Giampietro, Letizia; D'Angelo, Alessandra; Giancristofaro, Antonella; Ammazzalorso, Alessandra; De Filippis, Barbara; Di Matteo, Mauro; Fantacuzzi, Marialuigia; Linciano, Pasquale; Maccallini, Cristina; Amoroso, Rosa
2014-01-01
In an effort to develop safe and efficacious compounds for the treatment of metabolic disorders, new compounds based on a combination of clofibric acid, the active metabolite of clofibrate, and trans-stilbene, chalcone, and other lipophilic groups were synthesized. They were evaluated for PPARα transactivation activity; all branched derivatives showed an increase of the transcriptional activity of receptor compared to the linear ones. Noteworthy, stilbene and benzophenone branched derivatives activated the PPARα better than clofibric acid.
Cabrera-González, Justo; Viñas, Clara; Haukka, Matti; Bhattacharyya, Santanu; Gierschner, Johannes; Núñez, Rosario
2016-09-12
A set of triads in which o- and m-carborane clusters are bonded to two stilbene units through Ccluster -CH2 bonds was synthesized, and their structures were confirmed by X-ray diffraction. A study on the influence of the o- and m- isomers on the absorption and photoluminescence properties of the stilbene units in solution revealed no charge-transfer contributions in the lowest excited state, as confirmed by (TD)DFT calculations. The presence of one or two B-I groups in m-carborane derivatives does not affect the emission properties of the stilbenes in solution, probably due to the rather large distance between the iodo substituents and the fluorophore. Nevertheless, a significant redshift of the photoluminescence (PL) emission maximum in the solid state (thin films and powder samples) compared to solution was observed; this can be traced back to PL sensitization, most probably due to more densely packed stilbene moieties. Remarkably, the PL absolute quantum yields of powder samples are significantly higher than those in solution, and this was attributed to the restricted environment and the aforementioned sensitization. Thus, the bonding of the carborane clusters to two stilbene units preserves their PL behavior in solution, but produces significant changes in the solid state. Furthermore, iodinated species can be considered to be promising precursors for theranostic agents in which both imaging and therapeutic functions could possibly be combined. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Prototype Stilbene Neutron Collar
Energy Technology Data Exchange (ETDEWEB)
Prasad, M. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Shumaker, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Snyderman, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Verbeke, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-10-26
A neutron collar using stilbene organic scintillator cells for fast neutron counting is described for the assay of fresh low enriched uranium (LEU) fuel assemblies. The prototype stilbene collar has a form factor similar to standard He-3 based collars and uses an AmLi interrogation neutron source. This report describes the simulation of list mode neutron correlation data on various fuel assemblies including some with neutron absorbers (burnable Gd poisons). Calibration curves (doubles vs 235U linear mass density) are presented for both thermal and fast (with Cd lining) modes of operation. It is shown that the stilbene collar meets or exceeds the current capabilities of He-3 based neutron collars. A self-consistent assay methodology, uniquely suited to the stilbene collar, using triples is described which complements traditional assay based on doubles calibration curves.
Jian, Weilin; He, Daohang; Song, Shaoyun
2016-08-01
Natural stilbenes (especially resveratrol) play important roles in plant protection by acting as both constitutive and inducible defenses. However, their exogenous applications on crops as fungicidal agents are challenged by their oxidative degradation and limited availability. In this study, a new class of resveratrol-inspired oxadiazole-stilbene hybrids was synthesized via Wittig-Horner reaction. Bioassay results indicated that some of the compounds exhibited potent fungicidal activity against Botrytis cinerea in vitro. Among these stilbene hybrids, compounds 11 showed promising inhibitory activity with the EC50 value of 144.6 μg/mL, which was superior to that of resveratrol (315.6 μg/mL). Remarkably, the considerably abnormal mycelial morphology was observed in the presence of compound 11. The inhibitory profile was further proposed by homology modeling and molecular docking studies, which showed the possible interaction of resveratrol and oxadiazole-stilbene hybrids with the cytochrome P450-dependent sterol 14α-demethylase from B. cinerea (BcCYP51) for the first time. Taken together, these results would provide new insights into the fungicidal mechanism of stilbenes, as well as an important clue for biology-oriented synthesis of stilbene hybrids with improved bioactivity against plant pathogenic fungi in crop protection.
Isomerization Intermediates In Solution Phase Photochemistry Of Stilbenes
Doany, F. E.; Hochstrasser, R. M.; Greene, B. I.
1985-04-01
Picosecond and subpicosecond spectroscopic studies have revealed evidence for an isomerization intermediate between cis and trans in the photoinduced isomerism of both stilbene and biindanyledene ("stiff" stilbene). In stiff stilbene, a transient absorption at 351 nm displays time evolution and viscosity dependence consistent with absorption by a twisted intermediate ("phantom" state) with a lOps lifetime. An analagous bottleneck state with a life-time of 4ps is also consistent with the ground state recovery dynamics of t-stilbene following excitation of c-stilbene when monitored with 0.1ps resolution.
Photoinduced gelation by stilbene oxalyl amide compounds.
Miljanić, Snezana; Frkanec, Leo; Meić, Zlatko; Zinić, Mladen
2005-03-29
Oxalyl amide derivatives bearing 4-dodecyloxy-stilbene as a cis-trans photoisomerizing unit were synthesized. The trans derivative acted as a versatile gelator of various organic solvents, whereas the corresponding cis derivative showed a poor gelation ability or none at all. In diluted solution (c = 2.0 x10(-5) mol dm(-3), ethanol), the cis isomer was photochemically converted into the trans isomer within 4 min. Depending on the radiation wavelength, the trans isomer was stable or liable to photodecomposition. When exposed to irradiation, a concentrated solution of the cis isomer (c = 2.0 x 10(-2) mol dm(-3), ethanol) turned into a gel. The FT-Raman, FT-IR, and 1H NMR spectra demonstrated that the gelation process occurred because of a rapid cis --> trans photoisomerization followed by a self-assembly of the trans molecules. Apart from the formation of hydrogen bonding between the oxalyl amide parts of the molecules, confirmed by FT-IR spectroscopy, it was assumed that the pi-pi stacking between the trans-stilbene units of the molecule and a lipophilic interaction between long alkyl chains were the interactions responsible for gelation.
Characteristics evaluation of stilbene single crystal grown by vertical bridgman technique
International Nuclear Information System (INIS)
Jo, Kwang Ho
2012-02-01
As the nature of organic scintillator, stilbene single crystal's decay time is only a couple of nano seconds, which makes it suitable for fast neutron detection. However, the entire amount of stilbene single crystal being used relies on import currently. As the necessity of fast neutron detection equipment such as KSTAR and Sodium-cooled Fast Reactor system increases, the goal is to have our own domestic technology through the growth of stilbene single crystal. The emission wavelength of grown stilbene single crystal is confirmed, and the property of grown stilbene single crystal is assessed compared to commercial stilbene (Ukraine ISMA research center) through gamma ray and neutron tests. In this research, we have grown stilbenes through Bridgman technique, and obtained three stilbenes out of two amples. (Two ones of Φ 30 mm x 15 mm, and Φ 40 mm x 17 mm from the first ample, and size of Φ 25 mm x 13 mm from the other) The grown stilbene's emission wavelength and inherent property of stilbene are confirmed. As the result of gamma ray test, we have confirmed linearity of grown stilbene's scintillator, and the relative light yield ratio is proven 101% efficiency to reference stilbene. Neutron detection efficiency of the three stilbenes amounts to 80% of reference stilbene, and FOM of them is 108% efficiency to reference stilbene's one. Although Ukraine ISMA research center still holds a dominant position with world-class efficiency and performance of its stilbene, we expect to produce a better stilbene with our domestic technology development. Through this, fast neutron detection technique can be obtained, which opens up an opportunity to be used not only in neutron monitoring system in nuclear fusion reactor, but also in alternative measurement technique as the unit price of He-3 increases recently
Two new stilbene trimers from Cynodon dactylon.
Li, Bi-Jun; Liu, Yao; Gu, Ai-Tong; Zhang, Qing; Chen, Lei; Wang, Shu-Mei; Wang, Feng
2017-11-01
Many naturally occurring oligostilbenes have drawn considerable attention because of their intricate structures and diverse bioactivities. Two new stilbene trimers, cystibenetrimerol A (1) and cystibenetrimerol B (2) were isolated from the dried grass of Cynodon dactylon (L.) Pers. The planar structures and stereo configurations of them were elucidated by spectroscopic and spectrometric methods. The isolation and structures elucidation of two new stilbene trimers suggested the ordinary grass belonging to the family Poaceae may be a rich source of stilbene oligomers.
Photoisomerization of Stilbene: The Detailed XMCQDPT2 Treatment.
Ioffe, I N; Granovsky, A A
2013-11-12
We report the detailed XMCQDPT2/cc-pVTZ study of trans-cis photoisomerization in one of the core systems of both experimental and computational photochemistry-the stilbene molecule. For the first time, the potential energy surface (PES) of the S1 state has been directly optimized and scanned using a multistate multiconfiguration second-order perturbation theory. We characterize the trans-stilbene, pyramidalized (phantom), and DHP-cis-stilbene geometric domains of the S1 state and describe their stationary points including the transition states between them, as well as S1/S0 intersections. Also reported are the minima and the activation barriers in the ground state. Our calculations correctly predict the kinetic isotope effect due to H/D exchange at ethylenic hydrogens, the dynamic behavior of excited cis-stilbene, and trans-cis branching ratio after relaxation to S0 through a rather unsymmetric conical intersection. In general, the XMCQDPT2 results confirm the qualitative adequacy of the TDDFT (especially SF-TDDFT) picture of the excited stilbene but also reveal quantitative discrepancies that deserve further exploration.
Merocyanines: polyene-polymethine transition in donor-acceptor-substituted stilbenes and polyenes
International Nuclear Information System (INIS)
Rettig, Wolfgang; Dekhtyar, Marina
2003-01-01
Three series of donor-acceptor-substituted conjugated compounds, namely, stilbenes, the open-chain polyenes of equivalent length, and the species of intermediate structure (polyenes terminated with only one phenyl ring) have been studied by the AM1 and HMO methods to elucidate and compare the structural prerequisites of the ideal polymethinic state ('cyanine limit'). The transition from polyenic to polymethinic properties has been traced in terms of bond-length (bond-order) alternation using the variation of terminal donor and acceptor substituents. Stilbenes manifest themselves as notably 'retarded' polyenes since a larger electronic asymmetry is necessary for them to reach the same degree of polymethinic character. The ground and the excited state have been shown to differ much more strongly for stilbenes than for polyenes with respect to the position of the bond equalization point on the scale of donor-acceptor difference. For the compounds containing one phenyl ring, the features revealed are intermediate between stilbenes and polyenes. The large S 0 -S 1 discrepancy in terms of bond alternation is a general property of aromatic ring-terminated chains (stilbenes) and is related to the influence of the aromatic character which can be quantified in this way. In this context, the most relevant definition for the cyanine limit (based on the bond invariance upon excitation) was selected from the existing definitions. The major trends revealed in the polyenic/polymethinic behaviour of the molecules can be interpreted on a topological basis within HMO or even simpler models with some additional influence due to the interelectronic repulsion which is taken into account in the AM1 treatment
Design, Synthesis and Cytotoxic Evaluation of o-Carboxamido Stilbene Analogues
Directory of Open Access Journals (Sweden)
Mohamad Nurul Azmi
2013-11-01
Full Text Available Resveratrol, a natural stilbene found in grapes and wines exhibits a wide range of pharmacological properties. Resveratrol is also known as a good chemopreventive agent for inhibiting carcinogenesis processes that target kinases, cyclooxygenases, ribonucleotide reductase and DNA polymerases. A total of 19 analogues with an amide moiety were synthesized and the cytotoxic effects of the analogues on a series of human cancer cell lines are reported. Three compounds 6d, 6i and 6n showed potent cytotoxicity against prostate cancer DU-145 (IC50 = 16.68 µM, colon cancer HT-29 (IC50 = 7.51 µM and breast cancer MCF-7 (IC50 = 21.24 µM, respectively, which are comparable with vinblastine. The resveratrol analogues were synthesized using the Heck method.
Stilbene crystalline powder in polymer base as a new fast neutron detector
International Nuclear Information System (INIS)
Budakovsky, S.V.; Galunov, N.Z.; Grinyov, B.V.; Karavaeva, N.L.; Kyung Kim, Jong; Kim, Yong-Kyun; Pogorelova, N.V.; Tarasenko, O.A.
2007-01-01
A new organic scintillation material consisting of stilbene grains in a polymer glue base is presented. The crystalline grains of stilbene are obtained by mechanical grinding of stilbene single crystals. The resulting composite scintillators have been studied as detectors for fast neutrons
Water deficit increases stilbene metabolism in Cabernet Sauvignon berries.
Deluc, Laurent G; Decendit, Alain; Papastamoulis, Yorgos; Mérillon, Jean-Michel; Cushman, John C; Cramer, Grant R
2011-01-12
The impact of water deficit on stilbene biosynthesis in wine grape (Vitis vinifera) berries was investigated. Water deficit increased the accumulation of trans-piceid (the glycosylated form of resveratrol) by 5-fold in Cabernet Sauvignon berries but not in Chardonnay. Similarly, water deficit significantly increased the transcript abundance of genes involved in the biosynthesis of stilbene precursors in Cabernet Sauvignon. Increased expression of stilbene synthase, but not that of resveratrol-O-glycosyltransferase, resulted in increased trans-piceid concentrations. In contrast, the transcript abundance of the same genes declined in Chardonnay in response to water deficit. Twelve single nucleotide polymorphisms (SNPs) were identified in the promoters of stilbene synthase genes of Cabernet Sauvignon, Chardonnay, and Pinot Noir. These polymorphisms resulted in eight changes within the predicted cis regulatory elements in Cabernet Sauvignon and Chardonnay. These results suggest that cultivar-specific molecular mechanisms might exist that control resveratrol biosynthesis in grapes.
Preharvest methyl jasmonate and postharvest UVC treatments: increasing stilbenes in wine.
Fernández-Marín, María Isabel; Puertas, Belén; Guerrero, Raúl F; García-Parrilla, María Carmen; Cantos-Villar, Emma
2014-03-01
Stilbene-enriched wine is considered to be an interesting new food product with added value due to its potential health-promoting properties. Stilbene concentration in grape is highly variable and rather scarce. However, it can be increased by stress treatments. For this reason, numerous pre- and postharvest grape treatments, and some combinations of them, have been tested to maximize stilbene content in grapes. In the present manuscript, Syrah grapes were treated with (i) methyl jasmonate (MEJA), (ii) ultraviolet light (UVC), and (iii) methyl jasmonate and ultraviolet light (MEJA-UVC) and compared with untreated grapes. Afterward, winemaking was developed. Wine achieved by combination of both treatments (MEJA-UVC) contained significantly higher stilbene concentration (trans-resveratrol and piceatannol) than its respective control (2.5-fold). Wine quality was improved in color-related parameters (color intensity, L*, a*, b*, ΔE*, anthocyanins, and tannin). Moreover, MEJA-UVC wines obtained the highest score in sensorial analysis. To the best of our knowledge, this is the first time that pre- and postharvest treatments are combined to increase stilbenes in wine. The effect of treatment combination (methyl jasmonate and UVC light) on grape and wine was evaluated. Our results highlight the positive effect of the treatments in stilbene content, color parameters, and sensorial analysis. Moreover, added-value by-products were achieved. © 2014 Institute of Food Technologists®
Screening Analyses of Pinosylvin Stilbenes, Resin Acids and Lignans in Norwegian Conifers
Anne Fiksdahl; Karin Oyaas; Ingebjorg Leirset; Hanne Hovelstad
2006-01-01
The content and distribution of stilbenes and resin acids in Scots pine (Pinus sylvestris) and spruce (Picea abies), sampled in central Norway, have been examined. The contents of pinosylvin stilbenes in pine heartwood/living knots were 0.2-2/2-8 % (w/w). No stilbenes could be detected in spruce (Picea abies). The resin acid contents of pine sapwood/heartwood and knots were 1-4 and 5-10 % (w/w), respectively. Minor amounts of resin acids (
The Use of Stilbene Scaffold in Medicinal Chemistry and Multi- Target Drug Design.
Giacomini, Elisa; Rupiani, Sebastiano; Guidotti, Laura; Recanatini, Maurizio; Roberti, Marinella
2016-01-01
The stilbene scaffold is a basic element for a number of biologically active natural and synthetic compounds, and it is considered as a privileged structure. Stilbenes exemplified by resveratrol, combretastatin A-4 and pterostilbene are of significant interest for drug research and development because of their potential in therapeutic and preventive application. Resveratrol, present in grapes and other food products, plays a role in the prevention of several human pathological processes and has been suggested as an anticancer agent. Moreover, recent evidence has revealed its potential effect on the aging process, diabetes and neurological dysfunction. Combretastatin A-4, from the bark of South African bush willow Combretum caffrum, also shows significant antitumor activity. Pterostilbene is closely related to resveratrol, sharing the same unique therapeutic potential as anti-inflammatory, antineoplastic and antioxidant agent. Therefore, research and development of stilbene-based medicinal chemistry have become rapidly evolving and increasingly active topics covering almost the whole range of therapeutic fields. In the present review, we provide an overview of the role of stilbenes in medicinal chemistry. In this context, we highlight the chemical methodologies adopted for the synthesis of stilbene derivatives, and outline the successful design of novel stilbene based hybrids in the field of cancer, Alzheimer's and other relevant diseases. This information may be useful in further design of stilbene-based molecules as new leads for the development of novel agents with clinical potential or as effective chemical probes to dissect biological processes.
Stilbene dimer radical cations in the radiolyses of stilbenes and 1,2,3,4-tetraphenylcyclobutanes
International Nuclear Information System (INIS)
Tojo, Sachiko; Morishima, Kazuhiro; Ishida, Akito; Majima, Tetsuro; Takamuku, Setsuo
1995-01-01
The reaction of the stilbene radical cation formed by pulse radiolysis or γ-radiolyses is explained based on neutralization as well as the formation of a π-type stilbene dimer radical cation (π-St 2 +· ), converting to the σ-type St 2 +· (σ-St 2 +· ). The r-1, c-2, t-3, t-4-tetraphenylcyclobutane radical cation generated in a rigid matrix at 77 K which converted to σ-St 2 +· upon warming. Both r-1, c-2, t-3, t-4- and r-1, t-2, c-3, t-4-tetraphenylcyclobutane radical cations underwent photochemical cycloreversion to π-St 2 +· upon irradiation at wavelengths longer than 390 nm at 77 K, and converted to σ-St 2 +· upon warming. It is suggested that π-St 2 +· has overlapping arrangements of π-electrons, while σ-St 2 +· has radical and cation centers on the 1- and 4-positions of the C 4 linkage. (author)
Characterisation of stilbenes in California almonds (Prunus dulcis) by UHPLC-MS.
Xie, Liyang; Bolling, Bradley W
2014-04-01
Stilbene polyphenols are present in some fruits and nuts, but their abundance in many foods, such as almonds, is unknown. Therefore, we characterised stilbenes from Nonpareil, Butte and Carmel almond (Prunus dulcis) varieties from California. UHPLC-MS conditions were optimised to resolve cis- and trans-resveratrol, d4-resveratrol, dienestrol, hexestrol, oxyresveratrol, piceatannol, pterostilbene, and resveratrol-3-β-glucoside (polydatin). Stilbenes were isolated from ethanolic almond extracts by solid-phase extraction and identified with UHPLC-MS by comparison of retention times, mass spectra, in-source CID spectra, and enzymatic hydrolysis to authentic standards. Polydatin was identified in almond extracts, with 7.19-8.52 μg/100 g almond. Piceatannol+oxyresveratrol was tentatively identified in almond blanch water, at 0.19-2.55 μg/100 g almond. Polydatin was concentrated in almond skins, which contained 95.6-97.5% of the total almond content. Therefore, almonds contain the stilbene class of polyphenols in addition to the previously identified proanthocyanidin, hydrolysable tannin, flavonoid, and phenolic acid classes. Copyright © 2013 Elsevier Ltd. All rights reserved.
76 FR 30967 - Certain Stilbenic Optical Brightening Agents From China and Taiwan
2011-05-27
... Stilbenic Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1... is a reasonable indication that an industry in the United States is materially injured by reason of imports from China and Taiwan of certain stilbenic optical brightening agents, provided for in subheadings...
Ultrasound-Assisted Extraction of Stilbenes from Grape Canes.
Piñeiro, Zulema; Marrufo-Curtido, Almudena; Serrano, Maria Jose; Palma, Miguel
2016-06-16
An analytical ultrasound-assisted extraction (UAE) method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying) and several extraction variables (solvent, sample-solvent ratio and extraction time between others) on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5) for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.
Directory of Open Access Journals (Sweden)
Hamza Temsamani
2016-06-01
Full Text Available The aggregation of α-synuclein is one on the key pathogenic events in Parkinson’s disease. In the present study, we investigated the inhibitory capacities of stilbenes against α-synuclein aggregation and toxicity. Thioflavin T fluorescence, transmission electronic microscopy, and SDS-PAGE analysis were performed to investigate the inhibitory effects of three stilbenes against α-synuclein aggregation: piceatannol, ampelopsin A, and isohopeaphenol. Lipid vesicle permeabilization assays were performed to screen stilbenes for protection against membrane damage induced by aggregated α-synuclein. The viability of PC12 cells was examined using an MTT assay to assess the preventive effects of stilbenes against α-synuclein-induced toxicity. Piceatannol inhibited the formation of α synuclein fibrils and was able to destabilize preformed filaments. It seems to induce the formation of small soluble complexes protecting membranes against α-synuclein-induced damage. Finally, piceatannol protected cells against α-synuclein-induced toxicity. The oligomers tested (ampelopsin A and hopeaphenol were less active.
International Nuclear Information System (INIS)
Yanagida, Takayuki; Watanabe, Kenichi; Fujimoto, Yutaka
2015-01-01
Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under 137 Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators
Energy Technology Data Exchange (ETDEWEB)
Yanagida, Takayuki, E-mail: yanagida@lsse.kyutech.ac.jp [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan); Watanabe, Kenichi [Nagoya University, Furocho, Chikusa, Nagoya 464-8603 (Japan); Fujimoto, Yutaka [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan)
2015-06-01
Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under {sup 137}Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators.
Ultrasound-Assisted Extraction of Stilbenes from Grape Canes
Directory of Open Access Journals (Sweden)
Zulema Piñeiro
2016-06-01
Full Text Available An analytical ultrasound-assisted extraction (UAE method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying and several extraction variables (solvent, sample-solvent ratio and extraction time between others on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5 for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.
Effect of stilbene resveratrol on haematological indices of rats
Czech Academy of Sciences Publication Activity Database
Doubek, J.; Volný, T.; Lojek, Antonín; Knotková, Z.; Kotrbáček, V.; Scheer, P.; Holešovská, Z.
2005-01-01
Roč. 74, č. 2 (2005), s. 205-208 ISSN 0001-7213 Institutional research plan: CEZ:AV0Z50040507 Keywords : antioxidative capacity * stilbene-resveratrol Subject RIV: BO - Biophysics Impact factor: 0.353, year: 2005
Mahdavi, Mohammad; Pedrood, Keyvan; Safavi, Maliheh; Saeedi, Mina; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Emami, Saeed; Adib, Mehdi; Foroumadi, Alireza; Shafiee, Abbas
2015-05-05
A novel series of 2-arylquinazolinones 7a-o bearing trans-stilbene moiety were designed, synthesized, and evaluated against human breast cancer cell lines including human breast adenocarcinoma (MCF-7 and MDA-MB-231) and human ductal breast epithelial tumor (T-47D). Among the tested compounds, the sec-butyl derivative 7h showed the best profile of activity (IC50 < 5 μM) against all cell lines, being 2-fold more potent than standard drug, etoposide. Our investigation revealed that the cytotoxic activity was significantly affected by N3-alkyl substituents. Furthermore, the morphological analysis by acridine orange/ethidium bromide double staining test and flow cytometry analysis indicated that the prototype compound 7h can induce apoptosis in MCF-7 and MDA-MB-231 cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
López-Alfaro, Isabel; González-Arenzana, Lucía; López, Noelia; Santamaría, Pilar; López, Rosa; Garde-Cerdán, Teresa
2013-12-15
The purpose of this paper was to study the effect of pulsed electric fields (PEF) on the stilbene content of three grape varieties. For this purpose, four different PEF treatments were applied using a continuous system over three varieties, Graciano, Tempranillo and Grenache, destemmed and crushed. In addition, the influence of PEF on their physicochemical composition was studied. PEF treatments did not affect the pH or total acidity of Graciano, however, musts from Tempranillo and Grenache had higher pH values and lower total acidity. In the three varieties, all treatments resulted in an increase of potassium content, deeper colour intensity and total polyphenol index and lower tonality, more pronounced in the treatments with higher time and energy. The stilbene content of the must significantly increased with respect to the control. This increase depended on the variety and the treatment applied. Tempranillo increased up 200% the total stilbene concentration, Grenache 60% and Graciano 50%. For the three varieties, the treatment with the highest time and energy was the most effective on the total stilbene extraction. These results indicate that PEF could be a suitable technology for obtaining musts with deeper colour and higher phenolic content, including resveratrol and piceid. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ferrer-Ugalde, A; Cabrera-González, J; Juárez-Pérez, E J; Teixidor, F; Pérez-Inestrosa, E; Montenegro, J M; Sillanpää, R; Haukka, M; Núñez, R
2017-02-14
Two novel styrene-containing meta-carborane derivatives substituted at the second carbon cluster atom (C c ) with either a methyl (Me) or a phenyl (Ph) group are introduced herein along with a new set of stilbene-containing ortho- (o-) and meta- (m-) carborane dyads. The latter set of compounds have been prepared from styrene-containing carborane derivatives via a Heck coupling reaction. High regioselectivity has been achieved for these compounds by using a combination of palladium complexes [Pd 2 (dba) 3 ]/[Pd(t-Bu 3 P) 2 ] as a catalytic system, yielding exclusively E isomers. All compounds have been fully characterised and the crystal structures of seven of them were analysed by X-ray diffraction. The absorption spectra of these compounds are similar to those of their respective fluorophore groups (styrene or stilbene), showing a very small influence of the substituent (Me or Ph) linked to the second C c atom or the cluster isomer (o- or m-). On the other hand, fluorescence spectroscopy revealed high emission intensities for Me-o-carborane derivatives, whereas their Ph-o-carborane analogues evidenced an almost total lack of fluorescence, confirming the significant role of the substituent bound to the adjacent C c in o-carboranes. In contrast, all the m-carborane derivatives display similar photoluminescence (PL) behavior regardless of the substituent attached to the second C c , demonstrating its small influence on emission properties. Additionally, m-carborane derivatives are significantly more fluorescent than their o-counterparts, reaching quantum yield values as high as 30.2%. Regarding solid state emission, only stilbene-containing Ph-o-carborane derivatives, which showed very low fluorescence in solution, exhibited notable PL emission in films attributed to aggregation-induced emission. DFT calculations were performed to successfully complement the photoluminescence studies, supporting the experimentally observed photophysical behavior of the styrene and
Target molecular weights for red cell band 3 stilbene and mercurial binding sites
International Nuclear Information System (INIS)
Verkman, A.S.; Skorecki, K.L.; Jung, C.Y.; Ausiello, D.A.
1986-01-01
Radiation inactivation was used to measure the target sizes for binding of disulfonic stilbene anion transport inhibitor 4,4'-dibenzamido-2,2'-disulfonic stilbene (DBDS) and mercurial water transport inhibitor p-chloromercuribenzene sulfonate (pCMBS) to human erythrocytes. The measured target size for erythrocyte ghost acetylcholinesterase was 78 +/- 3 kDa. DBDS binding to ghost membranes was measured by a fluorescence enhancement technique. Radiation (0-26 Mrad) had no effect on total membrane protein and DBDS binding affinity, whereas DBDS binding stoichiometry decreased exponentially with radiation dose, giving a target size of 59 +/- 4 kDa. H2-4,4'-diisothiocyano-2,2'-disulfonic stilbene (H2-DIDS, 5 microM) blocked greater than 95% of DBDS binding at all radiation doses. pCMBS binding was measured from the time course of tryptophan fluorescence quenching in ghosts treated with the sulfhydryl reagent N-ethylmaleimide (NEM). Radiation did not affect the kinetics of tryptophan quenching, whereas the total amplitude of the fluorescence signal inactivated with radiation with a target size of 31 +/- 6 kDa. These results support the notion that DBDS and pCMBS bind to the transmembrane domain of erythrocyte band 3 in NEM-treated ghosts and demonstrate that radiation inactivation may probe a target significantly smaller than a covalently linked protein subunit. The small target size for the band 3 stilbene binding site may correspond to the intramembrane domain of the band 3 monomer (52 kDa), which is physically distinct from the cytoplasmic domain (42 kDa)
Directory of Open Access Journals (Sweden)
Gang Li
2018-01-01
Full Text Available Fenugreek (Trigonella foenum-graecum L. is a well-known annual plant that is widely distributed worldwide and has possessed obvious hypoglycemic and hypercholesterolemia characteristics. In our previous study, three polyphenol stilbenes were separated from fenugreek seeds. Here, we investigated the effect of polyphenol stilbenes on adipogenesis and insulin resistance in 3T3-L1 adipocytes. Oil Red O staining and triglyceride assays showed that polyphenol stilbenes differently reduced lipid accumulation by suppressing the expression of adipocyte-specific proteins. In addition, polyphenol stilbenes improved the uptake of 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino-2-deoxyglucose (2-NBDG by promoting the phosphorylation of protein kinase B (AKT and AMP-activated protein kinase (AMPK. In present studies, it was found that polyphenol stilbenes had the ability to scavenge reactive oxygen species (ROS. Results from adenosine triphosphate (ATP production and mitochondrial membrane potentials suggested that mitochondria play a critical role in insulin resistance and related signaling activation, such as AKT and AMPK. Rhaponticin, one of the stilbenes from fenugreek, had the strongest activity among the three compounds in vitro. Future studies will focus on mitochondrial biogenesis and function.
Mendez, Violaine; Guillois, Kevin; Daniè le, Sté phane; Tuel, Alain; Caps, Valerie
2010-01-01
Aerobic partial oxidations of alkanes and alkenes are important processes of the petrochemical industry. The radical mechanisms involved can be catalyzed by soluble salts of transition metals (Co, Cu, Mn...). We show here that the model methylcyclohexane/stilbene co-oxidation reaction can be efficiently catalyzed at lower temperature by supported gold nanoparticles. The support has little influence on gold intrinsic activity but more on the apparent reaction rates which are a combination of catalytic activity and diffusion limitations. These are here minimized by using gadolinium-doped titania nanocrystallites as support for gold nanoparticles. This material is obtained by mild hydrolysis of a new Gd4TiO(OiPr)14 bimetallic oxoalkoxide. It leads to enhanced wettability of the < 3 nm gold particles in the tert-butyl hydroperoxide (TBHP)-initiated epoxidation of stilbene in methylcyclohexane; Au/TiO2:Gd3+ is in turn as active as the state-of-the-art hydrophobic Au/SiO2 catalyst. The rate-determining step of this reaction is identified as the gold-catalyzed homolytic decomposition of TBHP generating radicals and initiating the methylcyclohexane-mediated epoxidation of stilbene, yielding a methylcyclohexan-1-ol/trans-stilbene oxide mixture. Methylcyclohexan-1-ol can also be obtained in the absence of the alkene in the gold-catalyzed solvent-free autoxidation of methylcyclohexane, evidencing the catalytic potential of gold nanoparticles for low temperature C-H activation. © 2010 The Royal Society of Chemistry.
Directory of Open Access Journals (Sweden)
Roy Deodutta
2004-01-01
Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental
Energy Technology Data Exchange (ETDEWEB)
Wright, A. von (Univ. of Eastern Finland, Kuopio (Finland). Dept. of Biosciences.), Email: atte.vonWright@uef.fi
2010-10-15
Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Wright, A. von (Univ. of Kuopio, Dept. of Biosciences (Finland)), email: atte.vonWright@uku.fi
2009-10-15
Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type 2 diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type 2 diabetes) highlighting results. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Wright, A. von (Kuopio Univ., Department of Biosciences (Finland))
2008-07-01
Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and as derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)
Digital Data Processing of Stilbene
International Nuclear Information System (INIS)
AMIRI, Moslem; MATEJ, Zdenek; MRAVEC, Filip; PRENOSIL, Vaclav; CVACHOVEC, Frantisek
2013-06-01
Stilbene is a proven spectrometric detector for mixed fields of neutrons and gamma rays. By digital processing of shape output pulses from the detector it is possible to obtain information about the energy of the interacting neutron / photon and distinguish which of these two particles interacts in the detector. Another numerical processing of digital data can finalize the energy spectrum of both components of the mixed field. The quality of the digitized data is highly dependent on the parameters of the hardware used for digitization and on the quality of software processing. Our results also show how the quality of the particle type identification depends on the sampling rate and as well as the method of processing of the sampled data. (authors)
Identification and quantification of stilbenes in some Tunisian red wines using UPLC-MS and HPLC-DAD
Directory of Open Access Journals (Sweden)
Kamel Arraki
2017-06-01
Full Text Available Seven Tunisian red wines mainly from the Mornag appellation were analyzed for resveratrol and analogues. The wines of each variety were evaporated, concentrated, and then subjected to fractionation and purification using XAD16 and DOWEX column chromatography. In addition to resveratrol, seven stilbenes were identified by UPLC-MS. The stilbenes derived were shown to be piceatannol, piceid, a-viniferin, e-viniferin, hopeaphenol and isohopeaphenol. From the point of view of the presence of resveratrol derivatives, one wine, Sidi Zahia, was the richest qualitatively.
Piao, Shu-juan; Chen, Li-xia; Kang, Ning; Qiu, Feng
2011-01-01
Cortex Mori, one of the well-known traditional Chinese herbal medicines, is derived from the root bark of Morus alba L. according to the China Pharmacopeia. Stilbene glycosides are the main components isolated from aqueous extracts of Morus alba and their content varies depending on where Cortex Mori was collected. We have established a qualitative and quantitative method based on the bioactive stilbene glycosides for control of the quality of Cortex Mori from different sources. To develop a high-performance liquid chromatography coupled with ultraviolet absorption detection for simultaneous quantitative determination of five major characteristic stilbene glycosides in 34 samples of the root bark of Morus alba L. (Cortex Mori) from different sources. The analysis was performed on an ODS column using methanol-water-acetic acid (18: 82: 0.1, v/v/v) as the mobile phase and the peaks were monitored at 320 nm. All calibration curves showed good linearity (r ≥ 0.9991) within test ranges. This method showed good repeatability for the quantification of these five components in Cortex Mori with intra- and inter-day standard deviations less than 2.19% and 1.45%, respectively. The validated method was successfully applied to quantify the five investigated components, including a pair of cis-trans-isomers 1 and 2 and a pair of isomers 4 and 5 in 34 samples of Cortex Mori from different sources. Copyright © 2010 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Quentin Lefebvre
2013-09-01
Full Text Available A continuous flow oxidative photocyclization of stilbene derivatives has been developed which allows the scalable synthesis of backbone functionalized phenanthrenes and helicenes of various sizes in good yields.
