consumption, participants performed six sets each of upper- (i.e., bench press) and lower-body (i.e., leg press) exercises to failure at 80 % of previously established one-repetition maximum. Immediately after each set, repetitions completed, heart rate and rating of perceived exertion (RPE) were recorded. Repeated-measures analysis of variance indicated that subjects completed significantly (p = .045) more repetitions throughout upper-body exercise when consuming CM versus placebo (34.1 ± 5.7 vs. 32.9 ± 6.0, respectively). When consuming CM, similar significant (p = .03) improvements in total repetitions completed were observed for lower-body exercise (66.7 ± 30.5 vs. 55.13 ± 20.64, respectively). Overall RPE score was significantly lower (p = .02) in upper-body exercise when subjects consumed CM versus placebo (7.9 ± 0.3 and 8.6 ± 0.2, respectively). The supplement consumed exhibited no significant effects on heart rate at any time point. Acute CM supplementation in females increased upper- and lower-body resistance exercise performance and decreased RPE during upper-body exercise. These data indicate that athletes competing in sports with muscular endurance-based requirements may potentially improve performance by acutely supplementing CM.

  15. Combined inactivation of the Clostridium cellulolyticum lactate and malate dehydrogenase genes substantially increases ethanol yield from cellulose and switchgrass fermentations

    Li Yongchao

    2012-01-01

    Full Text Available Abstract Background The model bacterium Clostridium cellulolyticum efficiently degrades crystalline cellulose and hemicellulose, using cellulosomes to degrade lignocellulosic biomass. Although it imports and ferments both pentose and hexose sugars to produce a mixture of ethanol, acetate, lactate, H2 and CO2, the proportion of ethanol is low, which impedes its use in consolidated bioprocessing for biofuels production. Therefore genetic engineering will likely be required to improve the ethanol yield. Plasmid transformation, random mutagenesis and heterologous expression systems have previously been developed for C. cellulolyticum, but targeted mutagenesis has not been reported for this organism, hindering genetic engineering. Results The first targeted gene inactivation system was developed for C. cellulolyticum, based on a mobile group II intron originating from the Lactococcus lactis L1.LtrB intron. This markerless mutagenesis system was used to disrupt both the paralogous L-lactate dehydrogenase (Ccel_2485; ldh and L-malate dehydrogenase (Ccel_0137; mdh genes, distinguishing the overlapping substrate specificities of these enzymes. Both mutations were then combined in a single strain, resulting in a substantial shift in fermentation toward ethanol production. This double mutant produced 8.5-times more ethanol than wild-type cells growing on crystalline cellulose. Ethanol constituted 93% of the major fermentation products, corresponding to a molar ratio of ethanol to organic acids of 15, versus 0.18 in wild-type cells. During growth on acid-pretreated switchgrass, the double mutant also produced four times as much ethanol as wild-type cells. Detailed metabolomic analyses identified increased flux through the oxidative branch of the mutant's tricarboxylic acid pathway. Conclusions The efficient intron-based gene inactivation system produced the first non-random, targeted mutations in C. cellulolyticum. As a key component of the genetic toolbox

  16. Glycogen synthase activation by sugars in isolated hepatocytes.

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  17. Crystallization and crystallographic analysis of the ligand-binding domain of the Pseudomonas putida chemoreceptor McpS in complex with malate and succinate

    Gavira, J. A.; Lacal, J.; Ramos, J. L.; García-Ruiz, J. M.; Krell, T.; Pineda-Molina, E.

    2012-01-01

    The crystallization of the ligand-binding domain of the methyl-accepting chemotaxis protein chemoreceptor McpS (McpS-LBD) is reported. Methyl-accepting chemotaxis proteins (MCPs) are transmembrane proteins that sense changes in environmental signals, generating a chemotactic response and regulating other cellular processes. MCPs are composed of two main domains: a ligand-binding domain (LBD) and a cytosolic signalling domain (CSD). Here, the crystallization of the LBD of the chemoreceptor McpS (McpS-LBD) is reported. McpS-LBD is responsible for sensing most of the TCA-cycle intermediates in the soil bacterium Pseudomonas putida KT2440. McpS-LBD was expressed, purified and crystallized in complex with two of its natural ligands (malate and succinate). Crystals were obtained by both the counter-diffusion and the hanging-drop vapour-diffusion techniques after pre-incubation of McpS-LBD with the ligands. The crystals were isomorphous and belonged to space group C2, with two molecules per asymmetric unit. Diffraction data were collected at the ESRF synchrotron X-ray source to resolutions of 1.8 and 1.9 Å for the malate and succinate complexes, respectively

  18. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  19. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  20. Generation and Functional Evaluation of Designer Monoterpene Synthases.

    Srividya, N; Lange, I; Lange, B M

    2016-01-01

    Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.

  1. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

    2010-01-01

    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  2. Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

    Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

    2002-11-01

    In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

  3. Glucose-Modulated Mitochondria Adaptation in Tumor Cells: A Focus on ATP Synthase and Inhibitor Factor 1

    Irene Mavelli

    2012-02-01

    Full Text Available Warburg’s hypothesis has been challenged by a number of studies showing that oxidative phosphorylation is repressed in some tumors, rather than being inactive per se. Thus, treatments able to shift energy metabolism by activating mitochondrial pathways have been suggested as an intriguing basis for the optimization of antitumor strategies. In this study, HepG2 hepatocarcinoma cells were cultivated with different metabolic substrates under conditions mimicking “positive” (activation/biogenesis or “negative” (silencing mitochondrial adaptation. In addition to the expected up-regulation of mitochondrial biogenesis, glucose deprivation caused an increase in phosphorylating respiration and a rise in the expression levels of the ATP synthase β subunit and Inhibitor Factor 1 (IF1. Hyperglycemia, on the other hand, led to a markedly decreased level of the transcriptional coactivator PGC-α suggesting down-regulation of mitochondrial biogenesis, although no change in mitochondrial mass and no impairment of phosphorylating respiration were observed. Moreover, a reduction in mitochondrial networking and in ATP synthase dimer stability was produced. No effect on β-ATP synthase expression was elicited. Notably, hyperglycemia caused an increase in IF1 expression levels, but it did not alter the amount of IF1 associated with ATP synthase. These results point to a new role of IF1 in relation to high glucose utilization by tumor cells, in addition to its well known effect upon mitochondrial ATP synthase regulation.

  4. Cyclic GMP-AMP Synthase is an Innate Immune Sensor of HIV and Other Retroviruses

    Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J.

    2013-01-01

    Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic-GMP-AMP (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type-I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse transcribed HIV DNA triggers the...

  5. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  6. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  7. Synthesis of isoprenoid bisphosphonate ethers through C–P bond formations: Potential inhibitors of geranylgeranyl diphosphate synthase

    Xiang Zhou

    2014-07-01

    Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.

  8. Isolation of developing secondary xylem specific cellulose synthase ...

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

  9. Cloning and expression of pineapple sucrose- phosphate synthase ...

    hope&shola

    2010-12-06

    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

  10. Modulation of hyaluronan synthase activity in cellular membrane fractions

    Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto

    2009-01-01

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...

  11. Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision

    2013-05-01

    acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for

  12. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    2012-05-01

    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  13. Purification of 1-aminocyclopropane-1-carboxylate synthase from apple fruits using s-adenosyl [3,414C]-methionine (SAM) as a probe

    Yip, Wingkip; Dong, Jianguo; Yang, Shang Fa

    1989-01-01

    Tomato ACC synthase is inactivated by its substrate SAM, with the moiety of aminobutyrate being covalently linked to ACC synthase during the catalytic reactions. A partial purified ACC synthase (the catalytic activity 100 μmol/h·mg protein) from pellets of apple extract was incubated with [3,4 14 C] SAM. Only one radioactive peak was revealed in a C-4 reverse phase HPLC and one radioactive band on SDS-PAGE with an M.W. of 48 kDa. Apple ACC synthase in native form is resistant to V8, α-chromtrypsin and carboxylpeptidase A digestion, but effectively inactivated by trypsin and ficin, as demonstrated by both the activity assay and SAM labeling. The radioactive protein cut from the SDS-PAGE was injected to three mice, two of the mice showed responses to the protein in western blot analysis. The antibodies from mice is currently under characterization

  14. Functional loss of two ceramide synthases elicits autophagy-dependent lifespan extension in C. elegans

    Mosbech, Mai-Britt; Kruse, Rikke; Harvald, Eva Bang

    2013-01-01

    Ceramide and its metabolites constitute a diverse group of lipids, which play important roles as structural entities of biological membranes as well as regulators of cellular growth, differentiation, and development. The C. elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2...... that hyl-1;lagr-1 animals display reduced feeding, increased resistance to heat, and reduced reproduction. Collectively, our data suggest that specific sphingolipids produced by different ceramide synthases have opposing roles in determination of C. elegans lifespan. We propose that loss of HYL-1 and LAGR......, and lagr-1. HYL-1 function is required for synthesis of ceramides and sphingolipids containing very long acyl-chains (≥C24), while HYL-2 is required for synthesis of ceramides and sphingolipids containing shorter acyl-chains (≤C22). Here we show that functional loss of HYL-2 decreases lifespan, while loss...

  15. Homocystinuria due to cystathionine beta synthase deficiency

    Rao T

    2008-01-01

    Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.

  16. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  17. Engineering of Ion Sensing by the Cystathionine beta-Synthase Module of the ABC Transporter OpuA

    Mahmood, Nik A. B. N.; Biemans-Oldehinkel, Esther; Poolman, Bert

    2009-01-01

    We have previously shown that the C-terminal cystathionine beta-synthase (CBS) domains of the nucleotide-binding domains of the ABC transporter OpuA, in conjunction with an anionic membrane surface function, act as sensor of internal ionic strength (I(in)). Here, we show that a surface-exposed

  18. Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade

    Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.

    2008-01-01

    Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups

  19. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  1. Structural study and thermodynamic characterization of inhibitor binding to lumazine synthase from Bacillus anthracis

    Morgunova, Ekaterina [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden); Illarionov, Boris; Saller, Sabine [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Popov, Aleksander [European Synchrotron Radiation Facility, BP 220, F-38043 Grenoble CEDEX 09 (France); Sambaiah, Thota [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Bacher, Adelbert [Chemistry Department, Technical University of Munich, 85747 Garching (Germany); Cushman, Mark [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Fischer, Markus [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Ladenstein, Rudolf, E-mail: rudolf.ladenstein@ki.se [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden)

    2010-09-01

    Crystallographic studies of lumazine synthase, the penultimate enzyme of the riboflavin-biosynthetic pathway in B. anthracis, provide a structural framework for the design of antibiotic inhibitors, together with calorimetric and kinetic investigations of inhibitor binding. The crystal structure of lumazine synthase from Bacillus anthracis was solved by molecular replacement and refined to R{sub cryst} = 23.7% (R{sub free} = 28.4%) at a resolution of 3.5 Å. The structure reveals the icosahedral symmetry of the enzyme and specific features of the active site that are unique in comparison with previously determined orthologues. The application of isothermal titration calorimetry in combination with enzyme kinetics showed that three designed pyrimidine derivatives bind to lumazine synthase with micromolar dissociation constants and competitively inhibit the catalytic reaction. Structure-based modelling suggested the binding modes of the inhibitors in the active site and allowed an estimation of the possible contacts formed upon binding. The results provide a structural framework for the design of antibiotics active against B. anthracis.

  2. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  3. Effects of Tributyltin Chloride on Cybrids with or without an ATP Synthase Pathologic Mutation.

    López-Gallardo, Ester; Llobet, Laura; Emperador, Sonia; Montoya, Julio; Ruiz-Pesini, Eduardo

    2016-09-01

    The oxidative phosphorylation system (OXPHOS) includes nuclear chromosome (nDNA)- and mitochondrial DNA (mtDNA)-encoded polypeptides. Many rare OXPHOS disorders, such as striatal necrosis syndromes, are caused by genetic mutations. Despite important advances in sequencing procedures, causative mutations remain undetected in some patients. It is possible that etiologic factors, such as environmental toxins, are the cause of these cases. Indeed, the inhibition of a particular enzyme by a poison could imitate the biochemical effects of pathological mutations in that enzyme. Moreover, environmental factors can modify the penetrance or expressivity of pathological mutations. We studied the interaction between mitochondrially encoded ATP synthase 6 (p.MT-ATP6) subunit and an environmental exposure that may contribute phenotypic differences between healthy individuals and patients suffering from striatal necrosis syndromes or other mitochondriopathies. We analyzed the effects of the ATP synthase inhibitor tributyltin chloride (TBTC), a widely distributed environmental factor that contaminates human food and water, on transmitochondrial cell lines with or without an ATP synthase mutation that causes striatal necrosis syndrome. Doses were selected based on TBTC concentrations previously reported in human whole blood samples. TBTC modified the phenotypic effects caused by a pathological mtDNA mutation. Interestingly, wild-type cells treated with this xenobiotic showed similar bioenergetics when compared with the untreated mutated cells. In addition to the known genetic causes, our findings suggest that environmental exposure to TBTC might contribute to the etiology of striatal necrosis syndromes. López-Gallardo E, Llobet L, Emperador S, Montoya J, Ruiz-Pesini E. 2016. Effects of tributyltin chloride on cybrids with or without an ATP synthase pathologic mutation. Environ Health Perspect 124:1399-1405; http://dx.doi.org/10.1289/EHP182.

  4. Plant oxidosqualene metabolism: cycloartenol synthase-dependent sterol biosynthesis in Nicotiana benthamiana.

    Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert

    2014-01-01

    The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.

  5. ORF Alignment: NC_002755 [GENIUS II[Archive

    Full Text Available 1551] ... pdb|1N8W|B Chain B, Biochemical And Structural Studies ... Of Malate Synthase From Mycobacterium Tuberculosis...al Studies ... Of Malate Synthase From Mycobacterium Tuberculosis ... pdb|1N8I|A Chain A, Bioc...hemical And Structural Studies ... Of Malate Synthase From Mycobacterium Tuberculosis ... emb|

  6. ORF Alignment: NC_000962 [GENIUS II[Archive

    Full Text Available 1551] ... pdb|1N8W|B Chain B, Biochemical And Structural Studies ... Of Malate Synthase From Mycobacterium Tuberculosis...al Studies ... Of Malate Synthase From Mycobacterium Tuberculosis ... pdb|1N8I|A Chain A, Bioc...hemical And Structural Studies ... Of Malate Synthase From Mycobacterium Tuberculosis ... emb|

  7. ORF Alignment: NC_002945 [GENIUS II[Archive

    Full Text Available 1551] ... pdb|1N8W|B Chain B, Biochemical And Structural Studies ... Of Malate Synthase From Mycobacterium Tuberculosis...al Studies ... Of Malate Synthase From Mycobacterium Tuberculosis ... pdb|1N8I|A Chain A, Bioc...hemical And Structural Studies ... Of Malate Synthase From Mycobacterium Tuberculosis ... emb|

  8. Circulation of Pneumocystis dihydropteroate synthase mutants in France.

    Le Gal, Solène; Damiani, Céline; Perrot, Maëla; Rouillé, Amélie; Virmaux, Michèle; Quinio, Dorothée; Moalic, Elodie; Saliou, Philippe; Berthou, Christian; Le Meur, Yann; Totet, Anne; Nevez, Gilles

    2012-10-01

    Data on the prevalence of Pneumocystis jirovecii (P. jirovecii) dihydropteroate synthase (DHPS) mutants in France are still limited. In this study, mutant prevalence in the Brest region (western France) was determined. Archival pulmonary specimens from 85 patients infected with P. jirovecii and admitted to our institution (University Hospital, Brest) from October 2007 to February 2010 were retrospectively typed at the DHPS locus using a polymerase chain reaction-restriction fragment length polymorphism assay. Type identification was successful in 66 of 85 patients. Sixty-four patients were infected with a wild type, whereas mutants were found in 2 patients (2/66, 3%). Medical chart analysis revealed that these 2 patients usually lived in Paris. Another patient usually lived on the French Riviera, whereas 63 patients were from the city of Brest. Thus, the corrected prevalence of mutants in patients who effectively lived in our geographic area was 0% (0/63). Taking into account that i) Paris is characterized by a high prevalence of mutants from 18.5% to 40%, ii) infection diagnoses were performed in the 2 Parisians during their vacation Paris to Brest through infected vacationers. The study shows that the usual city of patient residence, rather than the city of infection diagnosis, is a predictor of mutants and that P. jirovecii infections involving mutants do not represent a public health issue in western France. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Library of Norcoclaurine Synthases and Their Immobilization for Biocatalytic Transformations.

    Lechner, Horst; Soriano, Pablo; Poschner, Roman; Hailes, Helen C; Ward, John M; Kroutil, Wolfgang

    2018-03-01

    Norcoclaurine synthases (NCS), catalyzing a Pictet-Spengler reaction in plants as one of the first enzymes in the biosynthetic benzylisoquinoline pathway, are investigated for biocatalytic transformations. The library of NCS available is extended by two novel NCSs from Argemone mexicana (AmNCS1, AmNCS2) and one new NCS from Corydalis saxicola (CsNCS); furthermore, it is shown that the NCS from Papaver bracteatum (PbNCS) is a highly productive catalyst leading to the isoquinoline product with up to >99% e.e. Under certain conditions lyophilized whole Escherichia coli cells containing the various overexpressed NCS turned out to be suitable catalysts. The reaction using dopamine as substrate bears several challenges such as the spontaneous non-stereoselective background reaction and side reactions. The PbNCS enzyme is successfully immobilized on various carriers whereby EziG3 proved to be the best suited for biotransformations. Dopamine showed limited stability in solution resulting in the coating of the catalyst over time, which could be solved by the addition of ascorbic acid (e.g., 1 mg ml -1 ) as antioxidant. © 2017 The Authors. Biotechnology Journal Published by Wiley-VCH Verlag GmbH &Co. KGaA.

  10. Identification and Functional Characterization of Sesquiterpene Synthases from Xanthium strumarium.

    Li, Yuanjun; Chen, Fangfang; Li, Zhenqiu; Li, Changfu; Zhang, Yansheng

    2016-03-01

    Xanthium strumarium synthesizes various pharmacologically active sesquiterpenes. The molecular characterization of sesquiterpene biosynthesis in X. strumarium has not been reported so far. In this study, the cDNAs coding for three sesquiterpene synthases (designated as XsTPS1, XsTPS2 and XsTPS3) were isolated using the X. strumarium transcriptome that we recently constructed. XsTPS1, XsTPS2 and XsTPS3 were revealed to have primary activities forming germacrene D, guaia-4,6-diene and germacrene A, respectively, by either ectopic expression in yeast cells or purified recombinant protein-based in vitro assays. Quantitative real-time PCRs and metabolite analysis for the different plant parts showed that the transcript abundance of XsTPS1-XsTPS3 is consistent with the accumulation pattern of their enzymatic products, supporting their biochemical functions in vivo. In particular, we discovered that none of the XsTPS2 product, guaia-4,6-diene, can be detected in one of the X. strumarium cultivars used in this study (it was named the Hubei-cultivar), in which a natural deletion of two A bases in the XsTPS2 cDNA disrupts its activity, which further confirmed the proposed biochemical role of XsTPS2 in X. strumarium in vivo. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  11. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Vinciane Régnier

    Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  12. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Régnier, Vinciane; Billard, Jean-Marie; Gupta, Sapna; Potier, Brigitte; Woerner, Stéphanie; Paly, Evelyne; Ledru, Aurélie; David, Sabrina; Luilier, Sabrina; Bizot, Jean-Charles; Vacano, Guido; Kraus, Jan P; Patterson, David; Kruger, Warren D; Delabar, Jean M; London, Jaqueline

    2012-01-01

    The cystathionine β-synthase (CBS) gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS) cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA) metabolism, a pathway important for several brain physiological processes. Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1) expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line. We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  13. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  14. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  15. Ceramide synthases expression and role of ceramide synthase-2 in the lung: insight from human lung cells and mouse models.

    Irina Petrache

    Full Text Available Increases in ceramide levels have been implicated in the pathogenesis of both acute or chronic lung injury models. However, the role of individual ceramide species, or of the enzymes that are responsible for their synthesis, in lung health and disease has not been clarified. We now show that C24- and C16-ceramides are the most abundant lung ceramide species, paralleled by high expression of their synthetic enzymes, ceramide synthase 2 (CerS2 and CerS5, respectively. Furthermore, the ceramide species synthesis in the lung is homeostatically regulated, since mice lacking very long acyl chain C24-ceramides due to genetic deficiency of CerS2 displayed a ten-fold increase in C16-ceramides and C16-dihydroceramides along with elevation of acid sphingomyelinase and CerS5 activities. Despite relatively preserved total lung ceramide levels, inhibition of de novo sphingolipid synthesis at the level of CerS2 was associated with significant airflow obstruction, airway inflammation, and increased lung volumes. Our results suggest that ceramide species homeostasis is crucial for lung health and that CerS2 dysfunction may predispose to inflammatory airway and airspace diseases.

  16. Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases

    Saito Koji

    2005-08-01

    Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1

  17. Chitin synthases from Saprolegnia are involved in tip growth and represent a potential target for anti-oomycete drugs.

    Gea Guerriero

    Full Text Available Oomycetes represent some of the most devastating plant and animal pathogens. Typical examples are Phytophthora infestans, which causes potato and tomato late blight, and Saprolegnia parasitica, responsible for fish diseases. Despite the economical and environmental importance of oomycete diseases, their control is difficult, particularly in the aquaculture industry. Carbohydrate synthases are vital for hyphal growth and represent interesting targets for tackling the pathogens. The existence of 2 different chitin synthase genes (SmChs1 and SmChs2 in Saprolegnia monoica was demonstrated using bioinformatics and molecular biology approaches. The function of SmCHS2 was unequivocally demonstrated by showing its catalytic activity in vitro after expression in Pichia pastoris. The recombinant SmCHS1 protein did not exhibit any activity in vitro, suggesting that it requires other partners or effectors to be active, or that it is involved in a different process than chitin biosynthesis. Both proteins contained N-terminal Microtubule Interacting and Trafficking domains, which have never been reported in any other known carbohydrate synthases. These domains are involved in protein recycling by endocytosis. Enzyme kinetics revealed that Saprolegnia chitin synthases are competitively inhibited by nikkomycin Z and quantitative PCR showed that their expression is higher in presence of the inhibitor. The use of nikkomycin Z combined with microscopy showed that chitin synthases are active essentially at the hyphal tips, which burst in the presence of the inhibitor, leading to cell death. S. parasitica was more sensitive to nikkomycin Z than S. monoica. In conclusion, chitin synthases with species-specific characteristics are involved in tip growth in Saprolegnia species and chitin is vital for the micro-organisms despite its very low abundance in the cell walls. Chitin is most likely synthesized transiently at the apex of the cells before cellulose, the major

  18. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  19. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  20. Crystallization of the c[subscript 14]-rotor of the chloroplast ATP synthase reveals that it contains pigments

    Varco-Merth, Benjamin; Fromme, Raimund; Wang, Meitian; Fromme, Petra (AZU)

    2008-08-27

    The ATP synthase is one of the most important enzymes on earth as it couples the transmembrane electrochemical potential of protons to the synthesis of ATP from ADP and inorganic phosphage, providing the main ATP source of almost all higher life on earth. During ATP synthesis, stepwise protonation of a conserved carboxylate on each protein subunit of an oligomeric ring of 10--15 c-subunits is commonly thought to drive rotation of the rotor moiety (c{sub 10-14}{gamma}{sup {epsilon}}) relative to stator moiety ({alpha}{sub 3}{beta}{sub 3}{delta}ab{sub 2}). Here we report the isolation and crystallization of the c{sub 14}-ring of subunit c from the spinach chloroplast enzyme diffracting as far as 2.8 {angstrom}. Though ATP synthase was not previously know to contain any pigments, the crystals of the c-subunit possessed a strong yellow color. The pigment analysis revaled that they contain 1 chlorophyll and 2 carotenoids, thereby showing for the first time that the chloroplast ATP synthase contains cofactors, leading to the question of the possible roles of the functions of the pigments in the chloroplast ATP synthase.

