WorldWideScience

Sample records for major stilbenes synthesized

  1. Prototype Stilbene Neutron Collar

    Prasad, M. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Shumaker, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Snyderman, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Verbeke, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-10-26

    A neutron collar using stilbene organic scintillator cells for fast neutron counting is described for the assay of fresh low enriched uranium (LEU) fuel assemblies. The prototype stilbene collar has a form factor similar to standard He-3 based collars and uses an AmLi interrogation neutron source. This report describes the simulation of list mode neutron correlation data on various fuel assemblies including some with neutron absorbers (burnable Gd poisons). Calibration curves (doubles vs 235U linear mass density) are presented for both thermal and fast (with Cd lining) modes of operation. It is shown that the stilbene collar meets or exceeds the current capabilities of He-3 based neutron collars. A self-consistent assay methodology, uniquely suited to the stilbene collar, using triples is described which complements traditional assay based on doubles calibration curves.

  2. Photoinduced gelation by stilbene oxalyl amide compounds.

    Miljanić, Snezana; Frkanec, Leo; Meić, Zlatko; Zinić, Mladen

    2005-03-29

    Oxalyl amide derivatives bearing 4-dodecyloxy-stilbene as a cis-trans photoisomerizing unit were synthesized. The trans derivative acted as a versatile gelator of various organic solvents, whereas the corresponding cis derivative showed a poor gelation ability or none at all. In diluted solution (c = 2.0 x10(-5) mol dm(-3), ethanol), the cis isomer was photochemically converted into the trans isomer within 4 min. Depending on the radiation wavelength, the trans isomer was stable or liable to photodecomposition. When exposed to irradiation, a concentrated solution of the cis isomer (c = 2.0 x 10(-2) mol dm(-3), ethanol) turned into a gel. The FT-Raman, FT-IR, and 1H NMR spectra demonstrated that the gelation process occurred because of a rapid cis --> trans photoisomerization followed by a self-assembly of the trans molecules. Apart from the formation of hydrogen bonding between the oxalyl amide parts of the molecules, confirmed by FT-IR spectroscopy, it was assumed that the pi-pi stacking between the trans-stilbene units of the molecule and a lipophilic interaction between long alkyl chains were the interactions responsible for gelation.

  3. Effect of stilbene and chalcone scaffolds incorporation in clofibric acid on PPARα agonistic activity.

    Giampietro, Letizia; D'Angelo, Alessandra; Giancristofaro, Antonella; Ammazzalorso, Alessandra; De Filippis, Barbara; Di Matteo, Mauro; Fantacuzzi, Marialuigia; Linciano, Pasquale; Maccallini, Cristina; Amoroso, Rosa

    2014-01-01

    In an effort to develop safe and efficacious compounds for the treatment of metabolic disorders, new compounds based on a combination of clofibric acid, the active metabolite of clofibrate, and trans-stilbene, chalcone, and other lipophilic groups were synthesized. They were evaluated for PPARα transactivation activity; all branched derivatives showed an increase of the transcriptional activity of receptor compared to the linear ones. Noteworthy, stilbene and benzophenone branched derivatives activated the PPARα better than clofibric acid.

  4. Two new stilbene trimers from Cynodon dactylon.

    Li, Bi-Jun; Liu, Yao; Gu, Ai-Tong; Zhang, Qing; Chen, Lei; Wang, Shu-Mei; Wang, Feng

    2017-11-01

    Many naturally occurring oligostilbenes have drawn considerable attention because of their intricate structures and diverse bioactivities. Two new stilbene trimers, cystibenetrimerol A (1) and cystibenetrimerol B (2) were isolated from the dried grass of Cynodon dactylon (L.) Pers. The planar structures and stereo configurations of them were elucidated by spectroscopic and spectrometric methods. The isolation and structures elucidation of two new stilbene trimers suggested the ordinary grass belonging to the family Poaceae may be a rich source of stilbene oligomers.

  5. Synthesis, Biological Evaluation, and Molecular Modeling Studies of New Oxadiazole-Stilbene Hybrids against Phytopathogenic Fungi

    Jian, Weilin; He, Daohang; Song, Shaoyun

    2016-08-01

    Natural stilbenes (especially resveratrol) play important roles in plant protection by acting as both constitutive and inducible defenses. However, their exogenous applications on crops as fungicidal agents are challenged by their oxidative degradation and limited availability. In this study, a new class of resveratrol-inspired oxadiazole-stilbene hybrids was synthesized via Wittig-Horner reaction. Bioassay results indicated that some of the compounds exhibited potent fungicidal activity against Botrytis cinerea in vitro. Among these stilbene hybrids, compounds 11 showed promising inhibitory activity with the EC50 value of 144.6 μg/mL, which was superior to that of resveratrol (315.6 μg/mL). Remarkably, the considerably abnormal mycelial morphology was observed in the presence of compound 11. The inhibitory profile was further proposed by homology modeling and molecular docking studies, which showed the possible interaction of resveratrol and oxadiazole-stilbene hybrids with the cytochrome P450-dependent sterol 14α-demethylase from B. cinerea (BcCYP51) for the first time. Taken together, these results would provide new insights into the fungicidal mechanism of stilbenes, as well as an important clue for biology-oriented synthesis of stilbene hybrids with improved bioactivity against plant pathogenic fungi in crop protection.

  6. Digital Data Processing of Stilbene

    AMIRI, Moslem; MATEJ, Zdenek; MRAVEC, Filip; PRENOSIL, Vaclav; CVACHOVEC, Frantisek

    2013-06-01

    Stilbene is a proven spectrometric detector for mixed fields of neutrons and gamma rays. By digital processing of shape output pulses from the detector it is possible to obtain information about the energy of the interacting neutron / photon and distinguish which of these two particles interacts in the detector. Another numerical processing of digital data can finalize the energy spectrum of both components of the mixed field. The quality of the digitized data is highly dependent on the parameters of the hardware used for digitization and on the quality of software processing. Our results also show how the quality of the particle type identification depends on the sampling rate and as well as the method of processing of the sampled data. (authors)

  7. Photoluminescence in Carborane-Stilbene Triads: A Structural, Spectroscopic, and Computational Study.

    Cabrera-González, Justo; Viñas, Clara; Haukka, Matti; Bhattacharyya, Santanu; Gierschner, Johannes; Núñez, Rosario

    2016-09-12

    A set of triads in which o- and m-carborane clusters are bonded to two stilbene units through Ccluster -CH2 bonds was synthesized, and their structures were confirmed by X-ray diffraction. A study on the influence of the o- and m- isomers on the absorption and photoluminescence properties of the stilbene units in solution revealed no charge-transfer contributions in the lowest excited state, as confirmed by (TD)DFT calculations. The presence of one or two B-I groups in m-carborane derivatives does not affect the emission properties of the stilbenes in solution, probably due to the rather large distance between the iodo substituents and the fluorophore. Nevertheless, a significant redshift of the photoluminescence (PL) emission maximum in the solid state (thin films and powder samples) compared to solution was observed; this can be traced back to PL sensitization, most probably due to more densely packed stilbene moieties. Remarkably, the PL absolute quantum yields of powder samples are significantly higher than those in solution, and this was attributed to the restricted environment and the aforementioned sensitization. Thus, the bonding of the carborane clusters to two stilbene units preserves their PL behavior in solution, but produces significant changes in the solid state. Furthermore, iodinated species can be considered to be promising precursors for theranostic agents in which both imaging and therapeutic functions could possibly be combined. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Isomerization Intermediates In Solution Phase Photochemistry Of Stilbenes

    Doany, F. E.; Hochstrasser, R. M.; Greene, B. I.

    1985-04-01

    Picosecond and subpicosecond spectroscopic studies have revealed evidence for an isomerization intermediate between cis and trans in the photoinduced isomerism of both stilbene and biindanyledene ("stiff" stilbene). In stiff stilbene, a transient absorption at 351 nm displays time evolution and viscosity dependence consistent with absorption by a twisted intermediate ("phantom" state) with a lOps lifetime. An analagous bottleneck state with a life-time of 4ps is also consistent with the ground state recovery dynamics of t-stilbene following excitation of c-stilbene when monitored with 0.1ps resolution.

  9. Merocyanines: polyene-polymethine transition in donor-acceptor-substituted stilbenes and polyenes

    Rettig, Wolfgang; Dekhtyar, Marina

    2003-01-01

    Three series of donor-acceptor-substituted conjugated compounds, namely, stilbenes, the open-chain polyenes of equivalent length, and the species of intermediate structure (polyenes terminated with only one phenyl ring) have been studied by the AM1 and HMO methods to elucidate and compare the structural prerequisites of the ideal polymethinic state ('cyanine limit'). The transition from polyenic to polymethinic properties has been traced in terms of bond-length (bond-order) alternation using the variation of terminal donor and acceptor substituents. Stilbenes manifest themselves as notably 'retarded' polyenes since a larger electronic asymmetry is necessary for them to reach the same degree of polymethinic character. The ground and the excited state have been shown to differ much more strongly for stilbenes than for polyenes with respect to the position of the bond equalization point on the scale of donor-acceptor difference. For the compounds containing one phenyl ring, the features revealed are intermediate between stilbenes and polyenes. The large S 0 -S 1 discrepancy in terms of bond alternation is a general property of aromatic ring-terminated chains (stilbenes) and is related to the influence of the aromatic character which can be quantified in this way. In this context, the most relevant definition for the cyanine limit (based on the bond invariance upon excitation) was selected from the existing definitions. The major trends revealed in the polyenic/polymethinic behaviour of the molecules can be interpreted on a topological basis within HMO or even simpler models with some additional influence due to the interelectronic repulsion which is taken into account in the AM1 treatment

  10. Water deficit increases stilbene metabolism in Cabernet Sauvignon berries.

    Deluc, Laurent G; Decendit, Alain; Papastamoulis, Yorgos; Mérillon, Jean-Michel; Cushman, John C; Cramer, Grant R

    2011-01-12

    The impact of water deficit on stilbene biosynthesis in wine grape (Vitis vinifera) berries was investigated. Water deficit increased the accumulation of trans-piceid (the glycosylated form of resveratrol) by 5-fold in Cabernet Sauvignon berries but not in Chardonnay. Similarly, water deficit significantly increased the transcript abundance of genes involved in the biosynthesis of stilbene precursors in Cabernet Sauvignon. Increased expression of stilbene synthase, but not that of resveratrol-O-glycosyltransferase, resulted in increased trans-piceid concentrations. In contrast, the transcript abundance of the same genes declined in Chardonnay in response to water deficit. Twelve single nucleotide polymorphisms (SNPs) were identified in the promoters of stilbene synthase genes of Cabernet Sauvignon, Chardonnay, and Pinot Noir. These polymorphisms resulted in eight changes within the predicted cis regulatory elements in Cabernet Sauvignon and Chardonnay. These results suggest that cultivar-specific molecular mechanisms might exist that control resveratrol biosynthesis in grapes.

  11. Characteristics evaluation of stilbene single crystal grown by vertical bridgman technique

    Jo, Kwang Ho

    2012-02-01

    As the nature of organic scintillator, stilbene single crystal's decay time is only a couple of nano seconds, which makes it suitable for fast neutron detection. However, the entire amount of stilbene single crystal being used relies on import currently. As the necessity of fast neutron detection equipment such as KSTAR and Sodium-cooled Fast Reactor system increases, the goal is to have our own domestic technology through the growth of stilbene single crystal. The emission wavelength of grown stilbene single crystal is confirmed, and the property of grown stilbene single crystal is assessed compared to commercial stilbene (Ukraine ISMA research center) through gamma ray and neutron tests. In this research, we have grown stilbenes through Bridgman technique, and obtained three stilbenes out of two amples. (Two ones of Φ 30 mm x 15 mm, and Φ 40 mm x 17 mm from the first ample, and size of Φ 25 mm x 13 mm from the other) The grown stilbene's emission wavelength and inherent property of stilbene are confirmed. As the result of gamma ray test, we have confirmed linearity of grown stilbene's scintillator, and the relative light yield ratio is proven 101% efficiency to reference stilbene. Neutron detection efficiency of the three stilbenes amounts to 80% of reference stilbene, and FOM of them is 108% efficiency to reference stilbene's one. Although Ukraine ISMA research center still holds a dominant position with world-class efficiency and performance of its stilbene, we expect to produce a better stilbene with our domestic technology development. Through this, fast neutron detection technique can be obtained, which opens up an opportunity to be used not only in neutron monitoring system in nuclear fusion reactor, but also in alternative measurement technique as the unit price of He-3 increases recently

  12. Stilbene dimer radical cations in the radiolyses of stilbenes and 1,2,3,4-tetraphenylcyclobutanes

    Tojo, Sachiko; Morishima, Kazuhiro; Ishida, Akito; Majima, Tetsuro; Takamuku, Setsuo

    1995-01-01

    The reaction of the stilbene radical cation formed by pulse radiolysis or γ-radiolyses is explained based on neutralization as well as the formation of a π-type stilbene dimer radical cation (π-St 2 +· ), converting to the σ-type St 2 +· (σ-St 2 +· ). The r-1, c-2, t-3, t-4-tetraphenylcyclobutane radical cation generated in a rigid matrix at 77 K which converted to σ-St 2 +· upon warming. Both r-1, c-2, t-3, t-4- and r-1, t-2, c-3, t-4-tetraphenylcyclobutane radical cations underwent photochemical cycloreversion to π-St 2 +· upon irradiation at wavelengths longer than 390 nm at 77 K, and converted to σ-St 2 +· upon warming. It is suggested that π-St 2 +· has overlapping arrangements of π-electrons, while σ-St 2 +· has radical and cation centers on the 1- and 4-positions of the C 4 linkage. (author)

  13. Photoisomerization of Stilbene: The Detailed XMCQDPT2 Treatment.

    Ioffe, I N; Granovsky, A A

    2013-11-12

    We report the detailed XMCQDPT2/cc-pVTZ study of trans-cis photoisomerization in one of the core systems of both experimental and computational photochemistry-the stilbene molecule. For the first time, the potential energy surface (PES) of the S1 state has been directly optimized and scanned using a multistate multiconfiguration second-order perturbation theory. We characterize the trans-stilbene, pyramidalized (phantom), and DHP-cis-stilbene geometric domains of the S1 state and describe their stationary points including the transition states between them, as well as S1/S0 intersections. Also reported are the minima and the activation barriers in the ground state. Our calculations correctly predict the kinetic isotope effect due to H/D exchange at ethylenic hydrogens, the dynamic behavior of excited cis-stilbene, and trans-cis branching ratio after relaxation to S0 through a rather unsymmetric conical intersection. In general, the XMCQDPT2 results confirm the qualitative adequacy of the TDDFT (especially SF-TDDFT) picture of the excited stilbene but also reveal quantitative discrepancies that deserve further exploration.

  14. Design, Synthesis and Cytotoxic Evaluation of o-Carboxamido Stilbene Analogues

    Mohamad Nurul Azmi

    2013-11-01

    Full Text Available Resveratrol, a natural stilbene found in grapes and wines exhibits a wide range of pharmacological properties. Resveratrol is also known as a good chemopreventive agent for inhibiting carcinogenesis processes that target kinases, cyclooxygenases, ribonucleotide reductase and DNA polymerases. A total of 19 analogues with an amide moiety were synthesized and the cytotoxic effects of the analogues on a series of human cancer cell lines are reported. Three compounds 6d, 6i and 6n showed potent cytotoxicity against prostate cancer DU-145 (IC50 = 16.68 µM, colon cancer HT-29 (IC50 = 7.51 µM and breast cancer MCF-7 (IC50 = 21.24 µM, respectively, which are comparable with vinblastine. The resveratrol analogues were synthesized using the Heck method.

  15. Stilbene crystalline powder in polymer base as a new fast neutron detector

    Budakovsky, S.V.; Galunov, N.Z.; Grinyov, B.V.; Karavaeva, N.L.; Kyung Kim, Jong; Kim, Yong-Kyun; Pogorelova, N.V.; Tarasenko, O.A.

    2007-01-01

    A new organic scintillation material consisting of stilbene grains in a polymer glue base is presented. The crystalline grains of stilbene are obtained by mechanical grinding of stilbene single crystals. The resulting composite scintillators have been studied as detectors for fast neutrons

  16. Effect of stilbene resveratrol on haematological indices of rats

    Doubek, J.; Volný, T.; Lojek, Antonín; Knotková, Z.; Kotrbáček, V.; Scheer, P.; Holešovská, Z.

    2005-01-01

    Roč. 74, č. 2 (2005), s. 205-208 ISSN 0001-7213 Institutional research plan: CEZ:AV0Z50040507 Keywords : antioxidative capacity * stilbene-resveratrol Subject RIV: BO - Biophysics Impact factor: 0.353, year: 2005

  17. Synthesis and anticancer activity of N-substituted 2-arylquinazolinones bearing trans-stilbene scaffold.

    Mahdavi, Mohammad; Pedrood, Keyvan; Safavi, Maliheh; Saeedi, Mina; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Emami, Saeed; Adib, Mehdi; Foroumadi, Alireza; Shafiee, Abbas

    2015-05-05

    A novel series of 2-arylquinazolinones 7a-o bearing trans-stilbene moiety were designed, synthesized, and evaluated against human breast cancer cell lines including human breast adenocarcinoma (MCF-7 and MDA-MB-231) and human ductal breast epithelial tumor (T-47D). Among the tested compounds, the sec-butyl derivative 7h showed the best profile of activity (IC50 < 5 μM) against all cell lines, being 2-fold more potent than standard drug, etoposide. Our investigation revealed that the cytotoxic activity was significantly affected by N3-alkyl substituents. Furthermore, the morphological analysis by acridine orange/ethidium bromide double staining test and flow cytometry analysis indicated that the prototype compound 7h can induce apoptosis in MCF-7 and MDA-MB-231 cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  18. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes

    Zulema Piñeiro

    2016-06-01

    Full Text Available An analytical ultrasound-assisted extraction (UAE method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying and several extraction variables (solvent, sample-solvent ratio and extraction time between others on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5 for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  19. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes.

    Piñeiro, Zulema; Marrufo-Curtido, Almudena; Serrano, Maria Jose; Palma, Miguel

    2016-06-16

    An analytical ultrasound-assisted extraction (UAE) method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying) and several extraction variables (solvent, sample-solvent ratio and extraction time between others) on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5) for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  20. Screening Analyses of Pinosylvin Stilbenes, Resin Acids and Lignans in Norwegian Conifers

    Anne Fiksdahl; Karin Oyaas; Ingebjorg Leirset; Hanne Hovelstad

    2006-01-01

    The content and distribution of stilbenes and resin acids in Scots pine (Pinus sylvestris) and spruce (Picea abies), sampled in central Norway, have been examined. The contents of pinosylvin stilbenes in pine heartwood/living knots were 0.2-2/2-8 % (w/w). No stilbenes could be detected in spruce (Picea abies). The resin acid contents of pine sapwood/heartwood and knots were 1-4 and 5-10 % (w/w), respectively. Minor amounts of resin acids (

  1. 76 FR 30967 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    2011-05-27

    ... Stilbenic Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1... is a reasonable indication that an industry in the United States is materially injured by reason of imports from China and Taiwan of certain stilbenic optical brightening agents, provided for in subheadings...

  2. The Use of Stilbene Scaffold in Medicinal Chemistry and Multi- Target Drug Design.

    Giacomini, Elisa; Rupiani, Sebastiano; Guidotti, Laura; Recanatini, Maurizio; Roberti, Marinella

    2016-01-01

    The stilbene scaffold is a basic element for a number of biologically active natural and synthetic compounds, and it is considered as a privileged structure. Stilbenes exemplified by resveratrol, combretastatin A-4 and pterostilbene are of significant interest for drug research and development because of their potential in therapeutic and preventive application. Resveratrol, present in grapes and other food products, plays a role in the prevention of several human pathological processes and has been suggested as an anticancer agent. Moreover, recent evidence has revealed its potential effect on the aging process, diabetes and neurological dysfunction. Combretastatin A-4, from the bark of South African bush willow Combretum caffrum, also shows significant antitumor activity. Pterostilbene is closely related to resveratrol, sharing the same unique therapeutic potential as anti-inflammatory, antineoplastic and antioxidant agent. Therefore, research and development of stilbene-based medicinal chemistry have become rapidly evolving and increasingly active topics covering almost the whole range of therapeutic fields. In the present review, we provide an overview of the role of stilbenes in medicinal chemistry. In this context, we highlight the chemical methodologies adopted for the synthesis of stilbene derivatives, and outline the successful design of novel stilbene based hybrids in the field of cancer, Alzheimer's and other relevant diseases. This information may be useful in further design of stilbene-based molecules as new leads for the development of novel agents with clinical potential or as effective chemical probes to dissect biological processes.

  3. Mesoporous stilbene-based lanthanide metal organic frameworks: synthesis, photoluminescence and radioluminescence characteristics.

    Mathis Ii, Stephan R; Golafale, Saki T; Bacsa, John; Steiner, Alexander; Ingram, Conrad W; Doty, F Patrick; Auden, Elizabeth; Hattar, Khalid

    2017-01-03

    Ultra large pore isostructural metal organic frameworks (MOFs) which exhibit both photoluminescence and scintillation properties, were synthesized from trans-4,4'-stilbenedicarboxylic acid (H 2 L) and trivalent lanthanide (Ln) metal salts under solvothermal conditions (Ln = Er 3+ (1) and Tm 3+ (2)). This new class of mesoporous materials is a non-interpenetrating network that features ultra-large diamond shaped pores of dimensions with approximate cross-sectional dimensions of 28 Å × 12 Å. The fully deprotonated ligand, L, is isolated and rigidified as it serves as the organic linker component of the MOF structure. Its low density unit cells possess asymmetric units with two crystallographically independent Ln 3+ ions in seven coordinate arrangements. A distinct feature of the structure is the bis-bidentate carboxylate groups. They serve as a ligand that coordinates two Ln(iii) ions while each L connects four Ln(iii) ions yielding an exceptionally large diamond-shaped rectangular network. The structure exhibits ligand-based photoluminescence with increased lifetime compared to free stilbene molecules on exposure to UV radiation, and also exhibits strong scintillation characteristics, comprising of both prompt and delayed radioluminescence features, on exposure to ionizing radiation.

  4. Superior optical nonlinearity of an exceptional fluorescent stilbene dye

    He, Tingchao [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Sreejith, Sivaramapanicker; Zhao, Yanli [Division of Chemistry and Biological Chemistry, School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Gao, Yang; Grimsdale, Andrew C. [School of Materials Science and Engineering, Nanyang Technological University, Singapore, Singapore 639798 (Singapore); Lin, Xiaodong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Sun, Handong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore)

    2015-03-16

    Strong multiphoton absorption and harmonic generation in organic fluorescent chromophores are, respectively, significant in many fields of research. However, most of fluorescent chromophores fall short of the full potential due to the absence of the combination of such different nonlinear upconversion behaviors. Here, we demonstrate that an exceptional fluorescent stilbene dye could exhibit efficient two- and three-photon absorption under the excitation of femtosecond pulses in solution phase. Benefiting from its biocompatibility and strong excited state absorption behavior, in vitro two-photon bioimaging and superior optical limiting have been exploited, respectively. Simultaneously, the chromophore could generate efficient three-photon excited fluorescence and third-harmonic generation (THG) when dispersed into PMMA film, circumventing the limitations of classical fluorescent chromophores. Such chromophore may find application in the production of coherent light sources of higher photon energy. Moreover, the combination of three-photon excited fluorescence and THG can be used in tandem to provide complementary information in biomedical studies.

  5. Synthesis of amide isosteres of schweinfurthin-based stilbenes.

    Stockdale, David P; Beutler, John A; Wiemer, David F

    2017-10-15

    The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Continuous flow photocyclization of stilbenes – scalable synthesis of functionalized phenanthrenes and helicenes

    Quentin Lefebvre

    2013-09-01

    Full Text Available A continuous flow oxidative photocyclization of stilbene derivatives has been developed which allows the scalable synthesis of backbone functionalized phenanthrenes and helicenes of various sizes in good yields.

  7. HPLC Quantitative Analysis of Main Stilbenes and Flavones in Different Parts of Matteuccia struthiopteris

    Li, S.; Zhang, D.; Yang, L.; Li, Y.; Zhu, X.; Kmoníčková, Eva; Zídek, Zdeněk

    -, č. 452610 (2013), s. 1-6 ISSN 2090-9063 R&D Projects: GA MŠk(CZ) ME10116 Institutional support: RVO:68378041 Keywords : flavones * alternative medicine * stilbenes Subject RIV: FR - Pharmacology ; Medidal Chemistry

  8. Preharvest methyl jasmonate and postharvest UVC treatments: increasing stilbenes in wine.

    Fernández-Marín, María Isabel; Puertas, Belén; Guerrero, Raúl F; García-Parrilla, María Carmen; Cantos-Villar, Emma

    2014-03-01

    Stilbene-enriched wine is considered to be an interesting new food product with added value due to its potential health-promoting properties. Stilbene concentration in grape is highly variable and rather scarce. However, it can be increased by stress treatments. For this reason, numerous pre- and postharvest grape treatments, and some combinations of them, have been tested to maximize stilbene content in grapes. In the present manuscript, Syrah grapes were treated with (i) methyl jasmonate (MEJA), (ii) ultraviolet light (UVC), and (iii) methyl jasmonate and ultraviolet light (MEJA-UVC) and compared with untreated grapes. Afterward, winemaking was developed. Wine achieved by combination of both treatments (MEJA-UVC) contained significantly higher stilbene concentration (trans-resveratrol and piceatannol) than its respective control (2.5-fold). Wine quality was improved in color-related parameters (color intensity, L*, a*, b*, ΔE*, anthocyanins, and tannin). Moreover, MEJA-UVC wines obtained the highest score in sensorial analysis. To the best of our knowledge, this is the first time that pre- and postharvest treatments are combined to increase stilbenes in wine. The effect of treatment combination (methyl jasmonate and UVC light) on grape and wine was evaluated. Our results highlight the positive effect of the treatments in stilbene content, color parameters, and sensorial analysis. Moreover, added-value by-products were achieved. © 2014 Institute of Food Technologists®

  9. Simultaneous determination of five characteristic stilbene glycosides in root bark of Morus albus L. (Cortex Mori) using high-performance liquid chromatography.

    Piao, Shu-juan; Chen, Li-xia; Kang, Ning; Qiu, Feng

    2011-01-01

    Cortex Mori, one of the well-known traditional Chinese herbal medicines, is derived from the root bark of Morus alba L. according to the China Pharmacopeia. Stilbene glycosides are the main components isolated from aqueous extracts of Morus alba and their content varies depending on where Cortex Mori was collected. We have established a qualitative and quantitative method based on the bioactive stilbene glycosides for control of the quality of Cortex Mori from different sources. To develop a high-performance liquid chromatography coupled with ultraviolet absorption detection for simultaneous quantitative determination of five major characteristic stilbene glycosides in 34 samples of the root bark of Morus alba L. (Cortex Mori) from different sources. The analysis was performed on an ODS column using methanol-water-acetic acid (18: 82: 0.1, v/v/v) as the mobile phase and the peaks were monitored at 320 nm. All calibration curves showed good linearity (r ≥ 0.9991) within test ranges. This method showed good repeatability for the quantification of these five components in Cortex Mori with intra- and inter-day standard deviations less than 2.19% and 1.45%, respectively. The validated method was successfully applied to quantify the five investigated components, including a pair of cis-trans-isomers 1 and 2 and a pair of isomers 4 and 5 in 34 samples of Cortex Mori from different sources. Copyright © 2010 John Wiley & Sons, Ltd.

  10. Pulse radiolysis of solutions of trans-stilbene

    Langan, J.R.; Salmon, G.A.

    1982-01-01

    On pulse radiolysis of solutions of trans-stilbene (t-St) in THF the radical-anion of t-St is formed by reaction of e - sub(s) with t-St. The transient absorption spectrum observed with lambdasub(max) at 500 and 720 nm is attributed to the unassociated St - . The subsequent decay of the radical-anion is accounted for by reaction with the counter-cation of THF formed on radiolysis and with radiolytically generated radicals; rate constants for these processes are estimated. Addition of sodium tetrahydridoaluminate (NAH) results in the radical-anion being associated with Na + as a contact ion-pair and a shift of lambdasub(max) to 490 nm. In the presence of the lithium salt the absorption spectrum of the radical-anion reverts to 500 nm. On pulse radiolysis of solutions containing NAH the main reaction forming St - is that of (Na + , e - sub(s))ion pairs with t-St. In addition there is a delayed formation of St - over a period of microseconds. The presence of tetrahydridoaluminate salts also greatly enhances the stability of St - and at high doses per pulse little decay was observed over 700 μs. The variation of G(St - ) with [NAH] was studied and was found to attain a plateau value of 2.0 at the higher concentrations. (author)

  11. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  12. Evidence for excited state intramolecular charge transfer in benzazole-based pseudo-stilbenes.

    Santos, Fabiano da Silveira; Descalzo, Rodrigo Roceti; Gonçalves, Paulo Fernando Bruno; Benvenutti, Edilson Valmir; Rodembusch, Fabiano Severo

    2012-08-21

    Two azo compounds were obtained through the diazotization reaction of aminobenzazole derivatives and N,N-dimethylaniline using clay montmorillonite KSF as catalyst. The synthesized dyes were characterized using elemental analysis, Fourier transform infrared spectroscopy, and (13)C and (1)H NMR spectroscopy in solution. Their photophysical behavior was studied using UV-vis and steady-state fluorescence in solution. These dyes present intense absorption in the blue region. The spectral features of the azo compounds can be related to the pseudo-stilbene type as well as the E isomer of the dyes. Excitation at the absorption maxima does not produce emissive species in the excited state. However, excitation around 350 nm allowed dual emission of fluorescence, from both a locally excited (LE, short wavelength) and an intramolecular charge transfer (ICT, long wavelength) state, which was corroborated by a linear relation of the fluorescence maximum (ν(max)) versus the solvent polarity function (Δf) from the Lippert-Mataga correlation. Evidence of TICT in these dyes was discussed from the viscosity dependence of the fluorescence intensity in the ICT emission band. Theoretical calculations were also performed in order to study the geometry and charge distribution of the dyes in their ground and excited electronic states. Using DFT methods at the theoretical levels BLYP/Aug-cc-pVDZ, for geometry optimizations and frequency calculations, and B3LYP/6-311+G(2d), for single-point energy evaluations, the calculations revealed that the least energetic and most intense photon absorption leads to a very polar excited state that relaxes non-radioactively, which can be associated with photochemical isomerization.

  13. Conformationally constrained farnesoid X receptor (FXR) agonists: alternative replacements of the stilbene.

    Akwabi-Ameyaw, Adwoa; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce

    2011-10-15

    To further explore the optimum placement of the acid moiety in conformationally constrained analogs of GW 4064 1a, a series of stilbene replacements were prepared. The benzothiophene 1f and the indole 1g display the optimal orientation of the carboxylate for enhanced FXR agonist potency. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L

    Soural, I.; Vrchotová, Naděžda; Tříska, Jan; Balík, J.; Horník, Štěpán; Cuřínová, Petra; Sýkora, Jan

    2015-01-01

    Roč. 20, č. 4 (2015), s. 6093-6112 ISSN 1420-3049 R&D Projects: GA MŠk(CZ) LD14038 Institutional support: RVO:67179843 ; RVO:67985858 Keywords : Vitis vinifera L * grape cane * stilbenes * accelerated solvent extraction ( ASE ) * microwave-assisted extraction (MAE) * LC-MS Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.465, year: 2015

  15. Effect of Dietary Stilbenes on 5-Lipoxygenase and Cyclooxygenases Activities In Vitro

    Kutil, Zsófia; Kvasnicová, Marie; Temml, V.; Schuster, D.; Maršík, Petr; Cusimamani, E.F.; Lou, J.D.; Vaněk, Tomáš; Landa, Přemysl

    2015-01-01

    Roč. 18, č. 7 (2015), s. 1471-1477 ISSN 1094-2912 R&D Projects: GA MŠk LH12164 Institutional support: RVO:61389030 Keywords : Dietary stilbenes * Cyclooxygenase inhibition * Docking Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.586, year: 2015

  16. Aerobic methylcyclohexane-promoted epoxidation of stilbene over gold nanoparticles supported on Gd-doped titania

    Mendez, Violaine; Guillois, Kevin; Daniè le, Sté phane; Tuel, Alain; Caps, Valerie

    2010-01-01

    Aerobic partial oxidations of alkanes and alkenes are important processes of the petrochemical industry. The radical mechanisms involved can be catalyzed by soluble salts of transition metals (Co, Cu, Mn...). We show here that the model methylcyclohexane/stilbene co-oxidation reaction can be efficiently catalyzed at lower temperature by supported gold nanoparticles. The support has little influence on gold intrinsic activity but more on the apparent reaction rates which are a combination of catalytic activity and diffusion limitations. These are here minimized by using gadolinium-doped titania nanocrystallites as support for gold nanoparticles. This material is obtained by mild hydrolysis of a new Gd4TiO(OiPr)14 bimetallic oxoalkoxide. It leads to enhanced wettability of the < 3 nm gold particles in the tert-butyl hydroperoxide (TBHP)-initiated epoxidation of stilbene in methylcyclohexane; Au/TiO2:Gd3+ is in turn as active as the state-of-the-art hydrophobic Au/SiO2 catalyst. The rate-determining step of this reaction is identified as the gold-catalyzed homolytic decomposition of TBHP generating radicals and initiating the methylcyclohexane-mediated epoxidation of stilbene, yielding a methylcyclohexan-1-ol/trans-stilbene oxide mixture. Methylcyclohexan-1-ol can also be obtained in the absence of the alkene in the gold-catalyzed solvent-free autoxidation of methylcyclohexane, evidencing the catalytic potential of gold nanoparticles for low temperature C-H activation. © 2010 The Royal Society of Chemistry.

  17. Piceatannol and Other Wine Stilbenes: A Pool of Inhibitors against α-Synuclein Aggregation and Cytotoxicity

    Hamza Temsamani

    2016-06-01

    Full Text Available The aggregation of α-synuclein is one on the key pathogenic events in Parkinson’s disease. In the present study, we investigated the inhibitory capacities of stilbenes against α-synuclein aggregation and toxicity. Thioflavin T fluorescence, transmission electronic microscopy, and SDS-PAGE analysis were performed to investigate the inhibitory effects of three stilbenes against α-synuclein aggregation: piceatannol, ampelopsin A, and isohopeaphenol. Lipid vesicle permeabilization assays were performed to screen stilbenes for protection against membrane damage induced by aggregated α-synuclein. The viability of PC12 cells was examined using an MTT assay to assess the preventive effects of stilbenes against α-synuclein-induced toxicity. Piceatannol inhibited the formation of α synuclein fibrils and was able to destabilize preformed filaments. It seems to induce the formation of small soluble complexes protecting membranes against α-synuclein-induced damage. Finally, piceatannol protected cells against α-synuclein-induced toxicity. The oligomers tested (ampelopsin A and hopeaphenol were less active.

  18. Pulsed electric field treatment enhanced stilbene content in Graciano, Tempranillo and Grenache grape varieties.

    López-Alfaro, Isabel; González-Arenzana, Lucía; López, Noelia; Santamaría, Pilar; López, Rosa; Garde-Cerdán, Teresa

    2013-12-15

    The purpose of this paper was to study the effect of pulsed electric fields (PEF) on the stilbene content of three grape varieties. For this purpose, four different PEF treatments were applied using a continuous system over three varieties, Graciano, Tempranillo and Grenache, destemmed and crushed. In addition, the influence of PEF on their physicochemical composition was studied. PEF treatments did not affect the pH or total acidity of Graciano, however, musts from Tempranillo and Grenache had higher pH values and lower total acidity. In the three varieties, all treatments resulted in an increase of potassium content, deeper colour intensity and total polyphenol index and lower tonality, more pronounced in the treatments with higher time and energy. The stilbene content of the must significantly increased with respect to the control. This increase depended on the variety and the treatment applied. Tempranillo increased up 200% the total stilbene concentration, Grenache 60% and Graciano 50%. For the three varieties, the treatment with the highest time and energy was the most effective on the total stilbene extraction. These results indicate that PEF could be a suitable technology for obtaining musts with deeper colour and higher phenolic content, including resveratrol and piceid. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. 76 FR 19383 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    2011-04-07

    ... Stilbenic Optical Brightening Agents From China and Taiwan AGENCY: United States International Trade... reasonable indication that an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of...

  20. 77 FR 27079 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    2012-05-08

    ... industry in the United States is materially injured by reason of imports from China and Taiwan of certain... Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1\\ developed... that imports of certain stilbenic optical brightening agents from China and Taiwan were being sold at...

  1. Characterisation of stilbenes in California almonds (Prunus dulcis) by UHPLC-MS.

    Xie, Liyang; Bolling, Bradley W

    2014-04-01

    Stilbene polyphenols are present in some fruits and nuts, but their abundance in many foods, such as almonds, is unknown. Therefore, we characterised stilbenes from Nonpareil, Butte and Carmel almond (Prunus dulcis) varieties from California. UHPLC-MS conditions were optimised to resolve cis- and trans-resveratrol, d4-resveratrol, dienestrol, hexestrol, oxyresveratrol, piceatannol, pterostilbene, and resveratrol-3-β-glucoside (polydatin). Stilbenes were isolated from ethanolic almond extracts by solid-phase extraction and identified with UHPLC-MS by comparison of retention times, mass spectra, in-source CID spectra, and enzymatic hydrolysis to authentic standards. Polydatin was identified in almond extracts, with 7.19-8.52 μg/100 g almond. Piceatannol+oxyresveratrol was tentatively identified in almond blanch water, at 0.19-2.55 μg/100 g almond. Polydatin was concentrated in almond skins, which contained 95.6-97.5% of the total almond content. Therefore, almonds contain the stilbene class of polyphenols in addition to the previously identified proanthocyanidin, hydrolysable tannin, flavonoid, and phenolic acid classes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Varietal Distributions of Stilbenes in Grape Cane of Vitis vinifera L.

    Soural, I.; Balík, J.; Vrchotová, Naděžda; Tříska, Jan

    2017-01-01

    Roč. 20, č. 1 (2017), s. 11-14 ISSN 1335-2563 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LD14038 Institutional support: RVO:86652079 Keywords : Vitis vinifera L. * varieties * grape canes * stilbenes * distribution Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7)

  3. Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

    Roy Deodutta

    2004-01-01

    Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

  4. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    Yanagida, Takayuki; Watanabe, Kenichi; Fujimoto, Yutaka

    2015-01-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under 137 Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators

  5. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    Yanagida, Takayuki, E-mail: yanagida@lsse.kyutech.ac.jp [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan); Watanabe, Kenichi [Nagoya University, Furocho, Chikusa, Nagoya 464-8603 (Japan); Fujimoto, Yutaka [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan)

    2015-06-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under {sup 137}Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators.

  6. Antiviral Stilbene 1,2-Diamines Prevent Initiation of Hepatitis C Virus RNA Replication at the Outset of Infection▿

    Gastaminza, Pablo; Pitram, Suresh M.; Dreux, Marlene; Krasnova, Larissa B.; Whitten-Bauer, Christina; Dong, Jiajia; Chung, Josan; Fokin, Valery V.; Sharpless, K. Barry; Chisari, Francis V.

    2011-01-01

    The recent development of a cell culture model of hepatitis C virus (HCV) infection based on the JFH-1 molecular clone has enabled discovery of new antiviral agents. Using a cell-based colorimetric screening assay to interrogate a 1,200-compound chemical library for anti-HCV activity, we identified a family of 1,2-diamines derived from trans-stilbene oxide that prevent HCV infection at nontoxic, low micromolar concentrations in cell culture. Structure-activity relationship analysis of ∼300 derivatives synthesized using click chemistry yielded compounds with greatly enhanced low nanomolar potency and a >1,000:1 therapeutic ratio. Using surrogate models of HCV infection, we showed that the compounds selectively block the initiation of replication of incoming HCV RNA but have no impact on viral entry, primary translation, or ongoing HCV RNA replication, nor do they suppress persistent HCV infection. Selection of an escape variant revealed that NS5A is directly or indirectly targeted by this compound. In summary, we have identified a family of HCV inhibitors that target a critical step in the establishment of HCV infection in which NS5A translated de novo from an incoming genomic HCV RNA template is required to initiate the replication of this important human pathogen. PMID:21430055

  7. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Wright, A. von (Univ. of Eastern Finland, Kuopio (Finland). Dept. of Biosciences.), Email: atte.vonWright@uef.fi

    2010-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  8. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Wright, A. von (Univ. of Kuopio, Dept. of Biosciences (Finland)), email: atte.vonWright@uku.fi

    2009-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type 2 diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type 2 diabetes) highlighting results. (orig.)

  9. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents (BIOSTIMUL)

    Wright, A. von (Kuopio Univ., Department of Biosciences (Finland))

    2008-07-01

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and as derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  10. Factors influencing the production of stilbenes by the knotweed, Reynoutria × bohemica

    Kovářová, Marcela; Bartůňková, Kristýna; Frantík, Tomáš; Koblihová, Helena; Prchalová, K.; Vosátka, Miroslav

    2010-01-01

    Roč. 10, č. 19 (2010), s. 1-16 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : japanese knotweed * Reynoutria * stilbenes Subject RIV: EF - Botanics Impact factor: 4.085, year: 2010 http://www.biomedcentral.com/1471-2229/10/19

  11. Target molecular weights for red cell band 3 stilbene and mercurial binding sites

    Verkman, A.S.; Skorecki, K.L.; Jung, C.Y.; Ausiello, D.A.

    1986-01-01

    Radiation inactivation was used to measure the target sizes for binding of disulfonic stilbene anion transport inhibitor 4,4'-dibenzamido-2,2'-disulfonic stilbene (DBDS) and mercurial water transport inhibitor p-chloromercuribenzene sulfonate (pCMBS) to human erythrocytes. The measured target size for erythrocyte ghost acetylcholinesterase was 78 +/- 3 kDa. DBDS binding to ghost membranes was measured by a fluorescence enhancement technique. Radiation (0-26 Mrad) had no effect on total membrane protein and DBDS binding affinity, whereas DBDS binding stoichiometry decreased exponentially with radiation dose, giving a target size of 59 +/- 4 kDa. H2-4,4'-diisothiocyano-2,2'-disulfonic stilbene (H2-DIDS, 5 microM) blocked greater than 95% of DBDS binding at all radiation doses. pCMBS binding was measured from the time course of tryptophan fluorescence quenching in ghosts treated with the sulfhydryl reagent N-ethylmaleimide (NEM). Radiation did not affect the kinetics of tryptophan quenching, whereas the total amplitude of the fluorescence signal inactivated with radiation with a target size of 31 +/- 6 kDa. These results support the notion that DBDS and pCMBS bind to the transmembrane domain of erythrocyte band 3 in NEM-treated ghosts and demonstrate that radiation inactivation may probe a target significantly smaller than a covalently linked protein subunit. The small target size for the band 3 stilbene binding site may correspond to the intramembrane domain of the band 3 monomer (52 kDa), which is physically distinct from the cytoplasmic domain (42 kDa)

  12. A single source precursor route to group 13 homo- and heterometallic oxides as highly active supports for gold-catalyzed aerobic epoxidation of trans-stilbene

    Mishra, Shashank K.; Mendez, Violaine; Jeanneau, Erwann; Caps, Valerie; Daniè le, Sté phane

    2012-01-01

    A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. A single source precursor route to group 13 homo- and heterometallic oxides as highly active supports for gold-catalyzed aerobic epoxidation of trans-stilbene

    Mishra, Shashank K.

    2012-12-14

    A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Carborane-stilbene dyads: the influence of substituents and cluster isomers on photoluminescence properties.

    Ferrer-Ugalde, A; Cabrera-González, J; Juárez-Pérez, E J; Teixidor, F; Pérez-Inestrosa, E; Montenegro, J M; Sillanpää, R; Haukka, M; Núñez, R

    2017-02-14

    Two novel styrene-containing meta-carborane derivatives substituted at the second carbon cluster atom (C c ) with either a methyl (Me) or a phenyl (Ph) group are introduced herein along with a new set of stilbene-containing ortho- (o-) and meta- (m-) carborane dyads. The latter set of compounds have been prepared from styrene-containing carborane derivatives via a Heck coupling reaction. High regioselectivity has been achieved for these compounds by using a combination of palladium complexes [Pd 2 (dba) 3 ]/[Pd(t-Bu 3 P) 2 ] as a catalytic system, yielding exclusively E isomers. All compounds have been fully characterised and the crystal structures of seven of them were analysed by X-ray diffraction. The absorption spectra of these compounds are similar to those of their respective fluorophore groups (styrene or stilbene), showing a very small influence of the substituent (Me or Ph) linked to the second C c atom or the cluster isomer (o- or m-). On the other hand, fluorescence spectroscopy revealed high emission intensities for Me-o-carborane derivatives, whereas their Ph-o-carborane analogues evidenced an almost total lack of fluorescence, confirming the significant role of the substituent bound to the adjacent C c in o-carboranes. In contrast, all the m-carborane derivatives display similar photoluminescence (PL) behavior regardless of the substituent attached to the second C c , demonstrating its small influence on emission properties. Additionally, m-carborane derivatives are significantly more fluorescent than their o-counterparts, reaching quantum yield values as high as 30.2%. Regarding solid state emission, only stilbene-containing Ph-o-carborane derivatives, which showed very low fluorescence in solution, exhibited notable PL emission in films attributed to aggregation-induced emission. DFT calculations were performed to successfully complement the photoluminescence studies, supporting the experimentally observed photophysical behavior of the styrene and

  15. Assessing and Synthesizing the Last Decade of Research on the Major Pools and Fluxes of the Carbon Cycle in the US and North America: An Interagency Governmental Perspective

    Cavallaro, N.; Shrestha, G.; Stover, D. B.; Zhu, Z.; Ombres, E. H.; Deangelo, B.

    2015-12-01

    The 2nd State of the Carbon Cycle Report (SOCCR-2) is focused on US and North American carbon stocks and fluxes in managed and unmanaged systems, including relevant carbon management science perspectives and tools for supporting and informing decisions. SOCCR-2 is inspired by the US Carbon Cycle Science Plan (2011) which emphasizes global scale research on long-lived, carbon-based greenhouse gases, carbon dioxide and methane, and the major pools and fluxes of the global carbon cycle. Accordingly, the questions framing the Plan inform this report's topical roadmap, with a focus on US and North America in the global context: 1) How have natural processes and human actions affected the global carbon cycle on land, in the atmosphere, in the oceans and in the ecosystem interfaces (e.g. coastal, wetlands, urban-rural)? 2) How have socio-economic trends affected the levels of the primary carbon-containing gases, carbon dioxide and methane, in the atmosphere? 3) How have species, ecosystems, natural resources and human systems been impacted by increasing greenhouse gas concentrations, the associated changes in climate, and by carbon management decisions and practices? To address these aspects, SOCCR-2 will encompass the following broad assessment framework: 1) Carbon Cycle at Scales (Global Perspective, North American Perspective, US Perspective, Regional Perspective); 2) Role of carbon in systems (Soils; Water, Oceans, Vegetation; Terrestrial-aquatic Interfaces); 3) Interactions/Disturbance/Impacts from/on the carbon cycle. 4) Carbon Management Science Perspective and Decision Support (measurements, observations and monitoring for research and policy relevant decision-support etc.). In this presentation, the Carbon Cycle Interagency Working Group and the U.S. Global Change Research Program's U.S. Carbon Cycle Science Program Office will highlight the scientific context, strategy, structure, team and production process of the report, which is part of the USGCRP's Sustained

  16. Holographic recording of surface relief gratings in stilbene azobenzene derivatives at 633 nm

    Ozols, A; Saharov, D; Kokars, V; Kampars, V; Maleckis, A; Mezinskis, G; Pludons, A

    2010-01-01

    Holographic recording in stilbene azobenzene derivatives by He-Ne 633 nm laser light has been experimentally studied. It was found that surface relief gratings (SRG) can be recorded by red light. Usually shorter wavelengths are used to induce the trans-cis photo-isomerization in organic materials. SRG with 2 μm period and an amplitude of 130 nm have been recorded with 0.88 W/cm 2 light in about 20 minutes in amorphous films of 3-(4-(bis(2-(trityloxy)ethyl)amino)phenyl)-2-(4-(2-bromo-4-nitrophenyl) diazenyl)phenyl)acrylonitrile spin-coated on glass substrates. Self-diffraction efficiency up to 17.4% and specific recording energy down to 114 J/(cm 2 %) were measured. The recorded SRG were stable as proved by subsequent AFM measurements. The photo-induced changes in absorption spectra did not reveal noticeable signs of trans-cis transformations. Rather, spectrally uniform bleaching of the films took place. We conclude that a photothermally stimulated photo-destruction of chromophores is responsible for the SRG recording. The recording of stable SRG in the stilbene azobenzene derivatives we studied is accompanied by the recording of relaxing volume-phase gratings due to the photo-orientation of chromophores by the linearly polarized recording light. It should also be noted that holographic recording efficiency in stilbene azobenzene derivatives exhibit an unusual non-monotonic sample storage-time dependence presumably caused by the peculiarities of structural relaxation of the films.

  17. New organic photorefractive material composed of a charge-transporting dendrimer and a stilbene chromophore

    Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.

    1999-10-01

    In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.

  18. A radioimmunoassay for the detection of diethylstilboestrol and related stilbenes in biological fluids

    Hallahan, Cornelius; McGarry, Yvonne; Collins, J.D.

    1985-01-01

    A radioimmunoassay for the measurement of the synthetic anabolic agent diethylstilboestrol (DES) is described. It is based on a commercially available antiserum and a tritiated derivative of DES. The method can detect low concentrations of residues (less than 0.5 ng/ml) in small samples (0.05 to 0.2 ml) of biological fluids. DES was measured in plasma, bile and urine obtained from a calf slaughtered 22 days after subcutaneous implantation of 24 mg DES. The assay described is suitable as a rapid screening procedure for identifying animals treated with stilbene substances. (author)

  19. Identification and quantification of stilbenes in some Tunisian red wines using UPLC-MS and HPLC-DAD

    Kamel Arraki

    2017-06-01

    Full Text Available Seven Tunisian red wines mainly from the Mornag appellation were analyzed for resveratrol and analogues. The wines of each variety were evaporated, concentrated, and then subjected to fractionation and purification using XAD16 and DOWEX column chromatography. In addition to resveratrol, seven stilbenes were identified by UPLC-MS. The stilbenes derived were shown to be piceatannol, piceid, a-viniferin, e-viniferin, hopeaphenol and isohopeaphenol. From the point of view of the presence of resveratrol derivatives, one wine, Sidi Zahia, was the richest qualitatively.

  20. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L.

    Ivo Soural

    2015-04-01

    Full Text Available Grape cane, leaves and grape marc are waste products from viticulture, which can be used to obtain secondary stilbene derivatives with high antioxidant value. The presented work compares several extraction methods: maceration at laboratory temperature, extraction at elevated temperature, fluidized-bed extraction, Soxhlet extraction, microwave-assisted extraction, and accelerated solvent extraction. To obtain trans-resveratrol, trans-ε-viniferin and r2-viniferin from grape cane of the V. vinifera variety Cabernet Moravia, various conditions were studied: different solvents, using powdered versus cut cane material, different extraction times, and one-step or multiple extractions. The largest concentrations found were 6030 ± 680 µg/g dry weight (d.w. for trans-resveratrol, 2260 ± 90 µg/g d.w. for trans-ε-viniferin, and 510 ± 40 µg/g d.w. for r2-viniferin. The highest amounts of stilbenes (8500 ± 1100 µg/g d.w. were obtained using accelerated solvent extraction in methanol.

  1. Digital pile-up rejection for plutonium experiments with solution-grown stilbene

    Bourne, M.M., E-mail: mmbourne@umich.edu; Clarke, S.D., E-mail: clarkesd@umich.edu; Paff, M., E-mail: mpaff@umich.edu; DiFulvio, A., E-mail: difulvio@umich.edu; Norsworthy, M., E-mail: marknors@umich.edu; Pozzi, S.A., E-mail: pozzisa@umich.edu

    2017-01-11

    A solution-grown stilbene detector was used in several experiments with plutonium samples including plutonium oxide, mixed oxide, and plutonium metal samples. Neutrons from different reactions and plutonium isotopes are accompanied by numerous gamma rays especially by the 59-keV gamma ray of {sup 241}Am. Identifying neutrons correctly is important for nuclear nonproliferation applications and makes neutron/gamma discrimination and pile-up rejection necessary. Each experimental dataset is presented with and without pile-up filtering using a previously developed algorithm. The experiments were simulated using MCNPX-PoliMi, a Monte Carlo code designed to accurately model scintillation detector response. Collision output from MCNPX-PoliMi was processed using the specialized MPPost post-processing code to convert neutron energy depositions event-by-event into light pulses. The model was compared to experimental data after pulse-shape discrimination identified waveforms as gamma ray or neutron interactions. We show that the use of the digital pile-up rejection algorithm allows for accurate neutron counting with stilbene to within 2% even when not using lead shielding.

  2. Effect of clone selection, nitrogen supply, leaf damage and mycorrhizal fungi on stilbene and emodin production in knotweed

    Kovářová, Marcela; Frantík, Tomáš; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav

    2011-01-01

    Roč. 11, č. 98 (2011), s. 1-14 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : knotweed * stilbenes * leaf damage Subject RIV: EF - Botanics Impact factor: 3.447, year: 2011

  3. Perpendicular State of an Electronically Excited Stilbene: Observation by Femtosecond-Stimulated Raman Spectroscopy.

    Quick, Martin; Dobryakov, Alexander L; Ioffe, Ilya N; Granovsky, Alex A; Kovalenko, Sergey A; Ernsting, Nikolaus P

    2016-10-20

    In the photoisomerization path of stilbene, a perpendicular state P on the S 1 potential energy surface is expected just before internal conversion through a conical intersection S 1 /S 0 . For decades the observation of P was thwarted by a short lifetime τ P in combination with slow population flow over a barrier. But these limitations can be overcome by ethylenic substitution. Following optical excitation of trans-1,1'-dicyanostilbene, P is populated significantly (τ P = 27 ps in n-hexane) and monitored by an exited-state absorption band at 370 nm. Here we report stimulated Raman lines of P. The strongest, at 1558 cm -1 , is attributed to stretching vibrations of the phenyl rings. Transient electronic states, resonance conditions, and corresponding Raman signals are discussed.

  4. Synthesis of stilbene derivatives via visible-light-induced cross-coupling of aryl diazonium salts with nitroalkenes using -NO2 as a leaving group.

    Zhang, Na; Quan, Zheng-Jun; Zhang, Zhang; Da, Yu-Xia; Wang, Xi-Cun

    2016-12-06

    The straightforward visible-light-induced synthesis of stilbene compounds via the cross-coupling of nitroalkenes and diazonium tetrafluoroborates under transition-metal-free conditions is described. The protocol uses green LEDs as light sources and eosin Y as an organophotoredox catalyst. Broad substrate scope and exclusive selectivity for the (E)-configuration of stilbenes are observed. This protocol proceeds via a radical pathway, with nitroalkenes serving as the radical acceptor, and the nitro group is cleaved during the process.

  5. Polyphenol Stilbenes from Fenugreek (Trigonella foenum-graecum L. Seeds Improve Insulin Sensitivity and Mitochondrial Function in 3T3-L1 Adipocytes

    Gang Li

    2018-01-01

    Full Text Available Fenugreek (Trigonella foenum-graecum L. is a well-known annual plant that is widely distributed worldwide and has possessed obvious hypoglycemic and hypercholesterolemia characteristics. In our previous study, three polyphenol stilbenes were separated from fenugreek seeds. Here, we investigated the effect of polyphenol stilbenes on adipogenesis and insulin resistance in 3T3-L1 adipocytes. Oil Red O staining and triglyceride assays showed that polyphenol stilbenes differently reduced lipid accumulation by suppressing the expression of adipocyte-specific proteins. In addition, polyphenol stilbenes improved the uptake of 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino-2-deoxyglucose (2-NBDG by promoting the phosphorylation of protein kinase B (AKT and AMP-activated protein kinase (AMPK. In present studies, it was found that polyphenol stilbenes had the ability to scavenge reactive oxygen species (ROS. Results from adenosine triphosphate (ATP production and mitochondrial membrane potentials suggested that mitochondria play a critical role in insulin resistance and related signaling activation, such as AKT and AMPK. Rhaponticin, one of the stilbenes from fenugreek, had the strongest activity among the three compounds in vitro. Future studies will focus on mitochondrial biogenesis and function.

  6. A comparison of two methods of pulse-shape discrimination for alpha-gamma separation with trans-stilbene

    Shani, G.; Cojocaru, M.

    1977-01-01

    A method for measurement of low level alpha particles in high level gamma background is investigated. Because of its pulse-shape-discrimination properties and being a solid scintillator, trans-stilbene seems to be the proper scintillator, for this purpose. The investigation was done by measuring the effect of different gamma background level (from very low to very high) on constant alpha count rate. Two different pulse-shape-discrimination systems were used and compared. The Ortec system measures the pulse fall time and supplies a corresponding pulse height and the Elscint system checks whether the pulse is what is expected to be the gamma pulse, or is a longer pulse. Both systems yielded good results and were found to be adequate for alpha-gamma separation with trans-stilbene. (Auth.)

  7. Stilbenes from Deguelia rufescens var. urucu (Ducke) A. M. G. Azevedo leaves: effects on seed germination and plant growth

    Lobo, Livia T.; Silva, Geilson A. da; Freitas, Manolo C.C. de; Silva, Milton N. da; Arruda, Alberto C.; Guilhon, Giselle M.S.P.; Santos, Lourivaldo S.; Santos, Alberdan S.; Arruda, Mara S.P., E-mail: mspa@ufpa.b [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais. Programa de Pos-Graduacao em Quimica; Souza Filho, Antonio Pedro S. [Centro de Pesquisa Agroflorestal da Amazonia Oriental (CPATU), Belem, PA (Brazil)

    2010-07-01

    The Amazon biodiversity may provide plants whose chemical substances are capable of controlling weeds. In this study we report the isolation and identification of five stilbenes from the leaves of 'timbo vermelho' (Deguelia rufescens var. urucu): 4-methoxylonchocarpene (1); 3,5-dimethoxy-4'-hydroxy-3'-prenyl-trans-stilbene (2), lonchocarpene (3), 3,5-dimethoxy-4'-Oprenyl- trans-stilbene (4) and pterostilbene (5). Compounds 2 and 4 are new natural products although 2 has been previously cited as synthesis product. Potential allelopathic activity for 1, 2 and 4 was evaluated over seed germination and plant growth of Mimosa pudica weed. The observed effects on seed germination did not vary significantly (p > 0.05) when the analysis of phytotoxicity was performed with the substances alone, the maximum inhibition did not exceed 20%. The most intense inhibitions on radicle and hypocotyl development were found for compound 4 (p < 0.05). When tested in pairs, showed antagonism for seed germination and synergism for radicle and hypocotyl development. (author)

  8. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  9. Synergistic action of fatty acids, sulphides and stilbene against acaricide-resistant Rhipicephalus microplus ticks.