Effect of Dietary Stilbenes on 5-Lipoxygenase and Cyclooxygenases Activities In Vitro
Czech Academy of Sciences Publication Activity Database
Kutil, Zsófia; Kvasnicová, Marie; Temml, V.; Schuster, D.; Maršík, Petr; Cusimamani, E.F.; Lou, J.D.; Vaněk, Tomáš; Landa, Přemysl
2015-01-01
Roč. 18, č. 7 (2015), s. 1471-1477 ISSN 1094-2912 R&D Projects: GA MŠk LH12164 Institutional support: RVO:61389030 Keywords : Dietary stilbenes * Cyclooxygenase inhibition * Docking Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.586, year: 2015
Mathis Ii, Stephan R; Golafale, Saki T; Bacsa, John; Steiner, Alexander; Ingram, Conrad W; Doty, F Patrick; Auden, Elizabeth; Hattar, Khalid
2017-01-03
Ultra large pore isostructural metal organic frameworks (MOFs) which exhibit both photoluminescence and scintillation properties, were synthesized from trans-4,4'-stilbenedicarboxylic acid (H 2 L) and trivalent lanthanide (Ln) metal salts under solvothermal conditions (Ln = Er 3+ (1) and Tm 3+ (2)). This new class of mesoporous materials is a non-interpenetrating network that features ultra-large diamond shaped pores of dimensions with approximate cross-sectional dimensions of 28 Å × 12 Å. The fully deprotonated ligand, L, is isolated and rigidified as it serves as the organic linker component of the MOF structure. Its low density unit cells possess asymmetric units with two crystallographically independent Ln 3+ ions in seven coordinate arrangements. A distinct feature of the structure is the bis-bidentate carboxylate groups. They serve as a ligand that coordinates two Ln(iii) ions while each L connects four Ln(iii) ions yielding an exceptionally large diamond-shaped rectangular network. The structure exhibits ligand-based photoluminescence with increased lifetime compared to free stilbene molecules on exposure to UV radiation, and also exhibits strong scintillation characteristics, comprising of both prompt and delayed radioluminescence features, on exposure to ionizing radiation.
Directory of Open Access Journals (Sweden)
Vannozzi Alessandro
2012-08-01
Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be
Holographic recording of surface relief gratings in stilbene azobenzene derivatives at 633 nm
International Nuclear Information System (INIS)
Ozols, A; Saharov, D; Kokars, V; Kampars, V; Maleckis, A; Mezinskis, G; Pludons, A
2010-01-01
Holographic recording in stilbene azobenzene derivatives by He-Ne 633 nm laser light has been experimentally studied. It was found that surface relief gratings (SRG) can be recorded by red light. Usually shorter wavelengths are used to induce the trans-cis photo-isomerization in organic materials. SRG with 2 μm period and an amplitude of 130 nm have been recorded with 0.88 W/cm 2 light in about 20 minutes in amorphous films of 3-(4-(bis(2-(trityloxy)ethyl)amino)phenyl)-2-(4-(2-bromo-4-nitrophenyl) diazenyl)phenyl)acrylonitrile spin-coated on glass substrates. Self-diffraction efficiency up to 17.4% and specific recording energy down to 114 J/(cm 2 %) were measured. The recorded SRG were stable as proved by subsequent AFM measurements. The photo-induced changes in absorption spectra did not reveal noticeable signs of trans-cis transformations. Rather, spectrally uniform bleaching of the films took place. We conclude that a photothermally stimulated photo-destruction of chromophores is responsible for the SRG recording. The recording of stable SRG in the stilbene azobenzene derivatives we studied is accompanied by the recording of relaxing volume-phase gratings due to the photo-orientation of chromophores by the linearly polarized recording light. It should also be noted that holographic recording efficiency in stilbene azobenzene derivatives exhibit an unusual non-monotonic sample storage-time dependence presumably caused by the peculiarities of structural relaxation of the films.
Varietal Distributions of Stilbenes in Grape Cane of Vitis vinifera L.
Czech Academy of Sciences Publication Activity Database
Soural, I.; Balík, J.; Vrchotová, Naděžda; Tříska, Jan
2017-01-01
Roč. 20, č. 1 (2017), s. 11-14 ISSN 1335-2563 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LD14038 Institutional support: RVO:86652079 Keywords : Vitis vinifera L. * varieties * grape canes * stilbenes * distribution Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7)
Digital pile-up rejection for plutonium experiments with solution-grown stilbene
Energy Technology Data Exchange (ETDEWEB)
Bourne, M.M., E-mail: mmbourne@umich.edu; Clarke, S.D., E-mail: clarkesd@umich.edu; Paff, M., E-mail: mpaff@umich.edu; DiFulvio, A., E-mail: difulvio@umich.edu; Norsworthy, M., E-mail: marknors@umich.edu; Pozzi, S.A., E-mail: pozzisa@umich.edu
2017-01-11
A solution-grown stilbene detector was used in several experiments with plutonium samples including plutonium oxide, mixed oxide, and plutonium metal samples. Neutrons from different reactions and plutonium isotopes are accompanied by numerous gamma rays especially by the 59-keV gamma ray of {sup 241}Am. Identifying neutrons correctly is important for nuclear nonproliferation applications and makes neutron/gamma discrimination and pile-up rejection necessary. Each experimental dataset is presented with and without pile-up filtering using a previously developed algorithm. The experiments were simulated using MCNPX-PoliMi, a Monte Carlo code designed to accurately model scintillation detector response. Collision output from MCNPX-PoliMi was processed using the specialized MPPost post-processing code to convert neutron energy depositions event-by-event into light pulses. The model was compared to experimental data after pulse-shape discrimination identified waveforms as gamma ray or neutron interactions. We show that the use of the digital pile-up rejection algorithm allows for accurate neutron counting with stilbene to within 2% even when not using lead shielding.
76 FR 19383 - Certain Stilbenic Optical Brightening Agents From China and Taiwan
2011-04-07
... Stilbenic Optical Brightening Agents From China and Taiwan AGENCY: United States International Trade... reasonable indication that an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of...
Czech Academy of Sciences Publication Activity Database
Li, S.; Zhang, D.; Yang, L.; Li, Y.; Zhu, X.; Kmoníčková, Eva; Zídek, Zdeněk
-, č. 452610 (2013), s. 1-6 ISSN 2090-9063 R&D Projects: GA MŠk(CZ) ME10116 Institutional support: RVO:68378041 Keywords : flavones * alternative medicine * stilbenes Subject RIV: FR - Pharmacology ; Medidal Chemistry
77 FR 27079 - Certain Stilbenic Optical Brightening Agents From China and Taiwan
2012-05-08
... industry in the United States is materially injured by reason of imports from China and Taiwan of certain... Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1\\ developed... that imports of certain stilbenic optical brightening agents from China and Taiwan were being sold at...
Akwabi-Ameyaw, Adwoa; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce
2011-10-15
To further explore the optimum placement of the acid moiety in conformationally constrained analogs of GW 4064 1a, a series of stilbene replacements were prepared. The benzothiophene 1f and the indole 1g display the optimal orientation of the carboxylate for enhanced FXR agonist potency. Copyright © 2011 Elsevier Ltd. All rights reserved.
Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L.
Directory of Open Access Journals (Sweden)
Ivo Soural
2015-04-01
Full Text Available Grape cane, leaves and grape marc are waste products from viticulture, which can be used to obtain secondary stilbene derivatives with high antioxidant value. The presented work compares several extraction methods: maceration at laboratory temperature, extraction at elevated temperature, fluidized-bed extraction, Soxhlet extraction, microwave-assisted extraction, and accelerated solvent extraction. To obtain trans-resveratrol, trans-ε-viniferin and r2-viniferin from grape cane of the V. vinifera variety Cabernet Moravia, various conditions were studied: different solvents, using powdered versus cut cane material, different extraction times, and one-step or multiple extractions. The largest concentrations found were 6030 ± 680 µg/g dry weight (d.w. for trans-resveratrol, 2260 ± 90 µg/g d.w. for trans-ε-viniferin, and 510 ± 40 µg/g d.w. for r2-viniferin. The highest amounts of stilbenes (8500 ± 1100 µg/g d.w. were obtained using accelerated solvent extraction in methanol.
Factors influencing the production of stilbenes by the knotweed, Reynoutria × bohemica
Czech Academy of Sciences Publication Activity Database
Kovářová, Marcela; Bartůňková, Kristýna; Frantík, Tomáš; Koblihová, Helena; Prchalová, K.; Vosátka, Miroslav
2010-01-01
Roč. 10, č. 19 (2010), s. 1-16 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : japanese knotweed * Reynoutria * stilbenes Subject RIV: EF - Botanics Impact factor: 4.085, year: 2010 http://www.biomedcentral.com/1471-2229/10/19
Brillante, Luca; De Rosso, Mirko; Dalla Vedova, Antonio; Maoz, Itay; Flamini, Riccardo; Tomasi, Diego
2018-03-01
Grape withering is a process used to produce reinforced wines and raisins. Dehydration is usually carried out postharvest by keeping ripe grapes in special warehouses in controlled conditions of temperature, relative humidity (RH) and air flow. Alternatively, grape clusters can be left on the vines after the canes have been pruned. In general, dehydration increases stilbenes in grape, but there are few studies on the effects of on-vine withering. The stilbene profiles of Raboso Piave grape during postharvest and on-vine dehydration were studied here. High-resolution mass spectrometry (MS) was used to identify 19 stilbenes, including resveratrol monomers, dimers (viniferins), oligomers and glucoside derivatives. The two dehydration methods generally had different effects on the above nutraceuticals in grape. The samples kept in warehouses revealed significant increases in Z-ω-viniferin, E-ϵ-viniferin, δ-viniferin and another resveratrol dimer which were not observed in the plants. Trans-Resveratrol increased significantly only in samples dehydrated in the warehouse at 21 °C and 60-70% RH. The findings increase knowledge of stilbene composition in grapes subjected to withering on-vine. The choice of dehydration method affects the contents of these nutraceuticals in the grape and consequently in wines. Reasonably, it could also affect other secondary metabolites important for wine quality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Energy Technology Data Exchange (ETDEWEB)
Lobo, Livia T.; Silva, Geilson A. da; Freitas, Manolo C.C. de; Silva, Milton N. da; Arruda, Alberto C.; Guilhon, Giselle M.S.P.; Santos, Lourivaldo S.; Santos, Alberdan S.; Arruda, Mara S.P., E-mail: mspa@ufpa.b [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais. Programa de Pos-Graduacao em Quimica; Souza Filho, Antonio Pedro S. [Centro de Pesquisa Agroflorestal da Amazonia Oriental (CPATU), Belem, PA (Brazil)
2010-07-01
The Amazon biodiversity may provide plants whose chemical substances are capable of controlling weeds. In this study we report the isolation and identification of five stilbenes from the leaves of 'timbo vermelho' (Deguelia rufescens var. urucu): 4-methoxylonchocarpene (1); 3,5-dimethoxy-4'-hydroxy-3'-prenyl-trans-stilbene (2), lonchocarpene (3), 3,5-dimethoxy-4'-Oprenyl- trans-stilbene (4) and pterostilbene (5). Compounds 2 and 4 are new natural products although 2 has been previously cited as synthesis product. Potential allelopathic activity for 1, 2 and 4 was evaluated over seed germination and plant growth of Mimosa pudica weed. The observed effects on seed germination did not vary significantly (p > 0.05) when the analysis of phytotoxicity was performed with the substances alone, the maximum inhibition did not exceed 20%. The most intense inhibitions on radicle and hypocotyl development were found for compound 4 (p < 0.05). When tested in pairs, showed antagonism for seed germination and synergism for radicle and hypocotyl development. (author)
International Nuclear Information System (INIS)
Shani, G.; Cojocaru, M.
1977-01-01
A method for measurement of low level alpha particles in high level gamma background is investigated. Because of its pulse-shape-discrimination properties and being a solid scintillator, trans-stilbene seems to be the proper scintillator, for this purpose. The investigation was done by measuring the effect of different gamma background level (from very low to very high) on constant alpha count rate. Two different pulse-shape-discrimination systems were used and compared. The Ortec system measures the pulse fall time and supplies a corresponding pulse height and the Elscint system checks whether the pulse is what is expected to be the gamma pulse, or is a longer pulse. Both systems yielded good results and were found to be adequate for alpha-gamma separation with trans-stilbene. (Auth.)
Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L
Czech Academy of Sciences Publication Activity Database
Soural, I.; Vrchotová, Naděžda; Tříska, Jan; Balík, J.; Horník, Štěpán; Cuřínová, Petra; Sýkora, Jan
2015-01-01
Roč. 20, č. 4 (2015), s. 6093-6112 ISSN 1420-3049 R&D Projects: GA MŠk(CZ) LD14038 Institutional support: RVO:67179843 ; RVO:67985858 Keywords : Vitis vinifera L * grape cane * stilbenes * accelerated solvent extraction ( ASE ) * microwave-assisted extraction (MAE) * LC-MS Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.465, year: 2015
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Zhang, Na; Quan, Zheng-Jun; Zhang, Zhang; Da, Yu-Xia; Wang, Xi-Cun
2016-12-06
The straightforward visible-light-induced synthesis of stilbene compounds via the cross-coupling of nitroalkenes and diazonium tetrafluoroborates under transition-metal-free conditions is described. The protocol uses green LEDs as light sources and eosin Y as an organophotoredox catalyst. Broad substrate scope and exclusive selectivity for the (E)-configuration of stilbenes are observed. This protocol proceeds via a radical pathway, with nitroalkenes serving as the radical acceptor, and the nitro group is cleaved during the process.
Guillois, Kevin
2013-03-01
The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.
Guillois, Kevin; Mangematin, Sté phane; Tuel, Alain; Caps, Valerie
2013-01-01
The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Püttner, Ralph; Schmidt-Weber, Philipp; Kampen, Thorsten; Kolczewski, Christine; Hermann, Klaus; Horn, Karsten
2017-01-01
Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.
Energy Technology Data Exchange (ETDEWEB)
Püttner, Ralph [Department of Physics, Freie Universität Berlin, 14195 Berlin (Germany); Schmidt-Weber, Philipp [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Kampen, Thorsten [SPECS Surface Nano Analysis GmbH, 13355 Berlin (Germany); Kolczewski, Christine [Deutsches Museum München, 80538 Munich (Germany); Hermann, Klaus [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Horn, Karsten, E-mail: horn@fhi-berlin.mpg.de [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany)
2017-02-15
Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.
Mishra, Shashank K.; Mendez, Violaine; Jeanneau, Erwann; Caps, Valerie; Daniè le, Sté phane
2012-01-01
A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mishra, Shashank K.
2012-12-14
A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Wolfgang Streicher
Full Text Available BACKGROUND: Advanced castration resistant prostate cancer (CRPC is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. METHODOLOGY: In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV and (E-4-(2, 6-Difluorostyryl-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. RESULTS: The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. CONCLUSION: RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors.
Energy Technology Data Exchange (ETDEWEB)
Brown, J. A.; Goldblum, B. L., E-mail: bethany@nuc.berkeley.edu; Brickner, N. M.; Daub, B. H.; Kaufman, G. S.; Bibber, K. van; Vujic, J. [Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States); Bernstein, L. A.; Bleuel, D. L.; Caggiano, J. A.; Hatarik, R.; Phillips, T. W.; Zaitseva, N. P. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Wender, S. A. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)
2014-05-21
The neutron time-of-flight (nTOF) diagnostics used to characterize implosions at the National Ignition Facility (NIF) has necessitated the development of novel scintillators that exhibit a rapid temporal response and high light yield. One such material, a bibenzyl-stilbene mixed single-crystal organic scintillator grown in a 99.5:0.5 ratio in solution, has become the standard scintillator used for nTOF diagnostics at NIF. The prompt fluorescence lifetime and relative light yield as a function of proton energy were determined to calibrate this material as a neutron detector. The temporal evolution of the intensity of the prompt fluorescent response was modeled using first-order reaction kinetics and the prompt fluorescence decay constant was determined to be 2.46 ± 0.01 (fit) ± 0.13 (systematic) ns. The relative response of the bibenzyl-stilbene mixed crystal generated by recoiling protons was measured, and results were analyzed using Birks' relation to quantify the non-radiative quenching of excitation energy in the scintillator.
Synthesis of amide isosteres of schweinfurthin-based stilbenes.
Stockdale, David P; Beutler, John A; Wiemer, David F
2017-10-15
The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhao, Xiao-Hui; Han, Fa; Li, Yu-Lin; Yue, Hui-Lan
2013-02-01
Stilbene glycosides are the primary constituents of Rheum tanguticum Maxim. ex Balf., to which different bioactivities has been attributed, including: anti-HIV, anti-oxidant, anti-tumour, anti-malarial, and anti-allergy activity. However, effective methods for the isolation and purification of stilbene glycosides, such as trans-rhapontin, cis-rhapontin and trans-desoxyrhaponticin, from this herb are not currently available. To develop an efficient method for the preparative isolation and purification of three stilbene glycosides from Rheum tanguticum Maxim. ex Balf. via high-speed counter-current chromatography (HSCCC). A solvent system composed of chloroform:n-butanol:methanol:water (4:1:3:2, v/v/v/v) was developed for the separation. The upper phase was used as the stationary phase, and the lower phase was used as the mobile phase. The flow rate was 1.8 mL/min. The apparatus was controlled at 800 rpm and 25 °C, and the effluent was monitored at 280 nm. Chemical constituents were analysed by high-performance liquid chromatography (HPLC), and their structures were identified by ¹H- and ¹³C-NMR. Under the optimised conditions, 25.5 mg trans-rhapontin, 16.0 mg cis-rhapontin and 20.5 mg trans-desoxyrhaponticin were separated from 80 mg crude sample; the isolates had purities of 99.6, 97.2 and 99.2%, respectively. A simple and efficient HSCCC method has been optimised for the preparative separation of stilbene glycosides from Rheum tanguticum Maxim. ex Balf. Copyright © 2012 John Wiley & Sons, Ltd.
Evidence for excited state intramolecular charge transfer in benzazole-based pseudo-stilbenes.
Santos, Fabiano da Silveira; Descalzo, Rodrigo Roceti; Gonçalves, Paulo Fernando Bruno; Benvenutti, Edilson Valmir; Rodembusch, Fabiano Severo
2012-08-21
Two azo compounds were obtained through the diazotization reaction of aminobenzazole derivatives and N,N-dimethylaniline using clay montmorillonite KSF as catalyst. The synthesized dyes were characterized using elemental analysis, Fourier transform infrared spectroscopy, and (13)C and (1)H NMR spectroscopy in solution. Their photophysical behavior was studied using UV-vis and steady-state fluorescence in solution. These dyes present intense absorption in the blue region. The spectral features of the azo compounds can be related to the pseudo-stilbene type as well as the E isomer of the dyes. Excitation at the absorption maxima does not produce emissive species in the excited state. However, excitation around 350 nm allowed dual emission of fluorescence, from both a locally excited (LE, short wavelength) and an intramolecular charge transfer (ICT, long wavelength) state, which was corroborated by a linear relation of the fluorescence maximum (ν(max)) versus the solvent polarity function (Δf) from the Lippert-Mataga correlation. Evidence of TICT in these dyes was discussed from the viscosity dependence of the fluorescence intensity in the ICT emission band. Theoretical calculations were also performed in order to study the geometry and charge distribution of the dyes in their ground and excited electronic states. Using DFT methods at the theoretical levels BLYP/Aug-cc-pVDZ, for geometry optimizations and frequency calculations, and B3LYP/6-311+G(2d), for single-point energy evaluations, the calculations revealed that the least energetic and most intense photon absorption leads to a very polar excited state that relaxes non-radioactively, which can be associated with photochemical isomerization.
Energy Technology Data Exchange (ETDEWEB)
Wang, Yechun; Yi, Hankuil; Wang, Melissa; Yu, Oliver; Jez, Joseph M. (WU); (Danforth)
2012-10-24
To increase the biochemical efficiency of biosynthetic systems, metabolic engineers have explored different approaches for organizing enzymes, including the generation of unnatural fusion proteins. Previous work aimed at improving the biosynthesis of resveratrol, a stilbene associated a range of health-promoting activities, in yeast used an unnatural engineered fusion protein of Arabidopsis thaliana (thale cress) 4-coumaroyl-CoA ligase (At4CL1) and Vitis vinifera (grape) stilbene synthase (VvSTS) to increase resveratrol levels 15-fold relative to yeast expressing the individual enzymes. Here we present the crystallographic and biochemical analysis of the 4CL::STS fusion protein. Determination of the X-ray crystal structure of 4CL::STS provides the first molecular view of an artificial didomain adenylation/ketosynthase fusion protein. Comparison of the steady-state kinetic properties of At4CL1, VvSTS, and 4CL::STS demonstrates that the fusion protein improves catalytic efficiency of either reaction less than 3-fold. Structural and kinetic analysis suggests that colocalization of the two enzyme active sites within 70 {angstrom} of each other provides the basis for enhanced in vivo synthesis of resveratrol.
Ioffe, Ilya N; Quick, Martin; Quick, Michael T; Dobryakov, Alexander L; Richter, Celin; Granovsky, Alex A; Berndt, Falko; Mahrwald, Rainer; Ernsting, Nikolaus P; Kovalenko, Sergey A
2017-10-25
Spontaneous polarization of a nonpolar molecule upon photoexcitation (the sudden polarization effect) earlier discussed for 90°-twisted alkenes is observed and calculated for planar ring-fluorinated stilbenes, trans-2,3,5,6,2',3',5',6'-octofluorostilbene (tF2356) and trans-2,3,4,5,6,2',3',4',5',6'-decafluorostilbene (tF23456). Due to the fluorination, Franck-Condon states S 1 FC and S 2 FC are dominated by the quasi-degenerate HOMO-1 → LUMO and HOMO-2 → LUMO excitations, while their interaction gives rise to a symmetry-broken zwitterionic S 1 state. After optical excitation of tF2356, one observes an ultrafast (∼0.06 ps) evolution that reflects relaxation from initial nonpolar S 3 FC to long-lived (1.3 ns in n-hexane and 3.4 ns in acetonitrile) polar S 1 . The polarity of S 1 is evidenced by a solvatochromic shift of its fluorescence band. The experimental results provide a sensitive test for quantum-chemical calculations. In particular, our calculations agree with the experiment, and raise concerns about the applicability of the common TDDFT approach to relatively simple stilbenic systems.
Czech Academy of Sciences Publication Activity Database
Kovářová, Marcela; Frantík, Tomáš; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav
2011-01-01
Roč. 11, č. 98 (2011), s. 1-14 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : knotweed * stilbenes * leaf damage Subject RIV: EF - Botanics Impact factor: 3.447, year: 2011
International Nuclear Information System (INIS)
Hallahan, Cornelius; McGarry, Yvonne; Collins, J.D.
1985-01-01
A radioimmunoassay for the measurement of the synthetic anabolic agent diethylstilboestrol (DES) is described. It is based on a commercially available antiserum and a tritiated derivative of DES. The method can detect low concentrations of residues (less than 0.5 ng/ml) in small samples (0.05 to 0.2 ml) of biological fluids. DES was measured in plasma, bile and urine obtained from a calf slaughtered 22 days after subcutaneous implantation of 24 mg DES. The assay described is suitable as a rapid screening procedure for identifying animals treated with stilbene substances. (author)
Gastaminza, Pablo; Pitram, Suresh M.; Dreux, Marlene; Krasnova, Larissa B.; Whitten-Bauer, Christina; Dong, Jiajia; Chung, Josan; Fokin, Valery V.; Sharpless, K. Barry; Chisari, Francis V.
2011-01-01
The recent development of a cell culture model of hepatitis C virus (HCV) infection based on the JFH-1 molecular clone has enabled discovery of new antiviral agents. Using a cell-based colorimetric screening assay to interrogate a 1,200-compound chemical library for anti-HCV activity, we identified a family of 1,2-diamines derived from trans-stilbene oxide that prevent HCV infection at nontoxic, low micromolar concentrations in cell culture. Structure-activity relationship analysis of ∼300 derivatives synthesized using click chemistry yielded compounds with greatly enhanced low nanomolar potency and a >1,000:1 therapeutic ratio. Using surrogate models of HCV infection, we showed that the compounds selectively block the initiation of replication of incoming HCV RNA but have no impact on viral entry, primary translation, or ongoing HCV RNA replication, nor do they suppress persistent HCV infection. Selection of an escape variant revealed that NS5A is directly or indirectly targeted by this compound. In summary, we have identified a family of HCV inhibitors that target a critical step in the establishment of HCV infection in which NS5A translated de novo from an incoming genomic HCV RNA template is required to initiate the replication of this important human pathogen. PMID:21430055
Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.
1999-10-01
In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.
Superior optical nonlinearity of an exceptional fluorescent stilbene dye
Energy Technology Data Exchange (ETDEWEB)
He, Tingchao [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Sreejith, Sivaramapanicker; Zhao, Yanli [Division of Chemistry and Biological Chemistry, School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Gao, Yang; Grimsdale, Andrew C. [School of Materials Science and Engineering, Nanyang Technological University, Singapore, Singapore 639798 (Singapore); Lin, Xiaodong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Sun, Handong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore)
2015-03-16
Strong multiphoton absorption and harmonic generation in organic fluorescent chromophores are, respectively, significant in many fields of research. However, most of fluorescent chromophores fall short of the full potential due to the absence of the combination of such different nonlinear upconversion behaviors. Here, we demonstrate that an exceptional fluorescent stilbene dye could exhibit efficient two- and three-photon absorption under the excitation of femtosecond pulses in solution phase. Benefiting from its biocompatibility and strong excited state absorption behavior, in vitro two-photon bioimaging and superior optical limiting have been exploited, respectively. Simultaneously, the chromophore could generate efficient three-photon excited fluorescence and third-harmonic generation (THG) when dispersed into PMMA film, circumventing the limitations of classical fluorescent chromophores. Such chromophore may find application in the production of coherent light sources of higher photon energy. Moreover, the combination of three-photon excited fluorescence and THG can be used in tandem to provide complementary information in biomedical studies.
International Nuclear Information System (INIS)
Kremlev, M.M.; Fialkov, Yu.A.
1976-01-01
The interaction is studied of trans-α, β-dibromostilbene and meso -1, 2 - dibromo -1, 2 - diphenylethane with potassium and cesium fluorides in dimethyl sulphoxide and N - methyl pyrrolidone. It has been found that in this interaction there takes place debromination of vicinal dibromides resulting in the formation of tolan and trans-stilbene, respectively, with a quantitative yield
Hammerbacher, Almuth; Ralph, Steven G; Bohlmann, Joerg; Fenning, Trevor M; Gershenzon, Jonathan; Schmidt, Axel
2011-10-01
Stilbenes are dibenzyl polyphenolic compounds produced in several unrelated plant families that appear to protect against various biotic and abiotic stresses. Stilbene biosynthesis has been well described in economically important plants, such as grape (Vitis vinifera), peanut (Arachis hypogaea), and pine (Pinus species). However, very little is known about the biosynthesis and ecological role of stilbenes in spruce (Picea), an important gymnosperm tree genus in temperate and boreal forests. To investigate the biosynthesis of stilbenes in spruce, we identified two similar stilbene synthase (STS) genes in Norway spruce (Picea abies), PaSTS1 and PaSTS2, which had orthologs with high sequence identity in sitka (Picea sitchensis) and white (Picea glauca) spruce. Despite the conservation of STS sequences in these three spruce species, they differed substantially from angiosperm STSs. Several types of in vitro and in vivo assays revealed that the P. abies STSs catalyze the condensation of p-coumaroyl-coenzyme A and three molecules of malonyl-coenzyme A to yield the trihydroxystilbene resveratrol but do not directly form the dominant spruce stilbenes, which are tetrahydroxylated. However, in transgenic Norway spruce overexpressing PaSTS1, significantly higher amounts of the tetrahydroxystilbene glycosides, astringin and isorhapontin, were produced. This result suggests that the first step of stilbene biosynthesis in spruce is the formation of resveratrol, which is further modified by hydroxylation, O-methylation, and O-glucosylation to yield astringin and isorhapontin. Inoculating spruce with fungal mycelium increased STS transcript abundance and tetrahydroxystilbene glycoside production. Extracts from STS-overexpressing lines significantly inhibited fungal growth in vitro compared with extracts from control lines, suggesting that spruce stilbenes have a role in antifungal defense.
Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter
2016-10-01
Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Czech Academy of Sciences Publication Activity Database
Honová, J.; Luňák, S.; Vala, M.; Stříteský, S.; Fekete, Ladislav; Weiter, M.; Kovalenko, A.
2016-01-01
Roč. 70, č. 10 (2016), s. 1416-1424 ISSN 0366-6352 R&D Projects: GA MŠk LO1409; GA ČR(CZ) GA15-05095S; GA MŠk LM2015088 Institutional support: RVO:68378271 Keywords : organic solar cell * thiophene-free * diphenyl-amino-stilbene * hole mobility * molecular structure Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.258, year: 2016
Vedernikov, Artem I; Ushakov, Evgeny N; Efremova, Asya A; Kuz'mina, Lyudmila G; Moiseeva, Anna A; Lobova, Natalia A; Churakov, Andrei V; Strelenko, Yuri A; Alfimov, Michael V; Howard, Judith A K; Gromov, Sergey P
2011-08-19
4,4'-Bipyridine and 2,7-diazapyrene derivatives (A) having two ammonioalkyl N-substituents were synthesized. The complex formation of these compounds with bis(18-crown-6)stilbene (D) was studied by spectrophotometry, cyclic voltammetry, (1)H NMR spectroscopy, and X-ray diffraction analysis. In MeCN, π-donor D and π-acceptors A form supramolecular 1:1 (D·A) and 2:1 (D·A·D) charge-transfer complexes. The D·A complexes have a pseudocyclic structure as a result of ditopic binding of the ammonium groups to the crown-ether fragments. The better the geometric matching between the components, the higher the stability of the D·A complexes (log K up to 9.39). A key driving force of the D·A·D complex formation is the excessive steric strain in the precursor D·A complexes. The pseudocyclic D·A complexes involving the ammoniopropyl derivative of 4,4'-bipyridine were obtained as single crystals. Crystallization of the related ammonioethyl derivative was accompanied by transition of the D·A complexes to a structure of the (D·A)(m) coordination polymer type.
Pulse radiolysis of solutions of trans-stilbene
International Nuclear Information System (INIS)
Langan, J.R.; Salmon, G.A.
1982-01-01
On pulse radiolysis of solutions of trans-stilbene (t-St) in THF the radical-anion of t-St is formed by reaction of e - sub(s) with t-St. The transient absorption spectrum observed with lambdasub(max) at 500 and 720 nm is attributed to the unassociated St - . The subsequent decay of the radical-anion is accounted for by reaction with the counter-cation of THF formed on radiolysis and with radiolytically generated radicals; rate constants for these processes are estimated. Addition of sodium tetrahydridoaluminate (NAH) results in the radical-anion being associated with Na + as a contact ion-pair and a shift of lambdasub(max) to 490 nm. In the presence of the lithium salt the absorption spectrum of the radical-anion reverts to 500 nm. On pulse radiolysis of solutions containing NAH the main reaction forming St - is that of (Na + , e - sub(s))ion pairs with t-St. In addition there is a delayed formation of St - over a period of microseconds. The presence of tetrahydridoaluminate salts also greatly enhances the stability of St - and at high doses per pulse little decay was observed over 700 μs. The variation of G(St - ) with [NAH] was studied and was found to attain a plateau value of 2.0 at the higher concentrations. (author)
International Nuclear Information System (INIS)
Ishikawa, M.; Itoga, T.; Okuji, T.; Nakhostin, M.; Shinohara, K.; Hayashi, T.; Sukegawa, A.; Baba, M.; Nishitani, T.
2006-01-01
A line-integrated neutron emission profile is routinely measured using the radial neutron collimator system in JT-60U tokamak. Stilbene neuron detectors (SNDs), which combine a stilbene organic crystal scintillation detector (SD) with an analog neutron-gamma pulse shape discrimination (PSD) circuit, have been used to measure collimated neutron flux. Although the SND has many advantages as a neutron detector, the maximum count rate is limited up to ∼1x10 5 counts/s due to the analog PSD circuit. To overcome this issue, a digital signal processing system (DSPS) using a flash analog-to-digital converter (Acqiris DC252, 8 GHz, 10 bits) has been developed at Cyclotron and Radioisotope Center in Tohoku University. In this system anode signals from photomultiplier of the SD are directory stored and digitized. Then, the PSD between neutrons and gamma rays is performed using software. The DSPS has been installed in the vertical neutron collimator system in JT-60U and applied to deuterium experiments. It is confirmed that the PSD is sufficiently performed and collimated neutron flux is successfully measured with count rate up to ∼5x10 5 counts/s without the effect of pileup of detected pulses. The performance of the DSPS as a neutron detector, which supersedes the SND, is demonstrated
Quick, Martin; Dobryakov, Alexander L; Ioffe, Ilya N; Granovsky, Alex A; Kovalenko, Sergey A; Ernsting, Nikolaus P
2016-10-20
In the photoisomerization path of stilbene, a perpendicular state P on the S 1 potential energy surface is expected just before internal conversion through a conical intersection S 1 /S 0 . For decades the observation of P was thwarted by a short lifetime τ P in combination with slow population flow over a barrier. But these limitations can be overcome by ethylenic substitution. Following optical excitation of trans-1,1'-dicyanostilbene, P is populated significantly (τ P = 27 ps in n-hexane) and monitored by an exited-state absorption band at 370 nm. Here we report stimulated Raman lines of P. The strongest, at 1558 cm -1 , is attributed to stretching vibrations of the phenyl rings. Transient electronic states, resonance conditions, and corresponding Raman signals are discussed.
Schmidt, Bernd; Elizarov, Nelli; Berger, René; Hölter, Frank
2013-06-14
4-Phenol diazonium salts undergo Pd-catalyzed Heck reactions with various styrenes to 4'-hydroxy stilbenes. In almost all cases higher yields and fewer side products were observed, compared to the analogous 4-methoxy benzene diazonium salts. In contrast, the reaction fails completely with 2- and 3-phenol diazonium salts. For these substitution patterns the methoxy-substituted derivatives are superior.
Energy Technology Data Exchange (ETDEWEB)
Vijayakumar, T.; Hubert Joe, I. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India); Reghunadhan Nair, C.P. [Polymers and Special Chemicals Division, Vikram Sarabhai Space Centre, Thiruvananthapuram 695 022, Kerala (India); Jayakumar, V.S. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India)], E-mail: vsjk@vsnl.net
2008-01-22
A comprehensive investigation on the intramolecular charge transfer (ICT) of an efficient {pi}-conjugated potential push-pull NLO chromophore, 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS), from a strong electron-donor group (dimethylamino-N(CH{sub 3}){sub 2}) to a strong electron-acceptor group (nitro-NO{sub 2}) through the {pi}-conjugated bridge (trans-stilbene) has been carried out from their vibrational spectra. The NIR FT-Raman and FT-IR spectra supported by the density functional theory (DFT) quantum chemical computations have been employed to analyze the effects of intramolecular charge transfer on the geometries and the vibrational modes contributing to the linear electro-optic effect of the organic NLO material. It has been observed that the changes in the endocyclic and exocyclic angles result from the charge-transfer interaction of the phenyl ring and the amino group in the electron-donor side of the NLO chromophore. The strongest vibrational modes contributing to the electro-optic effect have been identified and examined from the concurrent IR and Raman activation of {nu}(C=C/C-C) mode, ring C=C stretching modes, in-plane deformation modes, nitro modes and the umbrella mode of methyl groups. Furthermore, the splitting of the vinyl stretching modes and the electronic effects such as hyperconjugation and backdonation on the methyl hydrogen atoms causing the decrease of stretching frequencies and infrared intensities have also been analyzed in detail. The effect of frontier orbitals transition of electron density transfer and the influence of planarity between the phenyl rings of the stilbene moiety on the first hyperpolarizability have also been discussed.
Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping
2012-12-01
Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All
Syntheses of Resveratrol Analogues and Evaluation of Their Antioxidant Activity
International Nuclear Information System (INIS)
Kim, Mi Jeong; Jung, Se Hoon; Moon, Insu; Jun Jonggab; Lee, Jeong Tae
2014-01-01
Free radicals such as superoxide anion radicals (O 2 · - ), hydroxyl radicals (·OH) and non-free radical species such as hydrogen peroxide (H 2 O 2 ) and singlet oxygen ( 1 O 2 ) are considered as ROS. These ROS not only oxidize membrane lipids but damage nucleic acids, proteins and carbohydrates leading to mutations. If ROS are not scavenged by antioxidants, they could be involved in ageing and various diseases related to oxidative stress. Resveratrol is a natural phytoalexin found in the skin of grapes, red wines, and peanuts. It has three hydroxyl groups at the trans-stilbene structure, in which resorcinol and phenol are bridged by a trans double bond. The recent extensive studies on the resveratrol and its derivatives revealed that they have antioxidant, antimutagenic, antiinflammatory, antidiabetic, cardiovascular protective, and anticancer properties. It has been believed that the majority of the biological functions of resveratrol has been attributed to its antioxidant activity
Syntheses of Resveratrol Analogues and Evaluation of Their Antioxidant Activity
Energy Technology Data Exchange (ETDEWEB)
Kim, Mi Jeong; Jung, Se Hoon; Moon, Insu; Jun Jonggab; Lee, Jeong Tae [Hallym Univ., Chuncheon (Korea, Republic of)
2014-05-15
Free radicals such as superoxide anion radicals (O{sub 2}·{sup -}), hydroxyl radicals (·OH) and non-free radical species such as hydrogen peroxide (H{sub 2}O{sub 2}) and singlet oxygen ({sup 1}O{sub 2}) are considered as ROS. These ROS not only oxidize membrane lipids but damage nucleic acids, proteins and carbohydrates leading to mutations. If ROS are not scavenged by antioxidants, they could be involved in ageing and various diseases related to oxidative stress. Resveratrol is a natural phytoalexin found in the skin of grapes, red wines, and peanuts. It has three hydroxyl groups at the trans-stilbene structure, in which resorcinol and phenol are bridged by a trans double bond. The recent extensive studies on the resveratrol and its derivatives revealed that they have antioxidant, antimutagenic, antiinflammatory, antidiabetic, cardiovascular protective, and anticancer properties. It has been believed that the majority of the biological functions of resveratrol has been attributed to its antioxidant activity.
Knauf, Philip A; Law, Foon-Yee; Leung, Tze-Wah Vivian; Atherton, Stephen J
2004-09-28
Previous fluorescence resonance energy transfer (FRET) measurements, using BIDS (4-benzamido-4'-isothiocyanostilbene-2,2'-disulfonate) as a label for the disulfonic stilbene site and FM (fluorescein-5-maleimide) as a label for the cytoplasmic SH groups on band 3 (AE1), combined with data showing that the cytoplasmic SH groups lie about 40 A from the cytoplasmic surface of the lipid bilayer, would place the BIDS sites very near the membrane's inner surface, a location that seems to be inconsistent with current models of AE1 structure and mechanism. We reinvestigated the BIDS-FM distance, using laser single photon counting techniques as well as steady-state fluorescence of AE1, in its native membrane environment. Both techniques agree that there is very little energy transfer from BIDS to FM. The mean energy transfer (E), based on three-exponential fits to the fluorescence decay data, is 2.5 +/- 0.7% (SEM, N = 12). Steady-state fluorescence measurements also indicate BIDS to FM. These data indicate that the BIDS sites are probably over 63 A from the cytoplasmic SH groups, placing them near the middle or the external half of the lipid bilayer. This relocation of the BIDS sites fits with other evidence that the disulfonic stilbene sites are located farther toward the external membrane surface than Glu-681, a residue near the inner membrane surface whose modification affects the pH dependence and anion selectivity of band 3. The involvement of two relatively distant parts of the AE1 protein in transport function suggests that the transport mechanism requires coordinated large-scale conformational changes in the band 3 protein.
Shimasaki, Toshiaki; Kato, Shin-ichiro; Ideta, Keiko; Goto, Kenta; Shinmyozu, Teruo
2007-02-16
Novel photoswitchable chiral hosts having an axis chiral 2,2'-dihydroxy-1,1'-binaphthyl (BINOL)-appended stiff-stilbene, trans-(R,R)- and -(S,S)-1, were synthesized by palladium-catalyzed Suzuki-Miyaura coupling and low-valence titanium-catalyzed McMurry coupling as key steps, and they were fully characterized by various NMR spectral techniques. The enantiomers of trans-1 showed almost complete mirror images in the CD spectra, where two split Cotton effects (exciton coupling) were observed in the beta-transitions of the naphthyl chromophore at 222 and 235 nm, but no Cotton effect was observed in the stiff-stilbene chromophore at 365 nm. The structures of (R)-10 and trans-(R,R)-1 were confirmed by X-ray structural analysis. The optimized structure of cis-1 by MO calculations has a wide chiral cavity of 7-8 A in diameter, whereas trans-1 cannot form an intramolecular cavity based on the X-ray data. Irradiation of (R,R)-trans-1 with black light (lambda = 365 nm) in CH3CN or benzene at 23 degrees C led to the conversion to the corresponding cis-isomer, as was monitored by 1H NMR, UV-vis, and CD spectra. At the photostationary state, the cis-1/trans-1 ratio was 86/14 in benzene or 75/25 in CH3CN. On the other hand, irradiation of the cis-1/trans-1 (75/25) mixture in CH3CN with an ultra-high-pressure Hg lamp at 23 degrees C (lambda = 410 nm) led to the photostationary state, where the cis-1/trans-1 ratio was estimated to be 9/91 on the basis of the 1H NMR spectra. The cis-trans and trans-cis interconversions could be repeated 10 times without decomposition of the C=C double bond. Thus, a new type of photoswitchable molecule has been developed, and trans-1 and cis-1 were quite durable under irradiation conditions. The guest binding properties of the BINOL moieties of trans- and cis-(R,R)-1 with F-, Cl-, and H2PO4- were examined by 1H NMR titration in CDCl3. Similar interaction with F- and Cl- was observed in trans-1 (host/guest = 1/1, Kassoc = (1.0 +/- 0.13) x 103 for F
Antimicrobial Activity of Resveratrol Analogues
Directory of Open Access Journals (Sweden)
Malik Chalal
2014-06-01
Full Text Available Stilbenes, especially resveratrol and its derivatives, have become famous for their positive effects on a wide range of medical disorders, as indicated by a huge number of published studies. A less investigated area of research is their antimicrobial properties. A series of 13 trans-resveratrol analogues was synthesized via Wittig or Heck reactions, and their antimicrobial activity assessed on two different grapevine pathogens responsible for severe diseases in the vineyard. The entire series, together with resveratrol, was first evaluated on the zoospore mobility and sporulation level of Plasmopara viticola (the oomycete responsible for downy mildew. Stilbenes displayed a spectrum of activity ranging from low to high. Six of them, including the most active ones, were subsequently tested on the development of Botrytis cinerea (fungus responsible for grey mold. The results obtained allowed us to identify the most active stilbenes against both grapevine pathogens, to compare the antimicrobial activity of the evaluated series of stilbenes, and to discuss the relationship between their chemical structure (number and position of methoxy and hydroxy groups and antimicrobial activity.
Miura, Yousuke; Momotake, Atsuya; Takeuchi, Keiichirou; Arai, Tatsuo
2011-01-01
A series of stilbene-cored poly(benzyl ether) dendrimers with benzophenone peripheries were synthesized and their photophysical and photochemical properties were studied. Fluorescence studies revealed that singlet-singlet energy transfer (SSET) from the stilbene core to the benzophenone units took place efficiently in dendrimers of all generations. Similarly, phosphorescence and time-resolved spectroscopic measurements indicated efficient triplet-triplet energy transfer (TTET) from the benzophenone periphery to the stilbene core. Upon excitation at 310 nm, the stilbene core isomerizes via an energy round trip within the dendrimer shell. The quantum yields for the energy round trip (Φ(ERT)), defined as the product of the quantum yields of SSET, intersystem crossing, and TTET (Φ(ERT) = Φ(SS)Φ(isc)Φ(TT)), were extremely high for all generations--99%, 95% and 94% for G1, G2, and G3, respectively--which means that the excitation energy of the dendrimer core was transferred to the dendrimer periphery and back to the core almost quantitatively. The quantum yield for photoisomerization of G1-G3 via an energy round trip was higher than for other stilbene-cored dendrimers, which mainly isomerize from the excited singlet state. Photostability in the dendrimers was also demonstrated and discussed.
As part of a broad-based SAR investigation of E-resveratrol (strong sirtuin activator and antineoplastic) and the anticancer vascular-targeting combretastatin-type stilbenes, a series of twenty-three beta-E-nitrostyrenes was synthesized in order to evaluate potential antineoplastic, antitubulin poly...
Guillois, Kevin
2012-02-01
The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda\\'s method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.
Guillois, Kevin; Burel, Laurence; Tuel, Alain; Caps, Valerie
2012-01-01
The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda's method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.
The O-methyltransferase PMT2 mediates methylation of pinosylvin in Scots pine.
Paasela, Tanja; Lim, Kean-Jin; Pietiäinen, Milla; Teeri, Teemu H
2017-06-01
Heartwood extractives are important determinants of the natural durability of pine heartwood. The most important phenolic compounds affecting durability are the stilbenes pinosylvin and its monomethylether, which in addition have important functions as phytoalexins in active defense. A substantial portion of the synthesized pinosylvin is 3-methoxylated but the O-methyltransferase responsible for this modification has not been correctly identified. We studied the expression of the stilbene pathway during heartwood development as well as in response to wounding of xylem and UV-C treatment of needles. We isolated and enzymatically characterized a novel O-methyltransferase, PMT2. The methylated product was verified as pinosylvin monomethylether using ultra performance liquid chromatography-tandem mass spectrometry and high performance liquid chromatography analyses. The PMT2 enzyme was highly specific for stilbenes as substrate, in contrast to caffeoyl-CoA O-methyltransferase (CCoAOMT) and PMT1 that were multifunctional. Expression profile and multifunctional activity of CCoAOMT suggest that it might have additional roles outside lignin biosynthesis. PMT1 is not involved in the stilbene pathway and its biological function remains an open question. We isolated a new specific O-methyltransferase responsible for 3-methoxylation of pinosylvin. Expression of PMT2 closely follows stilbene biosynthesis during developmental and stress induction. We propose that PMT2 is responsible for pinosylvin methylation in Scots pine (Pinus sylvestris), instead of the previously characterized methyltransferase, PMT1. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Groh, Matthias Friedrich
2013-01-01
The high-temperature syntheses of the low-valent halogenides P2I4, Te2Br, α-Te4I4, Te4(Al2Cl7)2, Te4(Bi6Cl20), Te8(Bi4Cl14),Bi8(AlCl4)2, Bi6Cl7,and Bi6Br7, as well as of WSCl4 andWOCl4 have been replaced by resource-efficient low-temperature syntheses in room temperature ionic liquids (RTILs). The simple one-pot syntheses generally do not require elaborate equipment such as twozone furnaces or evacuated silica ampoules. Compared to the published conventional approaches, reduction of reaction time (up to 80%) and temperature (up to 500 K) and, simultaneously, an increase in yield were achieved. In the majority of cases, the solid products were phase-pure. X-Ray diffraction on single crystals (redetermination of 11 crystal structures) has demonstrated that the quality of the crystals from RTILs is comparable to that of products obtained by chemical transport reactions. © 2013 Verlag der Zeitschrift für Naturforschung, Tübingen.
Energy Technology Data Exchange (ETDEWEB)
Cui, Mengchao; Tang, Ruikun; Li, Zijing; Jia, Hongmei; Liu, Boli [Beijing Normal Univ. (China). Key Laboratory of Radiopharmaceuticals; Zhang, Jinming; Zhang, Xiaojun [Chinese PLA General Hospital, Beijing (China). Dept. of Nuclear Medicine
2014-04-01
Four stilbene derivatives from natural products were screened as novel β-amyloid (Aβ) imaging ligands. In vitro binding assay showed that the methylated ligand, (E)-1-methoxy-4-styrylbenzene (8) displayed high binding affinity to Aβ{sub 1-42} aggregates (K{sub i} = 19.5 nM). Moreover, the {sup 11}C-labeled ligand, [{sup 11}C]8 was prepared through an O-methylation reaction using [{sup 11}C]CH{sub 3}OTf. In vitro autoradiography with sections of transgenic mouse brain also confirmed the high and specific binding of [{sup 11}C]8 to Aβ plaques. In vivo biodistribution experiments in normal mice indicated that [{sup 11}C]8 displayed high initial uptake (9.41 ± 0.51% ID/g at 5 min post-injection) into and rapid washout from the brain, with a brain{sub 5} {sub min}/brain{sub 30} {sub min} ratio of 6.63. These preliminary results suggest that [{sup 11}C]8 may be served as a novel Aβ imaging probe for PET. (orig.)
Arceo-Medina, G N; Rosado-Aguilar, J A; Rodríguez-Vivas, R I; Borges-Argaez, R
2016-09-15
Six compounds in a methanolic extract of Petiveria alliacea stem (cis-stilbene; benzyl disulphide; benzyl trisulphide; and methyl esters of hexadecanoic acid, octadecadienoic acid and octadecenoic acid) are known to exercise acaricide activity against cattle tick Rhipicephalus microplus larvae and adults. The synergistic effect of 57 combinations of these six compounds on acaricide activity against R. microplus was evaluated. Larvae immersion tests produced the lethal concentrations needed to kill 50% (LC 50 ) and 99% (LC 99 ) of the population. Adult immersion tests produced rates (%) for mortality, oviposition inhibition and eclosion inhibition. Individually, none of the compounds (1% concentration) exhibited acaricide activity (mortality ≤2.3%). When combined, however, nine mixtures exhibited a synergistic increase in activity, with high mortality rates (≥92%) in larvae. Values for LC 50 ranged from 0.07 to 0.51% and those for LC 99 from 0.66 to 5.16%. Thirty six compound mixtures had no significant activity (mortality ≤30%) against larvae. Two mixtures exhibited synergism against adults, with high rates (≥92%) of oviposition inhibition. The mixtures based on the benzyl disulphide+benzyl trisulphide pairing produced a synergistic effect against acaricide-resistant R. microplus larva and adults, and are therefore the most promising combination for controlling this ubiquitous ectoparasite. Copyright © 2016 Elsevier B.V. All rights reserved.
De Filippis, Barbara; Giancristofaro, Antonella; Ammazzalorso, Alessandra; D'Angelo, Alessandra; Fantacuzzi, Marialuigia; Giampietro, Letizia; Maccallini, Cristina; Petruzzelli, Michele; Amoroso, Rosa
2011-10-01
A new series of gemfibrozil analogues conjugated with α-asarone, trans-stilbene, chalcone, and their bioisosteric modifications were synthesized and evaluated to develop PPARα agonists. In this attempt, we have removed the methyls on the phenyl ring of gemfibrozil and introduced the above scaffolds in para position synthesizing two series of derivatives, keeping the dimethylpentanoic skeleton of gemfibrozil unaltered or demethylated. Four compounds exhibited good activation of the PPARα receptor and were also screened for their activity on PPARα-regulated gene CPT1A. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Biomedical applications of green synthesized Nobel metal nanoparticles.
Khan, Zia Ul Haq; Khan, Amjad; Chen, Yongmei; Shah, Noor S; Muhammad, Nawshad; Khan, Arif Ullah; Tahir, Kamran; Khan, Faheem Ullah; Murtaza, Behzad; Hassan, Sadaf Ul; Qaisrani, Saeed Ahmad; Wan, Pingyu
2017-08-01
Synthesis of Nobel metal nanoparticles, play a key role in the field of medicine. Plants contain a substantial number of organic constituents, like phenolic compounds and various types of glycosides that help in synthesis of metal nanoparticles. Synthesis of metal nanoparticles by green method is one of the best and environment friendly methods. The major significance of the green synthesis is lack of toxic by-products produced during metal nanoparticle synthesis. The nanoparticles, synthesized by green method show various significant biological activities. Most of the research articles report the synthesized nanoparticles to be active against gram positive and gram negative bacteria. Some of these bacteria include Escherichia coli, Bacillus subtilis, Klebsiella pneumonia and Pseudomonas fluorescens. The synthesized nanoparticles also show significant antifungal activity against Trichophyton simii, Trichophyton mentagrophytes and Trichophyton rubrum as well as different types of cancer cells such as breast cancer cell line. They also exhibit significant antioxidant activity. The activities of these Nobel metal nano-particles mainly depend on the size and shape. The particles of small size with large surface area show good activity in the field of medicine. The synthesized nanoparticles are also active against leishmanial diseases. This research article explores in detail the green synthesis of the nanoparticles and their uses thereof. Copyright © 2017 Elsevier B.V. All rights reserved.
Zhang, Jinglong; Moore, Michael E; Wang, Zhonghai; Rong, Zhou; Yang, Chaowen; Hayward, Jason P
2017-10-01
Choosing a digitizer with an appropriate sampling rate is often a trade-off between performance and economy. The influence of sampling rates on the neutron-gamma Pulse Shape Discrimination (PSD) with a solid stilbene scintillator coupled to a Silicon Photomultiplier was investigated in this work. Sampling rates from 125MSPS to 2GSPS from a 10-bit digitizer were used to collect detector pulses produced by the interactions of a Cf-252 source. Due to the decreased signal-to-noise ratio (SNR), the PSD performance degraded with reduced sampling rates. The reason of PSD performance degradation was discussed. Then, an efficient combination of filtering and digital signal processing (DSP) was then applied to suppress the timing noise and electronic background noise. The results demonstrate an improved PSD performance especially at low sampling rates, down to 125MSPS. Using filtering and DSP, the ascribed Figure of Merit (FOM) at 125keV ee (± 10keV ee ) increased from 0.95 to 1.02 at 125MSPS. At 300keV ee and above, all the FOMs are better than 2.00. Our study suggests that 250MSPS is a good enough sampling rate for neutron-gamma discrimination in this system in order to be sensitive to neutrons at and above ~ 125keV ee . Copyright © 2017 Elsevier Ltd. All rights reserved.
Sales, Jocelyn M; Resurreccion, Anna V A
2014-01-01
Peanuts are important dietary food source of resveratrol with potent antioxidant properties implicated in reducing risk of cancer, cardiovascular and Alzheimer's disease, and delaying aging. Resveratrol is a naturally occurring stilbene phytoalexin phenolic compound produced in response to a variety of biotic and abiotic stresses. This paper is a review of trans-resveratrol and related stilbenes from peanuts--their chemical structures, mechanisms for their biosynthesis, and concentrations in comparison with other major food sources. It will also discuss trans-resveratrol's absorption, bioavailability, and major health benefits; processes to enhance their biosynthesis in peanuts by biotic and abiotic stresses; process optimization for enhanced levels in peanuts and their potential food applications; and methods used for its extraction and analysis.
Ring strain and total syntheses of modified macrocycles of the isoplagiochin type
Directory of Open Access Journals (Sweden)
Andreas Speicher
2009-12-01
Full Text Available Macrocycles of the bisbibenzyl-type are natural products that are found exclusively in bryophytes (liverworts. The molecular framework of the subtype “isoplagiochin” is of substantial structural interest because of the chirality of the entire molecule, which arises from two biaryl axes in combination with two helical two-carbon units in a cyclic arrangement. From a structural as well as a synthetic point of view we report on the total synthesis of compounds which possess more rigid two-carbon biaryl bridges like stilbene (E or Z or even tolane moieties which were introduced starting with a Sonogashira protocol. The McMurry method proved to be a powerful tool for the cyclization to these considerably ring-strained macrocycles.
Directory of Open Access Journals (Sweden)
Ya-Fei Tan
2008-09-01
Full Text Available A natural product, stilbene glycoside (2,3,5,4’-tetrahydroxydiphenylethylene-2-O-glucoside, TBG, has been evaluated for the first time as a potential substrate for horseradish peroxidase (HRP-catalyzed fluorogenic reactions. The properties of TBG as a fluorogenic substrate for HRP and its application in a fluorometric enzyme-linked immunosensing system were compared with commercially available substrates such as p-hydroxyphenylpropionic acid (pHPPA, chavicol and Amplex red using Brucella melitensis antibody (BrAb as a model analyte. The immunosensing body based on HRP-BrAb was constructed by dispersing graphite, BrAg and paraffin wax at room temperature. In a competitive immunoassay procedure, the BrAb competed with HRP-BrAb to react with the immobilized BrAg. In the enzymatic reaction, the binding HRP-BrAb on the sensing body surface can catalyze the polymerization reaction of TBG by H2O2 forming fluorescent dimers and causing an increase in fluorescence intensity. TBG showed comparable ability for HRP detection and its enzyme-linked immunosensing reaction system, in a linear detection ranging of 3.5´10-8~7.6´10-6g/L and with a detection limit of 1.7´10-9 g/L. The immobilized biocomposite surface could be regenerated with excellent reproducibility (RSD=3.8% by simply polishing with an alumina paper. The proposed immunosensing system has been used to determine the BrAb in rabbit serum samples with satisfactory results.
Wei, Qian; Ta, Guang; He, Wenjing; Wang, Wei; Wu, Qiucheng
2017-01-01
Chinese herbal medicine (CHM) has been used for treating insomnia for centuries. The most used CHM for insomnia was Polygonum multiflorum. However, the molecular mechanism for CHM preventing insomnia is unknown. Stilbene glucoside (THSG), an important active component of P. multiflorum, may play an important role for treating insomnia. To test the hypothesis, Kunming mice were treated with different dosages of THSG. To examine the sleep duration, a computer-controlled sleep-wake detection system was implemented. Electroencephalogram (EEG) and electromyogram (EMG) electrodes were implanted to determine sleep-wake state. RT-PCR and Western blot was used to measure the levels of lactate dehydrogenase (LDH) and saliva alpha amylase. Spearman's rank correlation coefficient was used to identify the strength of correlation between the variables. The results showed that THSG significantly prolonged the sleep time of the mice (palpha amylase (palpha amylase (pamylase were negatively associated with sleep duration (palpha amylase.
Waghadkar, Yogesh; Arbuj, Sudhir; Shinde, Manish; Ballal, Reshma; Rane, Sunit B.; Gosavi, Suresh; Fouad, H.; Chauhan, Ratna
2018-02-01
In this work, we reported the synthesis of zinc sulphide microspheres using the hydrothermal method. ZnS microspheres were synthesized using water, zinc acetate, thiourea and ammonia solution at 150°C for 6 h, 12 h, and 24 h. The as-synthesized ZnS powders were characterized by x-ray diffraction (XRD), field emission scanning electron microscopy (FESEM) and ultraviolet-visible (UV-Vis) spectroscopy. XRD indicates the cubic (major phase) as well as hexagonal (minor phase) crystalline phase with enhanced crystallinity increased gradually with more reaction time. UV-Vis spectra show the absorption peaks in the UV-Vis region for all the samples. The Tauc's plot was used to calculate the band gap energy of ZnS samples, which are found to be 3.39 eV, 3.4 eV, and 3.42 eV for the samples synthesized at reaction times of 6 h, 12 h, and 24 h, respectively. FESEM images confirm the formation of microspheres as aggregates of spherical nanoparticles. The as-synthesized ZnS microspheres have been explored for solar light-induced photo-catalytic dye degradation of methylene blue (MB), and the results confirm that such microspheres exhibit effectual photocatalytic properties.
Bruno, Federica; Castelli, Germano; Vitale, Fabrizio; Giacomini, Elisa; Roberti, Marinella; Colomba, Claudia; Cascio, Antonio; Tolomeo, Manlio
2018-01-01
Most of the antileishmanial modern therapies are not satisfactory due to high toxicity or emergence of resistance and high cost of treatment. Previously, we observed that two compounds of a small library of trans-stilbene and terphenyl derivatives, ST18 and TR4, presented the best activity and safety profiles against Leishmania infantum promastigotes and amastigotes. In the present study we evaluated the effects of ST18 and the TR4 in 6 different species of Leishmania and the modifications induced by these two compounds in the production of 8 different cytokines from infected macrophages. We observed that TR4 was potently active in all Leishmania species tested in the study showing a leishmanicidal activity higher than that of ST18 and meglumine antimoniate in the most of the species. Moreover, TR4 was able to decrease the levels of IL-10, a cytokine able to render the host macrophage inactive allowing the persistence of parasites inside its phagolysosome, and increase the levels of IL-1β, a cytokine important for host resistance to Leishmania infection by inducible iNOS-mediated production of NO, and IL-18, a cytokine implicated in the development of Th1-type immune response. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Tomasello, Gaia; Altoe, Piero; Garavelli, Marco; Orlandi, Giorgio
2007-01-01
Stilbene photoexcitation and consequent decay to the ground state has been investigated by mapping the Minimum Energy Path (MEP) from S 1 spectroscopic state triggering an almost barrierless reaction pathway to an S 1 /S 0 degenerate region. The particular influence of the σ-π excitation on the S 1 wave function, dominated by a π→π* character, reveals how the non-dynamical correlation energy was important to correctly describe the excited state behaviour and the topological aspect of its potential energy surface. Several strategies of calculations, by using CASSCF//CASPT2 methods, were performed trying to improve the photochemical description nowadays known. Both symmetry and non symmetry preserving computations were performed; systematically was concluded that, because of the limit of CASSCF description enables only to introduce the correlation effect such as the ones due to σ-π excitations, CASSCF and CASPT2 topologies are probably often not in agreement. Thus CC2 methodology was adopted o optimize the S 1 geometries and obtain reasonable structures for the minima. Two S 1 /S 0 accessible conical intersections featured by pyramidalized carbons were located on the first excited state explaining the ultrafast radiationless decay to the ground state and the photoproducts observed within the timescale of ps
International Nuclear Information System (INIS)
Phu, Nguyen Dang; Hoang, Luc Huy; Chen, Xiang-Bai; Kong, Meng-Hong; Wen, Hua-Chiang; Chou, Wu Ching
2015-01-01
We present a study of photocatalytic activities of Bi 2 WO 6 nanoparticles synthesized by fast microwave-assisted method. The photocatalytic activities of the nanoparticles were evaluated by the decolorization of methylene-blue under visible-light-irradiation. Our results show that the surface area of Bi 2 WO 6 nanoparticles plays a major role for improving photocatalytic activity, while visible-light absorption has only a weak effect on photocatalytic activity. This suggests efficient transportation of photo-generated electrons and holes to the oxidation active sites on the surface of nanoparticles, indicating Bi 2 WO 6 nanoparticles synthesized by fast microwave-assisted method are promising for achieving high photocatalytic activity under visible-light-irradiation. - Highlights: • The Bi 2 WO 6 nanoparticles were synthesized via fast microwave-assisted method. • The obtained Bi 2 WO 6 nanoparticles exhibited visible-light absorbance. • The surface area of Bi 2 WO 6 nanoparticles plays major role for improving photocatalytic activity. • The Bi 2 WO 6 nanoparticles are promising for achieving high photocatalytic activity under visible-light-irradiation
Suzuki, Mami; Nakabayashi, Ryo; Ogata, Yoshiyuki; Sakurai, Nozomu; Tokimatsu, Toshiaki; Goto, Susumu; Suzuki, Makoto; Jasinski, Michal; Martinoia, Enrico; Otagaki, Shungo; Matsumoto, Shogo; Saito, Kazuki; Shiratake, Katsuhiro
2015-01-01
Grape (Vitis vinifera) accumulates various polyphenolic compounds, which protect against environmental stresses, including ultraviolet-C (UV-C) light and pathogens. In this study, we looked at the transcriptome and metabolome in grape berry skin after UV-C irradiation, which demonstrated the effectiveness of omics approaches to clarify important traits of grape. We performed transcriptome analysis using a genome-wide microarray, which revealed 238 genes up-regulated more than 5-fold by UV-C light. Enrichment analysis of Gene Ontology terms showed that genes encoding stilbene synthase, a key enzyme for resveratrol synthesis, were enriched in the up-regulated genes. We performed metabolome analysis using liquid chromatography-quadrupole time-of-flight mass spectrometry, and 2,012 metabolite peaks, including unidentified peaks, were detected. Principal component analysis using the peaks showed that only one metabolite peak, identified as resveratrol, was highly induced by UV-C light. We updated the metabolic pathway map of grape in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and in the KaPPA-View 4 KEGG system, then projected the transcriptome and metabolome data on a metabolic pathway map. The map showed specific induction of the resveratrol synthetic pathway by UV-C light. Our results showed that multiomics is a powerful tool to elucidate the accumulation mechanisms of secondary metabolites, and updated systems, such as KEGG and KaPPA-View 4 KEGG for grape, can support such studies. PMID:25761715
Kerns, Q.A.
1963-08-01
>An electronlc circuit for synthesizing electrical current pulses having very fast rise times includes several sinewave generators tuned to progressively higher harmonic frequencies with signal amplitudes and phases selectable according to the Fourier series of the waveform that is to be synthesized. Phase control is provided by periodically triggering the generators at precisely controlled times. The outputs of the generators are combined in a coaxial transmission line. Any frequency-dependent delays that occur in the transmission line can be readily compensated for so that the desired signal wave shape is obtained at the output of the line. (AEC)
Composites comprising biologically-synthesized nanomaterials
Curran, Seamus; Dias, Sampath; Blau, Werner; Wang, Jun; Oremland, Ronald S; Baesman, Shaun
2013-04-30
The present disclosure describes composite materials containing a polymer material and a nanoscale material dispersed in the polymer material. The nanoscale materials may be biologically synthesized, such as tellurium nanorods synthesized by Bacillus selenitireducens. Composite materials of the present disclosure may have optical limiting properties and find use in optical limiting devices.
Global Mental Health: sharing and synthesizing knowledge for sustainable development.
O'Donnell, K; O'Donnell, M Lewis
2016-01-01
Global mental health (GMH) is a growing domain with an increasing capacity to positively impact the world community's efforts for sustainable development and wellbeing. Sharing and synthesizing GMH and multi-sectoral knowledge, the focus of this paper, is an important way to support these global efforts. This paper consolidates some of the most recent and relevant 'context resources' [global multi-sector (GMS) materials, emphasizing world reports on major issues] and 'core resources' (GMH materials, including newsletters, texts, conferences, training, etc.). In addition to offering a guided index of materials, it presents an orientation framework (global integration) to help make important information as accessible and useful as possible. Mental health colleagues are encouraged to stay current in GMH and global issues, to engage in the emerging agendas for sustainable development and wellbeing, and to intentionally connect and contribute across sectors. Colleagues in all sectors are encouraged to do likewise, and to take advantage of the wealth of shared and synthesized knowledge in the GMH domain, such as the materials featured in this paper.
Analyzing and synthesizing phylogenies using tree alignment graphs.
Directory of Open Access Journals (Sweden)
Stephen A Smith
Full Text Available Phylogenetic trees are used to analyze and visualize evolution. However, trees can be imperfect datatypes when summarizing multiple trees. This is especially problematic when accommodating for biological phenomena such as horizontal gene transfer, incomplete lineage sorting, and hybridization, as well as topological conflict between datasets. Additionally, researchers may want to combine information from sets of trees that have partially overlapping taxon sets. To address the problem of analyzing sets of trees with conflicting relationships and partially overlapping taxon sets, we introduce methods for aligning, synthesizing and analyzing rooted phylogenetic trees within a graph, called a tree alignment graph (TAG. The TAG can be queried and analyzed to explore uncertainty and conflict. It can also be synthesized to construct trees, presenting an alternative to supertrees approaches. We demonstrate these methods with two empirical datasets. In order to explore uncertainty, we constructed a TAG of the bootstrap trees from the Angiosperm Tree of Life project. Analysis of the resulting graph demonstrates that areas of the dataset that are unresolved in majority-rule consensus tree analyses can be understood in more detail within the context of a graph structure, using measures incorporating node degree and adjacency support. As an exercise in synthesis (i.e., summarization of a TAG constructed from the alignment trees, we also construct a TAG consisting of the taxonomy and source trees from a recent comprehensive bird study. We synthesized this graph into a tree that can be reconstructed in a repeatable fashion and where the underlying source information can be updated. The methods presented here are tractable for large scale analyses and serve as a basis for an alternative to consensus tree and supertree methods. Furthermore, the exploration of these graphs can expose structures and patterns within the dataset that are otherwise difficult to
Analyzing and synthesizing phylogenies using tree alignment graphs.
Smith, Stephen A; Brown, Joseph W; Hinchliff, Cody E
2013-01-01
Phylogenetic trees are used to analyze and visualize evolution. However, trees can be imperfect datatypes when summarizing multiple trees. This is especially problematic when accommodating for biological phenomena such as horizontal gene transfer, incomplete lineage sorting, and hybridization, as well as topological conflict between datasets. Additionally, researchers may want to combine information from sets of trees that have partially overlapping taxon sets. To address the problem of analyzing sets of trees with conflicting relationships and partially overlapping taxon sets, we introduce methods for aligning, synthesizing and analyzing rooted phylogenetic trees within a graph, called a tree alignment graph (TAG). The TAG can be queried and analyzed to explore uncertainty and conflict. It can also be synthesized to construct trees, presenting an alternative to supertrees approaches. We demonstrate these methods with two empirical datasets. In order to explore uncertainty, we constructed a TAG of the bootstrap trees from the Angiosperm Tree of Life project. Analysis of the resulting graph demonstrates that areas of the dataset that are unresolved in majority-rule consensus tree analyses can be understood in more detail within the context of a graph structure, using measures incorporating node degree and adjacency support. As an exercise in synthesis (i.e., summarization of a TAG constructed from the alignment trees), we also construct a TAG consisting of the taxonomy and source trees from a recent comprehensive bird study. We synthesized this graph into a tree that can be reconstructed in a repeatable fashion and where the underlying source information can be updated. The methods presented here are tractable for large scale analyses and serve as a basis for an alternative to consensus tree and supertree methods. Furthermore, the exploration of these graphs can expose structures and patterns within the dataset that are otherwise difficult to observe.