  1. ATP Synthase Deficiency due to TMEM70 Mutation Leads to Ultrastructural Mitochondrial Degeneration and Is Amenable to Treatment

    Anne K. Braczynski

    2015-01-01

    Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.

  2. The Regulation of Nitric Oxide Synthase Isoform Expression in Mouse and Human Fallopian Tubes: Potential Insights for Ectopic Pregnancy

    Junting Hu

    2014-12-01

    Full Text Available Nitric oxide (NO is highly unstable and has a half-life of seconds in buffer solutions. It is synthesized by NO-synthase (NOS, which has been found to exist in the following three isoforms: neuro nitric oxide synthase (nNOS, inducible nitric oxide synthase (iNOS, and endothelial nitric oxide synthase (eNOS. NOS activity is localized in the reproductive tracts of many species, although direct evidence for NOS isoforms in the Fallopian tubes of mice is still lacking. In the present study, we investigated the expression and regulation of NOS isoforms in the mouse and human Fallopian tubes during the estrous and menstrual cycles, respectively. We also measured isoform expression in humans with ectopic pregnancy and in mice treated with lipopolysaccharide (LPS. Our results confirmed the presence of different NOS isoforms in the mouse and human Fallopian tubes during different stages of the estrous and menstrual cycles and showed that iNOS expression increased in the Fallopian tubes of women with ectopic pregnancy and in LPS-treated mice. Elevated iNOS activity might influence ovulation, cilia beats, contractility, and embryo transportation in such a manner as to increase the risk of ectopic pregnancy. This study has provided morphological and molecular evidence that NOS isoforms are present and active in the human and mouse Fallopian tubes and suggests that iNOS might play an important role in both the reproductive cycle and infection-induced ectopic pregnancies.

  3. Nitric oxide synthase-3 promotes embryonic development of atrioventricular valves.

    Yin Liu

    Full Text Available Nitric oxide synthase-3 (NOS3 has recently been shown to promote endothelial-to-mesenchymal transition (EndMT in the developing atrioventricular (AV canal. The present study was aimed to investigate the role of NOS3 in embryonic development of AV valves. We hypothesized that NOS3 promotes embryonic development of AV valves via EndMT. To test this hypothesis, morphological and functional analysis of AV valves were performed in wild-type (WT and NOS3(-/- mice at postnatal day 0. Our data show that the overall size and length of mitral and tricuspid valves were decreased in NOS3(-/- compared with WT mice. Echocardiographic assessment showed significant regurgitation of mitral and tricuspid valves during systole in NOS3(-/- mice. These phenotypes were all rescued by cardiac specific NOS3 overexpression. To assess EndMT, immunostaining of Snail1 was performed in the embryonic heart. Both total mesenchymal and Snail1(+ cells in the AV cushion were decreased in NOS3(-/- compared with WT mice at E10.5 and E12.5, which was completely restored by cardiac specific NOS3 overexpression. In cultured embryonic hearts, NOS3 promoted transforming growth factor (TGFβ, bone morphogenetic protein (BMP2 and Snail1expression through cGMP. Furthermore, mesenchymal cell formation and migration from cultured AV cushion explants were decreased in the NOS3(-/- compared with WT mice. We conclude that NOS3 promotes AV valve formation during embryonic heart development and deficiency in NOS3 results in AV valve insufficiency.

  4. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  5. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  6. Functional identification of a Lippia dulcis bornyl diphosphate synthase that contains a duplicated, inhibitory arginine-rich motif.

    Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun

    2017-08-26

    Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase

    Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)

    2011-09-20

    The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.

  8. Protein kinase Cα phosphorylates a novel argininosuccinate synthase site at serine 328 during calcium-dependent stimulation of endothelial nitric-oxide synthase in vascular endothelial cells.

    Haines, Ricci J; Corbin, Karen D; Pendleton, Laura C; Eichler, Duane C

    2012-07-27

    Endothelial nitric-oxide synthase (eNOS) utilizes l-arginine as its principal substrate, converting it to l-citrulline and nitric oxide (NO). l-Citrulline is recycled to l-arginine by two enzymes, argininosuccinate synthase (AS) and argininosuccinate lyase, providing the substrate arginine for eNOS and NO production in endothelial cells. Together, these three enzymes, eNOS, AS, and argininosuccinate lyase, make up the citrulline-NO cycle. Although AS catalyzes the rate-limiting step in NO production, little is known about the regulation of AS in endothelial cells beyond the level of transcription. In this study, we showed that AS Ser-328 phosphorylation was coordinately regulated with eNOS Ser-1179 phosphorylation when bovine aortic endothelial cells were stimulated by either a calcium ionophore or thapsigargin to produce NO. Furthermore, using in vitro kinase assay, kinase inhibition studies, as well as protein kinase Cα (PKCα) knockdown experiments, we demonstrate that the calcium-dependent phosphorylation of AS Ser-328 is mediated by PKCα. Collectively, these findings suggest that phosphorylation of AS at Ser-328 is regulated in accordance with the calcium-dependent regulation of eNOS under conditions that promote NO production and are in keeping with the rate-limiting role of AS in the citrulline-NO cycle of vascular endothelial cells.

  9. p63 promotes cell survival through fatty acid synthase.

    Venkata Sabbisetti

    2009-06-01

    Full Text Available There is increasing evidence that p63, and specifically DeltaNp63, plays a central role in both development and tumorigenesis by promoting epithelial cell survival. However, few studies have addressed the molecular mechanisms through which such important function is exerted. Fatty acid synthase (FASN, a key enzyme that synthesizes long-chain fatty acids and is involved in both embryogenesis and cancer, has been recently proposed as a direct target of p53 family members, including p63 and p73. Here we show that knockdown of either total or DeltaN-specific p63 isoforms in squamous cell carcinoma (SCC9 or immortalized prostate epithelial (iPrEC cells caused a decrease in cell viability by inducing apoptosis without affecting the cell cycle. p63 silencing significantly reduced both the expression and the activity of FASN. Importantly, stable overexpression of either FASN or myristoylated AKT (myr-AKT was able to partially rescue cells from cell death induced by p63 silencing. FASN induced AKT phosphorylation and a significant reduction in cell viability was observed when FASN-overexpressing SCC9 cells were treated with an AKT inhibitor after p63 knockdown, indicating that AKT plays a major role in FASN-mediated survival. Activated AKT did not cause any alteration in the FASN protein levels but induced its activity, suggesting that the rescue from apoptosis documented in the p63-silenced cells expressing myr-AKT cells may be partially mediated by FASN. Finally, we demonstrated that p63 and FASN expression are positively associated in clinical squamous cell carcinoma samples as well as in the developing prostate. Taken together, our findings demonstrate that FASN is a functionally relevant target of p63 and is required for mediating its pro-survival effects.

  10. Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila

    Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.

    The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are

  11. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  12. Studies on the Active Site of Deacetoxycephalosporin C Synthase

    Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama

    1999-01-01

    The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of

  13. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  14. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....

  15. Endothelial nitric oxide synthase polymorphism G298T in ...

    Supplementary data: Endothelial nitric oxide synthase polymorphism G298T in association with oxidative DNA damage in coronary atherosclerosis. Rajesh G. Kumar, Mrudula K. Spurthi, Kishore G. Kumar, Sanjib K. Sahu and Surekha H. Rani. J. Genet. 91, 349–352. Table 1. The demographic and clinical data of the CHD ...

  16. ATP synthase--a marvellous rotary engine of the cell.

    Yoshida, M; Muneyuki, E; Hisabori, T

    2001-09-01

    ATP synthase can be thought of as a complex of two motors--the ATP-driven F1 motor and the proton-driven Fo motor--that rotate in opposite directions. The mechanisms by which rotation and catalysis are coupled in the working enzyme are now being unravelled on a molecular scale.

  17. Contribution of granule bound starch synthase in kernel modification ...

    The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...

  18. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  19. Analysis of genetic variation of inducible nitric oxide synthase and ...

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  20. Characterising the cellulose synthase complexes of cell walls

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  1. Molecular cloning and characterization of strictosidine synthase, a ...

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  2. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Chronic nitric oxide synthase inhibition exacerbates renal dysfunction in cirrhotic rats

    Graebe, M.; Brond, L.; Christensen, S.

    2004-01-01

    The present study investigated sodium balance and renal tubular function in cirrhotic rats with chronic blockade of the nitric oxide (NO) system. Rats were treated with the nonselective NO synthase inhibitor NG-nitro-l-arginine methyl ester (l-NAME) starting on the day of common bile duct ligation...... (CBL). Three weeks of daily sodium balance studies showed that CBL rats developed sodium retention compared with sham-operated rats and that l-NAME treatment dose dependently deteriorated cumulative sodium balance by reducing urinary sodium excretion. Five weeks after CBL, renal clearance studies were...

  4. Common catabolic enzyme patterns in a microplankton community of the Humboldt Current System off northern and central-south Chile: Malate dehydrogenase activity as an index of water-column metabolism in an oxygen minimum zone

    González, R. R.; Quiñones, R. A.

    2009-07-01

    An extensive subsurface oxygen minimum zone off northern and central-south Chile, associated with the Peru-Chile undercurrent, has important effects on the metabolism of the organisms inhabiting therein. Planktonic species deal with the hypoxic and anoxic environments by relying on biochemical as well as physiological processes related to their anaerobic metabolisms. Here we characterize, for the first time, the potential enzymatic activities involved in the aerobic and anaerobic energy production pathways of microplanktonic organisms (oxygen concentration and microplanktonic biomass in the oxygen minimum zone and adjacent areas of the Humboldt Current System water column. Our results demonstrate significant potential enzymatic activity of catabolic pathways in the oxygen minimum zone. Malate dehydrogenase had the highest oxidizing activity of nicotinamide adenine dinucleotide (reduced form) in the batch of catabolic enzymatic activities assayed, including potential pyruvate oxidoreductases activity, the electron transport system, and dissimilatory nitrate reductase. Malate dehydrogenase correlated significantly with almost all the enzymes analyzed within and above the oxygen minimum zone, and also with the oxygen concentration and microplankton biomass in the water column of the Humboldt Current System, especially in the oxygen minimum zone off Iquique. These results suggest a possible specific pattern for the catabolic activity of the microplanktonic realm associated with the oxygen minimum zone spread along the Humboldt Current System off Chile. We hypothesize that malate dehydrogenase activity could be an appropriate indicator of microplankton catabolism in the oxygen minimum zone and adjacent areas.

  5. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  6. Bifunctional activity of deoxyhypusine synthase/hydroxylase from Trichomonas vaginalis.

    Quintas-Granados, Laura Itzel; Carvajal Gamez, Bertha Isabel; Villalpando, Jose Luis; Ortega-Lopez, Jaime; Arroyo, Rossana; Azuara-Liceaga, Elisa; Álvarez-Sánchez, María Elizbeth

    2016-04-01

    The Trichomonas vaginalis genome analysis suggested the presence of a putative deoxyhypusine synthase (TvDHS) that catalyzes the posttranslational modification of eIF-5A. Herein, we expressed and purified the recombinant TvDHS (rTvDHS) protein (43 kDa) and the recombinant TveIF-5A (rTveIF-5A) precursor protein (46 kDa). A 41 kDa band of the native TvDHS was recognized by western blot analysis in T. vaginalis total protein extract by a mouse polyclonal anti-rTvDHS antibody. The enzymatic activity of rTvDHS was determined by in vitro rTveIF-5A precursor modification. The modification reaction was performed by using ((3)H)-spermidine, and the biochemical analysis showed that rTvDHS exhibited Km value of 0.6 μM. The rTvDHS activity was inhibited by the spermidine analog, N″-guanyl-1,7-diamino-heptane (GC7). Native gel electrophoresis analysis showed two bands corresponding to an rTvDHS-rTveIF-5A complex and an intermediate form of rTveIF-5A. The two forms were subsequently separated by ion exchange chromatography to identify the hypusine residue by MS/MS analysis. Moreover, mutations in TvDHS showed that the putative HE motif present in this enzyme is involved in the hydroxylation of TveIF-5A. We observed that only hypusine-containing TveIF-5A was bound to an RNA hairpin ERE structure from the cox-2 gene, which contains the AAAUGUCACAC consensus sequence. Interestingly, 2DE-WB assays, using parasites that were grown in DAB-culture conditions and transferred to exogenous putrescine, showed the new isoform of TveIF-5A. In summary, our results indicate that T. vaginalis contains an active TvDHS capable of modifying the precursor TveIF-5A protein, which subsequently exhibits RNA binding activity. Copyright © 2015. Published by Elsevier B.V.

  7. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  8. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  9. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  10. Eckmaxol, a Phlorotannin Extracted from Ecklonia maxima, Produces Anti-β-amyloid Oligomer Neuroprotective Effects Possibly via Directly Acting on Glycogen Synthase Kinase 3β.

    Wang, Jialing; Zheng, Jiachen; Huang, Chunhui; Zhao, Jiaying; Lin, Jiajia; Zhou, Xuezhen; Naman, C Benjamin; Wang, Ning; Gerwick, William H; Wang, Qinwen; Yan, Xiaojun; Cui, Wei; He, Shan

    2018-04-10

    Alzheimer's disease is a progressive neurodegenerative disorder that mainly affects the elderly. Soluble β-amyloid oligomer, which can induce neurotoxicity, is generally regarded as the main neurotoxin in Alzheimer's disease. Here we report that eckmaxol, a phlorotannin extracted from the brown alga Ecklonia maxima, could produce neuroprotective effects in SH-SY5Y cells. Eckmaxol effectively prevented but did not rescue β-amyloid oligomer-induced neuronal apoptosis and increase of intracellular reactive oxygen species. Eckmaxol also significantly reversed the decreased expression of phospho-Ser9-glycogen synthase kinase 3β and increased expression of phospho-extracellular signal-regulated kinase, which was induced by Aβ oligomer. Moreover, both glycogen synthase kinase 3β and mitogen activated protein kinase inhibitors produced neuroprotective effects in SH-SY5Y cells. Furthermore, eckmaxol showed favorable interaction in the ATP binding site of glycogen synthase kinase 3β and mitogen activated protein kinase. These results suggested that eckmaxol might produce neuroprotective effects via concurrent inhibition of glycogen synthase kinase 3β and extracellular signal-regulated kinase pathways, possibly via directly acting on glycogen synthase kinase 3β and mitogen activated protein kinase. Based on the central role that β-amyloid oligomers play in the pathogenesis of Alzheimer's disease and the high annual production of Ecklonia maxima for alginate and other nutritional ingredients, this report represents a new candidate for the treatment of Alzheimer's disease, and also expands the potential application of Ecklonia maxima and its constituents in the field of pharmacology.

  11. Yeast Cells Lacking the CIT1-encoded Mitochondrial Citrate Synthase Are Hypersusceptible to Heat- or Aging-induced Apoptosis

    Lee, Yong Joo; Hoe, Kwang Lae; Maeng, Pil Jae

    2007-01-01

    In Saccharomyces cerevisiae, the initial reaction of the tricarboxylic acid cycle is catalyzed by the mitochondrial citrate synthase Cit1. The function of Cit1 has previously been studied mainly in terms of acetate utilization and metabolon construction. Here, we report the relationship between the function of Cit1 and apoptosis. Yeast cells with cit1 deletion showed a temperature-sensitive growth phenotype, and they displayed a rapid loss in viability associated with typical apoptotic hallma...

  12. Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.

    Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François

    2018-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.

  13. Trichothecenes induce accumulation of glucosylceramide in neural cells by interfering with lactosylceramide synthase activity

    Kralj, Ana; Gurgui, Mihaela; Koenig, Gabriele M.; Echten-Deckert, Gerhild van

    2007-01-01

    Trichothecenes are sesquiterpenoid metabolites produced by several fungal strains that impair human and animal health. Since sphingolipids were connected with fungal toxicity the aim of the present study was to test the influence of fungal metabolites on sphingolipid metabolism in neural cells. The crude extract of fungal strain Spicellum roseum induced accumulation of glucosylceramide (GlcCer), and simultaneous reduction of the formation of lactosylceramide (LacCer) and complex gangliosides in primary cultured neurons. Following a bioassay-guided fractionation of the respective fungal extract we could demonstrate that the two isolated trichothecene derivatives, 8-deoxy-trichothecin (8-dT) and trichodermol (Td-ol) were responsible for this effect. Thus, incubation of primary cultured neurons as well as of neuroblastoma B104 cells for 24 h with 30 μM of either of the two fungal metabolites resulted in uncoupling of sphingolipid biosynthesis at the level of LacCer. For the observed reduction of LacCer synthase activity by about 90% cell integrity was crucial in both cell types. In neuroblastoma cells the amount of LacCer synthase mRNA was reduced in the presence of trichothecenes, whereas in primary cultured neurons this was not the case, suggesting a post-transcriptional mechanism of action in the latter cell type. The data also show that the compounds did not interfere with the translocation of GlcCer in neuroblastoma cells. Collectively, our results demonstrate that trichodermol and 8-deoxy-trichothecin inhibit LacCer synthase activity in a cell-type-specific manner

  14. Risk Aversion in Game Shows

    Andersen, Steffen; Harrison, Glenn W.; Lau, Morten I.

    2008-01-01

    We review the use of behavior from television game shows to infer risk attitudes. These shows provide evidence when contestants are making decisions over very large stakes, and in a replicated, structured way. Inferences are generally confounded by the subjective assessment of skill in some games......, and the dynamic nature of the task in most games. We consider the game shows Card Sharks, Jeopardy!, Lingo, and finally Deal Or No Deal. We provide a detailed case study of the analyses of Deal Or No Deal, since it is suitable for inference about risk attitudes and has attracted considerable attention....

  15. Measuring performance at trade shows

    Hansen, Kåre

    2004-01-01

    Trade shows is an increasingly important marketing activity to many companies, but current measures of trade show performance do not adequately capture dimensions important to exhibitors. Based on the marketing literature's outcome and behavior-based control system taxonomy, a model is built...... that captures a outcome-based sales dimension and four behavior-based dimensions (i.e. information-gathering, relationship building, image building, and motivation activities). A 16-item instrument is developed for assessing exhibitors perceptions of their trade show performance. The paper presents evidence...

  16. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  17. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

    Xiang, Lin; Zhao, Kaige; Chen, Longqing

    2010-01-01

    Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  18. Lithium chloride ameliorates learning and memory ability and inhibits glycogen synthase kinase-3 beta activity in a mouse model of fragile X syndrome

    Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi

    2011-01-01

    In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.

  19. A high-performance liquid chromatography-based radiometric assay for sucrose-phosphate synthase and other UDP-glucose requiring enzymes

    Salvucci, M.E.; Crafts-Brandner, S.J.

    1991-01-01

    A method for product analysis that eliminates a problematic step in the radiometric sucrose-phosphate synthase assay is described. The method uses chromatography on a boronate-derivatized high-performance liquid chromatography column to separate the labeled product, [14C]sucrose phosphate, from unreacted uridine 5'-diphosphate-[14C]glucose (UDP-Glc). Direct separation of these compounds eliminates the need for treatment of the reaction mixtures with alkaline phosphatase, thereby avoiding the problem of high background caused by contaminating phosphodiesterase activity in alkaline phosphatase preparations. The method presented in this paper can be applied to many UDP-Glc requiring enzymes; here the authors show its use for determining the activities of sucrose-phosphate synthase, sucrose synthase, and uridine diphosphate-glucose pyrophosphorylase in plant extracts

  20. Novel protein–protein interaction between spermidine synthase and S-adenosylmethionine decarboxylase from Leishmania donovani

    Mishra, Arjun K.; Agnihotri, Pragati; Srivastava, Vijay Kumar; Pratap, J. Venkatesh, E-mail: jvpratap@cdri.res.in

    2015-01-09

    Highlights: • L. donovani spermidine synthase and S-adenosylmethionine decarboxylase have been cloned and purified. • S-adenosylmethionine decarboxylase has autocatalytic property. • GST pull down assay shows the two proteins to form a metabolon. • Isothermal titration calorimetry shows that binding was exothermic having K{sub d} value of 0.4 μM. • Interaction confirmed by fluorescence spectroscopy and size exclusion chromatography. - Abstract: Polyamine biosynthesis pathway has long been considered an essential drug target for trypanosomatids including Leishmania. S-adenosylmethionine decarboxylase (AdoMetDc) and spermidine synthase (SpdSyn) are enzymes of this pathway that catalyze successive steps, with the product of the former, decarboxylated S-adenosylmethionine (dcSAM), acting as an aminopropyl donor for the latter enzyme. Here we have explored the possibility of and identified the protein–protein interaction between SpdSyn and AdoMetDc. The protein–protein interaction has been identified using GST pull down assay. Isothermal titration calorimetry reveals that the interaction is thermodynamically favorable. Fluorescence spectroscopy studies also confirms the interaction, with SpdSyn exhibiting a change in tertiary structure with increasing concentrations of AdoMetDc. Size exclusion chromatography suggests the presence of the complex as a hetero-oligomer. Taken together, these results suggest that the enzymes indeed form a heteromer. Computational analyses suggest that this complex differs significantly from the corresponding human complex, implying that this complex could be a better therapeutic target than the individual enzymes.

  1. In vitro biochemical characterization of all barley endosperm starch synthases

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...

  2. ATP Synthase, a Target for Dementia and Aging?

    Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R

    2018-02-01

    Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.

  3. A natural mutation-led truncation in one of the two aluminum-activated malate transporter-like genes at the Ma locus is associated with low fruit acidity in apple.