    Arceo-Medina, G N; Rosado-Aguilar, J A; Rodríguez-Vivas, R I; Borges-Argaez, R

    2016-09-15

    Six compounds in a methanolic extract of Petiveria alliacea stem (cis-stilbene; benzyl disulphide; benzyl trisulphide; and methyl esters of hexadecanoic acid, octadecadienoic acid and octadecenoic acid) are known to exercise acaricide activity against cattle tick Rhipicephalus microplus larvae and adults. The synergistic effect of 57 combinations of these six compounds on acaricide activity against R. microplus was evaluated. Larvae immersion tests produced the lethal concentrations needed to kill 50% (LC 50 ) and 99% (LC 99 ) of the population. Adult immersion tests produced rates (%) for mortality, oviposition inhibition and eclosion inhibition. Individually, none of the compounds (1% concentration) exhibited acaricide activity (mortality ≤2.3%). When combined, however, nine mixtures exhibited a synergistic increase in activity, with high mortality rates (≥92%) in larvae. Values for LC 50 ranged from 0.07 to 0.51% and those for LC 99 from 0.66 to 5.16%. Thirty six compound mixtures had no significant activity (mortality ≤30%) against larvae. Two mixtures exhibited synergism against adults, with high rates (≥92%) of oviposition inhibition. The mixtures based on the benzyl disulphide+benzyl trisulphide pairing produced a synergistic effect against acaricide-resistant R. microplus larva and adults, and are therefore the most promising combination for controlling this ubiquitous ectoparasite. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Syntheses of Resveratrol Analogues and Evaluation of Their Antioxidant Activity

    Kim, Mi Jeong; Jung, Se Hoon; Moon, Insu; Jun Jonggab; Lee, Jeong Tae

    2014-01-01

    Free radicals such as superoxide anion radicals (O 2 · - ), hydroxyl radicals (·OH) and non-free radical species such as hydrogen peroxide (H 2 O 2 ) and singlet oxygen ( 1 O 2 ) are considered as ROS. These ROS not only oxidize membrane lipids but damage nucleic acids, proteins and carbohydrates leading to mutations. If ROS are not scavenged by antioxidants, they could be involved in ageing and various diseases related to oxidative stress. Resveratrol is a natural phytoalexin found in the skin of grapes, red wines, and peanuts. It has three hydroxyl groups at the trans-stilbene structure, in which resorcinol and phenol are bridged by a trans double bond. The recent extensive studies on the resveratrol and its derivatives revealed that they have antioxidant, antimutagenic, antiinflammatory, antidiabetic, cardiovascular protective, and anticancer properties. It has been believed that the majority of the biological functions of resveratrol has been attributed to its antioxidant activity

  11. An Immunosensing System Using Stilbene Glycoside as a Fluorogenic Substrate for an Enzymatic Reaction Model

    Ya-Fei Tan

    2008-09-01

    Full Text Available A natural product, stilbene glycoside (2,3,5,4’-tetrahydroxydiphenylethylene-2-O-glucoside, TBG, has been evaluated for the first time as a potential substrate for horseradish peroxidase (HRP-catalyzed fluorogenic reactions. The properties of TBG as a fluorogenic substrate for HRP and its application in a fluorometric enzyme-linked immunosensing system were compared with commercially available substrates such as p-hydroxyphenylpropionic acid (pHPPA, chavicol and Amplex red using Brucella melitensis antibody (BrAb as a model analyte. The immunosensing body based on HRP-BrAb was constructed by dispersing graphite, BrAg and paraffin wax at room temperature. In a competitive immunoassay procedure, the BrAb competed with HRP-BrAb to react with the immobilized BrAg. In the enzymatic reaction, the binding HRP-BrAb on the sensing body surface can catalyze the polymerization reaction of TBG by H2O2 forming fluorescent dimers and causing an increase in fluorescence intensity. TBG showed comparable ability for HRP detection and its enzyme-linked immunosensing reaction system, in a linear detection ranging of 3.5´10-8~7.6´10-6g/L and with a detection limit of 1.7´10-9 g/L. The immobilized biocomposite surface could be regenerated with excellent reproducibility (RSD=3.8% by simply polishing with an alumina paper. The proposed immunosensing system has been used to determine the BrAb in rabbit serum samples with satisfactory results.

  12. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    Püttner, Ralph; Schmidt-Weber, Philipp; Kampen, Thorsten; Kolczewski, Christine; Hermann, Klaus; Horn, Karsten

    2017-01-01

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  13. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    Püttner, Ralph [Department of Physics, Freie Universität Berlin, 14195 Berlin (Germany); Schmidt-Weber, Philipp [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Kampen, Thorsten [SPECS Surface Nano Analysis GmbH, 13355 Berlin (Germany); Kolczewski, Christine [Deutsches Museum München, 80538 Munich (Germany); Hermann, Klaus [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Horn, Karsten, E-mail: horn@fhi-berlin.mpg.de [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany)

    2017-02-15

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  14. Thiophene-free diphenyl-amino-stilbene-diketo-pyrrolo-pyrrole derivatives as donors for organic bulk heterojunction solar cell

    Honová, J.; Luňák, S.; Vala, M.; Stříteský, S.; Fekete, Ladislav; Weiter, M.; Kovalenko, A.

    2016-01-01

    Roč. 70, č. 10 (2016), s. 1416-1424 ISSN 0366-6352 R&D Projects: GA MŠk LO1409; GA ČR(CZ) GA15-05095S; GA MŠk LM2015088 Institutional support: RVO:68378271 Keywords : organic solar cell * thiophene-free * diphenyl-amino-stilbene * hole mobility * molecular structure Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.258, year: 2016

  15. Stilbene induced inhibition of androgen receptor dimerization: implications for AR and ARΔLBD-signalling in human prostate cancer cells.

    Wolfgang Streicher

    Full Text Available BACKGROUND: Advanced castration resistant prostate cancer (CRPC is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. METHODOLOGY: In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV and (E-4-(2, 6-Difluorostyryl-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. RESULTS: The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. CONCLUSION: RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors.

  16. Synthesis and structural and photoswitchable properties of novel chiral host molecules: axis chiral 2,2'-dihydroxy-1,1'-binaphthyl-appended stiff-stilbene.

    Shimasaki, Toshiaki; Kato, Shin-ichiro; Ideta, Keiko; Goto, Kenta; Shinmyozu, Teruo

    2007-02-16

    Novel photoswitchable chiral hosts having an axis chiral 2,2'-dihydroxy-1,1'-binaphthyl (BINOL)-appended stiff-stilbene, trans-(R,R)- and -(S,S)-1, were synthesized by palladium-catalyzed Suzuki-Miyaura coupling and low-valence titanium-catalyzed McMurry coupling as key steps, and they were fully characterized by various NMR spectral techniques. The enantiomers of trans-1 showed almost complete mirror images in the CD spectra, where two split Cotton effects (exciton coupling) were observed in the beta-transitions of the naphthyl chromophore at 222 and 235 nm, but no Cotton effect was observed in the stiff-stilbene chromophore at 365 nm. The structures of (R)-10 and trans-(R,R)-1 were confirmed by X-ray structural analysis. The optimized structure of cis-1 by MO calculations has a wide chiral cavity of 7-8 A in diameter, whereas trans-1 cannot form an intramolecular cavity based on the X-ray data. Irradiation of (R,R)-trans-1 with black light (lambda = 365 nm) in CH3CN or benzene at 23 degrees C led to the conversion to the corresponding cis-isomer, as was monitored by 1H NMR, UV-vis, and CD spectra. At the photostationary state, the cis-1/trans-1 ratio was 86/14 in benzene or 75/25 in CH3CN. On the other hand, irradiation of the cis-1/trans-1 (75/25) mixture in CH3CN with an ultra-high-pressure Hg lamp at 23 degrees C (lambda = 410 nm) led to the photostationary state, where the cis-1/trans-1 ratio was estimated to be 9/91 on the basis of the 1H NMR spectra. The cis-trans and trans-cis interconversions could be repeated 10 times without decomposition of the C=C double bond. Thus, a new type of photoswitchable molecule has been developed, and trans-1 and cis-1 were quite durable under irradiation conditions. The guest binding properties of the BINOL moieties of trans- and cis-(R,R)-1 with F-, Cl-, and H2PO4- were examined by 1H NMR titration in CDCl3. Similar interaction with F- and Cl- was observed in trans-1 (host/guest = 1/1, Kassoc = (1.0 +/- 0.13) x 103 for F

  17. Tuning Stilbene Photochemistry by Fluorination: State Reordering Leads to Sudden Polarization near the Franck-Condon Region.

    Ioffe, Ilya N; Quick, Martin; Quick, Michael T; Dobryakov, Alexander L; Richter, Celin; Granovsky, Alex A; Berndt, Falko; Mahrwald, Rainer; Ernsting, Nikolaus P; Kovalenko, Sergey A

    2017-10-25

    Spontaneous polarization of a nonpolar molecule upon photoexcitation (the sudden polarization effect) earlier discussed for 90°-twisted alkenes is observed and calculated for planar ring-fluorinated stilbenes, trans-2,3,5,6,2',3',5',6'-octofluorostilbene (tF2356) and trans-2,3,4,5,6,2',3',4',5',6'-decafluorostilbene (tF23456). Due to the fluorination, Franck-Condon states S 1 FC and S 2 FC are dominated by the quasi-degenerate HOMO-1 → LUMO and HOMO-2 → LUMO excitations, while their interaction gives rise to a symmetry-broken zwitterionic S 1 state. After optical excitation of tF2356, one observes an ultrafast (∼0.06 ps) evolution that reflects relaxation from initial nonpolar S 3 FC to long-lived (1.3 ns in n-hexane and 3.4 ns in acetonitrile) polar S 1 . The polarity of S 1 is evidenced by a solvatochromic shift of its fluorescence band. The experimental results provide a sensitive test for quantum-chemical calculations. In particular, our calculations agree with the experiment, and raise concerns about the applicability of the common TDDFT approach to relatively simple stilbenic systems.

  18. Relative light yield and temporal response of a stilbene-doped bibenzyl organic scintillator for neutron detection

    Brown, J. A.; Goldblum, B. L., E-mail: bethany@nuc.berkeley.edu; Brickner, N. M.; Daub, B. H.; Kaufman, G. S.; Bibber, K. van; Vujic, J. [Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States); Bernstein, L. A.; Bleuel, D. L.; Caggiano, J. A.; Hatarik, R.; Phillips, T. W.; Zaitseva, N. P. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Wender, S. A. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

    2014-05-21

    The neutron time-of-flight (nTOF) diagnostics used to characterize implosions at the National Ignition Facility (NIF) has necessitated the development of novel scintillators that exhibit a rapid temporal response and high light yield. One such material, a bibenzyl-stilbene mixed single-crystal organic scintillator grown in a 99.5:0.5 ratio in solution, has become the standard scintillator used for nTOF diagnostics at NIF. The prompt fluorescence lifetime and relative light yield as a function of proton energy were determined to calibrate this material as a neutron detector. The temporal evolution of the intensity of the prompt fluorescent response was modeled using first-order reaction kinetics and the prompt fluorescence decay constant was determined to be 2.46 ± 0.01 (fit) ± 0.13 (systematic) ns. The relative response of the bibenzyl-stilbene mixed crystal generated by recoiling protons was measured, and results were analyzed using Birks' relation to quantify the non-radiative quenching of excitation energy in the scintillator.

  19. Structural and kinetic analysis of the unnatural fusion protein 4-coumaroyl-CoA ligase::stilbene synthase

    Wang, Yechun; Yi, Hankuil; Wang, Melissa; Yu, Oliver; Jez, Joseph M. (WU); (Danforth)

    2012-10-24

    To increase the biochemical efficiency of biosynthetic systems, metabolic engineers have explored different approaches for organizing enzymes, including the generation of unnatural fusion proteins. Previous work aimed at improving the biosynthesis of resveratrol, a stilbene associated a range of health-promoting activities, in yeast used an unnatural engineered fusion protein of Arabidopsis thaliana (thale cress) 4-coumaroyl-CoA ligase (At4CL1) and Vitis vinifera (grape) stilbene synthase (VvSTS) to increase resveratrol levels 15-fold relative to yeast expressing the individual enzymes. Here we present the crystallographic and biochemical analysis of the 4CL::STS fusion protein. Determination of the X-ray crystal structure of 4CL::STS provides the first molecular view of an artificial didomain adenylation/ketosynthase fusion protein. Comparison of the steady-state kinetic properties of At4CL1, VvSTS, and 4CL::STS demonstrates that the fusion protein improves catalytic efficiency of either reaction less than 3-fold. Structural and kinetic analysis suggests that colocalization of the two enzyme active sites within 70 {angstrom} of each other provides the basis for enhanced in vivo synthesis of resveratrol.

  20. Fast collimated neutron flux measurement using stilbene scintillator and flashy analog-to-digital converter in JT-60U

    Ishikawa, M.; Itoga, T.; Okuji, T.; Nakhostin, M.; Shinohara, K.; Hayashi, T.; Sukegawa, A.; Baba, M.; Nishitani, T.

    2006-01-01

    A line-integrated neutron emission profile is routinely measured using the radial neutron collimator system in JT-60U tokamak. Stilbene neuron detectors (SNDs), which combine a stilbene organic crystal scintillation detector (SD) with an analog neutron-gamma pulse shape discrimination (PSD) circuit, have been used to measure collimated neutron flux. Although the SND has many advantages as a neutron detector, the maximum count rate is limited up to ∼1x10 5 counts/s due to the analog PSD circuit. To overcome this issue, a digital signal processing system (DSPS) using a flash analog-to-digital converter (Acqiris DC252, 8 GHz, 10 bits) has been developed at Cyclotron and Radioisotope Center in Tohoku University. In this system anode signals from photomultiplier of the SD are directory stored and digitized. Then, the PSD between neutrons and gamma rays is performed using software. The DSPS has been installed in the vertical neutron collimator system in JT-60U and applied to deuterium experiments. It is confirmed that the PSD is sufficiently performed and collimated neutron flux is successfully measured with count rate up to ∼5x10 5 counts/s without the effect of pileup of detected pulses. The performance of the DSPS as a neutron detector, which supersedes the SND, is demonstrated

  1. Scope and limitations of the Heck-Matsuda-coupling of phenol diazonium salts and styrenes: a protecting-group economic synthesis of phenolic stilbenes.

    Schmidt, Bernd; Elizarov, Nelli; Berger, René; Hölter, Frank

    2013-06-14

    4-Phenol diazonium salts undergo Pd-catalyzed Heck reactions with various styrenes to 4'-hydroxy stilbenes. In almost all cases higher yields and fewer side products were observed, compared to the analogous 4-methoxy benzene diazonium salts. In contrast, the reaction fails completely with 2- and 3-phenol diazonium salts. For these substitution patterns the methoxy-substituted derivatives are superior.

  2. Insights on the stilbenes in Raboso Piave grape (Vitis vinifera L.) as a consequence of postharvest vs on-vine dehydration.

    Brillante, Luca; De Rosso, Mirko; Dalla Vedova, Antonio; Maoz, Itay; Flamini, Riccardo; Tomasi, Diego

    2018-03-01

    Grape withering is a process used to produce reinforced wines and raisins. Dehydration is usually carried out postharvest by keeping ripe grapes in special warehouses in controlled conditions of temperature, relative humidity (RH) and air flow. Alternatively, grape clusters can be left on the vines after the canes have been pruned. In general, dehydration increases stilbenes in grape, but there are few studies on the effects of on-vine withering. The stilbene profiles of Raboso Piave grape during postharvest and on-vine dehydration were studied here. High-resolution mass spectrometry (MS) was used to identify 19 stilbenes, including resveratrol monomers, dimers (viniferins), oligomers and glucoside derivatives. The two dehydration methods generally had different effects on the above nutraceuticals in grape. The samples kept in warehouses revealed significant increases in Z-ω-viniferin, E-ϵ-viniferin, δ-viniferin and another resveratrol dimer which were not observed in the plants. Trans-Resveratrol increased significantly only in samples dehydrated in the warehouse at 21 °C and 60-70% RH. The findings increase knowledge of stilbene composition in grapes subjected to withering on-vine. The choice of dehydration method affects the contents of these nutraceuticals in the grape and consequently in wines. Reasonably, it could also affect other secondary metabolites important for wine quality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  3. On interaction of α,β-dibromo-derivatives of 1,2-diphenyl ethane and stilbene with potassium and cesium fluorides

    Kremlev, M.M.; Fialkov, Yu.A.

    1976-01-01

    The interaction is studied of trans-α, β-dibromostilbene and meso -1, 2 - dibromo -1, 2 - diphenylethane with potassium and cesium fluorides in dimethyl sulphoxide and N - methyl pyrrolidone. It has been found that in this interaction there takes place debromination of vicinal dibromides resulting in the formation of tolan and trans-stilbene, respectively, with a quantitative yield

  4. Synthesis, structure, and properties of supramolecular charge-transfer complexes between bis(18-crown-6)stilbene and ammonioalkyl derivatives of 4,4'-bipyridine and 2,7-diazapyrene.

    Vedernikov, Artem I; Ushakov, Evgeny N; Efremova, Asya A; Kuz'mina, Lyudmila G; Moiseeva, Anna A; Lobova, Natalia A; Churakov, Andrei V; Strelenko, Yuri A; Alfimov, Michael V; Howard, Judith A K; Gromov, Sergey P

    2011-08-19

    4,4'-Bipyridine and 2,7-diazapyrene derivatives (A) having two ammonioalkyl N-substituents were synthesized. The complex formation of these compounds with bis(18-crown-6)stilbene (D) was studied by spectrophotometry, cyclic voltammetry, (1)H NMR spectroscopy, and X-ray diffraction analysis. In MeCN, π-donor D and π-acceptors A form supramolecular 1:1 (D·A) and 2:1 (D·A·D) charge-transfer complexes. The D·A complexes have a pseudocyclic structure as a result of ditopic binding of the ammonium groups to the crown-ether fragments. The better the geometric matching between the components, the higher the stability of the D·A complexes (log K up to 9.39). A key driving force of the D·A·D complex formation is the excessive steric strain in the precursor D·A complexes. The pseudocyclic D·A complexes involving the ammoniopropyl derivative of 4,4'-bipyridine were obtained as single crystals. Crystallization of the related ammonioethyl derivative was accompanied by transition of the D·A complexes to a structure of the (D·A)(m) coordination polymer type.

  5. PULSE SYNTHESIZING GENERATOR

    Kerns, Q.A.

    1963-08-01

    >An electronlc circuit for synthesizing electrical current pulses having very fast rise times includes several sinewave generators tuned to progressively higher harmonic frequencies with signal amplitudes and phases selectable according to the Fourier series of the waveform that is to be synthesized. Phase control is provided by periodically triggering the generators at precisely controlled times. The outputs of the generators are combined in a coaxial transmission line. Any frequency-dependent delays that occur in the transmission line can be readily compensated for so that the desired signal wave shape is obtained at the output of the line. (AEC)

  6. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part I: Design of a reference catalyst

    Guillois, Kevin

    2012-02-01

    The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda\\'s method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.

  7. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part I: Design of a reference catalyst

    Guillois, Kevin; Burel, Laurence; Tuel, Alain; Caps, Valerie

    2012-01-01

    The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda's method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.

  8. Relocation of the disulfonic stilbene sites of AE1 (band 3) on the basis of fluorescence energy transfer measurements.

    Knauf, Philip A; Law, Foon-Yee; Leung, Tze-Wah Vivian; Atherton, Stephen J

    2004-09-28

    Previous fluorescence resonance energy transfer (FRET) measurements, using BIDS (4-benzamido-4'-isothiocyanostilbene-2,2'-disulfonate) as a label for the disulfonic stilbene site and FM (fluorescein-5-maleimide) as a label for the cytoplasmic SH groups on band 3 (AE1), combined with data showing that the cytoplasmic SH groups lie about 40 A from the cytoplasmic surface of the lipid bilayer, would place the BIDS sites very near the membrane's inner surface, a location that seems to be inconsistent with current models of AE1 structure and mechanism. We reinvestigated the BIDS-FM distance, using laser single photon counting techniques as well as steady-state fluorescence of AE1, in its native membrane environment. Both techniques agree that there is very little energy transfer from BIDS to FM. The mean energy transfer (E), based on three-exponential fits to the fluorescence decay data, is 2.5 +/- 0.7% (SEM, N = 12). Steady-state fluorescence measurements also indicate BIDS to FM. These data indicate that the BIDS sites are probably over 63 A from the cytoplasmic SH groups, placing them near the middle or the external half of the lipid bilayer. This relocation of the BIDS sites fits with other evidence that the disulfonic stilbene sites are located farther toward the external membrane surface than Glu-681, a residue near the inner membrane surface whose modification affects the pH dependence and anion selectivity of band 3. The involvement of two relatively distant parts of the AE1 protein in transport function suggests that the transport mechanism requires coordinated large-scale conformational changes in the band 3 protein.

  9. Souper: A Synthesizing Superoptimizer

    Sasnauskas, Raimondas; Chen, Yang; Collingbourne, Peter; Ketema, Jeroen; Lup, Gratian; Taneja, Jubi; Regehr, John

    2017-01-01

    If we can automatically derive compiler optimizations, we might be able to sidestep some of the substantial engineering challenges involved in creating and maintaining a high-quality compiler. We developed Souper, a synthesizing superoptimizer, to see how far these ideas might be pushed in the context of LLVM. Along the way, we discovered that Souper's intermediate representation was sufficiently similar to the one in Microsoft Visual C++ that we applied Souper to that compiler as well. Shipp...

  10. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    Guillois, Kevin

    2013-03-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  11. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    Guillois, Kevin; Mangematin, Sté phane; Tuel, Alain; Caps, Valerie

    2013-01-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  12. Preparative isolation and purification of three stilbene glycosides from the tibetan medicinal plant Rheum tanguticum maxim. Ex Balf. by high-speed counter-current chromatography.

    Zhao, Xiao-Hui; Han, Fa; Li, Yu-Lin; Yue, Hui-Lan

    2013-02-01

    Stilbene glycosides are the primary constituents of Rheum tanguticum Maxim. ex Balf., to which different bioactivities has been attributed, including: anti-HIV, anti-oxidant, anti-tumour, anti-malarial, and anti-allergy activity. However, effective methods for the isolation and purification of stilbene glycosides, such as trans-rhapontin, cis-rhapontin and trans-desoxyrhaponticin, from this herb are not currently available. To develop an efficient method for the preparative isolation and purification of three stilbene glycosides from Rheum tanguticum Maxim. ex Balf. via high-speed counter-current chromatography (HSCCC). A solvent system composed of chloroform:n-butanol:methanol:water (4:1:3:2, v/v/v/v) was developed for the separation. The upper phase was used as the stationary phase, and the lower phase was used as the mobile phase. The flow rate was 1.8 mL/min. The apparatus was controlled at 800 rpm and 25 °C, and the effluent was monitored at 280 nm. Chemical constituents were analysed by high-performance liquid chromatography (HPLC), and their structures were identified by ¹H- and ¹³C-NMR. Under the optimised conditions, 25.5 mg trans-rhapontin, 16.0 mg cis-rhapontin and 20.5 mg trans-desoxyrhaponticin were separated from 80 mg crude sample; the isolates had purities of 99.6, 97.2 and 99.2%, respectively. A simple and efficient HSCCC method has been optimised for the preparative separation of stilbene glycosides from Rheum tanguticum Maxim. ex Balf. Copyright © 2012 John Wiley & Sons, Ltd.

  13. Widely tunable THz synthesizer

    Hindle, F.; Mouret, G.; Eliet, S.; Guinet, M.; Cuisset, A.; Bocquet, R.; Yasui, T.; Rovera, D.

    2011-09-01

    The generation of cw-THz radiation by photomixing is particularly suited to the high resolution spectroscopy of gases; nevertheless, until recently, it has suffered from a lack of frequency metrology. Frequency combs are a powerful tool that can transfer microwave frequency standards to optical frequencies and a single comb has permitted accurate (10-8) THz frequency synthesis with a limited tuning range. A THz synthesizer composed of three extended cavity laser diodes phase locked to a frequency comb has been constructed and its utility for high resolution gas phase spectroscopy demonstrated. The third laser diode allows a larger tuning range of up to 300 MHz to be achieved without the need for large frequency excursions, while the frequency comb provides a versatile link to be established from any traceable microwave frequency standard. The use of a single frequency comb as a reference for all of the cw-lasers eliminates the dependency of synthesized frequency on the carrier envelope offset frequency. This greatly simplifies the frequency comb stabilization requirements and leads to a reduced instrument complexity.

  14. SYNTH: A spectrum synthesizer

    Hensley, W.K.; McKinnon, A.D.; Miley, H.S.; Panisko, M.E.; Savard, R.M.

    1994-07-01

    A computer code has been written at the Pacific Northwest Laboratory (PNL) to synthesize the results of typical gamma-ray spectroscopy experiments. The code, dubbed SYNTH, allows a use r to specify physical characteristics of a gamma-ray source, the quantity of the nuclides producing the radiation, the source-to-detector distance and the type and thickness of absorbers, the size and composition of the detector (Ge or NaI), and the electronic set up used to gather the data. In the process of specifying the parameters needed to synthesize a spectrum, several interesting intermediate results are produced, including a photopeak transmission function vs energy, a detector efficiency curve, and a weighted list of gamma and x rays produced from a set of nuclides. All of these intermediate results are available for graphical inspection and for printing. SYNTH runs on personal computers. It is menu driven and can be customized to user specifications. SYNTH contains robust support for coaxial germanium detectors and some support for sodium iodide detectors. SYNTH is not a finished product. A number of additional developments are planned. However, the existing code has been compared carefully to spectra obtained from National Institute for Standards and Technology (NIST) certified standards with very favorable results. Examples of the use of SYNTH and several spectral results will be presented

  15. SYNTH: A spectrum synthesizer

    Hensley, W.K.; McKinnon, A.D.; Miley, H.S.; Panisko, M.E.; Savard, R.M.

    1993-10-01

    A computer code has been written at the Pacific Northwest Laboratory (PNL) to synthesize the results of typical gamma ray spectroscopy experiments. The code, dubbed SYNTH, allows a user to specify physical characteristics of a gamma ray source, the quantity of the nuclides producing the radiation, the source-to-detector distance and the presence of absorbers, the type and size of the detector, and the electronic set up used to gather the data. In the process of specifying the parameters needed to synthesize a spectrum, several interesting intermediate results are produced, including a photopeak transmission function versus energy, a detector efficiency curve, and a weighted list of gamma and x rays produced from a set of nuclides. All of these intermediate results are available for graphical inspection and for printing. SYNTH runs on personal computers. It is menu driven and can be customized to user specifications. SYNTH contains robust support for coaxial germanium detectors and some support for sodium iodide detectors. SYNTH is not a finished product. A number of additional developments are planned. However, the existing code has been compared carefully to spectra obtained from National Institute for Standards and Technology (NIST) certified standards with very favorable results. Examples of the use of SYNTH and several spectral results are presented

  16. Carbon-11 labeled stilbene derivatives from natural products for the imaging of Aβ plaques in the brain

    Cui, Mengchao; Tang, Ruikun; Li, Zijing; Jia, Hongmei; Liu, Boli [Beijing Normal Univ. (China). Key Laboratory of Radiopharmaceuticals; Zhang, Jinming; Zhang, Xiaojun [Chinese PLA General Hospital, Beijing (China). Dept. of Nuclear Medicine

    2014-04-01

    Four stilbene derivatives from natural products were screened as novel β-amyloid (Aβ) imaging ligands. In vitro binding assay showed that the methylated ligand, (E)-1-methoxy-4-styrylbenzene (8) displayed high binding affinity to Aβ{sub 1-42} aggregates (K{sub i} = 19.5 nM). Moreover, the {sup 11}C-labeled ligand, [{sup 11}C]8 was prepared through an O-methylation reaction using [{sup 11}C]CH{sub 3}OTf. In vitro autoradiography with sections of transgenic mouse brain also confirmed the high and specific binding of [{sup 11}C]8 to Aβ plaques. In vivo biodistribution experiments in normal mice indicated that [{sup 11}C]8 displayed high initial uptake (9.41 ± 0.51% ID/g at 5 min post-injection) into and rapid washout from the brain, with a brain{sub 5} {sub min}/brain{sub 30} {sub min} ratio of 6.63. These preliminary results suggest that [{sup 11}C]8 may be served as a novel Aβ imaging probe for PET. (orig.)

  17. Effects of trans-stilbene and terphenyl compounds on different strains of Leishmania and on cytokines production from infected macrophages.

    Bruno, Federica; Castelli, Germano; Vitale, Fabrizio; Giacomini, Elisa; Roberti, Marinella; Colomba, Claudia; Cascio, Antonio; Tolomeo, Manlio

    2018-01-01

    Most of the antileishmanial modern therapies are not satisfactory due to high toxicity or emergence of resistance and high cost of treatment. Previously, we observed that two compounds of a small library of trans-stilbene and terphenyl derivatives, ST18 and TR4, presented the best activity and safety profiles against Leishmania infantum promastigotes and amastigotes. In the present study we evaluated the effects of ST18 and the TR4 in 6 different species of Leishmania and the modifications induced by these two compounds in the production of 8 different cytokines from infected macrophages. We observed that TR4 was potently active in all Leishmania species tested in the study showing a leishmanicidal activity higher than that of ST18 and meglumine antimoniate in the most of the species. Moreover, TR4 was able to decrease the levels of IL-10, a cytokine able to render the host macrophage inactive allowing the persistence of parasites inside its phagolysosome, and increase the levels of IL-1β, a cytokine important for host resistance to Leishmania infection by inducible iNOS-mediated production of NO, and IL-18, a cytokine implicated in the development of Th1-type immune response. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Multiomics in Grape Berry Skin Revealed Specific Induction of the Stilbene Synthetic Pathway by Ultraviolet-C Irradiation1

    Suzuki, Mami; Nakabayashi, Ryo; Ogata, Yoshiyuki; Sakurai, Nozomu; Tokimatsu, Toshiaki; Goto, Susumu; Suzuki, Makoto; Jasinski, Michal; Martinoia, Enrico; Otagaki, Shungo; Matsumoto, Shogo; Saito, Kazuki; Shiratake, Katsuhiro

    2015-01-01

    Grape (Vitis vinifera) accumulates various polyphenolic compounds, which protect against environmental stresses, including ultraviolet-C (UV-C) light and pathogens. In this study, we looked at the transcriptome and metabolome in grape berry skin after UV-C irradiation, which demonstrated the effectiveness of omics approaches to clarify important traits of grape. We performed transcriptome analysis using a genome-wide microarray, which revealed 238 genes up-regulated more than 5-fold by UV-C light. Enrichment analysis of Gene Ontology terms showed that genes encoding stilbene synthase, a key enzyme for resveratrol synthesis, were enriched in the up-regulated genes. We performed metabolome analysis using liquid chromatography-quadrupole time-of-flight mass spectrometry, and 2,012 metabolite peaks, including unidentified peaks, were detected. Principal component analysis using the peaks showed that only one metabolite peak, identified as resveratrol, was highly induced by UV-C light. We updated the metabolic pathway map of grape in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and in the KaPPA-View 4 KEGG system, then projected the transcriptome and metabolome data on a metabolic pathway map. The map showed specific induction of the resveratrol synthetic pathway by UV-C light. Our results showed that multiomics is a powerful tool to elucidate the accumulation mechanisms of secondary metabolites, and updated systems, such as KEGG and KaPPA-View 4 KEGG for grape, can support such studies. PMID:25761715

  19. Study of sampling rate influence on neutron-gamma discrimination with stilbene coupled to a silicon photomultiplier.

    Zhang, Jinglong; Moore, Michael E; Wang, Zhonghai; Rong, Zhou; Yang, Chaowen; Hayward, Jason P

    2017-10-01

    Choosing a digitizer with an appropriate sampling rate is often a trade-off between performance and economy. The influence of sampling rates on the neutron-gamma Pulse Shape Discrimination (PSD) with a solid stilbene scintillator coupled to a Silicon Photomultiplier was investigated in this work. Sampling rates from 125MSPS to 2GSPS from a 10-bit digitizer were used to collect detector pulses produced by the interactions of a Cf-252 source. Due to the decreased signal-to-noise ratio (SNR), the PSD performance degraded with reduced sampling rates. The reason of PSD performance degradation was discussed. Then, an efficient combination of filtering and digital signal processing (DSP) was then applied to suppress the timing noise and electronic background noise. The results demonstrate an improved PSD performance especially at low sampling rates, down to 125MSPS. Using filtering and DSP, the ascribed Figure of Merit (FOM) at 125keV ee (± 10keV ee ) increased from 0.95 to 1.02 at 125MSPS. At 300keV ee and above, all the FOMs are better than 2.00. Our study suggests that 250MSPS is a good enough sampling rate for neutron-gamma discrimination in this system in order to be sensitive to neutrons at and above ~ 125keV ee . Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Syntheses of Resveratrol Analogues and Evaluation of Their Antioxidant Activity

    Kim, Mi Jeong; Jung, Se Hoon; Moon, Insu; Jun Jonggab; Lee, Jeong Tae [Hallym Univ., Chuncheon (Korea, Republic of)

    2014-05-15

    Free radicals such as superoxide anion radicals (O{sub 2}·{sup -}), hydroxyl radicals (·OH) and non-free radical species such as hydrogen peroxide (H{sub 2}O{sub 2}) and singlet oxygen ({sup 1}O{sub 2}) are considered as ROS. These ROS not only oxidize membrane lipids but damage nucleic acids, proteins and carbohydrates leading to mutations. If ROS are not scavenged by antioxidants, they could be involved in ageing and various diseases related to oxidative stress. Resveratrol is a natural phytoalexin found in the skin of grapes, red wines, and peanuts. It has three hydroxyl groups at the trans-stilbene structure, in which resorcinol and phenol are bridged by a trans double bond. The recent extensive studies on the resveratrol and its derivatives revealed that they have antioxidant, antimutagenic, antiinflammatory, antidiabetic, cardiovascular protective, and anticancer properties. It has been believed that the majority of the biological functions of resveratrol has been attributed to its antioxidant activity.

  1. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  2. A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence.

    Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter

    2016-10-01

    Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  3. Major depression

    Depression - major; Depression - clinical; Clinical depression; Unipolar depression; Major depressive disorder ... providers do not know the exact causes of depression. It is believed that chemical changes in the ...

  4. Fully automated parallel oligonucleotide synthesizer

    Lebl, M.; Burger, Ch.; Ellman, B.; Heiner, D.; Ibrahim, G.; Jones, A.; Nibbe, M.; Thompson, J.; Mudra, Petr; Pokorný, Vít; Poncar, Pavel; Ženíšek, Karel

    2001-01-01

    Roč. 66, č. 8 (2001), s. 1299-1314 ISSN 0010-0765 Institutional research plan: CEZ:AV0Z4055905 Keywords : automated oligonucleotide synthesizer Subject RIV: CC - Organic Chemistry Impact factor: 0.778, year: 2001

  5. Stilbene Glucoside, a Putative Sleep Promoting Constituent from Polygonum multiflorum Affects Sleep Homeostasis by Affecting the Activities of Lactate Dehydrogenase and Salivary Alpha Amylase.

    Wei, Qian; Ta, Guang; He, Wenjing; Wang, Wei; Wu, Qiucheng

    2017-01-01

    Chinese herbal medicine (CHM) has been used for treating insomnia for centuries. The most used CHM for insomnia was Polygonum multiflorum. However, the molecular mechanism for CHM preventing insomnia is unknown. Stilbene glucoside (THSG), an important active component of P. multiflorum, may play an important role for treating insomnia. To test the hypothesis, Kunming mice were treated with different dosages of THSG. To examine the sleep duration, a computer-controlled sleep-wake detection system was implemented. Electroencephalogram (EEG) and electromyogram (EMG) electrodes were implanted to determine sleep-wake state. RT-PCR and Western blot was used to measure the levels of lactate dehydrogenase (LDH) and saliva alpha amylase. Spearman's rank correlation coefficient was used to identify the strength of correlation between the variables. The results showed that THSG significantly prolonged the sleep time of the mice (palpha amylase (palpha amylase (pamylase were negatively associated with sleep duration (palpha amylase.

  6. Information Retrieval for Ecological Syntheses

    Bayliss, Helen R.; Beyer, Fiona R.

    2015-01-01

    Research syntheses are increasingly being conducted within the fields of ecology and environmental management. Information retrieval is crucial in any synthesis in identifying data for inclusion whilst potentially reducing biases in the dataset gathered, yet the nature of ecological information provides several challenges when compared with…

  7. Method of synthesizing pyrite nanocrystals

    Wadia, Cyrus; Wu, Yue

    2013-04-23

    A method of synthesizing pyrite nanocrystals is disclosed which in one embodiment includes forming a solution of iron (III) diethyl dithiophosphate and tetra-alkyl-ammonium halide in water. The solution is heated under pressure. Pyrite nanocrystal particles are then recovered from the solution.

  8. Major Links.

    Henderson, Tona

    1995-01-01

    Provides electronic mail addresses for resources and discussion groups related to the following academic majors: art, biology, business, chemistry, computer science, economics, health sciences, history, literature, math, music, philosophy, political science, psychology, sociology, and theater. (AEF)

  9. Major Roads

    Minnesota Department of Natural Resources — This data set contains roadway centerlines for major roads (interstates and trunk highways) found on the USGS 1:24,000 mapping series. These roadways are current...

  10. Solid phase syntheses of oligoureas

    Burgess, K.; Linthicum, D.S.; Russell, D.H.; Shin, H.; Shitangkoon, A.; Totani, R.; Zhang, A.J.; Ibarzo, J. [Texas A& M Univ., College Station, TX (United States)

    1997-02-19

    Isocyanates 7 were formed from monoprotected diamines 3 or 6, which in turn can be easily prepared from commercially available N-BOC- or N-FMOC-protected amino acid derivatives. Isocyanates 7, formed in situ, could be coupled directly to a solid support functionalized with amine groups or to amino acids anchored on resins using CH{sub 2}Cl{sub 2} as solvent and an 11 h coupling time at 25 {degree}C. Such couplings afforded peptidomimetics with an N-phthaloyl group at the N-terminus. The optimal conditions identified for removal of the N-phthaloyl group were to use 60% hydrazine in DMF for 1-3 h. Several sequences of amino acids coupled to ureas (`peptidic ureas`) and of sequential urea units (`oligoureas`) were prepared via solid phase syntheses and isolated by HPLC. Partition coefficients were measured for two of these peptidomimetics, and their water solubilities were found to be similar to the corresponding peptides. A small library of 160 analogues of the YGGFL-amide sequence was prepared via Houghten`s tea bag methodology. This library was tested for binding to the anti-{beta}-endorphin monoclonal antibody. Overall, this paper describes methodology for solid phase syntheses of oligourea derivatives with side chains corresponding to some of the protein amino acids. The chemistry involved is ideal for high-throughput syntheses and screening operations. 51 refs., 3 figs., 2 tabs.

  11. Method of synthesizing tungsten nanoparticles

    Thoma, Steven G; Anderson, Travis M

    2013-02-12

    A method to synthesize tungsten nanoparticles has been developed that enables synthesis of nanometer-scale, monodisperse particles that can be stabilized only by tetrahydrofuran. The method can be used at room temperature, is scalable, and the product concentrated by standard means. Since no additives or stabilizing surfactants are required, this method is particularly well suited for producing tungsten nanoparticles for dispersion in polymers. If complete dispersion is achieved due to the size of the nanoparticles, then the optical properties of the polymer can be largely maintained.

  12. Optical fusions and proportional syntheses

    Albert-Vanel, Michel

    2002-06-01

    A tragic error is being made in the literature concerning matters of color when dealing with optical fusions. They are still considered to be of additive nature, whereas experience shows us somewhat different results. The goal of this presentation is to show that fusions are, in fact, of 'proportional' nature, tending to be additive or subtractive, depending on each individual case. Using the pointillist paintings done in the manner of Seurat, or the spinning discs experiment could highlight this intermediate sector of the proportional. So, let us try to examine more closely what occurs in fact, by reviewing additive, subtractive and proportional syntheses.

  13. Postharvest stilbenes and flavonoids enrichment of table grape cv Redglobe (Vitis vinifera L.) as affected by interactive UV-C exposure and storage conditions.

    Crupi, Pasquale; Pichierri, Arianna; Basile, Teodora; Antonacci, Donato

    2013-11-15

    Flavonoids and stilbenes are secondary metabolites produced in plants that can play an important health-promoting role. The biosynthesis of these compounds generally increases as a response to biotic or abiotic stress; therefore, in order to achieve as high phenolic accumulation as possible, the interactive effects of storage conditions (temperature and time) and UV-C radiation on polyphenols content in postharvest Redglobe table grape variety were investigated. During a storage time longer than 48h, both cold storage (4°C) and UV-C exposure of almost 3min (2.4kJm(-2)) positively enhanced the content of cis- and trans-piceid (34 and 90μgg(-1) of skin, respectively) together with quercetin-3-O-galactoside and quercetin-3-O-glucoside (15 and 140μgg(-1) of skin, respectively) up to three fold respect to control grape samples. Conversely, catechin was not significantly affected by irradiation and storage treatments. With regard anthocyanins, the highest concentrations of cyanidin-3-O-glucoside and peonidin-3-Oglucoside were observed in Redglobe, stored at both room temperature and 4°C, after 5min (4.1kJm(-2)) of UV-C treatment and 24h of storage. Gathered findings showed that combined postharvest treatments can lead to possible "functional" grapes, within normal conditions of market commercialization, responding to the rising consumers demand to have foods that support and promote health. Copyright © 2013. Published by Elsevier Ltd.

  14. Photoinduced Ultrafast Intramolecular Excited-State Energy Transfer in the Silylene-Bridged Biphenyl and Stilbene (SBS) System: A Nonadiabatic Dynamics Point of View.

    Wang, Jun; Huang, Jing; Du, Likai; Lan, Zhenggang

    2015-07-09

    The photoinduced intramolecular excited-state energy-transfer (EET) process in conjugated polymers has received a great deal of research interest because of its important role in the light harvesting and energy transport of organic photovoltaic materials in photoelectric devices. In this work, the silylene-bridged biphenyl and stilbene (SBS) system was chosen as a simplified model system to obtain physical insight into the photoinduced intramolecular energy transfer between the different building units of the SBS copolymer. In the SBS system, the vinylbiphenyl and vinylstilbene moieties serve as the donor (D) unit and the acceptor (A) unit, respectively. The ultrafast excited-state dynamics of the SBS system was investigated from the point of view of nonadiabatic dynamics with the surface-hopping method at the TDDFT level. The first two excited states (S1 and S2) are characterized by local excitations at the acceptor (vinylstilbene) and donor (vinylbiphenyl) units, respectively. Ultrafast S2-S1 decay is responsible for the intramolecular D-A excitonic energy transfer. The geometric distortion of the D moiety play an essential role in this EET process, whereas the A moiety remains unchanged during the nonadiabatic dynamics simulation. The present work provides a direct dynamical approach to understand the ultrafast intramolecular energy-transfer dynamics in SBS copolymers and other similar organic photovoltaic copolymers.

  15. Ab initio Investigation to Model Stilbene Photo-Physical Properties by Combining CC2 Topological Investigation and CASPT2 Energy Corrections

    Tomasello, Gaia; Altoe, Piero; Garavelli, Marco; Orlandi, Giorgio

    2007-01-01

    Stilbene photoexcitation and consequent decay to the ground state has been investigated by mapping the Minimum Energy Path (MEP) from S 1 spectroscopic state triggering an almost barrierless reaction pathway to an S 1 /S 0 degenerate region. The particular influence of the σ-π excitation on the S 1 wave function, dominated by a π→π* character, reveals how the non-dynamical correlation energy was important to correctly describe the excited state behaviour and the topological aspect of its potential energy surface. Several strategies of calculations, by using CASSCF//CASPT2 methods, were performed trying to improve the photochemical description nowadays known. Both symmetry and non symmetry preserving computations were performed; systematically was concluded that, because of the limit of CASSCF description enables only to introduce the correlation effect such as the ones due to σ-π excitations, CASSCF and CASPT2 topologies are probably often not in agreement. Thus CC2 methodology was adopted o optimize the S 1 geometries and obtain reasonable structures for the minima. Two S 1 /S 0 accessible conical intersections featured by pyramidalized carbons were located on the first excited state explaining the ultrafast radiationless decay to the ground state and the photoproducts observed within the timescale of ps

  16. National Gas Survey. Synthesized gaseous hydrocarbon fuels

    None

    1978-06-01

    The supply-Technical Advisory Task Force-Synthesized Gaseous Hydrocarbon Fuels considered coal, hydrocarbon liquids, oil shales, tar sands, and bioconvertible materials as potential feedstocks for gaseous fuels. Current status of process technology for each feedstock was reviewed, economic evaluations including sensitivity analysis were made, and constraints for establishment of a synthesized gaseous hydrocarbon fuels industry considered. Process technology is presently available to manufacture gaseous hydrocarbon fuels from each of the feedstocks. In 1975 there were eleven liquid feedstock SNG plants in the United States having a capacity of 1.1 billion SCFD. There can be no contribution of SNG before 1982 from plants using feedstocks other than liquids because there are no plants in operation or under construction as of 1977. Costs for SNG are higher than current regulated prices for U.S. natural gas. Because of large reserves, coal is a prime feedstock candidate although there are major constraints in the area of coal leases, mining and water permits, and others. Commercial technology is available and several new gasification processes are under development. Oil shale is also a feedstock in large supply and commercial process technology is available. There are siting and permit constraints, and water availability may limit the ultimate size of an oil shale processing industry. Under projected conditions, bioconvertible materials are not expected to support the production of large quantities of pipeline quality gas during the next decade. Production of low or medium Btu gas from municipal solid wastes can be expected to be developed in urban areas in conjunction with savings in disposal costs. In the economic evaluations presented, the most significant factor for liquid feedstock plants is the anticipated cost of feedstock and fuel. The economic viability of plants using other feedstocks is primarily dependent upon capital requirements.

  17. Multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts: differential role of hydroxycinnamic acids, flavonols and stilbenes on endothelial inflammatory gene expression.

    Calabriso, Nadia; Scoditti, Egeria; Massaro, Marika; Pellegrino, Mariangela; Storelli, Carlo; Ingrosso, Ilaria; Giovinazzo, Giovanna; Carluccio, Maria Annunziata

    2016-03-01

    The aim of the study was to evaluate the vascular anti-inflammatory effects of polyphenolic extracts from two typical South Italy red wines, the specific contribution of individual polyphenols and the underlying mechanisms of action. Human endothelial cells were incubated with increasing concentrations (1-50 μg/mL) of Primitivo and Negroamaro polyphenolic extracts (PWPE and NWPE, respectively) or pure polyphenols (1-25 μmol/L), including hydroxycinnamic acids (p-coumaric, caffeic and caftaric acids), flavonols (kaempferol, quercetin, myricetin) or stilbenes (trans-resveratrol, trans-piceid) before stimulation with lipopolysaccharide. Through multiple assays, we analyzed the endothelial-monocyte adhesion, the endothelial expression of adhesion molecules (ICAM-1, VCAM-1 and E-Selectin), monocyte chemoattractant protein-1 (MCP-1) and macrophage colony-stimulating factor (M-CSF), as well as ROS intracellular levels and the activation of NF-κB and AP-1. Both PWPE and NWPE, already at 1 μg/mL, inhibited monocyte adhesion to stimulated endothelial cells, a key event in triggering vascular inflammation. They down-regulated the expression of adhesion molecules, ICAM-1, VCAM-1, E-Selectin, as well as MCP-1 and M-CSF, at mRNA and protein levels. All polyphenols reduced intracellular ROS, and everything, except caftaric acid, inhibited the endothelial expression of adhesion molecules and MCP-1, although with different potency. Flavonols and resveratrol significantly reduced also the endothelial expression and release of M-CSF. The decrease in endothelial inflammatory gene expression was related to the inhibition of NF-κB and AP-1 activation but not to intracellular oxidative stress. This study showed multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts and indentified specific bioactive polyphenols which could counteract inflammatory diseases including atherosclerosis.

  18. Efficient {pi} electrons delocalization in prospective push-pull non-linear optical chromophore 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS): A vibrational spectroscopic study

    Vijayakumar, T.; Hubert Joe, I. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India); Reghunadhan Nair, C.P. [Polymers and Special Chemicals Division, Vikram Sarabhai Space Centre, Thiruvananthapuram 695 022, Kerala (India); Jayakumar, V.S. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India)], E-mail: vsjk@vsnl.net

    2008-01-22

    A comprehensive investigation on the intramolecular charge transfer (ICT) of an efficient {pi}-conjugated potential push-pull NLO chromophore, 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS), from a strong electron-donor group (dimethylamino-N(CH{sub 3}){sub 2}) to a strong electron-acceptor group (nitro-NO{sub 2}) through the {pi}-conjugated bridge (trans-stilbene) has been carried out from their vibrational spectra. The NIR FT-Raman and FT-IR spectra supported by the density functional theory (DFT) quantum chemical computations have been employed to analyze the effects of intramolecular charge transfer on the geometries and the vibrational modes contributing to the linear electro-optic effect of the organic NLO material. It has been observed that the changes in the endocyclic and exocyclic angles result from the charge-transfer interaction of the phenyl ring and the amino group in the electron-donor side of the NLO chromophore. The strongest vibrational modes contributing to the electro-optic effect have been identified and examined from the concurrent IR and Raman activation of {nu}(C=C/C-C) mode, ring C=C stretching modes, in-plane deformation modes, nitro modes and the umbrella mode of methyl groups. Furthermore, the splitting of the vinyl stretching modes and the electronic effects such as hyperconjugation and backdonation on the methyl hydrogen atoms causing the decrease of stretching frequencies and infrared intensities have also been analyzed in detail. The effect of frontier orbitals transition of electron density transfer and the influence of planarity between the phenyl rings of the stilbene moiety on the first hyperpolarizability have also been discussed.

  19. Perception of Paralinguistic Traits in Synthesized Voices

    Baird, Alice Emily; Hasse Jørgensen, Stina; Parada-Cabaleiro, Emilia

    2017-01-01

    Along with the rise of artificial intelligence and the internet-of-things, synthesized voices are now common in daily–life, providing us with guidance, assistance, and even companionship. From formant to concatenative synthesis, the synthesized voice continues to be defined by the same traits we...

  20. Composites comprising biologically-synthesized nanomaterials

    Curran, Seamus; Dias, Sampath; Blau, Werner; Wang, Jun; Oremland, Ronald S; Baesman, Shaun

    2013-04-30

    The present disclosure describes composite materials containing a polymer material and a nanoscale material dispersed in the polymer material. The nanoscale materials may be biologically synthesized, such as tellurium nanorods synthesized by Bacillus selenitireducens. Composite materials of the present disclosure may have optical limiting properties and find use in optical limiting devices.

  1. Biomedical applications of green synthesized Nobel metal nanoparticles.

    Khan, Zia Ul Haq; Khan, Amjad; Chen, Yongmei; Shah, Noor S; Muhammad, Nawshad; Khan, Arif Ullah; Tahir, Kamran; Khan, Faheem Ullah; Murtaza, Behzad; Hassan, Sadaf Ul; Qaisrani, Saeed Ahmad; Wan, Pingyu

    2017-08-01

    Synthesis of Nobel metal nanoparticles, play a key role in the field of medicine. Plants contain a substantial number of organic constituents, like phenolic compounds and various types of glycosides that help in synthesis of metal nanoparticles. Synthesis of metal nanoparticles by green method is one of the best and environment friendly methods. The major significance of the green synthesis is lack of toxic by-products produced during metal nanoparticle synthesis. The nanoparticles, synthesized by green method show various significant biological activities. Most of the research articles report the synthesized nanoparticles to be active against gram positive and gram negative bacteria. Some of these bacteria include Escherichia coli, Bacillus subtilis, Klebsiella pneumonia and Pseudomonas fluorescens. The synthesized nanoparticles also show significant antifungal activity against Trichophyton simii, Trichophyton mentagrophytes and Trichophyton rubrum as well as different types of cancer cells such as breast cancer cell line. They also exhibit significant antioxidant activity. The activities of these Nobel metal nano-particles mainly depend on the size and shape. The particles of small size with large surface area show good activity in the field of medicine. The synthesized nanoparticles are also active against leishmanial diseases. This research article explores in detail the green synthesis of the nanoparticles and their uses thereof. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Method to synthesize metal chalcogenide monolayer nanomaterials

    Hernandez-Sanchez, Bernadette A.; Boyle, Timothy J.

    2016-12-13

    Metal chalcogenide monolayer nanomaterials can be synthesized from metal alkoxide precursors by solution precipitation or solvothermal processing. The synthesis routes are more scalable, less complex and easier to implement than other synthesis routes.

  3. nanoparticles synthesized by citrate precursor m

    user

    (M=Co, Cu) nanoparticles synthesized by citrate precursor method ... The structural characterization was carried out using an X-ray Diffractometer (Rikagu Miniflex, Japan) ..... His current area of interest includes magnetic nanomaterials.

  4. Syntheses, molecular and crystalline architectures, and ...

    Syntheses, molecular and crystalline architectures, and luminescence behaviour of terephthalate bridged heptacoordinated dinuclear lead(II) complexes containing a pentadentate N-donor Schiff base. SUBHASIS ROYa, SOMNATH CHOUBEYa, SUMITAVA KHANa, KISHALAY BHARa,. PARTHA MITRAb and BARINDRA ...

  5. Synthese en chemotherapeutisch onderzoek van sulfanilamidopyrimidinen

    Grevenstuk, Anton Bernard

    1942-01-01

    In order to investigate the influence of substitution in the pyrimidine nucleous on the activity of the three isomeric sulfanilamidopyrimidines (2, 5 and 6), a number of substituted sulfanilamidopyrimidines were synthesized and tested on chemotherapeutic activity. ... Zie: Summary

  6. CAMAC programmable-control frequency synthesizer

    Yumaguzin, T.Kh.; Vyazovkin, D.E.; Nazirov, Eh.P.; Tuktarov, R.F.

    1989-01-01

    Synthesizer allows to set frequency with 0.015% accuracy and to scan it with variable step. Frequency controlled divider with further summing-up of divided frequency with fundamental one is used in synthesizer, and it has allowed to use digit of the input code and to obtain 3-4 MHz frequency range. Variation of operation flowsheet in the other frequency range is possible. K-155 and K-531 series microcircuits were used during development

  7. Operational Design that Synthesizes Art and Science

    2011-05-04

    FINAL 3. DATES COVERED (From - To) Feb - May 2011 4. TITLE AND SUBTITLE OPERATIONAL DESIGN THAT SYNTHESIZES ART AND SCIENCE 5a...TITLE AND SUBTITLE Operational Design That Synthesizes Art And Science 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR...proponents of EBO view warfare as only a science and not a combination of art and science . 9 Another main point of contention centered on the term

  8. Raman assisted lightwave synthesized frequency sweeper

    Pedersen, Anders Tegtmeier; Rottwitt, Karsten

    2010-01-01

    We present a Lightwave Synthesized Frequency Sweeper comprising a Raman amplifier for loss compensation. The generated pulse train contains 123 pulses and has a flat signal level as well as a low noise level.......We present a Lightwave Synthesized Frequency Sweeper comprising a Raman amplifier for loss compensation. The generated pulse train contains 123 pulses and has a flat signal level as well as a low noise level....

  9. Synthesizing Modular Invariants for Synchronous Code

    Pierre-Loic Garoche

    2014-12-01

    Full Text Available In this paper, we explore different techniques to synthesize modular invariants for synchronous code encoded as Horn clauses. Modular invariants are a set of formulas that characterizes the validity of predicates. They are very useful for different aspects of analysis, synthesis, testing and program transformation. We describe two techniques to generate modular invariants for code written in the synchronous dataflow language Lustre. The first technique directly encodes the synchronous code in a modular fashion. While in the second technique, we synthesize modular invariants starting from a monolithic invariant. Both techniques, take advantage of analysis techniques based on property-directed reachability. We also describe a technique to minimize the synthesized invariants.

  10. Poly[bis(N,N-dimethylformamidetris(μ4-trans-stilbene-4,4′-dicarboxylatotricadmium(II]: a two-dimensional network with an unusual 36 topology

    Gyungse Park

    2008-07-01

    Full Text Available In the title compound, [Cd3(C16H10O43(C3H7NO2]n or [Cd3(SDA3(DMF2]n (H2SDA is trans-stilbene-4,4′-dicarboxylic acid and DMF is dimethylformamide, the linear dicarboxylate ligand forms a two-dimensionally layered metal–organic network with the relatively uncommon 36 topology. The structure reveals trinuclear secondary building units and has an octahedral geometry at a central metal ion (occupying a overline{3} symmetry site and tetrahedral geometries at two surrounding symmetrically equivalent metal ions lying on a threefold axis. The six-connected planar trinuclear CdII centers, Cd3(O2CR6, play a role as potential nodes in generation of the relatively uncommon 36 topology. The coordinated DMF unit is disordered around the threefold axis.

  11. Substitution of conventional high-temperature syntheses of inorganic compounds by near-room-temperature syntheses in ionic liquids

    Groh, Matthias Friedrich

    2013-01-01

    The high-temperature syntheses of the low-valent halogenides P2I4, Te2Br, α-Te4I4, Te4(Al2Cl7)2, Te4(Bi6Cl20), Te8(Bi4Cl14),Bi8(AlCl4)2, Bi6Cl7,and Bi6Br7, as well as of WSCl4 andWOCl4 have been replaced by resource-efficient low-temperature syntheses in room temperature ionic liquids (RTILs). The simple one-pot syntheses generally do not require elaborate equipment such as twozone furnaces or evacuated silica ampoules. Compared to the published conventional approaches, reduction of reaction time (up to 80%) and temperature (up to 500 K) and, simultaneously, an increase in yield were achieved. In the majority of cases, the solid products were phase-pure. X-Ray diffraction on single crystals (redetermination of 11 crystal structures) has demonstrated that the quality of the crystals from RTILs is comparable to that of products obtained by chemical transport reactions. © 2013 Verlag der Zeitschrift für Naturforschung, Tübingen.

  12. Knockout of GAD65 has major impact on synaptic GABA synthesized from astrocyte-derived glutamine

    Walls, Anne Byriel; Eyjolfsson, Elvar M.; Smeland, Olav B.

    2011-01-01

    γ-Aminobutyric acid (GABA) synthesis from glutamate is catalyzed by glutamate decarboxylase (GAD) of which two isoforms, GAD65 and GAD67, have been identified. The GAD65 has repeatedly been shown to be important during intensified synaptic activity. To specifically elucidate the significance of G...... glutamine both via direct synthesis and via a pathway involving mitochondrial metabolism. Furthermore, a severe neuronal hypometabolism, involving glycolysis and tricarboxylic acid (TCA) cycle activity, was observed in cerebral cortex of GAD65 knockout mice.......65 for maintenance of the highly compartmentalized intracellular and intercellular GABA homeostasis, GAD65 knockout and corresponding wild-type mice were injected with [1-(13)C]glucose and the astrocyte-specific substrate [1,2-(13)C]acetate. Synthesis of GABA from glutamine in the GABAergic synapses...