Energy Technology Data Exchange (ETDEWEB)
Phu, Nguyen Dang [Faculty of Physics, Hanoi National University of Education, 136 Xuanthuy, Cau Giay, Hanoi (Viet Nam); Hoang, Luc Huy, E-mail: hoanglhsp@hnue.edu.vn [Faculty of Physics, Hanoi National University of Education, 136 Xuanthuy, Cau Giay, Hanoi (Viet Nam); Chen, Xiang-Bai, E-mail: xchen@wit.edu.cn [School of Science and Laboratory of Optical Information Technology, Wuhan Institute of Technology, Wuhan 430205 (China); Kong, Meng-Hong [School of Science and Laboratory of Optical Information Technology, Wuhan Institute of Technology, Wuhan 430205 (China); Wen, Hua-Chiang; Chou, Wu Ching [Department of Electrophysics, National Chiao Tung University, Hsin-Chu 30010, Taiwan (China)
2015-10-25
We present a study of photocatalytic activities of Bi{sub 2}WO{sub 6} nanoparticles synthesized by fast microwave-assisted method. The photocatalytic activities of the nanoparticles were evaluated by the decolorization of methylene-blue under visible-light-irradiation. Our results show that the surface area of Bi{sub 2}WO{sub 6} nanoparticles plays a major role for improving photocatalytic activity, while visible-light absorption has only a weak effect on photocatalytic activity. This suggests efficient transportation of photo-generated electrons and holes to the oxidation active sites on the surface of nanoparticles, indicating Bi{sub 2}WO{sub 6} nanoparticles synthesized by fast microwave-assisted method are promising for achieving high photocatalytic activity under visible-light-irradiation. - Highlights: • The Bi{sub 2}WO{sub 6} nanoparticles were synthesized via fast microwave-assisted method. • The obtained Bi{sub 2}WO{sub 6} nanoparticles exhibited visible-light absorbance. • The surface area of Bi{sub 2}WO{sub 6} nanoparticles plays major role for improving photocatalytic activity. • The Bi{sub 2}WO{sub 6} nanoparticles are promising for achieving high photocatalytic activity under visible-light-irradiation.
CAMAC programmable-control frequency synthesizer
International Nuclear Information System (INIS)
Yumaguzin, T.Kh.; Vyazovkin, D.E.; Nazirov, Eh.P.; Tuktarov, R.F.
1989-01-01
Synthesizer allows to set frequency with 0.015% accuracy and to scan it with variable step. Frequency controlled divider with further summing-up of divided frequency with fundamental one is used in synthesizer, and it has allowed to use digit of the input code and to obtain 3-4 MHz frequency range. Variation of operation flowsheet in the other frequency range is possible. K-155 and K-531 series microcircuits were used during development
Directory of Open Access Journals (Sweden)
Gyungse Park
2008-07-01
Full Text Available In the title compound, [Cd3(C16H10O43(C3H7NO2]n or [Cd3(SDA3(DMF2]n (H2SDA is trans-stilbene-4,4′-dicarboxylic acid and DMF is dimethylformamide, the linear dicarboxylate ligand forms a two-dimensionally layered metal–organic network with the relatively uncommon 36 topology. The structure reveals trinuclear secondary building units and has an octahedral geometry at a central metal ion (occupying a overline{3} symmetry site and tetrahedral geometries at two surrounding symmetrically equivalent metal ions lying on a threefold axis. The six-connected planar trinuclear CdII centers, Cd3(O2CR6, play a role as potential nodes in generation of the relatively uncommon 36 topology. The coordinated DMF unit is disordered around the threefold axis.
Wang, Jun; Huang, Jing; Du, Likai; Lan, Zhenggang
2015-07-09
The photoinduced intramolecular excited-state energy-transfer (EET) process in conjugated polymers has received a great deal of research interest because of its important role in the light harvesting and energy transport of organic photovoltaic materials in photoelectric devices. In this work, the silylene-bridged biphenyl and stilbene (SBS) system was chosen as a simplified model system to obtain physical insight into the photoinduced intramolecular energy transfer between the different building units of the SBS copolymer. In the SBS system, the vinylbiphenyl and vinylstilbene moieties serve as the donor (D) unit and the acceptor (A) unit, respectively. The ultrafast excited-state dynamics of the SBS system was investigated from the point of view of nonadiabatic dynamics with the surface-hopping method at the TDDFT level. The first two excited states (S1 and S2) are characterized by local excitations at the acceptor (vinylstilbene) and donor (vinylbiphenyl) units, respectively. Ultrafast S2-S1 decay is responsible for the intramolecular D-A excitonic energy transfer. The geometric distortion of the D moiety play an essential role in this EET process, whereas the A moiety remains unchanged during the nonadiabatic dynamics simulation. The present work provides a direct dynamical approach to understand the ultrafast intramolecular energy-transfer dynamics in SBS copolymers and other similar organic photovoltaic copolymers.
Synthesizing Modular Invariants for Synchronous Code
Directory of Open Access Journals (Sweden)
Pierre-Loic Garoche
2014-12-01
Full Text Available In this paper, we explore different techniques to synthesize modular invariants for synchronous code encoded as Horn clauses. Modular invariants are a set of formulas that characterizes the validity of predicates. They are very useful for different aspects of analysis, synthesis, testing and program transformation. We describe two techniques to generate modular invariants for code written in the synchronous dataflow language Lustre. The first technique directly encodes the synchronous code in a modular fashion. While in the second technique, we synthesize modular invariants starting from a monolithic invariant. Both techniques, take advantage of analysis techniques based on property-directed reachability. We also describe a technique to minimize the synthesized invariants.
A family of related proteins is encoded by the major Drosophila heat shock gene family
International Nuclear Information System (INIS)
Wadsworth, S.C.
1982-01-01
At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites
Assessment voice synthesizers for reading in digital books
Directory of Open Access Journals (Sweden)
Sérvulo Fernandes da Silva Neto
2013-07-01
Full Text Available The digital accessibility shows ways to information access in digital media that assist people with different types of disabilities to a better interaction with the computer independent of its limitations. Of these tools are composed by voice synthesizers, that supposedly simplifying their access to any recorded knowledge through digital technologies. However such tools have emerged originally in countries foreign language. Which brings us to the following research problem: the voice synthesizers are appropriate for reading digital books in the Portuguese language? The objective of this study was to analyze and classify different software tools voice synthesizers in combination with software digital book readers to support accessibility to e-books in Portuguese. Through literature review were identified applications software voice synthesizers, composing the sample analyzed in this work. We used a simplified version of the method of Multiple Criteria Decision Support - MMDA, to assess these. In the research 12 were considered readers of e-books and 11 software voice synthesizer, tested with six formats of e-books (E-pub, PDF, HTML, DOC, TXT, and Mobi. In accordance with the results, the software Virtual Vision achieved the highest score. Relative to formats, it was found that the PDF has measured a better score when summed the results of the three synthesizers. In the studied universe contacted that many synthesizers simply cannot be used because they did not support the Portuguese language.
Perception of Paralinguistic Traits in Synthesized Voices
DEFF Research Database (Denmark)
Baird, Alice Emily; Hasse Jørgensen, Stina; Parada-Cabaleiro, Emilia
2017-01-01
Along with the rise of artificial intelligence and the internet-of-things, synthesized voices are now common in daily–life, providing us with guidance, assistance, and even companionship. From formant to concatenative synthesis, the synthesized voice continues to be defined by the same traits we...
Raman assisted lightwave synthesized frequency sweeper
DEFF Research Database (Denmark)
Pedersen, Anders Tegtmeier; Rottwitt, Karsten
2010-01-01
We present a Lightwave Synthesized Frequency Sweeper comprising a Raman amplifier for loss compensation. The generated pulse train contains 123 pulses and has a flat signal level as well as a low noise level.......We present a Lightwave Synthesized Frequency Sweeper comprising a Raman amplifier for loss compensation. The generated pulse train contains 123 pulses and has a flat signal level as well as a low noise level....
Effect of zinc oxide nanoparticles synthesized by a precipitation
Indian Academy of Sciences (India)
ZnO nanoparticles were synthesized by a precipitation method in aqueous media from zinc nitrate hexahydrate and sodium hydroxide. The synthesized ZnO nanoparticles exhibited a crystalline structure with hexagonal structure of the wurtzite. The morphology of the synthesized ZnO nanoparticles presented a spherical ...
Directory of Open Access Journals (Sweden)
Azmi Seyhun Kipcak
2013-01-01
Full Text Available Magnesium borates are one of the major groups of boron minerals that have good neutron shielding performance. In this study, dehydrated magnesium borates were synthesized by solid-state method using magnesium oxide (MgO and boron oxide (B2O3, in order to test their ability of neutron shielding. After synthesizing the dehydrated magnesium borates, characterizations were done by X-ray Diffraction (XRD, fourier transform infrared (FT-IR, Raman spectroscopy, and scanning electron microscopy (SEM. Also boron oxide (B2O3 contents and reaction yields (% were calculated. XRD results showed that seven different types of dehydrated magnesium borates were synthesized. 1000°C reaction temperature, 240 minutes of reaction time, and 3 : 2, 1 : 1 mole ratios of products were selected and tested for neutron transmission. Also reaction yields were calculated between 84 and 88% for the 3 : 2 mole ratio products. The neutron transmission experiments revealed that the 3 : 2 mole ratio of MgO to B2O3 neutron transmission results (0.618–0.655 was better than the ratio of 1 : 1 (0.772–0.843.
Rajamanickam, Karthic; Sudha, S S; Francis, Mebin; Sowmya, T; Rengaramanujam, J; Sivalingam, Periyasamy; Prabakar, Kandasamy
2013-09-01
The biosynthesis of silver nanoparticles and its antimicrobial property was studied using bacteria isolated from Spirulina products. Isolated bacteria were identified as Bacillus sp. MSK 1 (JX495945), Staphylococcus sp. MSK 2 (JX495946), Bacillus sp. MSK 3 (JX495947) and Brevundimonas sp. MSK 4 (JX495948). Silver nanoparticles (AgNPs) were synthesized using bacterial culture filtrate with AgNO3. The initial syntheses of Ag nanoparticles were characterized by UV-vis spectrophotometer (by measuring the color change to intense brown). Fourier Transform Infrared Spectroscopy (FTIR) study showed evidence that proteins are possible reducing agents and Energy-dispersive X-ray (EDX) study showing the metal silver as major signal. The structure of AgNPs was determined by Scanning electron microscopy (SEM) and X-ray diffraction (XRD). Synthesized Ag nanoparticles with an average size of 40-65 nm have antimicrobial property against human pathogens like Proteus vulgaris, Salmonella typhi, Vibrio cholera, Streptococcus sp., Bacillus subtilis, Staphylococcus aureus, and Escherichia coli. Among the isolates Brevundimonas sp. MSK 4 alone showed good activity in both synthesis of AgNPs and antimicrobial activity. This work demonstrates the possible use of biological synthesized silver nanoparticles to combat the drug resistant problem. Copyright © 2013 Elsevier B.V. All rights reserved.
Enantioselective catalytic syntheses of alpha-branched chiral amines
DEFF Research Database (Denmark)
Brase, S.; Baumann, T.; Dahmen, S.
2007-01-01
Chiral amines play a pivotal role in fine chemical and natural product syntheses and the design of novel materials.......Chiral amines play a pivotal role in fine chemical and natural product syntheses and the design of novel materials....
Aeon: Synthesizing Scheduling Algorithms from High-Level Models
Monette, Jean-Noël; Deville, Yves; van Hentenryck, Pascal
This paper describes the aeon system whose aim is to synthesize scheduling algorithms from high-level models. A eon, which is entirely written in comet, receives as input a high-level model for a scheduling application which is then analyzed to generate a dedicated scheduling algorithm exploiting the structure of the model. A eon provides a variety of synthesizers for generating complete or heuristic algorithms. Moreover, synthesizers are compositional, making it possible to generate complex hybrid algorithms naturally. Preliminary experimental results indicate that this approach may be competitive with state-of-the-art search algorithms.
The development of [18F]FDG synthesizer
International Nuclear Information System (INIS)
Hu, M. G.; Kim, S. W.; Lee, J. Y.; Yang, S. D.; Jun, G. S.
2003-01-01
The automatic system for [ 18 F]FDG production using for the diagnosis of cancer has been developed. This automation system was consisted of a synthesizer module, a PLC based controller and a PMU for graphic user interface. By this system, the radiochemical purity was over 98%, the production yield was over 30% after synthesize and elapsed time was 35 minute
Crupi, Pasquale; Pichierri, Arianna; Basile, Teodora; Antonacci, Donato
2013-11-15
Flavonoids and stilbenes are secondary metabolites produced in plants that can play an important health-promoting role. The biosynthesis of these compounds generally increases as a response to biotic or abiotic stress; therefore, in order to achieve as high phenolic accumulation as possible, the interactive effects of storage conditions (temperature and time) and UV-C radiation on polyphenols content in postharvest Redglobe table grape variety were investigated. During a storage time longer than 48h, both cold storage (4°C) and UV-C exposure of almost 3min (2.4kJm(-2)) positively enhanced the content of cis- and trans-piceid (34 and 90μgg(-1) of skin, respectively) together with quercetin-3-O-galactoside and quercetin-3-O-glucoside (15 and 140μgg(-1) of skin, respectively) up to three fold respect to control grape samples. Conversely, catechin was not significantly affected by irradiation and storage treatments. With regard anthocyanins, the highest concentrations of cyanidin-3-O-glucoside and peonidin-3-Oglucoside were observed in Redglobe, stored at both room temperature and 4°C, after 5min (4.1kJm(-2)) of UV-C treatment and 24h of storage. Gathered findings showed that combined postharvest treatments can lead to possible "functional" grapes, within normal conditions of market commercialization, responding to the rising consumers demand to have foods that support and promote health. Copyright © 2013. Published by Elsevier Ltd.
National Gas Survey. Synthesized gaseous hydrocarbon fuels
Energy Technology Data Exchange (ETDEWEB)
None
1978-06-01
The supply-Technical Advisory Task Force-Synthesized Gaseous Hydrocarbon Fuels considered coal, hydrocarbon liquids, oil shales, tar sands, and bioconvertible materials as potential feedstocks for gaseous fuels. Current status of process technology for each feedstock was reviewed, economic evaluations including sensitivity analysis were made, and constraints for establishment of a synthesized gaseous hydrocarbon fuels industry considered. Process technology is presently available to manufacture gaseous hydrocarbon fuels from each of the feedstocks. In 1975 there were eleven liquid feedstock SNG plants in the United States having a capacity of 1.1 billion SCFD. There can be no contribution of SNG before 1982 from plants using feedstocks other than liquids because there are no plants in operation or under construction as of 1977. Costs for SNG are higher than current regulated prices for U.S. natural gas. Because of large reserves, coal is a prime feedstock candidate although there are major constraints in the area of coal leases, mining and water permits, and others. Commercial technology is available and several new gasification processes are under development. Oil shale is also a feedstock in large supply and commercial process technology is available. There are siting and permit constraints, and water availability may limit the ultimate size of an oil shale processing industry. Under projected conditions, bioconvertible materials are not expected to support the production of large quantities of pipeline quality gas during the next decade. Production of low or medium Btu gas from municipal solid wastes can be expected to be developed in urban areas in conjunction with savings in disposal costs. In the economic evaluations presented, the most significant factor for liquid feedstock plants is the anticipated cost of feedstock and fuel. The economic viability of plants using other feedstocks is primarily dependent upon capital requirements.
Syntheses and absorption-structure relationships of some new ...
Indian Academy of Sciences (India)
New biheterocyclic compound was synthesized as starting material to prepare new photosensitizers mono-, tri-, substituted tri-, azadimethine and mixed cyanine dyes. Absorption-structure relationship of the synthesized cyanine dyes were determined by studying their electronic spectral behaviour in ethanol. The structure of ...
Huang, Bin; Zhang, Fengying; Yu, Gang; Song, Yan; Wang, Xintong; Wang, Meiliang; Gong, Zehui; Su, Ruibin; Jia, Yanxing
2016-04-28
(-)-Incarvillateine (INCA) is the major antinociceptive component of Incarvillea sinensis, which has been used to treat rheumatism and relieve pain in traditional Chinese medicine. We have developed a concise and general synthetic approach for INCA, which enabled gram-scale asymmetric syntheses of (-)-INCA, (-)-incarvilline, (-)-isoincarvilline, and six other INCA analogues. The synthesis of isoincarvilline was reported for the first time. Three structurally simplified analogues of INCA were also synthesized. In vivo screening found that INCA and two structurally optimized analogues were efficacious in preventing the acetic acid-induced writhing response. Moreover, their analgesic efficacy was demonstrated in formalin induced pain model. More importantly, administration of 20 or 40 mg/kg INCA and two structurally optimized analogues showed strong analgesic effects in spared nerve injury (SNI) model, and their effective doses were lower than the current gold standard, gabapentin (100 mg/kg in this model).
Solid phase syntheses of oligoureas
Energy Technology Data Exchange (ETDEWEB)
Burgess, K.; Linthicum, D.S.; Russell, D.H.; Shin, H.; Shitangkoon, A.; Totani, R.; Zhang, A.J.; Ibarzo, J. [Texas A& M Univ., College Station, TX (United States)
1997-02-19
Isocyanates 7 were formed from monoprotected diamines 3 or 6, which in turn can be easily prepared from commercially available N-BOC- or N-FMOC-protected amino acid derivatives. Isocyanates 7, formed in situ, could be coupled directly to a solid support functionalized with amine groups or to amino acids anchored on resins using CH{sub 2}Cl{sub 2} as solvent and an 11 h coupling time at 25 {degree}C. Such couplings afforded peptidomimetics with an N-phthaloyl group at the N-terminus. The optimal conditions identified for removal of the N-phthaloyl group were to use 60% hydrazine in DMF for 1-3 h. Several sequences of amino acids coupled to ureas (`peptidic ureas`) and of sequential urea units (`oligoureas`) were prepared via solid phase syntheses and isolated by HPLC. Partition coefficients were measured for two of these peptidomimetics, and their water solubilities were found to be similar to the corresponding peptides. A small library of 160 analogues of the YGGFL-amide sequence was prepared via Houghten`s tea bag methodology. This library was tested for binding to the anti-{beta}-endorphin monoclonal antibody. Overall, this paper describes methodology for solid phase syntheses of oligourea derivatives with side chains corresponding to some of the protein amino acids. The chemistry involved is ideal for high-throughput syntheses and screening operations. 51 refs., 3 figs., 2 tabs.
Organodioxygen complexes of some group 4B metal ions
International Nuclear Information System (INIS)
Tarafder, M.T.H.; Akhter Hossain; Gino Mariotto
2003-09-01
Organodioxygen complexes of some group 4B metal ions, viz., zirconium(IV), tin(IV) and lead(II) containing monodentate, bidentate and tridentate ligands were synthesized and characterized. The complexes have the compositions of [Zr(O)(O 2 )2C 5 H 5 N.H 2 O], [Zr(O)(O 2 - ) 2 .2OPPh 3 ], [Sn(O 2 )(C 9 H 6 NO) 2 ], [Sn(0 2 ) 2 .(CH 2 ) 2 (NH 2 ) 2 ], [Pb(O 2 - )(C 5 H 5 N) 2 NO 3 ], [Pb(O 2 )(C 8 H 6 NOH)], [Pb(O 2 - )(det)NO 3 ] and [PbO 2 - ) (C 5 H 4 NCOOH)NO 3 .H 2 O]. Because of apparent linearity of M- O 2 grouping, the V 1 (O-O) stretching modes were only Raman active, giving bands at 810- 841 cm 1 for the peroxo complexes (1, 3, ,4 and 6), while the bands in the superoxo complexes (2, 5, 7 and 8) appeared at 1020- 1100 cm -1 . The peroxo complex of Zr(IV) containing monodentate ligands were found to oxidize trans-stilbene to trans-stilbene oxide under stoichiometric conditions. The organoperoxo complexes of tin and lead were insensitive to oxidative processes. (author)
Directory of Open Access Journals (Sweden)
Mohidul Hasan
2017-02-01
Full Text Available Resveratrol is the most important stilbene phytoalexin synthesized naturally or induced in plants, as a part of their defense mechanism. Grapes and their derivative products, including juice and wine, are the most important natural sources of resveratrol, consisting of notably higher amounts than other natural sources like peanuts. Consumption of red wine with its presence of resveratrol explained the “French Paradox”. Hence, the demand of resveratrol from grapes is increasing. Moreover, as a natural source of resveratrol, grapes became very important in the nutraceutical industry for their benefits to human health. The accumulation of resveratrol in grape skin, juice, and wine has been found to be induced by the external stimuli: microbial infection, ultrasonication (US treatment, light-emitting diode (LED, ultra violet (UV irradiation, elicitors or signaling compounds, macronutrients, and fungicides. Phenylalanine ammonia lyase, cinnamate-4-hydroxylase, coumaroyl-CoA ligase, and stilbene synthase play a key role in the synthesis of resveratrol. The up-regulation of those genes have the positive relationship with the elicited accumulation of resveratrol. In this review, we encapsulate the effect of different external stimuli (biotic and abiotic stresses or signaling compounds in order to obtain the maximum accumulation of resveratrol in grape skin, leaves, juice, wine, and cell cultures.
Operational Design that Synthesizes Art and Science
2011-05-04
FINAL 3. DATES COVERED (From - To) Feb - May 2011 4. TITLE AND SUBTITLE OPERATIONAL DESIGN THAT SYNTHESIZES ART AND SCIENCE 5a...TITLE AND SUBTITLE Operational Design That Synthesizes Art And Science 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR...proponents of EBO view warfare as only a science and not a combination of art and science . 9 Another main point of contention centered on the term
Some organoperoxo complexes of antimony, niobium and tantalum and their oxidation properties
International Nuclear Information System (INIS)
Tarafder, M.T.H.
1999-05-01
Several novel organoperoxo complexes of Nb(V), Ta(V) and Sb(V) have been synthesized and characterized. The complexes have the compositions [M(O 2 ) 2 L Cl] and [M(O 2 ) 2 L'] [L = monodentate and bidentate, neutral ligand; L' = bidentate, uninegative ligand]. These complexes are very reactive to both organic and inorganic substrates. Niobium and tantalum complexes were found to oxidize phosphines and arsines to their oxides. These also oxidize olefins to epoxides under stoichiometric conditions while under catalytic conditions, ring opening of the epoxides occur producing α-hydroxyketone when the substrate is trans-stilbene. The antimony complexes are decidedly inert towards oxidation. (author)
Fully automated parallel oligonucleotide synthesizer
Czech Academy of Sciences Publication Activity Database
Lebl, M.; Burger, Ch.; Ellman, B.; Heiner, D.; Ibrahim, G.; Jones, A.; Nibbe, M.; Thompson, J.; Mudra, Petr; Pokorný, Vít; Poncar, Pavel; Ženíšek, Karel
2001-01-01
Roč. 66, č. 8 (2001), s. 1299-1314 ISSN 0010-0765 Institutional research plan: CEZ:AV0Z4055905 Keywords : automated oligonucleotide synthesizer Subject RIV: CC - Organic Chemistry Impact factor: 0.778, year: 2001
Widely tunable THz synthesizer
Hindle, F.; Mouret, G.; Eliet, S.; Guinet, M.; Cuisset, A.; Bocquet, R.; Yasui, T.; Rovera, D.
2011-09-01
The generation of cw-THz radiation by photomixing is particularly suited to the high resolution spectroscopy of gases; nevertheless, until recently, it has suffered from a lack of frequency metrology. Frequency combs are a powerful tool that can transfer microwave frequency standards to optical frequencies and a single comb has permitted accurate (10-8) THz frequency synthesis with a limited tuning range. A THz synthesizer composed of three extended cavity laser diodes phase locked to a frequency comb has been constructed and its utility for high resolution gas phase spectroscopy demonstrated. The third laser diode allows a larger tuning range of up to 300 MHz to be achieved without the need for large frequency excursions, while the frequency comb provides a versatile link to be established from any traceable microwave frequency standard. The use of a single frequency comb as a reference for all of the cw-lasers eliminates the dependency of synthesized frequency on the carrier envelope offset frequency. This greatly simplifies the frequency comb stabilization requirements and leads to a reduced instrument complexity.
A frequency tracking synthesizer for beam diagnostic systems
International Nuclear Information System (INIS)
Peterson, D.; Marriner, J.
1991-01-01
In low and medium energy synchrotrons the beam revolution frequency changes by a large factor during the acceleration process. High production rates require that these machines cycle rapidly. In attempting to diagnose instabilities which develop during the acceleration process it is useful to be able to select some frequency segment between revolution harmonics for viewing. Most types of test equipment operating in the frequency domain, such as spectrum analyzers and network analyzers, are not suited to making direct measurements on such rapidly sweeping signals. Ideally, one would want to set the frequency frame of reference to the spot in the accelerating revolution harmonic domain where the measurements are to be made. A scheme using a direct digital synthesizer (DDS) was developed to provide this moving reference frame. This paper describes a synthesizer scheme combining digital and analog synthesizer techniques to allow tracking of signals during acceleration. Virtually any ratio of synthesizer to beam revolution frequency may be generated by this scheme. Details of hardware and measurement results are presented
Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier
2017-07-01
Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.
Gandhi, P Rajiv; Jayaseelan, C; Mary, R Regina; Mathivanan, D; Suseem, S R
2017-10-01
The aim of the present study was to evaluate the acaricidal, pediculicidal and larvicidal effect of synthesized zinc oxide nanoparticles (ZnO NPs) using Momordica charantia leaf extract against the larvae of Rhipicephalus (Boophilus) microplus, adult of Pediculus humanus capitis, and the larvae of Anopheles stephensi, Culex quinquefasciatus. The ZnO NPs were characterized by using UV, XRD, FTIR and SEM-EDX. The SEM image confirms that the synthesized nanoparticles were spherical in shape with a size of 21.32 nm. The results of GC-MS analysis indicates the presence of the major compound of Nonacosane (C 29 H 60 ) in the M. charantia leaf extract. Cattle tick, head lice and mosquito larvae were exposed to a varying concentrations of the synthesized ZnO NPs and M. charantia leaf extract for 24 h. Compared to the leaf aqueous extract, biosynthesized ZnO NPs showed higher toxicity against R. microplus, P. humanus capitis, An. stephensi, and Cx. Quinquefasciatus with the LC 50 values of 6.87, 14.38, 5.42, and 4.87 mg/L, respectively. The findings revealed that synthesized ZnO NPs possess excellent anti-parasitic activity. These results suggest that the green synthesized ZnO NPs has the potential to be used as an ideal ecofriendly approach for the control of R. microplus, P. humanus capitis and the mosquito larvae of An. Stephensi and Cx. quinquefasciatus. Copyright © 2017 Elsevier Inc. All rights reserved.
Method of synthesizing pyrite nanocrystals
Wadia, Cyrus; Wu, Yue
2013-04-23
A method of synthesizing pyrite nanocrystals is disclosed which in one embodiment includes forming a solution of iron (III) diethyl dithiophosphate and tetra-alkyl-ammonium halide in water. The solution is heated under pressure. Pyrite nanocrystal particles are then recovered from the solution.
A low-spurious fast-hopping MB-OFDM UWB synthesizer
Energy Technology Data Exchange (ETDEWEB)
Chen Danfeng; Li Wei; Li Ning; Ren Junyan, E-mail: w-li@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)
2010-06-15
A frequency synthesizer for the ultra-wide band (UWB) group no. 1 is proposed. The synthesizer uses a phase-locked loop (PLL) and single-sideband (SSB) mixers to generate the three center frequencies of the first band group by mixing 4224 MHz with {+-}264 MHz and 792 MHz, respectively. A novel multi-QSSB mixer is designed to combine the function of frequency selection and frequency conversion for low power and high linearity. The synthesizer is fabricated in Jazz 0.18-{mu}m RF CMOS technology. The measured reference spur is as low as -69 dBc and the maximum spur is the LO leakage of -32 dBc. A low phase noise of -110 dBc/Hz - 1 MHz offset and an integrated phase noise of 1.86{sup 0} are achieved. The hopping time between different bands is less than 1.8 ns. The synthesizer consumes 30 mA from a 1.8 V supply. (semiconductor integrated circuits)
A low-spurious fast-hopping MB-OFDM UWB synthesizer
International Nuclear Information System (INIS)
Chen Danfeng; Li Wei; Li Ning; Ren Junyan
2010-01-01
A frequency synthesizer for the ultra-wide band (UWB) group no. 1 is proposed. The synthesizer uses a phase-locked loop (PLL) and single-sideband (SSB) mixers to generate the three center frequencies of the first band group by mixing 4224 MHz with ±264 MHz and 792 MHz, respectively. A novel multi-QSSB mixer is designed to combine the function of frequency selection and frequency conversion for low power and high linearity. The synthesizer is fabricated in Jazz 0.18-μm RF CMOS technology. The measured reference spur is as low as -69 dBc and the maximum spur is the LO leakage of -32 dBc. A low phase noise of -110 dBc/Hz - 1 MHz offset and an integrated phase noise of 1.86 0 are achieved. The hopping time between different bands is less than 1.8 ns. The synthesizer consumes 30 mA from a 1.8 V supply. (semiconductor integrated circuits)
Information Retrieval for Ecological Syntheses
Bayliss, Helen R.; Beyer, Fiona R.
2015-01-01
Research syntheses are increasingly being conducted within the fields of ecology and environmental management. Information retrieval is crucial in any synthesis in identifying data for inclusion whilst potentially reducing biases in the dataset gathered, yet the nature of ecological information provides several challenges when compared with…
Fast, High-Precision Optical Polarization Synthesizer for Ultracold-Atom Experiments
Robens, Carsten; Brakhane, Stefan; Alt, Wolfgang; Meschede, Dieter; Zopes, Jonathan; Alberti, Andrea
2018-03-01
We present a technique for the precision synthesis of arbitrary polarization states of light with a high modulation bandwidth. Our approach consists of superimposing two laser light fields with the same wavelength, but with opposite circular polarizations, where the phase and the amplitude of each light field are individually controlled. We find that the polarization-synthesized beam reaches a degree of polarization of 99.99%, which is mainly limited by static spatial variations of the polarization state over the beam profile. We also find that the depolarization caused by temporal fluctuations of the polarization state is about 2 orders of magnitude smaller. In a recent work, Robens et al. [Low-Entropy States of Neutral Atoms in Polarization-Synthesized Optical Lattices, Phys. Rev. Lett. 118, 065302 (2017), 10.1103/PhysRevLett.118.065302] demonstrated an application of the polarization synthesizer to create two independently controllable optical lattices which trap atoms depending on their internal spin state. We use ultracold atoms in polarization-synthesized optical lattices to give an independent, in situ demonstration of the performance of the polarization synthesizer.
nanoparticles synthesized by citrate precursor m
African Journals Online (AJOL)
user
(M=Co, Cu) nanoparticles synthesized by citrate precursor method ... The structural characterization was carried out using an X-ray Diffractometer (Rikagu Miniflex, Japan) ..... His current area of interest includes magnetic nanomaterials.
Proteins synthesized in tobacco mosaic virus infected protoplasts
International Nuclear Information System (INIS)
Huber, R.
1979-01-01
The author deals with research on the multiplication of tobacco mosaic virus (TMV) in leaf cell protoplasts. An attempt is made to answer three questions: (1) Which proteins are synthesized in TMV infected protoplasts as a result of TMV multiplication. (2) Which of the synthesized proteins are made under the direction of the TMV genome and, if any, which of the proteins are host specific. (3) In which functions are these proteins involved. (Auth.)
International Nuclear Information System (INIS)
Hensley, W.K.; McKinnon, A.D.; Miley, H.S.; Panisko, M.E.; Savard, R.M.
1993-10-01
A computer code has been written at the Pacific Northwest Laboratory (PNL) to synthesize the results of typical gamma ray spectroscopy experiments. The code, dubbed SYNTH, allows a user to specify physical characteristics of a gamma ray source, the quantity of the nuclides producing the radiation, the source-to-detector distance and the presence of absorbers, the type and size of the detector, and the electronic set up used to gather the data. In the process of specifying the parameters needed to synthesize a spectrum, several interesting intermediate results are produced, including a photopeak transmission function versus energy, a detector efficiency curve, and a weighted list of gamma and x rays produced from a set of nuclides. All of these intermediate results are available for graphical inspection and for printing. SYNTH runs on personal computers. It is menu driven and can be customized to user specifications. SYNTH contains robust support for coaxial germanium detectors and some support for sodium iodide detectors. SYNTH is not a finished product. A number of additional developments are planned. However, the existing code has been compared carefully to spectra obtained from National Institute for Standards and Technology (NIST) certified standards with very favorable results. Examples of the use of SYNTH and several spectral results are presented
General Syntheses of Nanotubes Induced by Block Copolymer Self-Assembly
DEFF Research Database (Denmark)
Zhao, Jianming; Huang, Wei; Si, Pengchao
2018-01-01
Amphiphilic block copolymer templating strategies are extensively used for syntheses of mesoporous materials. However, monodisperse tubular nanostructures are limited. Here, a general method is developed to synthesize monodisperse nanotubes with narrow diameter distribution induced by self...
Mala, R.; Celsia, A. S. Ruby; Malathi Devi, S.; Geerthika, S.
2017-08-01
Biologically synthesized silver nanoparticle are biocompatible for medical applications. The present work is aimed to synthesize silver nanoparticle using the fruit pulp of Tamarindusindica and to evaluate its antibacterial and anticancer activity against lung cancercell lines. Antibacterial activity was assessed by well diffusion method. Cytotoxicity was evaluated using MTT assay. GC-MS of fruit pulp extract showed the presence of levoglucosenone, n-hexadecanoic acid, 9,12-octadecadienoic acid etc. Antioxidant activity of the fruit pulp was determined by DPPH assay, hydrogen peroxide scavenging assay and lipid peroxidation. The size of biologically synthesized silver nanoparticle varied from 50 nm to 76 nm. It was 59 nm to 98 nm for chemically synthesized silver nanoparticle. Biologically synthesized silver nanoparticle showed 26 mm inhibition zone against E. coli and chemically synthesized silver nanoparticle showed 20 mm. Antioxidant activity of fruit extract by DPPH showed 84 % reduction. The IC 50 of biologically synthesized silver nanoparticle against lung cancer cell lines was 48 µg/ml. It was 95 µg/ml for chemically synthesized silver nanoparticle. The increased activity of biologically synthesized silver nanoparticle was due to its smaller size, stability and the bioactive compounds capping the silver nanoparticle extracted from the fruit extract.
Janković, Bojan
2011-10-01
The non-isothermal pyrolysis kinetics of Acetocell (the organosolv) and Lignoboost® (kraft) lignins, in an inert atmosphere, have been studied by thermogravimetric analysis. Using isoconversional analysis, it was concluded that the apparent activation energy for all lignins strongly depends on conversion, showing that the pyrolysis of lignins is not a single chemical process. It was identified that the pyrolysis process of Acetocell and Lignoboost® lignin takes place over three reaction steps, which was confirmed by appearance of the corresponding isokinetic relationships (IKR). It was found that major pyrolysis stage of both lignins is characterized by stilbene pyrolysis reactions, which were subsequently followed by decomposition reactions of products derived from the stilbene pyrolytic process. It was concluded that non-isothermal pyrolysis of Acetocell and Lignoboost® lignins can be best described by n-th (n>1) reaction order kinetics, using the Weibull mixture model (as distributed reactivity model) with alternating shape parameters. Copyright © 2011 Elsevier Ltd. All rights reserved.