    Bai, Yang; Dougherty, Laura; Li, Mingjun; Fazio, Gennaro; Cheng, Lailiang; Xu, Kenong

    2012-08-01

    Acidity levels greatly affect the taste and flavor of fruit, and consequently its market value. In mature apple fruit, malic acid is the predominant organic acid. Several studies have confirmed that the major quantitative trait locus Ma largely controls the variation of fruit acidity levels. The Ma locus has recently been defined in a region of 150 kb that contains 44 predicted genes on chromosome 16 in the Golden Delicious genome. In this study, we identified two aluminum-activated malate transporter-like genes, designated Ma1 and Ma2, as strong candidates of Ma by narrowing down the Ma locus to 65-82 kb containing 12-19 predicted genes depending on the haplotypes. The Ma haplotypes were determined by sequencing two bacterial artificial chromosome clones from G.41 (an apple rootstock of genotype Mama) that cover the two distinct haplotypes at the Ma locus. Gene expression profiling in 18 apple germplasm accessions suggested that Ma1 is the major determinant at the Ma locus controlling fruit acidity as Ma1 is expressed at a much higher level than Ma2 and the Ma1 expression is significantly correlated with fruit titratable acidity (R (2) = 0.4543, P = 0.0021). In the coding sequences of low acidity alleles of Ma1 and Ma2, sequence variations at the amino acid level between Golden Delicious and G.41 were not detected. But the alleles for high acidity vary considerably between the two genotypes. The low acidity allele of Ma1, Ma1-1455A, is mainly characterized by a mutation at base 1455 in the open reading frame. The mutation leads to a premature stop codon that truncates the carboxyl terminus of Ma1-1455A by 84 amino acids compared with Ma1-1455G. A survey of 29 apple germplasm accessions using marker CAPS(1455) that targets the SNP(1455) in Ma1 showed that the CAPS(1455A) allele was associated completely with high pH and highly with low titratable acidity, suggesting that the natural mutation-led truncation is most likely responsible for the abolished function of Ma

  4. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Nitric oxide synthase isoforms in spontaneous and salt hypertension

    Hojná, Silvie; Kuneš, Jaroslav; Zicha, Josef

    2007-01-01

    Roč. 25, Suppl. 2 (2007), S 338-S 338 ISSN 0263-6352. [European Meeting on Hypertension /17./. 15.06.2007-19.06.2007, Milan] R&D Projects: GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : nitric oxide synthase isoforms * spontaneous and salt hypertension Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  6. Use of linalool synthase in genetic engineering of scent production

    Pichersky, Eran

    1998-01-01

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  7. Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion

    Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius

    2012-01-01

    Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012 http://www.sciencedirect.com/science/article/pii/S0166685112000539

  8. Catalytic site interactions in yeast OMP synthase

    Hansen, Michael Riis; Barr, Eric W.; Jensen, Kaj Frank

    2014-01-01

    45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal...

  9. Tokyo Motor Show 2003; Tokyo Motor Show 2003

    Joly, E.

    2004-01-01

    The text which follows present the different techniques exposed during the 37. Tokyo Motor Show. The report points out the great tendencies of developments of the Japanese automobile industry. The hybrid electric-powered vehicles or those equipped with fuel cells have been highlighted by the Japanese manufacturers which allow considerable budgets in the research of less polluting vehicles. The exposed models, although being all different according to the manufacturer, use always a hybrid system: fuel cell/battery. The manufacturers have stressed too on the intelligent systems for navigation and safety as well as on the design and comfort. (O.M.)

  10. Multi-substrate terpene synthases: their occurrence and physiological significance

    Leila Pazouki

    2016-07-01

    Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.

  11. From bacterial to human dihydrouridine synthase: automated structure determination

    Whelan, Fiona, E-mail: fiona.whelan@york.ac.uk; Jenkins, Huw T., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom)

    2015-06-30

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  12. From bacterial to human dihydrouridine synthase: automated structure determination

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.

    2015-01-01

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer

  13. Phytochelatin synthase activity as a marker of metal pollution

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: kizek@sci.muni.cz [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)

    2011-08-30

    Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.

  14. Phytochelatin synthase activity as a marker of metal pollution

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene

    2011-01-01

    Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.

  15. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  16. The basal kinetic parameters of glycogen synthase in human myotube cultures are not affected by chronic high insulin exposure

    Gaster, M; Schrøder, H D; Handberg, A

    2001-01-01

    results show that chronic exposure of human myotubes to high insulin with or without high glucose did not affect the basal kinetic parameters but abolished the reactivity of GS to acute insulin stimulation. We suggest that insulin induced insulin resistance of GS is caused by a failure of acute insulin......There is no consensus regarding the results from in vivo and in vitro studies on the impact of chronic high insulin and/or high glucose exposure on acute insulin stimulation of glycogen synthase (GS) kinetic parameters in human skeletal muscle. The aim of this study was to evaluate the kinetic...... parameters of glycogen synthase activity in human myotube cultures at conditions of chronic high insulin combined or not with high glucose exposure, before and after a subsequent acute insulin stimulation. Acute insulin stimulation significantly increased the fractional activity (FV(0.1)) of GS, increased...

  17. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  18. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  19. Chitin Synthases with a Myosin Motor-Like Domain Control the Resistance of Aspergillus fumigatus to Echinocandins

    Jiménez-Ortigosa, Cristina; Aimanianda, Vishukumar; Muszkieta, Laetitia; Mouyna, Isabelle; Alsteens, David; Pire, Stéphane; Beau, Remi; Krappmann, Sven; Beauvais, Anne; Dufrêne, Yves F.

    2012-01-01

    Aspergillus fumigatus has two chitin synthases (CSMA and CSMB) with a myosin motor-like domain (MMD) arranged in a head-to-head configuration. To understand the function of these chitin synthases, single and double csm mutant strains were constructed and analyzed. Although there was a slight reduction in mycelial growth of the mutants, the total chitin synthase activity and the cell wall chitin content were similar in the mycelium of all of the mutants and the parental strain. In the conidia, chitin content in the ΔcsmA strain cell wall was less than half the amount found in the parental strain. In contrast, the ΔcsmB mutant strain and, unexpectedly, the ΔcsmA/ΔcsmB mutant strain did not show any modification of chitin content in their conidial cell walls. In contrast to the hydrophobic conidia of the parental strain, conidia of all of the csm mutants were hydrophilic due to the presence of an amorphous material covering the hydrophobic surface-rodlet layer. The deletion of CSM genes also resulted in an increased susceptibility of resting and germinating conidia to echinocandins. These results show that the deletion of the CSMA and CSMB genes induced a significant disorganization of the cell wall structure, even though they contribute only weakly to the overall cell wall chitin synthesis. PMID:22964252

  20. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  1. The alpha2-5'AMP-activated protein kinase is a site 2 glycogen synthase kinase in skeletal muscle and is responsive to glucose loading

    Jørgensen, Sebastian B; Nielsen, Jakob N.; Birk, Jesper Bratz

    2004-01-01

    The 5'AMP-activated protein kinase (AMPK) is a potential antidiabetic drug target. Here we show that the pharmacological activation of AMPK by 5-aminoimidazole-1-beta-4-carboxamide ribofuranoside (AICAR) leads to inactivation of glycogen synthase (GS) and phosphorylation of GS at Ser 7 (site 2). ...

  2. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis.

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E; Chen, Ming; Zhou, Yongming; Yu, Bin; Cahoon, Edgar B

    2015-08-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. © 2015 American Society of

  3. Reality show: um paradoxo nietzschiano

    Ilana Feldman

    2011-01-01

    Full Text Available

    O fenômeno dos reality shows - e a subseqüente relação entre imagem e verdade - assenta-se sobre uma série de paradoxos. Tais paradoxos podem ser compreendidos à luz do pensamento do filósofo alemão Friedrich Nietzsche, que, através dos usos de formulações paradoxais, concebia a realidade como um mundo de pura aparência e a verdade como um acréscimo ficcional, como um efeito. A ficção é então tomada, na filosofia de Nietzsche, não em seu aspecto falsificante e desrealizador - como sempre pleiteou nossa tradição metafísica -, mas como condição necessária para que certa espécie de invenção possa operar como verdade. Sendo assim, a própria expressão reality show, através de sua formulação paradoxal, engendra explicitamente um mundo de pura aparência, em que a verdade, a parte reality da proposição, é da ordem do suplemento, daquilo que se acrescenta ficcionalmente - como um adjetivo - a show. O ornamento, nesse caso, passa a ocupar o lugar central, apontando para o efeito produzido: o efeito-de-verdade. Seguindo, então, o pensamento nietzschiano e sua atualização na contemporaneidade, investigaremos de que forma os televisivos “shows de realidade” operam paradoxalmente, em consonância com nossas paradoxais práticas culturais.

  4. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  5. Calcium-regulation of mitochondrial respiration maintains ATP homeostasis and requires ARALAR/AGC1-malate aspartate shuttle in intact cortical neurons.

    Llorente-Folch, Irene; Rueda, Carlos B; Amigo, Ignacio; del Arco, Araceli; Saheki, Takeyori; Pardo, Beatriz; Satrústegui, Jorgina

    2013-08-28

    Neuronal respiration is controlled by ATP demand and Ca2+ but the roles played by each are unknown, as any Ca2+ signal also impacts on ATP demand. Ca2+ can control mitochondrial function through Ca2+-regulated mitochondrial carriers, the aspartate-glutamate and ATP-Mg/Pi carriers, ARALAR/AGC1 and SCaMC-3, respectively, or in the matrix after Ca2+ transport through the Ca2+ uniporter. We have studied the role of Ca2+ signaling in the regulation of mitochondrial respiration in intact mouse cortical neurons in basal conditions and in response to increased workload caused by increases in [Na+]cyt (veratridine, high-K+ depolarization) and/or [Ca2+]cyt (carbachol). Respiration in nonstimulated neurons on 2.5-5 mm glucose depends on ARALAR-malate aspartate shuttle (MAS), with a 46% drop in aralar KO neurons. All stimulation conditions induced increased OCR (oxygen consumption rate) in the presence of Ca2+, which was prevented by BAPTA-AM loading (to preserve the workload), or in Ca2+-free medium (which also lowers cell workload). SCaMC-3 limits respiration only in response to high workloads and robust Ca2+ signals. In every condition tested Ca2+ activation of ARALAR-MAS was required to fully stimulate coupled respiration by promoting pyruvate entry into mitochondria. In aralar KO neurons, respiration was stimulated by veratridine, but not by KCl or carbachol, indicating that the Ca2+ uniporter pathway played a role in the first, but not in the second condition, even though KCl caused an increase in [Ca2+]mit. The results suggest a requirement for ARALAR-MAS in priming pyruvate entry in mitochondria as a step needed to activate respiration by Ca2+ in response to moderate workloads.

  6. The enhancement of tolerance to salt and cold stresses by modifying the redox state and salicylic acid content via the cytosolic malate dehydrogenase gene in transgenic apple plants.

    Wang, Qing-Jie; Sun, Hong; Dong, Qing-Long; Sun, Tian-Yu; Jin, Zhong-Xin; Hao, Yu-Jin; Yao, Yu-Xin

    2016-10-01

    In this study, we characterized the role of an apple cytosolic malate dehydrogenase gene (MdcyMDH) in the tolerance to salt and cold stresses and investigated its regulation mechanism in stress tolerance. The MdcyMDH transcript was induced by mild cold and salt treatments, and MdcyMDH-overexpressing apple plants possessed improved cold and salt tolerance compared to wild-type (WT) plants. A digital gene expression tag profiling analysis revealed that MdcyMDH overexpression largely altered some biological processes, including hormone signal transduction, photosynthesis, citrate cycle and oxidation-reduction. Further experiments verified that MdcyMDH overexpression modified the mitochondrial and chloroplast metabolisms and elevated the level of reducing power, primarily caused by increased ascorbate and glutathione, as well as the increased ratios of ascorbate/dehydroascorbate and glutathione/glutathione disulphide, under normal and especially stress conditions. Concurrently, the transgenic plants produced a high H2 O2 content, but a low O2·- production rate was observed compared to the WT plants. On the other hand, the transgenic plants accumulated more free and total salicylic acid (SA) than the WT plants under normal and stress conditions. Taken together, MdcyMDH conferred the transgenic apple plants a higher stress tolerance by producing more reductive redox states and increasing the SA level; MdcyMDH could serve as a target gene to genetically engineer salt- and cold-tolerant trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Functional, structural and phylogenetic analysis of domains underlying the Al sensitivity of the aluminum-activated malate/anion transporter, TaALMT1.

    Ligaba, Ayalew; Dreyer, Ingo; Margaryan, Armine; Schneider, David J; Kochian, Leon; Piñeros, Miguel

    2013-12-01

    Triticum aestivum aluminum-activated malate transporter (TaALMT1) is the founding member of a unique gene family of anion transporters (ALMTs) that mediate the efflux of organic acids. A small sub-group of root-localized ALMTs, including TaALMT1, is physiologically associated with in planta aluminum (Al) resistance. TaALMT1 exhibits significant enhancement of transport activity in response to extracellular Al. In this study, we integrated structure-function analyses of structurally altered TaALMT1 proteins expressed in Xenopus oocytes with phylogenic analyses of the ALMT family. Our aim is to re-examine the role of protein domains in terms of their potential involvement in the Al-dependent enhancement (i.e. Al-responsiveness) of TaALMT1 transport activity, as well as the roles of all its 43 negatively charged amino acid residues. Our results indicate that the N-domain, which is predicted to form the conductive pathway, mediates ion transport even in the absence of the C-domain. However, segments in both domains are involved in Al(3+) sensing. We identified two regions, one at the N-terminus and a hydrophobic region at the C-terminus, that jointly contribute to the Al-response phenotype. Interestingly, the characteristic motif at the N-terminus appears to be specific for Al-responsive ALMTs. Our study highlights the need to include a comprehensive phylogenetic analysis when drawing inferences from structure-function analyses, as a significant proportion of the functional changes observed for TaALMT1 are most likely the result of alterations in the overall structural integrity of ALMT family proteins rather than modifications of specific sites involved in Al(3+) sensing. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  8. Surface exposed amino acid differences between mesophilic and thermophilic phosphoribosyl diphosphate synthase

    Hove-Jensen, Bjarne; McGuire, James N

    2004-01-01

    The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...

  9. Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.

    Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng

    2017-03-01

    Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.

  10. Cyanide detoxification in an insect herbivore: Molecular identification of β-cyanoalanine synthases from Pieris rapae.

    van Ohlen, Maike; Herfurth, Anna-Maria; Kerbstadt, Henrike; Wittstock, Ute

    2016-03-01

    Cyanogenic compounds occur widely in the plant kingdom. Therefore, many herbivores are adapted to the presence of these compounds in their diet by either avoiding cyanide release or by efficient cyanide detoxification mechanisms. The mechanisms of adaptation are not fully understood. Larvae of Pieris rapae (Lepidoptera: Pieridae) are specialist herbivores on glucosinolate-containing plants. They are exposed to cyanide during metabolism of phenylacetonitrile, a product of benzylglucosinolate breakdown catalyzed by plant myrosinases and larval nitrile-specifier protein (NSP) in the gut. Cyanide is metabolized to β-cyanoalanine and thiocyanate in the larvae. Here, we demonstrate that larvae of P. rapae possess β-cyanoalanine activity in their gut. We have identified three gut-expressed cDNAs designated PrBSAS1-PrBSAS3 which encode proteins with similarity to β-substituted alanine synthases (BSAS). Characterization of recombinant PrBSAS1-PrBSAS3 shows that they possess β-cyanoalanine activity. In phylogenetic trees, PrBSAS1-PrBSAS3, the first characterized insect BSAS, group together with a characterized mite β-cyanoalanine synthase and bacterial enzymes indicating a similar evolutionary history. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Early growth and development impairments in patients with ganglioside GM3 synthase deficiency.

    Wang, H; Wang, A; Wang, D; Bright, A; Sency, V; Zhou, A; Xin, B

    2016-05-01

    Ganglioside GM3 synthase is a key enzyme involved in the biosynthesis of gangliosides. GM3 synthase deficiency (GSD) causes a complete absence of GM3 and all downstream biosynthetic derivatives. The individuals affected by this disorder manifest severe irritability, intractable seizures and profound intellectual disability. However, we have found that most newborns seem symptom-free for a period of time after birth. In order to further understand the onset of the disease, we investigated the early growth and development of patients with this condition through this study. We compared 37 affected individuals with their normal siblings and revealed that all children with GSD had relatively normal intrauterine growth and development, as their weight, length and head circumference were similar to their normal siblings at birth. However, the disease progresses quickly after birth and causes significant constitutional impairments of growth and development by 6 months of age. Neither breastfeeding nor gastrostomy tube placement made significant difference on growth and development as all groups of patients showed the similar pattern. We conclude that GSD causes significant postnatal growth and developmental impairments and the amount of gangliosides in breast milk and general nutritional intervention do not seem to alter these outcomes. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Plant polyketide synthases: a chalcone synthase-type enzyme which performs a condensation reaction with methylmalonyl-CoA in the biosynthesis of C-methylated chalcones.

    Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G

    1998-06-09

    Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.

  13. Geranylgeranyl diphosphate synthase in fission yeast is a heteromer of farnesyl diphosphate synthase (FPS), Fps1, and an FPS-like protein, Spo9, essential for sporulation.

    Ye, Yanfang; Fujii, Makoto; Hirata, Aiko; Kawamukai, Makoto; Shimoda, Chikashi; Nakamura, Taro

    2007-09-01

    Both farnesyl diphosphate synthase (FPS) and geranylgeranyl diphosphate synthase (GGPS) are key enzymes in the synthesis of various isoprenoid-containing compounds and proteins. Here, we describe two novel Schizosaccharomyces pombe genes, fps1(+) and spo9(+), whose products are similar to FPS in primary structure, but whose functions differ from one another. Fps1 is essential for vegetative growth, whereas, a spo9 null mutant exhibits temperature-sensitive growth. Expression of fps1(+), but not spo9(+), suppresses the lethality of a Saccharomyces cerevisiae FPS-deficient mutant and also restores ubiquinone synthesis in an Escherichia coli ispA mutant, which lacks FPS activity, indicating that S. pombe Fps1 in fact functions as an FPS. In contrast to a typical FPS gene, no apparent GGPS homologues have been found in the S. pombe genome. Interestingly, although neither fps1(+) nor spo9(+) expression alone in E. coli confers clear GGPS activity, coexpression of both genes induces such activity. Moreover, the GGPS activity is significantly reduced in the spo9 mutant. In addition, the spo9 mutation perturbs the membrane association of a geranylgeranylated protein, but not that of a farnesylated protein. Yeast two-hybrid and coimmunoprecipitation analyses indicate that Fps1 and Spo9 physically interact. Thus, neither Fps1 nor Spo9 alone functions as a GGPS, but the two proteins together form a complex with GGPS activity. Because spo9 was originally identified as a sporulation-deficient mutant, we show here that expansion of the forespore membrane is severely inhibited in spo9Delta cells. Electron microscopy revealed significant accumulation membrane vesicles in spo9Delta cells. We suggest that lack of GGPS activity in a spo9 mutant results in impaired protein prenylation in certain proteins responsible for secretory function, thereby inhibiting forespore membrane formation.

  14. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

    Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.

    2014-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  15. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  16. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  17. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.

    1986-01-01

    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor

  18. Alliinase and cysteine synthase transcription in developing garlic (Allium sativum L.) over time.

    Mitrová, Katarina; Svoboda, Pavel; Milella, Luigi; Ovesná, Jaroslava

    2018-06-15

    Garlic is a valuable source of healthy compounds, including secondary metabolites rich in sulphur such as cysteine sulphoxides (CSOs). Here, we present new qRT-PCR assays analysing the transcription of two genes encoding key enzymes in CSO biosynthetic pathways (cysteine synthase and alliinase) in developing garlic. We also identified a set of genes (ACT I, GAPDH, and TUB) to use as transcription normalisation controls. We showed that the (normalised) transcription of both enzymes was highest during sprouting and decreased significantly in fully developed leaves, which are the major CSO-producing organs. Transcriptional activity further declined at the end of the growing season. Different cultivars show similar sulphur metabolism gene expression when European garlics were compared to Chinese and American genotypes. The qRT-PCR assays presented are also suitable for investigating the effects of agricultural practices on CSO formation in garlic to satisfy consumer demands. Copyright © 2017. Published by Elsevier Ltd.

  19. Biocatalytic production of psilocybin and derivatives in tryptophan synthase-enhanced reactions.

    Blei, Felix; Baldeweg, Florian; Fricke, Janis; Hoffmeister, Dirk

    2018-05-11

    Psilocybin (4-phosphoryloxy-N,N-dimethyltryptamine) is the main alkaloid of the fungal genus Psilocybe, the so-called "magic mushrooms". The pharmaceutical interest in this psychotropic natural product as a future medication to treat depression and anxiety is strongly re-emerging. Here, we present an enhanced enzymatic route of psilocybin production by adding TrpB, the tryptophan synthase of the mushroom Psilocybe cubensis, to the reaction. We capitalized on its substrate flexibility and show psilocybin formation from 4-hydroxyindole and L-serine, which are less cost-intensive substrates, compared to the previous method. Further, we show enzymatic production of 7-phosphoryloxytryptamine (isonorbaeocystin), a non-natural congener of the Psilocybe alkaloid norbaeocystin (4-phosphoryloxytryptamine), and of serotonin (5-hydroxytryptamine) via the same in vitro approach. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.

    Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan

    2009-01-01

    The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.

  1. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  2. Kinerja Biosensor Konduktometri Berbasis (Screen Printed Carbon Electrode SPCE––Kitosan untuk Deteksi Diazinon, Malation, Klorpirifos dan Profenofos

    Nuzulul Kurniawan Isvani

    2016-08-01

    Full Text Available The performance of biosensor is based on the hydrolysis reaction of organophosphorus compounds catalyzed by organophosphate hydrolase (OPH, produce H+ and the other ionic species that increase conductance on the surface of electrode. In this research, OPH was immobilized by crosslinking on chitosan–glutaraldehyde membrane on the (Screen Printed Carbon Electrode SPCE surface. Measurements were carried out at the range concentration 0 to 3.0 ppm of organophosphate, the range of pH 7.0 to 9.0 and 5–25 mL of enzyme. The result showed that optimum performances were obtained at 25 mL of OPH, pH 8.5, with the sensitivity for dizinon, malathion, chlorpirifos and profenofos is 1.353 mS/ppm, 1.270 mS/ppm, 1.230 mS/ppm dan 1.77 mS/ppm respectively and 0.97; 1.03; 0.98; 0.97 of LOD. DOI :http://dx.doi.org/10.15408/jkv.v0i0.3156.

  3. Enhancement of vascular targeting by inhibitors of nitric oxide synthase

    Davis, Peter D.; Tozer, Gillian M.; Naylor, Matthew A.; Thomson, Peter; Lewis, Gemma; Hill, Sally A.

    2002-01-01

    Purpose: This study investigates the enhancement of the vascular targeting activity of the tubulin-binding agent combretastatin A4 phosphate (CA4P) by various inhibitors of nitric oxide synthases. Methods and Materials: The syngeneic tumors CaNT and SaS growing in CBA mice were used for this study. Reduction in perfused vascular volume was measured by injection of Hoechst 33342 24 h after drug administration. Necrosis (hematoxylin and eosin stain) was assessed also at 24 h after treatment. Combretastatin A4 phosphate was synthesized by a modification of the published procedure and the nitric oxide synthase inhibitors L-NNA, L-NMMA, L-NIO, L-NIL, S-MTC, S-EIT, AMP, AMT, and L-TC, obtained from commercial sources. Results: A statistically significant augmentation of the reduction in perfused vascular volume by CA4P in the CaNT tumor was observed with L-NNA, AMP, and AMT. An increase in CA4P-induced necrosis in the same tumor achieved significance with L-NNA, L-NMMA, L-NIL, and AMT. CA4P induced little necrosis in the SaS tumor, but combination with the inhibitors L-NNA, L-NMMA, L-NIO, S-EIT, and L-TC was effective. Conclusions: Augmentation of CA4P activity by nitric oxide synthase inhibitors of different structural classes supports a nitric oxide-related mechanism for this effect. L-NNA was the most effective inhibitor studied

  4. Incorporation of phosphate into glycogen by glycogen synthase.

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Microsomal prostaglandin E synthase-1 in rheumatic diseases

    Marina eKorotkova

    2011-01-01

    Full Text Available Microsomal prostaglandin E synthase-1 (mPGES-1 is a well recognized target for the development of novel anti-inflammatory drugs that can reduce symptoms of inflammation in rheumatic diseases and other inflammatory conditions. In this review, we focus on mPGES-1 in rheumatic diseases with the aim to cover the most recent advances in the understanding of mPGES-1 in rheumatoid arthritis, osteoarthritis and inflammatory myopathies. Novel findings regarding regulation of mPGES1 cell expression as well as enzyme inhibitors are also summarized.