  13. Syntheses of copper complexes of nicotinohydroxamic and ...

    Nicotinohydroxamic acid (NHA) and isonicotinohydroxamic acid (INHA) were synthesized, characterized by electronic and spectral studies,magnetic measurements and their pKa determined spectrophotometrically as 8.68 ± 0.02 in aqueous medium of 0.1mol dm-3 I=ionic strength. The composition of the complexes was ...

  14. SYNTHESES AND PROPERTIES OF SOME ORGANOSILANE POLYMERS

    ZHANG Xinghua; Robert West

    1984-01-01

    Some organosilane polymers with high molecular weights have been synthesized by cocondensation of organosilicon dihalide monomers with sodium metal in toluene. These polymers are both soluble in common solvents and meltable at lower temperatures, and can be molded, cast into films or drawn into fibers. Exposure of the solid polymers to ultraviolet light leads to degradation or crosslinking.

  15. Biological activities of synthesized silver nanoparticles

    The C. halicacabum leaf extract synthesized AgNPs efficiency were tested against different bacterial pathogens MTCC-426 Proteus vulgaris, MTCC-2453 Pseudomonas aeruginosa, MTCC-96 Staphylococcus aureus, MTCC-441 Bacillus subtilis andMTCC-735 Salmonella paratyphi, and fungal pathogens Alternaria solani ...

  16. Synthesizing chaotic maps with prescribed invariant densities

    Rogers, Alan; Shorten, Robert; Heffernan, Daniel M.

    2004-01-01

    The Inverse Frobenius-Perron Problem (IFPP) concerns the creation of discrete chaotic mappings with arbitrary invariant densities. In this Letter, we present a new and elegant solution to the IFPP, based on positive matrix theory. Our method allows chaotic maps with arbitrary piecewise-constant invariant densities, and with arbitrary mixing properties, to be synthesized

  17. Cytotoxicity of Nanoliposomal Cisplatin Coated with Synthesized ...

    Purpose: To evaluate the cytotoxicity of pegylated nanoliposomal cisplatin on human ovarian cancer cell line A2780CP. Methods: Synthesized methoxypolyethylene glycol (mPEG) propionaldehyde was characterized by 1Hnuclear magnetic resonance (1H-NMR) and Fourier transform infrared spectroscopy (FTIR) and used ...

  18. Biosynthesis of silver nanoparticles synthesized by Aspergillus

    In the present study, biosynthesis of silver nanoparticles and its antioxidant, antimicrobial and cytotoxic activities were investigated. Silver nanoparticles were extracellularly synthesized using Aspergillus flavus and the formation of nanoparticles was observed after 72 h of incubation. The results recorded from colour ...

  19. Enzymatic synthesizing of phytosterol oleic esters.

    Pan, Xinxin; Chen, Biqiang; Wang, Juan; Zhang, Xinzhi; Zhul, Biyun; Tan, Tianwei

    2012-09-01

    A method of synthesizing the phytosterol esters from oleic acid and sterols was studied, using immobilized lipase Candida sp. 99-125 as catalyst. Molar ratio (oleic acid/phytosterols), temperature, reaction period, organic solvents, catalyst, and silica-gel drier were optimized, and the result showed that 93.4% of the sterols had been esterified under the optimal synthetic condition: the molar ratio of oleic acid/phytosterol is 1:1 in 10 mL iso-octane, immobilized lipase (w, 140% of the sterols), incubated in an orbital shaker (200 rpm) at a temperature of 45 °C for 24 h. The immobilized lipase could be reused for at least 13 times with limited loss of esterification activity. The conversion still maintained up to 86.6%. Hence, this developed process for synthesizing phytosterol esters could be considered as simple and low-energy consumption compared to existing chemical processes.

  20. Syntheses and studies of organosilicon compounds

    Xie, Ren [Iowa State Univ., Ames, IA (United States)

    1999-02-12

    The syntheses of polycarbosilanes and polysilanes as silicon carbide ceramic precursors have been active research areas in the Barton Research Group. In this thesis, the work is focused on the preparation of polycarbosilanes and polysilanes as stoichiometric silicon carbide precursor polymers. The syntheses of the precursor polymers are discussed and the conversions of these precursors to silicon carbide via pyrolysis are reported. The XRD pattern and elemental analyses of the resulting silicon carbide ceramics are presented. Silicon monoxide is an important intermediate in the production of silicon metal. The existence of silicon monoxide in gap phase has been widely accepted. In the second part of this thesis, the generation of gaseous silicon monoxide in four different reactors and the reactions of gaseous silicon monoxide towards organic compounds are discussed.

  1. SYNTHESES AND CHARACTERIZATIONS OF THE CYANIDE ...

    2015-10-28

    (Received October 28, 2015; revised June 25, 2016) ... suggest that the Ni(II) ion is four coordinate with four cyanide-carbon atoms in ... However, there have been many studies on octahedral [M(CN)6]n- but little ... were synthesized and investigated by vibrational spectral (FT-IR and ..... Karaağaç, D.; Kürkçüoğlu, G.S. Bull.

  2. Molecular trees: from syntheses towards applications

    Ardoin, N.; Astruc, D.

    1995-01-01

    Molecular trees, also called dendrimers, arborols, cauliflowers, cascades or hyperbranched molecules, have been synthesized since their first observation in 1978 by divergent, convergent or combined methods, with various functions on the branches. The potential applications of these nanoscopic molecules are in the fields of biology (gene therapy, virus mimicking an vectorization) and molecular materials sciences (new polymers, adhesion, liquid crystals, etc). (authors). 236 refs., 6 figs., 2 tabs., 8 schemes

  3. Novel stereocontrolled syntheses of tashiromine and epitashiromine

    Loránd Kiss

    2015-04-01

    Full Text Available A novel stereocontrolled approach has been developed for the syntheses of tashiromine and epitashiromine alkaloids from cyclooctene β-amino acids. The synthetic concept is based on the azetidinone opening of a bicyclic β-lactam, followed by oxidative ring opening through ring C–C double bond and reductive ring-closure reactions of the cis- or trans-cyclooctene β-amino acids.

  4. Spurious in PLL-DDS frequency synthesizers

    Kroupa, Věnceslav František; Štursa, Jarmil

    2002-01-01

    Roč. 2, č. 1 (2002), s. 48-51 ISSN 1335-8243. [Digital Signal Processing and Multimedia Communications DSP-MCOM 2001 /5./. Košice, 27.11.2001-29.11.2001] R&D Projects: GA ČR GA102/00/0958 Institutional research plan: CEZ:AV0Z2067918 Keywords : frequency synthesizers * phase locked loops * direct digital synthesis Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  5. Analyzing and synthesizing phylogenies using tree alignment graphs.

    Stephen A Smith

    Full Text Available Phylogenetic trees are used to analyze and visualize evolution. However, trees can be imperfect datatypes when summarizing multiple trees. This is especially problematic when accommodating for biological phenomena such as horizontal gene transfer, incomplete lineage sorting, and hybridization, as well as topological conflict between datasets. Additionally, researchers may want to combine information from sets of trees that have partially overlapping taxon sets. To address the problem of analyzing sets of trees with conflicting relationships and partially overlapping taxon sets, we introduce methods for aligning, synthesizing and analyzing rooted phylogenetic trees within a graph, called a tree alignment graph (TAG. The TAG can be queried and analyzed to explore uncertainty and conflict. It can also be synthesized to construct trees, presenting an alternative to supertrees approaches. We demonstrate these methods with two empirical datasets. In order to explore uncertainty, we constructed a TAG of the bootstrap trees from the Angiosperm Tree of Life project. Analysis of the resulting graph demonstrates that areas of the dataset that are unresolved in majority-rule consensus tree analyses can be understood in more detail within the context of a graph structure, using measures incorporating node degree and adjacency support. As an exercise in synthesis (i.e., summarization of a TAG constructed from the alignment trees, we also construct a TAG consisting of the taxonomy and source trees from a recent comprehensive bird study. We synthesized this graph into a tree that can be reconstructed in a repeatable fashion and where the underlying source information can be updated. The methods presented here are tractable for large scale analyses and serve as a basis for an alternative to consensus tree and supertree methods. Furthermore, the exploration of these graphs can expose structures and patterns within the dataset that are otherwise difficult to

  6. Analyzing and synthesizing phylogenies using tree alignment graphs.

    Smith, Stephen A; Brown, Joseph W; Hinchliff, Cody E

    2013-01-01

    Phylogenetic trees are used to analyze and visualize evolution. However, trees can be imperfect datatypes when summarizing multiple trees. This is especially problematic when accommodating for biological phenomena such as horizontal gene transfer, incomplete lineage sorting, and hybridization, as well as topological conflict between datasets. Additionally, researchers may want to combine information from sets of trees that have partially overlapping taxon sets. To address the problem of analyzing sets of trees with conflicting relationships and partially overlapping taxon sets, we introduce methods for aligning, synthesizing and analyzing rooted phylogenetic trees within a graph, called a tree alignment graph (TAG). The TAG can be queried and analyzed to explore uncertainty and conflict. It can also be synthesized to construct trees, presenting an alternative to supertrees approaches. We demonstrate these methods with two empirical datasets. In order to explore uncertainty, we constructed a TAG of the bootstrap trees from the Angiosperm Tree of Life project. Analysis of the resulting graph demonstrates that areas of the dataset that are unresolved in majority-rule consensus tree analyses can be understood in more detail within the context of a graph structure, using measures incorporating node degree and adjacency support. As an exercise in synthesis (i.e., summarization of a TAG constructed from the alignment trees), we also construct a TAG consisting of the taxonomy and source trees from a recent comprehensive bird study. We synthesized this graph into a tree that can be reconstructed in a repeatable fashion and where the underlying source information can be updated. The methods presented here are tractable for large scale analyses and serve as a basis for an alternative to consensus tree and supertree methods. Furthermore, the exploration of these graphs can expose structures and patterns within the dataset that are otherwise difficult to observe.

  7. Global Mental Health: sharing and synthesizing knowledge for sustainable development.

    O'Donnell, K; O'Donnell, M Lewis

    2016-01-01

    Global mental health (GMH) is a growing domain with an increasing capacity to positively impact the world community's efforts for sustainable development and wellbeing. Sharing and synthesizing GMH and multi-sectoral knowledge, the focus of this paper, is an important way to support these global efforts. This paper consolidates some of the most recent and relevant 'context resources' [global multi-sector (GMS) materials, emphasizing world reports on major issues] and 'core resources' (GMH materials, including newsletters, texts, conferences, training, etc.). In addition to offering a guided index of materials, it presents an orientation framework (global integration) to help make important information as accessible and useful as possible. Mental health colleagues are encouraged to stay current in GMH and global issues, to engage in the emerging agendas for sustainable development and wellbeing, and to intentionally connect and contribute across sectors. Colleagues in all sectors are encouraged to do likewise, and to take advantage of the wealth of shared and synthesized knowledge in the GMH domain, such as the materials featured in this paper.

  8. ANALISYS OF FRACTIONAL-N FREQUENCY SYNTHESIZERS

    Boris I. Shakhtarin

    2018-01-01

    Full Text Available Modern information and control systems cannot be imagined without synchronization subsystems. These are the basic elements that provide tracking of the frequency and phase of reference and information signals, the evaluation of information parameters, and the synthesis of reference and clock signals. Frequency synthesizers (FS are widely used due to the high speed of frequency setting, a wide range of frequency grids and minimal phase noise in the operating frequency range. Since with the mass appearance of specialized microprocessors and with the improvement of automatic design systems, the feasibility and repeatability of products has become simpler, digital FS are increasingly being used. The most widely used are FS with a frequency divider on digital elements, which serves to convert the signal of a reference oscillator and a controlled generator. For FS using a divisor with an integer division factor in the feedback loop, there are a number of limitations, such as the lower frequency of the FS and the frequency step of the FS. To solve this problem, divisors with fractional-variable division factors in the feedback loop are used, which allow to obtain the required range and the grid frequency step of the FS. The methods of improving the quality of spectral and dynamic characteristics of digital synthesizers in a given band of frequency detuning are analyzed. The principles of the FS operation with a divisor with a fractionalvariable fission coefficient are described, and structural schemes are given. The results of imitation simulation in the Simulink system of the software package MATLAB of frequency synthesizers with a divisor with a fractional-variable fission factor implemented in various ways are presented, and a comparative analysis of the spectral characteristics of the obtained models is carried out. 

  9. Biocompatibility of poly allylamine synthesized by plasma

    Colin, E.; Enriquez, M.A.; Olayo, M.G.; Cruz, G.J.; Morales, J.; Olayo, R.

    2007-01-01

    A study of the electric and hydrophilic properties of poly allylamine (PAI) synthesized by plasma whose structure contains N-H, C-H, C-O and O-H bonds is presented, that promote the biocompatibility with the human body. To study the PAI hydrolytic affinity, solutions of salt concentration similar to those of the human body were used. The results indicate that the solutions modify the charge balance in the surfaces reducing the hydrophobicity in the poly allylamine whose contact angle oscillates among 10 and 16 degrees and the liquid-solid surface tension between 4 and 8 dina/cm. (Author)

  10. Synthese monitoring mestmarkt 2006-2012

    Koeijer, de, T.J.; Luesink, H.H.; Daatselaar, C.H.G.

    2014-01-01

    De aanvoer en afzet van dierlijke mest via de mestmarkt in Nederland zijn op verzoek van het ministerie van Economische Zaken (EZ) voor de periode 2006-2012 in beeld gebracht. Dit is gedaan op basis van analyses van de Vervoersbewijzen Dierlijke Mest (VDM’s) van RVO.nl (Rijksdienst voor Ondernemend Nederland) en op basis van modelberekeningen met MAMBO. Dit WOt-technical report geeft een synthese van de resultaten. Op basis van vergelijkbare meststromen is het aanbod op basis van de VDM’s 73 ...

  11. Bone sialoprotein II synthesized by cultured osteoblasts contains tyrosine sulfate

    Ecarot-Charrier, B.; Bouchard, F.; Delloye, C.

    1989-01-01

    Isolated mouse osteoblasts that retain their osteogenic activity in culture were incubated with [35S] sulfate. Two radiolabeled proteins, in addition to proteoglycans, were extracted from the calcified matrix of osteoblast cultures. All the sulfate label in both proteins was in the form of tyrosine sulfate as assessed by amino acid analysis and thin layer chromatography following alkaline hydrolysis. The elution behavior on DEAE-Sephacel of the major sulfated protein and the apparent Mr on sodium dodecyl sulfate gels were characteristic of bone sialoprotein II extracted from rat. This protein was shown to cross-react with an antiserum raised against bovine bone sialoprotein II, indicating that bone sialoprotein II synthesized by cultured mouse osteoblasts is a tyrosine-sulfated protein. The minor sulfated protein was tentatively identified as bone sialoprotein I or osteopontin based on its elution properties on DEAE-Sephacel and anomalous behavior on sodium dodecyl sulfate gels similar to those reported for rat bone sialoprotein I

  12. Rapid decolorization of textile wastewater by green synthesized iron nanoparticles.

    Ozkan, Z Y; Cakirgoz, M; Kaymak, E S; Erdim, E

    2018-01-01

    The effectiveness of green tea (Camellia sinensis) and pomegranate (Punica granatum) extracts for the production of iron nanoparticles and their application for color removal from a textile industry wastewater was investigated. Polyphenols in extracts act as reducing agents for iron ions in aqueous solutions, forming iron nanoparticles. Pomegranate extract was found to have almost a 10-fold higher polyphenolic content than the same amount of green tea extract on a mass basis. However, the size of the synthesized nanoparticles did not show a correlation with the polyphenolic content. 100 ppm and 300 ppm of iron nanoparticles were evaluated in terms of color removal efficiency from a real textile wastewater sample. 300 ppm of pomegranate nanoscale zero-valent iron particles showed more than 95% color removal and almost 80% dissolved organic carbon removal. The degradation mechanisms are is considered to be adsorption and precipitation to a major extent, and mineralization to a minor extent.

  13. Biogenic synthesized nanoparticles and their applications

    Singh, Abhijeet, E-mail: abhijeet.singh@jaipur.manipal.edu; Sharma, Madan Mohan [Manipal University Jaipur (India)

    2016-05-06

    In the present scenario, there are growing concerns over the potential impacts of bioengineered nanoparticles in the health sector. However, our understanding of how bioengineered nanoparticles may affect organisms within natural ecosystems, lags far behind our rapidly increasing ability to engineer novel nanoparticles. To date, research on the biological impacts of bioengineered nanoparticles has primarily consisted of controlled lab studies of model organisms with single species in culture media. Here, we described a cost effective and environment friendly technique for green synthesis of silver nanoparticles. Silver nanoparticles were successfully synthesized from 1 mM AgNO{sub 3} via a green synthesis process using leaf extract as reducing as well as capping agent. Nanoparticles were characterized with the help of UV–vis absorption spectroscopy, X-ray diffraction and TEM analysis which revealed the size of nanoparticles of 30-40 nm size. Further the nanoparticles synthesized by green route are found highly toxic against pathogenic bacteria and plant pathogenic fungi viz. Escherichia coli, Pseudomonas syringae and Sclerotiniasclerotiorum. The most important outcome of this work will be the development of value-added products and protection of human health from pathogens viz., bacteria, virus, fungi etc.

  14. Biogenic synthesized nanoparticles and their applications

    Singh, Abhijeet; Sharma, Madan Mohan

    2016-01-01

    In the present scenario, there are growing concerns over the potential impacts of bioengineered nanoparticles in the health sector. However, our understanding of how bioengineered nanoparticles may affect organisms within natural ecosystems, lags far behind our rapidly increasing ability to engineer novel nanoparticles. To date, research on the biological impacts of bioengineered nanoparticles has primarily consisted of controlled lab studies of model organisms with single species in culture media. Here, we described a cost effective and environment friendly technique for green synthesis of silver nanoparticles. Silver nanoparticles were successfully synthesized from 1 mM AgNO_3 via a green synthesis process using leaf extract as reducing as well as capping agent. Nanoparticles were characterized with the help of UV–vis absorption spectroscopy, X-ray diffraction and TEM analysis which revealed the size of nanoparticles of 30-40 nm size. Further the nanoparticles synthesized by green route are found highly toxic against pathogenic bacteria and plant pathogenic fungi viz. Escherichia coli, Pseudomonas syringae and Sclerotiniasclerotiorum. The most important outcome of this work will be the development of value-added products and protection of human health from pathogens viz., bacteria, virus, fungi etc.

  15. Enantioselective catalytic syntheses of alpha-branched chiral amines

    Brase, S.; Baumann, T.; Dahmen, S.

    2007-01-01

    Chiral amines play a pivotal role in fine chemical and natural product syntheses and the design of novel materials.......Chiral amines play a pivotal role in fine chemical and natural product syntheses and the design of novel materials....

  16. Methods for synthesizing metal oxide nanowires

    Sunkara, Mahendra Kumar; Kumar, Vivekanand; Kim, Jeong H.; Clark, Ezra Lee

    2016-08-09

    A method of synthesizing a metal oxide nanowire includes the steps of: combining an amount of a transition metal or a transition metal oxide with an amount of an alkali metal compound to produce a mixture; activating a plasma discharge reactor to create a plasma discharge; exposing the mixture to the plasma discharge for a first predetermined time period such that transition metal oxide nanowires are formed; contacting the transition metal oxide nanowires with an acid solution such that an alkali metal ion is exchanged for a hydrogen ion on each of the transition metal oxide nanowires; and exposing the transition metal oxide nanowires to the plasma discharge for a second predetermined time period to thermally anneal the transition metal oxide nanowires. Transition metal oxide nanowires produced using the synthesis methods described herein are also provided.

  17. Sorption of mercury on chemically synthesized polyaniline

    Remya Devi, P.S.; Verma, R.; Sudersanan, M.

    2006-01-01

    Sorption of inorganic mercury (Hg 2+ ) and methyl mercury, on chemically synthesized polyaniline, in 0.1-10N HCl solutions has been studied. Hg 2+ is strongly sorbed at low acidities and the extent of sorption decreases with increase in acidity. The sorption of methyl mercury is very low in the HCl concentration range studied. Sorption of Hg 2+ on polyaniline in 0.1-10N LiCl and H 2 SO 4 solutions has also been studied. The analysis of the data indicates that the sorption of Hg 2+ depends on the degree of protonation of polyaniline and the nature of mercury(II) chloride complexes in solution. X-ray photoelectron spectroscopy analysis (XPS) of polyaniline sorbed with mercury show that mercury is bound as Hg 2+ . Sorbed mercury is quantitatively eluted from polyaniline with 0.5N HNO 3 . Polyaniline can be used for separation and pre-concentration of inorganic mercury from aqueous samples. (author)

  18. [Aerobic methylobacteria are capable of synthesizing auxins].

    Ivanova, E G; Doronina, N V; Trotsenko, Iu A

    2001-01-01

    Obligately and facultatively methylotrophic bacteria with different pathways of C1 metabolism were found to be able to produce auxins, particularly indole-3-acetic acid (IAA), in amounts of 3-100 micrograms/ml. Indole-3-pyruvic acid and indole-3-acetamide were detected only in methylobacteria with the serine pathway of C1 metabolism, Methylobacterium mesophilicum and Aminobacter aminovorans. The production of auxins by methylobacteria was stimulated by the addition of tryptophan to the growth medium and was inhibited by ammonium ions. The methylobacteria under study lacked tryptophan decarboxylase and tryptophan side-chain oxidase. At the same time, they were found to contain several aminotransferases. IAA is presumably synthesized by methylobacteria through indole-3-pyruvic acid.

  19. Synthesizing biomolecule-based Boolean logic gates.

    Miyamoto, Takafumi; Razavi, Shiva; DeRose, Robert; Inoue, Takanari

    2013-02-15

    One fascinating recent avenue of study in the field of synthetic biology is the creation of biomolecule-based computers. The main components of a computing device consist of an arithmetic logic unit, the control unit, memory, and the input and output devices. Boolean logic gates are at the core of the operational machinery of these parts, and hence to make biocomputers a reality, biomolecular logic gates become a necessity. Indeed, with the advent of more sophisticated biological tools, both nucleic acid- and protein-based logic systems have been generated. These devices function in the context of either test tubes or living cells and yield highly specific outputs given a set of inputs. In this review, we discuss various types of biomolecular logic gates that have been synthesized, with particular emphasis on recent developments that promise increased complexity of logic gate circuitry, improved computational speed, and potential clinical applications.

  20. Structure of the enzymatically synthesized fructan inulin

    Heyer, A.G.; Schroeer, B.; Radosta, S.; Wolff, D.; Czapla, S.; Springer, J.

    1998-01-01

    Construction, purification and characterization of a fusion protein of maltose-binding protein of Escherichia coli and the fructosyltransferase of Streptococcus mutans is described. With the purified protein, in vitro synthesis of inulin was performed. The obtained polysaccharide was characterized by high-performance size-exclusion chromatography (HPSEC) and static light scattering (SLS) in dilute aqueous and dimethyl sulfoxide solution. For all samples very high molecular weights between 60x10 6 and 90x10 6 g/mol and a remarkable small polydispersity index of 1.1 have been determined. Small root-mean-square radii of gyration point to a compact conformation in dilute solution. No difference between native and enzymatically synthesized inulin was observed by X-ray powder diffraction and thermoanalysis of solid samples. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  1. Structure of the enzymatically synthesized fructan inulin

    Heyer, A.G.; Schroeer, B. [Max-Planck-Institut fuer Molekulare Pflanzenphysiologie, Karl-Liebknecht-Str. 25, 14476 Golm (Germany); Radosta, S. [Fraunhofer-Institut fuer Angewandte Polymerforschung, Postfach 126, 14504 Teltow (Germany); Wolff, D.; Czapla, S.; Springer, J. [Technische Universitaet Berlin, FG Makromolekulare Chemie, Str. des 17. Juni 135, 10623 Berlin (Germany)

    1998-12-15

    Construction, purification and characterization of a fusion protein of maltose-binding protein of Escherichia coli and the fructosyltransferase of Streptococcus mutans is described. With the purified protein, in vitro synthesis of inulin was performed. The obtained polysaccharide was characterized by high-performance size-exclusion chromatography (HPSEC) and static light scattering (SLS) in dilute aqueous and dimethyl sulfoxide solution. For all samples very high molecular weights between 60x10{sup 6} and 90x10{sup 6} g/mol and a remarkable small polydispersity index of 1.1 have been determined. Small root-mean-square radii of gyration point to a compact conformation in dilute solution. No difference between native and enzymatically synthesized inulin was observed by X-ray powder diffraction and thermoanalysis of solid samples. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  2. Synthesizing lattice structures in phase space

    Guo, Lingzhen; Marthaler, Michael

    2016-01-01

    In one dimensional systems, it is possible to create periodic structures in phase space through driving, which is called phase space crystals (Guo et al 2013 Phys. Rev. Lett. 111 205303). This is possible even if for particles trapped in a potential without periodicity. In this paper we discuss ultracold atoms in a driven optical lattice, which is a realization of such a phase space crystals. The corresponding lattice structure in phase space is complex and contains rich physics. A phase space lattice differs fundamentally from a lattice in real space, because its coordinate system, i.e., phase space, has a noncommutative geometry, which naturally provides an artificial gauge (magnetic) field. We study the behavior of the quasienergy band structure and investigate the dissipative dynamics. Synthesizing lattice structures in phase space provides a new platform to simulate the condensed matter phenomena and study the intriguing phenomena of driven systems far away from equilibrium. (paper)

  3. Synthesized Mammography: Clinical Evidence, Appearance, and Implementation

    Melissa A. Durand

    2018-04-01

    Full Text Available Digital breast tomosynthesis (DBT has improved conventional mammography by increasing cancer detection while reducing recall rates. However, these benefits come at the cost of increased radiation dose. Synthesized mammography (s2D has been developed to provide the advantages of DBT with nearly half the radiation dose. Since its F.D.A. approval, multiple studies have evaluated the clinical performance of s2D. In clinical practice, s2D images are not identical to conventional 2D images and are designed for interpretation with DBT as a complement. This article reviews the present literature to assess whether s2D is a practical alternative to conventional 2D, addresses the differences in mammographic appearance of findings, and provides suggestions for implementation into clinical practice.

  4. Synthesized Mammography: Clinical Evidence, Appearance, and Implementation.

    Durand, Melissa A

    2018-04-04

    Digital breast tomosynthesis (DBT) has improved conventional mammography by increasing cancer detection while reducing recall rates. However, these benefits come at the cost of increased radiation dose. Synthesized mammography (s2D) has been developed to provide the advantages of DBT with nearly half the radiation dose. Since its F.D.A. approval, multiple studies have evaluated the clinical performance of s2D. In clinical practice, s2D images are not identical to conventional 2D images and are designed for interpretation with DBT as a complement. This article reviews the present literature to assess whether s2D is a practical alternative to conventional 2D, addresses the differences in mammographic appearance of findings, and provides suggestions for implementation into clinical practice.

  5. Synthesizing Biomolecule-based Boolean Logic Gates

    Miyamoto, Takafumi; Razavi, Shiva; DeRose, Robert; Inoue, Takanari

    2012-01-01

    One fascinating recent avenue of study in the field of synthetic biology is the creation of biomolecule-based computers. The main components of a computing device consist of an arithmetic logic unit, the control unit, memory, and the input and output devices. Boolean logic gates are at the core of the operational machinery of these parts, hence to make biocomputers a reality, biomolecular logic gates become a necessity. Indeed, with the advent of more sophisticated biological tools, both nucleic acid- and protein-based logic systems have been generated. These devices function in the context of either test tubes or living cells and yield highly specific outputs given a set of inputs. In this review, we discuss various types of biomolecular logic gates that have been synthesized, with particular emphasis on recent developments that promise increased complexity of logic gate circuitry, improved computational speed, and potential clinical applications. PMID:23526588

  6. [Facultative and obligate aerobic methylobacteria synthesize cytokinins].

    Ivanova, E G; Doronina, N V; Shepeliakovskaia, A O; Laman, A G; Brovko, F A; Trotsenko, Iu A

    2000-01-01

    The presence and expression of genes controlling the synthesis and secretion of cytokinins by the pink-pigmented facultative methylotroph Methylobacterium mesophilicum VKM B-2143 with the serine pathway and nonpigmented obligate methylotroph Methylovorus mays VKM B-2221 with the ribulose monophosphate pathway of C1 metabolism were shown using the polymerase chain reaction (PCR) and reverse transcription-PCR methods. The presence of the corresponding mRNA in M. mesophilicum cells grown on methanol or succinate suggests that the expression of these genes is constitutive. The cytokinin activity of culture liquid and its fractions was determined by a biotest with Amarantus caudatus L. seedlings. Using enzyme-linked immunosorbent analysis, we detected zeatin (riboside) in the culture liquid of both bacteria studied. The data obtained show that the aerobic methylobacteria are phytosymbionts that are able to utilize the single- and polycarbon compounds secreted by symbiotic plants and to synthesize cytokinins.

  7. Method and apparatus for synthesizing hydrocarbons

    Colmenares, C.A.; Somorjai, G.A.; Maj, J.J.

    1985-04-16

    A method and apparatus for synthesizing a mixture of aliphatic alcohols having five carbons or less is disclosed. An equal molar ratio of CO and H/sub 2/ gases is caused to pass through a ThO/sub 2/ catalyst having a surface area of about 80 to 125 m/sup 2//g. The catalyst further optionally includes Na ions present as substitutional cations in an amount of about 5 to 10 atom %. At a temperature of about 570 to 630/sup 0/K, and at pressures of about 20 to 50 atm, methanol and isobutanol are the predominant products and are produced in amounts of about 90 wt % of the total hydrocarbon mixture. 6 figs.

  8. Synthesizing Earth's geochemical data for hydrogeochemical analysis

    Brantley, S. L.; Kubicki, J.; Miller, D.; Richter, D.; Giles, L.; Mitra, P.

    2007-12-01

    For over 200 years, geochemical, microbiological, and chemical data have been collected to describe the evolution of the surface earth. Many of these measurements are data showing variations in time or in space. To forward predict hydrologic response to changing tectonic, climatic, or anthropogenic forcings requires synthesis of these data and utilization in hydrogeochemical models. Increasingly, scientists are attempting to synthesize such data in order to make predictions for new regions or for future time periods. However, to make such complex geochemical data accessible requires development of sophisticated cyberinfrastructures that both invite uploading as well as usage of data. Two such cyberinfrastructure (CI) initiatives are currently developing, one to invite and promote the use of environmental kinetics data (laboratory time course data) through ChemxSeer, and the other to invite and promote the use of spatially indexed geochemical data for the Earth's Critical Zone through CZEN.org. The vision of these CI initiatives is to provide cyber-enhanced portals that encourage domain scientists to upload their data before publication (in private cyberspace), and to make these data eventually publicly accessible (after an embargo period). If the CI can be made to provide services to the domain specialist - e.g. to provide data analysis services or data comparison services - we envision that scientists will upload data. In addition, the CI can promote the use and comparison of datasets across disciplines. For example, the CI can facilitate the use of spatially indexed geochemical data by scientists more accustomed to dealing with time-course data for hydrologic flow, and can provide user-friendly interfaces with CI established to facilitate the use of hydrologic data. Examples of the usage of synthesized data to predict soil development over the last 13ky and its effects on active hydrological flow boundaries in surficial systems will be discussed for i) a N

  9. Porous oxides synthesized by the combustion method

    Lugo L, V.

    2005-01-01

    The result of this work, seeks to be a contribution for the treatment of radioactive wastes, with base to the sorption properties that present those porous oxides, synthesized by a method that allows to increase the sorption capacity. The main objective of the present investigation has been the modification of the structural characteristics of the oxides of Fe, Mg and Zn to increase its capacity of sorption of 60 Co in particular. It was studied the effect of the synthesis method by combustion in the inorganic oxides; the obtained solids were characterized using the following techniques: X-ray diffraction (XRD), scanning electron microscopy (SEM), semiquantitative elementary analysis by Dispersive energy spectroscopy (EDS) and determination of surface area by the Brunauner-Emmett-Teller method (BET). Also was carried out batch type experiments for the sorption of Co 2+ , with the purpose of studying the sorption capacity of each one of the prepared oxides. In accordance with that previously exposed, the working plan that was carried out in this investigation is summarized in the following stages: 1. Preparation of inorganic oxides by two different methods, studying the effect of the temperature in the synthesis process. 2. Characterization of the inorganic oxides by XRD, by means of which those were chosen the solids with better properties. 3. Characterization of the inorganic oxides by SEM and EDS where it was studied the morphology of the synthesized materials and the semiquantitative elemental composition. 4. Realization of a sorption experiment type Batch with non radioactive Co 2+ to simulate the sorption of 60 Co and determination of the sorption capacity by means of neutron activation of the non radioactive cobalt. 5. Determination of the surface area by the (BET) technique of the inorganic oxides with better sorption properties. (Author)

  10. Major Sport Venues

    Department of Homeland Security — The Major Public Venues dataset is composed of facilities that host events for the National Association for Stock Car Auto Racing, Indy Racing League, Major League...

  11. Major Depression Among Adults

    ... Depressive Episode Among Adolescents Data Sources Share Major Depression Definitions Major depression is one of the most ... Bethesda, MD 20892-9663 Follow Us Facebook Twitter YouTube Google Plus NIMH Newsletter NIMH RSS Feed NIMH ...

  12. Effect of zinc oxide nanoparticles synthesized by a precipitation

    ZnO nanoparticles were synthesized by a precipitation method in aqueous media from zinc nitrate hexahydrate and sodium hydroxide. The synthesized ZnO nanoparticles exhibited a crystalline structure with hexagonal structure of the wurtzite. The morphology of the synthesized ZnO nanoparticles presented a spherical ...

  13. [Femicides in ethnic and racialized groups: syntheses].

    Meneghel, Stela Nazareth; Lerma, Betty Ruth Lozano

    2017-01-01

    The text entitled "Femicides in ethnic and racialized groups: syntheses" presents some of the discussions that took place during a seminar on this topic in Buenaventura. Buenaventura is the main Colombian port on the Pacific, a region rich in minerals and a corridor for the movement of goods, which makes it a strategic territory and a center for disputes. At the seminar, the social and political determinants of femicide were discussed, understanding it as a tactic of waging war against women. The forum provided a space for academic discussion, but also for grievances over inter-personal violence, the manifestation of feelings and the elaboration of pain and grief through the medium of art. We believe that the dissemination of this experience to the Brazilian public, in a country with ethnic, social and racial vulnerability similar to that in Colombia, will be of value to social and health workers. The scope of this paper is therefore to provide the opinion of its authors on the determinants of femicides and on actions to tackle them, in addition to a synthesis of the discussions and debates that permeated the event.

  14. Mechanochemically Driven Syntheses of Boride Nanomaterials

    Blair, Richard G.

    Solid state metathesis reactions have proven to be a viable route to the production of unfunctionalized nanomaterials. However, current implementations of this approach are limited to self-propagating reactions. We have been investigating mechanically driven metathesis reactions. The use of high-energy ball mills allows control of crystallite sizes without the use of a capping group. Reinforcement materials with crystallite sizes on the order of 5-30 nm can be produced in such a manner. Borides are of particular interest due to their strength, high melting point, and electrical conductivity. The ultimate goal of this work is to prepare oxide and capping group-free nanoparticles suitable for incorporation in thermoelectric, polymer, and ceramic composites. Ultimately this work will facilitate the production of improved thermoelectric materials that will provide robust, deployable, power generation modules to supplement or replace fuel cell, Stirling, and battery-derived power sources. It will also result in scalable, bulk syntheses of tough, refractory, conductive nanomaterials for polymer composites with improved electrical properties, ceramic composites with enhanced fracture toughness, and composites with enhanced neutron reflectance and/or absorbance.

  15. Prospects after Major Trauma

    Holtslag, H.R.

    2007-01-01

    Introduction. After patients survived major trauma, their prospects, in terms of the consequences for functioning, are uncertain, which may impact severely on patient, family and society. The studies in this thesis describes the long-term outcomes of severe injured patients after major trauma. In

  16. Study of photoconductor polymers synthesized by plasma

    Enriquez P, M.A.

    2007-01-01

    In this work the photoconductivity in poly thiophene (PTh), poly pyrrole (PPy) and doped poly pyrrole with iodine (PPy/I) is studied, whose structures depend of the intensity of the electric field applied during the synthesis by plasma. The conjugated organic polymers possess double alternated bonds in its chemical structure that its allow the one movement of π electrons through the polymeric chains. The plasma is produced by means of splendor discharges to 13.5 MHz, resistive coupling, at one pressure that oscillates in the interval from 2 to 3x10 -1 mbar, 180 min and powers of 10, 24, 40, 60 , 80 and 100 W. Its were used heteroaromatic polymers like PTh and PPy/I, due to their potential applications in optoelectronics. The influence of the iodine is evaluated as dopant in PPy and it is compared with their similar one without doping in the light absorption/emission processes. The polymers synthesized by plasma can ramify or to intersect due to the energy applied during the synthesis. However, if the polymer intersects, the aromaticity can continue through the polymeric chains. The absorptions obtained by infrared spectroscopy, suggest that the polymer conserves the aromatic structure of the monomer fundamentally with substitutions that indicate inter crossing and partial fragmentation. The structure of most of the polymers spreads to be amorphous because they don't possess any classification. However, the PPy/I and PTh synthesized by this technique present crystalline segments whose intensity diminishes with the power of the discharge. In PTh, the average crystallinity diminishes from 19.8% to 9.9%, and in PPy/I of 15.9% to 13.3% in the interval of 10 to 100 W of power. In this work, however, its were crystalline arrangements in all the studied powers. The classification of the polymeric structure favors the formation of trajectories of transfer of electric loads among the chains, that which influences in the global electric conductivity of the material. In UV

  17. Sequence determination of synthesized chondroitin sulfate dodecasaccharides.

    Shioiri, Tatsumasa; Tsuchimoto, Jun; Watanabe, Hideto; Sugiura, Nobuo

    2016-06-01

    Chondroitin sulfate (CS) is a linear acidic polysaccharide composed of repeating disaccharide units of glucuronic acid and N-acetyl-d-galactosamine. The polysaccharide is modified with sulfate groups at different positions by a variety of sulfotransferases. CS chains exhibit various biological and pathological functions by interacting with cytokines and growth factors and regulating their signal transduction. The fine structure of the CS chain defines its specific biological roles. However, structural analysis of CS has been restricted to disaccharide analysis, hampering the understanding of the structure-function relationship of CS chains. Here, we chemo-enzymatically synthesized CS dodecasaccharides having various sulfate modifications using a bioreactor system of bacterial chondroitin polymerase mutants and various CS sulfotransferases. We developed a sequencing method for CS chains using the CS dodecasaccharides. The method consists of (i) labeling a reducing end with 2-aminopyridine (PA), (ii) partial digestion of CS with testicular hyaluronidase, followed by separation of PA-conjugated oligosaccharides with different chain lengths, (iii) limited digestion of these oligosaccharides with chondroitin lyase AC II into disaccharides, followed by labeling with 2-aminobenzamide, (iv) CS disaccharide analysis using a dual-fluorescence HPLC system (reversed-phase ion-pair and ion-exchange chromatography), and (v) estimation of the composition by calculating individual disaccharide ratios. This CS chain sequencing allows characterization of CS-modifying enzymes and provides a useful tool toward understanding the structure-function relationship of CS chains. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Biosynthesis of the major tetrahydroxystilbenes in spruce, astringin and isorhapontin, proceeds via resveratrol and is enhanced by fungal infection.

    Hammerbacher, Almuth; Ralph, Steven G; Bohlmann, Joerg; Fenning, Trevor M; Gershenzon, Jonathan; Schmidt, Axel

    2011-10-01

    Stilbenes are dibenzyl polyphenolic compounds produced in several unrelated plant families that appear to protect against various biotic and abiotic stresses. Stilbene biosynthesis has been well described in economically important plants, such as grape (Vitis vinifera), peanut (Arachis hypogaea), and pine (Pinus species). However, very little is known about the biosynthesis and ecological role of stilbenes in spruce (Picea), an important gymnosperm tree genus in temperate and boreal forests. To investigate the biosynthesis of stilbenes in spruce, we identified two similar stilbene synthase (STS) genes in Norway spruce (Picea abies), PaSTS1 and PaSTS2, which had orthologs with high sequence identity in sitka (Picea sitchensis) and white (Picea glauca) spruce. Despite the conservation of STS sequences in these three spruce species, they differed substantially from angiosperm STSs. Several types of in vitro and in vivo assays revealed that the P. abies STSs catalyze the condensation of p-coumaroyl-coenzyme A and three molecules of malonyl-coenzyme A to yield the trihydroxystilbene resveratrol but do not directly form the dominant spruce stilbenes, which are tetrahydroxylated. However, in transgenic Norway spruce overexpressing PaSTS1, significantly higher amounts of the tetrahydroxystilbene glycosides, astringin and isorhapontin, were produced. This result suggests that the first step of stilbene biosynthesis in spruce is the formation of resveratrol, which is further modified by hydroxylation, O-methylation, and O-glucosylation to yield astringin and isorhapontin. Inoculating spruce with fungal mycelium increased STS transcript abundance and tetrahydroxystilbene glycoside production. Extracts from STS-overexpressing lines significantly inhibited fungal growth in vitro compared with extracts from control lines, suggesting that spruce stilbenes have a role in antifungal defense.

  19. Major operations and activities

    Black, D.G.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the major operations and activities on the site. These operations and activities include site management, waste management, environmental restoration and corrective actions, and research and technology development.

  20. A major safety overhaul

    2003-01-01

    A redefined policy, a revamped safety course, an environmental project... the TIS (Technical Inspection and Safety) Division has begun a major safety overhaul. Its new head, Wolfgang Weingarten, explains to the Bulletin why and how this is happening.

  1. Allegheny County Major Rivers

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — This dataset contains locations of major rivers that flow through Allegheny County. These shapes have been taken from the Hydrology dataset. The Ohio River,...

  2. Major operations and activities

    Black, D.G.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the major operations and activities on the site. These operations and activities include site management, waste management, environmental restoration and corrective actions, and research and technology development

  3. Syntheses of F-18 Labeled Fluoroalkyltyrosine Derivatives

    Moon, Byung Seok; Lee, Kyo Chul; Yang, Seung Dae; Chun, Kwon Soo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of); Chi, Dae Yoon [Inha Univ., Inchon (Korea, Republic of)

    2005-07-01

    Positron emission tomography (PET) offers the highest resolution of all nuclear medicine imaging modalities and allows quantitation of tracer concentration in tissues. For more than 60 years, some of C-11 or F-18 labeled amino acids have been synthesized and evaluated for potential use in oncology, neurology and psychiatric disorders. Besides, a variety of radioisotope labeled amino acids have proven to be useful for imaging tumors, especially for brain tumor, lung tumor and breast tumor. These amino acids can be subdivided into two categories. The first category is represented by radiolabled naturally occurring amino acids and structurally similar analogues. Although these radiolabeled amino acids have proven useful in detecting brain and systemic tumors, it is susceptible to in vivo metabolism through multiple pathways that give rise to numerous radiolabled metabolites. On the other side, structurally similar amino acid analogues have some significant advantages over the natural amino acids. These nonnatural amino acids are not metabolized, which simplifieds the kinetic analysis of their uptake. On the basis of the promising results obtained with these nonnatural amino acids in preclinical studies, recent efforts have focused on the development of new F-18 labeled nonnatural amino acids. Recently, O-(2-[{sup 18}F]Fluoroethyl)-L-tyrosine (FET), O-(3-[{sup 18}F]Fluoropropyl)-L-tyrosine (FPT) were developed and evaluated among structurally similar to a new amino acid analogue. FET has shown high uptake in activated inflammatory cells using an experimental acute abscess model and in inflammation within lymph nodes. FPT was superior to FDG and had a slight advantage over FET in the differentiation of tumor from inflammation, and, like FET, it appeared to be a potential amino acid tracer for tumor imaging with PET. In this paper, we elected to introduce fluoroethyl and fluoropropyl groups at the R{sub 1} positions and OCH{sub 3} at R{sub 2} position to the same effect

  4. Syntheses of F-18 Labeled Fluoroalkyltyrosine Derivatives

    Moon, Byung Seok; Lee, Kyo Chul; Yang, Seung Dae; Chun, Kwon Soo; Chi, Dae Yoon

    2005-01-01

    Positron emission tomography (PET) offers the highest resolution of all nuclear medicine imaging modalities and allows quantitation of tracer concentration in tissues. For more than 60 years, some of C-11 or F-18 labeled amino acids have been synthesized and evaluated for potential use in oncology, neurology and psychiatric disorders. Besides, a variety of radioisotope labeled amino acids have proven to be useful for imaging tumors, especially for brain tumor, lung tumor and breast tumor. These amino acids can be subdivided into two categories. The first category is represented by radiolabled naturally occurring amino acids and structurally similar analogues. Although these radiolabeled amino acids have proven useful in detecting brain and systemic tumors, it is susceptible to in vivo metabolism through multiple pathways that give rise to numerous radiolabled metabolites. On the other side, structurally similar amino acid analogues have some significant advantages over the natural amino acids. These nonnatural amino acids are not metabolized, which simplifieds the kinetic analysis of their uptake. On the basis of the promising results obtained with these nonnatural amino acids in preclinical studies, recent efforts have focused on the development of new F-18 labeled nonnatural amino acids. Recently, O-(2-[ 18 F]Fluoroethyl)-L-tyrosine (FET), O-(3-[ 18 F]Fluoropropyl)-L-tyrosine (FPT) were developed and evaluated among structurally similar to a new amino acid analogue. FET has shown high uptake in activated inflammatory cells using an experimental acute abscess model and in inflammation within lymph nodes. FPT was superior to FDG and had a slight advantage over FET in the differentiation of tumor from inflammation, and, like FET, it appeared to be a potential amino acid tracer for tumor imaging with PET. In this paper, we elected to introduce fluoroethyl and fluoropropyl groups at the R 1 positions and OCH 3 at R 2 position to the same effect of FET. Herein, we wish

  5. Syntheses and electronic structures of decamethylmetallocenes

    Robbins, J.L.

    1981-04-01

    The synthesis of decamethylmanganocene [(eta-C 5 (CH 3 ) 5 ) 2 Mn or (Me 5 Cp) 2 Mn)] is described. Magnetic susceptibility and electron paramagnetic resonance (EPR) studies show that (Me 5 Cp) 2 Mn is a low-spin, 17-electron compound with an orbitally degenerate, 2 E/sub 2g/ [e/sub 2g/ 3 a/sub 1g/ 2 ] ground state. An x-ray crystallographic study of (Me 5 Cp) 2 Mn shows that it is a monomeric, D/sub 5d/ decamethylmetallocene with metal to ring carbon distances that are about 0.3 A shorter than those determined for high-spin manganocenes. The syntheses of new (Me 5 Cp) 2 M (M = Mg,V,Cr,Co, and Ni) and [(Me 5 Cp) 2 M]PF 6 (M = Cr,Co, and Ni) compounds are described. In addition, a preparative route to a novel, dicationic decamethylmetallocene, [(Me 5 Cp) 2 Ni](PF 6 ) 2 is reported. Infrared, nuclear magnetic resonance, magnetic susceptibility, and/or x-ray crystallographic studies indicate that all the above compounds are D/sub 5d/ or D/sub 5h/ decamethylmetallocenes with low-spin electronic configurations. Cyclic voltammetry studies verify the reversibility and the one-electron nature of the (Me 5 Cp) 2 M → [(Me 5 Cp) 2 M] + (M = Cr,Mn,Fe,Co,Ni), [(Me 5 Cp) 2 Mn] - → (Me 5 Cp) 2 Mn and [(Me 5 Cp) 2 Ni] + → [Me 5 Cp) 2 Ni] 2+ redox reactions. These studies reveal that the neutral decamethylmetallocenes are much more easily oxidized than their metallocene counterparts. This result attests to the electron-donating properties of the ten substituent methyl groups. Proton and carbon-13 NMR data are reported for the diamagnetic Mg(II), Mn(I), Fe(II), Co(III), and Ni(IV) decamethylmetallocenes and for [(Me 5 Cp) 2 V(CO) 2 ] + . The uv-visible absorption spectra of the 15-, 18- and 20- electron decamethylmetallocenes are also reported

  6. Modification of Lime Mortars with Synthesized Aluminosilicates

    Loganina, Valentina I.; Sadovnikova, Marija E.; Jezierski, Walery; Małaszkiewicz, Dorota

    2017-10-01

    The increasing attention for restoration of buildings of historical and architectural importance has increased the interest for lime-based binders, which could be applied for manufacturing repair mortars and plasters compatible with historical heritage. Different additives, admixtures or fibers may be incorporated to improve mechanical and thermal features of such materials. In this study synthesized aluminosilicates (SA) were applied as an additive for lime mortar. The technology of synthesis consisted in the deposition of aluminosilicates from a sodium liquid glass by the aluminum sulphate Al2(SO4)3. The goal of this investigation was developing a new method of aluminosilicates synthesis from a sodium liquid glass and using this new material as a component for a lime mortar. Aluminosilicates were precipitated from the solution of aluminum sulphate Al2(SO)3 and sodium silicate. SA were then used as an additive to calcareous compositions and their influence was tested. Mortars were prepared with commercial air lime and siliceous river sand. Air lime binder was replaced by 5 and 10 wt.% of SA. Calcareous composition specimens were formed at water/lime ratio 1.0. The following analyses were made: grain size distribution of SA, X-ray diffraction analysis (XRD), sorption properties, plastic strength and compressive strength of lime mortars. XRD pattern of the SA shows the presence of thenardite, gibbsite and amorphous phase represented by aggregate of nano-size cristobalite-like crystallites. Application of SA leads to increase of compressive strength after 90 days of hardening by 28% and 53% at SA content 5 and 10% respectively comparing to specimens without this additive. Contents of chemically bound lime in the reference specimens after 28 days of hardening in air-dry conditions was 46.5%, while in specimens modified with SA contained 50.0-55.3% of bound lime depending on filtrate pH. This testifies to high activity of calcareous composition. The new blended lime

  7. Syntheses and electronic structures of decamethylmetallocenes

    Robbins, J.L.

    1981-04-01

    The synthesis of decamethylmanganocene ((eta-C/sub 5/(CH/sub 3/)/sub 5/)/sub 2/Mn or (Me/sub 5/Cp)/sub 2/Mn)) is described. Magnetic susceptibility and electron paramagnetic resonance (EPR) studies show that (Me/sub 5/Cp)/sub 2/Mn is a low-spin, 17-electron compound with an orbitally degenerate, /sup 2/E/sub 2g/ (e/sub 2g//sup 3/ a/sub 1g//sup 2/) ground state. An x-ray crystallographic study of (Me/sub 5/Cp)/sub 2/Mn shows that it is a monomeric, D/sub 5d/ decamethylmetallocene with metal to ring carbon distances that are about 0.3 A shorter than those determined for high-spin manganocenes. The syntheses of new (Me/sub 5/Cp)/sub 2/M (M = Mg,V,Cr,Co, and Ni) and ((Me/sub 5/Cp)/sub 2/M)PF/sub 6/ (M = Cr,Co, and Ni) compounds are described. In addition, a preparative route to a novel, dicationic decamethylmetallocene, ((Me/sub 5/Cp)/sub 2/Ni)(PF/sub 6/)/sub 2/ is reported. Infrared, nuclear magnetic resonance, magnetic susceptibility, and/or x-ray crystallographic studies indicate that all the above compounds are D/sub 5d/ or D/sub 5h/ decamethylmetallocenes with low-spin electronic configurations. Cyclic voltammetry studies verify the reversibility and the one-electron nature of the (Me/sub 5/Cp)/sub 2/M ..-->.. ((Me/sub 5/Cp)/sub 2/M)/sup +/ (M = Cr,Mn,Fe,Co,Ni), ((Me/sub 5/Cp)/sub 2/Mn)/sup -/ ..-->.. (Me/sub 5/Cp)/sub 2/Mn and ((Me/sub 5/Cp)/sub 2/Ni)/sup +/ ..-->.. (Me/sub 5/Cp)/sub 2/Ni)/sup 2 +/ redox reactions. These studies reveal that the neutral decamethylmetallocenes are much more easily oxidized than their metallocene counterparts. This result attests to the electron-donating properties of the ten substituent methyl groups. Proton and carbon-13 NMR data are reported for the diamagnetic Mg(II), Mn(I), Fe(II), Co(III), and Ni(IV) decamethylmetallocenes and for ((Me/sub 5/Cp)/sub 2/V(CO)/sub 2/)/sup +/. The uv-visible absorption spectra of the 15-, 18- and 20- electron decamethylmetallocenes are also reported.

  8. Uncertainty Evaluation for SMART Synthesized Power Distribution

    Cho, J. Y.; Song, J. S.; Lee, C. C.; Park, S. Y.; Kim, K. Y.; Lee, K. H.

    2010-07-01

    This report performs the uncertainty analysis for the SMART synthesis power distribution generated by a SSUN (SMART core SUpporting system coupled by Nuclear design code) code. SSUN runs coupled with the MASTER neutronics code and generates the core 3-D synthesis power distribution by using DPCM3D. The MASTER code plays a role to provide the DPCM3D constants to the SSUN code for the current core states. The uncertainties evaluated in this report are the form of 95%/95% probability/confidence one-sided tolerance limits and can be used in conjunction with Technical Specification limits on these quantities to establish appropriate LCO (Limiting Conditions of Operation) and LSSS (Limiting Safety System Settings) limits. This report is applicable to SMART nuclear reactor using fixed rhodium detector systems. The unknown true power distribution should be given for the uncertainty evaluation of the synthesis power distribution. This report produces virtual distributions for the true power distribution by imposing the CASMO-3/MASTER uncertainty to the MASTER power distribution. Detector signals are generated from these virtual distribution and the DPCM3D constants are from the MASTER power distribution. The SSUN code synthesizes the core 3-D power distribution by using these detector signals and the DPCM3D constants. The following summarizes the uncertainty evaluation procedure for the synthesis power distribution. (1) Generation of 3-D power distribution by MASTER -> Determination of the DPCM3D constants. (2) Generation of virtual power distribution (assumed to be true power distribution) -> Generation of detector signals. (3) Generation of synthesis power distribution. (4) Uncertainty evaluation for the synthesis power distribution. Chi-Square normality test rejects the hypothesis of normal distribution for the synthesis power error distribution. Therefore, the KRUSKAL WALLIS test and the non-parametric statistics are used for data pooling and the tolerance limits. The

  9. Synthesizing Smart Polymeric and Composite Materials

    Gong, Chaokun

    ,1-phenylene)bismaleimide (MDPB). It showed the same healing ability as 2MEP4F while all starting materials are cheaper and commercially available. To further improve the mechanical strength of the PFA-MDPB healable polymer, epoxy as a strengthening component was mixed with PFA-MDPB healable polymer. The PFA, MDPB and epoxy composite polymers were further reinforced by carbon fiber as done with 2MEP4F matrix and the final composites were proved to have higher short beam shear strength than 2MEP4F while exhibiting a similar healing efficiency. Healable polymer MDPB (a two maleimide groups monomer) -- FGEEDR (a four furan groups monomer) was also designed and synthesized for transparent healable polymer. The MDPB-FGEEDR healable polymer was composited with silver nanowires (AgNWs) to afford healable transparent composite conductor. Razer blade cuts in the composite conductor could heal upon heating to recover the mechanical strength and electrical conductivity of the composite. The healing could be repeated for multiple times on the same cut location. The healing process was as fast as 3 minutes for conductivity to recover 97% of the original value. For electroactive polymer polypyrrole, the fast volume change upon electrical field change due to electrochemical oxidization or reduction was studied for actuation targeting toward a robotic application. The flexibility of polypyrrole was improved via copolymerization with pyrrole derivatives. Actuator devices are fabricated that more suitable for implantable medical device application than pyrrole homopolymer. The change of dipole re-orientation and thus dielectric constant of ferroelectric polymers and ceramics upon electrical field may be exploited for electrocaloric effect (ECE) and solid state refrigeration. For ferroelectric ceramics, we synthesized a series of Ba1-xSrxTiO3 nanoparticles with diameter ranging from 8-12 nm and characterized their dielectric and ferroelectric properties through hysteresis measurement. It was

  10. The development of [18F]FDG synthesizer

    Hu, M. G.; Kim, S. W.; Lee, J. Y.; Yang, S. D.; Jun, G. S.

    2003-01-01

    The automatic system for [ 18 F]FDG production using for the diagnosis of cancer has been developed. This automation system was consisted of a synthesizer module, a PLC based controller and a PMU for graphic user interface. By this system, the radiochemical purity was over 98%, the production yield was over 30% after synthesize and elapsed time was 35 minute

  11. Syntheses and absorption-structure relationships of some new ...

    New biheterocyclic compound was synthesized as starting material to prepare new photosensitizers mono-, tri-, substituted tri-, azadimethine and mixed cyanine dyes. Absorption-structure relationship of the synthesized cyanine dyes were determined by studying their electronic spectral behaviour in ethanol. The structure of ...

  12. Major international sport profiles.

    Patel, Dilip R; Stier, Bernhard; Luckstead, Eugene F

    2002-08-01

    Sports are part of the sociocultural fabric of all countries. Although different sports have their origins in different countries, many sports are now played worldwide. International sporting events bring athletes of many cultures together and provide the opportunity not only for athletic competition but also for sociocultural exchange and understanding among people. This article reviews five major sports with international appeal and participation: cricket, martial arts, field hockey, soccer, and tennis. For each sport, the major aspects of physiological and biomechanical demands, injuries, and prevention strategies are reviewed.

  13. Major New Initiatives

    First page Back Continue Last page Overview Graphics. Major New Initiatives. Multi-party multi-rate video conferencing OOPS. Live Lecture OOPS. Rural ATM Machine Vortex. Finger print detection HP-IITM. Medical Diagnostic kit NeuroSynaptic. LCD projection system TeNeT. Web Terminal MeTeL Midas. Entertainment ...

  14. Major planning enquiries

    Shore, P

    1978-11-01

    This is a speech delivered by the U.K. Secretary of State for the Environment in Manchester (UK) on September 13th 1978. It outlines the Minister's views on the role and significance of major planning inquiries - such as that proposed to be held on the Commercial Demonstration Fast Reactor. (CDFR) (author).

  15. Major Biomass Conference

    Top Scientists, Industry and Government Leaders to Gather for Major Biomass Conference America, South America and Europe will focus on building a sustainable, profitable biomass business at the Third Biomass Conference of the Americas in Montreal. Scheduled presentations will cover all biomass

  16. Unity in Major Themes

    Booss-Bavnbek, Bernhelm; Davis, Philip J.