Evaluation of Biological Activities of Chemically Synthesized Silver Nanoparticles
International Nuclear Information System (INIS)
Mostafa, A. A.; Solkamy, E.N.; Sayed, Sh. R. M.; Khan, M.; Shaik, M.R.; Al-Warthan, A.; Adil, S.F.
2015-01-01
Silver nanoparticles were synthesized by the earlier reported methods. The synthesized nanoparticles were characterized using ultraviolet-visible spectrophotometry (UV/Vis), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDX), and X-ray powder diffraction (XRD). The synthesized materials were also evaluated for their antibacterial activity against Gram positive and Gram negative bacterial strains. TEM micrograph showed the spherical morphology of AgNPs with size range of 40-60 nm. The synthesized nanoparticles showed a strong antimicrobial activity and their effect depends upon bacterial strain as AgNPs exhibited greater inhibition zone for Pseudomonas aeruginosa (19.1 mm) followed by Staphylococcus aureus (14.8?mm) and S. pyogenes (13.6 mm) while the least activity was observed for Salmonella typhi (12.5 mm) at concentration of 5 μg/disc. The minimum inhibitory concentration (MIC) of AgNPs against S. aureus was 2.5 μg/disc and less than 2.5 μg/disc for P. aeruginosa. These results suggested that AgNPs can be used as an effective antiseptic agent for infectious control in medical field.
Energy Technology Data Exchange (ETDEWEB)
Shih, W.-J. [Department of Materials Science and Engineering, National Cheng Kung University, 1 Ta-Hsueh Road, Tainan, 70101, Taiwan (China); Wang, J.-W. [Department of Enviromental and Safety Engineering, Chung Hwa College of Medical Technology, 89 Wen-Hua 1st St., Rende Shiang, Tainan, 71703, Taiwan (China); Wang, M.-C. [Department of Materials Science and Engineering, National United University, 1 Lien-Da, Kung-Ching Li, Miao Li 360, Taiwan (China)]. E-mail: mcwang@nuu.edu.tw; Hon, M.-H. [Department of Materials Science and Engineering, National Cheng Kung University, 1 Ta-Hsueh Road, Tainan, 70101, Taiwan (China); Dayeh University, 112 Shan-Jiau Road, Da-Tsuen, Changhua 515, Taiwan (China)
2006-09-15
The biodegradable hydroxyapatite (HA) was synthesized by hydrolysis and characterized using high temperature X-ray diffraction (HT-XRD), differential thermal analysis and thermogravimetry (DTA/TG), and scanning electron microscopy (SEM). The in situ phase transformation of the HA synthesized from CaHPO{sub 4}.2H{sub 2}O (DCPD) and CaCO{sub 3} with a Ca / P = 1.5 in 2.5 M NaOH{sub (aq)} at 75 deg. C for 1 h was investigated by HT-XRD between 25 and 1500 deg. C. The HA was crystallized at 600 deg. C and maintained as the major phase until 1400 deg. C. The HA steadily transformed to the {alpha}-tricalcium phosphate ({alpha}-TCP) which became the major phosphate phase at 1500 deg. C. At 700 deg. C, the minor CaO phase appeared and vanished at 1300 deg. C. The Na{sup +} impurity from the hydrolysis process was responsible for the formation of the NaCaPO{sub 4} phase, which appeared above 800 deg. C and disappeared at 1200 deg. C.
Estrogenic activity of constituents from the rhizomes of Rheum undulatum Linné.
Park, SeonJu; Kim, Yun Na; Kwak, Hee Jae; Jeong, Eun Ju; Kim, Seung Hyun
2018-02-15
Stilbenes have been reported to be phytoestrogen compounds owing to its structural similarity to the estrogenic agent diethylstilbestrol. To find new stilbene-derivative phytoestrogens, isolation of stilbene-rich R. undulatum was performed and led to identify six new compounds (1-5 and 28), one newly determined absolute configurations compound (27) together with 21 previously reported compounds (6-26). The structures of compounds were determined on the basis of extensive spectroscopic methods including 1D and 2D NMR and CD spectra data. All the isolated compounds were tested for their estrogenic activities in HepG2 cells transiently transfected with ERα, ERβ and ERE-reporter plasmid. Among them, stilbene-derivatives, piceatannol 3'-O-β-d-xylopyranoside (12), cis-rhaponticin (16) and rhapontigenin 3'-O-β-d-glucopyranoside (17), showed the more potent binding affinity for estrogen receptors than 17β-estrodiol. Copyright © 2018 Elsevier Ltd. All rights reserved.
Syntheses and studies of organosilicon compounds
Energy Technology Data Exchange (ETDEWEB)
Xie, Ren [Iowa State Univ., Ames, IA (United States)
1999-02-12
The syntheses of polycarbosilanes and polysilanes as silicon carbide ceramic precursors have been active research areas in the Barton Research Group. In this thesis, the work is focused on the preparation of polycarbosilanes and polysilanes as stoichiometric silicon carbide precursor polymers. The syntheses of the precursor polymers are discussed and the conversions of these precursors to silicon carbide via pyrolysis are reported. The XRD pattern and elemental analyses of the resulting silicon carbide ceramics are presented. Silicon monoxide is an important intermediate in the production of silicon metal. The existence of silicon monoxide in gap phase has been widely accepted. In the second part of this thesis, the generation of gaseous silicon monoxide in four different reactors and the reactions of gaseous silicon monoxide towards organic compounds are discussed.
Syntheses, molecular and crystalline architectures, and ...
Indian Academy of Sciences (India)
Syntheses, molecular and crystalline architectures, and luminescence behaviour of terephthalate bridged heptacoordinated dinuclear lead(II) complexes containing a pentadentate N-donor Schiff base. SUBHASIS ROYa, SOMNATH CHOUBEYa, SUMITAVA KHANa, KISHALAY BHARa,. PARTHA MITRAb and BARINDRA ...
Wei, Lu; Yu, Yong; Shen, Yihui; Wang, Meng C.; Min, Wei
2013-01-01
Synthesis of new proteins, a key step in the central dogma of molecular biology, has been a major biological process by which cells respond rapidly to environmental cues in both physiological and pathological conditions. However, the selective visualization of a newly synthesized proteome in living systems with subcellular resolution has proven to be rather challenging, despite the extensive efforts along the lines of fluorescence staining, autoradiography, and mass spectrometry. Herein, we report an imaging technique to visualize nascent proteins by harnessing the emerging stimulated Raman scattering (SRS) microscopy coupled with metabolic incorporation of deuterium-labeled amino acids. As a first demonstration, we imaged newly synthesized proteins in live mammalian cells with high spatial–temporal resolution without fixation or staining. Subcellular compartments with fast protein turnover in HeLa and HEK293T cells, and newly grown neurites in differentiating neuron-like N2A cells, are clearly identified via this imaging technique. Technically, incorporation of deuterium-labeled amino acids is minimally perturbative to live cells, whereas SRS imaging of exogenous carbon–deuterium bonds (C–D) in the cell-silent Raman region is highly sensitive, specific, and compatible with living systems. Moreover, coupled with label-free SRS imaging of the total proteome, our method can readily generate spatial maps of the quantitative ratio between new and total proteomes. Thus, this technique of nonlinear vibrational imaging of stable isotope incorporation will be a valuable tool to advance our understanding of the complex spatial and temporal dynamics of newly synthesized proteome in vivo. PMID:23798434
Gene Cloning of Iranian Leishmania major Mannose-1-Phosphate Guanyltransferase
Directory of Open Access Journals (Sweden)
R Salehi
2009-07-01
Full Text Available "nBackground: Leishmania is an obligatory intracellular protozoan parasite, which infects human beings when infected sand fly vector takes a blood meal. Most efforts are towards designing an effective vaccine to prevent leishmaniasis. In this way, development of candidate antigen for vaccine has special important. In this study, we cloned mannose-1-phosphate guanyltransferase gene of Iranian L .major in pET32a expression vector. "nMethods: Primers based on L. major mannose-1-phosphate guanyltransferase sequence gene was designed and synthesized. DNA of Leishmania promastigotes was extracted and PCR reaction was done. PCR product was cloned into pTZ57R and sub cloned into pET32a expression vector. "nResults: Recombinant plasmid containing 1140 bp as L. major mannose-1-phosphate guanyltransferase gene was extracted and confirmed by restriction analysis. PCR product was sequenced and deposited to GenBank. There were some differences in amino acid sequences between Iranian L. major mannose-1-phosphate guanyltransferase and others previously accepted in GenBank "nConclusion: We amplified and cloned Iranian L. major mannose-1-phosphate guanyltransferase successfully.
Antibacterial activity of silver nanoparticles synthesized from serine
Energy Technology Data Exchange (ETDEWEB)
Jayaprakash, N. [Catalysis and Nanomaterials Research Laboratory, Department of Chemistry, Loyola College, Chennai 600 034 (India); SRM Valliammai Engineering College, Department of Chemistry, Chennai 603 203 (India); Judith Vijaya, J., E-mail: jjvijayaloyola@yahoo.co.in [Catalysis and Nanomaterials Research Laboratory, Department of Chemistry, Loyola College, Chennai 600 034 (India); John Kennedy, L. [Materials Division, School of Advanced Sciences, VIT University, Chennai Campus, Chennai 600 048 (India); Priadharsini, K.; Palani, P. [Department of Center for Advanced Study in Botany, University of Madras, Guindy Campus, Chennai 600 025 (India)
2015-04-01
Silver nanoparticles (Ag NPs) were synthesized by a simple microwave irradiation method using polyvinyl pyrrolidone (PVP) as a capping agent and serine as a reducing agent. UV–Visible spectra were used to confirm the formation of Ag NPs by observing the surface plasmon resonance (SPR) band at 443 nm. The emission spectrum of Ag NPs showed an emission band at 484 nm. In the presence of microwave radiation, serine acts as a reducing agent, which was confirmed by Fourier transformed infrared (FT-IR) spectrum. High-resolution transmission electron microscopy (HR-TEM) and high-resolution scanning electron microscopy (HR-SEM) were used to investigate the morphology of the synthesized sample. These images showed the sphere-like morphology. The elemental composition of the sample was determined by the energy dispersive X-ray analysis (EDX). Selected area electron diffraction (SAED) was used to find the crystalline nature of the Ag NPs. The electrochemical behavior of the synthesized Ag NPs was analyzed by the cyclic voltammetry (CV). Antibacterial experiments showed that the prepared Ag NPs showed relatively similar antibacterial activities, when compared with AgNO{sub 3} against Gram-positive and Gram-negative bacteria. - Highlights: • Microwave irradiation method is used to synthesize silver nanoparticles. • Highly stable silver nanoparticles are produced from serine. • A detailed study of antibacterial activities is discussed. • Formation mechanism of silver microspheres has been proposed.
Souper: A Synthesizing Superoptimizer
Sasnauskas, Raimondas; Chen, Yang; Collingbourne, Peter; Ketema, Jeroen; Lup, Gratian; Taneja, Jubi; Regehr, John
2017-01-01
If we can automatically derive compiler optimizations, we might be able to sidestep some of the substantial engineering challenges involved in creating and maintaining a high-quality compiler. We developed Souper, a synthesizing superoptimizer, to see how far these ideas might be pushed in the context of LLVM. Along the way, we discovered that Souper's intermediate representation was sufficiently similar to the one in Microsoft Visual C++ that we applied Souper to that compiler as well. Shipp...
A low-power CMOS frequency synthesizer for GPS receivers
International Nuclear Information System (INIS)
Yu Yunfeng; Xiao Shimao; Zhuang Haixiao; Ma Chengyan; Ye Tianchun; Yue Jianlian
2010-01-01
A low-power frequency synthesizer for GPS/Galileo L1/E1 band receivers implemented in a 0.18 μm CMOS process is introduced. By adding clock-controlled transistors at latch outputs to reduce the time constant at sensing time, the working frequency of the high-speed source-coupled logic prescaler supplying quadrature local oscillator signals has been increased, compared with traditional prescalers. Measurement results show that this synthesizer achieves an in-band phase noise of -87 dBc/Hz at 15 kHz offset, with spurs less than -65 dBc. The whole synthesizer consumes 6 mA in the case of a 1.8 V supply, and its core area is 0.6 mm 2 . (semiconductor integrated circuits)
Synthese en chemotherapeutisch onderzoek van sulfanilamidopyrimidinen
Grevenstuk, Anton Bernard
1942-01-01
In order to investigate the influence of substitution in the pyrimidine nucleous on the activity of the three isomeric sulfanilamidopyrimidines (2, 5 and 6), a number of substituted sulfanilamidopyrimidines were synthesized and tested on chemotherapeutic activity. ... Zie: Summary
International Nuclear Information System (INIS)
Hensley, W.K.; McKinnon, A.D.; Miley, H.S.; Panisko, M.E.; Savard, R.M.
1994-07-01
A computer code has been written at the Pacific Northwest Laboratory (PNL) to synthesize the results of typical gamma-ray spectroscopy experiments. The code, dubbed SYNTH, allows a use r to specify physical characteristics of a gamma-ray source, the quantity of the nuclides producing the radiation, the source-to-detector distance and the type and thickness of absorbers, the size and composition of the detector (Ge or NaI), and the electronic set up used to gather the data. In the process of specifying the parameters needed to synthesize a spectrum, several interesting intermediate results are produced, including a photopeak transmission function vs energy, a detector efficiency curve, and a weighted list of gamma and x rays produced from a set of nuclides. All of these intermediate results are available for graphical inspection and for printing. SYNTH runs on personal computers. It is menu driven and can be customized to user specifications. SYNTH contains robust support for coaxial germanium detectors and some support for sodium iodide detectors. SYNTH is not a finished product. A number of additional developments are planned. However, the existing code has been compared carefully to spectra obtained from National Institute for Standards and Technology (NIST) certified standards with very favorable results. Examples of the use of SYNTH and several spectral results will be presented
A fractional-N frequency synthesizer for wireless sensor network nodes
International Nuclear Information System (INIS)
Ma Xiao; Du Zhankun; Liu Chang; Liu Ke; Yan Yuepeng; Ye Tianchun
2014-01-01
This paper presents a fractional-N frequency synthesizer for wireless sensor network (WSN) nodes. The proposed frequency synthesizer adopts a phase locked loop (PLL) based structure, which employs an LC voltage-controlled oscillator (VCO) with small VCO gain (K VCO ) and frequency step (f step ) variations, a charge pump (CP) with current changing in proportion with the division ratio and a 20-bit ΔΣ modulator, etc. To realize constant K VCO and f step , a novel capacitor sub-bands grouping method is proposed. The VCO sub-groups' sizes are arranged according to the maximal allowed K VCO variation of the system. Besides, a current mode logic divide-by-2 circuit with inside-loop buffers ensures the synthesizer generates I/Q quadrature signals robustly. This synthesizer is implemented in a 0.13 μm CMOS process. Measurement results show that the frequency synthesizer has a frequency span from 2.07 to 3.11 GHz and the typical phase noise is −86.34 dBc/Hz at 100 kHz offset and −114.17 dBc/Hz at 1 MHz offset with a loop bandwidth of about 200 kHz, which meet the WSN nodes' requirements. (semiconductor integrated circuits)
SYNTHESIZER CONTROLLED BEAM TRANSFER FROM THE AGS TO RHIC
International Nuclear Information System (INIS)
DELONG, J.; BRENNAN, J.M.; FISCHER, W.; HAYES, T.; SMITH, K.; VALENTINO, S.
2001-01-01
To ensure minimal losses and to preserve longitudinal emittance, beam is transferred from the AGS to the RHIC bunch to bucket. This requires precision frequency and phase control for synchronization and kicker timing. The required precision is realized with a set of Direct Digital Synthesizers. Each synthesizer can be frequency and phase modulated to align the AGS bunch to the target bucket in the RHIC phase
An animated depiction of major depression epidemiology
Directory of Open Access Journals (Sweden)
Patten Scott B
2007-06-01
Full Text Available Abstract Background Epidemiologic estimates are now available for a variety of parameters related to major depression epidemiology (incidence, prevalence, etc.. These estimates are potentially useful for policy and planning purposes, but it is first necessary that they be synthesized into a coherent picture of the epidemiology of the condition. Several attempts to do so have been made using mathematical modeling procedures. However, this information is not easy to communicate to users of epidemiological data (clinicians, administrators, policy makers. Methods In this study, up-to-date data on major depression epidemiology were integrated using a discrete event simulation model. The mathematical model was animated in Virtual Reality Modeling Language (VRML to create a visual, rather than mathematical, depiction of the epidemiology. Results Consistent with existing literature, the model highlights potential advantages of population health strategies that emphasize access to effective long-term treatment. The paper contains a web-link to the animation. Conclusion Visual animation of epidemiological results may be an effective knowledge translation tool. In clinical practice, such animations could potentially assist with patient education and enhanced long-term compliance.
An animated depiction of major depression epidemiology.
Patten, Scott B
2007-06-08
Epidemiologic estimates are now available for a variety of parameters related to major depression epidemiology (incidence, prevalence, etc.). These estimates are potentially useful for policy and planning purposes, but it is first necessary that they be synthesized into a coherent picture of the epidemiology of the condition. Several attempts to do so have been made using mathematical modeling procedures. However, this information is not easy to communicate to users of epidemiological data (clinicians, administrators, policy makers). In this study, up-to-date data on major depression epidemiology were integrated using a discrete event simulation model. The mathematical model was animated in Virtual Reality Modeling Language (VRML) to create a visual, rather than mathematical, depiction of the epidemiology. Consistent with existing literature, the model highlights potential advantages of population health strategies that emphasize access to effective long-term treatment. The paper contains a web-link to the animation. Visual animation of epidemiological results may be an effective knowledge translation tool. In clinical practice, such animations could potentially assist with patient education and enhanced long-term compliance.
The Semi-automatic Synthesis of 18F-fluoroethyl-choline by Domestic FDG Synthesizer
Directory of Open Access Journals (Sweden)
ZHOU Ming
2016-02-01
Full Text Available As an important complementary imaging agent for 18F-FDG, 18F-fluoroethyl-choline (18F-FECH has been demonstrated to be promising in brain and prostate cancer imaging. By using domestic PET-FDG-TI-I CPCU synthesizer, 18F-FECH was synthesized by different reagents and consumable supplies. The C18 column was added before the product collection bottle to remove K2.2.2. The 18F-FECH was synthesized by PET-FDG-IT-I synthesizer efficiently about 30 minutes by radiochemical yield of 42.0% (no decay corrected, n=5, and the radiochemical purity was still more than 99.0% after 6 hours. The results showed the domestic PET-FDG-IT-I synthesizer could semi-automatically synthesize injectable 18F-FECH in high efficiency and radiochemical purity
Li, Hongde; Chawla, Geetanjali; Hurlburt, Alexander J; Sterrett, Maria C; Zaslaver, Olga; Cox, James; Karty, Jonathan A; Rosebrock, Adam P; Caudy, Amy A; Tennessen, Jason M
2017-02-07
L-2-hydroxyglutarate (L-2HG) has emerged as a putative oncometabolite that is capable of inhibiting enzymes involved in metabolism, chromatin modification, and cell differentiation. However, despite the ability of L-2HG to interfere with a broad range of cellular processes, this molecule is often characterized as a metabolic waste product. Here, we demonstrate that Drosophila larvae use the metabolic conditions established by aerobic glycolysis to both synthesize and accumulate high concentrations of L-2HG during normal developmental growth. A majority of the larval L-2HG pool is derived from glucose and dependent on the Drosophila estrogen-related receptor (dERR), which promotes L-2HG synthesis by up-regulating expression of the Drosophila homolog of lactate dehydrogenase (dLdh). We also show that dLDH is both necessary and sufficient for directly synthesizing L-2HG and the Drosophila homolog of L-2-hydroxyglutarate dehydrogenase (dL2HGDH), which encodes the enzyme that breaks down L-2HG, is required for stage-specific degradation of the L-2HG pool. In addition, dLDH also indirectly promotes L-2HG accumulation via synthesis of lactate, which activates a metabolic feed-forward mechanism that inhibits dL2HGDH activity and stabilizes L-2HG levels. Finally, we use a genetic approach to demonstrate that dLDH and L-2HG influence position effect variegation and DNA methylation, suggesting that this compound serves to coordinate glycolytic flux with epigenetic modifications. Overall, our studies demonstrate that growing animal tissues synthesize L-2HG in a controlled manner, reveal a mechanism that coordinates glucose catabolism with L-2HG synthesis, and establish the fly as a unique model system for studying the endogenous functions of L-2HG during cell growth and proliferation.
Li, Hongde; Chawla, Geetanjali; Hurlburt, Alexander J.; Sterrett, Maria C.; Zaslaver, Olga; Cox, James; Karty, Jonathan A.; Rosebrock, Adam P.; Caudy, Amy A.
2017-01-01
L-2-hydroxyglutarate (L-2HG) has emerged as a putative oncometabolite that is capable of inhibiting enzymes involved in metabolism, chromatin modification, and cell differentiation. However, despite the ability of L-2HG to interfere with a broad range of cellular processes, this molecule is often characterized as a metabolic waste product. Here, we demonstrate that Drosophila larvae use the metabolic conditions established by aerobic glycolysis to both synthesize and accumulate high concentrations of L-2HG during normal developmental growth. A majority of the larval L-2HG pool is derived from glucose and dependent on the Drosophila estrogen-related receptor (dERR), which promotes L-2HG synthesis by up-regulating expression of the Drosophila homolog of lactate dehydrogenase (dLdh). We also show that dLDH is both necessary and sufficient for directly synthesizing L-2HG and the Drosophila homolog of L-2-hydroxyglutarate dehydrogenase (dL2HGDH), which encodes the enzyme that breaks down L-2HG, is required for stage-specific degradation of the L-2HG pool. In addition, dLDH also indirectly promotes L-2HG accumulation via synthesis of lactate, which activates a metabolic feed-forward mechanism that inhibits dL2HGDH activity and stabilizes L-2HG levels. Finally, we use a genetic approach to demonstrate that dLDH and L-2HG influence position effect variegation and DNA methylation, suggesting that this compound serves to coordinate glycolytic flux with epigenetic modifications. Overall, our studies demonstrate that growing animal tissues synthesize L-2HG in a controlled manner, reveal a mechanism that coordinates glucose catabolism with L-2HG synthesis, and establish the fly as a unique model system for studying the endogenous functions of L-2HG during cell growth and proliferation. PMID:28115720
Zinc Oxide Nano crystals Synthesized by Quenching Technique
International Nuclear Information System (INIS)
Norhayati Abu Bakar; Akrajas Ali Umar; Muhamad Mat Salleh; Muhammad Yahya
2011-01-01
This paper reports an attempt to synthesize non toxic zinc oxide (ZnO) nano crystals using a simple quenching technique. The hot zinc oxide powder was quenched in hexane solution to obtain ZnO nano crystals. As the result, diameter size of the synthesized ZnO is 200 nm. It was also exhibited a good crystalline with wurtzite phase. The nano crystals properties of ZnO were revealed from good absorbance and green luminescence under UV exposure. This may be related with oxygen vacancy ionization during the annealing process. (author)
Biological activities of synthesized silver nanoparticles
Indian Academy of Sciences (India)
The C. halicacabum leaf extract synthesized AgNPs efficiency were tested against different bacterial pathogens MTCC-426 Proteus vulgaris, MTCC-2453 Pseudomonas aeruginosa, MTCC-96 Staphylococcus aureus, MTCC-441 Bacillus subtilis andMTCC-735 Salmonella paratyphi, and fungal pathogens Alternaria solani ...
Aerobic Epoxidation of Olefins Catalyzed by the Cobalt‐Based Metal–Organic Framework STA‐12(Co)
DEFF Research Database (Denmark)
Beier, Matthias Josef; Kleist, Wolfgang; Wharmby, Michael T.
2012-01-01
, (E)‐stilbene was converted with high selectivities between 80 and 90 %. Leaching of Co was low and the reaction was found to proceed mainly heterogeneously. The catalyst was reusable with only a small loss of activity. The catalytic epoxidation of stilbene with the MOF featured an induction period...
Enzymatic synthesizing of phytosterol oleic esters.
Pan, Xinxin; Chen, Biqiang; Wang, Juan; Zhang, Xinzhi; Zhul, Biyun; Tan, Tianwei
2012-09-01
A method of synthesizing the phytosterol esters from oleic acid and sterols was studied, using immobilized lipase Candida sp. 99-125 as catalyst. Molar ratio (oleic acid/phytosterols), temperature, reaction period, organic solvents, catalyst, and silica-gel drier were optimized, and the result showed that 93.4% of the sterols had been esterified under the optimal synthetic condition: the molar ratio of oleic acid/phytosterol is 1:1 in 10 mL iso-octane, immobilized lipase (w, 140% of the sterols), incubated in an orbital shaker (200 rpm) at a temperature of 45 °C for 24 h. The immobilized lipase could be reused for at least 13 times with limited loss of esterification activity. The conversion still maintained up to 86.6%. Hence, this developed process for synthesizing phytosterol esters could be considered as simple and low-energy consumption compared to existing chemical processes.
Directory of Open Access Journals (Sweden)
M. Solgi
2015-12-01
Full Text Available One of the major advantages of in vitro culture of African violet (Saintpaulha ionantha is production of new cultivars and propagation of their chimera which might not be propagated by the other methods. In this study, we tested the effects of silver nanoparticles on the sterilization rate (antifungal and antibacterial activity, regeneration and shoot formation of African violet "Pink Amiss" explants. These nanoparticles were synthesized from pomegranate peels and Damask rose petals extracts. We used a completely randomized design test with factorial arrangement to investigate various volumetric ratios of plant extracts to silver nitrate (1:20, 1:10, 1:5 and 1:1 on the culture contaminations. Using silver nanoparticles synthesized by the plant extracts, especially Damask rose petals extract resulted in no fungal and bacterial contamination in the African violet explants after 1 and 3 weeks as compared to the control, and silver nitrate (1mM. All tested concentrations of the silver nanoparticles significantly (P &le 0.05 controlled both bacterial and fungal contaminations. The 1:20 ratio of plant extracts to silver nitrate showed the best control. In addition, the highest regeneration (%52 and shoot regeneration (%38 was observed in this treatment. In conclusion, we suggest using silver nanoparticles synthesized by plant extracts for sterilization of in Vitro Culture for African Violet rather than using other chemicals such as silver nitrate.
Essential oils-oriented fenvalerate analogues: syntheses, characterization and biological evaluation
International Nuclear Information System (INIS)
Su, H.; Li, H.
2016-01-01
A series of essential oils oriented ester derivatives have been designed, synthesized and characterized based on the skeleton of fenvalerate. The preliminary bioassay results indicated that some of the newly synthesized compounds showed better insecticidal activities against Pyrausta nubilalis and Heliothis armigera than that of the control trans-prallethrin chloride. (author)
GHz band frequency hopping PLL-based frequency synthesizers
Institute of Scientific and Technical Information of China (English)
XU Yong; WANG Zhi-gong; GUAN Yu; XU Zhi-jun; QIAO Lu-feng
2005-01-01
In this paper we describe a full-integrated circuit containing all building blocks of a completed PLL-based synthesizer except for low pass filter(LPF).The frequency synthesizer is designed for a frequency hopping (FH) transceiver operating up to 1.5 GHz as a local oscillator. The architecture of Voltage Controlled Oscillator (VCO) is optimized to get better performance, and a phase noise of -111.85-dBc/Hz @ 1 MHz and a tuning range of 250 MHz are gained at a centre frequency of 1.35 GHz.A novel Dual-Modulus Prescaler(DMP) is designed to achieve a very low jitter and a lower power.The settling time of PLL is 80 μs while the reference frequency is 400 KHz.This monolithic frequency synthesizer is to integrate all main building blocks of PLL except for the low pass filter,with a maximum VCO output frequency of 1.5 GHz,and is fabricated with a 0.18 μm mixed signal CMOS process. Low power dissipation, low phase noise, large tuning range and fast settling time are gained in this design.
Bone sialoprotein II synthesized by cultured osteoblasts contains tyrosine sulfate
International Nuclear Information System (INIS)
Ecarot-Charrier, B.; Bouchard, F.; Delloye, C.
1989-01-01
Isolated mouse osteoblasts that retain their osteogenic activity in culture were incubated with [35S] sulfate. Two radiolabeled proteins, in addition to proteoglycans, were extracted from the calcified matrix of osteoblast cultures. All the sulfate label in both proteins was in the form of tyrosine sulfate as assessed by amino acid analysis and thin layer chromatography following alkaline hydrolysis. The elution behavior on DEAE-Sephacel of the major sulfated protein and the apparent Mr on sodium dodecyl sulfate gels were characteristic of bone sialoprotein II extracted from rat. This protein was shown to cross-react with an antiserum raised against bovine bone sialoprotein II, indicating that bone sialoprotein II synthesized by cultured mouse osteoblasts is a tyrosine-sulfated protein. The minor sulfated protein was tentatively identified as bone sialoprotein I or osteopontin based on its elution properties on DEAE-Sephacel and anomalous behavior on sodium dodecyl sulfate gels similar to those reported for rat bone sialoprotein I
Rapid decolorization of textile wastewater by green synthesized iron nanoparticles.
Ozkan, Z Y; Cakirgoz, M; Kaymak, E S; Erdim, E
2018-01-01
The effectiveness of green tea (Camellia sinensis) and pomegranate (Punica granatum) extracts for the production of iron nanoparticles and their application for color removal from a textile industry wastewater was investigated. Polyphenols in extracts act as reducing agents for iron ions in aqueous solutions, forming iron nanoparticles. Pomegranate extract was found to have almost a 10-fold higher polyphenolic content than the same amount of green tea extract on a mass basis. However, the size of the synthesized nanoparticles did not show a correlation with the polyphenolic content. 100 ppm and 300 ppm of iron nanoparticles were evaluated in terms of color removal efficiency from a real textile wastewater sample. 300 ppm of pomegranate nanoscale zero-valent iron particles showed more than 95% color removal and almost 80% dissolved organic carbon removal. The degradation mechanisms are is considered to be adsorption and precipitation to a major extent, and mineralization to a minor extent.
Directory of Open Access Journals (Sweden)
Lisa M Gandy
Full Text Available Scientists have unprecedented access to a wide variety of high-quality datasets. These datasets, which are often independently curated, commonly use unstructured spreadsheets to store their data. Standardized annotations are essential to perform synthesis studies across investigators, but are often not used in practice. Therefore, accurately combining records in spreadsheets from differing studies requires tedious and error-prone human curation. These efforts result in a significant time and cost barrier to synthesis research. We propose an information retrieval inspired algorithm, Synthesize, that merges unstructured data automatically based on both column labels and values. Application of the Synthesize algorithm to cancer and ecological datasets had high accuracy (on the order of 85-100%. We further implement Synthesize in an open source web application, Synthesizer (https://github.com/lisagandy/synthesizer. The software accepts input as spreadsheets in comma separated value (CSV format, visualizes the merged data, and outputs the results as a new spreadsheet. Synthesizer includes an easy to use graphical user interface, which enables the user to finish combining data and obtain perfect accuracy. Future work will allow detection of units to automatically merge continuous data and application of the algorithm to other data formats, including databases.
Tříska, Jan; Vrchotová, Naděžda; Balík, Josef; Soural, Ivo; Sotolář, Radek
2017-06-03
Grape canes are a waste product from viticulture that show potential as an industrially extractable source of stilbenes, which are valuable for medical and other purposes. In this work, grape canes collected in three consecutive years (2014-2016) at six different places in South Moravia, Czech Republic were extracted, and the contents of trans -resveratrol, trans -ε-viniferin, and r2-viniferin were determined by high-performance liquid chromatography. The study included three blue grape varieties of Vitis vinifera L. (Cabernet Moravia, Blaufränkisch, and Piwi variety Laurot) and four white grape varieties (Chardonnay, Green Veltliner, Piwi variety Hibernal, and Piwi variety Malverina). From the viewpoint of producing extracts with high stilbenes content, the Hibernal variety is clearly the best. The mean amounts of the stilbenes for this variety at all localities and for all three years were 4.99 g/kg for trans -resveratrol, 3.24 g/kg for trans -ε-viniferin, and 1.73 g/kg for r2-viniferin. The influence of vintage, locality, and variety on the amounts of stilbenes was studied using PCA analysis. In contrast to expectations, there was no strong impact of locality on stilbenes content. The differences were varietal for most varieties, regardless of the area of cultivation. Laurot and Hibernal varieties did differ significantly in that respect, however, as they exhibited clear dependence on location.
Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)
1975-06-01
Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.
Safeguards Technology Development Program 1st Quarter FY 2018 Report
Energy Technology Data Exchange (ETDEWEB)
Prasad, Manoj K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2018-01-10
LLNL will evaluate the performance of a stilbene-based scintillation detector array for IAEA neutron multiplicity counting (NMC) applications. This effort will combine newly developed modeling methodologies and recently acquired high-efficiency stilbene detector units to quantitatively compare the prototype system performance with the conventional He-3 counters and liquid scintillator alternatives.
Method to synthesize metal chalcogenide monolayer nanomaterials
Hernandez-Sanchez, Bernadette A.; Boyle, Timothy J.
2016-12-13
Metal chalcogenide monolayer nanomaterials can be synthesized from metal alkoxide precursors by solution precipitation or solvothermal processing. The synthesis routes are more scalable, less complex and easier to implement than other synthesis routes.
Sol–gel synthesized mesoporous anatase titanium dioxide ...
Indian Academy of Sciences (India)
for dye sensitized solar cell (DSSC) applications. R GOVINDARAJ1,∗, M ... DSSC than rutile phase. In this work, we have synthesized hierarchically structured ... Hydrolysis and polycondensation reaction mechanism of sol–gel process. 2.
Knowledge Syntheses in Medical Education: Demystifying Scoping Reviews.
Thomas, Aliki; Lubarsky, Stuart; Durning, Steven J; Young, Meredith E
2017-02-01
An unprecedented rise in health professions education (HPE) research has led to increasing attention and interest in knowledge syntheses. There are many different types of knowledge syntheses in common use, including systematic reviews, meta-ethnography, rapid reviews, narrative reviews, and realist reviews. In this Perspective, the authors examine the nature, purpose, value, and appropriate use of one particular method: scoping reviews. Scoping reviews are iterative and flexible and can serve multiple main purposes: to examine the extent, range, and nature of research activity in a given field; to determine the value and appropriateness of undertaking a full systematic review; to summarize and disseminate research findings; and to identify research gaps in the existing literature. Despite the advantages of this methodology, there are concerns that it is a less rigorous and defensible means to synthesize HPE literature. Drawing from published research and from their collective experience with this methodology, the authors present a brief description of scoping reviews, explore the advantages and disadvantages of scoping reviews in the context of HPE, and offer lessons learned and suggestions for colleagues who are considering conducting scoping reviews. Examples of published scoping reviews are provided to illustrate the steps involved in the methodology.
Study on magnetite nanoparticles synthesized by chemical method
International Nuclear Information System (INIS)
Pei Wenli; Kumada, H.; Natusme, T.; Saito, H.; Ishio, S.