  6. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal......NOS expressing cells in active lesions. NOS IR expressing cells were widely distributed in plaques, in white and gray matter that appeared normal macroscopically, and on MR. Endothelial NOS (eNOS) was highly expressed in intraparenchymal vascular endothelial cells of MS patients. A control group matched for age...

  7. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  8. Two Members of the Aluminum-Activated Malate Transporter Family, SlALMT4 and SlALMT5, are Expressed during Fruit Development, and the Overexpression of SlALMT5 Alters Organic Acid Contents in Seeds in Tomato (Solanum lycopersicum).

    Sasaki, Takayuki; Tsuchiya, Yoshiyuki; Ariyoshi, Michiyo; Nakano, Ryohei; Ushijima, Koichiro; Kubo, Yasutaka; Mori, Izumi C; Higashiizumi, Emi; Galis, Ivan; Yamamoto, Yoko

    2016-11-01

    The aluminum-activated malate transporter (ALMT) family of proteins transports malate and/or inorganic anions across plant membranes. To demonstrate the possible role of ALMT genes in tomato fruit development, we focused on SlALMT4 and SlALMT5, the two major genes expressed during fruit development. Predicted proteins were classified into clade 2 of the family, many members of which localize to endomembranes. Tissue-specific gene expression was determined using transgenic tomato expressing the β-glucuronidase reporter gene controlled by their own promoters. Both the genes were expressed in vascular bundles connecting to developing seeds in fruit and in the embryo of mature seeds. Further, SlALMT5 was expressed in embryo in developing seeds in fruit. Subcellular localization of both proteins to the endoplasmic reticulum (ER) was established by transiently expressing the green fluorescent protein fusions in plant protoplasts. SlALMT5 probably localized to other endomembranes as well. Localization of SlALMT5 to the ER was also confirmed by immunoblot analysis. The transport function of both SlALMT proteins was investigated electrophysiologically in Xenopus oocytes. SlALMT5 transported malate and inorganic anions such as nitrate and chloride, but not citrate. SlALMT4 also transported malate, but the results were less consistent perhaps because it did not localize strongly to the plasma membrane. To elucidate the physiological role of SlALMT5 further, we overexpressed SlALMT5 in tomato. Compared with the wild type, overexpressors exhibited higher malate and citrate contents in mature seeds, but not in fruit. We conclude that the malate transport function of SlALMT5 expressed in developing fruit influences the organic acid contents in mature seeds. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  9. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

    2015-03-31

    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  10. Cyclic GMP-AMP synthase is an innate immune sensor of HIV and other retroviruses.

    Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J

    2013-08-23

    Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse-transcribed HIV DNA triggers the innate immune response. Knockout or knockdown of cGAS in mouse or human cell lines blocked cytokine induction by HIV, murine leukemia virus, and simian immunodeficiency virus. These results indicate that cGAS is an innate immune sensor of HIV and other retroviruses.

  11. Constrained dansyl derivatives reveal bacterial specificity of highly conserved thymidylate synthases.

    Calò, Sanuele; Tondi, Donatella; Ferrari, Stefania; Venturelli, Alberto; Ghelli, Stefano; Costi, Maria Paola

    2008-03-25

    The elucidation of the structural/functional specificities of highly conserved enzymes remains a challenging area of investigation, and enzymes involved in cellular replication are important targets for functional studies and drug discovery. Thymidylate synthase (TS, ThyA) governs the synthesis of thymidylate for use in DNA synthesis. The present study focused on Lactobacillus casei TS (LcTS) and Escherichia coli TS (EcTS), which exhibit 50 % sequence identity and strong folding similarity. We have successfully designed and validated a chemical model in which linear, but not constrained, dansyl derivatives specifically complement the LcTS active site. Conversely, chemically constrained dansyl derivatives showed up to 1000-fold improved affinity for EcTS relative to the inhibitory activity of linear derivatives. This study demonstrates that the accurate design of small ligands can uncover functional features of highly conserved enzymes.

  12. Cortisol regulates nitric oxide synthase in freshwater and seawater acclimated rainbow trout, Oncorhynchus mykiss

    Gerber, Lucie; Madsen, Steffen S; Jensen, Frank B

    2017-01-01

    Cortisol and nitric oxide (NO) are regulators of ion transport and metabolic functions in fish. In the gill, they show opposite effects on Na(+)/K(+)-ATPase (NKA) activity: cortisol stimulates NKA activity while NO inhibits NKA activity. We hypothesized that cortisol may impact NO production...... in osmoregulatory tissues by regulating NO synthase (NOS) expression. We evaluated the influence of cortisol treatment on mRNA expression of Nos1 and Nos2 in gill, kidney and middle intestine of both freshwater (FW) and seawater (SW) acclimated rainbow trout and found both tissue- and salinity-dependent effects....... Nos2 expression was down-regulated in the gill by cortisol injection in both FW and SW trout. This was substantiated by incubating gill tissue with cortisol ex vivo. Similarly, cortisol injection significantly down-regulated Nos2 expression in kidney of SW fish but not in FW fish. In the middle...

  13. Dual regulation of muscle glycogen synthase during exercise by activation and compartmentalization

    Prats, Clara; Helge, Jørn W; Nordby, Pernille

    2009-01-01

    Glycogen synthase (GS) is considered the rate-limiting enzyme in glycogenesis but still today there is a lack of understanding on its regulation. We have previously shown phosphorylation-dependent GS intracellular redistribution at the start of glycogen re-synthesis in rabbit skeletal muscle (Prats......, C., Cadefau, J. A., Cussó, R., Qvortrup, K., Nielsen, J. N., Wojtaszewki, J. F., Wojtaszewki, J. F., Hardie, D. G., Stewart, G., Hansen, B. F., and Ploug, T. (2005) J. Biol. Chem. 280, 23165-23172). In the present study we investigate the regulation of human muscle GS activity by glycogen, exercise......, and insulin. Using immunocytochemistry we investigate the existence and relevance of GS intracellular compartmentalization during exercise and during glycogen re-synthesis. The results show that GS intrinsic activity is strongly dependent on glycogen levels and that such regulation involves associated...

  14. Promotor polymorphisms in leukotriene C4 synthase and risk of ischemic cerebrovascular disease

    Freiberg, J.J.; Tybjaerg-Hansen, A.; Sillesen, H.

    2008-01-01

    OBJECTIVE: Cysteinyl leukotrienes are involved in inflammation and possibly in early carotid atherosclerosis. We tested the hypothesis that the -444 A/C and -1072 G/A polymorphisms of the leukotriene C(4) synthase associate with risk of ischemic cerebrovascular disease. METHODS AND RESULTS: We...... genotyped 10 592 individuals from the Danish general population, the Copenhagen City Heart Study. During 24 years of follow-up, 557 individuals developed ischemic cerebrovascular disease. The allele frequency was 0.07 for -1072 A and 0.29 for -444 C. Cumulative incidence for ischemic cerebrovascular disease...... was higher for -1072 AA versus GG genotype (log-rank: P=0.002), and lower for -444 CC versus AA genotype (log-rank: P=0.008). Combined genotypes showed corresponding cumulative incidence differences (log-rank: P=0.003). Multifactorially adjusted hazard ratios for ischemic cerebrovascular disease were 2...

  15. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.

    1986-01-01

    The R and S enantionmers of S-adenosyl-3-[ 2 H]3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with [1,4- 2 H 4 ]-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral [ 2 H 5 ]spermidines were isolated and converted to their N 1 ,N 7 -dibocspermidine-N 4 -(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz 1 H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral [ 2 H 3 ]dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH 3 ) in all cases studied to date

  16. In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

    Jose Antonio Cuesta-Seijo

    2016-01-01

    Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.

  17. Modulation of hyaluronan synthase activity in cellular membrane fractions.

    Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto

    2009-10-30

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.

  18. Glycogen synthase kinase 3: more than a namesake.

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  19. Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors

    Daniela Hulcová

    2018-03-01

    Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.

  20. The crystal structure of human GDP-L-fucose synthase.

    Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua

    2013-09-01

    Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.

  1. Prostaglandin E(2) synthase inhibition as a therapeutic target.

    Iyer, Jitesh P; Srivastava, Punit K; Dev, Rishabh; Dastidar, Sunanda G; Ray, Abhijit

    2009-07-01

    Most NSAIDs function by inhibiting biosynthesis of PGE(2) by inhibition of COX-1 and/or COX-2. Since COX-1 has a protective function in the gastro-intestinal tract (GIT), non-selective inhibition of both cycloxy genases leads to moderate to severe gastro-intestinal intolerance. Attempts to identify selective inhibitors of COX-2, led to the identification of celecoxib and rofecoxib. However, long-term use of these drugs has serious adverse effects of sudden myocardial infarction and thrombosis. Drug-mediated imbalance in the levels of prostaglandin I(2) (PGI(2)) and thromboxane A(2) (TXA(2)) with a bias towards TXA(2) may be the primary reason for these events. This resulted in the drugs being withdrawn from the market, leaving a need for an effective and safe anti-inflammatory drug. Recently, the focus of research has shifted to enzymes downstream of COX in the prosta glandin biosynthetic pathway such as prostaglandin E(2) synthases. Microsomal prostaglandin E(2) synthase-1 (mPGES-1) specifically isomerizes PGH(2) to PGE(2), under inflammatory conditions. In this review, we examine the biology of mPGES-1 and its role in disease. Progress in designing molecules that can selectively inhibit mPGES-1 is reviewed. mPGES-1 has the potential to be a target for anti-inflammatory therapy, devoid of adverse GIT and cardiac effects and warrants further investigation.

  2. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  3. Functional loss of two ceramide synthases elicits autophagy-dependent lifespan extension in C. elegans.

    Mai-Britt Mosbech

    Full Text Available Ceramide and its metabolites constitute a diverse group of lipids, which play important roles as structural entities of biological membranes as well as regulators of cellular growth, differentiation, and development. The C. elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2, and lagr-1. HYL-1 function is required for synthesis of ceramides and sphingolipids containing very long acyl-chains (≥C24, while HYL-2 is required for synthesis of ceramides and sphingolipids containing shorter acyl-chains (≤C22. Here we show that functional loss of HYL-2 decreases lifespan, while loss of HYL-1 or LAGR-1 does not affect lifespan. We show that loss of HYL-1 and LAGR-1 functions extend lifespan in an autophagy-dependent manner, as knock down of the autophagy-associated gene ATG-12 abolishes hyl-1;lagr-1 longevity. The transcription factors PHA-4/FOXA, DAF-16/FOXO, and SKN-1 are also required for the observed lifespan extension, as well as the increased number of autophagosomes in hyl-1;lagr-1 animals. Both autophagic events and the transcription factors PHA-4/FOXA, DAF-16, and SKN-1 have previously been associated with dietary restriction-induced longevity. Accordingly, we find that hyl-1;lagr-1 animals display reduced feeding, increased resistance to heat, and reduced reproduction. Collectively, our data suggest that specific sphingolipids produced by different ceramide synthases have opposing roles in determination of C. elegans lifespan. We propose that loss of HYL-1 and LAGR-1 result in dietary restriction-induced autophagy and consequently prolonged longevity.

  4. Isolation and characterization of an oxidosqualene cyclase gene encoding a β-amyrin synthase involved in Polygala tenuifolia Willd. saponin biosynthesis.

    Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae

    2014-03-01

    Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.

  5. Selectivity of the surface binding site (SBS) on barley starch synthase I

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica

    2014-01-01

    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  6. Inhibition of the ATP Synthase Eliminates the Intrinsic Resistance of Staphylococcus aureus towards Polymyxins

    Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph

    2017-01-01

    , linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...

  7. Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)

    In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...

  8. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  9. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  10. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  11. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  12. Osteopontin protects against hyperoxia-induced lung injury by inhibiting nitric oxide synthases.

    Zhang, Xiang-Feng; Liu, Shuang; Zhou, Yu-Jie; Zhu, Guang-Fa; Foda, Hussein D

    2010-04-05

    Exposure of adult mice to more than 95% O(2) produces a lethal injury by 72 hours. Nitric oxide synthase (NOS) is thought to contribute to the pathophysiology of murine hyperoxia-induced acute lung injury (ALI). Osteopontin (OPN) is a phosphorylated glycoprotein produced principally by macrophages. OPN inhibits inducible nitric oxide synthase (iNOS), which generates large amounts of nitric oxide production. However, the relationship between nitric oxide and endogenous OPN in lung tissue during hyperoxia-induced ALI has not yet been elucidated, thus we examined the role that OPN plays in the hyperoxia-induced lung injury and its relationships with NOS. One hundred and forty-four osteopontin knock-out (KO) mice and their matched wild type background control (WT) were exposed in sealed cages > 95% oxygen or room air for 24- 72 hours, and the severity of lung injury was assessed; expression of OPN, endothelial nitric oxide synthase (eNOS) and iNOS mRNA in lung tissues at 24, 48 and 72 hours of hyperoxia were studied by reverse transcription-polymerase chain reaction (RT-PCR); immunohistochemistry (IHC) was performed for the detection of iNOS, eNOS, and OPN protein in lung tissues. OPN KO mice developed more severe acute lung injury at 72 hours of hyperoxia. The wet/dry weight ratio increased to 6.85 +/- 0.66 in the KO mice at 72 hours of hyperoxia as compared to 5.31 +/- 0.92 in the WT group (P < 0.05). iNOS mRNA (48 hours: 1.04 +/- 0.08 vs. 0.63 +/- 0.09, P < 0.01; 72 hours: 0.89 +/- 0.08 vs. 0.72 +/- 0.09, P < 0.05) and eNOS mRNA (48 hours: 0.62 +/- 0.08 vs. 0.43 +/- 0.09, P < 0.05; 72 hours: 0.67 +/- 0.08 vs. 0.45 +/- 0.09, P < 0.05) expression was more significantly increased in OPN KO mice than their matched WT mice when exposed to hyperoxia. IHC study showed higher expression of iNOS (20.54 +/- 3.18 vs. 12.52 +/- 2.46, P < 0.05) and eNOS (19.83 +/- 5.64 vs. 9.45 +/- 3.82, P < 0.05) in lung tissues of OPN KO mice at 72 hours of hyperoxia. OPN can protect against

  13. Functional specificity of cardiolipin synthase revealed by the identification of a cardiolipin synthase CrCLS1 in Chlamydomonas reinhardtii

    Chun-Hsien eHung

    2016-01-01

    Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.

  14. Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis.

    Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U

    2001-02-01

    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

  15. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  16. Geranylgeranyl diphosphate synthases from Scoparia dulcis and Croton sublyratus. cDNA cloning, functional expression, and conversion to a farnesyl diphosphate synthase.

    Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U

    2000-07-01

    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.

  17. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  18. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  19. Bedaquiline Inhibits the ATP Synthase in Mycobacterium abscessus and Is Effective in Infected Zebrafish.

    Dupont, Christian; Viljoen, Albertus; Thomas, Sangeeta; Roquet-Banères, Françoise; Herrmann, Jean-Louis; Pethe, Kevin; Kremer, Laurent

    2017-11-01

    Pulmonary infections caused by Mycobacterium abscessus are emerging as a global threat, especially in cystic fibrosis patients. Further intensifying the concern of M. abscessus infection is the recent evidence of human-to-human transmission of the infection. M. abscessus is a naturally multidrug-resistant fast-growing pathogen for which pharmacological options are limited. Repurposing antitubercular drugs represents an attractive option for the development of chemotherapeutic alternatives against M. abscessus infections. Bedaquiline (BDQ), an ATP synthase inhibitor, has recently been approved for the treatment of multidrug-resistant tuberculosis. Herein, we show that BDQ has a very low MIC against a vast panel of clinical isolates. Despite being bacteriostatic in vitro , BDQ was highly efficacious in a zebrafish model of M. abscessus infection. Remarkably, a very short period of treatment was sufficient to protect the infected larvae from M. abscessus -induced killing. This was corroborated with reduced numbers of abscesses and cords, considered to be major pathophysiological signs in infected zebrafish. Mode-of-action studies revealed that BDQ triggered a rapid depletion of ATP in M. abscessus in vitro , consistent with the drug targeting the F o F 1 ATP synthase. Importantly, despite a failure to select in vitro for spontaneous mutants that are highly resistant to BDQ, the transfer of single nucleotide polymorphisms leading to D29V or A64P substitutions in atpE conferred high resistance, thus resolving the target of BDQ in M. abscessus Overall, this study indicates that BDQ is active against M. abscessus in vitro and in vivo and should be considered for clinical use against the difficult-to-manage M. abscessus pulmonary infections. Copyright © 2017 American Society for Microbiology.

  20. Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

    Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

    2007-10-01

    Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

  1. Overexpression of Rat Neurons Nitric Oxide Synthase in Rice Enhances Drought and Salt Tolerance.

    Wei Cai

    Full Text Available Nitric oxide (NO has been shown to play an important role in the plant response to biotic and abiotic stresses in Arabidopsis mutants with lower or higher levels of endogenous NO. The exogenous application of NO donors or scavengers has also suggested an important role for NO in plant defense against environmental stress. In this study, rice plants under drought and high salinity conditions showed increased nitric oxide synthase (NOS activity and NO levels. Overexpression of rat neuronal NO synthase (nNOS in rice increased both NOS activity and NO accumulation, resulting in improved tolerance of the transgenic plants to both drought and salt stresses. nNOS-overexpressing plants exhibited stronger water-holding capability, higher proline accumulation, less lipid peroxidation and reduced electrolyte leakage under drought and salt conditions than wild rice. Moreover, nNOS-overexpressing plants accumulated less H2O2, due to the observed up-regulation of OsCATA, OsCATB and OsPOX1. In agreement, the activities of CAT and POX were higher in transgenic rice than wild type. Additionally, the expression of six tested stress-responsive genes including OsDREB2A, OsDREB2B, OsSNAC1, OsSNAC2, OsLEA3 and OsRD29A, in nNOS-overexpressing plants was higher than that in the wild type under drought and high salinity conditions. Taken together, our results suggest that nNOS overexpression suppresses the stress-enhanced electrolyte leakage, lipid peroxidation and H2O2 accumulation, and promotes proline accumulation and the expression of stress-responsive genes under stress conditions, thereby promoting increased tolerance to drought and salt stresses.

  2. Thermodynamic and NMR analyses of NADPH binding to lipocalin-type prostaglandin D synthase

    Qin, Shubin; Shimamoto, Shigeru; Maruno, Takahiro; Kobayashi, Yuji; Kawahara, Kazuki; Yoshida, Takuya; Ohkubo, Tadayasu

    2015-01-01

    Lipocalin-type prostaglandin D synthase (L-PGDS) is one of the most abundant proteins in human cerebrospinal fluid (CSF) with dual functions as a prostaglandin D_2 (PGD_2) synthase and a transporter of lipophilic ligands. Recent studies revealed that L-PGDS plays important roles in protecting against various neuronal diseases induced by reactive oxygen species (ROS). However, the molecular mechanisms of such protective actions of L-PGDS remain unknown. In this study, we conducted thermodynamic and nuclear magnetic resonance (NMR) analyses, and demonstrated that L-PGDS binds to nicotinamide coenzymes, including NADPH, NADP"+, and NADH. Although a hydrophilic ligand is not common for L-PGDS, these ligands, especially NADPH showed specific interaction with L-PGDS at the upper pocket of its ligand-binding cavity with an unusually bifurcated shape. The binding affinity of L-PGDS for NADPH was comparable to that previously reported for NADPH oxidases and NADPH in vitro. These results suggested that L-PGDS potentially attenuates the activities of NADPH oxidases through interaction with NADPH. Given that NADPH is the substrate for NADPH oxidases that play key roles in neuronal cell death by generating excessive ROS, these results imply a novel linkage between L-PGDS and ROS. - Highlights: • Interactions of L-PGDS with nicotinamide coenzymes were studied by ITC and NMR. • The binding affinity of L-PGDS was strongest to NADPH among nicotinamide coenzymes. • NADPH binds to the upper part of L-PGDS ligand-binding cavity. • L-PGDS binds to both lipophilic and hydrophilic ligands. • This study implies a novel linkage between L-PGDS and reactive oxygen species.

  3. The human coronary vasodilatory response to acute mental stress is mediated by neuronal nitric oxide synthase.

    Khan, Sitara G; Melikian, Narbeh; Shabeeh, Husain; Cabaco, Ana R; Martin, Katherine; Khan, Faisal; O'Gallagher, Kevin; Chowienczyk, Philip J; Shah, Ajay M

    2017-09-01

    Mental stress-induced ischemia approximately doubles the risk of cardiac events in patients with coronary artery disease, yet the mechanisms underlying changes in coronary blood flow in response to mental stress are poorly characterized. Neuronal nitric oxide synthase (nNOS) regulates basal coronary blood flow in healthy humans and mediates mental stress-induced vasodilation in the forearm. However, its possible role in mental stress-induced increases in coronary blood flow is unknown. We studied 11 patients (6 men and 5 women, mean age: 58 ± 14 yr) undergoing elective diagnostic cardiac catheterization and assessed the vasodilator response to mental stress elicited by the Stroop color-word test. Intracoronary substance P (20 pmol/min) and isosorbide dinitrate (1 mg) were used to assess endothelium-dependent and -independent vasodilation, respectively. Coronary blood flow was estimated using intracoronary Doppler recordings and quantitative coronary angiography to measure coronary artery diameter. Mental stress increased coronary flow by 34 ± 7.0% over the preceding baseline during saline infusion ( P stress increased coronary artery diameter by 6.9 ± 3.7% ( P = 0.02) and 0.5 ± 2.8% ( P = 0.51) in the presence of S -methyl-l-thiocitrulline. The response to substance P did not predict the response to mental stress ( r 2 = -0.22, P = 0.83). nNOS mediates the human coronary vasodilator response to mental stress, predominantly through actions at the level of coronary resistance vessels. NEW & NOTEWORTHY Acute mental stress induces vasodilation of the coronary microvasculature. Here, we show that this response involves neuronal nitric oxide synthase in the human coronary circulation.Listen to this article's corresponding podcast at http://ajpheart.podbean.com/e/nnos-and-coronary-flow-during-mental-stress/. Copyright © 2017 the American Physiological Society.