    We describe and explain the desire, common among mathematicians, both for unity and independence in its major themes. In the dialogue that follows, we express our spontaneous and considered judgment and reservations; by contrasting the development of mathematics as a goal-driven process as opposed...

  17. Hydrothermally Synthesized Zinc Sulphide Microspheres for Solar Light-Driven Photocatalytic Properties

    Waghadkar, Yogesh; Arbuj, Sudhir; Shinde, Manish; Ballal, Reshma; Rane, Sunit B.; Gosavi, Suresh; Fouad, H.; Chauhan, Ratna

    2018-02-01

    In this work, we reported the synthesis of zinc sulphide microspheres using the hydrothermal method. ZnS microspheres were synthesized using water, zinc acetate, thiourea and ammonia solution at 150°C for 6 h, 12 h, and 24 h. The as-synthesized ZnS powders were characterized by x-ray diffraction (XRD), field emission scanning electron microscopy (FESEM) and ultraviolet-visible (UV-Vis) spectroscopy. XRD indicates the cubic (major phase) as well as hexagonal (minor phase) crystalline phase with enhanced crystallinity increased gradually with more reaction time. UV-Vis spectra show the absorption peaks in the UV-Vis region for all the samples. The Tauc's plot was used to calculate the band gap energy of ZnS samples, which are found to be 3.39 eV, 3.4 eV, and 3.42 eV for the samples synthesized at reaction times of 6 h, 12 h, and 24 h, respectively. FESEM images confirm the formation of microspheres as aggregates of spherical nanoparticles. The as-synthesized ZnS microspheres have been explored for solar light-induced photo-catalytic dye degradation of methylene blue (MB), and the results confirm that such microspheres exhibit effectual photocatalytic properties.

  18. Assessment voice synthesizers for reading in digital books

    Sérvulo Fernandes da Silva Neto

    2013-07-01

    Full Text Available The digital accessibility shows ways to information access in digital media that assist people with different types of disabilities to a better interaction with the computer independent of its limitations. Of these tools are composed by voice synthesizers, that supposedly simplifying their access to any recorded knowledge through digital technologies. However such tools have emerged originally in countries foreign language. Which brings us to the following research problem: the voice synthesizers are appropriate for reading digital books in the Portuguese language? The objective of this study was to analyze and classify different software tools voice synthesizers in combination with software digital book readers to support accessibility to e-books in Portuguese. Through literature review were identified applications software voice synthesizers, composing the sample analyzed in this work. We used a simplified version of the method of Multiple Criteria Decision Support - MMDA, to assess these. In the research 12 were considered readers of e-books and 11 software voice synthesizer, tested with six formats of e-books (E-pub, PDF, HTML, DOC, TXT, and Mobi. In accordance with the results, the software Virtual Vision achieved the highest score. Relative to formats, it was found that the PDF has measured a better score when summed the results of the three synthesizers. In the studied universe contacted that many synthesizers simply cannot be used because they did not support the Portuguese language.

  19. Aeon: Synthesizing Scheduling Algorithms from High-Level Models

    Monette, Jean-Noël; Deville, Yves; van Hentenryck, Pascal

    This paper describes the aeon system whose aim is to synthesize scheduling algorithms from high-level models. A eon, which is entirely written in comet, receives as input a high-level model for a scheduling application which is then analyzed to generate a dedicated scheduling algorithm exploiting the structure of the model. A eon provides a variety of synthesizers for generating complete or heuristic algorithms. Moreover, synthesizers are compositional, making it possible to generate complex hybrid algorithms naturally. Preliminary experimental results indicate that this approach may be competitive with state-of-the-art search algorithms.

  20. The Ursa Major supercluster

    Schuch, N.J.

    1983-01-01

    An optical and a radio survey have been carried out. The optical observations consist of a spectroscopic survey in which redshift data for cluster galaxies and optical identifications of radio sources were obtained with the 98-inch Isaac Newton telescope at the Royal Greenwich Observatory, and the 200-inch Hale telescope; the photographic survey in B, V and R colors was made with the 48-inch Schmidt telescope at Palomar. Some results on the galaxy distribution in the Ursa Major supercluster are briefly discussed. (Auth.)

  1. Study of as-synthesized and calcined hydrocalumites as possible ...

    Administrator

    ments. Finally, these solids were tested as antacids by using a synthetic gastric juice. Results showed that calcined samples were able to neutralize the synthetic gastric juice in more extension as an as-synthesized ..... D 2010 Appl. Clay Sci.

  2. Syntheses, Protonation Constants and Antimicrobial Activity of 2 ...

    carboxaldehyde and N-alkylimidazole-2-methanol derivatives [alkyl = benzyl, methyl, ethyl, propyl, butyl, heptyl, octyl and decyl] have been synthesized and the protonation constants determined. The antimicrobial properties of the compounds were tested ...

  3. Characterization of combustion synthesized zirconia powder by UV

    . The surface acidbase properties of these samples were also investigated by indicator titration method. The catalytic activity was probed with transfer hydrogenation reaction in liquid phase. It was found that combustion synthesized zirconia did ...

  4. Bilateral Manipulandum to Synthesize Ground Referenced and Interlimb Viscoelastic Loads

    Gallasch, E

    2001-01-01

    .... The mechatronics consists of two angular voice coil actuators (+/- 40 Nm) with embedded rotary (+/- 20 degrees) and torque sensors driven by voltage controlled current sources, DSP software routines to synthesize isotonic...

  5. Exploitation of rare earth catalysts in polymer syntheses

    Shen Zhiquan

    2006-01-01

    The studies over forty years on rare earth catalysts in polymer syntheses of diene,alkyne,alkylene oxide,thiirane, carbon dioxide copolymerization, lactide,caprolactone,cyclic carbonate and so forth in China have been reviewed.

  6. Multiblock copolymers synthesized in aqueous dispersions using multifunctional RAFT agents

    Bussels, R.; Bergman-Göttgens, C.M.; Meuldijk, J.; Koning, C.E.

    2005-01-01

    Triblock copolymers were synthesized in aqueous dispersions in two polymerization steps using a low molar mass difunctional dithiocarbamate-based RAFT agent, and in merely one polymerization step using a macromolecular difunctional dithiocarbamate-based RAFT agent. Segmented block copolymers

  7. Sol–gel synthesized mesoporous anatase titanium dioxide ...

    for dye sensitized solar cell (DSSC) applications. R GOVINDARAJ1,∗, M ... DSSC than rutile phase. In this work, we have synthesized hierarchically structured ... Hydrolysis and polycondensation reaction mechanism of sol–gel process. 2.

  8. GaN Nanowires Synthesized by Electroless Etching Method

    Najar, Adel; Anjum, Dalaver H.; Ng, Tien Khee; Ooi, Boon S.; Ben Slimane, Ahmed

    2012-01-01

    Ultra-long Gallium Nitride Nanowires is synthesized via metal-electroless etching method. The morphologies and optical properties of GaN NWs show a single crystal GaN with hexagonal Wurtzite structure and high luminescence properties.

  9. Synthesizing International Understanding of Changes in the Arctic Hydrological System

    Pundsack, J. W.; Vorosmarty, C. J.; Hinzman, L. D.

    2009-12-01

    There are several notable gaps in our current level of understanding of Arctic hydrological systems. At the same time, rapidly emerging data sets, technologies, and modeling resources provide us with an unprecedented opportunity to move substantially forward. The Arctic Community-Wide Hydrological Analysis and Monitoring Program (Arctic-CHAMP), funded by NSF/ARCSS, was established to initiate a major effort to improve our current monitoring of water cycle variables, and to foster collaboration with the many relevant U.S. and international arctic research initiatives. These projects, funded under ARCSS through the ‘Freshwater Integration (FWI) study’, links CHAMP, the Arctic/Subarctic Ocean Fluxes (ASOF) Programme, and SEARCH. As part of the overall synthesis and integration efforts of the NSF-ARCSS Freshwater Integration (FWI) study, the program carried-out a major International Synthesis Capstone Workshop in Fall 2009 as an International Polar Year (IPY) affiliated meeting. The workshop, "Synthesizing International Understanding of Changes in the Arctic Hydrological System,” was held 30 September to 4 October 2009 in Stockholm at the Beijer Auditorium of the Royal Swedish Academy. The workshop was sponsored by the NSF-ARCSS Arctic-CHAMP Science Management Office (City College of New York / Univ. of New Hampshire), the International Study of Arctic Change (ISAC), and the International Arctic Research Center (IARC; Univ. of Alaska Fairbanks). The overarching goals of the meeting were to stage a post-IPY lessons-learned workshop with co-equal numbers of FWI, IPY, and ICARP-II researchers, using insights from recent scientific findings, data, and strategies to afford synthesis. The workshop aimed to: (1) take stock of recent advances in our understanding of changes in the Arctic hydrological system; (2) identify key remaining research gaps / unanswered questions; and (3) gather insight on where to focus future research efforts/initiatives (nationally and

  10. Securing Major Events

    Loeoef, Susanna

    2013-01-01

    When asked why the IAEA should provide nuclear security support to countries that organize large public events, Nuclear Security Officer Sophia Miaw answers quickly and without hesitation. ''Imagine any major public event such as the Olympics, a football championship, or an Expo. If a dirty bomb were to be exploded at a site where tens of thousands of people congregate, the radioactive contamination would worsen the effects of the bomb, increase the number of casualties, impede a rapid emergency response, and cause long term disruption in the vicinity,'' she said. Avoiding such nightmarish scenarios is the driving purpose behind the assistance the IAEA offers States that host major sporting or other public events. The support can range from a single training course to a comprehensive programme that includes threat assessment, training, loaned equipment and exercises. The type and scope of assistance depends on the host country's needs. ''We incorporate nuclear security measures into their security plan. We don't create anything new,'' Miaw said

  11. Entwicklung eines kontinuierlichen Verfahrens zur enzymkatalysierten Synthese eines strukturierten Triglycerides

    Stadler, Hans-Gerhard

    2005-01-01

    Ausgangspunkt für die in der vorliegenden Arbeit durchgeführten Entwicklung eines kontinuierlichen Verfahrens zur Synthese des strukturierten Triglycerides 1,3-Oleyl-2-palmitoylglycerin war die von Schmid [Schmid 1999] entwickelte lipase-katalysierte Zwei-Schritt-Synthese für strukturierte Triglyceride vom Typ ABA [European Patent Application; EP 0 882 797 A2]. In der ersten Reaktionsstufe dieser zweistufigen Umesterung wird in einer Folgereaktion das Substrat Tripalmitin mit Hilfe ein...

  12. Proteins synthesized in tobacco mosaic virus infected protoplasts

    Huber, R.

    1979-01-01

    The author deals with research on the multiplication of tobacco mosaic virus (TMV) in leaf cell protoplasts. An attempt is made to answer three questions: (1) Which proteins are synthesized in TMV infected protoplasts as a result of TMV multiplication. (2) Which of the synthesized proteins are made under the direction of the TMV genome and, if any, which of the proteins are host specific. (3) In which functions are these proteins involved. (Auth.)

  13. Design of a synthesizer for magnetic resonance equipment using FPGA

    Sonora A

    2006-01-01

    This paper exposes the design of a direct digital synthesizer in FPGA. This desing can generate a sine wave output up to 4MHZ with 3,33 mHz of precision. The frequency is set by 32bit word of phase increment in 350ns. The desing was made for Magnetic Resonance scanners and uses a 97% of logic resources of device. Functions for the synthesizer control are implemented in the same chip

  14. SYNTHESIZER CONTROLLED BEAM TRANSFER FROM THE AGS TO RHIC

    DELONG, J.; BRENNAN, J.M.; FISCHER, W.; HAYES, T.; SMITH, K.; VALENTINO, S.

    2001-01-01

    To ensure minimal losses and to preserve longitudinal emittance, beam is transferred from the AGS to the RHIC bunch to bucket. This requires precision frequency and phase control for synchronization and kicker timing. The required precision is realized with a set of Direct Digital Synthesizers. Each synthesizer can be frequency and phase modulated to align the AGS bunch to the target bucket in the RHIC phase

  15. Gram Scale Syntheses of (-)-Incarvillateine and Its Analogs. Discovery of Potent Analgesics for Neuropathic Pain.

    Huang, Bin; Zhang, Fengying; Yu, Gang; Song, Yan; Wang, Xintong; Wang, Meiliang; Gong, Zehui; Su, Ruibin; Jia, Yanxing

    2016-04-28

    (-)-Incarvillateine (INCA) is the major antinociceptive component of Incarvillea sinensis, which has been used to treat rheumatism and relieve pain in traditional Chinese medicine. We have developed a concise and general synthetic approach for INCA, which enabled gram-scale asymmetric syntheses of (-)-INCA, (-)-incarvilline, (-)-isoincarvilline, and six other INCA analogues. The synthesis of isoincarvilline was reported for the first time. Three structurally simplified analogues of INCA were also synthesized. In vivo screening found that INCA and two structurally optimized analogues were efficacious in preventing the acetic acid-induced writhing response. Moreover, their analgesic efficacy was demonstrated in formalin induced pain model. More importantly, administration of 20 or 40 mg/kg INCA and two structurally optimized analogues showed strong analgesic effects in spared nerve injury (SNI) model, and their effective doses were lower than the current gold standard, gabapentin (100 mg/kg in this model).

  16. Major Depressive Disorder

    G Grobler

    2013-08-01

    Full Text Available The treatment guideline draws on several international guidelines: (iPractice Guidelines of the American Psychiatric Association (APAfor the Treatment of Patients with Major Depressive Disorder, SecondEdition;[1](ii Clinical Guidelines for the Treatment of DepressiveDisorders by the Canadian Psychiatric Association and the CanadianNetwork for Mood and Anxiety Treatments (CANMAT;[2](iiiNational Institute for Clinical Excellence (NICE guidelines;[3](iv RoyalAustralian and New Zealand College of Psychiatrists Clinical PracticeGuidelines Team for Depression (RANZCAP;[4](v Texas MedicationAlgorithm Project (TMAP Guidelines;[5](vi World Federation ofSocieties of Biological Psychiatry (WFSBP Treatment Guideline forUnipolar Depressive Disorder;[6]and (vii British Association forPsychopharmacology Guidelines.[7

  17. Ribosomal dimerization factor YfiA is the major protein synthesized after abrupt glucose depletion in Lactococcus lactis.

    Breüner, Anne; Frees, Dorte; Varmanen, Pekka; Boguta, Anna Monika; Hammer, Karin; Martinussen, Jan; Kilstrup, Mogens

    2016-10-01

    We analysed the response of the model bacterium Lactococcus lactis to abrupt depletion of glucose after several generations of exponential growth. Glucose depletion resulted in a drastic drop in the energy charge accompanied by an extremely low GTP level and an almost total arrest of protein synthesis. Strikingly, the cell prioritized the continued synthesis of a few proteins, of which the ribosomal dimerization factor YfiA was the most highly expressed. Transcriptome analysis showed no immediate decrease in total mRNA levels despite the lowered nucleotide pools and only marginally increased levels of the yfiA transcript. Severe up-regulation of genes in the FruR, CcpA, ArgR and AhrC regulons were consistent with a downshift in carbon and energy source. Based upon the results, we suggest that transcription proceeded long enough to record the transcriptome changes from activation of the FruR, CcpA, ArgR and AhrC regulons, while protein synthesis stopped due to an extremely low GTP concentration emerging a few minutes after glucose depletion. The yfiA deletion mutant exhibited a longer lag phase upon replenishment of glucose and a faster death rate after prolonged starvation supporting that YfiA-mediated ribosomal dimerization is important for keeping long-term starved cells viable and competent for growth initiation.

  18. A low-power CMOS frequency synthesizer for GPS receivers

    Yu Yunfeng; Xiao Shimao; Zhuang Haixiao; Ma Chengyan; Ye Tianchun; Yue Jianlian

    2010-01-01

    A low-power frequency synthesizer for GPS/Galileo L1/E1 band receivers implemented in a 0.18 μm CMOS process is introduced. By adding clock-controlled transistors at latch outputs to reduce the time constant at sensing time, the working frequency of the high-speed source-coupled logic prescaler supplying quadrature local oscillator signals has been increased, compared with traditional prescalers. Measurement results show that this synthesizer achieves an in-band phase noise of -87 dBc/Hz at 15 kHz offset, with spurs less than -65 dBc. The whole synthesizer consumes 6 mA in the case of a 1.8 V supply, and its core area is 0.6 mm 2 . (semiconductor integrated circuits)

  19. Mesoporous Akaganeite of Adjustable Pore Size Synthesized using Mixed Templates

    Zhang, Y.; Ge, D. L.; Ren, H. P.; Fan, Y. J.; Wu, L. M.; Sun, Z. X.

    2017-12-01

    Mesoporous akaganeite with large and adjustable pore size was synthesized through a co-template method, which was achieved by the combined interaction between PEG2000 and alkyl amines with different lengths of the straight carbon chain. The characterized results indicate that the synthesized samples show comparatively narrow BJH pore size distributions and centered at 14.3 nm when PEG and HEPA was used, and it could be enlarged to 16.8 and 19.4 nm respectively through changing the alkyl amines to DDA and HDA. Meanwhile, all the synthesized akaganeite possess relativity high specific surface area ranging from 183 to 281 m2/g and high total pore volume of 0.98 to 1.5 cm3/g. A possible mechanism leading to the pore size changing was also proposed.

  20. Characterization and Neutron Shielding Behavior of Dehydrated Magnesium Borate Minerals Synthesized via Solid-State Method

    Azmi Seyhun Kipcak

    2013-01-01

    Full Text Available Magnesium borates are one of the major groups of boron minerals that have good neutron shielding performance. In this study, dehydrated magnesium borates were synthesized by solid-state method using magnesium oxide (MgO and boron oxide (B2O3, in order to test their ability of neutron shielding. After synthesizing the dehydrated magnesium borates, characterizations were done by X-ray Diffraction (XRD, fourier transform infrared (FT-IR, Raman spectroscopy, and scanning electron microscopy (SEM. Also boron oxide (B2O3 contents and reaction yields (% were calculated. XRD results showed that seven different types of dehydrated magnesium borates were synthesized. 1000°C reaction temperature, 240 minutes of reaction time, and 3 : 2, 1 : 1 mole ratios of products were selected and tested for neutron transmission. Also reaction yields were calculated between 84 and 88% for the 3 : 2 mole ratio products. The neutron transmission experiments revealed that the 3 : 2 mole ratio of MgO to B2O3 neutron transmission results (0.618–0.655 was better than the ratio of 1 : 1 (0.772–0.843.

  1. Zinc Oxide Nano crystals Synthesized by Quenching Technique

    Norhayati Abu Bakar; Akrajas Ali Umar; Muhamad Mat Salleh; Muhammad Yahya

    2011-01-01

    This paper reports an attempt to synthesize non toxic zinc oxide (ZnO) nano crystals using a simple quenching technique. The hot zinc oxide powder was quenched in hexane solution to obtain ZnO nano crystals. As the result, diameter size of the synthesized ZnO is 200 nm. It was also exhibited a good crystalline with wurtzite phase. The nano crystals properties of ZnO were revealed from good absorbance and green luminescence under UV exposure. This may be related with oxygen vacancy ionization during the annealing process. (author)

  2. Chemical phase analysis of seed mediated synthesized anisotropic silver nanoparticles

    Bharti, Amardeep; Goyal, Navdeep; Singh, Suman; Singla, M. L.

    2015-01-01

    Noble-metal nanoparticles are of great interest because of its broad applications almost in every stream (i.e. biology, chemistry and engineering) due to their unique size/shape dependant properties. In this paper, chemical phase of seed mediated synthesized anisotropic silver nanoparticle (AgNPs) has been investigated via fourier transform infrared spectroscopy (FTIR) and thermogravimetric analysis (TGA). These nanaoparticles were synthesized by seed-growth method controlled by urea and dextrose results to highly stable 12-20 nm particle size revealed by zeta potential and transmission electron microscopy (TEM)

  3. Study on magnetite nanoparticles synthesized by chemical method

    Pei Wenli; Kumada, H.; Natusme, T.; Saito, H.; Ishio, S.

    2007-01-01

    Magnetite nanoparticles with controlled size were synthesized by chemical method. Higher deposition temperature and a rapid-raising temperature procedure are favorable to particle size distribution and fabrication of monodisperse nanoparticles. The larger nanoparticles can be synthesized by the two-step method. The large nanoparticle (up to 25 nm) without agglomeration was successfully produced. The saturation magnetization of 11 nm magnetite particles was 45 emu/g at room temperature, which is smaller than that of bulk magnetite due to surface effect. Hysteresis of the magnetite nanoparticle was very small, indicating superparamagnetic behavior. The magnetic domains of the 11 nm magnetite nanoparticles were successfully observed by MFM

  4. Ring strain and total syntheses of modified macrocycles of the isoplagiochin type

    Andreas Speicher

    2009-12-01

    Full Text Available Macrocycles of the bisbibenzyl-type are natural products that are found exclusively in bryophytes (liverworts. The molecular framework of the subtype “isoplagiochin” is of substantial structural interest because of the chirality of the entire molecule, which arises from two biaryl axes in combination with two helical two-carbon units in a cyclic arrangement. From a structural as well as a synthetic point of view we report on the total synthesis of compounds which possess more rigid two-carbon biaryl bridges like stilbene (E or Z or even tolane moieties which were introduced starting with a Sonogashira protocol. The McMurry method proved to be a powerful tool for the cyclization to these considerably ring-strained macrocycles.

  5. Dielectric properties of CdS nanoparticles synthesized by soft ...

    If the field applied to the condenser is time-dependent (as in an alternating current), so ... tematically the dielectric properties of CdS synthesized by a soft chemical method .... The real parts of conductivity spectra can be explained by the power ...

  6. Is Synthesizing MRI Contrast Useful for Inter-modality Analysis?

    Iglesias, Juan Eugenio; Konukoglu, Ender; Zikic, Darko

    2013-01-01

    Availability of multi-modal magnetic resonance imaging (MRI) databases opens up the opportunity to synthesize different MRI contrasts without actually acquiring the images. In theory such synthetic images have the potential to reduce the amount of acquisitions to perform certain analyses. However...

  7. Antibacterial potential of silver nanoparticle synthesized by marine ...

    Multi resistance to antibiotics is a serious and disseminated clinical problem, common to several new compounds that block the resistance mechanism. The present study aimed at the comparative study of silver nanoparticles synthesized through actinomycetes and their antimicrobial metabolites with standard antibiotic.

  8. ARSENIC REMOVAL USING SOL-GEL SYNTHESIZED TITANIUM DIOXIDE NANOPARTICLES

    In this study, the effectiveness of TiO2 nanoparticles in arsenic adsorption was examined. TiO2 particles (LS) were synthesized via sol-gel techniques and characterized for their crystallinity, surface area and pore volume. Batch adsorption studies were perf...

  9. Radiolitically Synthesized Hybrid Nanosystems for Bio-Nano-Technologies

    Krkljes, A., E-mail: krkljes@vinca.rs [Vinca Institute of Nuclear Sciences, Laboratory for Radiation Chemistry and Physics, ' ' GAMMA' ' (030), P.O. Box 522, 11001 Belgrade (Serbia)

    2010-07-01

    In this report a review of the main results and the studies carried out under the scope of the IAEA CRP project: Nanoscale Radiation Engineering of Advanced Materials for Potential Biomedical Application is presented. In particular two topics are discussed: radiation synthesizing of Ag nanoparticles in hydrogels for potential biomedical application and decoration of carbon nanotubes with Ag clusters by gamma irradiation. (author)

  10. Bioactive nanocrystalline wollastonite synthesized by sol–gel ...

    The sol–gel combustion method was employed to synthesize the nanocrystalline wollastonite by taking the raw eggshell powder as a calcium source and TEOS as a source of silicate. Glycine was .... 94·37% CaCO3, hence in order to prepare 1 M Ca2+ ion solu- ... requires an acid or base catalyst hence the pH of the solu-.

  11. Bioactive nanocrystalline wollastonite synthesized by sol–gel ...

    The sol–gel combustion method was employed to synthesize the nanocrystalline wollastonite by taking the raw eggshell powder as a calcium source and TEOS as a source of silicate. Glycine was used as a reductant or fuel and nitrate ions present in metal nitrate acts as an oxidizer. The phase purity of the wollastonite was ...

  12. Synthesizing genetic sequential logic circuit with clock pulse generator.

    Chuang, Chia-Hua; Lin, Chun-Liang

    2014-05-28

    Rhythmic clock widely occurs in biological systems which controls several aspects of cell physiology. For the different cell types, it is supplied with various rhythmic frequencies. How to synthesize a specific clock signal is a preliminary but a necessary step to further development of a biological computer in the future. This paper presents a genetic sequential logic circuit with a clock pulse generator based on a synthesized genetic oscillator, which generates a consecutive clock signal whose frequency is an inverse integer multiple to that of the genetic oscillator. An analogous electronic waveform-shaping circuit is constructed by a series of genetic buffers to shape logic high/low levels of an oscillation input in a basic sinusoidal cycle and generate a pulse-width-modulated (PWM) output with various duty cycles. By controlling the threshold level of the genetic buffer, a genetic clock pulse signal with its frequency consistent to the genetic oscillator is synthesized. A synchronous genetic counter circuit based on the topology of the digital sequential logic circuit is triggered by the clock pulse to synthesize the clock signal with an inverse multiple frequency to the genetic oscillator. The function acts like a frequency divider in electronic circuits which plays a key role in the sequential logic circuit with specific operational frequency. A cascaded genetic logic circuit generating clock pulse signals is proposed. Based on analogous implement of digital sequential logic circuits, genetic sequential logic circuits can be constructed by the proposed approach to generate various clock signals from an oscillation signal.

  13. Antibacterial activity of silver nanoparticles synthesized from serine

    Jayaprakash, N. [Catalysis and Nanomaterials Research Laboratory, Department of Chemistry, Loyola College, Chennai 600 034 (India); SRM Valliammai Engineering College, Department of Chemistry, Chennai 603 203 (India); Judith Vijaya, J., E-mail: jjvijayaloyola@yahoo.co.in [Catalysis and Nanomaterials Research Laboratory, Department of Chemistry, Loyola College, Chennai 600 034 (India); John Kennedy, L. [Materials Division, School of Advanced Sciences, VIT University, Chennai Campus, Chennai 600 048 (India); Priadharsini, K.; Palani, P. [Department of Center for Advanced Study in Botany, University of Madras, Guindy Campus, Chennai 600 025 (India)

    2015-04-01

    Silver nanoparticles (Ag NPs) were synthesized by a simple microwave irradiation method using polyvinyl pyrrolidone (PVP) as a capping agent and serine as a reducing agent. UV–Visible spectra were used to confirm the formation of Ag NPs by observing the surface plasmon resonance (SPR) band at 443 nm. The emission spectrum of Ag NPs showed an emission band at 484 nm. In the presence of microwave radiation, serine acts as a reducing agent, which was confirmed by Fourier transformed infrared (FT-IR) spectrum. High-resolution transmission electron microscopy (HR-TEM) and high-resolution scanning electron microscopy (HR-SEM) were used to investigate the morphology of the synthesized sample. These images showed the sphere-like morphology. The elemental composition of the sample was determined by the energy dispersive X-ray analysis (EDX). Selected area electron diffraction (SAED) was used to find the crystalline nature of the Ag NPs. The electrochemical behavior of the synthesized Ag NPs was analyzed by the cyclic voltammetry (CV). Antibacterial experiments showed that the prepared Ag NPs showed relatively similar antibacterial activities, when compared with AgNO{sub 3} against Gram-positive and Gram-negative bacteria. - Highlights: • Microwave irradiation method is used to synthesize silver nanoparticles. • Highly stable silver nanoparticles are produced from serine. • A detailed study of antibacterial activities is discussed. • Formation mechanism of silver microspheres has been proposed.

  14. Accurate simulation of Raman amplified lightwave synthesized frequency sweeper

    Pedersen, Anders Tegtmeier; Olesen, Anders Sig; Rottwitt, Karsten

    2011-01-01

    A lightwave synthesized frequency sweeper using a Raman amplifier for loss compensation is presented together with a numerical model capable of predicting the shape of individual pulses as well as the overall envelope of more than 100 pulses. The generated pulse envelope consists of 116 pulses wi...

  15. Microstructural characterization of gold nanoparticles synthesized by solution plasma processing

    Cho, Sung-Pyo; Bratescu, Maria Antoaneta; Takai, Osamu; Saito, Nagahiro

    2011-01-01

    Microstructural characteristics of gold nanoparticles (Au NPs) fabricated by solution plasma processing (SPP) in reverse micelle solutions have been studied by high-resolution transmission electron microscopy (HRTEM). The synthesized Au NPs, with an average size of 6.3 ± 1.4 nm, have different crystal characteristics; fcc single-crystalline particles, multiply twinned particles (MTPs), and incomplete MTPs (single-nanotwinned fcc configuration). The crystal structure characteristics of the Au NPs synthesized by the SPP method were analyzed and compared with similar-size Au NPs obtained by the conventional chemical reduction synthesis (CRS) method. The TEM analysis results show that the Au NPs synthesized by the CRS method have shapes and crystal structures similar to those nanoparticles obtained by the SPP method. However, from the detailed HRTEM analysis, the relative number of the Au MTPs and incomplete MTPs to the total number of the Au NPs synthesized by the SPP method was observed to be around 94%, whereas the relative number of these kinds of crystal structures fabricated by the CRS method was about 63%. It is most likely that the enhanced formation of the Au MTPs is due to the fact that the SPP method generates highly reaction-activated species under low environmental temperature conditions.

  16. Nanoscale grain growth behaviour of CoAl intermetallic synthesized ...

    Grain growth behaviour of the nanocrystalline CoAl intermetallic compound synthesized by mechanical alloying has been studied by isothermal annealing at different temperatures and durations. X-ray diffraction method was employed to investigate structural evolutions during mechanical alloying and annealing processes.

  17. Electrodeposition route to synthesize cigs films – an economical way ...

    Electrodeposition route to synthesize cigs films – an economical way to harness solar energy. ... for solar cells, how the charge separation in this nano scale photovoltaic (PV) materials occurs which help in absorption of radiation, and the electro-deposition route, a low cost one, produces thin film solar cells are analyzed.

  18. Parametric Audio Based Decoder and Music Synthesizer for Mobile Applications

    Oomen, A.W.J.; Szczerba, M.Z.; Therssen, D.

    2011-01-01

    This paper reviews parametric audio coders and discusses novel technologies introduced in a low-complexity, low-power consumption audiodecoder and music synthesizer platform developed by the authors. Thedecoder uses parametric coding scheme based on the MPEG-4 Parametric Audio standard. In order to

  19. Proteins synthesized in tobacco mosaic virus infected protoplasts

    Huber, R.

    1979-01-01

    The study described here concerns the proteins, synthesized as a result of tobacco mosaic virus (TMV) multiplication in tobacco protoplasts and in cowpea protoplasts. The identification of proteins involved in the TMV infection, for instance in the virus RNA replication, helps to elucidate

  20. hydrazines and their nickel(II) complexes: Syntheses, structures and ...

    G Narendra Babu

    Abstract. The Schiff bases N-(acyl)-N -(ferrocenylidene)hydrazines (HFcah (1) and HFcbh (2), where acyl = acetyl in 1 and benzoyl in 2 and H represents the dissociable amide proton) were synthesized in high yields (74 and 81%) by condensation reactions of equimolar amounts of ferrocene-carboxaldehyde and the ...

  1. Investigation of formation constant of complex of a new synthesized ...

    The complex formation between a newly synthesized tripodal ligand and the cation Cu2+ in water and surfactant media was studied spectrophotometrically using rank annihilation factor analysis (RAFA). According to molar ratio data the stoichiometry of complexation between the ligand and the cation Cu2+ was 1:1.

  2. Characterization of chemically synthesized CdS nanoparticles

    Similar to the effects of charge carriers on optical properties, confinement of optical and acoustic phonons leads to interesting changes in the phonon spectra. In the present work, we have synthesized nanoparticles of CdS using chemical precipitation technique. The crystal structure and grain size of the particles are studied ...

  3. Evaluation of Biological Activities of Chemically Synthesized Silver Nanoparticles

    Mostafa, A. A.; Solkamy, E.N.; Sayed, Sh. R. M.; Khan, M.; Shaik, M.R.; Al-Warthan, A.; Adil, S.F.

    2015-01-01

    Silver nanoparticles were synthesized by the earlier reported methods. The synthesized nanoparticles were characterized using ultraviolet-visible spectrophotometry (UV/Vis), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDX), and X-ray powder diffraction (XRD). The synthesized materials were also evaluated for their antibacterial activity against Gram positive and Gram negative bacterial strains. TEM micrograph showed the spherical morphology of AgNPs with size range of 40-60 nm. The synthesized nanoparticles showed a strong antimicrobial activity and their effect depends upon bacterial strain as AgNPs exhibited greater inhibition zone for Pseudomonas aeruginosa (19.1 mm) followed by Staphylococcus aureus (14.8?mm) and S. pyogenes (13.6 mm) while the least activity was observed for Salmonella typhi (12.5 mm) at concentration of 5 μg/disc. The minimum inhibitory concentration (MIC) of AgNPs against S. aureus was 2.5 μg/disc and less than 2.5 μg/disc for P. aeruginosa. These results suggested that AgNPs can be used as an effective antiseptic agent for infectious control in medical field.

  4. A frequency tracking synthesizer for beam diagnostic systems

    Peterson, D.; Marriner, J.

    1991-01-01

    In low and medium energy synchrotrons the beam revolution frequency changes by a large factor during the acceleration process. High production rates require that these machines cycle rapidly. In attempting to diagnose instabilities which develop during the acceleration process it is useful to be able to select some frequency segment between revolution harmonics for viewing. Most types of test equipment operating in the frequency domain, such as spectrum analyzers and network analyzers, are not suited to making direct measurements on such rapidly sweeping signals. Ideally, one would want to set the frequency frame of reference to the spot in the accelerating revolution harmonic domain where the measurements are to be made. A scheme using a direct digital synthesizer (DDS) was developed to provide this moving reference frame. This paper describes a synthesizer scheme combining digital and analog synthesizer techniques to allow tracking of signals during acceleration. Virtually any ratio of synthesizer to beam revolution frequency may be generated by this scheme. Details of hardware and measurement results are presented

  5. Synthesizing Knowledge on Internet of Things (IoT)

    Liu, Fei; Tan, Chee-Wee; Lim, Eric T. K.

    2016-01-01

    Research on Internet of Things (IoT) has been booming for past couple of years due to technological advances and its potential for application. Nonetheless, the rapid growth of IoT articles as well as the heterogeneous nature of IoT pose challenges in synthesizing prior research on the phenomenon...

  6. Radiolitically Synthesized Hybrid Nanosystems for Bio-Nano-Technologies

    Krkljes, A.

    2010-01-01

    In this report a review of the main results and the studies carried out under the scope of the IAEA CRP project: Nanoscale Radiation Engineering of Advanced Materials for Potential Biomedical Application is presented. In particular two topics are discussed: radiation synthesizing of Ag nanoparticles in hydrogels for potential biomedical application and decoration of carbon nanotubes with Ag clusters by gamma irradiation. (author)

  7. Nanoscale grain growth behaviour of CoAl intermetallic synthesized ...

    Administrator

    Abstract. Grain growth behaviour of the nanocrystalline CoAl intermetallic compound synthesized by mechanical alloying has been studied by isothermal annealing at different temperatures and durations. X-ray diffraction method was employed to investigate structural evolutions during mechanical alloying and anneal-.

  8. Taenia solium tapeworms synthesize corticosteroids and sex steroids in vitro.

    Valdez, R A; Jiménez, P; Fernández Presas, A M; Aguilar, L; Willms, K; Romano, M C

    2014-09-01

    Cysticercosis is a disease caused by the larval stage of Taenia solium cestodes that belongs to the family Taeniidae that affects a number of hosts including humans. Taeniids tapeworms are hermaphroditic organisms that have reproductive units called proglottids that gradually mature to develop testis and ovaries. Cysticerci, the larval stage of these parasites synthesize steroids. To our knowledge there is no information about the capacity of T. solium tapeworms to metabolize progesterone or other precursors to steroid hormones. Therefore, the aim of this paper was to investigate if T. solium tapeworms were able to transform steroid precursors to corticosteroids and sex steroids. T. solium tapeworms were recovered from the intestine of golden hamsters that had been orally infected with cysticerci. The worms were cultured in the presence of tritiated progesterone or androstenedione. At the end of the experiments the culture media were analyzed by thin layer chromatography. The experiments described here showed that small amounts of testosterone were synthesized from (3)H-progesterone by complete or segmented tapeworms whereas the incubation of segmented tapeworms with (3)H-androstenedione, instead of (3)H-progesterone, improved their capacity to synthesize testosterone. In addition, the incubation of the parasites with (3)H-progesterone yielded corticosteroids, mainly deoxicorticosterone (DOC) and 11-deoxicortisol. In summary, the results described here, demonstrate that T. solium tapeworms synthesize corticosteroid and sex steroid like metabolites. The capacity of T. solium tapeworms to synthesize steroid hormones may contribute to the physiological functions of the parasite and also to their interaction with the host. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. An animated depiction of major depression epidemiology

    Patten Scott B

    2007-06-01

    Full Text Available Abstract Background Epidemiologic estimates are now available for a variety of parameters related to major depression epidemiology (incidence, prevalence, etc.. These estimates are potentially useful for policy and planning purposes, but it is first necessary that they be synthesized into a coherent picture of the epidemiology of the condition. Several attempts to do so have been made using mathematical modeling procedures. However, this information is not easy to communicate to users of epidemiological data (clinicians, administrators, policy makers. Methods In this study, up-to-date data on major depression epidemiology were integrated using a discrete event simulation model. The mathematical model was animated in Virtual Reality Modeling Language (VRML to create a visual, rather than mathematical, depiction of the epidemiology. Results Consistent with existing literature, the model highlights potential advantages of population health strategies that emphasize access to effective long-term treatment. The paper contains a web-link to the animation. Conclusion Visual animation of epidemiological results may be an effective knowledge translation tool. In clinical practice, such animations could potentially assist with patient education and enhanced long-term compliance.

  10. An animated depiction of major depression epidemiology.

    Patten, Scott B

    2007-06-08

    Epidemiologic estimates are now available for a variety of parameters related to major depression epidemiology (incidence, prevalence, etc.). These estimates are potentially useful for policy and planning purposes, but it is first necessary that they be synthesized into a coherent picture of the epidemiology of the condition. Several attempts to do so have been made using mathematical modeling procedures. However, this information is not easy to communicate to users of epidemiological data (clinicians, administrators, policy makers). In this study, up-to-date data on major depression epidemiology were integrated using a discrete event simulation model. The mathematical model was animated in Virtual Reality Modeling Language (VRML) to create a visual, rather than mathematical, depiction of the epidemiology. Consistent with existing literature, the model highlights potential advantages of population health strategies that emphasize access to effective long-term treatment. The paper contains a web-link to the animation. Visual animation of epidemiological results may be an effective knowledge translation tool. In clinical practice, such animations could potentially assist with patient education and enhanced long-term compliance.

  11. Weaving History through the Major

    Mayfield, Betty

    2014-01-01

    The benefits of including the study of the history of mathematics in the education of mathematics majors have been discussed at length elsewhere. Many colleges and universities now offer a History of Mathematics course for mathematics majors, for mathematics education majors, or for general credit. At Hood College, we emphasize our commitment to…

  12. Do Biology Majors Really Differ from Non–STEM Majors?

    Cotner, Sehoya; Thompson, Seth; Wright, Robin

    2017-01-01

    Recent calls to action urge sweeping reform in science education, advocating for improved learning for all students—including those majoring in fields beyond the sciences. However, little work has been done to characterize the differences—if any exist—between students planning a career in science and those studying other disciplines. We describe an attempt to clarify, in broad terms, how non–STEM (science, technology, engineering, and mathematics) majors differ from life sciences majors, and how they are similar. Using survey responses and institutional data, we find that non–STEM majors are not unilaterally science averse; non–STEM majors are more likely than biology majors to hold misconceptions about the nature of science, yet they are not completely ignorant of how science works; non–STEM majors are less likely than biology majors to see science as personally relevant; and non–STEM majors populations are likely to be more diverse—with respect to incoming knowledge, perceptions, backgrounds, and skills—than a biology majors population. We encourage science educators to consider these characteristics when designing curricula for future scientists or simply for a well-informed citizenry. PMID:28798210

  13. Characterization of tin selenides synthesized by high-energy milling

    Marcela Achimovičová

    2011-12-01

    Full Text Available Tin selenides SnSeX (x=1,2 were synthesized from tin and selenium powder precursors by high-energy milling in the planetary ballmill Pulverisette 6 (Fritsch, Germany. The orthorhombic tin selenide SnSe and the hexagonal tin diselenide SnSe2 phases were formed after4 min and 5 min of milling, respectively. Specific surface area of both selenides increased with increasing time of mechanochemicalsynthesis. The particle size distribution analysis demonstrated that the synthesized products contain agglomerated selenide particlesconsisting of numerous idiomorphic tin selenide crystals, measuring from 2 to more than 100 nm in diameter, which were also documentedby TEM. UV-Vis spectrophotometry confirmed that tin selenide particles do not behave as quantum dots.

  14. Method of synthesizing silica nanofibers using sound waves

    Sharma, Jaswinder K.; Datskos, Panos G.

    2015-09-15

    A method for synthesizing silica nanofibers using sound waves is provided. The method includes providing a solution of polyvinyl pyrrolidone, adding sodium citrate and ammonium hydroxide to form a first mixture, adding a silica-based compound to the solution to form a second mixture, and sonicating the second mixture to synthesize a plurality of silica nanofibers having an average cross-sectional diameter of less than 70 nm and having a length on the order of at least several hundred microns. The method can be performed without heating or electrospinning, and instead includes less energy intensive strategies that can be scaled up to an industrial scale. The resulting nanofibers can achieve a decreased mean diameter over conventional fibers. The decreased diameter generally increases the tensile strength of the silica nanofibers, as defects and contaminations decrease with the decreasing diameter.

  15. Antifouling activity of green-synthesized 7-hydroxy-4-methylcoumarin.

    Pérez, Miriam; García, Mónica; Ruiz, Diego; Autino, Juan Carlos; Romanelli, Gustavo; Blustein, Guillermo

    2016-02-01

    In the search for new environmental-friendly antifoulants for replace metallic biocides, 7-hydroxy-4-methylcoumarin was synthesized according to green chemistry procedures. This compound was characterized by current organic analysis and its antifouling properties were firstly evaluated on the bivalve Mytilus edulis platensis in the laboratory. In the second stage, a soluble matrix antifouling coating formulated with this compound was assayed in marine environment. Laboratory experiments showed that 7-hydroxy-4-methylcoumarin was effective in inhibiting both the settlement as well as the byssogenesis of mussels. In addition, after exposure time in the sea, painted panels containing this compound showed strong antifouling effect on conspicuous species of the fouling community of Mar el Plata harbor. In conclusion, green-synthesized coumarin could be a suitable antifoulant candidate for marine protective coatings. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Hydrothermally synthesized barium fluoride nanocubes for thermoluminescence dosimetry

    Bhadane, Mahesh S.; Dahiwale, S. S.; Bhoraskar, V. N.; Dhole, S. D., E-mail: sanjay@physics.unipune.ac.in [Department of Physics, Savitribai Phule Pune University, Pune-411007 (India)

    2016-05-23

    In this work, we report a hydrothermally synthesized Dy doped BaF{sub 2} (BaF{sub 2}:Dy) nanocubes and its Thermoluminescence studies. The synthesized BaF{sub 2}:Dy samples was found to posses FCC structure and having average size ~ 60-70 nm, as revealed through X-Ray Diffraction. Cubical morphology having size ~90 nm was observed from TEM analysis. The {sup 60}Co γ- ray irradiated BaF{sub 2}:Dy TL dosimetric experiments shows a pre-dominant single glow peak at 153 °C, indicating a single level trap present as a metastable state. Furthermore, BaF{sub 2}:Dy nanophosphor shows a sharp linear response from 10 Gy to 3 kGy, thus it can be applicable as a gamma dosimeter.

  17. Is Ghrelin Synthesized in the Central Nervous System?

    Cabral, Agustina; López Soto, Eduardo J; Epelbaum, Jacques; Perelló, Mario

    2017-03-15

    Ghrelin is an octanoylated peptide that acts via its specific receptor, the growth hormone secretagogue receptor type 1a (GHSR-1a), and regulates a vast variety of physiological functions. It is well established that ghrelin is predominantly synthesized by a distinct population of endocrine cells located within the gastric oxyntic mucosa. In addition, some studies have reported that ghrelin could also be synthesized in some brain regions, such as the hypothalamus. However, evidences of neuronal production of ghrelin have been inconsistent and, as a consequence, it is still as a matter of debate if ghrelin can be centrally produced. Here, we provide a comprehensive review and discussion of the data supporting, or not, the notion that the mammalian central nervous system can synthetize ghrelin. We conclude that no irrefutable and reproducible evidence exists supporting the notion that ghrelin is synthetized, at physiologically relevant levels, in the central nervous system of adult mammals.

  18. Studies on the Alkaloids of the Calycanthaceae and Their Syntheses

    Jin-Biao Xu

    2015-04-01

    Full Text Available Plants of the Calycanthaceae family, which possesses four genera and about 15 species, are mainly distributed in China, North America and Australia. Chemical studies on the Calycanthaceae have led to the discovery of about 14 alkaloids of different skeletons, including dimeric piperidinoquinoline, dimeric pyrrolidinoindoline and/or trimeric pyrrolidinoindolines, which exhibit significant anti-convulsant, anti-fungal, anti-viral analgesic, anti-tumor, and anti-melanogenesis activities. As some of complex tryptamine-derived alkaloids exhibit promising biological activities, the syntheses of these alkaloids have also been a topic of interest in synthetic chemistry during the last decades. This review will focus on the structures and total syntheses of these alkaloids.

  19. Interaction Studies between Newly Synthesized Photosensitive Polymer and Ionic Liquids

    In Tae Kim

    2015-01-01

    Full Text Available In this information age, different kinds of photosensitive materials have been used in the manufacture of information storage devices. But these photosensitive materials have the bane of low diffraction efficiency. In order to solve this problem, we have synthesized a novel photosensitive polymer from epoxy-based azopolymers (with three types of azochromophores. Furthermore, we have studied the interaction between this newly synthesized azopolymer and ionic liquids (ILs. For this purpose, we have used the ammonium and imidazolium families of ILs, such as diethylammonium dihydrogen phosphate (DEAP, tributylammonium methyl sulfate (TBMS, triethylammonium 4-aminotoluene-3-sulfonic acid (TASA, and 1-methylimidazolium chloride ([Mim]Cl. To investigate the molecular interaction between azopolymer and ILs, we have used the following spectroscopic methods of analysis: UV-visible spectroscopy, photoluminescence (PL spectroscopy, Fourier transformed infrared spectroscopy (FT-IR, and confocal Raman spectroscopy. In this study, we have developed new photosensitive materials by combining polymer with ILs.

  20. The Mossbauer spectra of carbon nanotubes synthesize using ferrite catalyst

    Zhang Haiyan; Lin Jiapeng; Peng Zuxiong; Zeng Guoxun; Pang Jinshan; Chen Yiming

    2009-01-01

    The ferrite powder with honeycombed structure obtained by chemical combustion was used as catalyst to synthesize multi-walled carbon nanotubes by chemical vapor deposition. The magnetic components and characters of the the carbon nanotubes synthesized were investigated by X-ray diffraction (XRD), Mossbauer spectra and vibrating-sample magnetometer (VSM). The ferric components of the carbon nanotubes samples can be identified by Mossbauer spectra. The Mossbauer spectra of carbon nanotubes sample after purification contains two ferromagnetic sextet components corresponding to α-Fe species and Fe 3 C (cementite) species. While the Mossbauer spectra of the carbon nanotubes sample before purification contains three ferromagnetic sextet components corresponding to α-Fe species, Fe 3 C species and γ-Fe 2 O 3 . The saturation magnetization intensity Ms of carbon nanotubes sample after purification is decreased from 46.61 to 2.94 emu/g, but the coercive force increasd and reached 328Oe.

  1. 4-GHz counters bring synthesizers up to speed

    Lee, F.; Miller, R.

    1984-06-01

    The availability of digital IC counters built on GaAs makes direct frequency division in microwave synthesizers possible. Four GHz is the highest clock rate achievable in production designs. These devices have the ability to drive TTL/CMOS logic, and the counter can be connected directly to single-chip frequency synthesizers controllers. A complete microwave sythesizer is formed by two chips and a voltage-controlled oscillator (VCO). The advantages of GaAs are discussed along with flip-flop basics, aspects of device fabrication, and the characteristics of GaAs MESAFETs. Attention is given to a GaAs prescaler usable for direct conversion, four kinds of flip-flops in a divide-by-two mode, and seven-stage binary ripple counters.

  2. Applications of Magnetosomes Synthesized by Magnetotactic Bacteria in Medicine

    Alphandéry, Edouard

    2014-01-01

    Magnetotactic bacteria belong to a group of bacteria that synthesize iron oxide nanoparticles covered by biological material that are called magnetosomes. These bacteria use the magnetosomes as a compass to navigate in the direction of the earth’s magnetic field. This compass helps the bacteria to find the optimum conditions for their growth and survival. Here, we review several medical applications of magnetosomes, such as those in magnetic resonance imaging (MRI), magnetic hyperthermia, and drug delivery. Different methods that can be used to prepare the magnetosomes for these applications are described. The toxicity and biodistribution results that have been published are summarized. They show that the magnetosomes can safely be used provided that they are prepared in specific conditions. The advantageous properties of the magnetosomes compared with those of chemically synthesized nanoparticles of similar composition are also highlighted.

  3. Is Ghrelin Synthesized in the Central Nervous System?

    Agustina Cabral

    2017-03-01

    Full Text Available Ghrelin is an octanoylated peptide that acts via its specific receptor, the growth hormone secretagogue receptor type 1a (GHSR-1a, and regulates a vast variety of physiological functions. It is well established that ghrelin is predominantly synthesized by a distinct population of endocrine cells located within the gastric oxyntic mucosa. In addition, some studies have reported that ghrelin could also be synthesized in some brain regions, such as the hypothalamus. However, evidences of neuronal production of ghrelin have been inconsistent and, as a consequence, it is still as a matter of debate if ghrelin can be centrally produced. Here, we provide a comprehensive review and discussion of the data supporting, or not, the notion that the mammalian central nervous system can synthetize ghrelin. We conclude that no irrefutable and reproducible evidence exists supporting the notion that ghrelin is synthetized, at physiologically relevant levels, in the central nervous system of adult mammals.

  4. Enhanced Hydrogen Storage Capacity over Electro-synthesized HKUST-1

    Witri Wahyu Lestari

    2017-12-01

    Full Text Available HKUST-1 [Cu3(1,3,5-BTC2] (BTC = benzene-tri-carboxylate was synthesized using an electrochemical method and tested for hydrogen storage. The obtained material showed a remarkably higher hydrogen uptake over reported HKUST-1 and reached until 4.75 wt% at room temperature and low pressure up to 1.2 bar. This yield was compared to HKUST-1 obtained from the solvothermal method, which showed a hydrogen uptake of only 1.19 wt%. Enhancement of hydrogen sorption of the electro-synthesized product was due to the more appropriate surface area and pore size, effected by the preferable physical interaction between the hydrogen gasses and the copper ions as unsaturated metal centers in the frameworks of HKUST-1.

  5. Monodisperse Silver Nanoparticles Synthesized by a Microwave-Assisted Method

    Shao-Peng, Zhu; Shao-Chun, Tang; Xiang-Kang, Meng

    2009-01-01

    Silver nanoparticles with an average size of about 20 nm are synthesized in a colloidal solution with the aid of microwave irradiation. Neither additional reductant nor stabilizer is required in this microwave-assisted method. The color of the colloidal solution is found to be dark green, different from the characteristic yellow of silver colloidal solutions. The silver nanoparticles in the colloidal solution have a narrow size distribution and large yield quantity. UV-visible absorption spectroscopy analysis reveals that the as-synthesized monodisperse silver nanoparticles have exceptional optical properties. Raman spectroscopy measurements demonstrate that these silver nanoparticles exhibit a notable surface-enhanced Raman scattering ability. (cross-disciplinary physics and related areas of science and technology)

  6. Morphology and topography study of graphene synthesized from plant oil

    Robaiah, M.; Rusop, M.; Abdullah, S.; Khusaimi, Z.; Azhan, H.; Laila, M. O.; Salifairus, M. J.; Asli, N. A.

    2018-05-01

    The graphene is material consists of bonded atom carbon atoms in sheet form one atom thick. The different types of carbon sources which are refined corn oil, palm oil and waste cooking palm oil were used as carbon feedstock to supply carbon atom for synthesizing graphene on the nickel substrate by thermal chemical vapour deposition. The substrate and carbon sources were placed in double zone furnaces. The carbon sources and the substrate were heated at 300 °C and 900 °C respectively. The both furnaces were switched off after synthesis time for cooling process finish. The formation of the graphene on the Ni surface appears due to segregation and precipitation of a high amount of carbon from the source material during the cooling process. FESEM, AFM, UV-VIS Spectroscopy and Raman Spectroscopy were used to characterize and synthesized graphene.

  7. Strong nonlinear photonic responses from microbiologically synthesized tellurium nanocomposites

    Liao, K.-S.; Wang, Jingyuan; Dias, S.; Dewald, J.; Alley, N.J.; Baesman, S.M.; Oremland, R.S.; Blau, W.J.; Curran, S.A.

    2010-01-01

    A new class of nanomaterials, namely microbiologically-formed nanorods composed of elemental tellurium [Te(0)] that forms unusual nanocomposites when combined with poly(m-phenylenevinylene-co-2,5-dioctoxy-phenylenevinylene) (PmPV) is described. These bio-nanocomposites exhibit excellent broadband optical limiting at 532 and 1064 nm. Nonlinear scattering, originating from the laser induced solvent bubbles and microplasmas, is responsible for this nonlinear behavior. The use of bacterially-formed Te(0) when combined with an organic chemical host (e.g., PmPV) is a new green method of nanoparticle syntheses. This opens the possibilities of using unique, biologically synthesized materials to advance future nanoelectronic and nanophotonic applications. ?? 2009 Elsevier B.V. All rights reserved.

  8. Can microcarrier-expanded chondrocytes synthesize cartilaginous tissue in vitro?

    Surrao, Denver C; Khan, Aasma A; McGregor, Aaron J; Amsden, Brian G; Waldman, Stephen D

    2011-08-01

    Tissue engineering is a promising approach for articular cartilage repair; however, it is challenging to produce adequate amounts of tissue in vitro from the limited number of cells that can be extracted from an individual. Relatively few cell expansion methods exist without the problems of de-differentiation and/or loss of potency. Recently, however, several studies have noted the benefits of three-dimensional (3D) over monolayer expansion, but the ability of 3D expanded chondrocytes to synthesize cartilaginous tissue constructs has not been demonstrated. Thus, the purpose of this study was to compare the properties of engineered cartilage constructs from expanded cells (monolayer and 3D microcarriers) to those developed from primary chondrocytes. Isolated bovine chondrocytes were grown for 3 weeks in either monolayer (T-Flasks) or 3D microcarrier (Cytodex 3) expansion culture. Expanded and isolated primary cells were then seeded in high density culture on Millicell™ filters for 4 weeks to evaluate the ability to synthesize cartilaginous tissue. While microcarrier expansion was twice as effective as monolayer expansion (microcarrier: 110-fold increase, monolayer: 52-fold increase), the expanded cells (monolayer and 3D microcarrier) were not effectively able to synthesize cartilaginous tissue in vitro. Tissues developed from primary cells were substantially thicker and accumulated significantly more extracellular matrix (proteoglycan content: 156%-292% increase; collagen content: 70%-191% increase). These results were attributed to phenotypic changes experienced during the expansion phase. Monolayer expanded chondrocytes lost their native morphology within 1 week, whereas microcarrier-expanded cells were spreading by 3 weeks of expansion. While the use of 3D microcarriers can lead to large cellular yields, preservation of chondrogenic phenotype during expansion is required in order to synthesize cartilaginous tissue.

  9. Annual reports in inorganic and general syntheses 1974

    Niedenzu, Kurt

    1975-01-01

    Annual Reports in Inorganic and General Syntheses-1974 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses the chemistry of simple and complex metal hydrides of main groups I, II, and III, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, lead, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens, and pseudohalogens. The text also describes the chemistry of scandium, yttrium, lanthanides, actinides, titanium, zirconium, hafnium, vanadium, niobium, tantalum, chromium, molybdenum, tungsten, ma

  10. Annual reports in inorganic and general syntheses 1973

    Niedenzu, Kurt

    1974-01-01

    Annual Reports in Inorganic and General Syntheses-1973 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book covers the synthetic aspects and structural or mechanistic features of elements, including the main group hydrides, alkali and alkaline earth elements, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, and lead, nitrogen, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens and pseudohalogens, and noble gases. The text also discusses the synthetic aspects and structural or mechanistic features of

  11. Economical parallel oligonucleotide and peptide synthesizer - PET OLIGATOR

    Lebl, M.; Pistek, Ch.; Hachmann, J.; Mudra, Petr; Pešek, Václav; Pokorný, Vít; Poncar, Pavel; Ženíšek, Karel

    2007-01-01

    Roč. 13, 1/2 (2007), s. 367-375 ISSN 1573-3149 Grant - others:NIH SBIR(US) R43 GM61511-01; NIH SBIR(US) R43 GM58981-01 Institutional research plan: CEZ:AV0Z40550506 Keywords : automated synthesizer * centrifugation * parallel synthesis Subject RIV: CC - Organic Chemistry Impact factor: 0.971, year: 2007

  12. Improved chemical syntheses of 5,6-dihydro-5-fluorouracil.

    LaFrate, Andrew L; Katzenellenbogen, John A

    2007-10-26

    5,6-dihydro-5-fluorouracil (5-DHFU) is a metabolite of the chemotherapy drug 5-fluorouracil (5-FU) of importance for biological studies. 5-DHFU has been prepared by enzymatic reduction of 5-FU and in very low yield by hydrogenation of 5-FU; however, a practical chemical synthesis is not available. Facile racemic syntheses of 5-DHFU from 5-FU or uracil, using p-methoxybenzyl protecting groups followed by L-Selectride reduction, are reported.

  13. Total syntheses of Prelactone V and Prelactone B.

    Raghavendra, S; Tadiparthi, Krishnaji; Yadav, J S

    2017-04-10

    The total syntheses of natural products Prelactone-V and Prelactone-B have been accomplished by a novel Chiron approach starting from d-glucose. The synthesis involves isopropylidene acetal formation of d-glucose using Poly(4-vinylpyridine) supported iodine as a catalyst, Tebbe olefination, Grignard reaction, Wittig olefination, selective mono deprotection of acetal using PMA/SiO 2 , hydrogenation and anti-1,3-diol formation are as key steps. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Syntheses and characterizations of LiFePO4 powders

    Jugović, Dragana; Kuzmanović, Maja; Mitrić, Miodrag; Cvjetićanin, Nikola; Uskoković, Dragan

    2011-01-01

    The olivine type compositions LiMPO4 (M = Fe, Mn, Co) are among the most attractive materials for the positive electrode of lithium-ion battery. The benefits of using LiFePO4 are excellent cycle life, high structural stability, low cost and environmental friendliness. Here will be presented our efforts to obtain LiFePO4 powders through several synthesis methods. The differences in phase purity, microstructure, morphology, and electrochemical performances of synthesized powders were investigat...