2007-01-01
Magnetite nanoparticles with controlled size were synthesized by chemical method. Higher deposition temperature and a rapid-raising temperature procedure are favorable to particle size distribution and fabrication of monodisperse nanoparticles. The larger nanoparticles can be synthesized by the two-step method. The large nanoparticle (up to 25 nm) without agglomeration was successfully produced. The saturation magnetization of 11 nm magnetite particles was 45 emu/g at room temperature, which is smaller than that of bulk magnetite due to surface effect. Hysteresis of the magnetite nanoparticle was very small, indicating superparamagnetic behavior. The magnetic domains of the 11 nm magnetite nanoparticles were successfully observed by MFM
Directory of Open Access Journals (Sweden)
Andrei C. Popescu
2015-06-01
Full Text Available Hard carbon thin films were synthesized on Si (100 and quartz substrates by the Pulsed Laser Deposition (PLD technique in vacuum or methane ambient to study their suitability for applications requiring high mechanical resistance. The deposited films’ surface morphology was investigated by scanning electron microscopy, crystalline status by X-ray diffraction, packing and density by X-ray reflectivity, chemical bonding by Raman and X-ray photoelectron spectroscopy, adherence by “pull-out” measurements and mechanical properties by nanoindentation tests. Films synthesized in vacuum were a-C DLC type, while films synthesized in methane were categorized as a-C:H. The majority of PLD films consisted of two layers: one low density layer towards the surface and a higher density layer in contact with the substrate. The deposition gas pressure played a crucial role on films thickness, component layers thickness ratio, structure and mechanical properties. The films were smooth, amorphous and composed of a mixture of sp3-sp2 carbon, with sp3 content ranging between 50% and 90%. The thickness and density of the two constituent layers of a film directly determined its mechanical properties.
Directory of Open Access Journals (Sweden)
Laetitia Nivelle
2017-03-01
Full Text Available In the present study, resveratrol and various oligomeric derivatives were obtained from a 14 L bioreactor culture of elicited grapevine cell suspensions (Vitis labrusca L.. The crude ethyl acetate stilbene extract obtained from the culture medium was fractionated by centrifugal partition chromatography (CPC using a gradient elution method and the major stilbenes contained in the fractions were subsequently identified by using a 13C-NMR-based dereplication procedure and further 2D NMR analyses including HSQC, HMBC, and COSY. Beside δ-viniferin (2, leachianol F (4 and G (4′, four stilbenes (resveratrol (1, ε-viniferin (5, pallidol (3 and a newly characterized dimer (6 were recovered as pure compounds in sufficient amounts to allow assessment of their biological activity on the cell growth of three different cell lines, including two human skin malignant melanoma cancer cell lines (HT-144 and SKMEL-28 and a healthy human dermal fibroblast HDF line. Among the dimers obtained in this study, the newly characterized resveratrol dimer (6 has never been described in nature and its biological potential was evaluated here for the first time. ε-viniferin as well as dimer (6 showed IC50 values on the three tested cell lines lower than the ones exerted by resveratrol and pallidol. However, activities of the first two compounds were significantly decreased in the presence of fetal bovine serum although that of resveratrol and pallidol was not. The differential tumor activity exerted by resveratrol on healthy and cancer lines was also discussed.
Taenia solium tapeworms synthesize corticosteroids and sex steroids in vitro.
Valdez, R A; Jiménez, P; Fernández Presas, A M; Aguilar, L; Willms, K; Romano, M C
2014-09-01
Cysticercosis is a disease caused by the larval stage of Taenia solium cestodes that belongs to the family Taeniidae that affects a number of hosts including humans. Taeniids tapeworms are hermaphroditic organisms that have reproductive units called proglottids that gradually mature to develop testis and ovaries. Cysticerci, the larval stage of these parasites synthesize steroids. To our knowledge there is no information about the capacity of T. solium tapeworms to metabolize progesterone or other precursors to steroid hormones. Therefore, the aim of this paper was to investigate if T. solium tapeworms were able to transform steroid precursors to corticosteroids and sex steroids. T. solium tapeworms were recovered from the intestine of golden hamsters that had been orally infected with cysticerci. The worms were cultured in the presence of tritiated progesterone or androstenedione. At the end of the experiments the culture media were analyzed by thin layer chromatography. The experiments described here showed that small amounts of testosterone were synthesized from (3)H-progesterone by complete or segmented tapeworms whereas the incubation of segmented tapeworms with (3)H-androstenedione, instead of (3)H-progesterone, improved their capacity to synthesize testosterone. In addition, the incubation of the parasites with (3)H-progesterone yielded corticosteroids, mainly deoxicorticosterone (DOC) and 11-deoxicortisol. In summary, the results described here, demonstrate that T. solium tapeworms synthesize corticosteroid and sex steroid like metabolites. The capacity of T. solium tapeworms to synthesize steroid hormones may contribute to the physiological functions of the parasite and also to their interaction with the host. Copyright © 2014 Elsevier Inc. All rights reserved.
ANALISYS OF FRACTIONAL-N FREQUENCY SYNTHESIZERS
Directory of Open Access Journals (Sweden)
Boris I. Shakhtarin
2018-01-01
Full Text Available Modern information and control systems cannot be imagined without synchronization subsystems. These are the basic elements that provide tracking of the frequency and phase of reference and information signals, the evaluation of information parameters, and the synthesis of reference and clock signals. Frequency synthesizers (FS are widely used due to the high speed of frequency setting, a wide range of frequency grids and minimal phase noise in the operating frequency range. Since with the mass appearance of specialized microprocessors and with the improvement of automatic design systems, the feasibility and repeatability of products has become simpler, digital FS are increasingly being used. The most widely used are FS with a frequency divider on digital elements, which serves to convert the signal of a reference oscillator and a controlled generator. For FS using a divisor with an integer division factor in the feedback loop, there are a number of limitations, such as the lower frequency of the FS and the frequency step of the FS. To solve this problem, divisors with fractional-variable division factors in the feedback loop are used, which allow to obtain the required range and the grid frequency step of the FS. The methods of improving the quality of spectral and dynamic characteristics of digital synthesizers in a given band of frequency detuning are analyzed. The principles of the FS operation with a divisor with a fractionalvariable fission coefficient are described, and structural schemes are given. The results of imitation simulation in the Simulink system of the software package MATLAB of frequency synthesizers with a divisor with a fractional-variable fission factor implemented in various ways are presented, and a comparative analysis of the spectral characteristics of the obtained models is carried out.
Mesoporous Akaganeite of Adjustable Pore Size Synthesized using Mixed Templates
Zhang, Y.; Ge, D. L.; Ren, H. P.; Fan, Y. J.; Wu, L. M.; Sun, Z. X.
2017-12-01
Mesoporous akaganeite with large and adjustable pore size was synthesized through a co-template method, which was achieved by the combined interaction between PEG2000 and alkyl amines with different lengths of the straight carbon chain. The characterized results indicate that the synthesized samples show comparatively narrow BJH pore size distributions and centered at 14.3 nm when PEG and HEPA was used, and it could be enlarged to 16.8 and 19.4 nm respectively through changing the alkyl amines to DDA and HDA. Meanwhile, all the synthesized akaganeite possess relativity high specific surface area ranging from 183 to 281 m2/g and high total pore volume of 0.98 to 1.5 cm3/g. A possible mechanism leading to the pore size changing was also proposed.
An Open-Source Automated Peptide Synthesizer Based on Arduino and Python.
Gali, Hariprasad
2017-10-01
The development of the first open-source automated peptide synthesizer, PepSy, using Arduino UNO and readily available components is reported. PepSy was primarily designed to synthesize small peptides in a relatively small scale (<100 µmol). Scripts to operate PepSy in a fully automatic or manual mode were written in Python. Fully automatic script includes functions to carry out resin swelling, resin washing, single coupling, double coupling, Fmoc deprotection, ivDde deprotection, on-resin oxidation, end capping, and amino acid/reagent line cleaning. Several small peptides and peptide conjugates were successfully synthesized on PepSy with reasonably good yields and purity depending on the complexity of the peptide.
M10.6.6: Designed and manufactured Frequency Synthesizer Board (AMC)
Czuba, K
2011-01-01
The LLRF system require generation of highly stable clock and trigger signals for high precision data processing and synchronous system operation. This deliverable provides an updated AMC module designed to fulfill the LLRF system timing synchronization needs. The module contains three independent clock synthesizers that are able to generate LVDS clock signals in the range of 10 MHz to 100 MHz. The clock synthesizers can be synchronized either by an internal quartz oscillator or an external phase reference signal provided to the board from the FLASH Master Oscillator. Besides clock synthesizers the AMC card contains also an optical receiver suited to convert and decode FLASH timing signals.
4-GHz counters bring synthesizers up to speed
Lee, F.; Miller, R.
1984-06-01
The availability of digital IC counters built on GaAs makes direct frequency division in microwave synthesizers possible. Four GHz is the highest clock rate achievable in production designs. These devices have the ability to drive TTL/CMOS logic, and the counter can be connected directly to single-chip frequency synthesizers controllers. A complete microwave sythesizer is formed by two chips and a voltage-controlled oscillator (VCO). The advantages of GaAs are discussed along with flip-flop basics, aspects of device fabrication, and the characteristics of GaAs MESAFETs. Attention is given to a GaAs prescaler usable for direct conversion, four kinds of flip-flops in a divide-by-two mode, and seven-stage binary ripple counters.
Peña, Maria J; Darvill, Alan G; Eberhard, Stefan; York, William S; O'Neill, Malcolm A
2008-11-01
Xyloglucan is a well-characterized hemicellulosic polysaccharide that is present in the cell walls of all seed-bearing plants. The cell walls of avascular and seedless vascular plants are also believed to contain xyloglucan. However, these xyloglucans have not been structurally characterized. This lack of information is an impediment to understanding changes in xyloglucan structure that occurred during land plant evolution. In this study, xyloglucans were isolated from the walls of avascular (liverworts, mosses, and hornworts) and seedless vascular plants (club and spike mosses and ferns and fern allies). Each xyloglucan was fragmented with a xyloglucan-specific endo-glucanase and the resulting oligosaccharides then structurally characterized using NMR spectroscopy, MALDI-TOF and electrospray mass spectrometry, and glycosyl-linkage and glycosyl residue composition analyses. Our data show that xyloglucan is present in the cell walls of all major divisions of land plants and that these xyloglucans have several common structural motifs. However, these polysaccharides are not identical because specific plant groups synthesize xyloglucans with unique structural motifs. For example, the moss Physcomitrella patens and the liverwort Marchantia polymorpha synthesize XXGGG- and XXGG-type xyloglucans, respectively, with sidechains that contain a beta-D-galactosyluronic acid and a branched xylosyl residue. By contrast, hornworts synthesize XXXG-type xyloglucans that are structurally homologous to the xyloglucans synthesized by many seed-bearing and seedless vascular plants. Our results increase our understanding of the evolution, diversity, and function of structural motifs in land-plant xyloglucans and provide support to the proposal that hornworts are sisters to the vascular plants.
Microstructural characterization of gold nanoparticles synthesized by solution plasma processing
International Nuclear Information System (INIS)
Cho, Sung-Pyo; Bratescu, Maria Antoaneta; Takai, Osamu; Saito, Nagahiro
2011-01-01
Microstructural characteristics of gold nanoparticles (Au NPs) fabricated by solution plasma processing (SPP) in reverse micelle solutions have been studied by high-resolution transmission electron microscopy (HRTEM). The synthesized Au NPs, with an average size of 6.3 ± 1.4 nm, have different crystal characteristics; fcc single-crystalline particles, multiply twinned particles (MTPs), and incomplete MTPs (single-nanotwinned fcc configuration). The crystal structure characteristics of the Au NPs synthesized by the SPP method were analyzed and compared with similar-size Au NPs obtained by the conventional chemical reduction synthesis (CRS) method. The TEM analysis results show that the Au NPs synthesized by the CRS method have shapes and crystal structures similar to those nanoparticles obtained by the SPP method. However, from the detailed HRTEM analysis, the relative number of the Au MTPs and incomplete MTPs to the total number of the Au NPs synthesized by the SPP method was observed to be around 94%, whereas the relative number of these kinds of crystal structures fabricated by the CRS method was about 63%. It is most likely that the enhanced formation of the Au MTPs is due to the fact that the SPP method generates highly reaction-activated species under low environmental temperature conditions.
Biosynthesis of silver nanoparticles synthesized by Aspergillus
Indian Academy of Sciences (India)
In the present study, biosynthesis of silver nanoparticles and its antioxidant, antimicrobial and cytotoxic activities were investigated. Silver nanoparticles were extracellularly synthesized using Aspergillus flavus and the formation of nanoparticles was observed after 72 h of incubation. The results recorded from colour ...
Design of a synthesizer for magnetic resonance equipment using FPGA
International Nuclear Information System (INIS)
Sonora A
2006-01-01
This paper exposes the design of a direct digital synthesizer in FPGA. This desing can generate a sine wave output up to 4MHZ with 3,33 mHz of precision. The frequency is set by 32bit word of phase increment in 350ns. The desing was made for Magnetic Resonance scanners and uses a 97% of logic resources of device. Functions for the synthesizer control are implemented in the same chip
Stadler, Hans-Gerhard
2005-01-01
Ausgangspunkt für die in der vorliegenden Arbeit durchgeführten Entwicklung eines kontinuierlichen Verfahrens zur Synthese des strukturierten Triglycerides 1,3-Oleyl-2-palmitoylglycerin war die von Schmid [Schmid 1999] entwickelte lipase-katalysierte Zwei-Schritt-Synthese für strukturierte Triglyceride vom Typ ABA [European Patent Application; EP 0 882 797 A2]. In der ersten Reaktionsstufe dieser zweistufigen Umesterung wird in einer Folgereaktion das Substrat Tripalmitin mit Hilfe ein...
Synthese monitoring mestmarkt 2006-2012
Koeijer, de, T.J.; Luesink, H.H.; Daatselaar, C.H.G.
2014-01-01
De aanvoer en afzet van dierlijke mest via de mestmarkt in Nederland zijn op verzoek van het ministerie van Economische Zaken (EZ) voor de periode 2006-2012 in beeld gebracht. Dit is gedaan op basis van analyses van de Vervoersbewijzen Dierlijke Mest (VDM’s) van RVO.nl (Rijksdienst voor Ondernemend Nederland) en op basis van modelberekeningen met MAMBO. Dit WOt-technical report geeft een synthese van de resultaten. Op basis van vergelijkbare meststromen is het aanbod op basis van de VDM’s 73 ...
SYNTHESES AND CHARACTERIZATIONS OF THE CYANIDE ...
African Journals Online (AJOL)
2015-10-28
(Received October 28, 2015; revised June 25, 2016) ... suggest that the Ni(II) ion is four coordinate with four cyanide-carbon atoms in ... However, there have been many studies on octahedral [M(CN)6]n- but little ... were synthesized and investigated by vibrational spectral (FT-IR and ..... Karaağaç, D.; Kürkçüoğlu, G.S. Bull.
Synthesizing genetic sequential logic circuit with clock pulse generator.
Chuang, Chia-Hua; Lin, Chun-Liang
2014-05-28
Rhythmic clock widely occurs in biological systems which controls several aspects of cell physiology. For the different cell types, it is supplied with various rhythmic frequencies. How to synthesize a specific clock signal is a preliminary but a necessary step to further development of a biological computer in the future. This paper presents a genetic sequential logic circuit with a clock pulse generator based on a synthesized genetic oscillator, which generates a consecutive clock signal whose frequency is an inverse integer multiple to that of the genetic oscillator. An analogous electronic waveform-shaping circuit is constructed by a series of genetic buffers to shape logic high/low levels of an oscillation input in a basic sinusoidal cycle and generate a pulse-width-modulated (PWM) output with various duty cycles. By controlling the threshold level of the genetic buffer, a genetic clock pulse signal with its frequency consistent to the genetic oscillator is synthesized. A synchronous genetic counter circuit based on the topology of the digital sequential logic circuit is triggered by the clock pulse to synthesize the clock signal with an inverse multiple frequency to the genetic oscillator. The function acts like a frequency divider in electronic circuits which plays a key role in the sequential logic circuit with specific operational frequency. A cascaded genetic logic circuit generating clock pulse signals is proposed. Based on analogous implement of digital sequential logic circuits, genetic sequential logic circuits can be constructed by the proposed approach to generate various clock signals from an oscillation signal.
Cytotoxicity of Nanoliposomal Cisplatin Coated with Synthesized ...
African Journals Online (AJOL)
Purpose: To evaluate the cytotoxicity of pegylated nanoliposomal cisplatin on human ovarian cancer cell line A2780CP. Methods: Synthesized methoxypolyethylene glycol (mPEG) propionaldehyde was characterized by 1Hnuclear magnetic resonance (1H-NMR) and Fourier transform infrared spectroscopy (FTIR) and used ...
Calabriso, Nadia; Scoditti, Egeria; Massaro, Marika; Pellegrino, Mariangela; Storelli, Carlo; Ingrosso, Ilaria; Giovinazzo, Giovanna; Carluccio, Maria Annunziata
2016-03-01
The aim of the study was to evaluate the vascular anti-inflammatory effects of polyphenolic extracts from two typical South Italy red wines, the specific contribution of individual polyphenols and the underlying mechanisms of action. Human endothelial cells were incubated with increasing concentrations (1-50 μg/mL) of Primitivo and Negroamaro polyphenolic extracts (PWPE and NWPE, respectively) or pure polyphenols (1-25 μmol/L), including hydroxycinnamic acids (p-coumaric, caffeic and caftaric acids), flavonols (kaempferol, quercetin, myricetin) or stilbenes (trans-resveratrol, trans-piceid) before stimulation with lipopolysaccharide. Through multiple assays, we analyzed the endothelial-monocyte adhesion, the endothelial expression of adhesion molecules (ICAM-1, VCAM-1 and E-Selectin), monocyte chemoattractant protein-1 (MCP-1) and macrophage colony-stimulating factor (M-CSF), as well as ROS intracellular levels and the activation of NF-κB and AP-1. Both PWPE and NWPE, already at 1 μg/mL, inhibited monocyte adhesion to stimulated endothelial cells, a key event in triggering vascular inflammation. They down-regulated the expression of adhesion molecules, ICAM-1, VCAM-1, E-Selectin, as well as MCP-1 and M-CSF, at mRNA and protein levels. All polyphenols reduced intracellular ROS, and everything, except caftaric acid, inhibited the endothelial expression of adhesion molecules and MCP-1, although with different potency. Flavonols and resveratrol significantly reduced also the endothelial expression and release of M-CSF. The decrease in endothelial inflammatory gene expression was related to the inhibition of NF-κB and AP-1 activation but not to intracellular oxidative stress. This study showed multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts and indentified specific bioactive polyphenols which could counteract inflammatory diseases including atherosclerosis.
Light- induced electron transfer and ATP synthesis in a carotene synthesizing insect
Valmalette, Jean Christophe; Dombrovsky, Aviv; Brat, Pierre; Mertz, Christian; Capovilla, Maria; Robichon, Alain
2012-08-01
A singular adaptive phenotype of a parthenogenetic insect species (Acyrthosiphon pisum) was selected in cold conditions and is characterized by a remarkable apparition of a greenish colour. The aphid pigments involve carotenoid genes well defined in chloroplasts and cyanobacteria and amazingly present in the aphid genome, likely by lateral transfer during evolution. The abundant carotenoid synthesis in aphids suggests strongly that a major and unknown physiological role is related to these compounds beyond their canonical anti-oxidant properties. We report here that the capture of light energy in living aphids results in the photo induced electron transfer from excited chromophores to acceptor molecules. The redox potentials of molecules involved in this process would be compatible with the reduction of the NAD+ coenzyme. This appears as an archaic photosynthetic system consisting of photo-emitted electrons that are in fine funnelled into the mitochondrial reducing power in order to synthesize ATP molecules.
Biogenic synthesized nanoparticles and their applications
Energy Technology Data Exchange (ETDEWEB)
Singh, Abhijeet, E-mail: abhijeet.singh@jaipur.manipal.edu; Sharma, Madan Mohan [Manipal University Jaipur (India)
2016-05-06
In the present scenario, there are growing concerns over the potential impacts of bioengineered nanoparticles in the health sector. However, our understanding of how bioengineered nanoparticles may affect organisms within natural ecosystems, lags far behind our rapidly increasing ability to engineer novel nanoparticles. To date, research on the biological impacts of bioengineered nanoparticles has primarily consisted of controlled lab studies of model organisms with single species in culture media. Here, we described a cost effective and environment friendly technique for green synthesis of silver nanoparticles. Silver nanoparticles were successfully synthesized from 1 mM AgNO{sub 3} via a green synthesis process using leaf extract as reducing as well as capping agent. Nanoparticles were characterized with the help of UV–vis absorption spectroscopy, X-ray diffraction and TEM analysis which revealed the size of nanoparticles of 30-40 nm size. Further the nanoparticles synthesized by green route are found highly toxic against pathogenic bacteria and plant pathogenic fungi viz. Escherichia coli, Pseudomonas syringae and Sclerotiniasclerotiorum. The most important outcome of this work will be the development of value-added products and protection of human health from pathogens viz., bacteria, virus, fungi etc.
Biogenic synthesized nanoparticles and their applications
International Nuclear Information System (INIS)
Singh, Abhijeet; Sharma, Madan Mohan
2016-01-01
In the present scenario, there are growing concerns over the potential impacts of bioengineered nanoparticles in the health sector. However, our understanding of how bioengineered nanoparticles may affect organisms within natural ecosystems, lags far behind our rapidly increasing ability to engineer novel nanoparticles. To date, research on the biological impacts of bioengineered nanoparticles has primarily consisted of controlled lab studies of model organisms with single species in culture media. Here, we described a cost effective and environment friendly technique for green synthesis of silver nanoparticles. Silver nanoparticles were successfully synthesized from 1 mM AgNO_3 via a green synthesis process using leaf extract as reducing as well as capping agent. Nanoparticles were characterized with the help of UV–vis absorption spectroscopy, X-ray diffraction and TEM analysis which revealed the size of nanoparticles of 30-40 nm size. Further the nanoparticles synthesized by green route are found highly toxic against pathogenic bacteria and plant pathogenic fungi viz. Escherichia coli, Pseudomonas syringae and Sclerotiniasclerotiorum. The most important outcome of this work will be the development of value-added products and protection of human health from pathogens viz., bacteria, virus, fungi etc.
Method of synthesizing tungsten nanoparticles
Thoma, Steven G; Anderson, Travis M
2013-02-12
A method to synthesize tungsten nanoparticles has been developed that enables synthesis of nanometer-scale, monodisperse particles that can be stabilized only by tetrahydrofuran. The method can be used at room temperature, is scalable, and the product concentrated by standard means. Since no additives or stabilizing surfactants are required, this method is particularly well suited for producing tungsten nanoparticles for dispersion in polymers. If complete dispersion is achieved due to the size of the nanoparticles, then the optical properties of the polymer can be largely maintained.
Spurious in PLL-DDS frequency synthesizers
Czech Academy of Sciences Publication Activity Database
Kroupa, Věnceslav František; Štursa, Jarmil
2002-01-01
Roč. 2, č. 1 (2002), s. 48-51 ISSN 1335-8243. [Digital Signal Processing and Multimedia Communications DSP-MCOM 2001 /5./. Košice, 27.11.2001-29.11.2001] R&D Projects: GA ČR GA102/00/0958 Institutional research plan: CEZ:AV0Z2067918 Keywords : frequency synthesizers * phase locked loops * direct digital synthesis Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.
Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S
2014-11-01
A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.
Exploitation of rare earth catalysts in polymer syntheses
Institute of Scientific and Technical Information of China (English)
Shen Zhiquan
2006-01-01
The studies over forty years on rare earth catalysts in polymer syntheses of diene,alkyne,alkylene oxide,thiirane, carbon dioxide copolymerization, lactide,caprolactone,cyclic carbonate and so forth in China have been reviewed.
Syntheses of copper complexes of nicotinohydroxamic and ...
African Journals Online (AJOL)
Nicotinohydroxamic acid (NHA) and isonicotinohydroxamic acid (INHA) were synthesized, characterized by electronic and spectral studies,magnetic measurements and their pKa determined spectrophotometrically as 8.68 ± 0.02 in aqueous medium of 0.1mol dm-3 I=ionic strength. The composition of the complexes was ...
Syntheses, Protonation Constants and Antimicrobial Activity of 2 ...
African Journals Online (AJOL)
carboxaldehyde and N-alkylimidazole-2-methanol derivatives [alkyl = benzyl, methyl, ethyl, propyl, butyl, heptyl, octyl and decyl] have been synthesized and the protonation constants determined. The antimicrobial properties of the compounds were tested ...
Hydrothermally synthesized barium fluoride nanocubes for thermoluminescence dosimetry
Energy Technology Data Exchange (ETDEWEB)
Bhadane, Mahesh S.; Dahiwale, S. S.; Bhoraskar, V. N.; Dhole, S. D., E-mail: sanjay@physics.unipune.ac.in [Department of Physics, Savitribai Phule Pune University, Pune-411007 (India)
2016-05-23
In this work, we report a hydrothermally synthesized Dy doped BaF{sub 2} (BaF{sub 2}:Dy) nanocubes and its Thermoluminescence studies. The synthesized BaF{sub 2}:Dy samples was found to posses FCC structure and having average size ~ 60-70 nm, as revealed through X-Ray Diffraction. Cubical morphology having size ~90 nm was observed from TEM analysis. The {sup 60}Co γ- ray irradiated BaF{sub 2}:Dy TL dosimetric experiments shows a pre-dominant single glow peak at 153 °C, indicating a single level trap present as a metastable state. Furthermore, BaF{sub 2}:Dy nanophosphor shows a sharp linear response from 10 Gy to 3 kGy, thus it can be applicable as a gamma dosimeter.
Tanaka, Makiko; Oguma, Kazuhiro; Saito, Yoshio; Saito, Isao
2012-06-15
5-(1-Naphthalenylethynyl)-2'-deoxyuridine ((N)U) and 5-[(4-cyano-1-naphthalenyl)ethynyl]-2'-deoxyuridine ((CN)U) were synthesized and incorporated into oligodeoxynucleotides. Fluorescence emissions of modified duplexes containing double (N)U were efficiently quenched depending upon the sequence pattern of the naphthalenes in DNA major groove, as compared to the duplex possessing single (N)U. When one of the naphthalene moieties has a cyano substituent, the exciplex emission from the chromophores in DNA major groove was observed at longer wavelength. Copyright © 2012 Elsevier Ltd. All rights reserved.
Characterization of combustion synthesized zirconia powder by UV
Indian Academy of Sciences (India)
. The surface acidbase properties of these samples were also investigated by indicator titration method. The catalytic activity was probed with transfer hydrogenation reaction in liquid phase. It was found that combustion synthesized zirconia did ...
GaN Nanowires Synthesized by Electroless Etching Method
Najar, Adel; Anjum, Dalaver H.; Ng, Tien Khee; Ooi, Boon S.; Ben Slimane, Ahmed
2012-01-01
Ultra-long Gallium Nitride Nanowires is synthesized via metal-electroless etching method. The morphologies and optical properties of GaN NWs show a single crystal GaN with hexagonal Wurtzite structure and high luminescence properties.
Characterization of chemically synthesized CdS nanoparticles
Indian Academy of Sciences (India)
Similar to the effects of charge carriers on optical properties, confinement of optical and acoustic phonons leads to interesting changes in the phonon spectra. In the present work, we have synthesized nanoparticles of CdS using chemical precipitation technique. The crystal structure and grain size of the particles are studied ...
Molecular trees: from syntheses towards applications
International Nuclear Information System (INIS)
Ardoin, N.; Astruc, D.
1995-01-01
Molecular trees, also called dendrimers, arborols, cauliflowers, cascades or hyperbranched molecules, have been synthesized since their first observation in 1978 by divergent, convergent or combined methods, with various functions on the branches. The potential applications of these nanoscopic molecules are in the fields of biology (gene therapy, virus mimicking an vectorization) and molecular materials sciences (new polymers, adhesion, liquid crystals, etc). (authors). 236 refs., 6 figs., 2 tabs., 8 schemes
Groh, Matthias Friedrich; Mü llera, Ulrike; Ahmed, Ejaz; Rothenberger, Alexander; Ruck, Michael J.
2013-01-01
The high-temperature syntheses of the low-valent halogenides P2I4, Te2Br, α-Te4I4, Te4(Al2Cl7)2, Te4(Bi6Cl20), Te8(Bi4Cl14),Bi8(AlCl4)2, Bi6Cl7,and Bi6Br7, as well as of WSCl4 andWOCl4 have been replaced by resource-efficient low
Chemical phase analysis of seed mediated synthesized anisotropic silver nanoparticles
International Nuclear Information System (INIS)
Bharti, Amardeep; Goyal, Navdeep; Singh, Suman; Singla, M. L.
2015-01-01
Noble-metal nanoparticles are of great interest because of its broad applications almost in every stream (i.e. biology, chemistry and engineering) due to their unique size/shape dependant properties. In this paper, chemical phase of seed mediated synthesized anisotropic silver nanoparticle (AgNPs) has been investigated via fourier transform infrared spectroscopy (FTIR) and thermogravimetric analysis (TGA). These nanaoparticles were synthesized by seed-growth method controlled by urea and dextrose results to highly stable 12-20 nm particle size revealed by zeta potential and transmission electron microscopy (TEM)
International Nuclear Information System (INIS)
Ahmad, R.; Hussain, J.
2014-01-01
Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)
Can microcarrier-expanded chondrocytes synthesize cartilaginous tissue in vitro?
Surrao, Denver C; Khan, Aasma A; McGregor, Aaron J; Amsden, Brian G; Waldman, Stephen D
2011-08-01
Tissue engineering is a promising approach for articular cartilage repair; however, it is challenging to produce adequate amounts of tissue in vitro from the limited number of cells that can be extracted from an individual. Relatively few cell expansion methods exist without the problems of de-differentiation and/or loss of potency. Recently, however, several studies have noted the benefits of three-dimensional (3D) over monolayer expansion, but the ability of 3D expanded chondrocytes to synthesize cartilaginous tissue constructs has not been demonstrated. Thus, the purpose of this study was to compare the properties of engineered cartilage constructs from expanded cells (monolayer and 3D microcarriers) to those developed from primary chondrocytes. Isolated bovine chondrocytes were grown for 3 weeks in either monolayer (T-Flasks) or 3D microcarrier (Cytodex 3) expansion culture. Expanded and isolated primary cells were then seeded in high density culture on Millicell™ filters for 4 weeks to evaluate the ability to synthesize cartilaginous tissue. While microcarrier expansion was twice as effective as monolayer expansion (microcarrier: 110-fold increase, monolayer: 52-fold increase), the expanded cells (monolayer and 3D microcarrier) were not effectively able to synthesize cartilaginous tissue in vitro. Tissues developed from primary cells were substantially thicker and accumulated significantly more extracellular matrix (proteoglycan content: 156%-292% increase; collagen content: 70%-191% increase). These results were attributed to phenotypic changes experienced during the expansion phase. Monolayer expanded chondrocytes lost their native morphology within 1 week, whereas microcarrier-expanded cells were spreading by 3 weeks of expansion. While the use of 3D microcarriers can lead to large cellular yields, preservation of chondrogenic phenotype during expansion is required in order to synthesize cartilaginous tissue.
Method of synthesizing silica nanofibers using sound waves
Sharma, Jaswinder K.; Datskos, Panos G.
2015-09-15
A method for synthesizing silica nanofibers using sound waves is provided. The method includes providing a solution of polyvinyl pyrrolidone, adding sodium citrate and ammonium hydroxide to form a first mixture, adding a silica-based compound to the solution to form a second mixture, and sonicating the second mixture to synthesize a plurality of silica nanofibers having an average cross-sectional diameter of less than 70 nm and having a length on the order of at least several hundred microns. The method can be performed without heating or electrospinning, and instead includes less energy intensive strategies that can be scaled up to an industrial scale. The resulting nanofibers can achieve a decreased mean diameter over conventional fibers. The decreased diameter generally increases the tensile strength of the silica nanofibers, as defects and contaminations decrease with the decreasing diameter.
Effect of annealing on the structure of chemically synthesized SnO_2 nanoparticles
International Nuclear Information System (INIS)
Singh, Kulwinder; Kumar, Akshay; Kumar, Virender; Vij, Ankush; Kumari, Sudesh; Thakur, Anup
2016-01-01
Tin oxide (SnO_2) nanoparticles have been synthesized by co-precipitation method. The synthesized nanoparticles were characterized by X-ray diffraction (XRD) and Raman spectroscopy. XRD analysis confirmed the single phase formation of SnO_2 nanoparticles. The Raman shifts showed the typical feature of the tetragonal phase of the as-synthesized SnO_2 nanoparticles. At low annealing temperature, a strong distortion of the crystalline structure and high degree of agglomeration was observed. It is concluded that the crystallinity of SnO_2 nanoparticles improves with the increase in annealing temperature.
Synthesizing chaotic maps with prescribed invariant densities
International Nuclear Information System (INIS)
Rogers, Alan; Shorten, Robert; Heffernan, Daniel M.
2004-01-01
The Inverse Frobenius-Perron Problem (IFPP) concerns the creation of discrete chaotic mappings with arbitrary invariant densities. In this Letter, we present a new and elegant solution to the IFPP, based on positive matrix theory. Our method allows chaotic maps with arbitrary piecewise-constant invariant densities, and with arbitrary mixing properties, to be synthesized
Characterization of tin selenides synthesized by high-energy milling
Directory of Open Access Journals (Sweden)
Marcela Achimovičová
2011-12-01
Full Text Available Tin selenides SnSeX (x=1,2 were synthesized from tin and selenium powder precursors by high-energy milling in the planetary ballmill Pulverisette 6 (Fritsch, Germany. The orthorhombic tin selenide SnSe and the hexagonal tin diselenide SnSe2 phases were formed after4 min and 5 min of milling, respectively. Specific surface area of both selenides increased with increasing time of mechanochemicalsynthesis. The particle size distribution analysis demonstrated that the synthesized products contain agglomerated selenide particlesconsisting of numerous idiomorphic tin selenide crystals, measuring from 2 to more than 100 nm in diameter, which were also documentedby TEM. UV-Vis spectrophotometry confirmed that tin selenide particles do not behave as quantum dots.
Monodisperse Silver Nanoparticles Synthesized by a Microwave-Assisted Method
International Nuclear Information System (INIS)
Shao-Peng, Zhu; Shao-Chun, Tang; Xiang-Kang, Meng
2009-01-01
Silver nanoparticles with an average size of about 20 nm are synthesized in a colloidal solution with the aid of microwave irradiation. Neither additional reductant nor stabilizer is required in this microwave-assisted method. The color of the colloidal solution is found to be dark green, different from the characteristic yellow of silver colloidal solutions. The silver nanoparticles in the colloidal solution have a narrow size distribution and large yield quantity. UV-visible absorption spectroscopy analysis reveals that the as-synthesized monodisperse silver nanoparticles have exceptional optical properties. Raman spectroscopy measurements demonstrate that these silver nanoparticles exhibit a notable surface-enhanced Raman scattering ability. (cross-disciplinary physics and related areas of science and technology)
Strong nonlinear photonic responses from microbiologically synthesized tellurium nanocomposites
Liao, K.-S.; Wang, Jingyuan; Dias, S.; Dewald, J.; Alley, N.J.; Baesman, S.M.; Oremland, R.S.; Blau, W.J.; Curran, S.A.