  4. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  5. Cross-species complementation of bacterial- and eukaryotic-type cardiolipin synthases

    Petra Gottier

    2017-11-01

    Full Text Available The glycerophospholipid cardiolipin is a unique constituent of bacterial and mitochondrial membranes. It is involved in forming and stabilizing high molecular mass membrane protein complexes and in maintaining membrane architecture. Absence of cardiolipin leads to reduced efficiency of the electron transport chain, decreased membrane potential, and, ultimately, impaired respiratory metabolism. For the protozoan parasite Trypanosoma brucei cardiolipin synthesis is essential for survival, indicating that the enzymes involved in cardiolipin production represent potential drug targets. T. brucei cardiolipin synthase (TbCLS is unique as it belongs to the family of phospholipases D (PLD, harboring a prokaryotic-type cardiolipin synthase (CLS active site domain. In contrast, most other eukaryotic CLS, including the yeast ortholog ScCrd1, are members of the CDP-alcohol phosphatidyl­ transferase family. To study if these mechanistically distinct CLS enzymes are able to catalyze cardiolipin production in a cell that normally expresses a different type of CLS, we expressed TbCLS and ScCrd1 in CLS-deficient yeast and trypanosome strains, respectively. Our results show that TbCLS complemented cardiolipin production in CRD1 knockout yeast and partly restored wild-type colony forming capability under stress conditions. Remarkably, CL remodeling appeared to be impaired in the transgenic construct, suggesting that CL production and remodeling are tightly coupled processes that may require a clustering of the involved proteins into specific CL-synthesizing domains. In contrast, no complementation was observed by heterologous expression of ScCrd1 in conditional TbCLS knockout trypanosomes, despite proper mitochondrial targeting of the protein.

  6. Neuronal nitric oxide synthase in the olfactory system of an adult teleost fish Oreochromis mossambicus.

    Singru, Praful S; Sakharkar, Amul J; Subhedar, Nishikant

    2003-07-11

    The aim of the present study is to explore the distribution of nitric oxide synthase in the olfactory system of an adult teleost, Oreochromis mossambicus using neuronal nitric oxide synthase (nNOS) immunocytochemistry and nicotinamide adenine dinucleotide phosphate diaphorase (NADPHd) histochemistry methods. Intense nNOS immunoreactivity was noticed in several olfactory receptor neurons (ORNs), in their axonal extensions over the olfactory nerve and in some basal cells of the olfactory epithelium. nNOS containing fascicles of the ORNs enter the bulb from its rostral pole, spread in the olfactory nerve layer in the periphery of the bulb and display massive innervation of the olfactory glomeruli. Unilateral ablation of the olfactory organ resulted in dramatic loss of nNOS immunoreactivity in the olfactory nerve layer of the ipsilateral bulb. In the olfactory bulb of intact fish, some granule cells showed intense immunoreactivity; dendrites arising from the granule cells could be traced to the glomerular layer. Of particular interest is the occurrence of nNOS immunoreactivity in the ganglion cells of the nervus terminalis. nNOS containing fibers were also encountered in the medial olfactory tracts as they extend to the telencephalon. The NADPHd staining generally coincides with that of nNOS suggesting that it may serve as a marker for nNOS in the olfactory system of this fish. However, mismatch was encountered in the case of mitral cells, while all are nNOS-negative, few were NADPHd positive. The present study for the first time revealed the occurrence of nNOS immunoreactivity in the ORNs of an adult vertebrate and suggests a role for nitric oxide in the transduction of odor stimuli, regeneration of olfactory epithelium and processing of olfactory signals.

  7. The human coronary vasodilatory response to acute mental stress is mediated by neuronal nitric oxide synthase

    Khan, Sitara G.; Melikian, Narbeh; Shabeeh, Husain; Cabaco, Ana R.; Martin, Katherine; Khan, Faisal; O’Gallagher, Kevin; Chowienczyk, Philip J.

    2017-01-01

    Mental stress-induced ischemia approximately doubles the risk of cardiac events in patients with coronary artery disease, yet the mechanisms underlying changes in coronary blood flow in response to mental stress are poorly characterized. Neuronal nitric oxide synthase (nNOS) regulates basal coronary blood flow in healthy humans and mediates mental stress-induced vasodilation in the forearm. However, its possible role in mental stress-induced increases in coronary blood flow is unknown. We studied 11 patients (6 men and 5 women, mean age: 58 ± 14 yr) undergoing elective diagnostic cardiac catheterization and assessed the vasodilator response to mental stress elicited by the Stroop color-word test. Intracoronary substance P (20 pmol/min) and isosorbide dinitrate (1 mg) were used to assess endothelium-dependent and -independent vasodilation, respectively. Coronary blood flow was estimated using intracoronary Doppler recordings and quantitative coronary angiography to measure coronary artery diameter. Mental stress increased coronary flow by 34 ± 7.0% over the preceding baseline during saline infusion (P coronary artery diameter by 6.9 ± 3.7% (P = 0.02) and 0.5 ± 2.8% (P = 0.51) in the presence of S-methyl-l-thiocitrulline. The response to substance P did not predict the response to mental stress (r2 = −0.22, P = 0.83). nNOS mediates the human coronary vasodilator response to mental stress, predominantly through actions at the level of coronary resistance vessels. NEW & NOTEWORTHY Acute mental stress induces vasodilation of the coronary microvasculature. Here, we show that this response involves neuronal nitric oxide synthase in the human coronary circulation. Listen to this article’s corresponding podcast at http://ajpheart.podbean.com/e/nnos-and-coronary-flow-during-mental-stress/. PMID:28646032

  8. Trimeric form of intracellular ATP synthase subunit β of Aggregatibacter actinomycetemcomitans binds human interleukin-1β.

    Annamari Paino

    Full Text Available Bacterial biofilms resist host defenses and antibiotics partly because of their decreased metabolism. Some bacteria use proinflammatory cytokines, such as interleukin (IL-1β, as cues to promote biofilm formation and to alter virulence. Although one potential bacterial IL-1β receptor has been identified, current knowledge of the bacterial IL-1β sensing mechanism is limited. In chronic biofilm infection, periodontitis, Aggregatibacter actinomycetemcomitans requires tight adherence (tad-locus to form biofilms, and tissue destroying active lesions contain more IL-1β than inactive ones. The effect of IL-1β on the metabolic activity of A. actinomycetemcomitans biofilm was tested using alamarBlue™. The binding of IL-1β to A. actinomycetemcomitans cells was investigated using transmission electron microscopy and flow cytometry. To identify the proteins which interacted with IL-1β, different protein fractions from A. actinomycetemcomitans were run in native-PAGE and blotted using biotinylated IL-1β and avidin-HRP, and identified using mass spectroscopy. We show that although IL-1β slightly increases the biofilm formation of A. actinomycetemcomitans, it reduces the metabolic activity of the biofilm. A similar reduction was observed with all tad-locus mutants except the secretin mutant, although all tested mutant strains as well as wild type strains bound IL-1β. Our results suggest that IL-1β might be transported into the A. actinomycetemcomitans cells, and the trimeric form of intracellular ATP synthase subunit β interacted with IL-1β, possibly explaining the decreased metabolic activity. Because ATP synthase is highly conserved, it might universally enhance biofilm resistance to host defense by binding IL-1β during inflammation.

  9. Thermodynamic and NMR analyses of NADPH binding to lipocalin-type prostaglandin D synthase

    Qin, Shubin [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Shimamoto, Shigeru [Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashi-Osaka, Osaka 577-8502 (Japan); Maruno, Takahiro; Kobayashi, Yuji [Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Kawahara, Kazuki; Yoshida, Takuya [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ohkubo, Tadayasu, E-mail: ohkubo@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2015-12-04

    Lipocalin-type prostaglandin D synthase (L-PGDS) is one of the most abundant proteins in human cerebrospinal fluid (CSF) with dual functions as a prostaglandin D{sub 2} (PGD{sub 2}) synthase and a transporter of lipophilic ligands. Recent studies revealed that L-PGDS plays important roles in protecting against various neuronal diseases induced by reactive oxygen species (ROS). However, the molecular mechanisms of such protective actions of L-PGDS remain unknown. In this study, we conducted thermodynamic and nuclear magnetic resonance (NMR) analyses, and demonstrated that L-PGDS binds to nicotinamide coenzymes, including NADPH, NADP{sup +}, and NADH. Although a hydrophilic ligand is not common for L-PGDS, these ligands, especially NADPH showed specific interaction with L-PGDS at the upper pocket of its ligand-binding cavity with an unusually bifurcated shape. The binding affinity of L-PGDS for NADPH was comparable to that previously reported for NADPH oxidases and NADPH in vitro. These results suggested that L-PGDS potentially attenuates the activities of NADPH oxidases through interaction with NADPH. Given that NADPH is the substrate for NADPH oxidases that play key roles in neuronal cell death by generating excessive ROS, these results imply a novel linkage between L-PGDS and ROS. - Highlights: • Interactions of L-PGDS with nicotinamide coenzymes were studied by ITC and NMR. • The binding affinity of L-PGDS was strongest to NADPH among nicotinamide coenzymes. • NADPH binds to the upper part of L-PGDS ligand-binding cavity. • L-PGDS binds to both lipophilic and hydrophilic ligands. • This study implies a novel linkage between L-PGDS and reactive oxygen species.

  10. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  12. Lack of Cross-Resistance of Imazaquin-Resistant Xanthium strumarium Acetolactate Synthase to Flumetsulam and Chlorimuron.

    Schmitzer, P. R.; Eilers, R. J.; Cseke, C.

    1993-09-01

    Acetolactate synthase (ALS) was isolated from a field population of cocklebur (Xanthium strumarium) that developed resistance to the herbicide Scepter following three consecutive years of application. The active ingredient of Scepter, imazaquin, gave an inhibitor concentration required to produce 50% inhibition of the enzyme activity that was more than 300 times greater for the resistant enzyme than for the wild-type cocklebur ALS. Tests with flumetsulam and chlorimuron show that the resistant ALS was not cross-resistant to these two other classes of ALS inhibitors.

  13. Hypothalamic glycogen synthase kinase 3β has a central role in the regulation of food intake and glucose metabolism

    Benzler, Jonas; Ganjam, Goutham K.; Krüger, Manon; Pinkenburg, Olaf; Kutschke, Maria; Stöhr, Sigrid; Steger, Juliane; Koch, Christiane E.; Ölkrug, Rebecca; Schwartz, Michael W.; Shepherd, Peter R.; Grattan, David R.; Tups, Alexander

    2012-01-01

    GSK3β (glycogen synthase kinase 3β) is a ubiquitous kinase that plays a key role in multiple intracellular signalling pathways, and increased GSK3β activity is implicated in disorders ranging from cancer to Alzheimer’s disease. In the present study, we provide the first evidence of increased hypothalamic signalling via GSK3β in leptin-deficient Lepob/ob mice and show that intracerebroventricular injection of a GSK3β inhibitor acutely improves glucose tolerance in these mice. The beneficial ef...

  14. Corn silk induces nitric oxide synthase in murine macrophages.

    Kim, Kyung A; Choi, Sang Kyu; Choi, Hye Seon

    2004-12-31

    Corn silk has been purified as an anticoagulant previously and the active component is a polysaccharide with a molecular mass of 135 kDa. It activates murine macrophages to induce nitric oxide synthase (NOS) and generate substantial amounts of NO in time and dose-dependent manners. It was detectable first at 15 h after stimulation by corn silk, peaked at 24 h, and undetectable by 48 h. Induction of NOS is inhibited by pyrolidine dithiocarbamate (PDTC) and genistein, an inhibitor of nuclear factor kappa B (NF-kappaB) and tyrosine kinase, respectively, indicating that iNOS stimulated by corn silk is associated with tyrosine kinase and NF-kappaB signaling pathways. IkappaB-alpha degradation was detectible at 10 min, and the level was restored at 120 min after treatment of corn silk. Corn silk induced nuclear translocation of NF-kappaB by phosphorylation and degradation of IkappaB-alpha.

  15. CTP synthase forms the cytoophidium in human hepatocellular carcinoma.

    Chang, Chia-Chun; Jeng, Yung-Ming; Peng, Min; Keppeke, Gerson Dierley; Sung, Li-Ying; Liu, Ji-Long

    2017-12-15

    CTP synthase (CTPS) can aggregate into an intracellular macrostructure, the cytoophidium, in various organisms including human cells. Previous studies have shown that assembly of human CTPS cytoophidia may be correlated with the cellular metabolic status, and is able to promote the activity of CTPS. A correlation between the cytoophidium and cancer metabolism has been proposed but not yet been revealed. In the current study we provide clear evidence of the presence of CTPS cytoophidia in various human cancers and some non-cancerous tissues. Moreover, among 203 tissue samples of hepatocellular carcinoma, 56 (28%) samples exhibited many cytoophidia, whereas no cytoophidia were detected in adjacent non-cancerous hepatocytes for all samples. Our findings suggest that the CTPS cytoophidium may participate in the adaptive metabolism of human hepatocellular carcinoma. Copyright © 2017. Published by Elsevier Inc.

  16. Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy

    Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte

    2014-01-01

    between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...

  17. Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.

    Anke Wittmann

    Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.

  18. The evolution of function in strictosidine synthase-like proteins.

    Hicks, Michael A; Barber, Alan E; Giddings, Lesley-Ann; Caldwell, Jenna; O'Connor, Sarah E; Babbitt, Patricia C

    2011-11-01

    The exponential growth of sequence data provides abundant information for the discovery of new enzyme reactions. Correctly annotating the functions of highly diverse proteins can be difficult, however, hindering use of this information. Global analysis of large superfamilies of related proteins is a powerful strategy for understanding the evolution of reactions by identifying catalytic commonalities and differences in reaction and substrate specificity, even when only a few members have been biochemically or structurally characterized. A comparison of >2500 sequences sharing the six-bladed β-propeller fold establishes sequence, structural, and functional links among the three subgroups of the functionally diverse N6P superfamily: the arylesterase-like and senescence marker protein-30/gluconolactonase/luciferin-regenerating enzyme-like (SGL) subgroups, representing enzymes that catalyze lactonase and related hydrolytic reactions, and the so-called strictosidine synthase-like (SSL) subgroup. Metal-coordinating residues were identified as broadly conserved in the active sites of all three subgroups except for a few proteins from the SSL subgroup, which have been experimentally determined to catalyze the quite different strictosidine synthase (SS) reaction, a metal-independent condensation reaction. Despite these differences, comparison of conserved catalytic features of the arylesterase-like and SGL enzymes with the SSs identified similar structural and mechanistic attributes between the hydrolytic reactions catalyzed by the former and the condensation reaction catalyzed by SS. The results also suggest that despite their annotations, the great majority of these >500 SSL sequences do not catalyze the SS reaction; rather, they likely catalyze hydrolytic reactions typical of the other two subgroups instead. This prediction was confirmed experimentally for one of these proteins. Copyright © 2011 Wiley-Liss, Inc.

  19. Intestinal nitric oxide synthase activity changes during experimental colon obstruction.

    Palásthy, Zsolt; Kaszaki, József; Lázár, György; Nagy, Sándor; Boros, Mihály

    2006-08-01

    The experiments in this study were designed to follow the time course of nitric oxide (NO) synthesis in the large bowel during acute mechanical ileus. Occlusion of the mid-transverse colon was maintained for 420 min in anesthetized dogs. Strain-gauge transducers were used to analyze motility changes on the hepatic and lienal flexures, respectively. Constitutive NO synthase (cNOS) and inducible NOS (iNOS) activities were determined in tissue biopsies, and plasma nitrite/nitrate (NOx) level was measured in the portal blood. Following completion of the baseline studies, the animals were treated with either 7-nitroindazole (7-NI, selective neuronal NOS inhibitor), or N-nitro-L-arginine (NNA, non-selective NOS inhibitor). In the sham-operated group the cNOS activities differed significantly in the oral and aboral tissue samples (oral: 102.9; versus aboral: 62.1 fmol/mg protein/min). The obstruction elicited a significant increase in portal NOx and elevated tissue inducible NO synthase (iNOS) activity. NNA treatment decreased the motility index in both intestinal segments for 60 min, but 120 min later the motility index was significantly elevated (2.5-fold increase in the oral part, and 1.8-fold enhancement in the aboral segment, respectively). Treatment with 7-NI decreased the cNOS activity in the oral and aboral parts by approximately 40% and 70%, respectively, and suppressed the motility increase in the aboral colon segment. The motility of the colon was either significantly increased or decreased, depending on the type and selectivity of the NOS inhibitor compounds applied. NO of neuronal origin is a transmitter that stimulates peristaltic activity; but an increased iNOS/nNOS ratio significantly moderates the obstruction-induced motility increase.

  20. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase

    Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.

    2016-01-01

    The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)

  2. Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.

    Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R

    1985-01-29

    Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.

  3. Rice terpene synthase 24 (OsTPS24) encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen.

    Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji

    2016-02-01

    Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. Copyright © 2015 Elsevier GmbH. All rights reserved.

  4. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...

  5. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  6. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  7. Molecular and Biochemical Analysis of Chalcone Synthase from Freesia hybrid in flavonoid biosynthetic pathway.

    Wei Sun

    Full Text Available Chalcone synthase (CHS catalyzes the first committed step in the flavonoid biosynthetic pathway. In this study, the cDNA (FhCHS1 encoding CHS from Freesia hybrida was successfully isolated and analyzed. Multiple sequence alignments showed that both the conserved CHS active site residues and CHS signature sequence were found in the deduced amino acid sequence of FhCHS1. Meanwhile, crystallographic analysis revealed that protein structure of FhCHS1 is highly similar to that of alfalfa CHS2, and the biochemical analysis results indicated that it has an enzymatic role in naringenin biosynthesis. Moreover, quantitative real-time PCR was performed to detect the transcript levels of FhCHS1 in flowers and different tissues, and patterns of FhCHS1 expression in flowers showed significant correlation to the accumulation patterns of anthocyanin during flower development. To further characterize the functionality of FhCHS1, its ectopic expression in Arabidopsis thaliana tt4 mutants and Petunia hybrida was performed. The results showed that overexpression of FhCHS1 in tt4 mutants fully restored the pigmentation phenotype of the seed coats, cotyledons and hypocotyls, while transgenic petunia expressing FhCHS1 showed flower color alteration from white to pink. In summary, these results suggest that FhCHS1 plays an essential role in the biosynthesis of flavonoid in Freesia hybrida and may be used to modify the components of flavonoids in other plants.

  8. Mitochondria and lipid raft-located FOF1-ATP synthase as major therapeutic targets in the antileishmanial and anticancer activities of ether lipid edelfosine.

    Janny A Villa-Pulgarín

    2017-08-01

    Full Text Available Leishmaniasis is the world's second deadliest parasitic disease after malaria, and current treatment of the different forms of this disease is far from satisfactory. Alkylphospholipid analogs (APLs are a family of anticancer drugs that show antileishmanial activity, including the first oral drug (miltefosine for leishmaniasis and drugs in preclinical/clinical oncology trials, but their precise mechanism of action remains to be elucidated.Here we show that the tumor cell apoptosis-inducer edelfosine was the most effective APL, as compared to miltefosine, perifosine and erucylphosphocholine, in killing Leishmania spp. promastigotes and amastigotes as well as tumor cells, as assessed by DNA breakdown determined by flow cytometry. In studies using animal models, we found that orally-administered edelfosine showed a potent in vivo antileishmanial activity and diminished macrophage pro-inflammatory responses. Edelfosine was also able to kill Leishmania axenic amastigotes. Edelfosine was taken up by host macrophages and killed intracellular Leishmania amastigotes in infected macrophages. Edelfosine accumulated in tumor cell mitochondria and Leishmania kinetoplast-mitochondrion, and led to mitochondrial transmembrane potential disruption, and to the successive breakdown of parasite mitochondrial and nuclear DNA. Ectopic expression of Bcl-XL inhibited edelfosine-induced cell death in both Leishmania parasites and tumor cells. We found that the cytotoxic activity of edelfosine against Leishmania parasites and tumor cells was associated with a dramatic recruitment of FOF1-ATP synthase into lipid rafts following edelfosine treatment in both parasites and cancer cells. Raft disruption and specific FOF1-ATP synthase inhibition hindered edelfosine-induced cell death in both Leishmania parasites and tumor cells. Genetic deletion of FOF1-ATP synthase led to edelfosine drug resistance in Saccharomyces cerevisiae yeast.The present study shows that the

  9. Structural and functional analysis of validoxylamine A 7'-phosphate synthase ValL involved in validamycin A biosynthesis.

    Lina Zheng

    Full Text Available Validamycin A (Val-A is an effective antifungal agent widely used in Asian countries as crop protectant. Validoxylamine A, the core structure and intermediate of Val-A, consists of two C(7-cyclitol units connected by a rare C-N bond. In the Val-A biosynthetic gene cluster in Streptomyces hygroscopicus 5008, the ORF valL was initially annotated as a validoxylamine A 7'-phosphate(V7P synthase, whose encoded 497-aa protein shows high similarity with trehalose 6-phosphate(T6P synthase. Gene inactivation of valL abolished both validoxylamine A and validamycin A productivity, and complementation with a cloned valL recovered 10% production of the wild-type in the mutant, indicating the involvement of ValL in validoxylamine A biosynthesis. Also we determined the structures of ValL and ValL/trehalose complex. The structural data indicates that ValL adopts the typical fold of GT-B protein family, featuring two Rossmann-fold domains and an active site at domain junction. The residues in the active site are arranged in a manner homologous to that of Escherichia coli (E.coli T6P synthase OtsA. However, a significant discrepancy is found in the active-site loop region. Also noticeable structural variance is found around the active site entrance in the apo ValL structure while the region takes an ordered configuration upon binding of product analog trehalose. Furthermore, the modeling of V7P in the active site of ValL suggests that ValL might have a similar SNi-like mechanism as OtsA.

  10. A new type of Na(+-driven ATP synthase membrane rotor with a two-carboxylate ion-coupling motif.

    Sarah Schulz

    Full Text Available The anaerobic bacterium Fusobacterium nucleatum uses glutamate decarboxylation to generate a transmembrane gradient of Na⁺. Here, we demonstrate that this ion-motive force is directly coupled to ATP synthesis, via an F₁F₀-ATP synthase with a novel Na⁺ recognition motif, shared by other human pathogens. Molecular modeling and free-energy simulations of the rotary element of the enzyme, the c-ring, indicate Na⁺ specificity in physiological settings. Consistently, activity measurements showed Na⁺ stimulation of the enzyme, either membrane-embedded or isolated, and ATP synthesis was sensitive to the Na⁺ ionophore monensin. Furthermore, Na⁺ has a protective effect against inhibitors targeting the ion-binding sites, both in the complete ATP synthase and the isolated c-ring. Definitive evidence of Na⁺ coupling is provided by two identical crystal structures of the c₁₁ ring, solved by X-ray crystallography at 2.2 and 2.6 Å resolution, at pH 5.3 and 8.7, respectively. Na⁺ ions occupy all binding sites, each coordinated by four amino acids and a water molecule. Intriguingly, two carboxylates instead of one mediate ion binding. Simulations and experiments demonstrate that this motif implies that a proton is concurrently bound to all sites, although Na⁺ alone drives the rotary mechanism. The structure thus reveals a new mode of ion coupling in ATP synthases and provides a basis for drug-design efforts against this opportunistic pathogen.