  15. Syntheses and pyrolytic studies of salicylate derivatives of ...

    New salicylate derivatives of heteronucleic-μ-oxoisopropoxide [SnO2AlB(OPri)4] have been synthesized by the thermal condensation of μ-oxoisopropoxide and methyl/ethyl/phenyl/phenyl ethyl salicylates in different molar ratios (1:1-1:2) yielding the compounds of the type [SnO2AlB(OPri)4-n(RSAL)n] (where n is 1-2 and ...

  16. Annual reports in inorganic and general syntheses 1972

    Niedenzu, Kurt

    1973-01-01

    Annual Reports in Inorganic and General Syntheses-1972 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses alkali and alkaline earth elements, alloys, silver, gold, zinc, cadmium, mercury, boron, aluminum, gallium, indium, thallium, yttrium, scandium, lanthanides, actinides, titanium, zirconium, hafnium, Group V and VI transition elements, manganese, technetium, rhenium, iron, cobalt, nickel, ruthenium, osmium, rhodium, and iridium. The text also describes the chemistry of palladium, platinum, silicon, germanium, tin,

  17. Analysis of Periodic Errors for Synthesized-Reference-Wave Holography

    V. Schejbal

    2009-12-01

    Full Text Available Synthesized-reference-wave holographic techniques offer relatively simple and cost-effective measurement of antenna radiation characteristics and reconstruction of complex aperture fields using near-field intensity-pattern measurement. These methods allow utilization of advantages of methods for probe compensations for amplitude and phasing near-field measurements for the planar and cylindrical scanning including accuracy analyses. The paper analyzes periodic errors, which can be created during scanning, using both theoretical results and numerical simulations.

  18. Knowledge Syntheses in Medical Education: Demystifying Scoping Reviews.

    Thomas, Aliki; Lubarsky, Stuart; Durning, Steven J; Young, Meredith E

    2017-02-01

    An unprecedented rise in health professions education (HPE) research has led to increasing attention and interest in knowledge syntheses. There are many different types of knowledge syntheses in common use, including systematic reviews, meta-ethnography, rapid reviews, narrative reviews, and realist reviews. In this Perspective, the authors examine the nature, purpose, value, and appropriate use of one particular method: scoping reviews. Scoping reviews are iterative and flexible and can serve multiple main purposes: to examine the extent, range, and nature of research activity in a given field; to determine the value and appropriateness of undertaking a full systematic review; to summarize and disseminate research findings; and to identify research gaps in the existing literature. Despite the advantages of this methodology, there are concerns that it is a less rigorous and defensible means to synthesize HPE literature. Drawing from published research and from their collective experience with this methodology, the authors present a brief description of scoping reviews, explore the advantages and disadvantages of scoping reviews in the context of HPE, and offer lessons learned and suggestions for colleagues who are considering conducting scoping reviews. Examples of published scoping reviews are provided to illustrate the steps involved in the methodology.

  19. Development of an Intelligent System to Synthesize Petrophysical Well Logs

    Morteza Nouri Taleghani

    2013-07-01

    Full Text Available Porosity is one of the fundamental petrophysical properties that should be evaluated for hydrocarbon bearing reservoirs. It is a vital factor in precise understanding of reservoir quality in a hydrocarbon field. Log data are exceedingly crucial information in petroleum industries, for many of hydrocarbon parameters are obtained by virtue of petrophysical data. There are three main petrophysical logging tools for the determination of porosity, namely neutron, density, and sonic well logs. Porosity can be determined by the use of each of these tools; however, a precise analysis requires a complete set of these tools. Log sets are commonly either incomplete or unreliable for many reasons (i.e. incomplete logging, measurement errors, and loss of data owing to unsuitable data storage. To overcome this drawback, in this study several intelligent systems such as fuzzy logic (FL, neural network (NN, and support vector machine are used to predict synthesized petrophysical logs including neutron, density, and sonic. To accomplish this, the petrophysical well logs data were collected from a real reservoir in one of Iran southwest oil fields. The corresponding correlation was obtained through the comparison of synthesized log values with real log values. The results showed that all intelligent systems were capable of synthesizing petrophysical well logs, but SVM had better accuracy and could be used as the most reliable method compared to the other techniques.

  20. A new approach to synthesize supported ruthenium phosphides for hydrodesulfurization

    Wang, Qingfang; Wang, Zhiqiang; Yin, Xiaoqian; Zhou, Linxi; Zhang, Minghui

    2016-01-01

    Highlights: • We bring out a new method to synthesize noble metal phosphides at low temperature. • Both RuP and Ru_2P were synthesized using triphenylphosphine as phosphorus sources. • Ru_2P was the better active phase for HDS than RuP and metal Ru. • RuP/SiO_2 prepared by new method had better HDS activity to that by TPR method. - Abstract: Supported noble metal ruthenium phosphides were synthesized by one-step H_2-thermal treatment method using triphenylphosphine (TPP) as phosphorus sources at low temperatures. Two phosphides RuP and Ru_2P can be prepared by this method via varying the molar ratio of metal salt and TPP. The as-prepared phosphides were characterized by X-ray powder diffraction (XRD), low-temperature N_2 adsorption, CO chemisorption and transmission electronic microscopy (TEM). The supported ruthenium phosphides prepared by new method and conventional method together with contradistinctive metallic ruthenium were evaluated in hydrodesulfurization (HDS) of dibenzothiophene (DBT). The catalytic results showed that metal-rich Ru_2P was the better active phase for HDS than RuP and metal Ru. Besides this, ruthenium phosphide catalyst prepared by new method exhibited superior HDS activity to that prepared by conventional method.

  1. A new approach to synthesize supported ruthenium phosphides for hydrodesulfurization

    Wang, Qingfang [Tianjin Key Laboratory of Water Environment and Resources, Tianjin Normal University, Tianjin 300387 (China); Key Laboratory of Advanced Energy Materials Chemistry (MOE), Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), College of Chemistry, Nankai University, Tianjin 300071 (China); Wang, Zhiqiang [Tianjin Key Laboratory of Water Environment and Resources, Tianjin Normal University, Tianjin 300387 (China); Yin, Xiaoqian; Zhou, Linxi [Key Laboratory of Advanced Energy Materials Chemistry (MOE), Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), College of Chemistry, Nankai University, Tianjin 300071 (China); Zhang, Minghui, E-mail: zhangmh@nankai.edu.cn [Key Laboratory of Advanced Energy Materials Chemistry (MOE), Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), College of Chemistry, Nankai University, Tianjin 300071 (China); College of Chemistry and Environmental Science, Kashgar University, Kashgar 844006 (China)

    2016-02-15

    Highlights: • We bring out a new method to synthesize noble metal phosphides at low temperature. • Both RuP and Ru{sub 2}P were synthesized using triphenylphosphine as phosphorus sources. • Ru{sub 2}P was the better active phase for HDS than RuP and metal Ru. • RuP/SiO{sub 2} prepared by new method had better HDS activity to that by TPR method. - Abstract: Supported noble metal ruthenium phosphides were synthesized by one-step H{sub 2}-thermal treatment method using triphenylphosphine (TPP) as phosphorus sources at low temperatures. Two phosphides RuP and Ru{sub 2}P can be prepared by this method via varying the molar ratio of metal salt and TPP. The as-prepared phosphides were characterized by X-ray powder diffraction (XRD), low-temperature N{sub 2} adsorption, CO chemisorption and transmission electronic microscopy (TEM). The supported ruthenium phosphides prepared by new method and conventional method together with contradistinctive metallic ruthenium were evaluated in hydrodesulfurization (HDS) of dibenzothiophene (DBT). The catalytic results showed that metal-rich Ru{sub 2}P was the better active phase for HDS than RuP and metal Ru. Besides this, ruthenium phosphide catalyst prepared by new method exhibited superior HDS activity to that prepared by conventional method.

  2. GHz band frequency hopping PLL-based frequency synthesizers

    XU Yong; WANG Zhi-gong; GUAN Yu; XU Zhi-jun; QIAO Lu-feng

    2005-01-01

    In this paper we describe a full-integrated circuit containing all building blocks of a completed PLL-based synthesizer except for low pass filter(LPF).The frequency synthesizer is designed for a frequency hopping (FH) transceiver operating up to 1.5 GHz as a local oscillator. The architecture of Voltage Controlled Oscillator (VCO) is optimized to get better performance, and a phase noise of -111.85-dBc/Hz @ 1 MHz and a tuning range of 250 MHz are gained at a centre frequency of 1.35 GHz.A novel Dual-Modulus Prescaler(DMP) is designed to achieve a very low jitter and a lower power.The settling time of PLL is 80 μs while the reference frequency is 400 KHz.This monolithic frequency synthesizer is to integrate all main building blocks of PLL except for the low pass filter,with a maximum VCO output frequency of 1.5 GHz,and is fabricated with a 0.18 μm mixed signal CMOS process. Low power dissipation, low phase noise, large tuning range and fast settling time are gained in this design.

  3. Radiolytic Syntheses of Nanoparticles and Inorganic-Polymer Hybrid Microgels

    Chen, Q.; Shi, J.; Zhao, R.; Shen, X.

    2010-01-01

    In the second year of the project, we have gotten progress mainly in two directions. Firstly, for the first time, Prussian blue (PB) nanoparticles (NPs) were successfully synthesized by the partly radiolytic reduction of Fe3+ and Fe(CN)63 in the presence of poly(N-vinyl pyrrolidine) (PVP) under N2 atmospheres at room temperature. With the increase of the concentration of PVP, the size and the size distribution of the synthesized quasi-spherical PB NPs decreased obviously, leading to a hypsochromic shift on their peak position of the characteristic absorption. In the experiment, we further found that the smaller ones have a larger capacity to Cs+, suggesting that the application of PB NPs in curing thallotoxicosis may decrease the usage of PB for the patient to great extent. Secondly, through a series of preliminary experiments, we got a clear picture about the one-step radiolytic preparation of inorganic-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by surfactant-free emulsion polymerization. Besides, unpurified N-carbamothioylmethacrylamide was synthesized via the methacrylation of thiourea. These created favorable conditions for the one-step synthesis of metal sulfide-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by -irradiation and surfactant-free emulsion polymerization. (author)

  4. Performance of Phonatory Deviation Diagrams in Synthesized Voice Analysis.

    Lopes, Leonardo Wanderley; da Silva, Karoline Evangelista; da Silva Evangelista, Deyverson; Almeida, Anna Alice; Silva, Priscila Oliveira Costa; Lucero, Jorge; Behlau, Mara

    2018-05-02

    To analyze the performance of a phonatory deviation diagram (PDD) in discriminating the presence and severity of voice deviation and the predominant voice quality of synthesized voices. A speech-language pathologist performed the auditory-perceptual analysis of the synthesized voice (n = 871). The PDD distribution of voice signals was analyzed according to area, quadrant, shape, and density. Differences in signal distribution regarding the PDD area and quadrant were detected when differentiating the signals with and without voice deviation and with different predominant voice quality. Differences in signal distribution were found in all PDD parameters as a function of the severity of voice disorder. The PDD area and quadrant can differentiate normal voices from deviant synthesized voices. There are differences in signal distribution in PDD area and quadrant as a function of the severity of voice disorder and the predominant voice quality. However, the PDD area and quadrant do not differentiate the signals as a function of severity of voice disorder and differentiated only the breathy and rough voices from the normal and strained voices. PDD density is able to differentiate only signals with moderate and severe deviation. PDD shape shows differences between signals with different severities of voice deviation. © 2018 S. Karger AG, Basel.

  5. The method of synthesizing of superhydrophobic surfaces by PECVD

    Orazbayev, Sagi; Gabdullin, Maratbek; Ramazanov, Tlekkabul; Dosbolayev, Merlan; Zhunisbekov, Askar; Omirbekov, Dulat; Otarbay, Zhuldyz

    2018-03-01

    The aim of this work was to obtain superhydrophobic surfaces in a plasma medium. The experiment was carried out using the PECVD method in two different modes: constant and pulsing. The surface roughness was obtained by applying nanoparticles synthesized in plasma in a mixture of argon and methane. The resulting particles were deposited on the surface of silicon and glass materials. The contact angle increased linearly depending on the number of cycles, until it reached 160° at 150-160th cycles, after that the increase in cycles does not affect the contact angle, since the saturation process is in progress. Also the effect of the working gas composition on the hydrophobicity of the surface was studied. At low concentrations of methane (1%) only particles are synthesized in the working gas, and hydrophobicity is unstable, with an increase in methane concentration (7%) nanofilms are synthesized from nanoclusters, and surface hydrophobicity is relatively stable. In addition, a pulsing plasma mode was used to obtain superhydrophobic surfaces. The hydrophobicity of the sample showed that the strength of the nanofilm was stable in comparison with the sample obtained in the first mode, but the contact angle was lower. The obtained samples were examined using SEM, SPM, optical analysis, and their contact angles were determined.

  6. Radiolytic Syntheses of Nanoparticles and Inorganic-Polymer Hybrid Microgels

    Chen, Q.; Shi, J.; Zhao, R.; Shen, X., E-mail: qdchen@pku.edu.cn [Department of Applied Chemistry, College of Chemistry and Molecular Engineering, Peking University, No. 5, Yiheyuan Load, Haidian District Beijing 100871 (China)

    2010-07-01

    In the second year of the project, we have gotten progress mainly in two directions. Firstly, for the first time, Prussian blue (PB) nanoparticles (NPs) were successfully synthesized by the partly radiolytic reduction of Fe3+ and Fe(CN)63 in the presence of poly(N-vinyl pyrrolidine) (PVP) under N2 atmospheres at room temperature. With the increase of the concentration of PVP, the size and the size distribution of the synthesized quasi-spherical PB NPs decreased obviously, leading to a hypsochromic shift on their peak position of the characteristic absorption. In the experiment, we further found that the smaller ones have a larger capacity to Cs+, suggesting that the application of PB NPs in curing thallotoxicosis may decrease the usage of PB for the patient to great extent. Secondly, through a series of preliminary experiments, we got a clear picture about the one-step radiolytic preparation of inorganic-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by surfactant-free emulsion polymerization. Besides, unpurified N-carbamothioylmethacrylamide was synthesized via the methacrylation of thiourea. These created favorable conditions for the one-step synthesis of metal sulfide-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by -irradiation and surfactant-free emulsion polymerization. (author)

  7. Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp.

    Thomas, Roshmi; Janardhanan, Anju; Varghese, Rintu T; Soniya, E V; Mathew, Jyothis; Radhakrishnan, E K

    2014-01-01

    Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM) and scanning electron microscope (SEM). The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm - 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus.

  8. Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp.

    Roshmi Thomas

    2014-12-01

    Full Text Available Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM and scanning electron microscope (SEM. The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm - 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus.

  9. Soft-Template-Synthesized Mesoporous Carbon for Oral Drug Delivery

    Saha, Dipendu [ORNL; Warren, Kaitlyn E [ORNL; Naskar, Amit K [ORNL

    2014-01-01

    Template-synthesized mesoporous carbons were successfully used in in vitro investigations of controlled delivery of three model drugs, captopril, furosemide, and ranitidine hydrochloride. Captopril and furosemide exhibited desorption kinetics over 30 40 h, and ranitidine HCl had a complete release time of 5 10 h. As evident from the slow release kinetics, we contend that our mesoporous carbon is an improved drug-delivery medium compared to state-of-the-art porous silica-based substrates. The mesoporous carbons, synthesized from phloroglucinol and lignin, a synthetic and a sustainable precursor, respectively, exhibit BET surface area of 200 400 m2 g-1 and pore volume of 0.2 0.6 cm3 g-1. The phloroglucinol-based carbon has narrower pore widths and higher pore volume than the lignin-derived counterpart and maintains a longer release time. Numerical modeling of the release kinetics data reveals that the diffusivities of all the drugs from lignin-based carbon media are of equivalent magnitude (10-22 to 10-24 m2 s-1). However, a tailored reduction of pore width in the sorbent reduces the diffusivity of smaller drug molecules (captopril) by an order of magnitude. Thus, engineered pore morphology in our synthesized carbon sorbent, along with its potential to tailor the chemistry of its interaction with sorbet, can be exploited for optimal delivery system of a preferred drug within its therapeutic level and below the level of toxicity.

  10. A novel nanostructure of cadmium oxide synthesized by mechanochemical method

    Tadjarodi, A., E-mail: tajarodi@iust.ac.ir [Research Laboratory of Inorganic Materials Synthesis, Department of Chemistry, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of); Imani, M. [Research Laboratory of Inorganic Materials Synthesis, Department of Chemistry, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of)

    2011-11-15

    Highlights: {yields} A novel nanostructure of CdO was synthesized by mechanochemical reaction followed by calcination. {yields} Mechanochemical method is a simple and low-cost to synthesize nanomaterials. {yields} The obtained precursor was characterized by FT-IR, NMR techniques and elemental analysis. {yields} SEM images showed cauliflower-like shape of sample with components average diameter of 68 nm. {yields} The rods and tubes bundles with single crystalline nature were revealed by ED pattern and TEM images. -- Abstract: Cauliflower-like cadmium oxide (CdO) nanostructure was synthesized by mechanochemical reaction followed calcination procedure. Cadmium acetate dihydrate and acetamide were used as reagents and the resulting precursor was calcinated at 450 {sup o}C for 2 h in air. The structures of the precursor and resultant product of the heating treatment were characterized using Fourier transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy and elemental analysis, X-ray powder diffraction (XRD), energy-dispersive X-ray spectroscopy analysis (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction pattern (ED). SEM and TEM images revealed the cauliflower-like morphology of the sample. This structure includes the bundles of rods and tubes in nanoscale, which combine with each other and form the resulting morphology with the average diameter, 68 nm of the components. ED pattern indicated the single crystal nature of the formed bundles.

  11. A novel nanostructure of cadmium oxide synthesized by mechanochemical method

    Tadjarodi, A.; Imani, M.

    2011-01-01

    Highlights: → A novel nanostructure of CdO was synthesized by mechanochemical reaction followed by calcination. → Mechanochemical method is a simple and low-cost to synthesize nanomaterials. → The obtained precursor was characterized by FT-IR, NMR techniques and elemental analysis. → SEM images showed cauliflower-like shape of sample with components average diameter of 68 nm. → The rods and tubes bundles with single crystalline nature were revealed by ED pattern and TEM images. -- Abstract: Cauliflower-like cadmium oxide (CdO) nanostructure was synthesized by mechanochemical reaction followed calcination procedure. Cadmium acetate dihydrate and acetamide were used as reagents and the resulting precursor was calcinated at 450 o C for 2 h in air. The structures of the precursor and resultant product of the heating treatment were characterized using Fourier transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy and elemental analysis, X-ray powder diffraction (XRD), energy-dispersive X-ray spectroscopy analysis (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction pattern (ED). SEM and TEM images revealed the cauliflower-like morphology of the sample. This structure includes the bundles of rods and tubes in nanoscale, which combine with each other and form the resulting morphology with the average diameter, 68 nm of the components. ED pattern indicated the single crystal nature of the formed bundles.

  12. Substitution of conventional high-temperature syntheses of inorganic compounds by near-room-temperature syntheses in ionic liquids

    Groh, Matthias Friedrich; Mü llera, Ulrike; Ahmed, Ejaz; Rothenberger, Alexander; Ruck, Michael J.

    2013-01-01

    The high-temperature syntheses of the low-valent halogenides P2I4, Te2Br, α-Te4I4, Te4(Al2Cl7)2, Te4(Bi6Cl20), Te8(Bi4Cl14),Bi8(AlCl4)2, Bi6Cl7,and Bi6Br7, as well as of WSCl4 andWOCl4 have been replaced by resource-efficient low

  13. Interdisciplinary Project Experiences: Collaboration between Majors and Non-Majors

    Smarkusky, Debra L.; Toman, Sharon A.

    2014-01-01

    Students in computer science and information technology should be engaged in solving real-world problems received from government and industry as well as those that expose them to various areas of application. In this paper, we discuss interdisciplinary project experiences between majors and non-majors that offered a creative and innovative…

  14. Do Biology Majors Really Differ from Non-STEM Majors?

    Cotner, Sehoya; Thompson, Seth; Wright, Robin

    2017-01-01

    Recent calls to action urge sweeping reform in science education, advocating for improved learning for all students-including those majoring in fields beyond the sciences. However, little work has been done to characterize the differences-if any exist-between students planning a career in science and those studying other disciplines. We describe an attempt to clarify, in broad terms, how non-STEM (science, technology, engineering, and mathematics) majors differ from life sciences majors, and how they are similar. Using survey responses and institutional data, we find that non-STEM majors are not unilaterally science averse; non-STEM majors are more likely than biology majors to hold misconceptions about the nature of science, yet they are not completely ignorant of how science works; non-STEM majors are less likely than biology majors to see science as personally relevant; and non-STEM majors populations are likely to be more diverse-with respect to incoming knowledge, perceptions, backgrounds, and skills-than a biology majors population. We encourage science educators to consider these characteristics when designing curricula for future scientists or simply for a well-informed citizenry. © 2017 S. Cotner et al. CBE—Life Sciences Education © 2017 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  15. Vibrational imaging of newly synthesized proteins in live cells by stimulated Raman scattering microscopy

    Wei, Lu; Yu, Yong; Shen, Yihui; Wang, Meng C.; Min, Wei

    2013-01-01

    Synthesis of new proteins, a key step in the central dogma of molecular biology, has been a major biological process by which cells respond rapidly to environmental cues in both physiological and pathological conditions. However, the selective visualization of a newly synthesized proteome in living systems with subcellular resolution has proven to be rather challenging, despite the extensive efforts along the lines of fluorescence staining, autoradiography, and mass spectrometry. Herein, we report an imaging technique to visualize nascent proteins by harnessing the emerging stimulated Raman scattering (SRS) microscopy coupled with metabolic incorporation of deuterium-labeled amino acids. As a first demonstration, we imaged newly synthesized proteins in live mammalian cells with high spatial–temporal resolution without fixation or staining. Subcellular compartments with fast protein turnover in HeLa and HEK293T cells, and newly grown neurites in differentiating neuron-like N2A cells, are clearly identified via this imaging technique. Technically, incorporation of deuterium-labeled amino acids is minimally perturbative to live cells, whereas SRS imaging of exogenous carbon–deuterium bonds (C–D) in the cell-silent Raman region is highly sensitive, specific, and compatible with living systems. Moreover, coupled with label-free SRS imaging of the total proteome, our method can readily generate spatial maps of the quantitative ratio between new and total proteomes. Thus, this technique of nonlinear vibrational imaging of stable isotope incorporation will be a valuable tool to advance our understanding of the complex spatial and temporal dynamics of newly synthesized proteome in vivo. PMID:23798434

  16. Antimicrobial activity and physical characterization of silver nanoparticles green synthesized using nitrate reductase from Fusarium oxysporum.

    Gholami-Shabani, Mohammadhassan; Akbarzadeh, Azim; Norouzian, Dariush; Amini, Abdolhossein; Gholami-Shabani, Zeynab; Imani, Afshin; Chiani, Mohsen; Riazi, Gholamhossein; Shams-Ghahfarokhi, Masoomeh; Razzaghi-Abyaneh, Mehdi

    2014-04-01

    Nanostructures from natural sources have received major attention due to wide array of biological activities and less toxicity for humans, animals, and the environment. In the present study, silver nanoparticles were successfully synthesized using a fungal nitrate reductase, and their biological activity was assessed against human pathogenic fungi and bacteria. The enzyme was isolated from Fusarium oxysporum IRAN 31C after culturing on malt extract-glucose-yeast extract-peptone (MGYP) medium. The enzyme was purified by a combination of ultrafiltration and ion exchange chromatography on DEAE Sephadex and its molecular weight was estimated by gel filtration on Sephacryl S-300. The purified enzyme had a maximum yield of 50.84 % with a final purification of 70 folds. With a molecular weight of 214 KDa, it is composed of three subunits of 125, 60, and 25 KDa. The purified enzyme was successfully used for synthesis of silver nanoparticles in a way dependent upon NADPH using gelatin as a capping agent. The synthesized silver nanoparticles were characterized by X-ray diffraction, dynamic light scattering spectroscopy, and transmission and scanning electron microscopy. These stable nonaggregating nanoparticles were spherical in shape with an average size of 50 nm and a zeta potential of -34.3. Evaluation of the antimicrobial effects of synthesized nanoparticles by disk diffusion method showed strong growth inhibitory activity against all tested human pathogenic fungi and bacteria as evident from inhibition zones that ranged from 14 to 25 mm. Successful green synthesis of biologically active silver nanoparticles by a nitrate reductase from F. oxysporum in the present work not only reduces laborious downstream steps such as purification of nanoparticle from interfering cellular components, but also provides a constant source of safe biologically-active nanomaterials with potential application in agriculture and medicine.

  17. Drosophila larvae synthesize the putative oncometabolite L-2-hydroxyglutarate during normal developmental growth.

    Li, Hongde; Chawla, Geetanjali; Hurlburt, Alexander J; Sterrett, Maria C; Zaslaver, Olga; Cox, James; Karty, Jonathan A; Rosebrock, Adam P; Caudy, Amy A; Tennessen, Jason M

    2017-02-07

    L-2-hydroxyglutarate (L-2HG) has emerged as a putative oncometabolite that is capable of inhibiting enzymes involved in metabolism, chromatin modification, and cell differentiation. However, despite the ability of L-2HG to interfere with a broad range of cellular processes, this molecule is often characterized as a metabolic waste product. Here, we demonstrate that Drosophila larvae use the metabolic conditions established by aerobic glycolysis to both synthesize and accumulate high concentrations of L-2HG during normal developmental growth. A majority of the larval L-2HG pool is derived from glucose and dependent on the Drosophila estrogen-related receptor (dERR), which promotes L-2HG synthesis by up-regulating expression of the Drosophila homolog of lactate dehydrogenase (dLdh). We also show that dLDH is both necessary and sufficient for directly synthesizing L-2HG and the Drosophila homolog of L-2-hydroxyglutarate dehydrogenase (dL2HGDH), which encodes the enzyme that breaks down L-2HG, is required for stage-specific degradation of the L-2HG pool. In addition, dLDH also indirectly promotes L-2HG accumulation via synthesis of lactate, which activates a metabolic feed-forward mechanism that inhibits dL2HGDH activity and stabilizes L-2HG levels. Finally, we use a genetic approach to demonstrate that dLDH and L-2HG influence position effect variegation and DNA methylation, suggesting that this compound serves to coordinate glycolytic flux with epigenetic modifications. Overall, our studies demonstrate that growing animal tissues synthesize L-2HG in a controlled manner, reveal a mechanism that coordinates glucose catabolism with L-2HG synthesis, and establish the fly as a unique model system for studying the endogenous functions of L-2HG during cell growth and proliferation.

  18. Drosophila larvae synthesize the putative oncometabolite L-2-hydroxyglutarate during normal developmental growth

    Li, Hongde; Chawla, Geetanjali; Hurlburt, Alexander J.; Sterrett, Maria C.; Zaslaver, Olga; Cox, James; Karty, Jonathan A.; Rosebrock, Adam P.; Caudy, Amy A.

    2017-01-01

    L-2-hydroxyglutarate (L-2HG) has emerged as a putative oncometabolite that is capable of inhibiting enzymes involved in metabolism, chromatin modification, and cell differentiation. However, despite the ability of L-2HG to interfere with a broad range of cellular processes, this molecule is often characterized as a metabolic waste product. Here, we demonstrate that Drosophila larvae use the metabolic conditions established by aerobic glycolysis to both synthesize and accumulate high concentrations of L-2HG during normal developmental growth. A majority of the larval L-2HG pool is derived from glucose and dependent on the Drosophila estrogen-related receptor (dERR), which promotes L-2HG synthesis by up-regulating expression of the Drosophila homolog of lactate dehydrogenase (dLdh). We also show that dLDH is both necessary and sufficient for directly synthesizing L-2HG and the Drosophila homolog of L-2-hydroxyglutarate dehydrogenase (dL2HGDH), which encodes the enzyme that breaks down L-2HG, is required for stage-specific degradation of the L-2HG pool. In addition, dLDH also indirectly promotes L-2HG accumulation via synthesis of lactate, which activates a metabolic feed-forward mechanism that inhibits dL2HGDH activity and stabilizes L-2HG levels. Finally, we use a genetic approach to demonstrate that dLDH and L-2HG influence position effect variegation and DNA methylation, suggesting that this compound serves to coordinate glycolytic flux with epigenetic modifications. Overall, our studies demonstrate that growing animal tissues synthesize L-2HG in a controlled manner, reveal a mechanism that coordinates glucose catabolism with L-2HG synthesis, and establish the fly as a unique model system for studying the endogenous functions of L-2HG during cell growth and proliferation. PMID:28115720

  19. Microalgae associated Brevundimonas sp. MSK 4 as the nano particle synthesizing unit to produce antimicrobial silver nanoparticles.

    Rajamanickam, Karthic; Sudha, S S; Francis, Mebin; Sowmya, T; Rengaramanujam, J; Sivalingam, Periyasamy; Prabakar, Kandasamy

    2013-09-01

    The biosynthesis of silver nanoparticles and its antimicrobial property was studied using bacteria isolated from Spirulina products. Isolated bacteria were identified as Bacillus sp. MSK 1 (JX495945), Staphylococcus sp. MSK 2 (JX495946), Bacillus sp. MSK 3 (JX495947) and Brevundimonas sp. MSK 4 (JX495948). Silver nanoparticles (AgNPs) were synthesized using bacterial culture filtrate with AgNO3. The initial syntheses of Ag nanoparticles were characterized by UV-vis spectrophotometer (by measuring the color change to intense brown). Fourier Transform Infrared Spectroscopy (FTIR) study showed evidence that proteins are possible reducing agents and Energy-dispersive X-ray (EDX) study showing the metal silver as major signal. The structure of AgNPs was determined by Scanning electron microscopy (SEM) and X-ray diffraction (XRD). Synthesized Ag nanoparticles with an average size of 40-65 nm have antimicrobial property against human pathogens like Proteus vulgaris, Salmonella typhi, Vibrio cholera, Streptococcus sp., Bacillus subtilis, Staphylococcus aureus, and Escherichia coli. Among the isolates Brevundimonas sp. MSK 4 alone showed good activity in both synthesis of AgNPs and antimicrobial activity. This work demonstrates the possible use of biological synthesized silver nanoparticles to combat the drug resistant problem. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

    Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

    2017-07-01

    Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

  1. Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

    Ahmad, R.; Hussain, J.

    2014-01-01

    Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

  2. Unconventional Internships for English Majors.

    Otto, Don H.

    After five years of research, the English department at St. Cloud (Minnesota) State University created an internship program for English majors. The philosophy behind the program is that the typical experience of the English major in college is excellent preparation for what the college graduate will be doing in most careers in business,…

  3. Do You Have Major Depression?

    ... of this page please turn Javascript on. Feature: Depression Do You Have Major Depression? Past Issues / Fall 2009 Table of Contents Simple ... member may have major depression. —NIMH Types of Depression Just like other illnesses, such as heart disease, ...

  4. Tribology of carbide derived carbon films synthesized on tungsten carbide

    Tlustochowicz, Marcin

    Tribologically advantageous films of carbide derived carbon (CDC) have been successfully synthesized on binderless tungsten carbide manufactured using the plasma pressure compaction (P2CRTM) technology. In order to produce the CDC films, tungsten carbide samples were reacted with chlorine containing gas mixtures at temperatures ranging from 800°C to 1000°C in a sealed tube furnace. Some of the treated samples were later dechlorinated by an 800°C hydrogenation treatment. Detailed mechanical and structural characterizations of the CDC films and sliding contact surfaces were done using a series of analytical techniques and their results were correlated with the friction and wear behavior of the CDC films in various tribosystems, including CDC-steel, CDC-WC, CDC-Si3N4 and CDC-CDC. Optimum synthesis and treatment conditions were determined for use in two specific environments: moderately humid air and dry nitrogen. It was found that CDC films first synthesized at 1000°C and then hydrogen post-treated at 800°C performed best in air with friction coefficient values as low as 0.11. However, for dry nitrogen applications, no dechlorination was necessary and both hydrogenated and as-synthesized CDC films exhibited friction coefficients of approximately 0.03. A model of tribological behavior of CDC has been proposed that takes into consideration the tribo-oxidation of counterface material, the capillary forces from adsorbed water vapor, the carbon-based tribofilm formation, and the lubrication effect of both chlorine and hydrogen.

  5. Fibronectin synthesized by a human hepatoma cell line

    Glasgow, J.E.; Colman, R.W.

    1984-01-01

    Fibronectin is a family of immunologically similar glycoproteins which mediate a variety of cell-cell and cell-substratum interactions. It is a constituent of the extracellular matrix of connective tissue and circulates in plasma. When suspension and adherent cultures of a human hepatoma cell line (SK-HEP-1) were incubated in serum-free medium, the resulting conditioned medium contained material which was specifically immunoprecipitated by antisera to human plasma fibronectin. By double immunodiffusion, a component in the conditioned culture medium was shown to form a line of identity with fibronectin in human plasma and to migrate as an alpha 2- to beta-globulin during immunoelectrophoresis. Human fibronectin was quantified in conditioned medium by electroimmunodiffusion, and was found to increase for at least three days at about 0.1 micrograms/10(6) cells/day. Adherent cultures of SK-HEP-1 cells were incubated with L-[ 35 S]methionine to label newly synthesized proteins. Labeled fibronectin in conditioned medium or in cell extracts comigrated with fibronectin in human plasma as shown by autoradiography following crossed-immunoelectrophoresis. Fibronectin was demonstrated in the extra-cellular matrix of adherent SK-HEP-1 cultures by immunofluorescence. It was shown previously that SK-HEP-1 cells synthesize alpha 1-protease inhibitor, one of the products of normal hepatocytes. The finding that these hepatoma cells also synthesize fibronectin supports the concept that the hepatocyte may be one source of circulating fibronectin, a possibility consistent with the established role of this cell type in blood plasma protein synthesis

  6. Miniaturized radiation detector with custom synthesized diamond crystal as sensor

    Grobbelaar, J.H.; Burns, R.C.; Nam, T.L.; Keddy, R.J.

    1991-01-01

    A miniaturized detector consisting of three custom built hybrid circuits, a counter and a miniature high voltage power supply was designed to operate with custom synthesized Type Ib diamond crystals as sensors. Thick-film technology was incorporated in the circuit design. With a crystal having a volume of approximately 10 mm 3 and containing approximately 60 ppm paramagnetic nitrogen, the detector was capable of measuring γ-ray dose-rates as low as 7.5 μ Gy h -1 . The response characteristic was linear up to 1 cGy h -1 . (orig.)

  7. Annual reports in inorganic and general syntheses 1976

    Zimmer, Hans

    2013-01-01

    Annual Reports in Inorganic and General Syntheses-1976 presents an annual review of synthetically useful information that would prove beneficial to nearly all organic chemists, both specialist and nonspecialist in synthesis. It should help relieve some of the information storage burden of the specialist and should aid the nonspecialist who is seeking help with a specific problem to become rapidly aware of recent synthetic advances.This is the fifth volume of ARIGS and is organized along the lines developed for the preceding volumes. The authors were encouraged to use synthetic aspects as their

  8. Comparative sinterability of combustion synthesized and commercial titanium carbides

    Manley, B.W.

    1984-11-01

    The influence of various parameters on the sinterability of combustion synthesized titanium carbide was investigaged. Titanium carbide powders, prepared by the combustion synthesis process, were sintered in the temperature range 1150 to 1600 0 C. Incomplete combustion and high oxygen contents were found to be the cause of reduced shrinkage during sintering of the combustion syntheized powders when compared to the shrinkage of commercial TiC. Free carbon was shown to inhibit shrinkage. The activation energy for sintering was found to depend on stoichiometry (C/Ti). With decreasing C/Ti, the rate of sintering increased. 29 references, 16 figures, 13 tables

  9. Copper nanoparticles synthesized in polymers by ion implantation

    Popok, Vladimir; Nuzhdin, Vladimir; Valeev, Valerij

    2015-01-01

    nanoparticles are observed to partly tower above the sample surface due to a side effect of high-fluence irradiation leading to considerable sputtering of polymers. Implantation and particle formation significantly change optical properties of both polymers reducing transmittance in the UV-visible range due...... as optical transmission spectroscopy. It is found that copper nanoparticles nucleation and growth are strongly fluence dependent as well as they are affected by the polymer properties, in particular, by radiation stability yielding different nanostructures for the implanted PI and PMMA. Shallow synthesized...

  10. Rotational spectrum of formaldehyde reinvestigated using a photomixing THz synthesizer

    Eliet, Sophie; Cuisset, Arnaud; Guinet, Mickaël; Hindle, Francis; Mouret, Gaël; Bocquet, Robin; Demaison, Jean

    2012-09-01

    Approximately 60 pure rotational frequency transitions of formaldehyde in its ground state have been measured with sub-MHz uncertainty in the 0.7-1.8 THz frequency range using a photomixing THz synthesizer locked onto a frequency comb. The frequencies associated with previous submillimeter and infrared data have been included in a fit providing a new set of improved molecular parameters. The assignment of each line was checked using the usual statistical diagnostics. Finally, the ability of the continuous-wave spectrometer coupled to a multipass-cell to measure THz rotational transitions of H2CO in the 31, 41 and 61 vibrational states was demonstrated.

  11. Bio-inspired routes for synthesizing efficient nanoscale platinum electrocatalysts

    Cha, Jennifer N. [Univ. of California, San Diego, CA (United States); Wang, Joseph [Univ. of California, San Diego, CA (United States)

    2014-08-31

    The overall objective of the proposed research is to use fundamental advances in bionanotechnology to design powerful platinum nanocrystal electrocatalysts for fuel cell applications. The new economically-viable, environmentally-friendly, bottom-up biochemical synthetic strategy will produce platinum nanocrystals with tailored size, shape and crystal orientation, hence leading to a maximum electrochemical reactivity. There are five specific aims to the proposed bio-inspired strategy for synthesizing efficient electrocatalytic platinum nanocrystals: (1) isolate peptides that both selectively bind particular crystal faces of platinum and promote the nucleation and growth of particular nanocrystal morphologies, (2) pattern nanoscale 2-dimensional arrays of platinum nucleating peptides from DNA scaffolds, (3) investigate the combined use of substrate patterned peptides and soluble peptides on nanocrystal morphology and growth (4) synthesize platinum crystals on planar and large-area carbon electrode supports, and (5) perform detailed characterization of the electrocatalytic behavior as a function of catalyst size, shape and morphology. Project Description and Impact: This bio-inspired collaborative research effort will address key challenges in designing powerful electrocatalysts for fuel cell applications by employing nucleic acid scaffolds in combination with peptides to perform specific, environmentally-friendly, simultaneous bottom-up biochemical synthesis and patterned assembly of highly uniform and efficient platinum nanocrystal catalysts. Bulk synthesis of nanoparticles usually produces a range of sizes, accessible catalytic sites, crystal morphologies, and orientations, all of which lead to inconsistent catalytic activities. In contrast, biological systems routinely demonstrate exquisite control over inorganic syntheses at neutral pH and ambient temperature and pressures. Because the orientation and arrangement of the templating biomolecules can be precisely

  12. Integrated digital superconducting logic circuits for the quantum synthesizer. Report

    Buchholz, F.I.; Kohlmann, J.; Khabipov, M.; Brandt, C.M.; Hagedorn, D.; Balashov, D.; Maibaum, F.; Tolkacheva, E.; Niemeyer, J.

    2006-11-01

    This report presents the results, which were reached in the framework of the BMBF cooperative plan ''Quantum Synthesizer'' in the partial plan ''Integrated Digital Superconducting Logic Circuits''. As essential goal of the plan a novel instrument on the base of quantum-coherent superconducting circuits should be developed. which allows to generate praxis-relevant wave forms with quantum accuracy, the quantum synthesizer. The main topics of development of the reported partial plan lied at the one hand in the development of integrated, digital, superconducting circuit in rapid-single-flux (RSFQ) quantum logics for the pattern generator of the quantum synthesizer, at the other hand in the further development of the fabrication technology for the aiming of high circuit complexity. In order to fulfil these requirements at the PTB a new design system was implemented, based on the software of Cadence. Together with the required RSFQ extensions for the design of digital superconducting circuits was a platform generated, on which the reachable circuit complexity is exclusively limited by the technology parameters of the available fabrication technology: Physical simulations are with PSCAN up to a complexity of more than 1000 circuit elements possible; furthermore VHDL allows the verification of arbitrarily large circuit architectures. In accordance for this the production line at the PTB was brought to a level, which allows in Nb/Al-Al x O y /Nb SIS technology implementation the fabrication of highly integrable RSFQ circuit architectures. The developed and fabricated basic circuits of the pattern generator have proved correct functionality and reliability in the measuring operation. Thereby for the circular RSFQ shift registers a key role as local memories in the construction of the pattern generator is devolved upon. The registers were realized with the aimed bit lengths up to 128 bit and with reachable signal-processing speeds of above 10 GHz. At the interface RSFQ

  13. Electrochemically synthesized nanocrystalline spinel thin film for high performance supercapacitor

    Gupta, Vinay [Carbon Technology Unit, Engineering Materials Division, National Physical Laboratory, New-Delhi, 110012 (India); Art, Science and Technology Center for Cooperative Research, Kyushu University, Kasuga-shi, Fukuoka, 816-8580 (Japan); Japan Science and Technology Agency, Kawaguchi-shi, Saitama, 332-0012 (Japan); Gupta, Shubhra; Miura, Norio [Art, Science and Technology Center for Cooperative Research, Kyushu University, Kasuga-shi, Fukuoka, 816-8580 (Japan)

    2010-06-01

    Spinels are not known for their supercapacitive nature. Here, we have explored electrochemically synthesized nanostructured NiCo{sub 2}O{sub 4} spinel thin-film electrode for electrochemical supercapacitors. The nanostructured NiCo{sub 2}O{sub 4} spinel thin film exhibited a high specific capacitance value of 580 F g{sup -1} and an energy density of 32 Wh kg{sup -1} at the power density of 4 kW kg{sup -1}, accompanying with good cyclic stability. (author)

  14. SEARCH AUTOMATION OF BINARIZATION OPTIMUM LEVEL FOR SYNTHESIZED HOLOGRAMS

    Oleg V. Nikanorov

    2017-11-01

    Full Text Available The paper considers the features of synthesized holograms suitable for practical use. It is established that binary holograms are the first of all suitable ones for successful application in practice. In order to select the most suitable (optimal level of hologram binarization, we propose a criterion for estimating the quality of an image reconstructed with a binary hologram. An algorithm is developed to find the optimal level. On the basis of the conducted experiments it is established that the introduction of the developed module gives the possibility to reduce the search time of the optimal binarization level of the hologram by eleven times in comparison with manual search.

  15. [Characteristics of proteins synthesized by hydrogen-oxidizing microorganisms].

    Volova, T G; Barashkov, V A

    2010-01-01

    The study was conducted to determine the biological value of proteins synthesized by hydrogen-oxidizing microorganisms--the hydrogen bacteria Alcaligenes eutrophus Z1 and Ralstonia eutropha B5786 and the CO-resistant strain of carboxydobacterium Seliberia carboxydohydrogena Z1062. Based on a number of significant parameters characterizing the biological value of a product, the proteins of hydrogen-oxidizing microorganisms have been found to occupy an intermediate position between traditional animal and plant proteins. The high total protein in biomass of these microorganisms, their complete amino acid content, and availability to proteolytic enzymes allow for us to consider these microorganisms as potential protein producers.

  16. Proposal of an Algorithm to Synthesize Music Suitable for Dance

    Morioka, Hirofumi; Nakatani, Mie; Nishida, Shogo

    This paper proposes an algorithm for synthesizing music suitable for emotions in moving pictures. Our goal is to support multi-media content creation; web page design, animation films and so on. Here we adopt a human dance as a moving picture to examine the availability of our method. Because we think the dance image has high affinity with music. This algorithm is composed of three modules. The first is the module for computing emotions from an input dance image, the second is for computing emotions from music in the database and the last is for selecting music suitable for input dance via an interface of emotion.

  17. Concrete Embedded Dye-Synthesized Photovoltaic Solar Cell

    Hosseini, T.; Flores-Vivian, I.; Sobolev, K.; Kouklin, N.

    2013-01-01

    This work presents the concept of a monolithic concrete-integrated dye-synthesized photovoltaic solar cell for optical-to-electrical energy conversion and on-site power generation. The transport measurements carried out in the dark revealed the presence of VOC of ~190?mV and ISC of ~9??A, induced by the electrochemical conversion of concrete-supplied ionic impurities at the electrodes. The current-voltage measurements performed under illumination at incident optical powers of ~46?mW confirmed...

  18. Moraxella catarrhalis Synthesizes an Autotransporter That Is an Acid Phosphatase▿

    Hoopman, Todd C.; Wang, Wei; Brautigam, Chad A.; Sedillo, Jennifer L.; Reilly, Thomas J.; Hansen, Eric J.

    2007-01-01

    Moraxella catarrhalis O35E was shown to synthesize a 105-kDa protein that has similarity to both acid phosphatases and autotransporters. The N-terminal portion of the M. catarrhalis acid phosphatase A (MapA) was most similar (the BLAST probability score was 10−10) to bacterial class A nonspecific acid phosphatases. The central region of the MapA protein had similarity to passenger domains of other autotransporter proteins, whereas the C-terminal portion of MapA resembled the translocation dom...

  19. Enantioselctive Syntheses of Sulfur Analogues of Flavan-3-Ols

    Richard Lombardy

    2010-08-01

    Full Text Available The first enantioselective syntheses of sulfur flavan-3-ol analogues 1–8 have been accomplished, whereby the oxygen atom of the pyran ring has been replaced by a sulfur atom. The key steps were: (a Pd(0 catalyzed introduction of –S t-butyl group, (b Sharpless enantioselective dihydroxylation of the alkene, (c acid catalyzed ring closure to produce the thiopyran ring, and (d removal of benzyl groups using N,N-dimethylaniline and AlCl3. The compounds were isolated in high chemical and optical purity.

  20. A facile route to synthesize nanogels doped with silver nanoparticles

    Coll Ferrer, M. Carme; Ferrier, Robert C.; Eckmann, David M.; Composto, Russell J.

    2013-01-01

    In this study, we describe a simple method to prepare hybrid nanogels consisting of a biocompatible core-shell polymer host containing silver nanoparticles. First, the nanogels (NG, 160 nm) containing a lysozyme rich core and a dextran rich shell, are prepared via Maillard and heat-gelation reactions. Second, silver nanoparticles (Ag NPs, 5 nm) are synthesized "in situ" in the NG solution without requiring additional reducing agents. This approach leads to stable Ag NPs located in the NG. Furthermore, we demonstrate that the amount of Ag NPs in the NG can be tuned by varying silver precursor concentration. Hybrid nanogels with silver nanoparticles have potential in antimicrobial, optical, and therapeutic applications.

  1. Light- induced electron transfer and ATP synthesis in a carotene synthesizing insect

    Valmalette, Jean Christophe; Dombrovsky, Aviv; Brat, Pierre; Mertz, Christian; Capovilla, Maria; Robichon, Alain

    2012-08-01

    A singular adaptive phenotype of a parthenogenetic insect species (Acyrthosiphon pisum) was selected in cold conditions and is characterized by a remarkable apparition of a greenish colour. The aphid pigments involve carotenoid genes well defined in chloroplasts and cyanobacteria and amazingly present in the aphid genome, likely by lateral transfer during evolution. The abundant carotenoid synthesis in aphids suggests strongly that a major and unknown physiological role is related to these compounds beyond their canonical anti-oxidant properties. We report here that the capture of light energy in living aphids results in the photo induced electron transfer from excited chromophores to acceptor molecules. The redox potentials of molecules involved in this process would be compatible with the reduction of the NAD+ coenzyme. This appears as an archaic photosynthetic system consisting of photo-emitted electrons that are in fine funnelled into the mitochondrial reducing power in order to synthesize ATP molecules.

  2. Laminin, a noncollagenous component of epithelial basement membranes synthesized by a rat yolk sac tumor

    Wewer, U; Albrechtsen, R; Ruoslahti, E

    1981-01-01

    Laminin, a glycoprotein antigenically similar or identical to a component of epithelial basement membranes, was identified as a major component of the abundant extracellular matrix synthesized by an experimentally induced rat yolk sac tumor. Immunocytochemical staining revealed laminin in cultured...... polypeptides with molecular weights of approximately 200,000 and 400,000. These comigrated with the polypeptides of mouse laminin isolated previously. The yolk sac tumor tissue grown in vivo contained laminin in the tumor cells and in the extracellular material as evidenced by immunofluorescence...... membranes in rat tissues in a manner indistinguishable from antilaminin. The presence of laminin in rat yolk sac cells, the presumed origin of our yolk sac tumor, was studied in some detail. Laminin was found to be present in normal cells of the visceral as well as the parietal yolk sac layer...

  3. Morphologic and structural characterization of the CoFe2O4 synthesized by combustion reaction

    Lima, M.S.; Sousa, J.-P.L.M.L.; Vieira, D.A.; Lira, H.L.; Costa, A.C.F.M.; Sasaki, J.M.

    2009-01-01

    CoFe 2 O 4 powders were synthesized by combustion reaction using glycine as fuel, aiming obtaining nanosized and monophase powders. Thus, different conditions of external heating during the synthesis were investigated. The powders were prepared according to the propellants and explosives theory, using glycine as fuel in the stoichiometric proportion (Φe = 1). During the synthesis the flame temperature and time were measured. The resulting powders were characterized by X-rays diffraction and scanning electronic microscopy (SEM). The results show that the condition in which the synthesis was realized it influences in the combustion flame temperature and time and contributes for the obtainment of powders with majority phase without secondary phases. Crystallite size varied of 33 to 50 nm. All powders presented morphology constituted by soft agglomerated formed by nanoparticles. (author). (author)

  4. Study of photocatalytic activities of Bi2WO6 nanoparticles synthesized by fast microwave-assisted method

    Phu, Nguyen Dang; Hoang, Luc Huy; Chen, Xiang-Bai; Kong, Meng-Hong; Wen, Hua-Chiang; Chou, Wu Ching

    2015-01-01

    We present a study of photocatalytic activities of Bi 2 WO 6 nanoparticles synthesized by fast microwave-assisted method. The photocatalytic activities of the nanoparticles were evaluated by the decolorization of methylene-blue under visible-light-irradiation. Our results show that the surface area of Bi 2 WO 6 nanoparticles plays a major role for improving photocatalytic activity, while visible-light absorption has only a weak effect on photocatalytic activity. This suggests efficient transportation of photo-generated electrons and holes to the oxidation active sites on the surface of nanoparticles, indicating Bi 2 WO 6 nanoparticles synthesized by fast microwave-assisted method are promising for achieving high photocatalytic activity under visible-light-irradiation. - Highlights: • The Bi 2 WO 6 nanoparticles were synthesized via fast microwave-assisted method. • The obtained Bi 2 WO 6 nanoparticles exhibited visible-light absorbance. • The surface area of Bi 2 WO 6 nanoparticles plays major role for improving photocatalytic activity. • The Bi 2 WO 6 nanoparticles are promising for achieving high photocatalytic activity under visible-light-irradiation

  5. Adsorptive removal of bisphenol A using synthesized magnetite nanoparticles

    Orimolade, B. O.; Adekola, F. A.; Adebayo, G. B.

    2018-03-01

    Bisphenol A (BPA) is an organic compound which is often used as plasticizer and has been reported to be hazardous to man. In this research the efficiency of removal of BPA from water by magnetite through adsorption process was studied. The magnetite was synthesized using reverse co-precipitation method and fully characterized. Various physicochemical parameters affecting the adsorption of BPA using magnetite were studied as well. The optimum time for the adsorption process was found to be 60 min at pH of 6, adsorbent dose of 0.2 g and 50 ppm of BPA. The adsorption data were fitted by the Langmuir adsorption isotherm best with a regression value of 0.957. The R L value was 0.179 which revealed that the process is favorable. The Freundlich constant n which was 1.901 also revealed that the adsorption is normal and favorable. The data were in agreement with the pseudo-second-order kinetics with regression value of 0.98. From the thermodynamic studies, the process was found to be exothermic and the Gibb's free energy value which was negative showed that the adsorption was spontaneous. The synthesized magnetite therefore offers great potential for the remediation of bisphenol A-contaminated media.

  6. Characterization of hematite nanoparticles synthesized via two different pathways

    Das, Soumya; Hendry, M. Jim

    2014-08-01

    Hematite is one of the most common and thermodynamically stable iron oxides found in both natural and anthropogenic systems. Owing to its ubiquity, stability, moderate specific surface area, and ability to sequester metals and metalloids from aquatic systems, it has been the subject of a large number of adsorption studies published during the past few decades. Although preparation techniques are known to affect the surface morphology of hematite nanoparticles, the effects of aging under environmentally relevant conditions have yet to be tested with respect to surface morphology, surface area, and adsorptive capacity. We prepared hematite via two different pathways and aged it under highly alkaline conditions encountered in many mill tailings settings. Crystal habits and morphologies of the hematite nanoparticles were analyzed via scanning electron microscopy and transmission electron microscopy. X-ray diffraction, Raman spectroscopy, and Brunauer-Emmett-Teller surface area analyses were also conducted on the hematite nanoparticles before and after aging. The hematite synthesized via an Fe(III) salt solution (average particle size 37 nm) was morphologically and structurally different from the hematite synthesized via ferrihydrite aging (average particle size 144 nm). Overall, our data demonstrate that the crystallinity of hematite produced via ferrihydrite transformation is susceptible to morphological alterations/modifications. In contrast, the hematite formed via hydrolysis of an Fe(III) salt solution remains very stable in terms of structure, size, and morphology even under extreme experimental conditions.

  7. A simple route to synthesize manganese germanate nanorods

    Pei, L.Z.; Yang, Y.; Yuan, C.Z.; Duan Taike; Zhang Qianfeng

    2011-01-01

    Manganese germanate nanorods have been synthesized by a simple route using germanium dioxide and manganese acetate as the source materials. X-ray diffraction observation shows that the nanorods are composed of orthorhombic and monoclinic manganese germanate phases. Scanning electron microscopy and transmission electron microscopy observations display that the manganese germanate nanorods have flat tips with the length of longer than 10 micrometers and diameter of 60-350 nm, respectively. The role of the growth conditions on the formation of the manganese germanate nanorods shows that the proper selection and combination of the growth conditions are the key factor for controlling the formation of the manganese germanate nanorods. The photoluminescence spectrum of the manganese germanate nanorods exhibits four fluorescence emission peaks centered at 422 nm, 472 nm, 487 nm and 530 nm showing the application potential for the optical devices. - Research Highlights: → Manganese germanate nanorods have been synthesized by simple hydrothermal process. → The formation of manganese germanate nanorods can be controlled by growth conditions. → Manganese germanate nanorods exhibit good PL emission ability for optical device.

  8. Synthesizing Iron Oxide Nanostructures: The Polyethylenenemine (PEI) Role

    Mozo, Sergio Lentijo

    2017-01-12

    Controlled synthesis of anisotropic iron oxide nanoparticles is a challenge in the field of nanomaterial research that requires an extreme attention to detail. In particular, following up a previous work showcasing the synthesis of magnetite nanorods (NRs) using a two-step approach that made use of polyethylenenemine (PEI) as a capping ligand to synthesize intermediate β-FeOOH NRs, we studied the effect and influence of the capping ligand on the formation of β-FeOOH NRs. By comparing the results reported in the literature with those we obtained from syntheses performed (1) in the absence of PEI or (2) by using PEIs with different molecular weight, we showed how the choice of different PEIs determines the aspect ratio and the structural stability of the β-FeOOH NRs and how this affects the final products. For this purpose, a combination of XRD, HRTEM, and direct current superconducting quantum interference device (DC SQUID) magnetometry was used to identify the phases formed in the final products and study their morphostructural features and related magnetic behavior.

  9. Mechanochemically synthesized Al2O3-TiC nanocomposite

    Mohammad Sharifi, E.; Karimzadeh, F.; Enayati, M.H.

    2010-01-01

    Al 2 O 3 -TiC nanocomposite was synthesized by ball milling of aluminum, titanium oxide and graphite powder mixtures. Effect of the milling time and heat treatment temperatures were investigated. The structural evolution of powder particles after different milling times was studied by X-ray diffractometry and scanning electron microscopy. The results showed that after 40 h of ball milling the Al/TiO 2 /C reacted with a self-propagating combustion mode producing Al 2 O 3 -TiC nanocomposite. In final stage of milling, alumina and titanium carbide crystallite sizes were less than 10 nm. After annealing at 900 o C for 1 h, Al 2 O 3 and TiC crystallite sizes remained constant, however increasing annealing temperature to 1200 o C increased Al 2 O 3 and TiC crystallite size to 65 and 30 nm, respectively. No phase change was observed after annealing of the synthesized Al 2 O 3 -TiC powder.

  10. Fast synthesize ZnO quantum dots via ultrasonic method.

    Yang, Weimin; Zhang, Bing; Ding, Nan; Ding, Wenhao; Wang, Lixi; Yu, Mingxun; Zhang, Qitu

    2016-05-01

    Green emission ZnO quantum dots were synthesized by an ultrasonic sol-gel method. The ZnO quantum dots were synthesized in various ultrasonic temperature and time. Photoluminescence properties of these ZnO quantum dots were measured. Time-resolved photoluminescence decay spectra were also taken to discover the change of defects amount during the reaction. Both ultrasonic temperature and time could affect the type and amount of defects in ZnO quantum dots. Total defects of ZnO quantum dots decreased with the increasing of ultrasonic temperature and time. The dangling bonds defects disappeared faster than the optical defects. Types of optical defects first changed from oxygen interstitial defects to oxygen vacancy and zinc interstitial defects. Then transformed back to oxygen interstitial defects again. The sizes of ZnO quantum dots would be controlled by both ultrasonic temperature and time as well. That is, with the increasing of ultrasonic temperature and time, the sizes of ZnO quantum dots first decreased then increased. Moreover, concentrated raw materials solution brought larger sizes and more optical defects of ZnO quantum dots. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Evolutionary selection of enzymatically synthesized semiconductors from biomimetic mineralization vesicles.