2010-01-01
A new class of nanomaterials, namely microbiologically-formed nanorods composed of elemental tellurium [Te(0)] that forms unusual nanocomposites when combined with poly(m-phenylenevinylene-co-2,5-dioctoxy-phenylenevinylene) (PmPV) is described. These bio-nanocomposites exhibit excellent broadband optical limiting at 532 and 1064 nm. Nonlinear scattering, originating from the laser induced solvent bubbles and microplasmas, is responsible for this nonlinear behavior. The use of bacterially-formed Te(0) when combined with an organic chemical host (e.g., PmPV) is a new green method of nanoparticle syntheses. This opens the possibilities of using unique, biologically synthesized materials to advance future nanoelectronic and nanophotonic applications. ?? 2009 Elsevier B.V. All rights reserved.
Characterization of hydrothermally synthesized SnS nanoparticles for solar cell application
Rajwar, Birendra Kumar; Sharma, Shailendra Kumar
2018-05-01
In the present study, SnS nanoparticles were synthesized by simple hydrothermal method using stannous chloride and thiourea as tin (Sn) and sulfur (S) precursor respectively. Synthesized nanoparticles were characterized by X-ray diffraction (XRD), Field Emission Scanning Electron Microscopy and UV-Vis Spectroscopy techniques. XRD pattern reveals that as-prepared nanoparticles exhibit orthorhombic structure. Average particles size was calculated using Scherrer's formula and found to be 23 nm. FESEM image shows that the as-prepared nanoparticles are in plate like structure. Direct optical band gap (Eg) of as-synthesized nanoparticles was calculated through UV-Vis Spectroscopy measurement and found to be 1.34 eV, which is near to optimum need for photovoltaic solar energy conversion (1.5 eV). Thus this SnS, narrowband gap semiconductor material can be applied as an alternative absorber material for solar cell application.
The effect of green synthesized gold nanoparticles on rice germination and roots
Tsi Ndeh, Nji; Maensiri, Santi; Maensiri, Duangkamol
2017-09-01
In this paper, gold nanoparticles were synthesized by means of a green approach with Tiliacora triandra leaf extracts under different conditions. No additional reducing or capping agents were employed. The gold nanoparticles were characterized using UV-visible spectrophotometry, transmission electron microscope, x-ray diffraction and Fourier transform infrared spectroscopy. Gold nanoparticles synthesized at temperature of 80 °C were further used to treat rice (Oryza sativa) grains at different concentrations (0, 10, 100, 500, 1000, 2000 mg l-1) for one week. While germination percentages were high (95-98.38%), a slight decrease in root and shoot lengths relative to the control was observed. Phytotoxicity results indicated that the plant synthesized gold nanoparticles were of minimal toxicity to rice seedlings. Increases in cell death, hydrogen peroxide formation and lipid peroxidation in roots and shoots were noted. However, these increases were not statistically significant. The overall results confirmed that Tiliacora triandra synthesized gold nanoparticles are biocompatible and can be potentially used as nanocarriers in agriculture. Contribution at 5th Thailand International Nanotechnology Conference (Nano Thailand-2016), 27-29 November 2016, Nakhon Ratchasima, Thailand.
Gholami-Shabani, Mohammadhassan; Akbarzadeh, Azim; Norouzian, Dariush; Amini, Abdolhossein; Gholami-Shabani, Zeynab; Imani, Afshin; Chiani, Mohsen; Riazi, Gholamhossein; Shams-Ghahfarokhi, Masoomeh; Razzaghi-Abyaneh, Mehdi
2014-04-01
Nanostructures from natural sources have received major attention due to wide array of biological activities and less toxicity for humans, animals, and the environment. In the present study, silver nanoparticles were successfully synthesized using a fungal nitrate reductase, and their biological activity was assessed against human pathogenic fungi and bacteria. The enzyme was isolated from Fusarium oxysporum IRAN 31C after culturing on malt extract-glucose-yeast extract-peptone (MGYP) medium. The enzyme was purified by a combination of ultrafiltration and ion exchange chromatography on DEAE Sephadex and its molecular weight was estimated by gel filtration on Sephacryl S-300. The purified enzyme had a maximum yield of 50.84 % with a final purification of 70 folds. With a molecular weight of 214 KDa, it is composed of three subunits of 125, 60, and 25 KDa. The purified enzyme was successfully used for synthesis of silver nanoparticles in a way dependent upon NADPH using gelatin as a capping agent. The synthesized silver nanoparticles were characterized by X-ray diffraction, dynamic light scattering spectroscopy, and transmission and scanning electron microscopy. These stable nonaggregating nanoparticles were spherical in shape with an average size of 50 nm and a zeta potential of -34.3. Evaluation of the antimicrobial effects of synthesized nanoparticles by disk diffusion method showed strong growth inhibitory activity against all tested human pathogenic fungi and bacteria as evident from inhibition zones that ranged from 14 to 25 mm. Successful green synthesis of biologically active silver nanoparticles by a nitrate reductase from F. oxysporum in the present work not only reduces laborious downstream steps such as purification of nanoparticle from interfering cellular components, but also provides a constant source of safe biologically-active nanomaterials with potential application in agriculture and medicine.
Performance of Phonatory Deviation Diagrams in Synthesized Voice Analysis.
Lopes, Leonardo Wanderley; da Silva, Karoline Evangelista; da Silva Evangelista, Deyverson; Almeida, Anna Alice; Silva, Priscila Oliveira Costa; Lucero, Jorge; Behlau, Mara
2018-05-02
To analyze the performance of a phonatory deviation diagram (PDD) in discriminating the presence and severity of voice deviation and the predominant voice quality of synthesized voices. A speech-language pathologist performed the auditory-perceptual analysis of the synthesized voice (n = 871). The PDD distribution of voice signals was analyzed according to area, quadrant, shape, and density. Differences in signal distribution regarding the PDD area and quadrant were detected when differentiating the signals with and without voice deviation and with different predominant voice quality. Differences in signal distribution were found in all PDD parameters as a function of the severity of voice disorder. The PDD area and quadrant can differentiate normal voices from deviant synthesized voices. There are differences in signal distribution in PDD area and quadrant as a function of the severity of voice disorder and the predominant voice quality. However, the PDD area and quadrant do not differentiate the signals as a function of severity of voice disorder and differentiated only the breathy and rough voices from the normal and strained voices. PDD density is able to differentiate only signals with moderate and severe deviation. PDD shape shows differences between signals with different severities of voice deviation. © 2018 S. Karger AG, Basel.
Radiolytic Syntheses of Nanoparticles and Inorganic-Polymer Hybrid Microgels
International Nuclear Information System (INIS)
Chen, Q.; Shi, J.; Zhao, R.; Shen, X.
2010-01-01
In the second year of the project, we have gotten progress mainly in two directions. Firstly, for the first time, Prussian blue (PB) nanoparticles (NPs) were successfully synthesized by the partly radiolytic reduction of Fe3+ and Fe(CN)63 in the presence of poly(N-vinyl pyrrolidine) (PVP) under N2 atmospheres at room temperature. With the increase of the concentration of PVP, the size and the size distribution of the synthesized quasi-spherical PB NPs decreased obviously, leading to a hypsochromic shift on their peak position of the characteristic absorption. In the experiment, we further found that the smaller ones have a larger capacity to Cs+, suggesting that the application of PB NPs in curing thallotoxicosis may decrease the usage of PB for the patient to great extent. Secondly, through a series of preliminary experiments, we got a clear picture about the one-step radiolytic preparation of inorganic-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by surfactant-free emulsion polymerization. Besides, unpurified N-carbamothioylmethacrylamide was synthesized via the methacrylation of thiourea. These created favorable conditions for the one-step synthesis of metal sulfide-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by -irradiation and surfactant-free emulsion polymerization. (author)
The method of synthesizing of superhydrophobic surfaces by PECVD
Orazbayev, Sagi; Gabdullin, Maratbek; Ramazanov, Tlekkabul; Dosbolayev, Merlan; Zhunisbekov, Askar; Omirbekov, Dulat; Otarbay, Zhuldyz
2018-03-01
The aim of this work was to obtain superhydrophobic surfaces in a plasma medium. The experiment was carried out using the PECVD method in two different modes: constant and pulsing. The surface roughness was obtained by applying nanoparticles synthesized in plasma in a mixture of argon and methane. The resulting particles were deposited on the surface of silicon and glass materials. The contact angle increased linearly depending on the number of cycles, until it reached 160° at 150-160th cycles, after that the increase in cycles does not affect the contact angle, since the saturation process is in progress. Also the effect of the working gas composition on the hydrophobicity of the surface was studied. At low concentrations of methane (1%) only particles are synthesized in the working gas, and hydrophobicity is unstable, with an increase in methane concentration (7%) nanofilms are synthesized from nanoclusters, and surface hydrophobicity is relatively stable. In addition, a pulsing plasma mode was used to obtain superhydrophobic surfaces. The hydrophobicity of the sample showed that the strength of the nanofilm was stable in comparison with the sample obtained in the first mode, but the contact angle was lower. The obtained samples were examined using SEM, SPM, optical analysis, and their contact angles were determined.
Radiolytic Syntheses of Nanoparticles and Inorganic-Polymer Hybrid Microgels
Energy Technology Data Exchange (ETDEWEB)
Chen, Q.; Shi, J.; Zhao, R.; Shen, X., E-mail: qdchen@pku.edu.cn [Department of Applied Chemistry, College of Chemistry and Molecular Engineering, Peking University, No. 5, Yiheyuan Load, Haidian District Beijing 100871 (China)
2010-07-01
In the second year of the project, we have gotten progress mainly in two directions. Firstly, for the first time, Prussian blue (PB) nanoparticles (NPs) were successfully synthesized by the partly radiolytic reduction of Fe3+ and Fe(CN)63 in the presence of poly(N-vinyl pyrrolidine) (PVP) under N2 atmospheres at room temperature. With the increase of the concentration of PVP, the size and the size distribution of the synthesized quasi-spherical PB NPs decreased obviously, leading to a hypsochromic shift on their peak position of the characteristic absorption. In the experiment, we further found that the smaller ones have a larger capacity to Cs+, suggesting that the application of PB NPs in curing thallotoxicosis may decrease the usage of PB for the patient to great extent. Secondly, through a series of preliminary experiments, we got a clear picture about the one-step radiolytic preparation of inorganic-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by surfactant-free emulsion polymerization. Besides, unpurified N-carbamothioylmethacrylamide was synthesized via the methacrylation of thiourea. These created favorable conditions for the one-step synthesis of metal sulfide-poly(methacrylic acid-co-methyl methacrylate) hybrid microgels by -irradiation and surfactant-free emulsion polymerization. (author)
Optical fusions and proportional syntheses
Albert-Vanel, Michel
2002-06-01
A tragic error is being made in the literature concerning matters of color when dealing with optical fusions. They are still considered to be of additive nature, whereas experience shows us somewhat different results. The goal of this presentation is to show that fusions are, in fact, of 'proportional' nature, tending to be additive or subtractive, depending on each individual case. Using the pointillist paintings done in the manner of Seurat, or the spinning discs experiment could highlight this intermediate sector of the proportional. So, let us try to examine more closely what occurs in fact, by reviewing additive, subtractive and proportional syntheses.
Bioactive nanocrystalline wollastonite synthesized by sol–gel ...
Indian Academy of Sciences (India)
The sol–gel combustion method was employed to synthesize the nanocrystalline wollastonite by taking the raw eggshell powder as a calcium source and TEOS as a source of silicate. Glycine was used as a reductant or fuel and nitrate ions present in metal nitrate acts as an oxidizer. The phase purity of the wollastonite was ...
SYNTHESES AND PROPERTIES OF SOME ORGANOSILANE POLYMERS
Institute of Scientific and Technical Information of China (English)
ZHANG Xinghua; Robert West
1984-01-01
Some organosilane polymers with high molecular weights have been synthesized by cocondensation of organosilicon dihalide monomers with sodium metal in toluene. These polymers are both soluble in common solvents and meltable at lower temperatures, and can be molded, cast into films or drawn into fibers. Exposure of the solid polymers to ultraviolet light leads to degradation or crosslinking.
Real-Time Control of an Articulatory-Based Speech Synthesizer for Brain Computer Interfaces.
Directory of Open Access Journals (Sweden)
Florent Bocquelet
2016-11-01
Full Text Available Restoring natural speech in paralyzed and aphasic people could be achieved using a Brain-Computer Interface (BCI controlling a speech synthesizer in real-time. To reach this goal, a prerequisite is to develop a speech synthesizer producing intelligible speech in real-time with a reasonable number of control parameters. We present here an articulatory-based speech synthesizer that can be controlled in real-time for future BCI applications. This synthesizer converts movements of the main speech articulators (tongue, jaw, velum, and lips into intelligible speech. The articulatory-to-acoustic mapping is performed using a deep neural network (DNN trained on electromagnetic articulography (EMA data recorded on a reference speaker synchronously with the produced speech signal. This DNN is then used in both offline and online modes to map the position of sensors glued on different speech articulators into acoustic parameters that are further converted into an audio signal using a vocoder. In offline mode, highly intelligible speech could be obtained as assessed by perceptual evaluation performed by 12 listeners. Then, to anticipate future BCI applications, we further assessed the real-time control of the synthesizer by both the reference speaker and new speakers, in a closed-loop paradigm using EMA data recorded in real time. A short calibration period was used to compensate for differences in sensor positions and articulatory differences between new speakers and the reference speaker. We found that real-time synthesis of vowels and consonants was possible with good intelligibility. In conclusion, these results open to future speech BCI applications using such articulatory-based speech synthesizer.
Antibacterial potential of silver nanoparticle synthesized by marine ...
African Journals Online (AJOL)
Multi resistance to antibiotics is a serious and disseminated clinical problem, common to several new compounds that block the resistance mechanism. The present study aimed at the comparative study of silver nanoparticles synthesized through actinomycetes and their antimicrobial metabolites with standard antibiotic.
Fibronectin synthesized by a human hepatoma cell line
International Nuclear Information System (INIS)
Glasgow, J.E.; Colman, R.W.
1984-01-01
Fibronectin is a family of immunologically similar glycoproteins which mediate a variety of cell-cell and cell-substratum interactions. It is a constituent of the extracellular matrix of connective tissue and circulates in plasma. When suspension and adherent cultures of a human hepatoma cell line (SK-HEP-1) were incubated in serum-free medium, the resulting conditioned medium contained material which was specifically immunoprecipitated by antisera to human plasma fibronectin. By double immunodiffusion, a component in the conditioned culture medium was shown to form a line of identity with fibronectin in human plasma and to migrate as an alpha 2- to beta-globulin during immunoelectrophoresis. Human fibronectin was quantified in conditioned medium by electroimmunodiffusion, and was found to increase for at least three days at about 0.1 micrograms/10(6) cells/day. Adherent cultures of SK-HEP-1 cells were incubated with L-[ 35 S]methionine to label newly synthesized proteins. Labeled fibronectin in conditioned medium or in cell extracts comigrated with fibronectin in human plasma as shown by autoradiography following crossed-immunoelectrophoresis. Fibronectin was demonstrated in the extra-cellular matrix of adherent SK-HEP-1 cultures by immunofluorescence. It was shown previously that SK-HEP-1 cells synthesize alpha 1-protease inhibitor, one of the products of normal hepatocytes. The finding that these hepatoma cells also synthesize fibronectin supports the concept that the hepatocyte may be one source of circulating fibronectin, a possibility consistent with the established role of this cell type in blood plasma protein synthesis
Enhanced Hydrogen Storage Capacity over Electro-synthesized HKUST-1
Directory of Open Access Journals (Sweden)
Witri Wahyu Lestari
2017-12-01
Full Text Available HKUST-1 [Cu3(1,3,5-BTC2] (BTC = benzene-tri-carboxylate was synthesized using an electrochemical method and tested for hydrogen storage. The obtained material showed a remarkably higher hydrogen uptake over reported HKUST-1 and reached until 4.75 wt% at room temperature and low pressure up to 1.2 bar. This yield was compared to HKUST-1 obtained from the solvothermal method, which showed a hydrogen uptake of only 1.19 wt%. Enhancement of hydrogen sorption of the electro-synthesized product was due to the more appropriate surface area and pore size, effected by the preferable physical interaction between the hydrogen gasses and the copper ions as unsaturated metal centers in the frameworks of HKUST-1.
Proteins synthesized in tobacco mosaic virus infected protoplasts
Huber, R.
1979-01-01
The study described here concerns the proteins, synthesized as a result of tobacco mosaic virus (TMV) multiplication in tobacco protoplasts and in cowpea protoplasts. The identification of proteins involved in the TMV infection, for instance in the virus RNA replication, helps to elucidateEnergy Technology Data Exchange (ETDEWEB)
Luridiana, Alberto; Pretta, Gianluca; Secci, Francesco; Frongia, Angelo [Dipartimento di Scienze Chimiche e Geologiche, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Chiriu, Daniele; Carbonaro, Carlo Maria; Corpino, Riccardo [Dipartimento di Fisica, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Ricci, Pier Carlo, E-mail: carlo.ricci@dsf.unica.it [Dipartimento di Fisica, Universitá degli Studi di Cagliari, S.P. Monserrato-Sestu Km 0,700, 09042 Monserrato (Canada) (Italy)
2014-10-21
It is well known that stilbene with a trans conformation is highly fluorescent. From the viewpoint of molecular structure, coumarins bear a carbon-carbon double bond which is fixed as trans conformation as in trans-stilbene through a lactone structure. This can help to avoid the trans-cis transformation of the double bond under ultraviolet (UV) irradiation as observed in stilbene compounds and results in strong fluorescence and high fluorescence quantum yield and photostability in most of coumarin derivatives. Herein we report some preliminary results about the synthesis and spectroscopic characterization of tunable coumarins and the development of a new linkage protocol for the obtainment of monolayer coumarin-covalently linked glasses. The resulting organic/inorganic coumarin/silica based Self-Assembled Monolayer (SMA) film is proposed as new phosphors for the substituting of critical raw materials, like rare earths, in photonics applications.
Low power fast settling multi-standard current reusing CMOS fractional-N frequency synthesizer
Institute of Scientific and Technical Information of China (English)
Lou Wenfeng; Feng Peng; Wang Haiyong; Wu Nanjian
2012-01-01
A low power fast settling multi-standard CMOS fractional-N frequency synthesizer is proposed.The current reusing and frequency presetting techniques are adopted to realize the low power fast settling multi-standard fractional-N frequency synthesizer.An auxiliary non-volatile memory (NVM) is embedded to avoid the repetitive calibration process and to save power in practical application.This PLL is implemented in a 0.18μm technology.The frequency range is 0.3 to 2.54 GHz and the settling time is less than 5μs over the entire frequency range.The LC-VCO with the stacked divide-by-2 has a good figure of merit of-193.5 dBc/Hz.The measured phase noise of frequency synthesizer is about -115 dBc/Hz at 1 MHz offset when the carrier frequency is 2.4 GHz and the reference spurs are less than -52 dBc.The whole frequency synthesizer consumes only 4.35 mA @ 1.8 V.
Bioactive nanocrystalline wollastonite synthesized by sol–gel ...
Indian Academy of Sciences (India)
The sol–gel combustion method was employed to synthesize the nanocrystalline wollastonite by taking the raw eggshell powder as a calcium source and TEOS as a source of silicate. Glycine was .... 94·37% CaCO3, hence in order to prepare 1 M Ca2+ ion solu- ... requires an acid or base catalyst hence the pH of the solu-.
Novel stereocontrolled syntheses of tashiromine and epitashiromine
Directory of Open Access Journals (Sweden)
Loránd Kiss
2015-04-01
Full Text Available A novel stereocontrolled approach has been developed for the syntheses of tashiromine and epitashiromine alkaloids from cyclooctene β-amino acids. The synthetic concept is based on the azetidinone opening of a bicyclic β-lactam, followed by oxidative ring opening through ring C–C double bond and reductive ring-closure reactions of the cis- or trans-cyclooctene β-amino acids.
DEFF Research Database (Denmark)
Xu, Deyang; Hanschen, Franziska S.; Witzel, Katja
2017-01-01
Casparian strip-generated apoplastic barriers not only control the radial flow of both water and ions but may also constitute a hindrance for the rhizosecretion of stele-synthesized phytochemicals. Here, we establish root-synthesized glucosinolates (GLS) are in Arabidopsis as a model to study...... via the xylem to the shoot; and (iii) GTR-dependent import to GLS-degrading myrosin cells at the cortex. The study suggests a previously undiscovered role of the import process in the rhizosecretion of root-synthesized phytochemicals....
Specific features of ZnCdS nanoparticles synthesized in different solvents
Energy Technology Data Exchange (ETDEWEB)
Kyazym-zade, A. G.; Jafarov, M. A., E-mail: maarif.jafarov@mail.ru; Nasirov, E. F.; Jahangirova, C. A.; Jafarli, R. S. [Baku State University (Azerbaijan)
2017-04-15
Stable colloidal solutions of ZnCdS nanoparticles (3–6 nm in diameter) in polyvinyl alcohol, polyethylene glycol, and H{sub 2}O are produced. The size of the synthesized nanoparticles is independent of the relation between precursors. It is shown that stabilization of the particles is defined by the charge-stability factor and can be attained without any additional stabilizing additives. The ZnCdS quantum dots synthesized emit in a wide spectral range from 450 to 600 nm.
Morphologic and structural characterization of the CoFe2O4 synthesized by combustion reaction
International Nuclear Information System (INIS)
Lima, M.S.; Sousa, J.-P.L.M.L.; Vieira, D.A.; Lira, H.L.; Costa, A.C.F.M.; Sasaki, J.M.
2009-01-01
CoFe 2 O 4 powders were synthesized by combustion reaction using glycine as fuel, aiming obtaining nanosized and monophase powders. Thus, different conditions of external heating during the synthesis were investigated. The powders were prepared according to the propellants and explosives theory, using glycine as fuel in the stoichiometric proportion (Φe = 1). During the synthesis the flame temperature and time were measured. The resulting powders were characterized by X-rays diffraction and scanning electronic microscopy (SEM). The results show that the condition in which the synthesis was realized it influences in the combustion flame temperature and time and contributes for the obtainment of powders with majority phase without secondary phases. Crystallite size varied of 33 to 50 nm. All powders presented morphology constituted by soft agglomerated formed by nanoparticles. (author). (author)
Photocatalytic activity of galvanically synthesized nanostructure SnO{sub 2} thin films
Energy Technology Data Exchange (ETDEWEB)
Jana, Sumanta, E-mail: sumantajana85@gmail.com [Department of Chemistry, Bengal Engineering and Science University, Botanic Garden, Howrah 711103, WB (India); Mitra, Bibhas Chandra [Department of Physics, Bengal Engineering and Science University, Botanic Garden, Howrah 711103, WB (India); Bera, Pulakesh [Department of Chemistry, Panskura Banamali College, Purba Medinipur, Panskura 721152, WB (India); Sikdar, Moushumi [Department of Chemistry, Bengal Engineering and Science University, Botanic Garden, Howrah 711103, WB (India); Mondal, Anup, E-mail: anupmondal2000@yahoo.co.in [Department of Chemistry, Bengal Engineering and Science University, Botanic Garden, Howrah 711103, WB (India)
2014-07-25
Graphical abstract: Nanostructured porous tin dioxide (SnO{sub 2}) thin films have been synthesized by simple and cost effective galvanic technique. The synthesized porous SnO{sub 2} thin films show excellent photocatalytic activity for degrading methyl orange (MO) dye under light irradiation. The porous morphological grain growth due to annealing is likely to play an active role for this degradation. - Highlights: • SnO{sub 2} thin films have been successfully synthesized by galvanic technique. • A drastic morphological change occurs after annealing as deposited SnO{sub 2} thin films. • Morphological advantage results enhanced photodegradation of dye. - Abstract: The study demonstrates an approach to synthesize nanostructure SnO{sub 2} thin films on TCO (transparent conducting oxide) coated glass substrates by galvanic technique. Aqueous solution of hydrated stannic chloride (SnCl{sub 4}⋅5H{sub 2}O) in potassium nitrate (KNO{sub 3}) solution was used as the working solution. The process involves no sophisticated reactor or toxic chemicals, and proceeds continuously under ambient condition; it provides an economic way of synthesizing nanostructure SnO{sub 2} semiconductor thin films. The influence of sintering temperature on crystalline structure, morphology, electrical and dielectric properties has been studied. A detail analysis of I−V, C−V and dielectrics for annealed SnO{sub 2} thin films have been carried out. The morphological advantage i.e. nanoporous flake like structure allows more efficient transport of reactant molecules to the active interfaces and results a strong photocatalytic activity for degrading methyl orange (MO) dye.
Impact of 50% Synthesized Iso-Paraffins (SIP) on F-76 Fuel Coalescence
2013-12-16
petroleum JP-5 and Synthesized Iso-Paraffins (SIP). SIP fuels are made from direct fermentation of sugar into olefinic hydrocarbons. The olefinic...manufactured scaled down filter/coalescer and separator to simulate the performance of a full-scale filter separator system. This test is designed to predict...5 and Synthesized Iso-Paraffins (SIP). SIP fuels are made from direct fermentation of sugar into olefinic hydrocarbons. The olefinic hydrocarbons
Biomimetic Syntheses of Callistrilones A-E via an Oxidative [3 + 2] Cycloaddition.
Guo, Yonghong; Zhang, Yuhan; Xiao, Mingxing; Xie, Zhixiang
2018-04-16
Concise total syntheses of callistrilones A-E have been achieved from 7 and commercially available α-phellandrene (8). The synthetic strategy, which was primarily inspired by the biogenetic hypothesis, was enabled by an oxidative [3 + 2] cycloaddition followed by a Michael addition and an intramolecular nucleophilic addition to construct the target molecules. Moreover, viminalin I was also synthesized, and its absolute configuration was unambiguously confirmed.
A Facile One Step Solution Route to Synthesize Cuprous Oxide Nanofluid
Directory of Open Access Journals (Sweden)
Shenoy U. Sandhya
2013-05-01
Full Text Available A cuprous oxide nanofluid stabilized by sodium lauryl sulfate, synthesized by using the one step method, has been reported. Nanofluids were synthesized by using a well‐ controlled surfactant‐assisted solution phase synthesis. The method involved reduction of copper acetate by glucose in a mixture of water and ethylene glycol serving as the base fluid. The synthesized fluid was characterized by X‐ray and electron diffraction techniques, in addition, transmission and field emission microscopic techniques and Fourier transform infra red spectroscopic analysis was undertaken. The rheological property, as well as the thermal conductivity of the fluid, were measured. The variation of reaction parameters considerably affected the size of the particles as well as the reaction rate. The uniform dispersion of the particles in the base fluid led to a stability period of three months under stationary state, augmenting the thermal conductivity of the nanofluid. The method is found to be simple, reliable and fast for the synthesis of Newtonian nanofluids containing cuprous oxide nanoparticles.
Design of a 2.4-GHz CMOS monolithic fractional-N frequency synthesizer
Shu, Keliu
The wireless communication technology and market have been growing rapidly since a decade ago. The high demand market is a driving need for higher integration in the wireless transceivers. The trend is to achieve low-cost, small form factor and low power consumption. With the ever-reducing feature size, it is becoming feasible to integrate the RF front-end together with the baseband in the low-cost CMOS technology. The frequency synthesizer is a key building block in the RF front-end of the transceivers. It is used as a local oscillator for frequency translation and channel selection. The design of a 2.4-GHz low-power frequency synthesizer in 0.35mum CMOS is a challenging task mainly due to the high-speed prescaler. In this dissertation, a brief review of conventional PLL and frequency synthesizers is provided. Design techniques of a 2.4-GHz monolithic SigmaDelta fractional-N frequency synthesizer are investigated. Novel techniques are proposed to tackle the speed and integration bottlenecks of high-frequency PLL. A low-power and inherently glitch-free phase-switching prescaler and an on-chip loop filter with capacitance multiplier are developed. Compared with the existing and popular dual-path topology, the proposed loop filter reduces circuit complexity and its power consumption and noise are negligible. Furthermore, a third-order three-level digital SigmaDelta modulator topology is employed to reduce the phase noise generated by the modulator. Suitable PFD and charge-pump designs are employed to reduce their nonlinearity effects and thus minimize the folding of the SigmaDelta modulator-shaped phase noise. A prototype of the fractional-N synthesizer together with some standalone building blocks is designed and fabricated in TSMC 0.35mum CMOS through MOSIS. The prototype frequency synthesizer and standalone prescaler and loop filter are characterized. The feasibility and practicality of the proposed prescaler and loop filter are experimentally verified.
Is Ghrelin Synthesized in the Central Nervous System?
Cabral, Agustina; López Soto, Eduardo J; Epelbaum, Jacques; Perelló, Mario
2017-03-15
Ghrelin is an octanoylated peptide that acts via its specific receptor, the growth hormone secretagogue receptor type 1a (GHSR-1a), and regulates a vast variety of physiological functions. It is well established that ghrelin is predominantly synthesized by a distinct population of endocrine cells located within the gastric oxyntic mucosa. In addition, some studies have reported that ghrelin could also be synthesized in some brain regions, such as the hypothalamus. However, evidences of neuronal production of ghrelin have been inconsistent and, as a consequence, it is still as a matter of debate if ghrelin can be centrally produced. Here, we provide a comprehensive review and discussion of the data supporting, or not, the notion that the mammalian central nervous system can synthetize ghrelin. We conclude that no irrefutable and reproducible evidence exists supporting the notion that ghrelin is synthetized, at physiologically relevant levels, in the central nervous system of adult mammals.
Is Ghrelin Synthesized in the Central Nervous System?
Directory of Open Access Journals (Sweden)
Agustina Cabral
2017-03-01
Full Text Available Ghrelin is an octanoylated peptide that acts via its specific receptor, the growth hormone secretagogue receptor type 1a (GHSR-1a, and regulates a vast variety of physiological functions. It is well established that ghrelin is predominantly synthesized by a distinct population of endocrine cells located within the gastric oxyntic mucosa. In addition, some studies have reported that ghrelin could also be synthesized in some brain regions, such as the hypothalamus. However, evidences of neuronal production of ghrelin have been inconsistent and, as a consequence, it is still as a matter of debate if ghrelin can be centrally produced. Here, we provide a comprehensive review and discussion of the data supporting, or not, the notion that the mammalian central nervous system can synthetize ghrelin. We conclude that no irrefutable and reproducible evidence exists supporting the notion that ghrelin is synthetized, at physiologically relevant levels, in the central nervous system of adult mammals.
Synthesized view comparison method for no-reference 3D image quality assessment
Luo, Fangzhou; Lin, Chaoyi; Gu, Xiaodong; Ma, Xiaojun
2018-04-01
We develop a no-reference image quality assessment metric to evaluate the quality of synthesized view rendered from the Multi-view Video plus Depth (MVD) format. Our metric is named Synthesized View Comparison (SVC), which is designed for real-time quality monitoring at the receiver side in a 3D-TV system. The metric utilizes the virtual views in the middle which are warped from left and right views by Depth-image-based rendering algorithm (DIBR), and compares the difference between the virtual views rendered from different cameras by Structural SIMilarity (SSIM), a popular 2D full-reference image quality assessment metric. The experimental results indicate that our no-reference quality assessment metric for the synthesized images has competitive prediction performance compared with some classic full-reference image quality assessment metrics.
Studies on the Alkaloids of the Calycanthaceae and Their Syntheses
Directory of Open Access Journals (Sweden)
Jin-Biao Xu
2015-04-01
Full Text Available Plants of the Calycanthaceae family, which possesses four genera and about 15 species, are mainly distributed in China, North America and Australia. Chemical studies on the Calycanthaceae have led to the discovery of about 14 alkaloids of different skeletons, including dimeric piperidinoquinoline, dimeric pyrrolidinoindoline and/or trimeric pyrrolidinoindolines, which exhibit significant anti-convulsant, anti-fungal, anti-viral analgesic, anti-tumor, and anti-melanogenesis activities. As some of complex tryptamine-derived alkaloids exhibit promising biological activities, the syntheses of these alkaloids have also been a topic of interest in synthetic chemistry during the last decades. This review will focus on the structures and total syntheses of these alkaloids.
International Nuclear Information System (INIS)
Karunakaran, C.; Manikandan, G.; Gomathisankar, P.
2013-01-01
Highlights: •CuO nanoleaves synthesized by CTAB-assisted hydrothermal method. •CuO nanodiscs synthesized by CTAB-assisted sonochemical method. •Combustion synthesized CuO is highly porous. •Synthetic method and morphology influence CuO bactericidal activity. -- Abstract: Cetyltrimethylammonium bromide (CTAB)-assisted microwave synthesis of CuO provides nanoleaves and in the absence of CTAB the shape of CuO is irregular. Sonochemical synthesis of CuO using CTAB gives nanodiscs whereas irregularly shaped flake-like structure is obtained without CTAB. Combustion synthesized CuO is highly porous with innumerable large holes. CTAB does not provide any structure in combustion synthesis. Transmission electron micrographs (TEM) display the constituent nanoparticles of microwave and sonochemically synthesized CuO. The powder X-ray diffractogram (XRD) shows the sample obtained by sonochemical method in the absence of CTAB as a mixture of monoclinic CuO, cubic Cu 2 O, and orthorhombic Cu(OH) 2 . But the rest of the samples are pure CuO in monoclinic phase. The selected area electron diffractograms (SAED) of the microwave and sonochemically synthesized samples, in the presence as well as in the absence of CTAB, confirm the monoclinic phase of CuO and indicates the presence of amorphous CuO in traces. All the samples are characteristic of Fourier Transform infrared (FT-IR) Cu–O stretching frequencies. The method of synthesis and also the morphology influence the electrical properties as well as the bactericidal activity of CuO
Mijts, Benjamin N; Lee, Pyung Cheon; Schmidt-Dannert, Claudia
2005-04-01
A carotenoid desaturase homolog from Staphylococcus aureus (CrtOx) was identified. When expressed in engineered E. coli cells synthesizing linear C(30) carotenoids, polar carotenoid products were generated, identified as aldehyde and carboxylic acid C(30) carotenoid derivatives. The major product in this engineered pathway is the fully desaturated C(30) dialdehyde carotenoid 4,4'-diapolycopen-4,4'-dial. Very low carotenoid yields were observed when CrtOx was complemented with the C(40) carotenoid lycopene pathway. But extension of an in vitro evolved pathway of the fully desaturated 2,4,2',4'-tetradehydrolycopene produced the structurally novel fully desaturated C(40) dialdehyde carotenoid 2,4,2',4'-tetradehydrolycopendial. Directed evolution of CrtOx by error-prone PCR resulted in a number of variants with higher activity on C(40) carotenoid substrates and improved product profiles. These findings may provide new biosynthetic routes to highly polar carotenoids with unique spectral properties desirable for a number of industrial and pharmaceutical applications.