  11. Protective effects of a squalene synthase inhibitor, lapaquistat acetate (TAK-475), on statin-induced myotoxicity in guinea pigs

    Nishimoto, Tomoyuki; Ishikawa, Eiichiro; Anayama, Hisashi; Hamajyo, Hitomi; Nagai, Hirofumi; Hirakata, Masao; Tozawa, Ryuichi

    2007-01-01

    High-dose statin treatment has been recommended as a primary strategy for aggressive reduction of LDL cholesterol levels and protection against coronary artery disease. The effectiveness of high-dose statins may be limited by their potential for myotoxic side effects. There is currently little known about the molecular mechanisms of statin-induced myotoxicity. Previously we showed that T-91485, an active metabolite of the squalene synthase inhibitor lapaquistat acetate (lapaquistat: a previous name is TAK-475), attenuated statin-induced cytotoxicity in human skeletal muscle cells [Nishimoto, T., Tozawa, R., Amano, Y., Wada, T., Imura, Y., Sugiyama, Y., 2003a. Comparing myotoxic effects of squalene synthase inhibitor, T-91485, and 3-hydroxy-3-methylglutaryl coenzyme A. Biochem. Pharmacol. 66, 2133-2139]. In the current study, we investigated the effects of lapaquistat administration on statin-induced myotoxicity in vivo. Guinea pigs were treated with either high-dose cerivastatin (1 mg/kg) or cerivastatin together with lapaquistat (30 mg/kg) for 14 days. Treatment with cerivastatin alone decreased plasma cholesterol levels by 45% and increased creatine kinase (CK) levels by more than 10-fold (a marker of myotoxicity). The plasma CK levels positively correlated with the severity of skeletal muscle lesions as assessed by histopathology. Co-administration of lapaquistat almost completely prevented the cerivastatin-induced myotoxicity. Administration of mevalonolactone (100 mg/kg b.i.d.) prevented the cerivastatin-induced myotoxicity, confirming that this effect is directly related to HMG-CoA reductase inhibition. These results strongly suggest that cerivastatin-induced myotoxicity is due to depletion of mevalonate derived isoprenoids. In addition, squalene synthase inhibition could potentially be used clinically to prevent statin-induced myopathy

  12. GENEL İMALAT MALİYETLERİNİN DAĞITIMINDA FAALİYET ESASINA DAYALI MALİYETLEME SİSTEMİ VE ÇEVRESEL MALİYETLERİN DEĞERLENDİRİLMESİ

    Otlu, Fikret; Çukacı, Yusuf Cahit

    2010-01-01

    Özet: Bu çalışmada faaliyet esaslı maliyetleme sistemi ile gelenekselsistemlerin karşılaştırılması yapılmış olup, işletmelerin son yıllardakarşılaştıkları çevresel maliyetler hakkında bilgi verilerek, çevresel maliyetlerinbir genel imalat maliyeti olarak geleneksel ve faaliyet esasına dayalımaliyetleme sistemine göre dağıtımı bir örnek yardımıyla gösterilmiştir.Anahtar Kelimeler: Genel İmalat Maliyetleri, Geleneksel MaliyetlemeSistemleri, Faaliyet Esas...

  13. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  14. Emission and Accumulation of Monoterpene and the Key Terpene Synthase (TPS) Associated with Monoterpene Biosynthesis in Osmanthus fragrans Lour

    Zeng, Xiangling; Liu, Cai; Zheng, Riru; Cai, Xuan; Luo, Jing; Zou, Jingjing; Wang, Caiyun

    2016-01-01

    Osmanthus fragrans is an ornamental and economically important plant known for its magnificent aroma, and the most important aroma-active compounds in flowers are monoterpenes, mainly β-ocimene, linalool and linalool derivatives. To understand the molecular mechanism of monoterpene production, we analyzed the emission and accumulation patterns of these compounds and the transcript levels of the genes involved in their biosynthesis in two O. fragrans cultivars during flowering stages. The results showed that both emission and accumulation of monoterpenes varied with flower development and glycosylation had an important impact on floral linalool emission during this process. Gene expression demonstrated that the transcript levels of terpene synthase (TPS) genes probably played a key role in monoterpene production, compared to the genes in the MEP pathway. Phylogenetic analysis showed that OfTPS1 and OfTPS2 belonged to a TPS-g subfamily, and OfTPS3 and OfTPS4 clustered into a TPS-b subfamily. Their transient and stable expression in tobacco leaves suggested that OfTPS1 and OfTPS2 exclusively produced β-linalool, and trans-β-ocimene was the sole product from OfTPS3, while OfTPS4, a predictive sesquiterpene synthase, produced α-farnesene. These results indicate that OfTPS1, OfTPS2, and OfTPS3 could account for the major floral monoterpenes, linalool and trans-β-ocimene, produced in O. fragrans flowers. PMID:26793212

  15. Emission and accumulation of monoterpene and the key terpene synthase (TPS associated with monoterpene biosynthesis in Osmanthus fragrans Lour.

    Xaingling eZeng

    2016-01-01

    Full Text Available Osmanthus fragrans is an ornamental and economically important plant known for its magnificent aroma, and the most important aroma-active compounds in flowers are monoterpenes, mainly β-ocimene, linalool and linalool derivatives. To understand the molecular mechanism of monoterpene production, we analyzed the emission and accumulation patterns of these compounds and the transcript levels of the genes involved in their biosynthesis in two O. fragrans cultivars during flowering stages. The results showed that both emission and accumulation of monoterpenes varied with flower development and glycosylation had an important impact on floral linalool emission during this process. Gene expression demonstrated that the transcript levels of terpene synthase (TPS genes probably played a key role in monoterpene production, compared to the genes in the MEP pathway. Phylogenetic analysis showed that OfTPS1 and OfTPS2 belonged to a TPS-g subfamily, and OfTPS3 and OfTPS4 clustered into a TPS-b subfamily. Their transient and stable expression in tobacco leaves suggested that OfTPS1 and OfTPS2 exclusively produced β-linalool, and trans-β-ocimene was the sole product from OfTPS3, while OfTPS4, a predictive sesquiterpene synthase, produced α-farnesene. These results indicate that OfTPS1, OfTPS2 and OfTPS3 could account for the major floral monoterpenes, linalool and trans-β-ocimene, produced in O. fragrans flowers.

  16. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Human Mitochondrial HMG-CoA Synthase Deficiency: Role of Enzyme Dimerization Surface and Characterization of Three New Patients

    Beatriz Puisac

    2018-03-01

    Full Text Available Mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase deficiency (mitochondrial HMG-CoA synthase deficiency or mHS deficiency, OMIM #605911 is an inborn error of metabolism that affects ketone body synthesis. Acute episodes include vomiting, lethargy, hepatomegaly, hypoglycemia and dicarboxylic aciduria. The diagnosis is difficult due to the relatively unspecific clinical and biochemical presentation, and fewer than 30 patients have been described. This work describes three new patients with mHS deficiency and two missense mutations c.334C>T (p.R112W and c.430G>T (p.V144L previously not reported. We developed a new method to express and measure the activity of the enzyme and in this work the study is extended to ten new missense variants including those of our patients. Enzymatic assays showed that three of the mutant proteins retained some but seven completely lacked activity. The identification of a patient homozygous for a mutation that retains 70% of enzyme activity opens the door to a new interpretation of the disease by demonstrating that a modest impairment of enzyme function can actually produce symptoms. This is also the first study employing molecular dynamics modelling of the enzyme mutations. We show that the correct maintenance of the dimerization surface is crucial for retaining the structure of the active center and therefore the activity of the enzyme.

  18. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Requirement of the inducible nitric oxide synthase pathway for IL-1-induced osteoclastic bone resorption

    van't Hof, R. J.; Armour, K. J.; Smith, L. M.; Armour, K. E.; Wei, X. Q.; Liew, F. Y.; Ralston, S. H.

    2000-01-01

    Nitric oxide has been suggested to be involved in the regulation of bone turnover, especially in pathological conditions characterized by release of bone-resorbing cytokines. The cytokine IL-1 is thought to act as a mediator of periarticular bone loss and tissue damage in inflammatory diseases such as rheumatoid arthritis. IL-1 is a potent stimulator of both osteoclastic bone resorption and expression of inducible nitric oxide synthase (iNOS) in bone cells and other cell types. In this study, we investigated the role that the iNOS pathway plays in mediating the bone-resorbing effects of IL-1 by studying mice with targeted disruption of the iNOS gene. Studies in vitro and in vivo showed that iNOS-deficient mice exhibited profound defects of IL-1-induced osteoclastic bone resorption but responded normally to calciotropic hormones such as 1,25 dihydroxyvitamin D3 and parathyroid hormone. Immunohistochemical studies and electrophoretic mobility shift assays performed on bone marrow cocultures from iNOS-deficient mice showed abnormalities in IL-1-induced nuclear translocation of the p65 component of NFκB and in NFκB-DNA binding, which were reversed by treatment with the NO donor S-nitroso-acetyl penicillamine. These results show that the iNOS pathway is essential for IL-1-induced bone resorption and suggest that the effects of NO may be mediated by modulating IL-1-induced nuclear activation of NFκB in osteoclast precursors. PMID:10869429

  20. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Inhibitory effect of organotin compounds on rat neuronal nitric oxide synthase through interaction with calmodulin

    Ohashi, Koji; Kominami, Shiro; Yamazaki, Takeshi; Ohta, Shigeru; Kitamura, Shigeyuki

    2004-01-01

    Organotin compounds, triphenyltin (TPT), tributyltin, dibutyltin, and monobutyltin (MBT), showed potent inhibitory effects on both L-arginine oxidation to nitric oxide and L-citrulline, and cytochrome c reduction catalyzed by recombinant rat neuronal nitric oxide synthase (nNOS). The two inhibitory effects were almost parallel. MBT and TPT showed the highest inhibitory effects, followed by tributyltin and dibutyltin; TPT and MBT showed inhibition constant (IC 50 ) values of around 10 μM. Cytochrome c reduction activity was markedly decreased by removal of calmodulin (CaM) from the complete mixture, and the decrease was similar to the extent of inhibition by TPT and MBT. The inhibitory effect of MBT on the cytochrome c reducing activity was rapidly attenuated upon dilution of the inhibitor, and addition of a high concentration of CaM reactivated the cytochrome c reduction activity inhibited by MBT. However, other cofactors such as FAD, FMN or tetrahydrobiopterin had no such ability. The inhibitory effect of organotin compounds (100 μM) on L-arginine oxidation of nNOS almost vanished when the amount of CaM was sufficiently increased (150-300 μM). It was confirmed by CaM-agarose column chromatography that the dissociation of nNOS-CaM complex was induced by organotin compounds. These results indicate that organotin compounds disturb the interaction between CaM and nNOS, thereby inhibiting electron transfer from the reductase domain to cytochrome c and the oxygenase domain

  2. Requirement of the inducible nitric oxide synthase pathway for IL-1-induced osteoclastic bone resorption.

    van't Hof, R J; Armour, K J; Smith, L M; Armour, K E; Wei, X Q; Liew, F Y; Ralston, S H

    2000-07-05

    Nitric oxide has been suggested to be involved in the regulation of bone turnover, especially in pathological conditions characterized by release of bone-resorbing cytokines. The cytokine IL-1 is thought to act as a mediator of periarticular bone loss and tissue damage in inflammatory diseases such as rheumatoid arthritis. IL-1 is a potent stimulator of both osteoclastic bone resorption and expression of inducible nitric oxide synthase (iNOS) in bone cells and other cell types. In this study, we investigated the role that the iNOS pathway plays in mediating the bone-resorbing effects of IL-1 by studying mice with targeted disruption of the iNOS gene. Studies in vitro and in vivo showed that iNOS-deficient mice exhibited profound defects of IL-1-induced osteoclastic bone resorption but responded normally to calciotropic hormones such as 1,25 dihydroxyvitamin D3 and parathyroid hormone. Immunohistochemical studies and electrophoretic mobility shift assays performed on bone marrow cocultures from iNOS-deficient mice showed abnormalities in IL-1-induced nuclear translocation of the p65 component of NFkappaB and in NFkappaB-DNA binding, which were reversed by treatment with the NO donor S-nitroso-acetyl penicillamine. These results show that the iNOS pathway is essential for IL-1-induced bone resorption and suggest that the effects of NO may be mediated by modulating IL-1-induced nuclear activation of NFkappaB in osteoclast precursors.

  3. Glycogen Synthase Kinase-3 is involved in glycogen metabolism control and embryogenesis of Rhodnius prolixus.

    Mury, Flávia B; Lugon, Magda D; DA Fonseca, Rodrigo Nunes; Silva, Jose R; Berni, Mateus; Araujo, Helena M; Fontenele, Marcio Ribeiro; Abreu, Leonardo Araujo DE; Dansa, Marílvia; Braz, Glória; Masuda, Hatisaburo; Logullo, Carlos

    2016-10-01

    Rhodnius prolixus is a blood-feeding insect that transmits Trypanosoma cruzi and Trypanosoma rangeli to vertebrate hosts. Rhodnius prolixus is also a classical model in insect physiology, and the recent availability of R. prolixus genome has opened new avenues on triatomine research. Glycogen synthase kinase 3 (GSK-3) is classically described as a key enzyme involved in glycogen metabolism, also acting as a downstream component of the Wnt pathway during embryogenesis. GSK-3 has been shown to be highly conserved among several organisms, mainly in the catalytic domain region. Meanwhile, the role of GSK-3 during R. prolixus embryogenesis or glycogen metabolism has not been investigated. Here we show that chemical inhibition of GSK-3 by alsterpaullone, an ATP-competitive inhibitor of GSK3, does not affect adult survival rate, though it alters oviposition and egg hatching. Specific GSK-3 gene silencing by dsRNA injection in adult females showed a similar phenotype. Furthermore, bright field and 4'-6-diamidino-2-phenylindole (DAPI) staining analysis revealed that ovaries and eggs from dsGSK-3 injected females exhibited specific morphological defects. We also demonstrate that glycogen content was inversely related to activity and transcription levels of GSK-3 during embryogenesis. Lastly, after GSK-3 knockdown, we observed changes in the expression of the Wingless (Wnt) downstream target β-catenin as well as in members of other pathways such as the receptor Notch. Taken together, our results show that GSK-3 regulation is essential for R. prolixus oogenesis and embryogenesis.

  4. SCREENING OF 6-PYRUVOYL-TETRAHYDROPTERIN SYNTHASE ACTIVITY DEFICIENCY AMONG HYPERP HENYLALANINEMIC PATIENTS

    DURDI QUJEQ

    1999-10-01

    Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

  5. Mechanical Control of ATP Synthase Function: Activation Energy Difference between Tight and Loose Binding Sites

    Beke-Somfai, Tamás; Lincoln, Per; Nordén, Bengt

    2010-01-01

    Despite exhaustive chemical and crystal structure studies, the mechanistic details of how FoF1-ATP synthase can convert mechanical energy to chemical, producing ATP, are still not fully understood. On the basis of quantum mechanical calculations

  6. Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

    Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

    2001-01-01

    no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

  7. Citric acid production and citrate synthase genes in distinct strains of ...

    SAM

    2014-05-28

    May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

  8. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-01-01

    An oligonucleotide representing a regulatory element of human thymidylate synthase mRNA has been crystallized as a dimer. The structure of the asymmetric dimer has been determined at 1.97 Å resolution.

  9. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    2017-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  10. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  11. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  12. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  13. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  14. Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

    Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

    2015-01-01

    Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

  15. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  16. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  17. A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

    Maiko Furubayashi

    Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

  18. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  19. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases

    Blacklock, Brenda J.; Jaworski, Jan G.

    2006-01-01

    The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates

  1. Kinetics and equilibria of cyanide binding to prostaglandin H synthase.

    MacDonald, I D; Dunford, H B

    1989-09-01

    Cyanide binding to prostaglandin H (PGH) synthase results in a spectral shift in the Soret region. This shift was exploited to determine equilibrium and kinetic parameters of the cyanide binding process. At pH 8.0, ionic strength 0.22 M, 4 degrees C, the cyanide dissociation constant, determined from equilibrium experiments, is (65 +/- 10) microM. The binding rate constant is (2.8 +/- 0.2) x 10(3) M-1 s-1, and the dissociation rate constant is zero within experimental error. Through a kinetic study of the binding process as a function of pH, from pH 3.96 to 8.00, it was possible to determine the pKa of a heme-linked acid group on the enzyme of 4.15 +/- 0.10 with citrate buffer. An apparent pKa of 4.75 +/- 0.03 was determined with acetate buffer; this different value is attributed to complexation of the enzyme with one of the components of the acetate buffer.

  2. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  3. Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA)

    2011-01-01

    Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583

  4. Differential modulation of nitric oxide synthases in aging: therapeutic opportunities

    Stêfany Bruno De Assis Cau

    2012-06-01

    Full Text Available Vascular aging is the term that describes the structural and functional disturbances of the vasculature with advancing aging. The molecular mechanisms of aging-associated endothelial dysfunction are complex, but reduced nitric oxide (NO bioavailability and altered vascular expression and activity of NO synthase (NOS enzymes have been implicated as major players. Impaired vascular relaxation in aging has been attributed to reduced endothelial NOS (eNOS-derived NO, while increased inducible NOS (iNOS expression seems to account for nitrosative stress and disrupted vascular homeostasis. Although eNOS is considered the main source of NO in the vascular endothelium, neuronal NOS (nNOS also contributes to endothelial cells-derived NO, a mechanism that is reduced in aging. Pharmacological modulation of NO generation and expression/activity of NOS isoforms may represent a therapeutic alternative to prevent the progression of cardiovascular diseases. Accordingly, this review will focus on drugs that modulate NO bioavailability, such as nitrite anions and NO-releasing non-steroidal anti-inflammatory drugs, hormones (dehydroepiandrosterone and estrogen, statins, resveratrol and folic acid, since they may be useful to treat/to prevent aging-associated vascular dysfunction. The impact of these therapies on life quality in elderly and longevity will be discussed.

  5. Hyperbaric oxygen upregulates cochlear constitutive nitric oxide synthase

    Kao Ming-Ching

    2011-02-01

    Full Text Available Abstract Background Hyperbaric oxygen therapy (HBOT is a known adjuvant for treating ischemia-related inner ear diseases. Controversies still exist in the role of HBOT in cochlear diseases. Few studies to date have investigated the cellular changes that occur in inner ears after HBOT. Nitric oxide, which is synthesized by nitric oxide synthase (NOS, is an important signaling molecule in cochlear physiology and pathology. Here we investigated the effects of hyperbaric oxygen on eardrum morphology, cochlear function and expression of NOS isoforms in cochlear substructures after repetitive HBOT in guinea pigs. Results Minor changes in the eardrum were observed after repetitive HBOT, which did not result in a significant hearing threshold shift by tone burst auditory brainstem responses. A differential effect of HBOT on the expression of NOS isoforms was identified. Upregulation of constitutive NOS (nNOS and eNOS was found in the substructures of the cochlea after HBOT, but inducible NOS was not found in normal or HBOT animals, as shown by immunohistochemistry. There was no obvious DNA fragmentation present in this HBOT animal model. Conclusions The present evidence indicates that the customary HBOT protocol may increase constitutive NOS expression but such upregulation did not cause cell death in the treated cochlea. The cochlear morphology and auditory function are consequently not changed through the protocol.

  6. Comparative study of Chalcone synthase promoters across plant families

    Francisco Buitrago

    2009-07-01

    Full Text Available En la era post-genómica, el entendimiento de la regulación génica se ha convertido en un reto y una prioridad de investigación. En este trabajo realizamos un estudio comparativo de las secuencias reguladoras del gen de la chalcón sintetasa de varias familias botánicas. Veintidós secuencias de promotores de Chalcone Synthase fueron comparados teniendo en cuenta tres elementos Cis reguladores: Caja-G, Caja-H y Caja-TATA, que podrían estar actuando como una sola unidad cooperativa. Nuestra comparación muestra que estos elementos puede que se conserven en algunas especies e inclusive que se conserven a nivel de familia. Sin embargo, en algunas especies no todos los elementos Cis fueron encontrados, mostrando que no todas las especies se regulan bajo los mismos parámetros. Adicionalmente, una comparación entre promotores de una misma especie con una familia de multigenes Chs, mostró que los genes duplicados son variables en la composición del elemento Cis, sugiriendo que estos genes pueden estarse expresando de maneras diferentes.

  7. Inducible expression of trehalose synthase in Bacillus licheniformis.

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Phylogenomic and functional domain analysis of polyketide synthases in Fusarium

    Brown, Daren W.; Butchko, Robert A.; Baker, Scott E.; Proctor, Robert H.

    2012-02-01

    Fusarium species are ubiquitous in nature, cause a range of plant diseases, and produce a variety of chemicals often referred to as secondary metabolites. Although some fungal secondary metabolites affect plant growth or protect plants from other fungi and bacteria, their presence in grain based food and feed is more often associated with a variety of diseases in plants and in animals. Many of these structurally diverse metabolites are derived from a family of related enzymes called polyketide synthases (PKSs). A search of genomic sequence of Fusarium verticillioides, F. graminearum, F. oxysporum and Nectria haematococca (anamorph F. solani) identified a total of 58 PKS genes. To gain insight into how this gene family evolved and to guide future studies, we conducted a phylogenomic and functional domain analysis. The resulting genealogy suggested that Fusarium PKSs represent 34 different groups responsible for synthesis of different core metabolites. The analyses indicate that variation in the Fusarium PKS gene family is due to gene duplication and loss events as well as enzyme gain-of-function due to the acquisition of new domains or of loss-of-function due to nucleotide mutations. Transcriptional analysis indicate that the 16 F. verticillioides PKS genes are expressed under a range of conditions, further evidence that they are functional genes that confer the ability to produce secondary metabolites.

  9. Conservation and Role of Electrostatics in Thymidylate Synthase.

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C

    2015-11-27

    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  10. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  11. SUCROSE SYNTHASE: ELUCIDATION OF COMPLEX POST-TRANSLATIONAL REGULATORY MECHANISMS

    Steven C. Huber

    2009-05-12

    Studies have focused on the enzyme sucrose synthase, which plays an important role in the metabolism of sucrose in seeds and tubers. There are three isoforms of SUS in maize, referred to as SUS1, SUS-SH1, and SUS2. SUS is generally considered to be tetrameric protein but recent evidence suggests that SUS can also occur as a dimeric protein. The formation of tetrameric SUS is regulated by sucrose concentration in vitro and this could also be an important factor in the cellular localization of the protein. We found that high sucrose concentrations, which promote tetramer formation, also inhibit the binding of SUS1 to actin filaments in vitro. Previously, high sucrose concentrations were shown to promote SUS association with the plasma membrane. The specific regions of the SUS molecule involved in oligomerization are not known, but we identified a region of the SUS1 moelcule by bioinformatic analysis that was predicted to form a coiled coil. We demonstrated that this sequence could, in fact, self-associate as predicted for a coiled coil, but truncation analysis with the full-length recombinant protein suggested that it was not responsible for formation of dimers or tetramers. However, the coiled coil may function in binding of other proteins to SUS1. Overall, sugar availability may differentially influence the binding of SUS to cellular structures, and these effects may be mediated by changes in the oligomeric nature of the enzyme.