    Bawazer, Lukmaan A; Izumi, Michi; Kolodin, Dmitriy; Neilson, James R; Schwenzer, Birgit; Morse, Daniel E

    2012-06-26

    The way nature evolves and sculpts materials using proteins inspires new approaches to materials engineering but is still not completely understood. Here, we present a cell-free synthetic biological platform to advance studies of biologically synthesized solid-state materials. This platform is capable of simultaneously exerting many of the hierarchical levels of control found in natural biomineralization, including genetic, chemical, spatial, structural, and morphological control, while supporting the evolutionary selection of new mineralizing proteins and the corresponding genetically encoded materials that they produce. DNA-directed protein expression and enzymatic mineralization occur on polystyrene microbeads in water-in-oil emulsions, yielding synthetic surrogates of biomineralizing cells that are then screened by flow sorting, with light-scattering signals used to sort the resulting mineralized composites differentially. We demonstrate the utility of this platform by evolutionarily selecting newly identified silicateins, biomineralizing enzymes previously identified from the silica skeleton of a marine sponge, for enzyme variants capable of synthesizing silicon dioxide (silica) or titanium dioxide (titania) composites. Mineral composites of intermediate strength are preferentially selected to remain intact for identification during cell sorting, and then to collapse postsorting to expose the encoding genes for enzymatic DNA amplification. Some of the newly selected silicatein variants catalyze the formation of crystalline silicates, whereas the parent silicateins lack this ability. The demonstrated bioengineered route to previously undescribed materials introduces in vitro enzyme selection as a viable strategy for mimicking genetic evolution of materials as it occurs in nature.

  12. Alternative methods of synthesizing 99Tcm-labelled ciprofloxacin

    Kumar, V.; Choong, K.K.L.; Evans, S.; Olma, T.R.

    1999-01-01

    Full text: 99 Tc m -labelled ciprofloxacin (Infecton) is a new class of radiopharmaceutical designed for imaging live bacterial infection. We synthesized Infecton by modifying the procedure described by Keith Britton's group (Lancet 1996; 347: 233-235) and reported our findings at the ANZSNM meeting last year. Since the methodology was cumbersome, we investigated simpler alternative ways of labelling ciprofloxacin with 99 Tc m -pertechnetate for routine imaging. There were several limitations in the previously described method: (1) Need to prepare pure ciprofloxacin which was unstable on storage. (2) Synthetic procedure using formimidine sulphinic acid (FSA) was complicated and required boiling step. (3) The radiochemical purity (RCP) of the product was low (45-50%) requiring purification. (4) Biodistribution studies showed a marked uptake by the liver which could interfere with scan interpretation in this region. The results of our present studies showed that Infecton could be prepared by a simple two-step method: (1) Reduce 99 Tc m -pertechnetate with stannous salt (SnCl 2 or Sn-tartrate). (2) Mix with Ciproxin IV-100. The RCP of the product was up to 98%, which obviates the need for further purification. Infecton synthesized by the above method showed avid localization in abscesses induced with Staphylococcus aureus in rats. The biodistribution studies showed that Infecton was renally excreted with minimal accumulation in the liver or other organs

  13. Dynamic balancing of mechanisms and synthesizing of parallel robots

    Wei, Bin

    2016-01-01

    This book covers the state-of-the-art technologies in dynamic balancing of mechanisms with minimum increase of mass and inertia. The synthesis of parallel robots based on the Decomposition and Integration concept is also covered in detail. The latest advances are described, including different balancing principles, design of reactionless mechanisms with minimum increase of mass and inertia, and synthesizing parallel robots. This is an ideal book for mechanical engineering students and researchers who are interested in the dynamic balancing of mechanisms and synthesizing of parallel robots. This book also: ·       Broadens reader understanding of the synthesis of parallel robots based on the Decomposition and Integration concept ·       Reinforces basic principles with detailed coverage of different balancing principles, including input torque balancing mechanisms ·       Reviews exhaustively the key recent research into the design of reactionless mechanisms with minimum increase of mass a...

  14. Two step continuous method to synthesize colloidal spheroid gold nanorods.

    Chandra, S; Doran, J; McCormack, S J

    2015-12-01

    This research investigated a two-step continuous process to synthesize colloidal suspension of spheroid gold nanorods. In the first step; gold precursor was reduced to seed-like particles in the presence of polyvinylpyrrolidone and ascorbic acid. In continuous second step; silver nitrate and alkaline sodium hydroxide produced various shape and size Au nanoparticles. The shape was manipulated through weight ratio of ascorbic acid to silver nitrate by varying silver nitrate concentration. The specific weight ratio of 1.35-1.75 grew spheroid gold nanorods of aspect ratio ∼1.85 to ∼2.2. Lower weight ratio of 0.5-1.1 formed spherical nanoparticle. The alkaline medium increased the yield of gold nanorods and reduced reaction time at room temperature. The synthesized gold nanorods retained their shape and size in ethanol. The surface plasmon resonance was red shifted by ∼5 nm due to higher refractive index of ethanol than water. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Stenting of major airway constriction

    Wu Xiaomei

    2002-01-01

    Objective: To investigate the correlated issues in the stenting treatment of major airway constriction. Methods: Nineteen cases of major airway stenting procedure were studied retrospectively. The clinical choice of stents of different advantages or deficiencies were discussed. The importance of intravenous anesthesia supporting, life-parameters monitoring during the procedures and the prevention of complications were analysed. Results: Under intravenous and local anesthesia, 19 Wallstents had been successively placed and relieved 19 cases of major airway constrictions due to malignant or benign diseases (15 of tumors, 3 of tuberculosis, 1 of tracheomalacia). Intravenous anesthesia and life-parameters monitoring had made the procedures more safe and precise. Conclusions: Major airway stenting is an reliable method for relieving tracheobronchial stenosis; and intravenous anesthesia supporting and life-parameters monitoring guarantee the satisfactions of procedures

  16. Major hazards onshore and offshore

    1992-01-01

    This symposium continues the tradition of bringing together papers on a topic of current interest and importance in terms of process safety - in this case, Major Hazards Onshore and Offshore. Lord Cullen in his report on the Piper Alpha disaster has, in effect, suggested that the experience gained in the control of major hazards onshore during the 1980s should be applied to improve safety offshore during the 1990s. This major three-day symposium reviews what has been learned so far with regard to major hazards and considers its present and future applications both onshore and offshore. The topics covered in the programme are wide ranging and deal with all aspects of legislation, the application of regulations, techniques for evaluating hazards and prescribing safety measures in design, construction and operation, the importance of the human factors, and recent technical developments in protective measures, relief venting and predicting the consequences of fires and explosions. (author)

  17. Acaricidal, pediculicidal and larvicidal activity of synthesized ZnO nanoparticles using Momordica charantia leaf extract against blood feeding parasites.

    Gandhi, P Rajiv; Jayaseelan, C; Mary, R Regina; Mathivanan, D; Suseem, S R

    2017-10-01

    The aim of the present study was to evaluate the acaricidal, pediculicidal and larvicidal effect of synthesized zinc oxide nanoparticles (ZnO NPs) using Momordica charantia leaf extract against the larvae of Rhipicephalus (Boophilus) microplus, adult of Pediculus humanus capitis, and the larvae of Anopheles stephensi, Culex quinquefasciatus. The ZnO NPs were characterized by using UV, XRD, FTIR and SEM-EDX. The SEM image confirms that the synthesized nanoparticles were spherical in shape with a size of 21.32 nm. The results of GC-MS analysis indicates the presence of the major compound of Nonacosane (C 29 H 60 ) in the M. charantia leaf extract. Cattle tick, head lice and mosquito larvae were exposed to a varying concentrations of the synthesized ZnO NPs and M. charantia leaf extract for 24 h. Compared to the leaf aqueous extract, biosynthesized ZnO NPs showed higher toxicity against R. microplus, P. humanus capitis, An. stephensi, and Cx. Quinquefasciatus with the LC 50 values of 6.87, 14.38, 5.42, and 4.87 mg/L, respectively. The findings revealed that synthesized ZnO NPs possess excellent anti-parasitic activity. These results suggest that the green synthesized ZnO NPs has the potential to be used as an ideal ecofriendly approach for the control of R. microplus, P. humanus capitis and the mosquito larvae of An. Stephensi and Cx. quinquefasciatus. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Liquid in the major incision

    Herrera Jaramillo, Diego Alberto; Ortega Jaramillo, Hector

    2003-01-01

    We present the case of a patient with spill pleural extending in the left major incision. In the chest thorax PA, we could observe one of the complex radiographic appearances that take the reconfiguration of fluid in this localization, being this appearance dependent of the patient's position. Some points are also discussed on the anatomy of the major incisions and some of their radiographic characteristics

  19. Water linked 3D coordination polymers: Syntheses, structures and applications

    Singh, Suryabhan, E-mail: sbs.bhu@gmail.com; Bhim, Anupam

    2016-12-15

    Three new coordination polymers (CPs) based on Cd and Pb, [Cd(OBA)(μ-H{sub 2}O)(H{sub 2}O)]{sub n}1, [Pb(OBA)(μ-H{sub 2}O)]{sub n}2 [where OBA=4,4’-Oxybis(benzoate)] and [Pb(SDBA)(H{sub 2}O)]{sub n}.1/4DMF 3 (SDBA=4,4’-Sulfonyldibenzoate), have been synthesized and characterized. The single crystal structural studies reveal that CPs 1 and 2 have three dimensional structure. A water molecule bridges two metal centres which appears to the responsible for the dimensionality increase from 2D to 3D. Compound 3 has a supramolecular 3D structure involving water molecule and hydrogen bonds. A structural transformation is observed when 3 was heated at 100 °C or kept in methanol, forming [Pb(SDBA)]{sub n}4. Compound 4 is used as supporting matrix for palladium nanoparticles, PdNPs@4. The PdNPs@4 exhibits good catalytic activity toward the reduction of 4-nitrophenol (4-NP) to 4-aminophenol (4-AP) in the presence of NaBH{sub 4} at room temperature. Luminescence studies revealed that all CPs could be an effective sensor for nitroaromatic explosives. - Graphical abstract: Three new CPs based on Cd and Pb, have been synthesized and characterized. A water molecule bridges two metal centres which appears to the responsible for the dimensionality increase from 2D to 3D. One of the CP is used as supporting matrix for palladium nanoparticles, PdNPs@4. The PdNPs@4 exhibits good catalytic activity toward the reduction of 4-nitrophenol. Luminescence studies shown that all CPs could be an effective sensor for nitroaromatic explosives. - Highlights: • Three new CPs based on Cd and Pb, have been synthesized and characterized. • A water molecule bridges two metal centres which appears to the responsible for the dimensionality increase from 2D to 3D. • One of the CP is used as supporting matrix for palladium nanoparticles, PdNPs@4. • Luminescence studies shown that all CPs could be an effective sensor for nitroaromatic explosives.

  20. A green chemistry approach for synthesizing biocompatible gold nanoparticles

    Gurunathan, Sangiliyandi; Han, JaeWoong; Park, Jung Hyun; Kim, Jin-Hoi

    2014-05-01

    Gold nanoparticles (AuNPs) are a fascinating class of nanomaterial that can be used for a wide range of biomedical applications, including bio-imaging, lateral flow assays, environmental detection and purification, data storage, drug delivery, biomarkers, catalysis, chemical sensors, and DNA detection. Biological synthesis of nanoparticles appears to be simple, cost-effective, non-toxic, and easy to use for controlling size, shape, and stability, which is unlike the chemically synthesized nanoparticles. The aim of this study was to synthesize homogeneous AuNPs using pharmaceutically important Ganoderma spp . We developed a simple, non-toxic, and green method for water-soluble AuNP synthesis by treating gold (III) chloride trihydrate (HAuCl4) with a hot aqueous extract of the Ganoderma spp . mycelia. The formation of biologically synthesized AuNPs (bio-AuNPs) was characterized by ultraviolet (UV)-visible absorption spectroscopy, X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), energy dispersive X-ray (EDX), dynamic light scattering (DLS), and transmission electron microscopy (TEM). Furthermore, the biocompatibility of as-prepared AuNPs was evaluated using a series of assays, such as cell viability, lactate dehydrogenase leakage, and reactive oxygen species generation (ROS) in human breast cancer cells (MDA-MB-231). The color change of the solution from yellow to reddish pink and strong surface plasmon resonance were observed at 520 nm using UV-visible spectroscopy, and that indicated the formation of AuNPs. DLS analysis revealed the size distribution of AuNPs in liquid solution, and the average size of AuNPs was 20 nm. The size and morphology of AuNPs were investigated using TEM. The biocompatibility effect of as-prepared AuNPs was investigated in MDA-MB-231 breast cancer cells by using various concentrations of AuNPs (10 to 100 μM) for 24 h. Our findings suggest that AuNPs are non-cytotoxic and biocompatible. To the best of our knowledge

  1. General Syntheses of Nanotubes Induced by Block Copolymer Self-Assembly

    Zhao, Jianming; Huang, Wei; Si, Pengchao

    2018-01-01

    Amphiphilic block copolymer templating strategies are extensively used for syntheses of mesoporous materials. However, monodisperse tubular nanostructures are limited. Here, a general method is developed to synthesize monodisperse nanotubes with narrow diameter distribution induced by self...

  2. Syntheses of crosslinked latex nanoparticles using differential microemulsion polymerization

    Hassmoro, N. F.; Rusop, M.; Abdullah, S.

    2013-06-01

    The differential microemulsion polymerization was used to synthesize latex nanoparticles. In this paper, 1, 3-butylene glycol dimethacrylate (1, 3-BGDMA) was used as a crosslinker respectively 1-5 weight% of monomer total. Butyl acrylate (BA), butyl methacrylate (BMA), and methacrylic acid (MAA) was used as the monomer. The thin film of latex nanoparticles were prepared by using spin coating method and have been dried at 100°C for 5 minutes. The amount of the crosslinker added in the polymerization was optimized and we found that the particle sizes fall in the range of 30-60 nm. The structural morphology of the uncrosslinked latex represented the most homogeneous image compared to the crosslinked latex. The effect of the amount of crosslinker on the particle sizes investigated by the Zeta-sizer Nano series while Atomic Force microscopy (AFM) was used to study the structural properties of latex nanoparticles.

  3. Syntheses of crosslinked latex nanoparticles using differential microemulsion polymerization

    Hassmoro, N F; Abdullah, S; Rusop, M

    2013-01-01

    The differential microemulsion polymerization was used to synthesize latex nanoparticles. In this paper, 1, 3-butylene glycol dimethacrylate (1, 3-BGDMA) was used as a crosslinker respectively 1–5 weight% of monomer total. Butyl acrylate (BA), butyl methacrylate (BMA), and methacrylic acid (MAA) was used as the monomer. The thin film of latex nanoparticles were prepared by using spin coating method and have been dried at 100°C for 5 minutes. The amount of the crosslinker added in the polymerization was optimized and we found that the particle sizes fall in the range of 30–60 nm. The structural morphology of the uncrosslinked latex represented the most homogeneous image compared to the crosslinked latex. The effect of the amount of crosslinker on the particle sizes investigated by the Zeta-sizer Nano series while Atomic Force microscopy (AFM) was used to study the structural properties of latex nanoparticles.

  4. Kinetic aspects of the syntheses using short-lived radionuclides

    Laangstroem, B.; Obenius, U.; Sjoeberg, S.; Bergson, G.

    1981-01-01

    In syntheses using short-lived radionuclides, such as 11 C, the reaction conditions are usually such that the concentrations of the reactants, except for the labelled reactant, can be considered constant during the reaction. Two kinetic models have been investigated - irreversible and reversible bimolecular elementary reactions. The influence of the rate constants, of the equilibrium constants, and of the ratio between the starting reactants on the yield of the labelled product has been studied. The results show that, even in cases with unfavourable equilibrium constants, high yields of the labelled products can be obtained if the rate constant for the forward reaction is large. In addition, the specific activity of the labelled product as a function of time has been studied for the irreversible bimolecular case. (author)

  5. Meta-analysis in plant pathology: synthesizing research results.

    Rosenberg, M S; Garrett, K A; Su, Z; Bowden, R L

    2004-09-01

    ABSTRACT Meta-analysis is a set of statistical procedures for synthesizing research results from a number of different studies. An estimate of a statistical effect, such as the difference in disease severity for plants with or without a management treatment, is collected from each study along with a measure of the variance of the estimate of the effect. Combining results from different studies will generally result in increased statistical power so that it is easier to detect small effects. Combining results from different studies may also make it possible to compare the size of the effect as a function of other predictor variables such as geographic region or pathogen species. We present a review of the basic methodology for meta-analysis. We also present an example of meta-analysis of the relationship between disease severity and yield loss for foliar wheat diseases, based on data collected from a decade of fungicide and nematicide test results.

  6. Planning chemical syntheses with deep neural networks and symbolic AI

    Segler, Marwin H. S.; Preuss, Mike; Waller, Mark P.

    2018-03-01

    To plan the syntheses of small organic molecules, chemists use retrosynthesis, a problem-solving technique in which target molecules are recursively transformed into increasingly simpler precursors. Computer-aided retrosynthesis would be a valuable tool but at present it is slow and provides results of unsatisfactory quality. Here we use Monte Carlo tree search and symbolic artificial intelligence (AI) to discover retrosynthetic routes. We combined Monte Carlo tree search with an expansion policy network that guides the search, and a filter network to pre-select the most promising retrosynthetic steps. These deep neural networks were trained on essentially all reactions ever published in organic chemistry. Our system solves for almost twice as many molecules, thirty times faster than the traditional computer-aided search method, which is based on extracted rules and hand-designed heuristics. In a double-blind AB test, chemists on average considered our computer-generated routes to be equivalent to reported literature routes.

  7. Syntheses and characterization of liposome-incorporated adamantyl aminoguanidines.

    Šekutor, Marina; Štimac, Adela; Mlinarić-Majerski, Kata; Frkanec, Ruža

    2014-08-21

    A series of mono and bis-aminoguanidinium adamantane derivatives has been synthesized and incorporated into liposomes. They combine two biomedically significant molecules, the adamantane moiety and the guanidinium group. The adamantane moiety possesses the membrane compatible features while the cationic guanidinium subunit was recognized as a favourable structural feature for binding to complementary molecules comprising phosphate groups. The liposome formulations of adamantyl aminoguanidines were characterized and it was shown that the entrapment efficiency of the examined compounds is significant. In addition, it was demonstrated that liposomes with incorporated adamantyl aminoguanidines effectively recognized the complementary liposomes via the phosphate group. These results indicate that adamantane derivatives bearing guanidinium groups might be versatile tools for biomedical application, from studies of molecular recognition processes to usage in drug formulation and cell targeting.

  8. Concrete embedded dye-synthesized photovoltaic solar cell.

    Hosseini, T; Flores-Vivian, I; Sobolev, K; Kouklin, N

    2013-09-25

    This work presents the concept of a monolithic concrete-integrated dye-synthesized photovoltaic solar cell for optical-to-electrical energy conversion and on-site power generation. The transport measurements carried out in the dark revealed the presence of VOC of ~190 mV and ISC of ~9 μA, induced by the electrochemical conversion of concrete-supplied ionic impurities at the electrodes. The current-voltage measurements performed under illumination at incident optical powers of ~46 mW confirmed the generation of electrical power of ~0.64 μW with almost half generated via battery effect. This work presents a first step towards realizing the additional pathways to low-cost electrical power production in urban environments based on a combined use of organic dyes, nanotitania and concrete technology.

  9. Cytotoxicity and antimicrobial activities of green synthesized silver nanoparticles.

    Lokina, S; Stephen, A; Kaviyarasan, V; Arulvasu, C; Narayanan, V

    2014-04-09

    Bio-inspired silver nanoparticles are synthesized using Malus domestica (apple) extract. Polyphenols present in the apple extract act as a reducing and capping agent to produce the silver nanoparticles. UV-Visible analysis shows the surface plasmon resonance (SPR) absorption at 420 nm. The FTIR analysis was used to identify the functional groups responsible for the bio-reduction of silver ion. The XRD and HRTEM images confirm the formation of silver nanoparticles. The minimal inhibitory concentration (MIC) of silver nanoparticles was recorded against most of the bacteria and fungus. Further, MCF-7 human breast adenocarcinoma cancer cell line was employed to observe the efficacy of cancer cell killing. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  10. Method for synthesizing metal bis(borano) hypophosphite complexes

    Cordaro, Joseph G.

    2013-06-18

    The present invention describes the synthesis of a family of metal bis(borano) hypophosphite complexes. One procedure described in detail is the syntheses of complexes beginning from phosphorus trichloride and sodium borohydride. Temperature, solvent, concentration, and atmosphere are all critical to ensure product formation. In the case of sodium bis(borano) hypophosphite, hydrogen gas was evolved upon heating at temperatures above 150.degree. C. Included in this family of materials are the salts of the alkali metals Li, Na and K, and those of the alkaline earth metals Mg and Ca. Hydrogen storage materials are possible. In particular the lithium salt, Li[PH.sub.2(BH.sub.3).sub.2], theoretically would contain nearly 12 wt % hydrogen. Analytical data for product characterization and thermal properties are given.

  11. Electrochemically synthesized stretchable polypyrrole/fabric electrodes for supercapacitor

    Yue, Binbin; Wang, Caiyun; Ding, Xin; Wallace, Gordon G.

    2013-01-01

    Wearable electronics offer the combined advantages of both electronics and fabrics. Being an indispensable part of these electronics, lightweight, stretchable and wearable power sources are strongly demanded. Here we describe a daily-used cotton fabric coated with polypyrrole as electrode for stretchable supercapacitors. Polypyrrole was synthesized on the Au coated fabric via an electrochemical polymerization process with p-toluenesulfonic acid (p-TS) as dopant from acetonitrile solution. This material was characterized with FESEM, tensile stress, and studied as a supercapacitor electrode in 1.0 M NaCl. This conductive textile electrode can sustain up to 140% strain without electric failure. It delivers a high specific capacitance of 254.9 F g −1 at a scan rate of 10 mV s −1 , and keeps almost unchanged at an applied strain (i.e. 30% and 50%) but with an improved cycling stability

  12. Piezoelectric Materials Synthesized by the Hydrothermal Method and Their Applications

    Takeshi Morita

    2010-12-01

    Full Text Available Synthesis by the hydrothermal method has various advantages, including low reaction temperature, three-dimensional substrate availability, and automatic polarization alignment during the process. In this review, powder synthesis, the fabrication of piezoelectric thin films, and their applications are introduced. A polycrystalline lead zirconate titanate (PZT thin film was applied to a micro ultrasonic motor, and an epitaxial lead titanate (PbTiO3 thin film was estimated as a ferroelectric data storage medium. Ferroelectric and piezoelectric properties were successfully obtained for epitaxial PbTiO3 films. As lead-free piezoelectric powders, KNbO3 and NaNbO3 powders were synthesized by the hydrothermal method and sintered together to form (K,NaNbO3 ceramics, from which reasonable piezoelectric performance was achieved.

  13. A facile route to synthesize nanogels doped with silver nanoparticles

    Coll Ferrer, M. Carme [University of Pennsylvania, Department of Materials Science (United States); Ferrier, Robert C. [University of Pennsylvania, Department of Chemical and Biomolecular Engineering (United States); Eckmann, David M. [University of Pennsylvania, Department of Anesthesiology and Critical Care (United States); Composto, Russell J., E-mail: composto@seas.upenn.edu [University of Pennsylvania, Department of Materials Science (United States)

    2013-01-15

    In this study, we describe a simple method to prepare hybrid nanogels consisting of a biocompatible core-shell polymer host containing silver nanoparticles. First, the nanogels (NG, {approx}160 nm) containing a lysozyme rich core and a dextran rich shell, are prepared via Maillard and heat-gelation reactions. Second, silver nanoparticles (Ag NPs, {approx}5 nm) are synthesized 'in situ' in the NG solution without requiring additional reducing agents. This approach leads to stable Ag NPs located in the NG. Furthermore, we demonstrate that the amount of Ag NPs in the NG can be tuned by varying silver precursor concentration. Hybrid nanogels with silver nanoparticles have potential in antimicrobial, optical, and therapeutic applications.

  14. Using Qualitative Metasummary to Synthesize Qualitative and Quantitative Descriptive Findings

    Sandelowski, Margarete; Barroso, Julie; Voils, Corrine I.

    2008-01-01

    The new imperative in the health disciplines to be more methodologically inclusive has generated a growing interest in mixed research synthesis, or the integration of qualitative and quantitative research findings. Qualitative metasummary is a quantitatively oriented aggregation of qualitative findings originally developed to accommodate the distinctive features of qualitative surveys. Yet these findings are similar in form and mode of production to the descriptive findings researchers often present in addition to the results of bivariate and multivariable analyses. Qualitative metasummary, which includes the extraction, grouping, and formatting of findings, and the calculation of frequency and intensity effect sizes, can be used to produce mixed research syntheses and to conduct a posteriori analyses of the relationship between reports and findings. PMID:17243111

  15. Method for synthesizing pollucite from chabazite and cesium chloride

    Pereira, C.

    1999-01-01

    A method is described for immobilizing waste chlorides salts containing radionuclides and hazardous nuclear material for permanent disposal, and in particular, a method is described for immobilizing waste chloride salts containing cesium, in a synthetic form of pollucite. The method for synthesizing pollucite from chabazite and cesium chloride includes mixing dry, non-aqueous cesium chloride with chabazite and heating the mixture to a temperature greater than the melting temperature of the cesium chloride, or above about 700 C. The method further comprises significantly improving the rate of retention of cesium in ceramic products comprised of a salt-loaded zeolite by adding about 10% chabazite by weight to the salt-loaded zeolite prior to conversion at elevated temperatures and pressures to the ceramic composite. 3 figs

  16. A facile route to synthesize nanogels doped with silver nanoparticles

    Coll Ferrer, M. Carme; Ferrier, Robert C.; Eckmann, David M.; Composto, Russell J.

    2013-01-01

    In this study, we describe a simple method to prepare hybrid nanogels consisting of a biocompatible core–shell polymer host containing silver nanoparticles. First, the nanogels (NG, ∼160 nm) containing a lysozyme rich core and a dextran rich shell, are prepared via Maillard and heat-gelation reactions. Second, silver nanoparticles (Ag NPs, ∼5 nm) are synthesized “in situ” in the NG solution without requiring additional reducing agents. This approach leads to stable Ag NPs located in the NG. Furthermore, we demonstrate that the amount of Ag NPs in the NG can be tuned by varying silver precursor concentration. Hybrid nanogels with silver nanoparticles have potential in antimicrobial, optical, and therapeutic applications.

  17. Major Decisions: Motivations for Selecting a Major, Satisfaction, and Belonging

    Soria, Krista M.; Stebleton, Michael

    2013-01-01

    In this paper, we analyzed the relationship between students' motivations for choosing academic majors and their satisfaction and sense of belonging on campus. Based on a multi-institutional survey of students who attended large, public, research universities in 2009, the results suggest that external extrinsic motivations for selecting a major…

  18. Synthesizing and salvaging NAD: lessons learned from Chlamydomonas reinhardtii.

    Huawen Lin

    2010-09-01

    Full Text Available The essential coenzyme nicotinamide adenine dinucleotide (NAD+ plays important roles in metabolic reactions and cell regulation in all organisms. Bacteria, fungi, plants, and animals use different pathways to synthesize NAD+. Our molecular and genetic data demonstrate that in the unicellular green alga Chlamydomonas NAD+ is synthesized from aspartate (de novo synthesis, as in plants, or nicotinamide, as in mammals (salvage synthesis. The de novo pathway requires five different enzymes: L-aspartate oxidase (ASO, quinolinate synthetase (QS, quinolate phosphoribosyltransferase (QPT, nicotinate/nicotinamide mononucleotide adenylyltransferase (NMNAT, and NAD+ synthetase (NS. Sequence similarity searches, gene isolation and sequencing of mutant loci indicate that mutations in each enzyme result in a nicotinamide-requiring mutant phenotype in the previously isolated nic mutants. We rescued the mutant phenotype by the introduction of BAC DNA (nic2-1 and nic13-1 or plasmids with cloned genes (nic1-1 and nic15-1 into the mutants. NMNAT, which is also in the de novo pathway, and nicotinamide phosphoribosyltransferase (NAMPT constitute the nicotinamide-dependent salvage pathway. A mutation in NAMPT (npt1-1 has no obvious growth defect and is not nicotinamide-dependent. However, double mutant strains with the npt1-1 mutation and any of the nic mutations are inviable. When the de novo pathway is inactive, the salvage pathway is essential to Chlamydomonas for the synthesis of NAD+. A homolog of the human SIRT6-like gene, SRT2, is upregulated in the NS mutant, which shows a longer vegetative life span than wild-type cells. Our results suggest that Chlamydomonas is an excellent model system to study NAD+ metabolism and cell longevity.

  19. cis-Stilbene and (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)benzene as mechanistic probes in the Mn(III)(salen)-catalyzed epoxidation: influence of the oxygen source and the counterion on the diastereoselectivity of the competitive concerted and radical-type oxygen transfer.

    Adam, Waldemar; Roschmann, Konrad J; Saha-Möller, Chantu R; Seebach, Dieter

    2002-05-08

    cis-Stilbene (1) has been epoxidized by a set of diverse oxygen donors [OxD], catalyzed by the Mn(III)(salen)X complexes 3 (X = Cl, PF(6)), to afford a mixture of cis- and trans-epoxides 2. The cis/trans ratios range from 29:71 (extensive isomerization) to 92:8, which depends both on the oxygen source [OxD] and on the counterion X of the catalyst. When (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)-benzene (4) is used as substrate, a mechanistic probe which differentiates between radical and cationic intermediates, no cationic ring-opening products are found in this epoxidation reaction; thus, isomerized epoxide product arises from intermediary radicals. The dependence of the diastereoselectivity on the oxygen source is rationalized in terms of a bifurcation step in the catalytic cycle, in which concerted Lewis-acid-activated oxygen transfer competes with stepwise epoxidation by the established Mn(V)(oxo) species. The experimental counterion effect is attributed to the computationally assessed ligand-dependent reaction profiles and stereoselectivities of the singlet, triplet, and quintet spin states available to the manganese species.

  20. Personality, academic majors and performance

    Vedel, Anna; Thomsen, Dorthe Kirkegaard; Larsen, Lars

    2015-01-01

    Personality–performance research typically uses samples of psychology students without questioning their representativeness. The present article reports two studies challenging this practice. Study 1: group differences in the Big Five personality traits were explored between students (N = 1067......) in different academic majors (medicine, psychology, law, economics, political science, science, and arts/humanities), who were tested immediately after university enrolment. Study 2: six and a half years later the students’ academic records were obtained, and predictive validity of the Big Five personality...... traits and their subordinate facets was examined in the various academic majors in relation to Grade Point Average (GPA). Significant group differences in all Big Five personality traits were found between students in different academic majors. Also, variability in predictive validity of the Big Five...

  1. Major disruption process in tokamak

    Kurita, Gen-ichi; Azumi, Masafumi; Tuda, Takashi; Takizuka, Tomonori; Tsunematsu, Toshihide; Tokuda, Shinji; Itoh, Kimitaka; Takeda, Tatsuoki

    1981-11-01

    The major disruption in a cylindrical tokamak is investigated by using the multi-helicity code, and the destabilization of the 3/2 mode by the mode coupling with the 2/1 mode is confirmed. The evolution of the magnetic field topology caused by the major disruption is studied in detail. The effect of the internal disruption on the 2/1 magnetic island width is also studied. The 2/1 magnetic island is not enhanced by the flattening of the q-profile due to the internal disruption. (author)

  2. Major KEEP Findings, 1971 - 1975.

    Kamehameha Schools, Honolulu, HI. Kamehameha Early Education Project.

    This report lists the 34 major research findings from the Kamehameha Early Education Program (KEEP) for the years 1971-1975. Each finding is accompanied by a listing of KEEP technical reports and working papers which contain information relevant to that finding. Included among areas covered in the findings are: (1) student motivation, (2) teacher…

  3. Dynamic range majority data structures

    Elmasry, Amr Ahmed Abd Elmoneim; He, Meng; Munro, J. Ian

    2011-01-01

    Given a set P of n coloured points on the real line, we study the problem of answering range α-majority (or "heavy hitter") queries on P. More specifically, for a query range Q, we want to return each colour that is assigned to more than an α-fraction of the points contained in Q. We present a ne...

  4. Understanding Business Majors' Learning Styles

    Giordano, James; Rochford, Regina A.

    2005-01-01

    Recently, business education programs have experienced a decline in enrollment and an increase in attrition. To understand these issues and recommend solutions, the learning styles of 503 first-year business majors at an urban community college were examined. The results demonstrated that: (a) 94% of the participants were analytic learners; (b)…

  5. Epidemiology of major depressive disorder

    Stegenga, B.T.

    2011-01-01

    Major depressive disorder (MDD) is a serious health problem and will be the second leading cause of burden of disease worldwide by 2030. To be able to prevent MDD, insight into risk factors for the onset of MDD is of clear importance. On the other hand, if onset of MDD has occurred, one may argue

  6. Rediscovering Major N. Clark Smith.

    Buckner, Reginald T.

    1985-01-01

    Historians of American music education have yet to recognize a Black music educator as important and worthy of observation. This article discusses a candidate--Major Nathaniel Clark Smith, a little-known Black music educator, composer of more than a hundred works, businessman, humanitarian, and teacher of numerous big-name jazz musicians. (RM)

  7. Endocrinopathies in thalassemia major patient

    Lubis, D. A.; Yunir, E. M.

    2018-03-01

    Advanced in chelation therapy and regular blood transfusion have marked improvements in the life expectancy of patients with thalassemia major, however these patients still have to deal with several complications. We report a 19-year-old male, presented with multiple endocrine complication-related thalassemia; hypogonadism, short stature, osteoporosis with history of fracture, and subclinical hypothyroid.

  8. Physics momentum 'stars' draw majors

    Lindström, I

    2003-01-01

    Over the past decade, the number of University of Arizona students declaring physics as their major has doubled, amid a national decline. According to a recent report by the National Task Force on Undergraduate Physics, it is the university's dedication to its undergraduate physics program which draws students in (1 page).

  9. Major Depression Can Be Prevented

    Munoz, Ricardo F.; Beardslee, William R.; Leykin, Yan

    2012-01-01

    The 2009 Institute of Medicine report on prevention of mental, emotional, and behavioral disorders (National Research Council & Institute of Medicine, 2009b) presented evidence that major depression can be prevented. In this article, we highlight the implications of the report for public policy and research. Randomized controlled trials have shown…

  10. Dirichlet polynomials, majorization, and trumping

    Pereira, Rajesh; Plosker, Sarah

    2013-01-01

    Majorization and trumping are two partial orders which have proved useful in quantum information theory. We show some relations between these two partial orders and generalized Dirichlet polynomials, Mellin transforms, and completely monotone functions. These relations are used to prove a succinct generalization of Turgut’s characterization of trumping. (paper)

  11. Managemant of NASA's major projects

    James, L. B.

    1973-01-01

    Approaches used to manage major projects are studied and the existing documents on NASA management are reviewed. The work consists of: (1) the project manager's role, (2) request for proposal, (3) project plan, (4) management information system, (5) project organizational thinking, (6) management disciplines, (7) important decisions, and (8) low cost approach.

  12. Major depression and secondhand smoke exposure.

    Patten, Scott B; Williams, Jeanne V A; Lavorato, Dina H; Woolf, Benjamin; Wang, Jian Li; Bulloch, Andrew G M; Sajobi, Tolulope

    2018-01-01

    Epidemiological studies have consistently linked smoking to poor mental health. Among non-smokers, some studies have also reported associations between secondhand smoke exposure and psychological symptoms. However, an association between secondhand smoke exposure and depressive disorders has not been well established. This analysis used cross-sectional data from a series of 10 population surveys conducted in Canada between 2003 and 2013. The surveys targeted the Canadian household population, included a brief structured interview for past year major depressive episode (MDE) and included items assessing secondhand smoke exposure. We used two-stage individual-level random-effects meta-regression to synthesize results from these surveys. Over the study interval, about 20% of non-smokers reported substantial exposure to secondhand smoke. In this group, the pooled annual prevalence of MDE was 6.1% (95% CI 5.3-6.9) compared to 4.0% (95% CI 3.7-4.3) in non-smokers without secondhand smoke exposure. The crude odds ratio was 1.5 (95% CI 1.4-1.7). With adjustment for a set of potential confounding variables the odds ratio was unchanged, 1.4 (95% CI 1.2 - 1.6). These results provide additional support for public health measures aimed at reducing secondhand smoke exposure. A causal connection between secondhand smoke exposure and MDEs cannot be confirmed due to the cross-sectional nature of the data. Longitudinal studies are needed to establish temporal sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. A synthesized biophysical and social vulnerability assessment for Taiwan

    Lee, Yung-Jaan

    2017-11-01

    Taiwan, located in the Western Pacific, is a country that is one of the most vulnerable to disasters that are associated with the changing climate; it is located within the Ring of Fire, which is the most geologically active region in the world. The environmental and geological conditions in Taiwan are sensitive and vulnerable to such disasters. Owing to increasing urbanization in Taiwan, floods and climate-related disasters have taken an increasing toll on human lives. As global warming accelerates the rising of sea levels and increasing of the frequency of extreme weather events, disasters will continue to affect socioeconomic development and human conditions. Under such circumstances, researchers and policymakers alike must recognize the importance of providing useful knowledge concerning vulnerability, disaster recovery and resilience. Strategies for reducing vulnerability and climate-related disaster risks and for increasing resilience involve preparedness, mitigation and adaptation. In the last two decades, extreme climate events have caused severe flash floods, debris flows, landslides, and other disasters and have had negative effects of many sectors, including agriculture, infrastructure and health. Since climate change is expected to have a continued impact on socio-economic development, this work develops a vulnerability assessment framework that integrates both biophysical and social vulnerability and supports synthesized vulnerability analyses to identify vulnerable areas in Taiwan. Owing to its geographical, geological and climatic features, Taiwan is susceptible to earthquakes, typhoons, droughts and various induced disasters. Therefore, Taiwan has the urgent task of establishing a framework for assessing vulnerability as a planning and policy tool that can be used to identify not only the regions that require special attention but also hotspots in which efforts should be made to reduce vulnerability and the risk of climate-related disaster. To

  14. Total Syntheses of Polycyclic Polyprenylated Acylphloroglucinol Natural Products and Analogs Utilizing Alkylative Dearomatizations and Cationic Cyclizations

    Boyce, Jonathan H.

    Polycyclic polyprenylated acylphloroglucinols (PPAPs) are structurally complex natural products with promising biological activities. These compounds have interesting anticancer and anti-HIV properties as well as other biological activities making them highly attractive synthetic targets. We report a stereodivergent, asymmetric total synthesis of (-)-clusianone in six steps from commercial materials. We have implemented a challenging cationic cyclization forging a bond between two sterically encumbered quaternary carbon atoms. Mechanistic studies point to the unique ability of formic acid to mediate the cyclization forming the clusianone framework. We also present a biosynthesis-inspired, diversity-oriented synthesis approach for rapid construction of PPAP analogs via palladium-catalyzed dearomative conjunctive allylic alkylation (DCAA). These efficient palladium-catalyzed protocols construct the [3.3.1]-bicyclic PPAP core in a single step from their stable aromatic precursors. The first syntheses of 13,14-didehydroxyisogarcinol and garcimultiflorone A stereoisomers are reported in six steps from a commercially available phloroglucinol. Lewis acid-controlled, diastereoselective cationic oxycyclizations enabled asymmetric syntheses of (-)-6-epi-13,14-didehydroxyisogarcinol and (+)-30-epi-13,14-didehydroxyisogarcinol. A similar strategy enabled production of the meso-derived isomers (+/-)-6,30- epi-13,14-didehydroxyisogarcinol and (+/-)-6,30-epi -garcmultiflorone A. A convenient strategy for gram scale synthesis of these stereoisomers was developed utilizing diastereomer separation at a later stage in the synthesis that minimized the number of necessary synthetic operations to access all possible stereoisomers. Finally, we report cationic rearrangements of dearomatized acylphloroglucinols leading to the formation of unprecedented PPAP scaffolds. A novel type A [3.3.1]-bicyclic PPAP was produced as a major product and the structure confirmed by X-ray crystallographic

  15. Sterilization of African Violet in the in Vitro Culture Using Synthesized Silver Nanoparticles by Two Plant Extracts

    M. Solgi

    2015-12-01

    Full Text Available One of the major advantages of in vitro culture of African violet (Saintpaulha ionantha is production of new cultivars and propagation of their chimera which might not be propagated by the other methods. In this study, we tested the effects of silver nanoparticles on the sterilization rate (antifungal and antibacterial activity, regeneration and shoot formation of African violet "Pink Amiss" explants. These nanoparticles were synthesized from pomegranate peels and Damask rose petals extracts. We used a completely randomized design test with factorial arrangement to investigate various volumetric ratios of plant extracts to silver nitrate (1:20, 1:10, 1:5 and 1:1 on the culture contaminations. Using silver nanoparticles synthesized by the plant extracts, especially Damask rose petals extract resulted in no fungal and bacterial contamination in the African violet explants after 1 and 3 weeks as compared to the control, and silver nitrate (1mM. All tested concentrations of the silver nanoparticles significantly (P &le 0.05 controlled both bacterial and fungal contaminations. The 1:20 ratio of plant extracts to silver nitrate showed the best control. In addition, the highest regeneration (%52 and shoot regeneration (%38 was observed in this treatment. In conclusion, we suggest using silver nanoparticles synthesized by plant extracts for sterilization of in Vitro Culture for African Violet rather than using other chemicals such as silver nitrate.

  16. Gene Cloning of Iranian Leishmania major Mannose-1-Phosphate Guanyltransferase

    R Salehi

    2009-07-01

    Full Text Available "nBackground: Leishmania is an obligatory intracellular protozoan parasite, which infects human be­ings when infected sand fly vector takes a blood meal.  Most efforts are towards designing an effective vaccine to prevent leishmaniasis. In this way, development of candidate antigen for vaccine has spe­cial im­portant. In this study, we cloned mannose-1-phosphate guanyltransferase gene of Iranian L .major in pET32a expression vector. "nMethods: Primers based on L. major mannose-1-phosphate guanyltransferase sequence gene was de­signed and synthesized. DNA of Leishmania promastigotes was extracted and PCR reaction was done. PCR product was cloned into pTZ57R and sub cloned into pET32a expression vector. "nResults: Recombinant plasmid containing 1140 bp as L. major mannose-1-phosphate guanyltrans­ferase gene was extracted and confirmed by restriction analysis. PCR product was sequenced and de­posited to GenBank. There were some differences in amino acid sequences between Iranian L. major mannose-1-phosphate guanyltransferase and others previously accepted in GenBank "nConclusion: We amplified and cloned Iranian L. major mannose-1-phosphate guanyltransferase successfully.

  17. Distance majorization and its applications.

    Chi, Eric C; Zhou, Hua; Lange, Kenneth

    2014-08-01

    The problem of minimizing a continuously differentiable convex function over an intersection of closed convex sets is ubiquitous in applied mathematics. It is particularly interesting when it is easy to project onto each separate set, but nontrivial to project onto their intersection. Algorithms based on Newton's method such as the interior point method are viable for small to medium-scale problems. However, modern applications in statistics, engineering, and machine learning are posing problems with potentially tens of thousands of parameters or more. We revisit this convex programming problem and propose an algorithm that scales well with dimensionality. Our proposal is an instance of a sequential unconstrained minimization technique and revolves around three ideas: the majorization-minimization principle, the classical penalty method for constrained optimization, and quasi-Newton acceleration of fixed-point algorithms. The performance of our distance majorization algorithms is illustrated in several applications.

  18. Neurobiology of Major Depressive Disorder

    Rosa Villanueva

    2013-01-01

    Full Text Available We survey studies which relate abnormal neurogenesis to major depressive disorder. Clinically, descriptive gene and protein expression analysis and genetic and functional studies revised here show that individual alterations of a complex signaling network, which includes the hypothalamic-pituitary-adrenal axis; the production of neurotrophins and growth factors; the expression of miRNAs; the production of proinflammatory cytokines; and, even, the abnormal delivery of gastrointestinal signaling peptides, are able to induce major mood alterations. Furthermore, all of these factors modulate neurogenesis in brain regions involved in MDD, and are functionally interconnected in such a fashion that initial alteration in one of them results in abnormalities in the others. We highlight data of potential diagnostic significance and the relevance of this information to develop new therapeutic approaches. Controversial issues, such as whether neurogenesis is the basis of the disease or whether it is a response induced by antidepressant treatments, are also discussed.

  19. Two-Volt Josephson Arbitrary Waveform Synthesizer Using Wilkinson Dividers

    Flowers-Jacobs, Nathan E.; Fox, Anna E.; Dresselhaus, Paul D.; Schwall, Robert E.; Benz, Samuel P.

    2016-01-01

    The root-mean-square (rms) output voltage of the NIST Josephson arbitrary waveform synthesizer (JAWS) has been doubled from 1 V to a record 2 V by combining two new 1 V chips on a cryocooler. This higher voltage will improve calibrations of ac thermal voltage converters and precision voltage measurements that require state-of-the-art quantum accuracy, stability, and signal-to-noise ratio. We achieved this increase in output voltage by using four on-chip Wilkinson dividers and eight inner-outer dc blocks, which enable biasing of eight Josephson junction (JJ) arrays with high-speed inputs from only four high-speed pulse generator channels. This approach halves the number of pulse generator channels required in future JAWS systems. We also implemented on-chip superconducting interconnects between JJ arrays, which reduces systematic errors and enables a new modular chip package. Finally, we demonstrate a new technique for measuring and visualizing the operating current range that reduces the measurement time by almost two orders of magnitude and reveals the relationship between distortion in the output spectrum and output pulse sequence errors. PMID:27453676

  20. Water linked 3D coordination polymers: Syntheses, structures and applications

    Singh, Suryabhan; Bhim, Anupam

    2016-12-01

    Three new coordination polymers (CPs) based on Cd and Pb, [Cd(OBA)(μ-H2O)(H2O)]n1, [Pb(OBA)(μ-H2O)]n2 [where OBA=4,4'-Oxybis(benzoate)] and [Pb(SDBA)(H2O)]n.1/4DMF 3 (SDBA=4,4'-Sulfonyldibenzoate), have been synthesized and characterized. The single crystal structural studies reveal that CPs 1 and 2 have three dimensional structure. A water molecule bridges two metal centres which appears to the responsible for the dimensionality increase from 2D to 3D. Compound 3 has a supramolecular 3D structure involving water molecule and hydrogen bonds. A structural transformation is observed when 3 was heated at 100 °C or kept in methanol, forming [Pb(SDBA)]n4. Compound 4 is used as supporting matrix for palladium nanoparticles, PdNPs@4. The PdNPs@4 exhibits good catalytic activity toward the reduction of 4-nitrophenol (4-NP) to 4-aminophenol (4-AP) in the presence of NaBH4 at room temperature. Luminescence studies revealed that all CPs could be an effective sensor for nitroaromatic explosives.

  1. Oleamide synthesizing activity from rat kidney: identification as cytochrome c.

    Driscoll, William J; Chaturvedi, Shalini; Mueller, Gregory P

    2007-08-03

    Oleamide (cis-9-octadecenamide) is the prototype member of an emerging class of lipid signaling molecules collectively known as the primary fatty acid amides. Current evidence suggests that oleamide participates in the biochemical mechanisms underlying the drive to sleep, thermoregulation, and antinociception. Despite the potential importance of oleamide in these physiologic processes, the biochemical pathway for its synthesis in vivo has not been established. We report here the discovery of an oleamide synthetase found in rat tissues using [(14)C]oleoyl-CoA and ammonium ion. Hydrogen peroxide was subsequently found to be a required cofactor. The enzyme displayed temperature and pH optima in the physiologic range, a remarkable resistance to proteolysis, and specificity for long-chain acyl-CoA substrates. The reaction demonstrated Michaelis-Menten kinetics with a K(m) for oleoyl-CoA of 21 microm. Proteomic, biochemical, and immunologic analyses were used to identify the source of the oleamide synthesizing activity as cytochrome c. This identification was based upon peptide mass fingerprinting of isolated synthase protein, a tight correlation between enzymatic activity and immunoreactivity for cytochrome c, and identical functional properties shared by the tissue-derived synthetase and commercially obtained cytochrome c. The ability of cytochrome c to catalyze the formation of oleamide experimentally raises the possibility that cytochrome c may mediate oleamide biosynthesis in vivo.

  2. Microreactors—A Powerful Tool to Synthesize Peroxycarboxylic Esters

    Tobias Illg

    2015-12-01

    Full Text Available The synthesis of peroxycarboxylic esters, as one subgroup of organic peroxides, is characterized by a high thermal hazard potential regarding process safety. In case of failure in the production process, e.g., if the heat of reaction cannot be removed sufficiently fast, decomposition reactions can be triggered, and as a result, remarkable amounts of heat and gas can be released and can cause a high extent of damage. Multifarious technical and organizational measures are necessary to ensure the safe industrial production of peroxides. With the introduction of microreaction technology plenty of possibilities have been opened to carry out highly exothermic reactions in smaller volumes and with more efficient heat removal. In this paper we report the application of three different microstructured reactors, representing different mixing strategies, to synthesize two peroxymonocarboxylic esters, namely tert-butyl peroxypivalate and tert-butyl peroxy-2-ethylhexanoate. The following reactor types were considered: an orifice microreactor, a split and recombine microreactor and a capillary tube reactor in combination with ultrasonication. The efficiency of the two phase liquid/liquid reaction is expressed in comparison of conversion and selectivity. With microreaction technology a remarkable increase in space-time-yield, ranging from 12,500 kg·m−3·h−1 to 414,000 kg·m−3·h−1, is achieved.

  3. Differential Transcriptome Analysis between Paulownia fortunei and Its Synthesized Autopolyploid

    Xiaoshen Zhang

    2014-03-01

    Full Text Available Paulownia fortunei is an ecologically and economically important tree species that is widely used as timber and chemical pulp. Its autotetraploid, which carries a number of valuable traits, was successfully induced with colchicine. To identify differences in gene expression between P. fortunei and its synthesized autotetraploid, we performed transcriptome sequencing using an Illumina Genome Analyzer IIx (GAIIx. About 94.8 million reads were generated and assembled into 383,056 transcripts, including 18,984 transcripts with a complete open reading frame. A conducted Basic Local Alignment Search Tool (BLAST search indicated that 16,004 complete transcripts had significant hits in the National Center for Biotechnology Information (NCBI non-redundant database. The complete transcripts were given functional assignments using three public protein databases. One thousand one hundred fifty eight differentially expressed complete transcripts were screened through a digital abundance analysis, including transcripts involved in energy metabolism and epigenetic regulation. Finally, the expression levels of several transcripts were confirmed by quantitative real-time PCR. Our results suggested that polyploidization caused epigenetic-related changes, which subsequently resulted in gene expression variation between diploid and autotetraploid P. fortunei. This might be the main mechanism affected by the polyploidization. Our results represent an extensive survey of the P. fortunei transcriptome and will facilitate subsequent functional genomics research in P. fortunei. Moreover, the gene expression profiles of P. fortunei and its autopolyploid will provide a valuable resource for the study of polyploidization.

  4. Antibacterial effect of bismuth subsalicylate nanoparticles synthesized by laser ablation

    Flores-Castañeda, Mariela; Vega-Jiménez, Alejandro L.; Almaguer-Flores, Argelia; Camps, Enrique; Pérez, Mario; Silva-Bermudez, Phaedra; Berea, Edgardo; Rodil, Sandra E.

    2015-01-01

    The antimicrobial properties of bismuth subsalicylate (BSS) nanoparticles against four opportunistic pathogens; E. coli, P. aeruginosa, S. aureus, and S. epidermidis were determined. BSS nanoparticles were synthesized by pulse laser ablation of a solid target in distilled water under different conditions. The nanoparticles were characterized using high-resolution transmission electron microscopy and absorption spectra and small angle X-ray scattering. The analysis shows that the colloids maintained the BSS structure and presented average particle size between 20 and 60 nm, while the concentration ranges from 95 to 195 mg/L. The antibacterial effect was reported as the inhibition ratio of the bacterial growth after 24 h and the cell viability was measured using the XTT assay. The results showed that the inhibition ratio of E. coli and S. epidermidis was dependant on the NPs size and/or concentration, meanwhile P. aeruginosa and S. aureus were more sensitive to the BSS nanoparticles independently of both the size and the concentration. In general, the BSS colloids with average particle size of 20 nm were the most effective, attaining inhibition ratios >80 %, similar or larger than those obtained with the antibiotic used as control. The results suggest that the BSS colloids could be used as effective antibacterial agents with potential applications in the medical area

  5. Synthesizing Econometric Evidence: The Case of Demand Elasticity Estimates.

    DeCicca, Philip; Kenkel, Don

    2015-06-01

    Econometric estimates of the responsiveness of health-related consumer demand to higher prices are often key ingredients for risk policy analysis. We review the potential advantages and challenges of synthesizing econometric evidence on the price-responsiveness of consumer demand. We draw on examples of research on consumer demand for health-related goods, especially cigarettes. We argue that the overarching goal of research synthesis in this context is to provide policy-relevant evidence for broad-brush conclusions. We propose three main criteria to select among research synthesis methods. We discuss how in principle and in current practice synthesis of research on the price-elasticity of smoking meets our proposed criteria. Our analysis of current practice also contributes to academic research on the specific policy question of the effectiveness of higher cigarette prices to reduce smoking. Although we point out challenges and limitations, we believe more work on research synthesis in this area will be productive and important. © 2015 Society for Risk Analysis.

  6. Kombucha-synthesized bacterial cellulose: preparation, characterization, and biocompatibility evaluation.

    Zhu, Changlai; Li, Feng; Zhou, Xinyang; Lin, Lin; Zhang, Tianyi

    2014-05-01

    Bacterial cellulose (BC) is a natural biomaterial with unique properties suitable for tissue engineering applications, but it has not yet been used for preparing nerve conduits to repair peripheral nerve injuries. The objectives of this study were to prepare and characterize the Kampuchea-synthesized bacterial cellulose (KBC) and further evaluate the biocompatibility of KBC with peripheral nerve cells and tissues in vitro and in vivo. KBC membranes were composed of interwoven ribbons of about 20-100 nm in width, and had a high purity and the same crystallinity as that of cellulose Iα. The results from light and scanning electron microscopy, MTT assay, flow cytometry, and RT-PCR indicated that no significant differences in the morphology and cell function were observed between Schwann cells (SCs) cultured on KBC membranes and glass slips. We also fabricated a nerve conduit using KBC, which was implanted into the spatium intermusculare of rats. At 1, 3, and 6 weeks post-implantation, clinical chemistry and histochemistry showed that there were no significant differences in blood counts, serum biochemical parameters, and tissue reactions between implanted rats and sham-operated rats. Collectively, our data indicated that KBC possessed good biocompatibility with primary cultured SCs and KBC did not exert hematological and histological toxic effects on nerve tissues in vivo. Copyright © 2013 Wiley Periodicals, Inc.

  7. Understanding betrayals in marriage: a synthesized model of forgiveness.

    Gordon, K C; Baucom, D H

    1998-01-01

    Forgiveness is an issue that is problematic for many couples, particularly those in marital therapy. However, little attention has been paid to this construct in the psychological literature. The purpose of this article is to describe a synthesized model of forgiveness using constructs from multiple theories, including forgiveness, trauma recovery, cognitive-behavioral, family systems, and insight-oriented theories. Forgiveness is conceptualized as a process consisting of three stages, each of which has cognitive, behavioral, and affective components. Furthermore, these stages seem to parallel a person's natural response to traumatic stress. First, there is a response to the initial impact; second, there is an attempt to give the event some kind of meaning, or put it into context; and finally, the person begins to move forward and readjust. Forgiveness is conceptualized as attaining: (a) a realistic, nondistorted, balanced view of the relationship; (b) a release from being controlled by negative affect toward the participating partner; and (c) a lessened desire to punish the participating partner. Implications for marital therapy also are discussed.

  8. Tools to synthesize the learning of thin films

    Rojas, Roberto; Fuster, Gonzalo; Sluesarenko, Viktor

    2011-01-01

    After a review of textbooks written for undergraduate courses in physics, we have found that discussions on thin films are mostly incomplete. They consider the reflected and not the transmitted light for two instead of the four types of thin films. In this work, we complement the discussion in elementary textbooks, by analysing the phase differences required to match the conditions for constructive and destructive interference, in the reflected and transmitted light in four types of thin films. We consider thin films with varied sequences in the refractive index, which we identify as barriers, wells and stairs (up and down). Also, we use the conservation of energy in order to understand the complementary colour fringes observed in the reflected and transmitted light through thin films. We analyse systematically the phase changes by introducing a phase table and we synthesize the results in a circular diagram matching 16 physical situations of interference and their corresponding conditions on the film thickness. The phase table and the circular diagram are a pair of tools easily assimilated by students, and useful to organize, analyse and activate the knowledge about thin films.

  9. Of Syntheses and Surprises: Toward a Critical Integral Theory

    Daniel Gustav Anderson

    2006-12-01

    Full Text Available The central concern of this article is how the search for formal structures with universal values functions ideologically, addressing Zizek’s claim that East-West syntheses may represent the dominant ideology par excellance of global capitalism. To this end, the article offers a Foucaultian genealogy of Integral theory, tracing its origins to the cultural and subjective contingencies of the British Empire, primarily in the work of Integral theory’s foundational thinker, Aurobindo Ghose. The article poses a primary critique of synthesis and evolution as mythological keys to Ultimate Reality which suggests that Zizek’s critique may have some validity, and offers the potential for a “critical integral theory” as an alternative. Situated in Deleuze and Guattari’s concept of becoming, and represented in the ideas and practices of a constellation of thinkers inclusive of Gurdjieff, Benjamin, and Trungpa, the article’s view of integration supports radical democracy as presented in the writings of Laclau and Mouffe as a model outcome for social and personal transformational practices.

  10. Of Syntheses and Surprises:Toward a Critical Integral Theory

    Daniel Gustav Anderson

    2006-12-01

    Full Text Available The central concern of this article is how the search for formal structures with universal values functions ideologically, addressing Zizek’s claim that East-West syntheses may represent the dominant ideology par excellance of global capitalism. To this end, the article offers a Foucaultian genealogy of Integral theory, tracing its origins to the cultural and subjective contingencies of the British Empire, primarily in the work of Integral theory’s foundational thinker, Aurobindo Ghose. The article poses a primary critique of synthesis and evolution as mythological keys to Ultimate Reality which suggests that Zizek’s critique may have some validity, and offers the potential for a “critical integral theory” as an alternative. Situated in Deleuze and Guattari’s concept of becoming, and represented in the ideas and practices of a constellation of thinkers inclusive of Gurdjieff, Benjamin, and Trungpa, the article’s view of integration supports radical democracy as presented in the writings of Laclau and Mouffe as a model outcome for social and personal transformational practices.

  11. Morphology and electrical properties of template-synthesized polypyrrole nanocylinders

    Mativetsky, J.M.; Datars, W.R.