  12. Glycogen synthase kinase-3 regulation of urinary concentrating ability.

    Rao, Reena

    2012-09-01

    Glycogen synthase kinase-3 (GSK3) is an enzyme that is gaining prominence as a critical signaling molecule in the epithelial cells of renal tubules. This review will focus on recent findings exploring the role of GSK3 in renal collecting ducts, especially its role in urine concentration involving vasopressin signaling. Recent studies using inhibition or tissue-specific gene deletion of GSK3 revealed the mechanism by which GSK3 regulates aquaporin 2 water channels via adenylate cyclase or the prostaglandin-E2 pathway. In other studies, postnatal treatment with lithium, an inhibitor of GSK3, increased cell proliferation and led to microcyst formation in rat kidneys. These studies suggest that loss of GSK3 activity could interfere with renal water transport at two levels. In the short term, it could disrupt vasopressin signaling in collecting duct cells and in the long term it could alter the structure of the collecting ducts, making them less responsive to the hydro-osmotic effects of vasopressin. Ongoing studies reveal the crucial role played by GSK3 in the regulation of vasopressin action in the renal collecting ducts and suggest a possible use of GSK3 inhibitors in disease conditions associated with disrupted vasopressin signaling.

  13. Glycogen synthase kinase-3 regulates inflammatory tolerance in astrocytes

    Beurel, Eléonore; Jope, Richard S.

    2010-01-01

    Inflammatory tolerance is the down-regulation of inflammation upon repeated stimuli, which is well-established to occur in peripheral immune cells. However, less is known about inflammatory tolerance in the brain although it may provide an important protective mechanism from detrimental consequences of prolonged inflammation, which appears to occur in many psychiatric and neurodegenerative conditions. Array analysis of 308 inflammatory molecules produced by mouse primary astrocytes after two sequential stimulations with lipopolysaccharide (LPS) distinguished three classes, tolerant, sensitized and unaltered groups. For many of these inflammatory molecules, inhibition of glycogen synthase kinase-3 (GSK3) increased tolerance and reduced sensitization. Focusing on LPS-tolerance in interleukin-6 (IL-6) production, we found that microglia exhibited a strong tolerance response that matched that of macrophages, whereas astrocytes exhibited only partial tolerance. The astrocyte semi-tolerance was found to be regulated by GSK3. GSK3 inhibitors or knocking down GSK3 levels promoted LPS-tolerance and astrocytes expressing constitutively active GSK3 did not develop LPS-tolerance. These findings identify the critical role of GSK3 in counteracting IL-6 inflammatory tolerance in cells of the CNS, supporting the therapeutic potential of GSK3 inhibitors to reduce neuroinflammation by promoting tolerance. PMID:20553816

  14. Oxide Synthase Expression by p38 MAP Kinase

    Tuija Turpeinen

    2011-01-01

    Full Text Available The role of dual specificity phosphatase 1 (DUSP1 in inducible nitric oxide synthase (iNOS expression in A549 human pulmonary epithelial cells, J774 mouse macrophages and primary mouse bone marrow-derived macrophages (BMMs was investigated. iNOS expression was induced by a cytokine mixture (TNF, IFNγ and IL-1β in A549 cells and by LPS in J774 cells, and it was inhibited by p38 MAPK inhibitors SB202190 and BIRB 796. Stimulation with cytokine mixture or LPS enhanced also DUSP1 expression. Down-regulation of DUSP1 by siRNA increased p38 MAPK phosphorylation and iNOS expression in A549 and J774 cells. In addition, LPS-induced iNOS expression was enhanced in BMMs from DUSP1(−/− mice as compared to that in BMMs from wild-type mice. The results indicate that DUSP1 suppresses iNOS expression by limiting p38 MAPK activity in human and mouse cells. Compounds that enhance DUSP1 expression or modulate its function may be beneficial in diseases complicated with increased iNOS-mediated NO production.

  15. Mechanics of Cellulose Synthase Complexes in Living Plant Cells

    Zehfroosh, Nina; Liu, Derui; Ramos, Kieran P.; Yang, Xiaoli; Goldner, Lori S.; Baskin, Tobias I.

    The polymer cellulose is one of the major components of the world's biomass with unique and fascinating characteristics such as its high tensile strength, renewability, biodegradability, and biocompatibility. Because of these distinctive aspects, cellulose has been the subject of enormous scientific and industrial interest, yet there are still fundamental open questions about cellulose biosynthesis. Cellulose is synthesized by a complex of transmembrane proteins called ``Cellulose Synthase A'' (CESA) in the plasma membrane. Studying the dynamics and kinematics of the CESA complex will help reveal the mechanism of cellulose synthesis and permit the development and validation of models of CESA motility. To understand what drives these complexes through the cell membrane, we used total internal reflection fluorescence microscopy (TIRFM) and variable angle epi-fluorescence microscopy to track individual, fluorescently-labeled CESA complexes as they move in the hypocotyl and root of living plants. A mean square displacement analysis will be applied to distinguish ballistic, diffusional, and other forms of motion. We report on the results of these tracking experiments. This work was funded by NSF/PHY-1205989.

  16. CTP limitation increases expression of CTP synthase in Lactococcus lactis

    Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...

  17. The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species- and strain-dependent genome context variation

    Harris, Abigail K P; Williamson, Neil R; Slater, Holly

    2004-01-01

    The prodigiosin biosynthesis gene cluster (pig cluster) from two strains of Serratia (S. marcescens ATCC 274 and Serratia sp. ATCC 39006) has been cloned, sequenced and expressed in heterologous hosts. Sequence analysis of the respective pig clusters revealed 14 ORFs in S. marcescens ATCC 274...... and 15 ORFs in Serratia sp. ATCC 39006. In each Serratia species, predicted gene products showed similarity to polyketide synthases (PKSs), non-ribosomal peptide synthases (NRPSs) and the Red proteins of Streptomyces coelicolor A3(2). Comparisons between the two Serratia pig clusters and the red cluster...... from Str. coelicolor A3(2) revealed some important differences. A modified scheme for the biosynthesis of prodigiosin, based on the pathway recently suggested for the synthesis of undecylprodigiosin, is proposed. The distribution of the pig cluster within several Serratia sp. isolates is demonstrated...

  18. Relationship of tightly bound ADP and ATP to control and catalysis by chloroplast ATP synthase

    Zhou, J.; Xue, Z.; Du, Z.; Melese, T.; Boyer, P.D.

    1988-07-12

    Whether the tightly bound ADP that can cause a pronounced inhibition of ATP hydrolysis by the chloroplast ATP synthase and F/sub 1/ ATPase (CF/sub 1/) is bound at catalytic sites or at noncatalytic regulatory sites or both has been uncertain. The authors have used photolabeling by 2-azido-ATP and 2-azido-ADP to ascertain the location, with Mg/sup 2 +/ activation, of tightly bound ADP (a) that inhibits the hydrolysis of ATP by chloroplast ATP synthase, (b) that can result in an inhibited form of CF/sub 1/ that slowly regains activity during ATP hydrolysis, and (c) that arises when low concentrations of ADP markedly inhibit the hydrolysis of GTP by CF/sub 1/. The data show that in all instances the inhibition is associated with ADP binding without inorganic phosphate (P/sub i/) at catalytic sites. After photophosphorylation of ADP or 2-azido-ADP with (/sup 32/P)P/sub i/, similar amounts of the corresponding triphosphates are present on washed thylakoid membranes. Trials with appropriately labeled substrates show that a small portion of the tightly bound 2-azido-ATP gives rise to covalent labeling with an ATP moiety at noncatalytic sites but that most of the bound 2-azido-ATP gives rise to covalent labeling with an ATP moiety at noncatalytic sites but that most of the bound 2-azido-ATP gives rise to covalent labeling by an ADP moiety at a catalytic site. They also report the occurrence of a 1-2-min delay in the onset of the Mg/sup 2 +/-induced inhibition after addition of CF/sub 1/ to solutions containing Mg/sup 2 +/ and ATP, and that this delay is not associated with the filling of noncatalytic sites. A rapid burst of P/sub i/ formation is followed by a much lower, constant steady-state rate. The burst is not observed with GTP as a substrate or with Ca/sup 2 +/ as the activating cation.

  19. A specific and potent inhibitor of glucosylceramide synthase for substrate inhibition therapy of Gaucher disease.

    McEachern, Kerry Anne; Fung, John; Komarnitsky, Svetlana; Siegel, Craig S; Chuang, Wei-Lien; Hutto, Elizabeth; Shayman, James A; Grabowski, Gregory A; Aerts, Johannes M F G; Cheng, Seng H; Copeland, Diane P; Marshall, John

    2007-07-01

    An approach to treating Gaucher disease is substrate inhibition therapy which seeks to abate the aberrant lysosomal accumulation of glucosylceramide. We have identified a novel inhibitor of glucosylceramide synthase (Genz-112638) and assessed its activity in a murine model of Gaucher disease (D409V/null). Biochemical characterization of Genz-112638 showed good potency (IC(50) approximately 24nM) and specificity against the target enzyme. Mice that received drug prior to significant accumulation of substrate (10 weeks of age) showed reduced levels of glucosylceramide and number of Gaucher cells in the spleen, lung and liver when compared to age-matched control animals. Treatment of older mice that already displayed significant amounts of tissue glucosylceramide (7 months old) resulted in arrest of further accumulation of the substrate and appearance of additional Gaucher cells in affected organs. These data indicate that substrate inhibition therapy with Genz-112638 represents a viable alternate approach to enzyme therapy to treat the visceral pathology in Gaucher disease.

  20. Glycogen synthase kinase-3β ablation limits pancreatitis-induced acinar-to-ductal metaplasia.

    Ding, Li; Liou, Geou-Yarh; Schmitt, Daniel M; Storz, Peter; Zhang, Jin-San; Billadeau, Daniel D

    2017-09-01

    Acinar-to-ductal metaplasia (ADM) is a reversible epithelial transdifferentiation process that occurs in the pancreas in response to acute inflammation. ADM can rapidly progress towards pre-malignant pancreatic intraepithelial neoplasia (PanIN) lesions in the presence of mutant KRas and ultimately pancreatic adenocarcinoma (PDAC). In the present work, we elucidate the role and related mechanism of glycogen synthase kinase-3beta (GSK-3β) in ADM development using in vitro 3D cultures and genetically engineered mouse models. We show that GSK-3β promotes TGF-α-induced ADM in 3D cultured primary acinar cells, whereas deletion of GSK-3β attenuates caerulein-induced ADM formation and PanIN progression in Kras G12D transgenic mice. Furthermore, we demonstrate that GSK-3β ablation influences ADM formation and PanIN progression by suppressing oncogenic KRas-driven cell proliferation. Mechanistically, we show that GSK-3β regulates proliferation by increasing the activation of S6 kinase. Taken together, these results indicate that GSK-3β participates in early pancreatitis-induced ADM and thus could be a target for the treatment of chronic pancreatitis and the prevention of PDAC progression. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  1. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  2. Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.

    Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng

    2015-09-01

    Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.

  3. UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

    Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

    1989-01-01

    A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

  4. Functional Disruption of a Chloroplast Pseudouridine Synthase Desensitizes Arabidopsis Plants to Phosphate Starvation

    Shan Lu

    2017-08-01

    Full Text Available Phosphate (Pi deficiency is a common nutritional stress of plants in both agricultural and natural ecosystems. Plants respond to Pi starvation in the environment by triggering a suite of biochemical, physiological, and developmental changes that increase survival and growth. The key factors that determine plant sensitivity to Pi starvation, however, are unclear. In this research, we identified an Arabidopsis mutant, dps1, with greatly reduced sensitivity to Pi starvation. The dps1 phenotypes are caused by a mutation in the previously characterized SVR1 (SUPPRESSION OF VARIAGATION 1 gene, which encodes a chloroplast-localized pseudouridine synthase. The mutation of SVR1 results in defects in chloroplast rRNA biogenesis, which subsequently reduces chloroplast translation. Another mutant, rps5, which contains a mutation in the chloroplast ribosomal protein RPS5 and has reduced chloroplast translation, also displayed decreased sensitivity to Pi starvation. Furthermore, wild type plants treated with lincomycin, a chemical inhibitor of chloroplast translation, showed similar growth phenotypes and Pi starvation responses as dps1 and rps5. These results suggest that impaired chloroplast translation desensitizes plants to Pi starvation. Combined with previously published results showing that enhanced leaf photosynthesis augments plant responses to Pi starvation, we propose that the decrease in responses to Pi starvation in dps1, rps5, and lincomycin-treated plants is due to their reduced demand for Pi input from the environment.

  5. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9.

    Lin, I Winnie; Sosso, Davide; Chen, Li-Qing; Gase, Klaus; Kim, Sang-Gyu; Kessler, Danny; Klinkenberg, Peter M; Gorder, Molly K; Hou, Bi-Huei; Qu, Xiao-Qing; Carter, Clay J; Baldwin, Ian T; Frommer, Wolf B

    2014-04-24

    Angiosperms developed floral nectaries that reward pollinating insects. Although nectar function and composition have been characterized, the mechanism of nectar secretion has remained unclear. Here we identify SWEET9 as a nectary-specific sugar transporter in three eudicot species: Arabidopsis thaliana, Brassica rapa (extrastaminal nectaries) and Nicotiana attenuata (gynoecial nectaries). We show that SWEET9 is essential for nectar production and can function as an efflux transporter. We also show that sucrose phosphate synthase genes, encoding key enzymes for sucrose biosynthesis, are highly expressed in nectaries and that their expression is also essential for nectar secretion. Together these data are consistent with a model in which sucrose is synthesized in the nectary parenchyma and subsequently secreted into the extracellular space via SWEET9, where sucrose is hydrolysed by an apoplasmic invertase to produce a mixture of sucrose, glucose and fructose. The recruitment of SWEET9 for sucrose export may have been a key innovation, and could have coincided with the evolution of core eudicots and contributed to the evolution of nectar secretion to reward pollinators.

  6. Functions of Ceramide Synthase Paralogs YPR114w and YJR116w of Saccharomyces cerevisiae.

    Shamroop K Mallela

    Full Text Available Ceramide is synthesized in yeast by two redundant acyl-CoA dependent synthases, Lag1 and Lac1. In lag1∆ lac1∆ cells, free fatty acids and sphingoid bases are elevated, and ceramides are produced through the redundant alkaline ceramidases Ypc1 and Ydc1, working backwards. Even with all four of these genes deleted, cells are surviving and continue to contain small amounts of complex sphingolipids. Here we show that these residual sphingolipids are not synthesized by YPR114w or YJR116w, proteins of unknown function showing a high degree of homology to Lag1 and Lac1. Indeed, the hextuple lag1∆ lac1∆ ypc1∆ ydc1∆ ypr114w∆ yjr116w∆ mutant still contains ceramides and complex sphingolipids. Yjr116w∆ exhibit an oxygen-dependent hypersensitivity to Cu2+ due to an increased mitochondrial production of reactive oxygen species (ROS and a mitochondrially orchestrated programmed cell death in presence of copper, but also a general copper hypersensitivity that cannot be counteracted by the antioxidant N-acetyl-cysteine (NAC. Myriocin efficiently represses the synthesis of sphingoid bases of ypr114w∆, but not its growth. Both yjr116w∆ and ypr114w∆ have fragmented vacuoles and produce less ROS than wild type, before and after diauxic shift. Ypr114w∆/ypr114w∆ have an increased chronological life span. Thus, Yjr116w and Ypr114w are related, but not functionally redundant.

  7. Thromboxane synthase suppression induces lung cancer cell apoptosis via inhibiting NF-κB

    Leung, Kin Chung; Li, Ming-Yue; Leung, Billy C.S.; Hsin, Michael K.Y.; Mok, Tony S.K.; Underwood, Malcolm J.; Chen, George G.

    2010-01-01

    Accumulating evidence shows that the inhibition of thromboxane synthase (TXS) induced apoptosis in cancer cells. TXS inhibitor 1-Benzylimidzole (1-BI) can trigger apoptosis in lung cancer cells but the mechanism is not fully defined. In this study, lung cancer cells were treated with 1-BI. In this study, the level of reactive oxygen species (ROS) was measured and NF-κB activity was determined in human lung cancer cells. The roles of ROS and NF-κB in 1-BI-mediated cell death were analyzed. The results showed that 1-BI induced ROS generation but decreased the activity of NF-κB by reducing phosphorylated IκBα (p-IκBα) and inhibiting the translocation of p65 into the nucleus. In contrast to 1-BI, antioxidant N-acetyl cysteine (NAC) stimulated cell proliferation and significantly protected the cells from 1-BI-mediated cell death by neutralizing ROS. Collectively, apoptosis induced by 1-BI is associated with the over-production of ROS and the reduction of NF-κB. Antioxidants can significantly block the inhibitory effect of 1-BI.

  8. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  9. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis1[OPEN

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E.; Chen, Ming; Zhou, Yongming; Yu, Bin

    2015-01-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. PMID:26048882

  10. Insulin Induces an Increase in Cytosolic Glucose Levels in 3T3-L1 Cells with Inhibited Glycogen Synthase Activation

    Helena H. Chowdhury

    2014-10-01

    Full Text Available Glucose is an important source of energy for mammalian cells and enters the cytosol via glucose transporters. It has been thought for a long time that glucose entering the cytosol is swiftly phosphorylated in most cell types; hence the levels of free glucose are very low, beyond the detection level. However, the introduction of new fluorescence resonance energy transfer-based glucose nanosensors has made it possible to measure intracellular glucose more accurately. Here, we used the fluorescent indicator protein (FLIPglu-600µ to monitor cytosolic glucose dynamics in mouse 3T3-L1 cells in which glucose utilization for glycogen synthesis was inhibited. The results show that cells exhibit a low resting cytosolic glucose concentration. However, in cells with inhibited glycogen synthase activation, insulin induced a robust increase in cytosolic free glucose. The insulin-induced increase in cytosolic glucose in these cells is due to an imbalance between the glucose transported into the cytosol and the use of glucose in the cytosol. In untreated cells with sensitive glycogen synthase activation, insulin stimulation did not result in a change in the cytosolic glucose level. This is the first report of dynamic measurements of cytosolic glucose levels in cells devoid of the glycogen synthesis pathway.

  11. Kernel based machine learning algorithm for the efficient prediction of type III polyketide synthase family of proteins

    Mallika V

    2010-03-01

    Full Text Available Type III Polyketide synthases (PKS are family of proteins considered to have significant role in the biosynthesis of various polyketides in plants, fungi and bacteria. As these proteins show positive effects to human health, more researches are going on regarding this particular protein. Developing a tool to identify the probability of sequence, being a type III polyketide synthase will minimize the time consumption and manpower efforts. In this approach, we have designed and implemented PKSIIIpred, a high performance prediction server for type III PKS where the classifier is Support Vector Machine (SVM. Based on the limited training dataset, the tool efficiently predicts the type III PKS superfamily of proteins with high sensitivity and specificity. PKSIIIpred is available at http://type3pks.in/prediction/. We expect that this tool may serve as a useful resource for type III PKS researchers. Currently work is being progressed for further betterment of prediction accuracy by including more sequence features in the training dataset.

  12. Interaction between Polyketide Synthase and Transporter Suggests Coupled Synthesis and Export of Virulence Lipid in M. tuberculosis.

    2005-09-01

    Full Text Available Virulent mycobacteria utilize surface-exposed polyketides to interact with host cells, but the mechanism by which these hydrophobic molecules are transported across the cell envelope to the surface of the bacteria is poorly understood. Phthiocerol dimycocerosate (PDIM, a surface-exposed polyketide lipid necessary for Mycobacterium tuberculosis virulence, is the product of several polyketide synthases including PpsE. Transport of PDIM requires MmpL7, a member of the MmpL family of RND permeases. Here we show that a domain of MmpL7 biochemically interacts with PpsE, the first report of an interaction between a biosynthetic enzyme and its cognate transporter. Overexpression of the interaction domain of MmpL7 acts as a dominant negative to PDIM synthesis by poisoning the interaction between synthase and transporter. This suggests that MmpL7 acts in complex with the synthesis machinery to efficiently transport PDIM across the cell membrane. Coordination of synthesis and transport may not only be a feature of MmpL-mediated transport in M. tuberculosis, but may also represent a general mechanism of polyketide export in many different microorganisms.

  13. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    Chang, Soo-Ik; Hammes, G.G.

    1989-01-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  14. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

    2008-01-01

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  15. An ATP synthase harboring an atypical γ-subunit is involved in ATP synthesis in tomato fruit chromoplasts.

    Pateraki, Irini; Renato, Marta; Azcón-Bieto, Joaquín; Boronat, Albert

    2013-04-01

    Chromoplasts are non-photosynthetic plastids specialized in the synthesis and accumulation of carotenoids. During fruit ripening, chloroplasts differentiate into photosynthetically inactive chromoplasts in a process characterized by the degradation of the thylakoid membranes, and by the active synthesis and accumulation of carotenoids. This transition renders chromoplasts unable to photochemically synthesize ATP, and therefore these organelles need to obtain the ATP required for anabolic processes through alternative sources. It is widely accepted that the ATP used for biosynthetic processes in non-photosynthetic plastids is imported from the cytosol or is obtained through glycolysis. In this work, however, we show that isolated tomato (Solanum lycopersicum) fruit chromoplasts are able to synthesize ATP de novo through a respiratory pathway using NADPH as an electron donor. We also report the involvement of a plastidial ATP synthase harboring an atypical γ-subunit induced during ripening, which lacks the regulatory dithiol domain present in plant and algae chloroplast γ-subunits. Silencing of this atypical γ-subunit during fruit ripening impairs the capacity of isolated chromoplast to synthesize ATP de novo. We propose that the replacement of the γ-subunit present in tomato leaf and green fruit chloroplasts by the atypical γ-subunit lacking the dithiol domain during fruit ripening reflects evolutionary changes, which allow the operation of chromoplast ATP synthase under the particular physiological conditions found in this organelle. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  16. The effect of inoculation with mycorrhizal arbuscular fungi on expression of limonene synthase in Mentha spicata L. genotypes

    Leila Shabani

    2015-03-01

    Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.

  17. Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak

    Marić Slađana

    2005-01-01

    Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.

  18. New procedures to measure synthase and phosphatase activities of bis-phosphoglycerate mutase. Interest for development of therapeutic drugs

    Ravel, P.; Garel, M.C.; Toullec, D.

    1997-01-01

    In red blood cells, a modulation of the level of the allosteric effector of hemoglobin, 2,3-diphosphoglycerate (2,3-DPG) would have implications in the treatment of ischemia and sickle cell anemia. Its concentrations is determined by the relative activities of the synthase and phosphatase reactions of the multifunctional bis-phosphoglycerate mutase (BPGM). In this report we develop first a more direct synthase assay which uses glyceraldehyde phosphate to suppress the aldolase and triose phosphate isomerase reactions. Secondly we propose a radioactive phosphatase assay coupled to chromatographic separation and identification of the reaction products by paper electrophoresis. Such identification of these products allows us to show that the multifunctional BPGM expresses its mutase instead of its phosphatase activity in conditions of competition between the 3-phosphoglycerate and the 2-phospho-glycolate activator in the phosphatase reaction. These two more precise procedures could be used to study the effects of substrate and cofactor analogues regarding potential therapeutic approaches and could be used for clinical analyses to detect deficiency of BPGM. (author)

  19. Structural basis for substrate activation and regulation by cystathionine beta-synthase (CBS) domains in cystathionine [beta]-synthase

    Koutmos, Markos; Kabil, Omer; Smith, Janet L.; Banerjee, Ruma (Michigan-Med)

    2011-08-17

    The catalytic potential for H{sub 2}S biogenesis and homocysteine clearance converge at the active site of cystathionine {beta}-synthase (CBS), a pyridoxal phosphate-dependent enzyme. CBS catalyzes {beta}-replacement reactions of either serine or cysteine by homocysteine to give cystathionine and water or H{sub 2}S, respectively. In this study, high-resolution structures of the full-length enzyme from Drosophila in which a carbanion (1.70 {angstrom}) and an aminoacrylate intermediate (1.55 {angstrom}) have been captured are reported. Electrostatic stabilization of the zwitterionic carbanion intermediate is afforded by the close positioning of an active site lysine residue that is initially used for Schiff base formation in the internal aldimine and later as a general base. Additional stabilizing interactions between active site residues and the catalytic intermediates are observed. Furthermore, the structure of the regulatory 'energy-sensing' CBS domains, named after this protein, suggests a mechanism for allosteric activation by S-adenosylmethionine.

  20. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  1. Inhibition of inducible Nitric Oxide Synthase by a mustard gas analog in murine macrophages

    Smith Milton

    2006-11-01

    Full Text Available Abstract Background 2-Chloroethyl ethyl sulphide (CEES is a sulphur vesicating agent and an analogue of the chemical warfare agent 2,2'-dichlorodiethyl sulphide, or sulphur mustard gas (HD. Both CEES and HD are alkylating agents that influence cellular thiols and are highly toxic. In a previous publication, we reported that lipopolysaccharide (LPS enhances the cytotoxicity of CEES in murine RAW264.7 macrophages. In the present investigation, we studied the influence of CEES on nitric oxide (NO production in LPS stimulated RAW264.7 cells since NO signalling affects inflammation, cell death, and wound healing. Murine macrophages stimulated with LPS produce NO almost exclusively via inducible nitric oxide synthase (iNOS activity. We suggest that the influence of CEES or HD on the cellular production of NO could play an important role in the pathophysiological responses of tissues to these toxicants. In particular, it is known that macrophage generated NO synthesised by iNOS plays a critical role in wound healing. Results We initially confirmed that in LPS stimulated RAW264.7 macrophages NO is exclusively generated by the iNOS form of nitric oxide synthase. CEES treatment inhibited the synthesis of NO (after 24 hours in viable LPS-stimulated RAW264.7 macrophages as measured by either nitrite secretion into the culture medium or the intracellular conversion of 4,5-diaminofluorescein diacetate (DAF-2DA or dichlorofluorescin diacetate (DCFH-DA. Western blots showed that CEES transiently decreased the expression of iNOS protein; however, treatment of active iNOS with CEES in vitro did not inhibit its enzymatic activity Conclusion CEES inhibits NO production in LPS stimulated macrophages by decreasing iNOS protein expression. Decreased iNOS expression is likely the result of CEES induced alteration in the nuclear factor kappa B (NF-κB signalling pathway. Since NO can act as an antioxidant, the CEES induced down-regulation of iNOS in LPS

  2. Cellulose synthase complex organization and cellulose microfibril structure.

    Turner, Simon; Kumar, Manoj

    2018-02-13

    Cellulose consists of linear chains of β-1,4-linked glucose units, which are synthesized by the cellulose synthase complex (CSC). In plants, these chains associate in an ordered manner to form the cellulose microfibrils. Both the CSC and the local environment in which the individual chains coalesce to form the cellulose microfibril determine the structure and the unique physical properties of the microfibril. There are several recent reviews that cover many aspects of cellulose biosynthesis, which include trafficking of the complex to the plasma membrane and the relationship between the movement of the CSC and the underlying cortical microtubules (Bringmann et al. 2012 Trends Plant Sci. 17 , 666-674 (doi:10.1016/j.tplants.2012.06.003); Kumar & Turner 2015 Phytochemistry 112 , 91-99 (doi:10.1016/j.phytochem.2014.07.009); Schneider et al. 2016 Curr. Opin. Plant Biol. 34 , 9-16 (doi:10.1016/j.pbi.2016.07.007)). In this review, we will focus on recent advances in cellulose biosynthesis in plants, with an emphasis on our current understanding of the structure of individual catalytic subunits together with the local membrane environment where cellulose synthesis occurs. We will attempt to relate this information to our current knowledge of the structure of the cellulose microfibril and propose a model in which variations in the structure of the CSC have important implications for the structure of the cellulose microfibril produced.This article is part of a discussion meeting issue 'New horizons for cellulose nanotechnology'. © 2017 The Author(s).

  3. On the function of chitin synthase extracellular domains in biomineralization.

    Weiss, Ingrid M; Lüke, Florian; Eichner, Norbert; Guth, Christina; Clausen-Schaumann, Hauke

    2013-08-01

    Molluscs with various shell architectures evolved around 542-525 million years ago, as part of a larger phenomenon related to the diversification of metazoan phyla. Molluscs deposit minerals in a chitin matrix. The mollusc chitin is synthesized by transmembrane enzymes that contain several unique extracellular domains. Here we investigate the assembly mechanism of the chitin synthase Ar-CS1 via its extracellular domain ArCS1_E22. The corresponding transmembrane protein ArCS1_E22TM accumulates in membrane fractions of the expression host Dictyostelium discoideum. Soluble recombinant ArCS1_E22 proteins can be purified as monomers only at basic pH. According to confocal fluorescence microscopy experiments, immunolabeled ArCS1_E22 proteins adsorb preferably to aragonitic nacre platelets at pH 7.75. At pH 8.2 or pH 9.0 the fluorescence signal is less intense, indicating that protein-mineral interaction is reduced with increasing pH. Furthermore, ArCS1_E22 forms regular nanostructures on cationic substrates as revealed by atomic force microscopy (AFM) experiments on modified mica cleavage planes. These experiments suggest that the extracellular domain ArCS1_E22 is involved in regulating the multiple enzyme activities of Ar-CS1 such as chitin synthesis and myosin movements by interaction with mineral surfaces and eventually by protein assembly. The protein complexes could locally probe the status of mineralization according to pH unless ions and pCO2 are balanced with suitable buffer substances. Taking into account that the intact enzyme could act as a force sensor, the results presented here provide further evidence that shell formation is coordinated physiologically with precise adjustment of cellular activities to the structure, topography and stiffness at the mineralizing interface. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Discriminating the reaction types of plant type III polyketide synthases.

    Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu

    2017-07-01

    Functional prediction of paralogs is challenging in bioinformatics because of rapid functional diversification after gene duplication events combined with parallel acquisitions of similar functions by different paralogs. Plant type III polyketide synthases (PKSs), producing various secondary metabolites, represent a paralogous family that has undergone gene duplication and functional alteration. Currently, there is no computational method available for the functional prediction of type III PKSs. We developed a plant type III PKS reaction predictor, pPAP, based on the recently proposed classification of type III PKSs. pPAP combines two kinds of similarity measures: one calculated by profile hidden Markov models (pHMMs) built from functionally and structurally important partial sequence regions, and the other based on mutual information between residue positions. pPAP targets PKSs acting on ring-type starter substrates, and classifies their functions into four reaction types. The pHMM approach discriminated two reaction types with high accuracy (97.5%, 39/40), but its accuracy decreased when discriminating three reaction types (87.8%, 43/49). When combined with a correlation-based approach, all 49 PKSs were correctly discriminated, and pPAP was still highly accurate (91.4%, 64/70) even after adding other reaction types. These results suggest pPAP, which is based on linear discriminant analyses of similarity measures, is effective for plant type III PKS function prediction. pPAP is freely available at ftp://ftp.genome.jp/pub/tools/ppap/. goto@kuicr.kyoto-u.ac.jp. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  5. Pharmacological modulation of human platelet leukotriene C4-synthase.

    Sala, A; Folco, G; Henson, P M; Murphy, R C

    1997-03-21

    The aim of this study was to test if human platelet leukotriene C4-synthase (LTC4-S) is pharmacologically different from cloned and expressed LTC4-S and, in light of the significant homologies between 5-lipoxygenase activating protein (FLAP) and LTC4-S, if different potencies of leukotriene synthesis inhibitors acting through binding with FLAP (FLAP inhibitors) reflect in different potencies as LTC4-S inhibitors. Leukotriene C4 (LTC4) synthesis by washed human platelets supplemented with synthetic leukotriene A4 (LTA4) was studied in the absence and presence of two different, structurally unrelated FLAP inhibitors (MK-886 and BAY-X1005) as well as a direct 5-lipoxygenase inhibitor (zileuton). LTC4 production was analyzed by RP-HPLC coupled to diode array detection. We report that human platelet LTC4-S was inhibited by MK-886 and BAY-X1005 (IC50 of 4.7 microM and 91.2 microM, respectively), but not by zileuton (inactive up to 300 microM); all 3 compounds were able to inhibit 5-lipoxygenase metabolite biosynthesis in intact human polymorphonuclear leukocytes (IC50 of 0.044 microM, 0.85 microM, and 1.5 microM, respectively). Platelet LTC4-S does not appear pharmacologically different from expression cloned LTC4-S. LTC4-S inhibition by FLAP inhibitors is in agreement with the significant homology reported for expression-cloned LTC4-S with FLAP, Furthermore, functional homology of the binding sites for inhibitors on LTC4-S and FLAP is suggested by the conservation of the relative potencies of MK-886 and BAY-X1005 vs FLAP-dependent 5-lipoxygenase activity and LTC4-S inhibition: MK-886 was 19.3-fold more potent than BAY-X1005 as FLAP inhibitor and 19.6-fold more potent than BAY-X1005 as LTC4-S inhibitor.

  6. Sucrose synthase: A unique glycosyltransferase for biocatalytic glycosylation process development.

    Schmölzer, Katharina; Gutmann, Alexander; Diricks, Margo; Desmet, Tom; Nidetzky, Bernd

    2016-01-01

    Sucrose synthase (SuSy, EC 2.4.1.13) is a glycosyltransferase (GT) long known from plants and more recently discovered in bacteria. The enzyme catalyzes the reversible transfer of a glucosyl moiety between fructose and a nucleoside diphosphate (NDP) (sucrose+NDP↔NDP-glucose+fructose). The equilibrium for sucrose conversion is pH dependent, and pH values between 5.5 and 7.5 promote NDP-glucose formation. The conversion of a bulk chemical to high-priced NDP-glucose in a one-step reaction provides the key aspect for industrial interest. NDP-sugars are important as such and as key intermediates for glycosylation reactions by highly selective Leloir GTs. SuSy has gained renewed interest as industrially attractive biocatalyst, due to substantial scientific progresses achieved in the last few years. These include biochemical characterization of bacterial SuSys, overproduction of recombinant SuSys, structural information useful for design of tailor-made catalysts, and development of one-pot SuSy-GT cascade reactions for production of several relevant glycosides. These advances could pave the way for the application of Leloir GTs to be used in cost-effective processes. This review provides a framework for application requirements, focusing on catalytic properties, heterologous enzyme production and reaction engineering. The potential of SuSy biocatalysis will be presented based on various biotechnological applications: NDP-sugar synthesis; sucrose analog synthesis; glycoside synthesis by SuSy-GT cascade reactions. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Insights into the reactivation of cobalamin-dependent methionine synthase

    Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.; Smith, Janet L.; Matthews, Rowena G.; (Michigan)

    2009-12-10

    Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every {approx}2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetH{sup CT}) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetH{sup CT} ({sub s-s}MetH{sup CT}) that offer further insight into the reactivation of MetH. The structure of {sub s-s}MetH{sup CT} with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of {sub s-s}MetH{sub CT} with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation.

  8. Prostaglandin endoperoxide H synthases: peroxidase hydroperoxide specificity and cyclooxygenase activation.

    Liu, Jiayan; Seibold, Steve A; Rieke, Caroline J; Song, Inseok; Cukier, Robert I; Smith, William L

    2007-06-22

    The cyclooxygenase (COX) activity of prostaglandin endoperoxide H synthases (PGHSs) converts arachidonic acid and O2 to prostaglandin G2 (PGG2). PGHS peroxidase (POX) activity reduces PGG2 to PGH2. The first step in POX catalysis is formation of an oxyferryl heme radical cation (Compound I), which undergoes intramolecular electron transfer forming Intermediate II having an oxyferryl heme and a Tyr-385 radical required for COX catalysis. PGHS POX catalyzes heterolytic cleavage of primary and secondary hydroperoxides much more readily than H2O2, but the basis for this specificity has been unresolved. Several large amino acids form a hydrophobic "dome" over part of the heme, but when these residues were mutated to alanines there was little effect on Compound I formation from H2O2 or 15-hydroperoxyeicosatetraenoic acid, a surrogate substrate for PGG2. Ab initio calculations of heterolytic bond dissociation energies of the peroxyl groups of small peroxides indicated that they are almost the same. Molecular Dynamics simulations suggest that PGG2 binds the POX site through a peroxyl-iron bond, a hydrogen bond with His-207 and van der Waals interactions involving methylene groups adjoining the carbon bearing the peroxyl group and the protoporphyrin IX. We speculate that these latter interactions, which are not possible with H2O2, are major contributors to PGHS POX specificity. The distal Gln-203 four residues removed from His-207 have been thought to be essential for Compound I formation. However, Q203V PGHS-1 and PGHS-2 mutants catalyzed heterolytic cleavage of peroxides and exhibited native COX activity. PGHSs are homodimers with each monomer having a POX site and COX site. Cross-talk occurs between the COX sites of adjoining monomers. However, no cross-talk between the POX and COX sites of monomers was detected in a PGHS-2 heterodimer comprised of a Q203R monomer having an inactive POX site and a G533A monomer with an inactive COX site.

  9. Hyaluronan synthase mediates dye translocation across liposomal membranes

    Medina Andria P

    2012-01-01

    Full Text Available Abstract Background Hyaluronan (HA is made at the plasma membrane and secreted into the extracellular medium or matrix by phospolipid-dependent hyaluronan synthase (HAS, which is active as a monomer. Since the mechanism by which HA is translocated across membranes is still unresolved, we assessed the presence of an intraprotein pore within HAS by adding purified Streptococcus equisimilis HAS (SeHAS to liposomes preloaded with the fluorophore Cascade Blue (CB. Results CB translocation (efflux was not observed with mock-purified material from empty vector control E. coli membranes, but was induced by SeHAS, purified from membranes, in a time- and dose-dependent manner. CB efflux was eliminated or greatly reduced when purified SeHAS was first treated under conditions that inhibit enzyme activity: heating, oxidization or cysteine modification with N-ethylmaleimide. Reduced CB efflux also occurred with SeHAS K48E or K48F mutants, in which alteration of K48 within membrane domain 2 causes decreased activity and HA product size. The above results used liposomes containing bovine cardiolipin (BCL. An earlier study testing many synthetic lipids found that the best activating lipid for SeHAS is tetraoleoyl cardiolipin (TO-CL and that, in contrast, tetramyristoyl cardiolipin (TM-CL is an inactivating lipid (Weigel et al, J. Biol. Chem. 281, 36542, 2006. Consistent with the effects of these CL species on SeHAS activity, CB efflux was more than 2-fold greater in liposomes made with TO-CL compared to TM-CL. Conclusions The results indicate the presence of an intraprotein pore in HAS and support a model in which HA is translocated to the exterior by HAS itself.

  10. Regulation of glycogen synthase kinase-3 during bipolar mania treatment.

    Li, Xiaohong; Liu, Min; Cai, Zhuoji; Wang, Gang; Li, Xiaohua

    2010-11-01

    Bipolar disorder is a debilitating psychiatric illness presenting with recurrent mania and depression. The pathophysiology of bipolar disorder is poorly understood, and molecular targets in the treatment of bipolar disorder remain to be identified. Preclinical studies have suggested that glycogen synthase kinase-3 (GSK3) is a potential therapeutic target in bipolar disorder, but evidence of abnormal GSK3 in human bipolar disorder and its response to treatment is still lacking. This study was conducted in acutely ill type I bipolar disorder subjects who were hospitalized for a manic episode. The protein level and the inhibitory serine phosphorylation of GSK3 in peripheral blood mononuclear cells of bipolar manic and healthy control subjects were compared, and the response of GSK3 to antimanic treatment was evaluated. The levels of GSK3α and GSK3β in this group of bipolar manic subjects were higher than healthy controls. Symptom improvement during an eight-week antimanic treatment with lithium, valproate, and atypical antipsychotics was accompanied by a significant increase in the inhibitory serine phosphorylation of GSK3, but not the total level of GSK3, whereas concomitant electroconvulsive therapy treatment during a manic episode appeared to dampen the response of GSK3 to pharmacological treatment. Results of this study suggest that GSK3 can be modified during the treatment of bipolar mania. This finding in human bipolar disorder is in agreement with preclinical data suggesting that inhibition of GSK3 by increasing serine phosphorylation is a response of GSK3 to psychotropics used in bipolar disorder, supporting the notion that GSK3 is a promising molecular target in the pharmacological treatment of bipolar disorder. © 2010 John Wiley and Sons A/S.

  11. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

    Gauba, Esha; Guo, Lan; Du, Heng

    2017-01-01

    Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

  13. The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.

    Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard

    2015-05-22

    HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Proteomic profiling of cellulase-aid-extracted membrane proteins for functional identification of cellulose synthase complexes and their potential associated- components in cotton fibers.

    Li, Ao; Wang, Ruyi; Li, Xianliang; Liu, Mingyong; Fan, Jian; Guo, Kai; Luo, Bing; Chen, Tingting; Feng, Shengqiu; Wang, Yanting; Wang, Bingrui; Peng, Liangcai; Xia, Tao

    2016-05-19

    Cotton fibers are an excellent model for understanding of cellulose biosynthesis in higher plants. In this study, we determined a high cellulose biosynthesis activity in vitro by optimizing biochemical reaction conditions in cotton fibers. By adding a commercial cellulase enzyme into fibers extraction process, we extracted markedly higher levels of GhCESA1 and GhCESA8 proteins and observed an increase in β-1,4-glucan and β-1,3-glucan products in vitro. LC-MS/MS analysis of anti-GhCESA8-immunoprecipitated proteins showed that 19 proteins could be found in three independent experiments including four CESAs (GhCESA1,2,7,8), five well-known non-CESA proteins, one callose synthase (CALS) and nine novel proteins. Notably, upon the cellulase treatment, four CESAs, one CALS and four novel proteins were measured at relatively higher levels by calculating total peptide counts and distinct peptide numbers, indicating that the cellulase-aid-extracted proteins most likely contribute to the increase in β-glucan products in vitro. These results suggest that the cellulase treatment may aid to release active cellulose synthases complexes from growing glucan chains and make them more amenable to extraction. To our knowledge, it is the first time report about the functional identification of the potential proteins that were associated with plant cellulose and callose synthases complexes by using the cellulase-aided protein extraction.

  15. Bioenergetic Consequences of FLAG Tag Addition to the C-Terminus of Subunit 8 of Yeast Saccharomyces cerevisiae Mitochondrial ATP Synthase

    I MADE ARTIKA

    2010-09-01

    Full Text Available The yeast mitochondrial F1F0-ATP synthase is a multisubunit complex that contains at least 17 different subunits. Subunit 8 of yeast mitochondrial ATP synthase is a hydrophobic protein of 48 amino acids encoded by the mitochondrial ATP8 gene. Subunit 8 has three distinct domains; an N-terminal domain, a central hydrophobic domain and a C-terminal domain. FLAG tag addition to subunit 8 protein potentially facilitate elucidation of its topology, structure, and function. It has been shown that following incorporation of FLAG tag to its C-terminus, subunit 8 still assemble into functional ATP synthase complex. In order to analyze bioenergetic consequences of the FLAG tag addition, a yeast strain expressing FLAG tagged-subunit 8 was subjected to cellular respiration assays. Results obtained showed that addition of FLAG tag to the C-terminus of subunit 8 does not impair its proper functioning. The FLAG tag system, therefore, can be employed to study subunit 8′s detailed structure, topology, and function.

  16. Tissue injury after lithium treatment in human and rat postnatal kidney involves glycogen synthase kinase 3β-positive epithelium

    Kjaersgaard, Gitte; Madsen, Kirsten; Marcussen, Niels

    2012-01-01

    plasma lithium concentration of 1.0 mmol/L. Kidneys from lithium-treated rat pups exhibited dilated distal nephron segments with microcysts. Stereological analysis showed reduced cortex and outer medullary volumes. Lithium increased pGSK-3β and the proliferation marker PCNA protein abundances in cortex...... concentration capacity and diminished outer medullary volume. Histological sections of nephrectomy samples and a biopsy from 3 long-term lithium-treated patients showed multiple cortical microcysts that originated from normally appearing tubules. Microcysts were lined by a cuboidal PCNA-, GSK-3β- and pGSK-3β......It was hypothesized that lithium causes accelerated and permanent injury to the postnatally developing kidney through entry into epithelial cells of the distal nephron and inhibition of glycogen synthase kinase-3β (GSK-3β). GSK-3β immunoreactivity was associated with glomeruli, thick ascending limb...

  17. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  18. Effects of various nitric oxide synthase inhibitors on AlCl3-induced neuronal injury in rats

    IVANA STEVANOVIĆ

    2009-05-01

    Full Text Available The present study was aimed at determining the effectiveness of nitric oxide synthase (NOS inhibitors: N-nitro-L-arginine methyl ester, 7-nitroindazole and aminoguanidine in modulating the toxicity of AlCl3 on superoxide production and the malondialdehyde concentration of Wistar rats. The animals were sacrificed 10 min and 3 days after the treatment and the forebrain cortex was removed. The results show that AlCl3 exposure promotes oxidative stress in different neural areas. The biochemical changes observed in the neuronal tissues show that aluminum acts as pro-oxidant, while NOS inhibitors exert an anti-oxidant action in AlCl3-treated animals.

  19. Interaction between Mitochondrial Reactive Oxygen Species, Heme Oxygenase, and Nitric Oxide Synthase Stimulates Phagocytosis in Macrophages

    Andrea Müllebner

    2018-01-01

    Full Text Available BackgroundMacrophages are cells of the innate immune system that populate every organ. They are required not only for defense against invading pathogens and tissue repair but also for maintenance of tissue homeostasis and iron homeostasis.AimThe aim of this study is to understand whether heme oxygenase (HO and nitric oxide synthase (NOS contribute to the regulation of nicotinamide adenine dinucleotide phosphate oxidase (NOX activity and phagocytosis, two key components of macrophage function.MethodsThis study was carried out using resting J774A.1 macrophages treated with hemin or vehicle. Activity of NOS, HO, or NOX was inhibited using specific inhibitors. Reactive oxygen species (ROS formation was determined by Amplex® red assay, and phagocytosis was measured using fluorescein isothiocyanate-labeled bacteria. In addition, we analyzed the fate of the intracellular heme by using electron spin resonance.ResultsWe show that both enzymes NOS and HO are essential for phagocytic activity of macrophages. NOS does not directly affect phagocytosis, but stimulates NOX activity via nitric oxide-triggered ROS production of mitochondria. Treatment of macrophages with hemin results in intracellular accumulation of ferrous heme and an inhibition of phagocytosis. In contrast to NOS, HO products, including carbon monoxide, neither clearly affect NOX activity nor clearly affect phagocytosis, but phagocytosis is accelerated by HO-mediated degradation of heme.ConclusionBoth enzymes contribute to the bactericidal activity of macrophages independently, by controlling different pathways.

  20. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.