    2002-01-01

    Polypyrrole nanocylinders were fabricated by chemically synthesizing polypyrrole within the pores of nanoporous polycarbonate particle track-etched membranes. The morphology of the nanostructures was characterized by transmission electron microscopy and scanning electron microscopy. The nanocylinders were observed to be cigar-shaped, with the diameter at the center being up to 2.5 times the diameter at the ends. The electrical conductivity of the nanocylinders was measured by leaving the nanocylinders embedded in the insulating template membrane and measuring the trans-membrane resistance. The cigar-like shape of the nanocylinders was taken into account in calculating the conductivity. Contrary to previous reports, the smallest diameter nanocylinders exhibited a slightly lower conductivity relative to the larger diameter nanocylinders. The temperature dependence of the resistance and magnetoresistance was in accordance with Mott variable range hopping at temperatures above 5±1 K and Efros-Shklovskii variable range hopping at temperatures below 5±1 K. Based on the measurements in the Mott regime, the localization length, the density of states at the Fermi energy, and the temperature dependence of the average hopping distance were calculated

  12. Molecular Docking and Anticonvulsant Activity of Newly Synthesized Quinazoline Derivatives

    Hatem A. Abuelizz

    2017-06-01

    Full Text Available A new series of quinazoline-4(3H-ones are evaluated for anticonvulsant activity. After intraperitoneal (ip injection to albino mice at a dose of 100 mg/kg body weight, synthesized quinazolin-4(3H-ones (1–24 were examined in the maximal electroshock (MES induced seizures and subcutaneous pentylenetetrazole (scPTZ induced seizure models in mice. The Rotarod method was applied to determine the neurotoxicity. Most of the compounds displayed anticonvulsant activity in the scPTZ screen at a dose range of 0.204–0.376 mmol/mL. Out of twenty-four, compounds 8, 13 and 19 proved to be the most active with a remarkable protection (100% against PTZ induced convulsions and four times more potent activity than ethosuximide. The structure-activity relationship concluded valuable pharmacophoric information, which was confirmed by the molecular docking studies using the target enzyme human carbon anhydrase II (HCA II. The studied quinazoline analogues suggested that the butyl substitution at position 3 has a significant effect on preventing the spread of seizure discharge and on raising the seizure threshold. However, benzyl substitution at position 3 has shown a strong anticonvulsant activity but with less seizure prevention compared to the butyl substitution.

  13. Antibacterial effect of bismuth subsalicylate nanoparticles synthesized by laser ablation

    Flores-Castañeda, Mariela; Vega-Jiménez, Alejandro L.; Almaguer-Flores, Argelia; Camps, Enrique; Pérez, Mario; Silva-Bermudez, Phaedra; Berea, Edgardo; Rodil, Sandra E.

    2015-11-01

    The antimicrobial properties of bismuth subsalicylate (BSS) nanoparticles against four opportunistic pathogens; E. coli, P. aeruginosa, S. aureus, and S. epidermidis were determined. BSS nanoparticles were synthesized by pulse laser ablation of a solid target in distilled water under different conditions. The nanoparticles were characterized using high-resolution transmission electron microscopy and absorption spectra and small angle X-ray scattering. The analysis shows that the colloids maintained the BSS structure and presented average particle size between 20 and 60 nm, while the concentration ranges from 95 to 195 mg/L. The antibacterial effect was reported as the inhibition ratio of the bacterial growth after 24 h and the cell viability was measured using the XTT assay. The results showed that the inhibition ratio of E. coli and S. epidermidis was dependant on the NPs size and/or concentration, meanwhile P. aeruginosa and S. aureus were more sensitive to the BSS nanoparticles independently of both the size and the concentration. In general, the BSS colloids with average particle size of 20 nm were the most effective, attaining inhibition ratios >80 %, similar or larger than those obtained with the antibiotic used as control. The results suggest that the BSS colloids could be used as effective antibacterial agents with potential applications in the medical area.

  14. Reduction reactions applied for synthesizing different nano-structured materials

    Albuquerque Brocchi, Eduardo de; Correia de Siqueira, Rogério Navarro [Department of Materials Engineering, PUC-Rio, Rua Marquês de São Vicente, 225, Gávea, 22453-900 Rio de Janeiro, RJ (Brazil); Motta, Marcelo Senna [Basck Ltd. (United Kingdom); Moura, Francisco José, E-mail: moura@puc-rio.br [Department of Materials Engineering, PUC-Rio, Rua Marquês de São Vicente, 225, Gávea, 22453-900 Rio de Janeiro, RJ (Brazil); Solórzano-Naranjo, Ivan Guillermo [Department of Materials Engineering, PUC-Rio, Rua Marquês de São Vicente, 225, Gávea, 22453-900 Rio de Janeiro, RJ (Brazil)

    2013-06-15

    Different materials have been synthesized by alternative routes: nitrates thermal decomposition to prepare oxide or co-formed oxides and reduction by hydrogen or graphite to obtain mixed oxides, composites or alloys. These chemical-based synthesis routes are described and thermodynamics studies and kinetics data are presented to support its feasibility. In addition, selective reduction reactions have been applied to successfully produce metal/ceramic composites, and alloys. Structural characterization has been carried out by X-ray Diffraction and, more extensively, Transmission Electron Microscopy operating in conventional diffraction contrast (CTEM) and high-resolution mode (HRTEM), indicated the possibility of obtaining oxide and alloy crystals of sizes ranging between 20 and 40 nm. - Highlights: • The viability in obtaining Ni–Co, Cu–Al, Mn–Al co-formed nano oxides was evaluated. • Partial and complete H{sub 2} reduction were used to produce alloy, composite and Spinel. • XRD, TEM and HREM techniques were used to characterize the obtained nanostructures.

  15. Evaluation of cytotoxicity of polypyrrole nanoparticles synthesized by oxidative polymerization

    Vaitkuviene, Aida [Department of Physical Chemistry, Faculty of Chemistry, Vilnius University, Naugarduko 24, LT-03225 Vilnius (Lithuania); Department of Stem Cell Biology, State Research Institute Center for Innovative Medicine, Zygimantu 9, LT-01102 Vilnius (Lithuania); Kaseta, Vytautas [Department of Stem Cell Biology, State Research Institute Center for Innovative Medicine, Zygimantu 9, LT-01102 Vilnius (Lithuania); Voronovic, Jaroslav [Department of Physical Chemistry, Faculty of Chemistry, Vilnius University, Naugarduko 24, LT-03225 Vilnius (Lithuania); Ramanauskaite, Giedre; Biziuleviciene, Gene [Department of Stem Cell Biology, State Research Institute Center for Innovative Medicine, Zygimantu 9, LT-01102 Vilnius (Lithuania); Ramanaviciene, Almira [NanoTechnas–Center of Nanotechnology and Material Science at Department of Analytical and Environmental Chemistry, Faculty of Chemistry, Vilnius University, Naugarduko 24, 03225 Vilnius (Lithuania); Ramanavicius, Arunas, E-mail: Arunas.Ramanavicius@chf.vu.lt [Department of Physical Chemistry, Faculty of Chemistry, Vilnius University, Naugarduko 24, LT-03225 Vilnius (Lithuania); Laboratory of BioNanoTechnology, Department of Materials Science and Electronics, Institute of Semiconductor Physics, State Scientific Research Institute Centre for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

    2013-04-15

    Highlights: ► Polypyrrole nanoparticles synthesized by environmentally friendly polymerization at high concentrations are cytotoxic. ► Primary mouse embryonic fibroblast, mouse hepatoma and human T lymphocyte Jurkat cell lines were treated by Ppy nanoparticles. ► Polypyrrole nanoparticles at high concentrations inhibit cell proliferation. -- Abstract: Polypyrrole (Ppy) is known as biocompatible material, which is used in some diverse biomedical applications and seeming to be a very promising for advanced biotechnological applications. In order to increase our understanding about biocompatibility of Ppy, in this study pure Ppy nanoparticles (Ppy-NPs) of fixed size and morphology were prepared by one-step oxidative polymerization and their cyto-compatibility was evaluated. The impact of different concentration of Ppy nanoparticles on primary mouse embryonic fibroblasts (MEF), mouse hepatoma cell line (MH-22A), and human T lymphocyte Jurkat cell line was investigated. Cell morphology, viability/proliferation after the treatment by Ppy nanoparticles was evaluated. Obtained results showed that Ppy nanoparticles at low concentrations are biocompatible, while at high concentrations they became cytotoxic for Jurkat, MEF and MH-22A cells, and it was found that cytotoxic effect is dose-dependent.

  16. Conducting polymer networks synthesized by photopolymerization-induced phase separation

    Yamashita, Yuki; Komori, Kana; Murata, Tasuku; Nakanishi, Hideyuki; Norisuye, Tomohisa; Yamao, Takeshi; Tran-Cong-Miyata, Qui

    2018-03-01

    Polymer mixtures composed of double networks of a polystyrene derivative (PSAF) and poly(methyl methacrylate) (PMMA) were alternatively synthesized by using ultraviolet (UV) and visible (Vis) light. The PSAF networks were generated by UV irradiation to photodimerize the anthracene (A) moieties labeled on the PSAF chains, whereas PMMA networks were produced by photopolymerization of methyl methacrylate (MMA) monomer and the cross-link reaction using ethylene glycol dimethacrylate (EGDMA) under Vis light irradiation. It was found that phase separation process of these networks can be independently induced and promptly controlled by using UV and Vis light. The characteristic length scale distribution of the resulting co-continuous morphology can be well regulated by the UV and Vis light intensity. In order to confirm and utilize the connectivity of the bicontinuous morphology observed by confocal microscopy, a very small amount, 0.1 wt%, of multi-walled carbon nanotubes (MWCNTs) was introduced into the mixture and the current-voltage (I-V) relationship was subsequently examined. Preliminary data show that MWCNTs are preferentially dispersed in the PSAF-rich continuous domains and the whole mixture became electrically conducting, confirming the connectivity of the observed bi-continuous morphology. The experimental data obtained in this study reveal a promising method to design various scaffolds for conducting soft matter taking advantages of photopolymerization-induced phase separation.

  17. Aortic wall damage in mice unable to synthesize ascorbic acid.

    Maeda, N; Hagihara, H; Nakata, Y; Hiller, S; Wilder, J; Reddick, R

    2000-01-18

    By inactivating the gene for L-gulono-gamma-lactone oxidase, a key enzyme in ascorbic acid synthesis, we have generated mice that, like humans, depend on dietary vitamin C. Regular chow, containing about 110 mg/kg of vitamin C, is unable to support the growth of the mutant mice, which require L-ascorbic acid supplemented in their drinking water (330 mg/liter). Upon withdrawal of supplementation, plasma and tissue ascorbic acid levels decreased to 10-15% of normal within 2 weeks, and after 5 weeks the mutants became anemic, began to lose weight, and die. Plasma total antioxidative capacities were approximately 37% normal in homozygotes after feeding the unsupplemented diet for 3-5 weeks. As plasma ascorbic acid decreased, small, but significant, increases in total cholesterol and decreases in high density lipoprotein cholesterol were observed. The most striking effects of the marginal dietary vitamin C were alterations in the wall of aorta, evidenced by the disruption of elastic laminae, smooth muscle cell proliferation, and focal endothelial desquamation of the luminal surface. Thus, marginal vitamin C deficiency affects the vascular integrity of mice unable to synthesize ascorbic acid, with potentially profound effects on the pathogenesis of vascular diseases. Breeding the vitamin C-dependent mice with mice carrying defined genetic mutations will provide numerous opportunities for systematic studies of the role of antioxidants in health and disease.

  18. Properties of radiation-synthesized polyvinylpyrrolidone/chitosan hydrogel blends

    Mahmud, Maznah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia 43600 Bangi, Selangor (Malaysia); Radiation Processing Technology Division, Malaysian Nuclear Agency, 43000 Kajang, Selangor (Malaysia); Daik, Rusli [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia 43600 Bangi, Selangor (Malaysia); Adam, Zainah [Radiation Processing Technology Division, Malaysian Nuclear Agency, 43000 Kajang, Selangor (Malaysia)

    2015-09-25

    Poly(vinylpyrrolidone) (PVP)-crosslinked chitosan hydrogels were prepared by gamma radiation at various doses; 1, 3 5, 7, 10, 15, 20, 25 and 30kGy. Gamma radiation was used as a crosslinking tool which requires no chemical initiator, no heating process and need no purification step on the end products obtained. The hydrogel formulations were composed of 6% chitosan with average molecular weight (Mw) = 48 800 g/mol and 14% PVP with Mw = 10 000 g/mol in 2% lactic acid. Physical properties of hydrogels such as gel fraction and swelling property at pH 5.5 and pH 7.0 as well as syneresis activity were determined. It was found that different radiation dose induces different effect on hydrogels’ network formed. Morphological study of hydrogels has been carried out by scanning electron microscope (SEM). From these preliminary evaluations, it can be concluded that gamma radiation is an effective tool for network development of hydrogels and it also induces enhancement on characteristics of hydrogels synthesized.

  19. Antibacterial effect of bismuth subsalicylate nanoparticles synthesized by laser ablation

    Flores-Castañeda, Mariela [Instituto Nacional de Investigaciones Nucleares (Mexico); Vega-Jiménez, Alejandro L., E-mail: argelia.almaguer@mac.com; Almaguer-Flores, Argelia [Universidad Nacional Autónoma de México, Facultad de Odontología, DEPeI, I (Mexico); Camps, Enrique; Pérez, Mario [Instituto Nacional de Investigaciones Nucleares (Mexico); Silva-Bermudez, Phaedra [Instituto Nacional de Rehabilitación, Unidad de Ingeniería de Tejidos, Terapia Celular y Medicina Regenerativa (Mexico); Berea, Edgardo [FarmaQuimia SA de CV. (Mexico); Rodil, Sandra E. [Universidad Nacional Autónoma de México, Instituto de Investigaciones en Materiales (Mexico)

    2015-11-15

    The antimicrobial properties of bismuth subsalicylate (BSS) nanoparticles against four opportunistic pathogens; E. coli, P. aeruginosa, S. aureus, and S. epidermidis were determined. BSS nanoparticles were synthesized by pulse laser ablation of a solid target in distilled water under different conditions. The nanoparticles were characterized using high-resolution transmission electron microscopy and absorption spectra and small angle X-ray scattering. The analysis shows that the colloids maintained the BSS structure and presented average particle size between 20 and 60 nm, while the concentration ranges from 95 to 195 mg/L. The antibacterial effect was reported as the inhibition ratio of the bacterial growth after 24 h and the cell viability was measured using the XTT assay. The results showed that the inhibition ratio of E. coli and S. epidermidis was dependant on the NPs size and/or concentration, meanwhile P. aeruginosa and S. aureus were more sensitive to the BSS nanoparticles independently of both the size and the concentration. In general, the BSS colloids with average particle size of 20 nm were the most effective, attaining inhibition ratios >80 %, similar or larger than those obtained with the antibiotic used as control. The results suggest that the BSS colloids could be used as effective antibacterial agents with potential applications in the medical area.

  20. Conceptualizing and measuring energy security: A synthesized approach

    Sovacool, Benjamin K.; Mukherjee, Ishani

    2011-01-01

    This article provides a synthesized, workable framework for analyzing national energy security policies and performance. Drawn from research interviews, survey results, a focused workshop, and an extensive literature review, this article proposes that energy security ought to be comprised of five dimensions related to availability, affordability, technology development, sustainability, and regulation. We then break these five dimensions down into 20 components related to security of supply and production, dependency, and diversification for availability; price stability, access and equity, decentralization, and low prices for affordability; innovation and research, safety and reliability, resilience, energy efficiency, and investment for technology development; land use, water, climate change, and air pollution for sustainability; and governance, trade, competition, and knowledge for sound regulation. Further still, our synthesis lists 320 simple indicators and 52 complex indicators that policymakers and scholars can use to analyze, measure, track, and compare national performance on energy security. The article concludes by offering implications for energy policy more broadly. -- Highlights: → Energy security should consist of five dimensions related to availability, affordability, technology development, sustainability, and regulation. → The dimensions of energy security can be broken down into 20 components. → These components can be distilled into 320 simple indicators and 52 complex indicators.

  1. Moss and liverwort xyloglucans contain galacturonic acid and are structurally distinct from the xyloglucans synthesized by hornworts and vascular plants.

    Peña, Maria J; Darvill, Alan G; Eberhard, Stefan; York, William S; O'Neill, Malcolm A

    2008-11-01

    Xyloglucan is a well-characterized hemicellulosic polysaccharide that is present in the cell walls of all seed-bearing plants. The cell walls of avascular and seedless vascular plants are also believed to contain xyloglucan. However, these xyloglucans have not been structurally characterized. This lack of information is an impediment to understanding changes in xyloglucan structure that occurred during land plant evolution. In this study, xyloglucans were isolated from the walls of avascular (liverworts, mosses, and hornworts) and seedless vascular plants (club and spike mosses and ferns and fern allies). Each xyloglucan was fragmented with a xyloglucan-specific endo-glucanase and the resulting oligosaccharides then structurally characterized using NMR spectroscopy, MALDI-TOF and electrospray mass spectrometry, and glycosyl-linkage and glycosyl residue composition analyses. Our data show that xyloglucan is present in the cell walls of all major divisions of land plants and that these xyloglucans have several common structural motifs. However, these polysaccharides are not identical because specific plant groups synthesize xyloglucans with unique structural motifs. For example, the moss Physcomitrella patens and the liverwort Marchantia polymorpha synthesize XXGGG- and XXGG-type xyloglucans, respectively, with sidechains that contain a beta-D-galactosyluronic acid and a branched xylosyl residue. By contrast, hornworts synthesize XXXG-type xyloglucans that are structurally homologous to the xyloglucans synthesized by many seed-bearing and seedless vascular plants. Our results increase our understanding of the evolution, diversity, and function of structural motifs in land-plant xyloglucans and provide support to the proposal that hornworts are sisters to the vascular plants.

  2. A "Hybrid" Approach for Synthesizing Optimal Controllers of Hybrid Systems

    Zhao, Hengjun; Zhan, Naijun; Kapur, Deepak

    2012-01-01

    to discretization manageable and within bounds. A major advantage of our approach is not only that it avoids errors due to numerical computation, but it also gives a better optimal controller. In order to illustrate our approach, we use the real industrial example of an oil pump provided by the German company HYDAC...

  3. Cytotoxic effect of nanoparticles synthesized from Salvia officinalis L ...

    The development of safe carriers for the use of plant extracts in industrial and health fields constitute a matter of serious concern. The development of plant derived nanoparticles may help to overcome such barriers. However, the major concern is still the safety of these carriers. The present study describes the synthesis of ...

  4. Epidemiology of major depressive disorder

    Stegenga, B.T.

    2011-01-01

    Major depressive disorder (MDD) is a serious health problem and will be the second leading cause of burden of disease worldwide by 2030. To be able to prevent MDD, insight into risk factors for the onset of MDD is of clear importance. On the other hand, if onset of MDD has occurred, one may argue that different course patterns of MDD can be identified and that it is essential to examine their relationship to symptoms and function over time. Insight into these course patterns could assist in p...

  5. Aostra claims major oilsands breakthrough

    Anon.

    1991-01-01

    This paper reports that Alberta Oil Sands Technology and Research Authority (Aostra) has completed a horizontal well in-situ steam injection project it calls a major breakthrough in commercially producing bitumen from the bast Athabasca oilsands deposit in Alberta. Aostra the its $71 million (Canadian) proof of concept pilot underground test facility (UTF) near Fort McMurray, achieved a 60% bitumen recovery rate, compared with less than 20% recovery typically achieved with Alberta bitumen. More than 100,000 bbl of bitumen was produced during the project

  6. Vanpooling: the three major approaches

    Sears, P.M.

    1979-08-01

    The manual provides technical assistance to existing or prospective vanpool sponsors. It is designed to help them promote vanpooling in its three major approaches: employer sponsored, third party sponsored, and driver owned and operated. The first chapter is an overview of vanpooling and a second chapter, on vanpool marketing, is addressed to ridesharing coordinators and others whose responsibilities include the promotion of vanpooling. Some fact sheets on the three approaches provide convenient summaries of the needs and opportunities of each approach and suggest solutions to practical problems likely to be encountered in starting new vanpool programs.

  7. Majority rule on heterogeneous networks

    Lambiotte, R

    2008-01-01

    We focus on the majority rule (MR) applied on heterogeneous networks. When the underlying topology is homogeneous, the system is shown to exhibit a transition from an ordered regime to a disordered regime when the noise is increased. When the network exhibits modular structures, in contrast, the system may also exhibit an asymmetric regime, where the nodes in each community reach an opposite average opinion. Finally, the node degree heterogeneity is shown to play an important role by displacing the location of the order-disorder transition and by making the system exhibit non-equipartition of the average spin

  8. Societal risk and major disasters

    Clement, C.F.

    1989-01-01

    A disaster can be defined as an event, or a series of events, in which a large number of people is adversely affected by a single cause. This definition includes man-made accidents, like that at Chernobyl, as well as the natural disasters that insurance companies are sometimes pleased to describe as Acts of God. In 1986 alone, 12,000 people died and 2.2 million were made homeless by 215 major accidents or disasters. The nature of risk is examined in this paper. (author)

  9. New effective chemically synthesized anti-smallpox compound NIOCH-14.

    Mazurkov, Oleg Yu; Kabanov, Alexey S; Shishkina, Larisa N; Sergeev, Alexander A; Skarnovich, Maksim O; Bormotov, Nikolay I; Skarnovich, Maria A; Ovchinnikova, Alena S; Titova, Ksenya A; Galahova, Darya O; Bulychev, Leonid E; Sergeev, Artemiy A; Taranov, Oleg S; Selivanov, Boris A; Tikhonov, Alexey Ya; Zavjalov, Evgenii L; Agafonov, Alexander P; Sergeev, Alexander N

    2016-05-01

    Antiviral activity of the new chemically synthesized compound NIOCH-14 (a derivative of tricyclodicarboxylic acid) in comparison with ST-246 (the condensed derivative of pyrroledione) was observed in experiments in vitro and in vivo using orthopoxviruses including highly pathogenic ones. After oral administration of NIOCH-14 to outbred ICR mice infected intranasally with 100 % lethal dose of ectromelia virus, it was shown that 50 % effective doses of NIOCH-14 and ST-246 did not significantly differ. The 'therapeutic window' varied from 1 day before infection to 6 days post-infection (p.i.) to achieve 100-60 % survival rate. The administration of NIOCH-14 and ST-246 to mice resulted in a significant reduction of ectromelia virus titres in organs examined as compared with the control and also reduced pathological changes in the lungs 6 days p.i. Oral administration of NIOCH-14 and ST-246 to ICR mice and marmots challenged with monkeypox virus as compared with the control resulted in a significant reduction of virus production in the lungs and the proportion of infected mice 7 days p.i. as well as the absence of disease in marmots. Significantly lower proportions of infected mice and virus production levels in the lungs as compared with the control were demonstrated in experiments after oral administration of NIOCH-14 and ST-246 to ICR mice and immunodeficient SCID mice challenged with variola virus 3 and 4 days p.i., respectively. The results obtained suggest good prospects for further study of the chemical compound NIOCH-14 to create a new smallpox drug on its basis.

  10. Amoxicillin Oxidative Degradation Synthesized by Nano Zero Valent Iron

    AR Yazdanbakhsh

    2016-03-01

    Full Text Available Introduction: Amoxicillin is one of the most important groups of pharmaceuticals that benefits humans and animals. However, antibiotics excertion in wastewaters and environment have emerged as a serious risk to the biotic environment, and their toxic effects can harm the organisms. Iron-based metallic nanoparticles have received special attention in regard with remediation of groundwater contaminants. In the typical nZVI-based bimetallic particle system, Fe acts as the reducing agent. Thus, the present study aimed to evaluate the synthesis and characteristics of nZVI in regard with degrading AMX. Methods: In this study, nZVI nanoparticles were synthesized using the liquid-phase reduction method by EDTA as a stabilizer material. Structure and properties of nanoparticles were characterized by BET, SEM, XRD and EDX analysis. A multi-variate analysis was applied using a response surface methodology (RSM in order to develop a quadratic model as a functional relationship between AMX removal efficiency and independent variables ( initial pH values, dosage of nZVI, contact time and amoxicillin concentration. The four independent variables of solution pH (2–10, AMX concentration (5-45mg/l, contact time (5-85 min and nanoparticles dose (0.25 – 1.25 g were transformed to the coded values. Results: The study results demonstrated that more than 69 % of AMX was removed by nZVI. The optimal AMX removal conditions using nZVI were found as 1.25 g of nZVI, pH 4, contact time of 80 min and concentration of 30 mg/l. Conclusions: The ability of nZVI in degradation of AMX revealed that these materials can serve as a potential nano material with respect to the environmental remediation.

  11. Adsorption of citrate ions on hydroxyapatite synthesized by various methods

    Skwarek, E.; Janusz, W.; Sternik, D.

    2014-01-01

    The specific adsorption of citric acid ions at hydroxyapatite interface was investigated by the means of radioisotope method ( 14 C) as a function of citric acid ions concentration, NaCl concentration and pH. Application of the hydroxyapatite has become wide in the biomaterial field as the Ca 10 (OH) 2 (PO 4 ) 6 possess biocompatibility with human hard tissue. Hydroxyapatite was synthesized using three different methods. The physical properties of the resulting powder were characterized by DTA/TG, XRD, AFM and SEM microscopy. Physicochemical qualities characterizing the electrical double layer of the hydroxyapatite/NaCl solution interface were determined. The zeta potential and the adsorption of citric acid molecule were studied as a function of pH. The point of zero charge and the isoelectric point of samples were determined. Electrical double layer parameters of hydroxyapatite/NaCl interface are influenced by a synthesis method. The points pH pzc and pH IEP for sample 1 are pH pzc 7.5 and pH IEP 3; for sample 2 pH pzc 7.05 and pH IEP 3, for sample 3 pH pzc 6.7 and pH IEP 3. Temperature has weak influence both on pure substance and with citric acid adsorbed, as derivatographic analysis has shown, and characterization of hydroxyapatite structure may be carried out by this thermal analysis. Two phenomena are responsible for citric acid adsorption: phosphate group's replacement at hydroxyapatite surface by citric ions parallel to intraspherical complexes formation. (author)

  12. Poly aniline synthesized in pilot scale: structural and morphological characteristics

    Mazzeu, Maria Alice Carvalho; Goncalves, Emerson Sarmento, E-mail: aie.mzz@hotmail.com [Instituto Tecnologico de Aeronautica (ITA), Sao Jose dos Campos, SP (Brazil); Gama, Adriana Medeiros [Instituto de Aeronautica e Espaco (IAE), Sao Jose dos Campos, SP (Brazil); Baldan, Mauricio Ribeiro [Instituto Nacional de Pesquisas Espaciais (INPE), Sao Jose dos Campos, SP (Brazil); Faria, Lohana Komorek [Universidade do Vale do Paraiba (UNIVAP), Sao Jose dos Campos, SP (Brazil)

    2016-07-01

    Full text: Among various conducting polymers, poly aniline (PAni) has received wide-spread attention because of its outstanding properties including simple and reversible doping–dedoping chemistry, stable electrical conduction mechanisms, high environmental stability and ease of synthesis [1]. Increasing applications require PAni at industrial scale and optimization of manufacturing processes are essential for this purpose. Since pilot scale influences hydrodynamics of the polymerizations system [2], pilot scale is an important instrument for evaluating amendments in the process. In this work, polyaniline was synthesized on pilot scale, with variation of reaction time for every synthesis, keeping the other parameters unchanged. The PAni salt first obtained was dedoped and the PAni-B (PAni in a base form, nonconductive) obtained was redoped with dodecylbenzenesulfonic acid (DBSA), when PAni-DBSA (PAni in a salt form, conductive) is obtained. The effects of synthesis conditions on the structural and morphological characteristics of PAni-B and PAni-DBSA are investigate by Raman Spectroscopy, XRD (X-ray diffractometer) and SEM (Scanning electron microscopy). Electrical conductivity was determined to redoped samples. Results were analyzed and we compare PAni forms to identifying the doping structure to PAni-DBSA by Raman spectroscopy. It was found too that reaction time can give some influence at conductivity. The XRD result showed differences in crystalline peaks of PAni-B and PAni-DBSA and this difference could be attributed mainly to the redoping process. Whereas the formation of crystals on a pilot scale may change because of effects caused by water flow, speed of polymerization could affect the formation of crystals too. The SEM pictures to PAni-B showed tiny coral reefs with globules structure and PAni-DBSA showed multilayer structure. References: 1 - Fratoddia I. et al. Sensors and Actuators B 220: 534–548 (2015); 2 - Roichman Y et al. Synthetic Metals 98

  13. Photoluminescence of Sequential Infiltration Synthesized ZnO nanostructures

    Ocola, Leonidas; Gosztola, David; Yanguas-Gil, Angel; Connolly, Aine

    We have investigated a variation of atomic layer deposition (ALD), called sequential infiltration synthesis (SiS), as an alternate method to incorporate ZnO and other oxides inside polymethylmethacrylate (PMMA) and other polymers. Energy dispersive spectroscopy (EDS) results show that we synthesize ZnO up to 300 nm inside a PMMA film. Photoluminescence data on a PMMA film shows that we achieve a factor of 400X increase in photoluminescence (PL) intensity when comparing a blank Si sample and a 270 nm thick PMMA film, where both were treated with the same 12 alternating cycles of H2O and diethyl zinc (DEZ). PMMA is a well-known ebeam resist. We can expose and develop patterns useful for photonics or sensing applications first, and then convert them afterwards into a hybrid polymer-oxide material. We show that patterning does indeed affect the photoluminescence signature of native ZnO. We demonstrate we can track the growth of the ZnO inside the PMMA polymer using both photoluminescence and Raman spectroscopy and determine the point in the process where ZnO is first photoluminescent and also at which point ZnO first exhibits long range order in the polymer. This work was supported by the Department of Energy under Contract No. DE-AC02-06CH11357. Use of the Center for Nanoscale Materials was supported by the U. S. Department of Energy, Office of Basic Energy Sciences, under Contract No. DE-AC02-06CH11357.

  14. Purity and crystallinity of microwave synthesized antimony sulfide microrods

    Martínez-Alonso, Claudia, E-mail: claudiamartinezalonso30@gmail.com [Facultad de Química, Universidad Autónoma de Querétaro, Querétaro, Querétaro, 76010 (Mexico); Olivos-Peralta, Eliot U. [Instituto de Energías Renovables, Universidad NacionalAutónoma de México, Temixco, Morelos, 62580 (Mexico); Sotelo-Lerma, Mérida [Universidad de Sonora, Hermosillo, Sonora, 83000 (Mexico); Sato-Berrú, Roberto Y. [Centro de Ciencias Aplicadas y Desarrollo Tecnológico, Universidad Nacional Autónoma de México, MéxicoD.F., 04510 (Mexico); Mayén-Hernández, S.A. [Facultad de Química, Universidad Autónoma de Querétaro, Querétaro, Querétaro, 76010 (Mexico); Hu, Hailin, E-mail: hzh@ier.unam.mx [Instituto de Energías Renovables, Universidad NacionalAutónoma de México, Temixco, Morelos, 62580 (Mexico)

    2017-01-15

    Antimony sulfide (Sb{sub 2}S{sub 3}) is a promising semiconductor material for solar cell applications. In this work, microrods of Sb{sub 2}S{sub 3} were synthesized by microwave heating with different sulfur sources, solvents, temperature, heating rate, power, and solution concentration. It was found that 90% of stoichiometric Sb{sub 2}S{sub 3} can be obtained with thiourea (TU) or thioacetamide (TA) as sulfur sources and that their optical band gap values were within the range of 1.59–1.60 eV. The most crystalline Sb{sub 2}S{sub 3} were obtained by using TU. The morphology of the Sb{sub 2}S{sub 3} with TU the individual rods were exhibited, whereas rods bundles appeared in TA-based products. The solvents were ethylene glycol (EG) and dimethylformamide (DMF). EG generates more heat than DMF during the microwave synthesis. As a result, the Sb{sub 2}S{sub 3} obtained with EG contained a larger percentage of oxygen and smaller crystal sizes compared to those from DMF. On the other hand, the length and diameter of Sb{sub 2}S{sub 3} microrods can be increased by applying higher heating power although the crystal size did not change at all. In summary, pure and highly crystalline Sb{sub 2}S{sub 3} microrods of 6–10 μm long and 330–850 nm in diameter can be obtained by the microwave method with a careful selection of chemical and thermodynamic parameters of the synthesis. - Highlights: • Purity up to 90% of crystalline Sb{sub 2}S{sub 3} nanorods can be obtained by microwave heating. • The combination of solvent and sulfide type affects crystallinity & purity of Sb2S3. • The high pressure generated in microwave heating helps to form Sb{sub 2}S{sub 3} nanorods.

  15. A new route of synthesizing perovskite nanotubes by templating approach

    Habiballah, Anisah Shafiqah; Osman, Nafisah; Jani, Abdul Mutalib Md

    2017-09-01

    A perovskite oxide for example Ba0.5Sr0.5Co0.8Fe0.2O3-δ (BSCF) has attracted growing attention due to its high catalytic activity and mixed ionic/electronic conductivity. Recent research of BSCF is more comprehensively based on a remarkable trajectory of innovation, in particular with regards to the synthesis of perovskite structures in one-dimensional (1-D) nanometric scales as they promote not only to increase an active electrode area for the oxygen reduction reaction, but also allow the tailoring of electrode's architecture. Nevertheless, achieving the desired 1-D structure by a conventional method such as hydrothermal, solvothermal, or sonochemical are far from satisfactory. Herein, the aim of this work is to synthesize the BSCF perovskite nanotubes via soft templating approach, particularly using anodic aluminium oxide (AAO) as a template, focusing on the morphology, composition and structural properties were demonstrated. After the AAO template was anodized at 80 V, the fabricated template was clamped between apair of spectroscopic cells containing BSCF sol and deionized water (with a hole of both sides) for 24 hours. After that, the sample was removed from the cells followed by heat treatment process. The FESEM images showed that BSCF nanotubes were successfully achieved, with the diameter of the nanotubes' approximately 80 nm. The EDX result also confirmed the nominal stoichiometry of Ba0.5Sr0.5Co0.8Fe0.2O3-δ. Meanwhile, the XRD pattern confirmed a single crystalline phase of BSCF nanotubes was successfully obtained and congruent to a cubic perovskite structure of BSCF. Possible formation mechanism,as well as the schematic illustration of BSCF nanotubes inside the template was also discussed in this paper.

  16. Syntheses, Crystal Structures and Bioactivities of Two Novel Isatin Derivatives

    SHANG Jian-li; LI Hui-dong; SHANG Jun; SONG Hai-bin; LI Zheng-ming; WANG Jian-guo

    2011-01-01

    Two novel compoundsl-(4-fluorobenzyl)-4-chloro-(Z)-3-benzoylhydrazono-2-indolinone(1) and 1-(4-methoxybenzyl)-(Z)-3-benzoylhydrazono-2-indolinone(2) were synthesized and their crystal structures were determined by single-crystal X-ray diffraction.Compound 1(C22H15ClFN3O2) crystallized in the triclinic system,space group P1- with a=0.94198(19) nm,b=1.4339(3) nm,c=1.5018(3) nm,a=101.58(3)°,β=102.96(3)°,γ=102.73°,V=1.8602(6) nm3,Mr=407.82,Dc=1.456 g/cm3,μ=0.240 mm-1,F(000)=840,Z=4,R1=0.0442 and wR2=0.1064.Compound 2(C23H19N3O3) crystallized in the triclinic system,space group P1- with a=1.0022(2) nm,b=1.0192(2) nm,c=1.0461(2) nm,a=99.86(3)°,β=117.30(3)°,γ=94.13(3)°,V=0.9215(3) nm3,Mr=385.41,Dc=1.389 g/cm3,μ=0.094mm-1,F(000)=404,Z=2,R1=0.0403 and wR2=0.1142.The preliminary herbicidal activities of the two compounds were also evaluated.

  17. Valorization of Bone Waste of Saudi Arabia by Synthesizing Hydroxyapatite.

    Amna, Touseef

    2018-05-09

    At present, hydroxyapatite is being frequently used for diverse biomedical applications as it possesses excellent biocompatibility, osteoconductivity, and non-immunogenic characteristics. The aim of the present work was to recycle bone waste for synthesis of hydroxyapatite nanoparticles to be used as bone extracellular matrix. For this reason, we for the first time utilized bio-waste of cow bones of Albaha city. The residual bones were utilized for the extraction of natural bone precursor hydroxyapatite. A facile scientific technique has been used to synthesize hydroxyapatite nanoparticles through calcinations of wasted cow bones without further supplementation of chemicals/compounds. The obtained hydroxyapatite powder was ascertained using physicochemical techniques such as XRD, SEM, FTIR, and EDX. These analyses clearly show that hydroxyapatite from native cow bone wastes is biologically and physicochemically comparable to standard hydroxyapatite, commonly used for biomedical functions. The cell viability and proliferation over the prepared hydroxyapatite was confirmed with CCk-8 colorimetric assay. The morphology of the cells growing over the nano-hydroxyapatite shows that natural hydroxyapatite promotes cellular attachment and proliferation. Hence, the as-prepared nano-hydroxyapatite can be considered as cost-effective source of bone precursor hydroxyapatite for bone tissue engineering. Taking into account the projected demand for reliable bone implants, the present research work suggested using environment friendly methods to convert waste of Albaha city into nano-hydroxyapatite scaffolds. Therefore, besides being an initial step towards accomplishment of projected demands of bone implants in Saudi Arabia, our study will also help in reducing the environmental burden by recycling of bone wastes of Albaha city.

  18. Data management in clinical research: Synthesizing stakeholder perspectives.

    Johnson, Stephen B; Farach, Frank J; Pelphrey, Kevin; Rozenblit, Leon

    2016-04-01

    This study assesses data management needs in clinical research from the perspectives of researchers, software analysts and developers. This is a mixed-methods study that employs sublanguage analysis in an innovative manner to link the assessments. We performed content analysis using sublanguage theory on transcribed interviews conducted with researchers at four universities. A business analyst independently extracted potential software features from the transcriptions, which were translated into the sublanguage. This common sublanguage was then used to create survey questions for researchers, analysts and developers about the desirability and difficulty of features. Results were synthesized using the common sublanguage to compare stakeholder perceptions with the original content analysis. Individual researchers exhibited significant diversity of perspectives that did not correlate by role or site. Researchers had mixed feelings about their technologies, and sought improvements in integration, interoperability and interaction as well as engaging with study participants. Researchers and analysts agreed that data integration has higher desirability and mobile technology has lower desirability but disagreed on the desirability of data validation rules. Developers agreed that data integration and validation are the most difficult to implement. Researchers perceive tasks related to study execution, analysis and quality control as highly strategic, in contrast with tactical tasks related to data manipulation. Researchers have only partial technologic support for analysis and quality control, and poor support for study execution. Software for data integration and validation appears critical to support clinical research, but may be expensive to implement. Features to support study workflow, collaboration and engagement have been underappreciated, but may prove to be easy successes. Software developers should consider the strategic goals of researchers with regard to the

  19. Electrochemically synthesized Si nano wire arrays and thermoelectric nano structures

    Khuan, N.I.; Ying, K.K.; Nur Ubaidah Saidin; Foo, C.T.

    2012-01-01

    Thermoelectric nano structures hold great promise for capturing and directly converting into electricity some vast amount of low-grade waste heats now being lost to the environment (for example from nuclear power plant, fossil fuel burning, automotive and household appliances). In this study, large-area vertically-aligned silicon nano wire (SiNW) arrays were synthesized in an aqueous solution containing AgNO 3 and HF on p-type Si (100) substrate by self-selective electroless etching process. The etching conditions were systematically varied in order to achieve different stages of nano wire formation. Diameters of the SiNWs obtained varied from approximately 50 to 200 nm and their lengths ranged from several to a few tens of μm. Te/ Bi 2 Te 3 -Si thermoelectric core-shell nano structures were subsequently obtained via galvanic displacement of SiNWs in acidic HF electrolytes containing HTeO 2 + and Bi 3+ / HTeO 2 + ions. The reactions were basically a nano-electrochemical process due to the difference in redox potentials between the materials. the surface-modified SiNWs of core-shell structures had roughened surface morphologies and therefore, higher surface-t-bulk ratios compared to unmodified SiNWs. They have potential applications in sensors, photovoltaic and thermoelectric nano devices. Growth study on the SiNWs and core-shell nano structures produced is presented using various microscopy, diffraction and probe-based techniques for microstructural, morphological and chemical characterizations. (Author)

  20. Purity and crystallinity of microwave synthesized antimony sulfide microrods

    Martínez-Alonso, Claudia; Olivos-Peralta, Eliot U.; Sotelo-Lerma, Mérida; Sato-Berrú, Roberto Y.; Mayén-Hernández, S.A.; Hu, Hailin

    2017-01-01

    Antimony sulfide (Sb_2S_3) is a promising semiconductor material for solar cell applications. In this work, microrods of Sb_2S_3 were synthesized by microwave heating with different sulfur sources, solvents, temperature, heating rate, power, and solution concentration. It was found that 90% of stoichiometric Sb_2S_3 can be obtained with thiourea (TU) or thioacetamide (TA) as sulfur sources and that their optical band gap values were within the range of 1.59–1.60 eV. The most crystalline Sb_2S_3 were obtained by using TU. The morphology of the Sb_2S_3 with TU the individual rods were exhibited, whereas rods bundles appeared in TA-based products. The solvents were ethylene glycol (EG) and dimethylformamide (DMF). EG generates more heat than DMF during the microwave synthesis. As a result, the Sb_2S_3 obtained with EG contained a larger percentage of oxygen and smaller crystal sizes compared to those from DMF. On the other hand, the length and diameter of Sb_2S_3 microrods can be increased by applying higher heating power although the crystal size did not change at all. In summary, pure and highly crystalline Sb_2S_3 microrods of 6–10 μm long and 330–850 nm in diameter can be obtained by the microwave method with a careful selection of chemical and thermodynamic parameters of the synthesis. - Highlights: • Purity up to 90% of crystalline Sb_2S_3 nanorods can be obtained by microwave heating. • The combination of solvent and sulfide type affects crystallinity & purity of Sb2S3. • The high pressure generated in microwave heating helps to form Sb_2S_3 nanorods.

  1. A veracity preserving model for synthesizing scalable electricity load profiles

    Huang, Yunyou; Zhan, Jianfeng; Luo, Chunjie; Wang, Lei; Wang, Nana; Zheng, Daoyi; Fan, Fanda; Ren, Rui

    2018-01-01

    Electricity users are the major players of the electric systems, and electricity consumption is growing at an extraordinary rate. The research on electricity consumption behaviors is becoming increasingly important to design and deployment of the electric systems. Unfortunately, electricity load profiles are difficult to acquire. Data synthesis is one of the best approaches to solving the lack of data, and the key is the model that preserves the real electricity consumption behaviors. In this...

  2. The Semi-automatic Synthesis of 18F-fluoroethyl-choline by Domestic FDG Synthesizer

    ZHOU Ming

    2016-02-01

    Full Text Available As an important complementary imaging agent for 18F-FDG, 18F-fluoroethyl-choline (18F-FECH has been demonstrated to be promising in brain and prostate cancer imaging. By using domestic PET-FDG-TI-I CPCU synthesizer, 18F-FECH was synthesized by different reagents and consumable supplies. The C18 column was added before the product collection bottle to remove K2.2.2. The 18F-FECH was synthesized by PET-FDG-IT-I synthesizer efficiently about 30 minutes by radiochemical yield of 42.0% (no decay corrected, n=5, and the radiochemical purity was still more than 99.0% after 6 hours. The results showed the domestic PET-FDG-IT-I synthesizer could semi-automatically synthesize injectable 18F-FECH in high efficiency and radiochemical purity

  3. Synthesis of Zeolite from Fly Ash and Removal of Heavy Metal Ions from Newly Synthesized Zeolite

    Solanki, Parag; Gupta, Vikal; Kulshrestha, Ruchi

    2010-01-01

    Coal fly ash was used to synthesize X-type zeolite by alkali fusion followed by hydrothermal treatment. Characteristics of the various Fly ash samples were carried out. Coal proximate analysis was done. Batch experiment was carried out for the adsorption of some heavy metal ions on to synthesized Zeolite. The cost of synthesized zeolite was estimated to be almost one-fifth of that of commercial 13X zeolite available in the market.

  4. Major Environmental Policy in 2000

    Choi, Hong Jin [Ministry Of Environment, Kwachon (Korea)

    2000-04-01

    As a new millennium has started, there are active movements developing a basic paradigm of vision and policy over a nation-wide to prepare changes actively. For the environmental sector, it is possible to live in a pleasant environment if everyone prepare and work together like dealing with Y2K problem. With a goal of being an environmentally advanced country in the early new millennium, it is planned to improve a basic life environment such as water and air and to promote an advanced environmental management policy for showing results of its reform in 2000. Therefore, it examines environmental management circumstances and a direction of environmental policy first and it discusses more about major environmental policy related to petroleum industry. 7 tabs.

  5. Neuroticism in remitted major depression

    Gade, Anders; Kristoffersen, Marius; Kessing, Lars Vedel

    2015-01-01

    not been consistent. METHOD: We examined neuroticism, extraversion and perceived stress in 88 fully remitted depressed patients with a mean age of 60 years and with a history of hospitalization for major depressive disorder. Patients were divided into those with onset after and those with onset before 50......BACKGROUND: The personality trait of neuroticism is strongly related to depression, but depression is etiologically heterogeneous. Late-onset depression (LOD) may be more closely related to vascular factors, and previous studies of neuroticism in LOD versus early-onset depression (EOD) have...... age of onset and neuroticism was confirmed in analyses based on age of depression onset as a continuous variable. CONCLUSION: Neuroticism may be an etiological factor in EOD but not or less so in LOD. This finding contributes to the growing evidence for etiological differences between early- and late...

  6. Psychosocial implications of Thalassemia Major.

    Aydinok, Yesim; Erermis, Serpil; Bukusoglu, Nagihan; Yilmaz, Deniz; Solak, Ufuk

    2005-02-01

    Many causes including the chronicity of disease, burden of treatment modalities, morbidities, and the expectation of early death resulting from the disease complications, may lead to psychosocial burden in Thalassemia Major (TM) patients. A total of 38 patients with TM and their mothers were recruited to evaluate the psychosocial burden as well as to disclose whether the psychological status of the patients contribute to the compliance with the therapy or to the contrary. Demographic and disease variables were obtained. Child Behavior Check-list (CBCL) was completed by the mothers of the patients. A detailed psychiatric interview based on the 4th edition of the Diagnostic and Statistical Manual diagnostic criteria was performed for each patient. Symptom Distress Checklist 90 (SCL-90) scale was given to all mothers for evaluating their psychopathology. Although CBCL scores remained between the normal ranges, desferrioxamine mesylate (DFO)-compliant patients and the patients with lower ferritin values had significantly higher scores. A total of 24% of the patients had a psychiatric diagnosis including major depression, anxiety disorder, tic disorder, and enuresis nocturnal. The psychiatric diagnosis was significantly higher in the patients who were compliant with desferrioxamine compared with the non-compliant group (P = 0.007). The SCL-90 scores indicated that the mothers who had a child with good adherence to DFO had higher scale scores than the mothers with a poor adherent child. The increase risk of psychosocial and behavioral problems in thalassemics and their parents indicated the importance of a lifelong psychosocial support for the prevention of mental health issues. The patients and their parents, who were more conscious of the illness, were more worried but more compliant with the therapy and need stronger psychiatric support.

  7. Thalassaemia major and the heart

    J. Malcolm Walker

    2013-03-01

    Full Text Available Disorders of haemoglobin synthesis are the commonest monogenetic disorders worldwide. When first described, thalassaemia was universally fatal in childhood, but after the adoption of regular blood transfusion survival until early teenage and adulthood was to be expected. At that stage in the life of these affected individuals organ failure followed, due to accumulated iron, for which the human has no excretory capacity. Principal amongst the tissues affected by iron overload is the heart and even to the present day, heart disease accounts for the overwhelming majority of premature deaths in this population. Managing transfusion derived iron overload was the next hurdle for clinicians and the families of the patients. For nearly four decades the only available treatment was the demanding regime of parenteral chelation therapy, required on a daily basis, to achieve growth, development and survival with limited or no organ damage. Despite the adoption of these treatment strategies the outlook for thalassaemia patients remained poor, with a 30% to 40% mortality occurring between late teenage and 30 years of age, even in well organised health care systems, such as in the UK, where regular transfusion and desferioxamine treatment were readily available. This dreadful early mortality, largely as a consequence of myocardial iron overload, (1,2 is now improving so that in the UK and other developed nations, heart failure in thalassaemic patients has become uncommon and premature death a much rarer tragedy. This editorial reviews, from a personal viewpoint of a cardiologist involved in the care of these patients for the last 20 years, the progress in the management of the cardiovascular complications of thalassaemia major (TM, which has followed better techniques of identifying those thalassaemic individuals at greatest risk, improved chelation strategies making best use of the three chelating agents that are now available and improved co

  8. Comparison on Bactericidal and Cytotoxic Effect of Silver Nanoparticles Synthesized by Different Methods

    Mala, R.; Celsia, A. S. Ruby; Malathi Devi, S.; Geerthika, S.

    2017-08-01

    Biologically synthesized silver nanoparticle are biocompatible for medical applications. The present work is aimed to synthesize silver nanoparticle using the fruit pulp of Tamarindusindica and to evaluate its antibacterial and anticancer activity against lung cancercell lines. Antibacterial activity was assessed by well diffusion method. Cytotoxicity was evaluated using MTT assay. GC-MS of fruit pulp extract showed the presence of levoglucosenone, n-hexadecanoic acid, 9,12-octadecadienoic acid etc. Antioxidant activity of the fruit pulp was determined by DPPH assay, hydrogen peroxide scavenging assay and lipid peroxidation. The size of biologically synthesized silver nanoparticle varied from 50 nm to 76 nm. It was 59 nm to 98 nm for chemically synthesized silver nanoparticle. Biologically synthesized silver nanoparticle showed 26 mm inhibition zone against E. coli and chemically synthesized silver nanoparticle showed 20 mm. Antioxidant activity of fruit extract by DPPH showed 84 % reduction. The IC 50 of biologically synthesized silver nanoparticle against lung cancer cell lines was 48 µg/ml. It was 95 µg/ml for chemically synthesized silver nanoparticle. The increased activity of biologically synthesized silver nanoparticle was due to its smaller size, stability and the bioactive compounds capping the silver nanoparticle extracted from the fruit extract.

  9. Microstructure and Corrosion Behavior of Laser Synthesized Cobalt Based Powder on Ti-6Al-4V

    Adesina, O. S.; Popoola, A. P. I.; Pityana, S. L.; Oloruntoba, D. T.

    2018-05-01

    The corrosion behavior of titanium alloys when used for various dynamic offshore components has been a major concern of titanium drilling risers in deepwater energy extraction. A way of achieving specified requirement is the development of coatings suitable to protect the base material against corrosion. In this work, laser cladding technique which is known as a leading edge due to its distinctive properties and outcomes was used in synthesizing Co-based powder on titanium alloy. The processing parameters used were laser power of 900W; scan speed of 0.6 to 1.2 m/min; powderfeedrate1.0g/min;beamspotsize3mm;gasflowrate1.2L/min.The effects of cobalt addition and laser parameters on corrosion behavior of laser clad Ti6AL4V coating in 0.5M sulfuric medium were investigated using linear potentiodynamic polarization. The changes in microstructure and corrosion behavior were analyzed using scanning electron microscopy (SEM) while the X –ray diffraction (XRD) indicates the intermetallics in the coatings. Results showed that the coatings displayed good metallurgical bonding with dendritic formations between the coatings and the substrate. The anodic current density increased with lower scan speed. However, the corrosion current densities of laser-clad samples were lower than Ti6Al4V alloy.

  10. Inactivation of E. Coli in Water Using Photocatalytic, Nanostructured Films Synthesized by Aerosol Routes

    Pratim Biswas

    2013-03-01

    Full Text Available TiO2 nanostructured films were synthesized by an aerosol chemical vapor deposition (ACVD method with different controlled morphologies: columnar, granular, and branched structures for the photocatalytic inactivation of Escherichia coli (E. coli in water. Effects of film morphology and external applied voltage on inactivation rate were investigated. As-prepared films were characterized using scanning electron microscopy (SEM, transmission electron microscopy (TEM, X-ray diffractometry (XRD, and UV-VIS. Photocatalytic and photoelectrochemical inactivation of E. coli using as-prepared TiO2 films were performed under irradiation of UVA light (note: UVA has a low efficiency to inactivate E. coli. Inactivation rate constants for each case were obtained from their respective inactivation curve through a 2 h incubation period. Photocatalytic inactivation rate constants of E. coli are 0.02/min (using columnar films, and 0.08/min (using branched films. The inactivation rate constant for the columnar film was enhanced by 330% by applied voltage on the film while that for the branched film was increased only by 30%. Photocatalytic microbial inactivation rate of the columnar and the branched films were also compared taking into account their different surface areas. Since the majority of the UV radiation that reaches the Earth’s surface is UVA, this study provides an opportunity to use sunlight to efficiently decontaminate drinking water.

  11. Electrical properties of bulk InP synthesized by modified horizontal Bridgman method

    Pak, K.; Matsui, M.; Fukuhara, H.; Nishinaga, T.; Nakamura, T.; Yasuda, Y.

    1986-01-01

    High purity polycrystalline InP has been required for preparation of starting materials in LEC pulling. Usually, these materials are synthesized by the horizontal Bridgman (HB) or gradient freeze (GF) method. The major problem for InP synthesis has been attributed to silicon contamination during the growth, as shown by several workers. In a previous paper, the authors proposed a model in which the silicon contamination would occur due to the transport of SiO and In/sub 2/O gas species from the In-P melt to the phosphorus region by the reaction of the melt with the quartz boat in the HB growth system and suggested that the Si concentration in the In-P melt would have an intimate correlation with the temperature in the phosphorus region. However, the effect of the temperature in the phosphorus region on the electrical properties has not been studied in details as of yet. In this note, a modified horizontal Bridgman (MHB) method was developed to reduce the residual donor impurities, and the reduction mechanism is discussed

  12. Newly synthesized proteins in seminiferous intertubular and intratubular compartments of the rat testis

    Shabanowitz, R.B.; Kierszenbaum, A.L.

    1986-01-01

    Two-dimensional gel electrophoresis combined with autoradiography and Western blot procedures have been used to characterize newly synthesized proteins in testicular intertubular fluid (TIF) and seminiferous tubular fluid (SNF). Fluids were collected following in vivo and in vitro intratesticular injection of [ 35 S]methionine into control and hypophysectomized adult rats. A discrete number of [ 35 S]methionine-labeled proteins were detected within TIF and SNF. Their presence and relative abundance varied according to in vivo and in vitro labeling conditions. While two major blood plasma proteins, albumin and transferrin, were radioactively labeled after in vivo labeling, these two proteins were insignificantly labeled in samples collected after in vitro labeling. Three acidic proteins, possibly secreted by Sertoli cells (Mr = 72,000, 45,000 and 35,000), were more abundant in TIF samples collected after in vitro [ 35 S]methionine labeling than after in vivo labeling. Incubated seminiferous tubules and TIF of hypophysectomized rats showed a decrease in [35S]methionine-labeling intensity of the Mr = 72,000 acidic protein, possibly reflecting changes in the seminiferous epithelium caused by pituitary hormonal deprivation. Autoradiographs of TIF and most remarkably, of SNF, showed many protein spots that suggested cell breakage and leakage during sample collection. Results of this study suggest that most albumin and transferrin found in TIF and SNF have an extratesticular origin and that proteins secreted by the Sertoli cell can gain access to both TIF and SNF

  13. Kinetic modeling of cement slurry synthesized with Henna extract in oil well acidizing treatments

    Amir Hossein Aghajafari

    2016-06-01

    Full Text Available Acidizing treatment in petroleum reservoirs is a short-term and viable strategy to preserve the productivity of a well. There is a major concern for the degradation of cement sheath integrity, leading to poor zonal isolation and environmental issues. Therefore, it is essential to understand how the cement behaves when attacked by hydrochloric acid. In this study, a cement slurry by incorporation of the Henna extract, as an environmentally friendly cement additive, was synthesized as a potential solution to solve this problem. The characteristics of the treated cement slurry were compared with a reference slurry (w/c = 0.44 which is composed of only cement and water. A kinetic study was carried out to evaluate the adsorption behavior of the cement slurries exposed to an acid solution with 0.1 M HCl in a range of 25 to 55 °C conditions. The features of the cement slurries were evaluated by multiple analytical techniques such as XRD, FTIR, TG, and DSC analysis. From the experimental data, it is concluded that the second-order Lagergren kinetic model revealed to be the best in describing kinetic isotherms taken, because the margin between experimental and calculated values was minor for this model. The results of the characterization and HCl interaction kinetic studies underlined the prominent protective role of Henna extract-modified cement slurry in the enhancement of the cement resistance against acid attack and utilization in environmentally favorable oil well acidizing treatments.

  14. Exploiting hidden symmetry in natural products: total syntheses of amphidinolides C and F.

    Mahapatra, Subham; Carter, Rich G

    2013-07-24

    The total synthesis of amphidinolide C and a second-generation synthesis of amphidinolide F have been accomplished through the use of a common intermediate to access both the C1-C8 and the C18-C25 sections. The development of a Ag-catalyzed cyclization of a propargyl benzoate diol is described to access both trans-tetrahydrofuran rings. The evolution of a Felkin-controlled, 2-lithio-1,3-dienyl addition strategy to incorporate C9-C11 diene as well as C8 stereocenter is detailed. Key controlling aspects in the sulfone alkylation/oxidative desulfurization to join the major subunits, including the exploration of the optimum masking group for the C18 carbonyl motif, are discussed. A Trost asymmetric alkynylation and a stereoselective cuprate addition to an alkynoate have been developed for the rapid construction of the C26-C34 subunit. A Tamura/Vedejs olefination to introduce the C26 side arm of amphidnolides C and F is employed. The late-stage incorporation of the C15, C18 diketone motif proved critical to the successful competition of the total syntheses.

  15. Repeatability and Reproducibility of Fibre-Based Nanogenerator Synthesized by Electrospinning Machine

    Suyitno; Huda, Sholiehul; Arifin, Zainal; Hadi, Syamsul; Lambang, Raymundus Lullus

    2014-01-01

    Zinc oxide fibres-based nanogenerators synthesized easily by electrospinning machine are promising to harvest electricity from mechanical energy. However, the repeatability and reproducibility were two major factors needed to be investigated to minimize product failure and to determine the feasibility of mass production of nanogenerators. The green fibres of zinc oxide were produced by electrospinning machine of zinc acetate and polyvinyl alcohol solution at a flow rate of 4 μL/min followed by sintering at temperature 550°C with heating rate 240°C/h. Each 10 nanogenerators was tested by three trained operators with three times of repetition at compressive load 0.5 kg. The nanogenerators revealed the maximum output voltage ranging from 203 to 217 mV. The value of repeatability and reproducibility of nanogenerators was approximately 24.29% showing that nanogenerators were still acceptable to be mass-produced. The relatively low reproducibility was mainly due to the operators, so that the checklist needed to be made easier and simpler for all the variables affecting to the quality of the fibres. Reducing the value of the repeatability and reproducibility is interesting to study further by creating a rotating collector so that the thickness and orientation of fibres can be arranged better

  16. Newly Synthesized Doxorubicin Complexes with Selected Metals—Synthesis, Structure and Anti-Breast Cancer Activity

    Agata Jabłońska-Trypuć

    2017-07-01

    Full Text Available Doxorubicin (DOX is very effective chemotherapeutic agent, however it has several major drawbacks. Therefore the motivation for developing novel drug complexes as anticancer agents with different mechanism of action has arisen. The aim of the present study was to evaluate the influence of newly synthesized DOX complexes with selected metals (Mg, Mn, Co, Ni, Fe, Cu, Zn on apoptosis, cell cycle, viability, proliferation and cytotoxicity in the breast cancer cell line MCF-7. Complexation of DOX with metals has likewise been the subject of our research. The current work showed that the tested bivalent metals at a given pH condition formed metal:DOX complexes in a ratio of 2:1, while iron complexes with DOX in a ratio of 3:1. The studies also showed that selected metal-DOX complexes (Mg-DOX, Mn-DOX, Ni-DOX at 0.5 µM concentration significantly decreased cell viability and proliferation, however they increased caspase 7 activity. Results also indicated that studied metal-DOX complexes showed high cytotoxicity in MCF-7 cells. Therefore they were chosen for cell cycle check-points and apoptosis/necrosis analysis studied by flow cytometry. Obtained results suggest that doxorubicin complexed by specified metals can be considered as a potential anti-breast cancer agent, which is characterized by a higher efficacy than a parent drug.

  17. The Human Nuclear Exosome Targeting Complex Is Loaded onto Newly Synthesized RNA to Direct Early Ribonucleolysis

    Michal Lubas

    2015-01-01

    Full Text Available The RNA exosome complex constitutes the major nuclear eukaryotic 3′-5′ exonuclease. Outside of nucleoli, the human nucleoplasmic exosome is directed to some of its substrates by the nuclear exosome targeting (NEXT complex. How NEXT targets RNA has remained elusive. Using an in vivo crosslinking approach, we report global RNA binding sites of RBM7, a key component of NEXT. RBM7 associates broadly with RNA polymerase II-derived RNA, including pre-mRNA and short-lived exosome substrates such as promoter upstream transcripts (PROMPTs, enhancer RNAs (eRNAs, and 3′-extended products from snRNA and replication-dependent histone genes. Within pre-mRNA, RBM7 accumulates at the 3′ ends of introns, and pulse-labeling experiments demonstrate that RBM7/NEXT defines an early exosome-targeting pathway for 3′-extended snoRNAs derived from such introns. We propose that RBM7 is generally loaded onto newly synthesized RNA to accommodate exosome action in case of available unprotected RNA 3′ ends.

  18. Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins

    Zhang, Kewei; Novak, Ondrej; Wei, Zhaoyang; Gou, Mingyue; Zhang, Xuebin; Yu, Yong; Yang, Huijun; Cai, Yuanheng; Strnad, Miroslav; Liu, Chang-Jun

    2014-02-01

    Cytokinins are a major group of phytohormones regulating plant growth, development and stress responses. However, in contrast to the well-defined polar transport of auxins, the molecular basis of cytokinin transport is poorly understood. Here we show that an ATP-binding cassette transporter in Arabidopsis, AtABCG14, is essential for the acropetal (root to shoot) translocation of the root-synthesized cytokinins. AtABCG14 is expressed primarily in the pericycle and stelar cells of roots. Knocking out AtABCG14 strongly impairs the translocation of trans-zeatin (tZ)-type cytokinins from roots to shoots, thereby affecting the plant’s growth and development. AtABCG14 localizes to the plasma membrane of transformed cells. In planta feeding of C14 or C13-labelled tZ suggests that it acts as an efflux pump and its presence in the cells directly correlates with the transport of the fed cytokinin. Therefore, AtABCG14 is a transporter likely involved in the long-distance translocation of cytokinins in planta.

  19. Identification of a carotenoid oxygenase synthesizing acyclic xanthophylls: combinatorial biosynthesis and directed evolution.

    Mijts, Benjamin N; Lee, Pyung Cheon; Schmidt-Dannert, Claudia

    2005-04-01

    A carotenoid desaturase homolog from Staphylococcus aureus (CrtOx) was identified. When expressed in engineered E. coli cells synthesizing linear C(30) carotenoids, polar carotenoid products were generated, identified as aldehyde and carboxylic acid C(30) carotenoid derivatives. The major product in this engineered pathway is the fully desaturated C(30) dialdehyde carotenoid 4,4'-diapolycopen-4,4'-dial. Very low carotenoid yields were observed when CrtOx was complemented with the C(40) carotenoid lycopene pathway. But extension of an in vitro evolved pathway of the fully desaturated 2,4,2',4'-tetradehydrolycopene produced the structurally novel fully desaturated C(40) dialdehyde carotenoid 2,4,2',4'-tetradehydrolycopendial. Directed evolution of CrtOx by error-prone PCR resulted in a number of variants with higher activity on C(40) carotenoid substrates and improved product profiles. These findings may provide new biosynthetic routes to highly polar carotenoids with unique spectral properties desirable for a number of industrial and pharmaceutical applications.

  20. Synthesizing evidences for policy translation: a public health discourse on rotavirus vaccine in India.

    Panda, Samiran; Das, Aritra; Samanta, Saheli

    2014-08-11

    The debate on the relevance of rotavirus vaccine to immunization program in India, where 27 million children are born every year, rages on. We synthesized the issues raised during these debates and reviewed the current literature to identify themes that could inform public health policy decision. The paradigm we used integrated disease burden data, host and environmental factors, vaccine efficacy, immunization program issues, and economic considerations. Our synthesis reveals that substantive country specific information on disease burden and economic impact of rotavirus illness in India is constrained by lack of public discussion and qualitative studies on mothers' perceptions of the vaccine in concern. The need to improve the performance of current immunization program against six major vaccine preventable diseases (tuberculosis, diphtheria, tetanus, pertussis, polio, and measles) is often cited as a priority over introduction of rotavirus vaccine. Health in India being a state subject, we emphasize that the states which are in a position to reap the benefit of rotavirus vaccine, due to their good immunization program performance, should not be restrained from doing so. Meanwhile, the poorly performing states should step up their vaccination program and increase immunization coverage. Scientific, ethical and societal concerns captured through multiple sources indicate that the introduction of rotavirus vaccine would be a good investment for India. Copyright © 2014. Published by Elsevier Ltd.

  1. Tilecal meets two major milestones

    Cavalli-Sforza, M.

    Over the last two months the Tile Calorimeter passed not one but two major milestones. In early May, the last of the 64 modules that make up one of the two Extended Barrels arrived at CERN from IFAE-Barcelona, equipped with optical components and tested. And during the Overview Week in Clermont-Ferrand, the last of the 64 Barrel modules, mechanically assembled, arrived from JINR-Dubna. Just a brief reminder: the ATLAS Tile Calorimeter is composed of 3 cylinders ("barrels") of steel, scintillating tiles and optical fibers, altogether about 12 m long, with an outer diameter of 8.4 m, and weighing about 2700 tons. The central cavity will contain the Liquid Argon cryostats, and the whole calorimetry system will measure the direction and energy of jets produced at the LHC, as well as the missing transverse energy, which as everyone knows is one of the telltale signals of new and exciting physics. Each of the three cylinders is divided azimuthally into 64 modules - much like the slices of an orange. The modules ar...

  2. Observing System Simulations for ASCENDS: Synthesizing Science Measurement Requirements (Invited)

    Kawa, S. R.; Baker, D. F.; Schuh, A. E.; Crowell, S.; Rayner, P. J.; Hammerling, D.; Michalak, A. M.; Wang, J. S.; Eluszkiewicz, J.; Ott, L.; Zaccheo, T.; Abshire, J. B.; Browell, E. V.; Moore, B.; Crisp, D.

    2013-12-01

    The measurement of atmospheric CO2 from space using active (lidar) sensing techniques has several potentially significant advantages in comparison to current and planned passive CO2 instruments. Application of this new technology aims to advance CO2 measurement capability and carbon cycle science into the next decade. The NASA Active Sensing of Carbon Emissions, Nights, Days, and Seasons (ASCENDS) mission has been recommended by the US National Academy of Sciences Decadal Survey for the next generation of space-based CO2 observing systems. ASCENDS is currently planned for launch in 2022. Several possible lidar instrument approaches have been demonstrated in airborne campaigns and the results indicate that such sensors are quite feasible. Studies are now underway to evaluate performance requirements for space mission implementation. Satellite CO2 observations must be highly precise and unbiased in order to accurately infer global carbon source/sink fluxes. Measurement demands are likely to further increase in the wake of GOSAT, OCO-2, and enhanced ground-based in situ and remote sensing CO2 data. The objective of our work is to quantitatively and consistently evaluate the measurement capabilities and requirements for ASCENDS in the context of advancing our knowledge of carbon flux distributions and their dependence on underlying physical processes. Considerations include requirements for precision, relative accuracy, spatial/temporal coverage and resolution, vertical information content, interferences, and possibly the tradeoffs among these parameters, while at the same time framing a mission that can be implemented within a constrained budget. Here, we attempt to synthesize the results of observing system simulation studies, commissioned by the ASCENDS Science Requirements Definition Team, into a coherent set of mission performance guidelines. A variety of forward and inverse model frameworks are employed to reduce the potential dependence of the results on model

  3. A family of related proteins is encoded by the major Drosophila heat shock gene family

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  4. Writing syntheses for managers: Lessons from the Rainbow Series and Fire Effects Information System

    Jane Kapler Smith; Kristin L. Zouhar; Janet Fryer

    2009-01-01

    Scientific knowledge is essential for sound wildland management, but this knowledge is a complex, ever-expanding resource. Managers often request syntheses or reviews of available knowledge, and scientists have responded with an increasing number of syntheses for managers. Unfortunately, little guidance is available for this kind of writing. While most scientists have...

  5. Accuracy of Repetition of Digitized and Synthesized Speech for Young Children in Background Noise

    Drager, Kathryn D. R.; Clark-Serpentine, Elizabeth A.; Johnson, Kate E.; Roeser, Jennifer L.

    2006-01-01

    Purpose: The present study investigated the intelligibility of digitized and synthesized speech output in background noise for children 3-5 years old. The purpose of the study was to determine whether there was a difference in the intelligibility (ability to repeat) of 3 types of speech output (digitized, DECTalk synthesized, and MacinTalk…

  6. Essential oils-oriented fenvalerate analogues: syntheses, characterization and biological evaluation

    Su, H.; Li, H.

    2016-01-01

    A series of essential oils oriented ester derivatives have been designed, synthesized and characterized based on the skeleton of fenvalerate. The preliminary bioassay results indicated that some of the newly synthesized compounds showed better insecticidal activities against Pyrausta nubilalis and Heliothis armigera than that of the control trans-prallethrin chloride. (author)

  7. A Two-Stage Approach to Synthesizing Covariance Matrices in Meta-Analytic Structural Equation Modeling

    Cheung, Mike W. L.; Chan, Wai

    2009-01-01

    Structural equation modeling (SEM) is widely used as a statistical framework to test complex models in behavioral and social sciences. When the number of publications increases, there is a need to systematically synthesize them. Methodology of synthesizing findings in the context of SEM is known as meta-analytic SEM (MASEM). Although correlation…

  8. [Oromaxillofacial changes in thalassemia major].

    De Mattia, D; Pettini, P L; Sabato, V; Rubini, G; Laforgia, A; Schettini, F

    1996-01-01

    Sixty patients (31 male and 29 female) with thalassemia major, aged between 6 and 26 years, 18 of which were splenectomized, were observed in this study evaluating the oro-maxillo-facial alterations and correlating them to transfusion indexes, serum ferritin levels, splenectomy and age. For each patient a haematologic and odontostomatologic card was filed with a view to report the medical and clinical history regarding: the haematologic picture, the prevention of caries and parodontal disease, the facies characteristics, the odonto-stomatologic examination, the orthodontic diagnosis, the skull X-rays and the orthopantomography. Poor oral hygiene as well as misknowledge of prevention were generally observed. All the patients showed carious lesions but most of them had never seen a dentist for therapy. The disharmonious growth of splanchnocranium, with the enlargement of the jaw and of its alveolar process, induced by the bone marrow hyperplasia, produced various and serious malocclusion stages (Angle's II class, deep bite, open bite), gnathologic alterations, hypodiaphanous paranasal sinuses and orbital hypertelorism, with a typical oriental-like facies. Malocclusion and the poor oral hygienic conditions determined the occurrence of marginal gingivitis, mainly localized at the level of the lower frontal teeth. In only 3 patients the oral mucous membrane was pale and atrophic. During this investigation agenesia and dental retention were reported in 30% and in 26% of the examined cases respectively, while no patients had supernumerary teeth. Tooth volume, position and shape abnormalities rarely occurred. Only in two patients was enamel hypoplasia described. The caries frequency greatly varied in number and in degree. Only five patients did not show any carious lesions. The caries index (DMF) for the permanent teeth calculated in all the 60 subjects was 5, 12 +/- 4.76. By utilizing Spearman's rank test the number of teeth with caries in the permanent dentition (DFM

  9. Chloroplast protein synthesis: thylakoid bound polysomes synthesize thylakoid proteins

    Hurewitz, J.; Jagendorf, A.T.

    1986-01-01

    Previous work indicated more polysomes bound to pea thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus the major effect of light in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus translation initiation and termination probably control the cycling of bound ribosomes. While only 3 to 6% of total RNA is in bound polysomes the incorporation of 3 H-Leu into thylakoids was proportional to the amount of this bound RNA. When Micrococcal nuclease-treated thylakoids were added to labeled runoff translation products of stroma ribosomes, less than 1% of the label adhered to the added membranes; but 37% of the labeled products made by thylakoid polysomes were bound. These data support the concept that stroma ribosomes are recruited into thylakoid proteins

  10. Radio-synthesized protein-based nanoparticles for biomedical purposes

    Varca, Gustavo H.C.; Ferraz, Caroline C.; Lopes, Patricia S.; Mathor, Monica beatriz; Grasselli, Mariano; Lugão, Ademar B.

    2014-01-01

    Protein-crosslinking whether done by enzymatic or chemically induced pathways increases the overall stability of proteins. In the continuous search for alternative routes for protein stabilization we report a novel technique – radio-induced synthesis of protein nanoparticles – to achieve size controlled particles with preserved bioactivity. Papain was used as model enzyme and the samples were irradiated at 10 kGy in a gammacell irradiator in phosphate buffer (pH=7.0) and additives such as ethanol (0–40%) and sodium chloride (0–25%). The structural rearrangement caused by irradiation under defined conditions led to an increase in papain particle size as a function of the additive and its concentration. These changes occur due to intermolecular bindings, of covalent nature, possibly involving the aromatic amino acids. Ethanol held major effects over papain particle size and particle size distribution if compared to sodium chloride. The particles presented relative retained bioactivity and the physic-chemical characterization revealed similar fluorescence spectra indicating preserved conformation. Differences in fluorescence units were observed according to the additive and its concentration, as a result of protein content changes. Therefore, under optimized conditions, the developed technique may be applied for enzyme nanoparticles formation of controllable size and preserved bioactivity. Highlights: • Novel technique for the development of protein nanoparticles using γ-irradiation. • Size control of papain particles with preserved conformation and bioactivity. • Alternative method for controlled protein crosslinking. • Bioactive protein nanoparticles of biotechnological and clinical interest. • Protein-based drug carrier potential of biotechnological and clinical interest

  11. Ribosomal dimerization factor YfiA is the major protein synthesized after abrupt glucose depletion in Lactococcus lactis

    Breuner, Anne; Frees, Dorte; Varmanen, Pekka

    2016-01-01

    R, CcpA, ArgR and AhrC regulons, while protein synthesis stopped due to an extremely low GTP concentration emerging a few minutes after glucose depletion. The yfiA deletion mutant exhibited a longer lag phase upon replenishment of glucose and a faster death rate after prolonged starvation supporting...

  12. Gold nanoparticles synthesized by Brassica oleracea (Broccoli) acting as antimicrobial agents against human pathogenic bacteria and fungi

    Piruthiviraj, Prakash; Margret, Anita; Krishnamurthy, Poornima Priyadharsani

    2016-04-01

    Production of antimicrobial agents through the synthesis of gold nanoparticles using green technology has been extensively made consistent by various researchers; yet, this study uses the flower bud's aqueous extracts of Brassica oleracea (Broccoli) as a reducing agent for chloroauric acid (1 mM). After 30 min of incubation, synthesis of gold nanoparticles (AuNps) was observed by a change in extract color from pale yellow to purple color. Synthesis of AuNps was confirmed in UV-visible spectroscopy at the range of approximately 560 nm. The SEM analysis showed the average nanoparticles size of 12-22 nm. The antimicrobial activity of AuNps was analyzed by subjecting it to human pathogenic bacteria (Gram-positive Staphylococcus aureus and Gram-negative Klebsiella pneumonia) and fungi (Aspergillus flavus, Aspergillus niger and Candida albicans) using disc diffusion method. The broccoli-synthesized AuNps showed the efficient antibacterial and antifungal activity of above-mentioned microbes. It was confirmed that AuNps have the best antimicrobial agent compared to the standard antibiotics (Gentamicin and Fluconazole). When the concentrations of AuNps were increased (10, 25, and 50 µg/ml), the sensitivity zone also increased for all the tested microbes. The synthesized AuNps are capable of rendering high antimicrobial efficacy and, hence, have a great potential in the preparation of drugs used against major bacterial and fungal diseases in humans.

  13. M10.6.6: Designed and manufactured Frequency Synthesizer Board (AMC)

    Czuba, K

    2011-01-01

    The LLRF system require generation of highly stable clock and trigger signals for high precision data processing and synchronous system operation. This deliverable provides an updated AMC module designed to fulfill the LLRF system timing synchronization needs. The module contains three independent clock synthesizers that are able to generate LVDS clock signals in the range of 10 MHz to 100 MHz. The clock synthesizers can be synchronized either by an internal quartz oscillator or an external phase reference signal provided to the board from the FLASH Master Oscillator. Besides clock synthesizers the AMC card contains also an optical receiver suited to convert and decode FLASH timing signals.

  14. Simple syntheses of 3-substituted indoles and their application for high yield 14C-labelling

    Schallenberg, J.; Meyer, E.

    1983-01-01

    Methods are described which allow the synthesis of several plant indole alkaloids and their metabolites at different scales. Compounds synthesized include gramine (1) (3-dimethylaminomethylindole) which is directly derived from indole, while its biosynthetic precursors 3-aminomethylindole (3) and 3-methylaminomethylindole (2) as well as indole3-carboxylic acid (7) are synthesized via indole-3-aldehyde (6). Slight changes of the experimental conditions allow syntheses with high yields not only at the molar but also at the μmolar level. This is extremely useful when isotope labelled compounds of high specific radioactivity are required for studies of plant metabolism. (orig.)

  15. Rhizosecretion of stele-synthesized glucosinolates and their catabolites requires GTR-mediated import in Arabidopsis

    Xu, Deyang; Hanschen, Franziska S.; Witzel, Katja

    2017-01-01

    Casparian strip-generated apoplastic barriers not only control the radial flow of both water and ions but may also constitute a hindrance for the rhizosecretion of stele-synthesized phytochemicals. Here, we establish root-synthesized glucosinolates (GLS) are in Arabidopsis as a model to study...... via the xylem to the shoot; and (iii) GTR-dependent import to GLS-degrading myrosin cells at the cortex. The study suggests a previously undiscovered role of the import process in the rhizosecretion of root-synthesized phytochemicals....

  16. Effect of annealing on the structure of chemically synthesized SnO_2 nanoparticles

    Singh, Kulwinder; Kumar, Akshay; Kumar, Virender; Vij, Ankush; Kumari, Sudesh; Thakur, Anup

    2016-01-01

    Tin oxide (SnO_2) nanoparticles have been synthesized by co-precipitation method. The synthesized nanoparticles were characterized by X-ray diffraction (XRD) and Raman spectroscopy. XRD analysis confirmed the single phase formation of SnO_2 nanoparticles. The Raman shifts showed the typical feature of the tetragonal phase of the as-synthesized SnO_2 nanoparticles. At low annealing temperature, a strong distortion of the crystalline structure and high degree of agglomeration was observed. It is concluded that the crystallinity of SnO_2 nanoparticles improves with the increase in annealing temperature.

  17. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  18. C-E1 fusion protein synthesized by rubella virus DI RNAs maintained during serial passage

    Tzeng, W.-P.; Frey, Teryl K.

    2006-01-01

    Rubella virus (RUB) replicons are derivatives of the RUB infectious cDNA clone that retain the nonstructural open reading frame (NS-ORF) that encodes the replicase proteins but not the structural protein ORF (SP-ORF) that encodes the virion proteins. RUB defective interfering (DI) RNAs contain deletions within the SP-ORF and thus resemble replicons. DI RNAs often retain the 5' end of the capsid protein (C) gene that has been shown to modulate virus-specific RNA synthesis. However, when replicons either with or without the C gene were passaged serially in the presence of wt RUB as a source of the virion proteins, it was found that neither replicon was maintained and DI RNAs were generated. The majority DI RNA species contained in-frame deletions in the SP-ORF leading to a fusion between the 5' end of the C gene and the 3' end of the E1 glycoprotein gene. DI infectious cDNA clones were constructed and transcripts from these DI infectious cDNA clones were maintained during serial passage with wt RUB. The C-E1 fusion protein encoded by the DI RNAs was synthesized and was required for maintenance of the DI RNA during serial passage. This is the first report of a functional novel gene product resulting from deletion during DI RNA generation. Thus far, the role of the C-E1 fusion protein in maintenance of DI RNAs during serial passage remained elusive as it was found that the fusion protein diminished rather than enhanced DI RNA synthesis and was not incorporated into virus particles

  19. Photoluminescent characteristics of ion beam synthesized Ge nanoparticles in thermally grown SiO2 films

    Yu, C.F.; Chao, D.S.; Chen, Y.-F.; Liang, J.H.

    2013-01-01

    Prospects of developing into numerous silicon-based optoelectronic applications have prompted many studies on the optical properties of Ge nanoparticles within a silicon oxide (SiO 2 ) matrix. Even with such abundant studies, the fundamental mechanism underlying the Ge nanoparticle-induced photoluminescence (PL) is still an open question. In order to elucidate the mechanism, we dedicate this study to investigating the correlation between the PL properties and microstructure of the Ge nanoparticles synthesized in thermally grown SiO 2 films. Our spectral data show that the peak position, at ∼3.1 eV or 400 nm, of the PL band arising from the Ge nanoparticles was essentially unchanged under different Ge implantation fluences and the temperatures of the following annealing process, whereas the sample preparation parameters modified or even fluctuated (in the case of the annealing temperature) the peak intensity considerably. Given the microscopically observed correlation between the nanoparticle structure and the sample preparation parameters, this phenomenon is consistent with the mechanism in which the oxygen-deficiency-related defects in the Ge/SiO 2 interface act as the major luminescence centers; this mechanism also successfully explains the peak intensity fluctuation with the annealing temperature. Moreover, our FTIR data indicate the formation of GeO x upon ion implantation. Since decreasing of the oxygen-related defects by the GeO x formation is expected to be correlated with the annealing temperature, presence of the GeO x renders further experimental support to the oxygen defect mechanism. This understanding may assist the designing of the manufacturing process to optimize the Ge nanoparticle-based PL materials for different technological applications

  20. Changes of electrochemical properties of polypyrrole when synthesized in a room-temperature ionic liquid

    Dalmolin, Carla, E-mail: carla.dalmolin@udesc.br; Biaggio, Sonia R.; Bocchi, Nerilso; Rocha-Filho, Romeu C.

    2014-09-15

    The room-temperature ionic liquid (RTIL) 1-butyl-3-methylimidazolium tetrafluoroborate, BMIM BF{sub 4}, was employed as electrolyte in the electrosynthesis of thin polypyrrole (PPy) films on a Pt substrate, and the resulting PPy electrodes were electrochemically characterized. Electrochemical impedance spectroscopy (EIS) was used to comparatively investigate the electric behavior of PPy produced in the RTIL and the one produced in a traditional acetonitrile/lithium salt system, and charge–discharge curves in the range 2.0–4.0 V (vs. Li/Li{sup +}) were obtained in a 1.0 M LiBF{sub 4} propylene carbonate solution. Although a reduction of the specific capacity for the PPy obtained in the RTIL was observed, compared to that of the PPy film synthesized in the acetonitrilic electrolyte, its chronopotentiometric profile presented a plateau in the 2.7 V region. This is a remarkable result, considering that a linear decrease in this profile is usually observed for the majority of conducting polymer cathodes. PPy films obtained in BMIM BF{sub 4} presented globular morphology, with a special arrangement of nanoparticles constituting the globules; the EIS results indicated that this nanoscale structure may be contributing to a better definition of the redox characteristics during the PPy charge–discharge processes, as it happens for the well-organized structure of some metal oxides. - Highlights: • PPy was produced in an ionic liquid medium as active material for battery electrodes. • Discharge curves present a plateau not usual for conducting polymer electrodes. • RTIL used as synthesis electrolyte produced PPy with surface nanograins. • Morphological features explain the improved redox properties of PPy electrode. • Electrical properties of PPy grown in RTIL were accessed by impedance measurements.

  1. Study of photocatalytic activities of Bi{sub 2}WO{sub 6} nanoparticles synthesized by fast microwave-assisted method

    Phu, Nguyen Dang [Faculty of Physics, Hanoi National University of Education, 136 Xuanthuy, Cau Giay, Hanoi (Viet Nam); Hoang, Luc Huy, E-mail: hoanglhsp@hnue.edu.vn [Faculty of Physics, Hanoi National University of Education, 136 Xuanthuy, Cau Giay, Hanoi (Viet Nam); Chen, Xiang-Bai, E-mail: xchen@wit.edu.cn [School of Science and Laboratory of Optical Information Technology, Wuhan Institute of Technology, Wuhan 430205 (China); Kong, Meng-Hong [School of Science and Laboratory of Optical Information Technology, Wuhan Institute of Technology, Wuhan 430205 (China); Wen, Hua-Chiang; Chou, Wu Ching [Department of Electrophysics, National Chiao Tung University, Hsin-Chu 30010, Taiwan (China)

    2015-10-25

    We present a study of photocatalytic activities of Bi{sub 2}WO{sub 6} nanoparticles synthesized by fast microwave-assisted method. The photocatalytic activities of the nanoparticles were evaluated by the decolorization of methylene-blue under visible-light-irradiation. Our results show that the surface area of Bi{sub 2}WO{sub 6} nanoparticles plays a major role for improving photocatalytic activity, while visible-light absorption has only a weak effect on photocatalytic activity. This suggests efficient transportation of photo-generated electrons and holes to the oxidation active sites on the surface of nanoparticles, indicating Bi{sub 2}WO{sub 6} nanoparticles synthesized by fast microwave-assisted method are promising for achieving high photocatalytic activity under visible-light-irradiation. - Highlights: • The Bi{sub 2}WO{sub 6} nanoparticles were synthesized via fast microwave-assisted method. • The obtained Bi{sub 2}WO{sub 6} nanoparticles exhibited visible-light absorbance. • The surface area of Bi{sub 2}WO{sub 6} nanoparticles plays major role for improving photocatalytic activity. • The Bi{sub 2}WO{sub 6} nanoparticles are promising for achieving high photocatalytic activity under visible-light-irradiation.

  2. Catalytically active and hierarchically porous SAPO-11 zeolite synthesized in the presence of polyhexamethylene biguanidine

    Liu, Yan; Qu, Wei; Chang, Weiwei; Pan, Shuxiang; Tian, Zhijian; Meng, Xiangju; Rigutto, Marcello; Made, Alexander van der; Zhao, Lan; Zheng, Xiaoming; Xiao, Feng Shou

    2014-01-01

    Hierarchically porous SAPO-11 zeolite (H-SAPO-11) is rationally synthesized from a starting silicoaluminophosphate gel in the presence of polyhexamethylene biguanidine as a mesoscale template. The sample is well characterized by XRD, N2 sorption

  3. Anionic polymerization and polyhomologation: An ideal combination to synthesize polyethylene-based block copolymers

    Zhang, H.; Alkayal, N.; Gnanou, Yves; Hadjichristidis, Nikolaos

    2013-01-01

    A novel one-pot methodology combining anionic polymerization and polyhomologation, through a "bridge" molecule (BF3OEt 2), was developed for the synthesis of polyethylene (PE)-based block copolymers. The anionically synthesized macroanion reacts

  4. The multilayered structure of ultrathin amorphous carbon films synthesized by filtered cathodic vacuum arc deposition

    Wang, Na; Komvopoulos, Kyriakos

    2013-01-01

    The structure of ultrathin amorphous carbon (a-C) films synthesized by filtered cathodic vacuum arc (FCVA) deposition was investigated by high-resolution transmission electron microscopy, electron energy loss spectroscopy, and x-ray photoelectron

  5. A Critical Analysis of Global Competition in Higher Education: Synthesizing Themes

    Portnoi, Laura M.; Bagley, Sylvia S.

    2014-01-01

    In this final chapter of the volume, the editors synthesize key themes that emerge from the preceding chapters. They also highlight the contributions the authors make through emphasizing critical perspectives and the tension between global and local forces.

  6. Solid ceramic based on mixed-frame titanium phosphate and calcium synthesized in solar furnace

    Salikhov, T. P.; Kan, V. V.; Urazaeva, Eh. M.; Savatyugina, T. V.; Arushanov, G. M.

    2012-01-01

    The authors synthesized of mixed orthophosphates Ca 0 . 5 Ti 2 (PO 4 ) 3 using concentrated solar radiation. We obtained a porous ceramic filter with the given type of NZP structure and high thermal and hydrolytic stability. (authors)

  7. Syntheses and spectroscopic properties of mercury(II) and nickel(II ...

    Syntheses and spectroscopic properties of mercury(II) and nickel(II) ... The complexes were characterized by IR, diffuse reflectance, 1H NMR spectra and elemental ... coordinating through thiolato sulphur and hydrazinic nitrogen atoms.

  8. Global transgenerational gene expression dynamics in two newly synthesized allohexaploid wheat (Triticum aestivum lines

    Qi Bao

    2012-01-01

    Full Text Available Abstract Background Alteration in gene expression resulting from allopolyploidization is a prominent feature in plants, but its spectrum and extent are not fully known. Common wheat (Triticum aestivum was formed via allohexaploidization about 10,000 years ago, and became the most important crop plant. To gain further insights into the genome-wide transcriptional dynamics associated with the onset of common wheat formation, we conducted microarray-based genome-wide gene expression analysis on two newly synthesized allohexaploid wheat lines with chromosomal stability and a genome constitution analogous to that of the present-day common wheat. Results Multi-color GISH (genomic in situ hybridization was used to identify individual plants from two nascent allohexaploid wheat lines between Triticum turgidum (2n = 4x = 28; genome BBAA and Aegilops tauschii (2n = 2x = 14; genome DD, which had a stable chromosomal constitution analogous to that of common wheat (2n = 6x = 42; genome BBAADD. Genome-wide analysis of gene expression was performed for these allohexaploid lines along with their parental plants from T. turgidum and Ae. tauschii, using the Affymetrix Gene Chip Wheat Genome-Array. Comparison with the parental plants coupled with inclusion of empirical mid-parent values (MPVs revealed that whereas the great majority of genes showed the expected parental additivity, two major patterns of alteration in gene expression in the allohexaploid lines were identified: parental dominance expression and non-additive expression. Genes involved in each of the two altered expression patterns could be classified into three distinct groups, stochastic, heritable and persistent, based on their transgenerational heritability and inter-line conservation. Strikingly, whereas both altered patterns of gene expression showed a propensity of inheritance, identity of the involved genes was highly stochastic, consistent with the involvement of diverse Gene Ontology (GO

  9. Lipase-katalysierte Synthese strukturierter Triglyceride: Verfahrensoptimierung und Erzeugung selektiver Lipasemutanten durch gerichtete Evolution

    Schmid, Ulrike

    1999-01-01

    In der vorliegenden Arbeit wurde zum einen die Lipase-Katalysierte Synthese strukturierter Triglyceride, zum anderen die Veränderung der Kettenlängenselektivität der slip1-Lipase aus C. rugosa durch gerichtete Evolution untersucht. Besonderes Interesse galt der Synthese von strukturierten Triglyceriden des ABA-Typs, die aufgrund ihrer symmetrischen Struktur zur Therapie von Fettabsorptionsproblemen wie z.B. Pankreasinsuffizienz eingesetzt werden können. Besonderes Interesse galt dabei der ...

  10. Impact of 50% Synthesized Iso-Paraffins (SIP) on F-76 Fuel Coalescence

    2013-12-16

    petroleum JP-5 and Synthesized Iso-Paraffins (SIP). SIP fuels are made from direct fermentation of sugar into olefinic hydrocarbons. The olefinic...manufactured scaled down filter/coalescer and separator to simulate the performance of a full-scale filter separator system. This test is designed to predict...5 and Synthesized Iso-Paraffins (SIP). SIP fuels are made from direct fermentation of sugar into olefinic hydrocarbons. The olefinic hydrocarbons

  11. A Study On Dispersion Stability Of Nickel Nanoparticles Synthesized By Wire Explosion In Liquid Media

    Kim C.K.; Lee G.-J.; Lee M.K.; Rhee C.K.

    2015-01-01

    In this study, nickel nanoparticles were synthesized in ethanol using portable pulsed wire evaporation, which is a one-step physical method. From transmission electron microscopy images, it was found that the Ni nanoparticles exhibited a spherical shape with an average diameter of 7.3 nm. To prevent aggregation of the nickel nanoparticles, a polymer surfactant was added into the ethanol before the synthesis of nickel nanoparticles, and adsorbed on the freshly synthesized nickel nanoparticles ...

  12. Biomimetic Syntheses of Callistrilones A-E via an Oxidative [3 + 2] Cycloaddition.

    Guo, Yonghong; Zhang, Yuhan; Xiao, Mingxing; Xie, Zhixiang

    2018-04-16

    Concise total syntheses of callistrilones A-E have been achieved from 7 and commercially available α-phellandrene (8). The synthetic strategy, which was primarily inspired by the biogenetic hypothesis, was enabled by an oxidative [3 + 2] cycloaddition followed by a Michael addition and an intramolecular nucleophilic addition to construct the target molecules. Moreover, viminalin I was also synthesized, and its absolute configuration was unambiguously confirmed.

  13. Major Highway Lines, US, 2015, NAVTEQ

    U.S. Environmental Protection Agency — NAVTEQ Major Highways for the United States. The Major Highways layer contains Road Network features based on the Functional Class attribute value on each link...

  14. Synthesizer: Expediting synthesis studies from context-free data with information retrieval techniques.

    Lisa M Gandy

    Full Text Available Scientists have unprecedented access to a wide variety of high-quality datasets. These datasets, which are often independently curated, commonly use unstructured spreadsheets to store their data. Standardized annotations are essential to perform synthesis studies across investigators, but are often not used in practice. Therefore, accurately combining records in spreadsheets from differing studies requires tedious and error-prone human curation. These efforts result in a significant time and cost barrier to synthesis research. We propose an information retrieval inspired algorithm, Synthesize, that merges unstructured data automatically based on both column labels and values. Application of the Synthesize algorithm to cancer and ecological datasets had high accuracy (on the order of 85-100%. We further implement Synthesize in an open source web application, Synthesizer (https://github.com/lisagandy/synthesizer. The software accepts input as spreadsheets in comma separated value (CSV format, visualizes the merged data, and outputs the results as a new spreadsheet. Synthesizer includes an easy to use graphical user interface, which enables the user to finish combining data and obtain perfect accuracy. Future work will allow detection of units to automatically merge continuous data and application of the algorithm to other data formats, including databases.

  15. Why It Pays to Major in Economics

    Carroll, Thomas; Assane, Djeto; Busker, Jared

    2014-01-01

    In this article, the authors use a large, recent, and accessible data set to examine the effect of economics major on individual earnings. They find a significant positive earnings gain for economics majors relative to other majors, and this advantage increases with the level of education. Their findings are consistent with Black, Sanders, and…

  16. 75 FR 31383 - Major Capital Investment Projects

    2010-06-03

    ...-0009] RIN 2132-AB02 Major Capital Investment Projects AGENCIES: Federal Transit Administration (FTA... current approach to evaluating and rating major capital investment projects (``New Starts'' and ``Small...'' to address identified transportation needs in the corridor without a major capital investment in new...

  17. The Prototypical Majority Effect Under Social Influence.

    Koriat, Asher; Adiv-Mashinsky, Shiri; Undorf, Monika; Schwarz, Norbert

    2018-05-01

    Majority views are reported with greater confidence and fluency than minority views, with the difference increasing with majority size. This Prototypical Majority Effect (PME) was attributed generally to conformity pressure, but Koriat et al. showed that it can arise from the processes underlying decision and confidence independent of social influence. Here we examined the PME under conditions that differ in social influence. In Experiment 1, a robust PME emerged in the absence of information about the majority views, but the provision sof that information increased the choice of the majority view and magnified the PME. In Experiment 2, a PME emerged in a minority-biased condition that misled participants to believe that the majority view was the minority view, but the PME was stronger in a majority-biased condition. The results were discussed in terms of a dual-process view: The PME observed under social influence may contain externally driven and internally driven components.

  18. A fractional-N frequency synthesizer for wireless sensor network nodes

    Ma Xiao; Du Zhankun; Liu Chang; Liu Ke; Yan Yuepeng; Ye Tianchun

    2014-01-01

    This paper presents a fractional-N frequency synthesizer for wireless sensor network (WSN) nodes. The proposed frequency synthesizer adopts a phase locked loop (PLL) based structure, which employs an LC voltage-controlled oscillator (VCO) with small VCO gain (K VCO ) and frequency step (f step ) variations, a charge pump (CP) with current changing in proportion with the division ratio and a 20-bit ΔΣ modulator, etc. To realize constant K VCO and f step , a novel capacitor sub-bands grouping method is proposed. The VCO sub-groups' sizes are arranged according to the maximal allowed K VCO variation of the system. Besides, a current mode logic divide-by-2 circuit with inside-loop buffers ensures the synthesizer generates I/Q quadrature signals robustly. This synthesizer is implemented in a 0.13 μm CMOS process. Measurement results show that the frequency synthesizer has a frequency span from 2.07 to 3.11 GHz and the typical phase noise is −86.34 dBc/Hz at 100 kHz offset and −114.17 dBc/Hz at 1 MHz offset with a loop bandwidth of about 200 kHz, which meet the WSN nodes' requirements. (semiconductor integrated circuits)

  19. Fast, High-Precision Optical Polarization Synthesizer for Ultracold-Atom Experiments

    Robens, Carsten; Brakhane, Stefan; Alt, Wolfgang; Meschede, Dieter; Zopes, Jonathan; Alberti, Andrea

    2018-03-01

    We present a technique for the precision synthesis of arbitrary polarization states of light with a high modulation bandwidth. Our approach consists of superimposing two laser light fields with the same wavelength, but with opposite circular polarizations, where the phase and the amplitude of each light field are individually controlled. We find that the polarization-synthesized beam reaches a degree of polarization of 99.99%, which is mainly limited by static spatial variations of the polarization state over the beam profile. We also find that the depolarization caused by temporal fluctuations of the polarization state is about 2 orders of magnitude smaller. In a recent work, Robens et al. [Low-Entropy States of Neutral Atoms in Polarization-Synthesized Optical Lattices, Phys. Rev. Lett. 118, 065302 (2017), 10.1103/PhysRevLett.118.065302] demonstrated an application of the polarization synthesizer to create two independently controllable optical lattices which trap atoms depending on their internal spin state. We use ultracold atoms in polarization-synthesized optical lattices to give an independent, in situ demonstration of the performance of the polarization synthesizer.

  20. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  1. Production of medically valuable stilbenes and emodin in knotweed

    Frantík, Tomáš; Kovářová, M.; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav

    2013-01-01

    Roč. 50, oct.2013 (2013), s. 237-243 ISSN 0926-6690 R&D Projects: GA MŠk 1M0571 Institutional support: RVO:67985939 Keywords : knokweed * resveratrol * emodin Subject RIV: EF - Botanics Impact factor: 3.208, year: 2013

  2. [Homoisoflavanones and stilbenes from fresh bulb of Scilla scilloides].

    Wang, Yan-Min; Fan, Meng-Yang; Li, Juan; Wang, Zhi-Min; Gao, Hui-Min

    2014-10-01

    Mian-Zao-Er was collected from the bulbs of Scilla scilloides (Lindl. ) Druce, belonging to the Hyacinthaceae family. 17 compounds were obtained using various column chromatographies on macroporus resin (HPD100), silica gel, Sephadex LH-20 and ODS, as well as semi-preparative HPLC. Their structures were elucidated on the basis of physicochemical properties and spectral data as 2-hydroxy-7-methoxyscillascillin (1), scillascillin (2), 5,7-dihydroxy-3',4'-dimethoxyspiro 2H-1-benzopyran-7'-bicyclo[4.2.0 ] octa [1,3,5 ] -trien } -4-one (3), socialinone (4), 4-methylresveratrol (5), (E)-resveratrol (6), scillavoneA (7), 3,9-di- hydroeucomnalin (8), 3-(3-hydroxy-4-methoxybenzyl) -5,7-dihydroxychroman-4-one (9), (3R)-5,7,3'-trihydroxy-4'-methoxyspiro (2H-1-benzopyran-7'-bicyclo[4, 2, 0] octa [1, 3, 5]-trien} -4-one (10), scillabene A (11), 2-hydroxyscillascillin (12), 3-(4-hydroxybenzyl) -5,7-dihydroxychroman-4-one (13), 3-( 4-hydroxybenzylidene) -5, 7-dihydroxychroman-4-one (14), 3-( 4-hydroxybenzyl) -5-hydroxy-7,8-dimethoxychroman-4-one (15), 3-(4-hydroxybenzyl) -5-hydroxy-6, 7-dimethoxychroman-4-one (16), and 3-(4-hydroxybenzyl)-5,8-hydroxy-7-methoxychroman-4-one (17). Among them, compounds 3, 4, 6, 9, 13 and 15-17 were isolated from this plant for the first time.

  3. Majorization arrow in quantum-algorithm design

    Latorre, J.I.; Martin-Delgado, M.A.

    2002-01-01

    We apply majorization theory to study the quantum algorithms known so far and find that there is a majorization principle underlying the way they operate. Grover's algorithm is a neat instance of this principle where majorization works step by step until the optimal target state is found. Extensions of this situation are also found in algorithms based in quantum adiabatic evolution and the family of quantum phase-estimation algorithms, including Shor's algorithm. We state that in quantum algorithms the time arrow is a majorization arrow

  4. Performance profiles of major energy producers 1989

    1991-01-23

    Performance Profiles of Major Energy Producers 1989 is the thirteenth annual report of the Energy Information Administration's (EIA) Financial Reporting System (FRS). The report examines financial and operating developments, with particular reference to the 23 major energy companies (the FRS companies'') required to report annually on Form EIA-28. Financial information is reported by major lines of business including oil and gas production, petroleum refining and marketing, and other energy operations. Domestic and international operations are examined separately in this report. It also traces key developments affecting the financial performance of major energy companies in 1989, as well as review of important trends.

  5. Performance profiles of major energy producers, 1991

    1992-01-01

    Performance Profiles of Major Energy Producers 1991 is the fifteenth annual report of the Energy Information Administration's (EIA) Financial Reporting System (FRS). The report examines financial and operating developments, with particular reference to the 23 major energy companies (the FRS companies) required to report annually on Form EIA-28. It also traces key developments affecting the financial performance of major energy companies in 1991, as well as reviews important trends. Financial information is reported by major lines of business including oil and gas production, petroleum refining and marketing, and other energy operations. Domestic and international operations are examined separately in this report

  6. Y2O3-MgO Nano-Composite Synthesized by Plasma Spraying and Thermal Decomposition of Solution Precursors

    Muoto, Chigozie Kenechukwu

    This research aims to identify the key feedstock characteristics and processing conditions to produce Y2O3-MgO composite coatings with high density and hardness using solution precursor plasma spray (SPPS) and suspension plasma spray (SPS) processes, and also, to explore the phenomena involved in the production of homogenized nano-composite powders of this material system by thermal decomposition of solution precursor mixtures. The material system would find potential application in the fabrication of components for optical applications such as transparent windows. It was shown that a lack of major endothermic events during precursor decomposition and the resultant formation of highly dense particles upon pyrolysis are critical precursor characteristics for the deposition of dense and hard Y2O3-MgO coatings by SPPS. Using these principles, a new Y2O3-MgO precursor solution was developed, which yielded a coating with Vickers hardness of 560 Hv. This was a considerable improvement over the hardness of the coatings obtained using conventional solution precursors, which was as low as 110 Hv. In the thermal decomposition synthesis process, binary solution precursor mixtures of: yttrium nitrate (Y[n]) or yttrium acetate (Y[a]), with magnesium nitrate (Mg[n]) or magnesium acetate (Mg[a]) were used in order to study the effects of precursor chemistry on the structural characteristics of the resultant Y2O3-MgO powders. The phase domains were coarse and distributed rather inhomogeneously in the materials obtained from the Y[n]Mg[n] and Y[a]Mg[a] mixtures; finer and more homogeneously-distributed phase domains were obtained for ceramics produced from the Y[a]Mg[n] and Y[n]Mg[a] mixtures. It was established that these phenomena were related to the thermal characteristics for the decomposition of the precursors and their effect on phase separation during oxide crystallization. Addition of ammonium acetate to the Y[n[Mg[n] mixture changed the endothermic process to exothermic

  7. Nanostructured tungsten trioxide thin films synthesized for photoelectrocatalytic water oxidation: a review.

    Zhu, Tao; Chong, Meng Nan; Chan, Eng Seng

    2014-11-01

    The recent developments of nanostructured WO3 thin films synthesized through the electrochemical route of electrochemical anodization and cathodic electrodeposition for the application in photoelectrochemical (PEC) water splitting are reviewed. The key fundamental reaction mechanisms of electrochemical anodization and cathodic electrodeposition methods for synthesizing nanostructured WO3 thin films are explained. In addition, the effects of metal oxide precursors, electrode substrates, applied potentials and current densities, and annealing temperatures on size, composition, and thickness of the electrochemically synthesized nanostructured WO3 thin films are elucidated in detail. Finally, a summary is given for the general evaluation practices used to calculate the energy conversion efficiency of nanostructured WO3 thin films and a recommendation is provided to standardize the presentation of research results in the field to allow for easy comparison of reported PEC efficiencies in the near future. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Characterization of hydrothermally synthesized SnS nanoparticles for solar cell application

    Rajwar, Birendra Kumar; Sharma, Shailendra Kumar

    2018-05-01

    In the present study, SnS nanoparticles were synthesized by simple hydrothermal method using stannous chloride and thiourea as tin (Sn) and sulfur (S) precursor respectively. Synthesized nanoparticles were characterized by X-ray diffraction (XRD), Field Emission Scanning Electron Microscopy and UV-Vis Spectroscopy techniques. XRD pattern reveals that as-prepared nanoparticles exhibit orthorhombic structure. Average particles size was calculated using Scherrer's formula and found to be 23 nm. FESEM image shows that the as-prepared nanoparticles are in plate like structure. Direct optical band gap (Eg) of as-synthesized nanoparticles was calculated through UV-Vis Spectroscopy measurement and found to be 1.34 eV, which is near to optimum need for photovoltaic solar energy conversion (1.5 eV). Thus this SnS, narrowband gap semiconductor material can be applied as an alternative absorber material for solar cell application.

  9. Recent progress in solution plasma-synthesized-carbon-supported catalysts for energy conversion systems

    Lun Li, Oi; Lee, Hoonseung; Ishizaki, Takahiro

    2018-01-01

    Carbon-based materials have been widely utilized as the electrode materials in energy conversion and storage technologies, such as fuel cells and metal-air batteries. In these systems, the oxygen reduction reaction is an important step that determines the overall performance. A novel synthesis route, named the solution plasma process, has been recently utilized to synthesize various types of metal-based and heteroatom-doped carbon catalysts. In this review, we summarize cutting-edge technologies involving the synthesis and modeling of carbon-supported catalysts synthesized via solution plasma process, followed by current progress on the electrocatalytic performance of these catalysts. This review provides the fundamental and state-of-the-art performance of solution-plasma-synthesized electrode materials, as well as the remaining scientific and technological challenges for this process.

  10. Multi-Band Multi-Tone Tunable Millimeter-Wave Frequency Synthesizer For Satellite Beacon Transmitter

    Simons, Rainee N.; Wintucky, Edwin G.

    2016-01-01

    This paper presents the design and test results of a multi-band multi-tone tunable millimeter-wave frequency synthesizer, based on a solid-state frequency comb generator. The intended application of the synthesizer is in a satellite beacon transmitter for radio wave propagation studies at K-band (18 to 26.5 GHz), Q-band (37 to 42 GHz), and E-band (71 to 76 GHz). In addition, the architecture for a compact beacon transmitter, which includes the multi-tone synthesizer, polarizer, horn antenna, and power/control electronics, has been investigated for a notional space-to-ground radio wave propagation experiment payload on a small satellite. The above studies would enable the design of robust high throughput multi-Gbps data rate future space-to-ground satellite communication links.

  11. A study on the effect of chemically synthesized magnetite nanoparticles on earthworm: Eudrilus eugeniae

    Samrot, Antony V.; Justin, C.; Padmanaban, S.; Burman, Ujjala

    2017-02-01

    Most look into the benefits of the nanoparticles, but keeping aside the benefits; this study focuses on the impacts of nanoparticles on living systems. Improper disposal of nanoparticles into the environment is a subject of pollution or nano-pollution which in turn affects the flora and fauna in the ecosystem, particularly soil ecosystem. Thus, this study was done to understand the impacts of chemically synthesized magnetite nanoparticles on earthworm— Eudrilus eugeniae, a soil-dependent organism which acquires food and nutrition from decaying matters. The chemically synthesized magnetite nanoparticles were characterized by UV-visible spectrophotometry, Fourier transform infrared spectroscopy and field emission scanning electron microscopy. Earthworms were allowed to interact with different concentrations of synthesized nanoparticles and the effect of the nanoparticles was analysed by studying the phenotypic changes followed by histology and inductively coupled plasma optical emission spectrometry analyses.

  12. Characterization of nano-crystalline ZrO{sub 2} synthesized via reactive plasma processing

    Jayakumar, S., E-mail: sjayakumar.physics@gmail.com [Research and Development Centre, Bharathiar University, Coimbatore 641 014 (India); Ananthapadmanabhan, P.V. [Laser and Plasma Technology Division, BARC, Trombay, Mumbai 400 085 (India); Perumal, K. [Department of Physics, Sri Ramakrishna Mission Vidyalaya College of Arts and Science, Coimbatore 641 020 India (India); Thiyagarajan, T.K. [Laser and Plasma Technology Division, BARC, Trombay, Mumbai 400 085 (India); Mishra, S.C. [Department of Metallurgical and Materials Engg, National Institute of Technology, Rourkela 769 008 (India); Su, L.T.; Tok, A.I.Y.; Guo, J. [School of Materials Science and Engg, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639 798 (Singapore)

    2011-07-25

    Highlights: > Direct conversion of micron-sized zirconium hydride powder to nanocrystalline ZrO{sub 2} powder. > The experimental approach uses reactive plasma processing technique. > The product has been characterized by various analytical tools to support the findings. - Abstract: Nano-crystalline ZrO{sub 2} powder has been synthesized via reactive plasma processing. The synthesized ZrO{sub 2} powders were characterized by X-ray diffraction (XRD), Raman spectroscopy, transmission electron microscopy (TEM) and FTIR spectroscopy. The synthesized powder consists of a mixture of tetragonal and monoclinic phases of zirconia. Average crystallite size calculated from the XRD pattern shows that particles with crystallite size 20 nm or less than 20 nm are in tetragonal phase, whereas particles greater than 20 nm are in the monoclinic phase. TEM results show that particles have spherical morphology with maximum percentage of particles distributed in a narrow size from about 15 nm to 30 nm.

  13. Biogenic silver and gold nanoparticles synthesized using red ginseng root extract, and their applications.

    Singh, Priyanka; Kim, Yeon Ju; Wang, Chao; Mathiyalagan, Ramya; El-Agamy Farh, Mohamed; Yang, Deok Chun

    2016-05-01

    In the present study, we report a green methodology for the synthesis of silver and gold nanoparticles, using the root extract of the herbal medicinal plant Korean red ginseng. The silver and gold nanoparticles were synthesized within 1 h and 10 min respectively. The nanoparticles generated were not aggregated, and remained stable for a long time, which suggests the nature of nanoparticles. The phytochemicals and ginsenosides present in the root extract assist in reducing and stabilizing the synthesized nanoparticles. The red ginseng root extract-generated silver nanoparticles exhibit antimicrobial activity against pathogenic microorganisms including Vibrio parahaemolyticus, Staphylococcus aureus, Bacillus cereus, and Candida albicans. In addition, the silver nanoparticles exhibit biofilm degrading activity against S. aureus and Pseudomonas aeruginosa. Thus, the present study opens up a new possibility of synthesizing silver and gold nanoparticles in a green and rapid manner using Korean red ginseng root extract, and explores their biomedical applications.

  14. Synthesized view comparison method for no-reference 3D image quality assessment

    Luo, Fangzhou; Lin, Chaoyi; Gu, Xiaodong; Ma, Xiaojun

    2018-04-01

    We develop a no-reference image quality assessment metric to evaluate the quality of synthesized view rendered from the Multi-view Video plus Depth (MVD) format. Our metric is named Synthesized View Comparison (SVC), which is designed for real-time quality monitoring at the receiver side in a 3D-TV system. The metric utilizes the virtual views in the middle which are warped from left and right views by Depth-image-based rendering algorithm (DIBR), and compares the difference between the virtual views rendered from different cameras by Structural SIMilarity (SSIM), a popular 2D full-reference image quality assessment metric. The experimental results indicate that our no-reference quality assessment metric for the synthesized images has competitive prediction performance compared with some classic full-reference image quality assessment metrics.

  15. A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

    Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang

    2009-01-01

    A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 μm CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm 2 .

  16. A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

    Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang, E-mail: yumeihuang@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)

    2009-09-15

    A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 {mu}m CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm{sup 2}.

  17. Enhanced antibacterial activity of zinc oxide nanoparticles synthesized using Petroselinum crispum extracts

    Stan, Manuela, E-mail: manuela.stan@itim-cj.ro; Popa, Adriana; Toloman, Dana; Silipas, Teofil-Danut [National Institute for Research and Development of Isotopic and Molecular Technologies, 67-103 Donat, 400293 Cluj-Napoca (Romania); Vodnar, Dan Cristian [University of Agricultural Sciences and Veterinary Medicine, Department of Food Science and Technology, 3-5 Manastur Street, 400372 Cluj-Napoca (Romania); Katona, Gabriel [Babes-Bolyai University, Faculty of Chemistry and Chemical Engineering, 11 Arany Janos Street, 400028 Cluj-Napoca (Romania)

    2015-12-23

    The present contribution reports the synthesis of zinc oxide nanoparticles (ZnO NPs) using aqueous leaf and root extracts of Petroselinum crispum (parsley) and characterization of as-prepared samples. ZnO NPs are subjected to X-ray diffraction (XRD), transmission electron microscopy (TEM) and electron paramagnetic resonance (EPR) studies. The XRD studies reveal a hexagonal wurtzite structure without supplementary diffraction lines for all ZnO samples. TEM analysis shows that the particle size is influenced by the type of plant extract. The EPR spectra indicate the presence of Mn{sup 2+} ions in ZnO sample synthesized using P. crispum leaf extract, while zinc vacancy complexes and oxygen vacancies are evidenced in all analyzed samples. ZnO NPs synthesized using P. crispum extracts exhibit increased (2-16 times) antibacterial activity as compared to chemically synthesized ZnO NPs.

  18. Enhanced antibacterial activity of zinc oxide nanoparticles synthesized using Petroselinum crispum extracts

    Stan, Manuela; Popa, Adriana; Toloman, Dana; Silipas, Teofil-Danut; Vodnar, Dan Cristian; Katona, Gabriel

    2015-01-01

    The present contribution reports the synthesis of zinc oxide nanoparticles (ZnO NPs) using aqueous leaf and root extracts of Petroselinum crispum (parsley) and characterization of as-prepared samples. ZnO NPs are subjected to X-ray diffraction (XRD), transmission electron microscopy (TEM) and electron paramagnetic resonance (EPR) studies. The XRD studies reveal a hexagonal wurtzite structure without supplementary diffraction lines for all ZnO samples. TEM analysis shows that the particle size is influenced by the type of plant extract. The EPR spectra indicate the presence of Mn 2+ ions in ZnO sample synthesized using P. crispum leaf extract, while zinc vacancy complexes and oxygen vacancies are evidenced in all analyzed samples. ZnO NPs synthesized using P. crispum extracts exhibit increased (2-16 times) antibacterial activity as compared to chemically synthesized ZnO NPs

  19. Novel Evaporation Process for Deposition of Kesterite Thin Films Synthesized by Solvothermal Method

    J. A. Estrada-Ayub

    2017-01-01

    Full Text Available Kesterite, a quaternary compound of Cu2ZnSnS4, is a promising option as a material absorber to reduce the cost of photovoltaic solar cells. The solvothermal method is a way to synthesize nanoparticles of this material. In this work, once synthesized, particles were deposited on a substrate through evaporation, and their morphological, structural, and optical properties were studied. Results show that changes of precursor ratios during solvothermal synthesis result in a modification of particle morphology but not on its size. The deposition of already synthesized kesterite through evaporation preserves kesterite structure and permits the formation of a homogenous film on a substrate. Optical reflectance and transmittance measurements allowed estimating the band-gap energy between 1.41 and 1.46 eV for representative samples, which is near the optimum for the absorber material.

  20. Granulometric analysis of metallic oxide in ceramic powder form synthesized by different methods

    Neiva, L.S.; Simoes, A.N.; Simoes, V.N.; Bispo, A.; Gama, L.

    2012-01-01

    The aim of this work is to synthesize ceramic powders based on CuO/CeO 2 by means two different synthesis methods, they are: the combustion reaction method and Pechini method. It's part of the aim of this work subject all samples to a synthesized qualitative and quantitative chemical analysis, using the technique EDX and then to a granulometric analysis. The samples of the ceramic powder based on CuO/CeO 2 synthesized in this work by means of the two above synthesis methods, contain various concentrations of CuO ranging between 0 and 0.5 mol. According to the results, only the Pechini method of synthesis exerted a significant and defined influence on the capacity of particle unit agglomeration in these powders (author)