Adam, Waldemar; Roschmann, Konrad J; Saha-Möller, Chantu R; Seebach, Dieter
2002-05-08
cis-Stilbene (1) has been epoxidized by a set of diverse oxygen donors [OxD], catalyzed by the Mn(III)(salen)X complexes 3 (X = Cl, PF(6)), to afford a mixture of cis- and trans-epoxides 2. The cis/trans ratios range from 29:71 (extensive isomerization) to 92:8, which depends both on the oxygen source [OxD] and on the counterion X of the catalyst. When (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)-benzene (4) is used as substrate, a mechanistic probe which differentiates between radical and cationic intermediates, no cationic ring-opening products are found in this epoxidation reaction; thus, isomerized epoxide product arises from intermediary radicals. The dependence of the diastereoselectivity on the oxygen source is rationalized in terms of a bifurcation step in the catalytic cycle, in which concerted Lewis-acid-activated oxygen transfer competes with stepwise epoxidation by the established Mn(V)(oxo) species. The experimental counterion effect is attributed to the computationally assessed ligand-dependent reaction profiles and stereoselectivities of the singlet, triplet, and quintet spin states available to the manganese species.
Synthesizing Knowledge on Internet of Things (IoT)
DEFF Research Database (Denmark)
Liu, Fei; Tan, Chee-Wee; Lim, Eric T. K.
2016-01-01
Research on Internet of Things (IoT) has been booming for past couple of years due to technological advances and its potential for application. Nonetheless, the rapid growth of IoT articles as well as the heterogeneous nature of IoT pose challenges in synthesizing prior research on the phenomenon...
Low power fast settling multi-standard current reusing CMOS fractional-N frequency synthesizer
International Nuclear Information System (INIS)
Lou Wenfeng; Feng Peng; Wang Haiyong; Wu Nanjian
2012-01-01
A low power fast settling multi-standard CMOS fractional-N frequency synthesizer is proposed. The current reusing and frequency presetting techniques are adopted to realize the low power fast settling multi-standard fractional-N frequency synthesizer. An auxiliary non-volatile memory (NVM) is embedded to avoid the repetitive calibration process and to save power in practical application. This PLL is implemented in a 0.18 μm technology. The frequency range is 0.3 to 2.54 GHz and the settling time is less than 5 μs over the entire frequency range. The LC-VCO with the stacked divide-by-2 has a good figure of merit of −193.5 dBc/Hz. The measured phase noise of frequency synthesizer is about −115 dBc/Hz at 1 MHz offset when the carrier frequency is 2.4 GHz and the reference spurs are less than −52 dBc. The whole frequency synthesizer consumes only 4.35 mA and 1.8 V. (semiconductor integrated circuits)
International Nuclear Information System (INIS)
Dhamale, Gayatri D.; Mathe, V.L.; Bhoraskar, S.V.; Ghorui, S.
2015-01-01
Thermal plasma devices with their unique processing capabilities due to extremely high temperature and steep temperature gradient play an important role in synthesis of ultrafine powders in the range of 100nm or less. High temperature gas phase synthesis in Radio Frequency (RF) thermal plasma reactor is an attractive route for mass production of refractory nanoparticles, especially in the case of rare earth oxides. Here we report synthesis of Yttrium Oxide (Y_2O_3), Neodymium Oxide (Nd_2O_3) and Aluminum Oxide (Al_2O_3) in an inductively coupled radio frequency thermal plasma reactor. Synthesized nanoparticles find wide application in various fields like gate dielectrics, photocatalytic applications, laser devices and photonics. Nano sized Yttrium oxide, Neodymium Oxide and Aluminum oxide powders were separately synthesized in an RF plasma reactor starting with micron sized irregular shaped precursor powders. The system was operated at 3MHz in atmospheric pressure at different power levels. Synthesized powders were scrapped out from different deposition locations inside the reactor and characterized for their phase, morphology, particle size, crystallinity and other characteristic features. Highly crystalline nature of the synthesized particles, narrow size distribution, location dependent phase formation, and distinct variation in the inherent defect states compared to the bulk are some of the important characteristic features observed
Energy Technology Data Exchange (ETDEWEB)
Stan, Manuela, E-mail: manuela.stan@itim-cj.ro; Popa, Adriana; Toloman, Dana; Silipas, Teofil-Danut [National Institute for Research and Development of Isotopic and Molecular Technologies, 67-103 Donat, 400293 Cluj-Napoca (Romania); Vodnar, Dan Cristian [University of Agricultural Sciences and Veterinary Medicine, Department of Food Science and Technology, 3-5 Manastur Street, 400372 Cluj-Napoca (Romania); Katona, Gabriel [Babes-Bolyai University, Faculty of Chemistry and Chemical Engineering, 11 Arany Janos Street, 400028 Cluj-Napoca (Romania)
2015-12-23
The present contribution reports the synthesis of zinc oxide nanoparticles (ZnO NPs) using aqueous leaf and root extracts of Petroselinum crispum (parsley) and characterization of as-prepared samples. ZnO NPs are subjected to X-ray diffraction (XRD), transmission electron microscopy (TEM) and electron paramagnetic resonance (EPR) studies. The XRD studies reveal a hexagonal wurtzite structure without supplementary diffraction lines for all ZnO samples. TEM analysis shows that the particle size is influenced by the type of plant extract. The EPR spectra indicate the presence of Mn{sup 2+} ions in ZnO sample synthesized using P. crispum leaf extract, while zinc vacancy complexes and oxygen vacancies are evidenced in all analyzed samples. ZnO NPs synthesized using P. crispum extracts exhibit increased (2-16 times) antibacterial activity as compared to chemically synthesized ZnO NPs.
International Nuclear Information System (INIS)
Stan, Manuela; Popa, Adriana; Toloman, Dana; Silipas, Teofil-Danut; Vodnar, Dan Cristian; Katona, Gabriel
2015-01-01
The present contribution reports the synthesis of zinc oxide nanoparticles (ZnO NPs) using aqueous leaf and root extracts of Petroselinum crispum (parsley) and characterization of as-prepared samples. ZnO NPs are subjected to X-ray diffraction (XRD), transmission electron microscopy (TEM) and electron paramagnetic resonance (EPR) studies. The XRD studies reveal a hexagonal wurtzite structure without supplementary diffraction lines for all ZnO samples. TEM analysis shows that the particle size is influenced by the type of plant extract. The EPR spectra indicate the presence of Mn 2+ ions in ZnO sample synthesized using P. crispum leaf extract, while zinc vacancy complexes and oxygen vacancies are evidenced in all analyzed samples. ZnO NPs synthesized using P. crispum extracts exhibit increased (2-16 times) antibacterial activity as compared to chemically synthesized ZnO NPs
Electrical properties of bulk InP synthesized by modified horizontal Bridgman method
International Nuclear Information System (INIS)
Pak, K.; Matsui, M.; Fukuhara, H.; Nishinaga, T.; Nakamura, T.; Yasuda, Y.
1986-01-01
High purity polycrystalline InP has been required for preparation of starting materials in LEC pulling. Usually, these materials are synthesized by the horizontal Bridgman (HB) or gradient freeze (GF) method. The major problem for InP synthesis has been attributed to silicon contamination during the growth, as shown by several workers. In a previous paper, the authors proposed a model in which the silicon contamination would occur due to the transport of SiO and In/sub 2/O gas species from the In-P melt to the phosphorus region by the reaction of the melt with the quartz boat in the HB growth system and suggested that the Si concentration in the In-P melt would have an intimate correlation with the temperature in the phosphorus region. However, the effect of the temperature in the phosphorus region on the electrical properties has not been studied in details as of yet. In this note, a modified horizontal Bridgman (MHB) method was developed to reduce the residual donor impurities, and the reduction mechanism is discussed
Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins
Zhang, Kewei; Novak, Ondrej; Wei, Zhaoyang; Gou, Mingyue; Zhang, Xuebin; Yu, Yong; Yang, Huijun; Cai, Yuanheng; Strnad, Miroslav; Liu, Chang-Jun
2014-02-01
Cytokinins are a major group of phytohormones regulating plant growth, development and stress responses. However, in contrast to the well-defined polar transport of auxins, the molecular basis of cytokinin transport is poorly understood. Here we show that an ATP-binding cassette transporter in Arabidopsis, AtABCG14, is essential for the acropetal (root to shoot) translocation of the root-synthesized cytokinins. AtABCG14 is expressed primarily in the pericycle and stelar cells of roots. Knocking out AtABCG14 strongly impairs the translocation of trans-zeatin (tZ)-type cytokinins from roots to shoots, thereby affecting the plant’s growth and development. AtABCG14 localizes to the plasma membrane of transformed cells. In planta feeding of C14 or C13-labelled tZ suggests that it acts as an efflux pump and its presence in the cells directly correlates with the transport of the fed cytokinin. Therefore, AtABCG14 is a transporter likely involved in the long-distance translocation of cytokinins in planta.
Soft-Template-Synthesized Mesoporous Carbon for Oral Drug Delivery
Energy Technology Data Exchange (ETDEWEB)
Saha, Dipendu [ORNL; Warren, Kaitlyn E [ORNL; Naskar, Amit K [ORNL
2014-01-01
Template-synthesized mesoporous carbons were successfully used in in vitro investigations of controlled delivery of three model drugs, captopril, furosemide, and ranitidine hydrochloride. Captopril and furosemide exhibited desorption kinetics over 30 40 h, and ranitidine HCl had a complete release time of 5 10 h. As evident from the slow release kinetics, we contend that our mesoporous carbon is an improved drug-delivery medium compared to state-of-the-art porous silica-based substrates. The mesoporous carbons, synthesized from phloroglucinol and lignin, a synthetic and a sustainable precursor, respectively, exhibit BET surface area of 200 400 m2 g-1 and pore volume of 0.2 0.6 cm3 g-1. The phloroglucinol-based carbon has narrower pore widths and higher pore volume than the lignin-derived counterpart and maintains a longer release time. Numerical modeling of the release kinetics data reveals that the diffusivities of all the drugs from lignin-based carbon media are of equivalent magnitude (10-22 to 10-24 m2 s-1). However, a tailored reduction of pore width in the sorbent reduces the diffusivity of smaller drug molecules (captopril) by an order of magnitude. Thus, engineered pore morphology in our synthesized carbon sorbent, along with its potential to tailor the chemistry of its interaction with sorbet, can be exploited for optimal delivery system of a preferred drug within its therapeutic level and below the level of toxicity.
Antifouling activity of green-synthesized 7-hydroxy-4-methylcoumarin.
Pérez, Miriam; García, Mónica; Ruiz, Diego; Autino, Juan Carlos; Romanelli, Gustavo; Blustein, Guillermo
2016-02-01
In the search for new environmental-friendly antifoulants for replace metallic biocides, 7-hydroxy-4-methylcoumarin was synthesized according to green chemistry procedures. This compound was characterized by current organic analysis and its antifouling properties were firstly evaluated on the bivalve Mytilus edulis platensis in the laboratory. In the second stage, a soluble matrix antifouling coating formulated with this compound was assayed in marine environment. Laboratory experiments showed that 7-hydroxy-4-methylcoumarin was effective in inhibiting both the settlement as well as the byssogenesis of mussels. In addition, after exposure time in the sea, painted panels containing this compound showed strong antifouling effect on conspicuous species of the fouling community of Mar el Plata harbor. In conclusion, green-synthesized coumarin could be a suitable antifoulant candidate for marine protective coatings. Copyright © 2015 Elsevier Ltd. All rights reserved.
Applications of Magnetosomes Synthesized by Magnetotactic Bacteria in Medicine
International Nuclear Information System (INIS)
Alphandéry, Edouard
2014-01-01
Magnetotactic bacteria belong to a group of bacteria that synthesize iron oxide nanoparticles covered by biological material that are called magnetosomes. These bacteria use the magnetosomes as a compass to navigate in the direction of the earth’s magnetic field. This compass helps the bacteria to find the optimum conditions for their growth and survival. Here, we review several medical applications of magnetosomes, such as those in magnetic resonance imaging (MRI), magnetic hyperthermia, and drug delivery. Different methods that can be used to prepare the magnetosomes for these applications are described. The toxicity and biodistribution results that have been published are summarized. They show that the magnetosomes can safely be used provided that they are prepared in specific conditions. The advantageous properties of the magnetosomes compared with those of chemically synthesized nanoparticles of similar composition are also highlighted.
Study of as-synthesized and calcined hydrocalumites as possible ...
Indian Academy of Sciences (India)
Administrator
ments. Finally, these solids were tested as antacids by using a synthetic gastric juice. Results showed that calcined samples were able to neutralize the synthetic gastric juice in more extension as an as-synthesized ..... D 2010 Appl. Clay Sci.
A new approach to synthesize supported ruthenium phosphides for hydrodesulfurization
International Nuclear Information System (INIS)
Wang, Qingfang; Wang, Zhiqiang; Yin, Xiaoqian; Zhou, Linxi; Zhang, Minghui
2016-01-01
Highlights: • We bring out a new method to synthesize noble metal phosphides at low temperature. • Both RuP and Ru_2P were synthesized using triphenylphosphine as phosphorus sources. • Ru_2P was the better active phase for HDS than RuP and metal Ru. • RuP/SiO_2 prepared by new method had better HDS activity to that by TPR method. - Abstract: Supported noble metal ruthenium phosphides were synthesized by one-step H_2-thermal treatment method using triphenylphosphine (TPP) as phosphorus sources at low temperatures. Two phosphides RuP and Ru_2P can be prepared by this method via varying the molar ratio of metal salt and TPP. The as-prepared phosphides were characterized by X-ray powder diffraction (XRD), low-temperature N_2 adsorption, CO chemisorption and transmission electronic microscopy (TEM). The supported ruthenium phosphides prepared by new method and conventional method together with contradistinctive metallic ruthenium were evaluated in hydrodesulfurization (HDS) of dibenzothiophene (DBT). The catalytic results showed that metal-rich Ru_2P was the better active phase for HDS than RuP and metal Ru. Besides this, ruthenium phosphide catalyst prepared by new method exhibited superior HDS activity to that prepared by conventional method.
A new approach to synthesize supported ruthenium phosphides for hydrodesulfurization
Energy Technology Data Exchange (ETDEWEB)
Wang, Qingfang [Tianjin Key Laboratory of Water Environment and Resources, Tianjin Normal University, Tianjin 300387 (China); Key Laboratory of Advanced Energy Materials Chemistry (MOE), Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), College of Chemistry, Nankai University, Tianjin 300071 (China); Wang, Zhiqiang [Tianjin Key Laboratory of Water Environment and Resources, Tianjin Normal University, Tianjin 300387 (China); Yin, Xiaoqian; Zhou, Linxi [Key Laboratory of Advanced Energy Materials Chemistry (MOE), Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), College of Chemistry, Nankai University, Tianjin 300071 (China); Zhang, Minghui, E-mail: zhangmh@nankai.edu.cn [Key Laboratory of Advanced Energy Materials Chemistry (MOE), Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), College of Chemistry, Nankai University, Tianjin 300071 (China); College of Chemistry and Environmental Science, Kashgar University, Kashgar 844006 (China)
2016-02-15
Highlights: • We bring out a new method to synthesize noble metal phosphides at low temperature. • Both RuP and Ru{sub 2}P were synthesized using triphenylphosphine as phosphorus sources. • Ru{sub 2}P was the better active phase for HDS than RuP and metal Ru. • RuP/SiO{sub 2} prepared by new method had better HDS activity to that by TPR method. - Abstract: Supported noble metal ruthenium phosphides were synthesized by one-step H{sub 2}-thermal treatment method using triphenylphosphine (TPP) as phosphorus sources at low temperatures. Two phosphides RuP and Ru{sub 2}P can be prepared by this method via varying the molar ratio of metal salt and TPP. The as-prepared phosphides were characterized by X-ray powder diffraction (XRD), low-temperature N{sub 2} adsorption, CO chemisorption and transmission electronic microscopy (TEM). The supported ruthenium phosphides prepared by new method and conventional method together with contradistinctive metallic ruthenium were evaluated in hydrodesulfurization (HDS) of dibenzothiophene (DBT). The catalytic results showed that metal-rich Ru{sub 2}P was the better active phase for HDS than RuP and metal Ru. Besides this, ruthenium phosphide catalyst prepared by new method exhibited superior HDS activity to that prepared by conventional method.
DEFF Research Database (Denmark)
Wewer, U; Albrechtsen, R; Ruoslahti, E
1981-01-01
Laminin, a glycoprotein antigenically similar or identical to a component of epithelial basement membranes, was identified as a major component of the abundant extracellular matrix synthesized by an experimentally induced rat yolk sac tumor. Immunocytochemical staining revealed laminin in cultured...... polypeptides with molecular weights of approximately 200,000 and 400,000. These comigrated with the polypeptides of mouse laminin isolated previously. The yolk sac tumor tissue grown in vivo contained laminin in the tumor cells and in the extracellular material as evidenced by immunofluorescence...... membranes in rat tissues in a manner indistinguishable from antilaminin. The presence of laminin in rat yolk sac cells, the presumed origin of our yolk sac tumor, was studied in some detail. Laminin was found to be present in normal cells of the visceral as well as the parietal yolk sac layer...
Economical parallel oligonucleotide and peptide synthesizer - PET OLIGATOR
Czech Academy of Sciences Publication Activity Database
Lebl, M.; Pistek, Ch.; Hachmann, J.; Mudra, Petr; Pešek, Václav; Pokorný, Vít; Poncar, Pavel; Ženíšek, Karel
2007-01-01
Roč. 13, 1/2 (2007), s. 367-375 ISSN 1573-3149 Grant - others:NIH SBIR(US) R43 GM61511-01; NIH SBIR(US) R43 GM58981-01 Institutional research plan: CEZ:AV0Z40550506 Keywords : automated synthesizer * centrifugation * parallel synthesis Subject RIV: CC - Organic Chemistry Impact factor: 0.971, year: 2007
ARSENIC REMOVAL USING SOL-GEL SYNTHESIZED TITANIUM DIOXIDE NANOPARTICLES
In this study, the effectiveness of TiO2 nanoparticles in arsenic adsorption was examined. TiO2 particles (LS) were synthesized via sol-gel techniques and characterized for their crystallinity, surface area and pore volume. Batch adsorption studies were perf...
Nanoscale grain growth behaviour of CoAl intermetallic synthesized ...
Indian Academy of Sciences (India)
Grain growth behaviour of the nanocrystalline CoAl intermetallic compound synthesized by mechanical alloying has been studied by isothermal annealing at different temperatures and durations. X-ray diffraction method was employed to investigate structural evolutions during mechanical alloying and annealing processes.
Nanoscale grain growth behaviour of CoAl intermetallic synthesized ...
Indian Academy of Sciences (India)
Administrator
Abstract. Grain growth behaviour of the nanocrystalline CoAl intermetallic compound synthesized by mechanical alloying has been studied by isothermal annealing at different temperatures and durations. X-ray diffraction method was employed to investigate structural evolutions during mechanical alloying and anneal-.
Four Proteins Synthesized in Response to Deoxyribonucleic Acid Damage in Micrococcus Radiodurans
DEFF Research Database (Denmark)
Hansen, M. T.
1980-01-01
Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis for these prote......Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis...
Zhu, Tao; Chong, Meng Nan; Chan, Eng Seng
2014-11-01
The recent developments of nanostructured WO3 thin films synthesized through the electrochemical route of electrochemical anodization and cathodic electrodeposition for the application in photoelectrochemical (PEC) water splitting are reviewed. The key fundamental reaction mechanisms of electrochemical anodization and cathodic electrodeposition methods for synthesizing nanostructured WO3 thin films are explained. In addition, the effects of metal oxide precursors, electrode substrates, applied potentials and current densities, and annealing temperatures on size, composition, and thickness of the electrochemically synthesized nanostructured WO3 thin films are elucidated in detail. Finally, a summary is given for the general evaluation practices used to calculate the energy conversion efficiency of nanostructured WO3 thin films and a recommendation is provided to standardize the presentation of research results in the field to allow for easy comparison of reported PEC efficiencies in the near future. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Seebeck coefficient of synthesized Titanium Dioxide thin film on FTO glass substrate
Usop, R.; Hamed, N. K. A.; Megat Hasnan, M. M. I.; Ikeda, H.; Sabri, M. F. M.; Ahmad, M. K.; Said, S. M.; Salleh, F.
2018-04-01
In order to fabricate a thermoelectric device on glass substrate for harvesting waste heat energy through house appliances, the Seebeck coefficient of translucent TiO2 thin film was investigated. The TiO2 thin film was synthesized by using hydrothermal method with F-SnO2 coated glass as substrate. From scanning electron microscopy analysis, the synthesized TiO2 thin film was found to be in nanometer-scale rod structure with a thickness of 4 µm. The Seebeck coefficient was measured in the temperature range of 300 – 400 K. The Seebeck coefficient is found to be in negative value which shows that synthesized film is an n-type semiconductor material, and is lower than the value of bulk-size material. This reduction in Seebeck coefficient of TiO2 thin film is likely due to the low dimensional effect and the difference of carrier concentration.
Multi-Band Multi-Tone Tunable Millimeter-Wave Frequency Synthesizer For Satellite Beacon Transmitter
Simons, Rainee N.; Wintucky, Edwin G.
2016-01-01
This paper presents the design and test results of a multi-band multi-tone tunable millimeter-wave frequency synthesizer, based on a solid-state frequency comb generator. The intended application of the synthesizer is in a satellite beacon transmitter for radio wave propagation studies at K-band (18 to 26.5 GHz), Q-band (37 to 42 GHz), and E-band (71 to 76 GHz). In addition, the architecture for a compact beacon transmitter, which includes the multi-tone synthesizer, polarizer, horn antenna, and power/control electronics, has been investigated for a notional space-to-ground radio wave propagation experiment payload on a small satellite. The above studies would enable the design of robust high throughput multi-Gbps data rate future space-to-ground satellite communication links.
A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system
International Nuclear Information System (INIS)
Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang
2009-01-01
A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 μm CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm 2 .
A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system
Energy Technology Data Exchange (ETDEWEB)
Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang, E-mail: yumeihuang@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)
2009-09-15
A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 {mu}m CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm{sup 2}.
A simple route to synthesize manganese germanate nanorods
International Nuclear Information System (INIS)
Pei, L.Z.; Yang, Y.; Yuan, C.Z.; Duan Taike; Zhang Qianfeng
2011-01-01
Manganese germanate nanorods have been synthesized by a simple route using germanium dioxide and manganese acetate as the source materials. X-ray diffraction observation shows that the nanorods are composed of orthorhombic and monoclinic manganese germanate phases. Scanning electron microscopy and transmission electron microscopy observations display that the manganese germanate nanorods have flat tips with the length of longer than 10 micrometers and diameter of 60-350 nm, respectively. The role of the growth conditions on the formation of the manganese germanate nanorods shows that the proper selection and combination of the growth conditions are the key factor for controlling the formation of the manganese germanate nanorods. The photoluminescence spectrum of the manganese germanate nanorods exhibits four fluorescence emission peaks centered at 422 nm, 472 nm, 487 nm and 530 nm showing the application potential for the optical devices. - Research Highlights: → Manganese germanate nanorods have been synthesized by simple hydrothermal process. → The formation of manganese germanate nanorods can be controlled by growth conditions. → Manganese germanate nanorods exhibit good PL emission ability for optical device.
Synthesizing Iron Oxide Nanostructures: The Polyethylenenemine (PEI) Role
Mozo, Sergio Lentijo
2017-01-12
Controlled synthesis of anisotropic iron oxide nanoparticles is a challenge in the field of nanomaterial research that requires an extreme attention to detail. In particular, following up a previous work showcasing the synthesis of magnetite nanorods (NRs) using a two-step approach that made use of polyethylenenemine (PEI) as a capping ligand to synthesize intermediate β-FeOOH NRs, we studied the effect and influence of the capping ligand on the formation of β-FeOOH NRs. By comparing the results reported in the literature with those we obtained from syntheses performed (1) in the absence of PEI or (2) by using PEIs with different molecular weight, we showed how the choice of different PEIs determines the aspect ratio and the structural stability of the β-FeOOH NRs and how this affects the final products. For this purpose, a combination of XRD, HRTEM, and direct current superconducting quantum interference device (DC SQUID) magnetometry was used to identify the phases formed in the final products and study their morphostructural features and related magnetic behavior.
A fractional-N frequency synthesizer for WCDMA/Bluetooth/ZigBee applications
Chunyuan, Zhou; Guolin, Li; Chun, Zhang; Baoyong, Chi; Dongmei, Li; Zhihua, Wang
2009-07-01
A triple-mode fractional-N frequency synthesizer with a noise-filter voltage controlled oscillator (VCO) for WCDMA/Bluetooth/ZigBee applications has been implemented in 0.18-μm RF-CMOS technology. The proposed synthesizer achieves a good phase noise lower than -80 dBc/Hz in band and -115 dBc/Hz@1 MHz for the three modes, and only draws 21 mA from a 1.8 V supply. It has a high hardware sharing and a small size, only 1.5 × 1.4 mm2. The system architecture, circuit design, and measured results are also presented.
First-principles calculations of a high-pressure synthesized compound PtC
International Nuclear Information System (INIS)
Li Linyan; Yu Wen; Jin Changqing
2005-01-01
The first-principles density-functional method is used to study the recently high-pressure synthesized compound PtC. It is confirmed by our calculations that platinum carbide has a zinc-blende ground-state phase at zero pressure and that the rock-salt structure is a high-pressure phase. The theoretical transition pressure from zinc-blende to rock-salt structure is determined to be 52 GPa. Furthermore, our calculation shows the possibility that the PtC experimentally synthesized under high pressure conditions might undergo a transition from rock-salt to zinc-blende structure after a pressure quench to ambient conditions
A fractional-N frequency synthesizer for WCDMA/Bluetooth/ZigBee applications
Energy Technology Data Exchange (ETDEWEB)
Zhou Chunyuan; Zhang Chun; Chi Baoyongi; Wang Zhihua [Institute of Microelectronics, Tsinghua University, Beijing 100084 (China); Li Guolin; Li Dongmei, E-mail: zhoucy06@mails.tsinghua.edu.c [Department of Electronic Engineering, Tsinghua University, Beijing 100084 (China)
2009-07-15
A triple-mode fractional-N frequency synthesizer with a noise-filter voltage controlled oscillator (VCO) for WCDMA/Bluetooth/ZigBee applications has been implemented in 0.18-{mu}m RF-CMOS technology. The proposed synthesizer achieves a good phase noise lower than -80 dBc/Hz in band and -115 dBc/Hz-1 MHz for the three modes, and only draws 21 mA from a 1.8 V supply. It has a high hardware sharing and a small size, only 1.5 x 1.4 mm{sup 2}. The system architecture, circuit design, and measured results are also presented.
Piruthiviraj, Prakash; Margret, Anita; Krishnamurthy, Poornima Priyadharsani
2016-04-01
Production of antimicrobial agents through the synthesis of gold nanoparticles using green technology has been extensively made consistent by various researchers; yet, this study uses the flower bud's aqueous extracts of Brassica oleracea (Broccoli) as a reducing agent for chloroauric acid (1 mM). After 30 min of incubation, synthesis of gold nanoparticles (AuNps) was observed by a change in extract color from pale yellow to purple color. Synthesis of AuNps was confirmed in UV-visible spectroscopy at the range of approximately 560 nm. The SEM analysis showed the average nanoparticles size of 12-22 nm. The antimicrobial activity of AuNps was analyzed by subjecting it to human pathogenic bacteria (Gram-positive Staphylococcus aureus and Gram-negative Klebsiella pneumonia) and fungi (Aspergillus flavus, Aspergillus niger and Candida albicans) using disc diffusion method. The broccoli-synthesized AuNps showed the efficient antibacterial and antifungal activity of above-mentioned microbes. It was confirmed that AuNps have the best antimicrobial agent compared to the standard antibiotics (Gentamicin and Fluconazole). When the concentrations of AuNps were increased (10, 25, and 50 µg/ml), the sensitivity zone also increased for all the tested microbes. The synthesized AuNps are capable of rendering high antimicrobial efficacy and, hence, have a great potential in the preparation of drugs used against major bacterial and fungal diseases in humans.
Evaluation of setting time and flow properties of self-synthesize alginate impressions
Halim, Calista; Cahyanto, Arief; Sriwidodo, Harsatiningsih, Zulia
2018-02-01
Alginate is an elastic hydrocolloid dental impression materials to obtain negative reproduction of oral mucosa such as to record soft-tissue and occlusal relationships. The aim of the present study was to synthesize alginate and to determine the setting time and flow properties. There were five groups of alginate consisted of fifty samples self-synthesize alginate and commercial alginate impression product. Fifty samples were divided according to two tests, each twenty-five samples for setting time and flow test. Setting time test was recorded in the s unit, meanwhile, flow test was recorded in the mm2 unit. The fastest setting time result was in the group three (148.8 s) and the latest was group fours). The highest flow test result was in the group three (69.70 mm2) and the lowest was group one (58.34 mm2). Results were analyzed statistically by one way ANOVA (α= 0.05), showed that there was a statistical significance of setting time while no statistical significance of flow properties between self-synthesize alginate and alginate impression product. In conclusion, the alginate impression was successfully self-synthesized and variation composition gives influence toward setting time and flow properties. The most resemble setting time of control group is group three. The most resemble flow of control group is group four.
A power scalable PLL frequency synthesizer for high-speed Δ—Σ ADC
International Nuclear Information System (INIS)
Han Siyang; Chi Baoyong; Zhang Xinwang; Wang Zhihua
2014-01-01
A 35–130 MHz/300–360 MHz phase-locked loop frequency synthesizer for Δ—Σ analog-to-digital converter (ADC) in 65 nm CMOS is presented. The frequency synthesizer can work in low phase-noise mode (300–360 MHz) or in low-power mode (35–130 MHz) to satisfy the ADC's requirements. To switch between these two modes, a high frequency GHz LC VCO followed by a divided-by-four frequency divider and a low frequency ring VCO followed by a divided-by-two frequency divider are integrated on-chip. The measured results show that the frequency synthesizer achieves a phase-noise of −132 dBc/Hz at 1 MHz offset and an integrated RMS jitter of 1.12 ps with 1.74 mW power consumption from a 1.2 V power supply in low phase-noise mode. In low-power mode, the frequency synthesizer achieves a phase-noise of −112 dBc/Hz at 1 MHz offset and an integrated RMS jitter of 7.23 ps with 0.92 mW power consumption from a 1.2 V power supply. (semiconductor integrated circuits)
Dielectric properties of CdS nanoparticles synthesized by soft ...
Indian Academy of Sciences (India)
If the field applied to the condenser is time-dependent (as in an alternating current), so ... tematically the dielectric properties of CdS synthesized by a soft chemical method .... The real parts of conductivity spectra can be explained by the power ...
Is Synthesizing MRI Contrast Useful for Inter-modality Analysis?
DEFF Research Database (Denmark)
Iglesias, Juan Eugenio; Konukoglu, Ender; Zikic, Darko
2013-01-01
Availability of multi-modal magnetic resonance imaging (MRI) databases opens up the opportunity to synthesize different MRI contrasts without actually acquiring the images. In theory such synthetic images have the potential to reduce the amount of acquisitions to perform certain analyses. However...
Energy Technology Data Exchange (ETDEWEB)
Dupeyre, R M [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires, Laboratoire de chimie organique physique
1967-12-01
Syntheses and study of pyrrolidinic nitroxide free radicals: These radicals are obtained by oxidation, with hydrogen peroxide, of pyrrolidinic amines prepared from triacetonamine by ring contraction. The U. V,, I. R, and E.P.R. spectral characteristics have been determined. The oxidation of these amines with hydrogen peroxide has led also to rupture of the pentagonal ring; some of the decomposition products have been identified. The high chemical stability of the nitroxide group has made it possible to synthesize and study a stable bi-radical. (author) [French] Syntheses et etudes de radicaux libres nitroxydes pyrrolidiniques: Ces radicaux sont obtenus par oxydation l'eau oxygenee d'amines pyrrolidiniques preparees a partir de la triacetonamine par contraction de cycle. Les caracteristiques spectroscopiques ultra-violettes, infra-rouge et resonance paramagnetique sont determinees. Cependant, 1'oxydation de ces amines a l'eau oxygenee a entraine la coupure du cycle pentagonal et identification de certaines substances de decomposition obtenues. La grande stabilite chimique de groupement nitroxyde a permis la synthese et l'etude d'un biradical stable. (auteur)
Maarif, H. A.; Akmeliawati, R.; Gunawan, T. S.; Shafie, A. A.
2013-12-01
Sign language synthesizer is a method to visualize the sign language movement from the spoken language. The sign language (SL) is one of means used by HSI people to communicate to normal people. But, unfortunately the number of people, including the HSI people, who are familiar with sign language is very limited. These cause difficulties in the communication between the normal people and the HSI people. The sign language is not only hand movement but also the face expression. Those two elements have complimentary aspect each other. The hand movement will show the meaning of each signing and the face expression will show the emotion of a person. Generally, Sign language synthesizer will recognize the spoken language by using speech recognition, the grammatical process will involve context free grammar, and 3D synthesizer will take part by involving recorded avatar. This paper will analyze and compare the existing techniques of developing a sign language synthesizer, which leads to IIUM Sign Language Synthesizer.
Bilateral Manipulandum to Synthesize Ground Referenced and Interlimb Viscoelastic Loads
National Research Council Canada - National Science Library
Gallasch, E
2001-01-01
.... The mechatronics consists of two angular voice coil actuators (+/- 40 Nm) with embedded rotary (+/- 20 degrees) and torque sensors driven by voltage controlled current sources, DSP software routines to synthesize isotonic...
Green synthesized zinc oxide nanoparticles as a therapeutic tool to combat candidiasis
Rathod, Tejas; Padalia, Hemali; Chanda, Sumitra
2017-05-01
Advancement of modern medicine, the increasing ratio of immunocompromised and immunosuppressive individuals is increased in hospitalized with serious underlying disease. This has resulted in a rise in the incidence of fungal infections, especially those due to Candida species. For many years the conventional antibiotic therapy has been critical in the fight against Candidiasis. Candidiasis is a fungal infection due to various types of Candida (yeast) species. In this study, zinc oxide nanoparticles (ZnONPs) were synthesized using the Cinnamomum verum bark plus Cassia auriculata leaf powder extracts. The characterization of synthesized ZnONPs was done by UV-Vis spectrophotometer and SEM analysis. The average size of nanoparticles was 77 nm. Synergistic anticandidal activity of ZnONPs (ZnONPs plus antibiotics) was determined by disc diffusion method against 16 multidrug resistant clinical pathogens of Candida species. Antibiotic Ketoconazole plus ZnONPs showed best synergistic anticandidal activity against all the 16 isolates. Green synthesized ZnONPs appears to be a new promising approach to fight against Candidiasis.
Gadolinium-doped ceria nanopowders synthesized by urea-based homogeneous co-precipitation (UBHP)
Energy Technology Data Exchange (ETDEWEB)
Accardo, G., E-mail: d16605@kist.re.kr [Fuel Cell Research Center, Korea Institute of Science and Technology, Hwarangno 14-gil, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Spiridigliozzi, L. [Department of Civil and Mechanical Engineering, INSTM Research Unit, University of Cassino and Southern Lazio, Via G. Di Biasio 43, 03043 Cassino, FR (Italy); Cioffi, R.; Ferone, C. [Department of Engineering, INSTM Research Unit, University Parthenope of Naples, Centro Direzionale, Is. C4, 80143 Napoli (Italy); Di Bartolomeo, E. [Department of Chemical Science and Technology, University of Rome “Tor Vergata”, Viale della Ricerca Scientifica, 00133 Rome (Italy); Yoon, Sung Pil [Fuel Cell Research Center, Korea Institute of Science and Technology, Hwarangno 14-gil, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Dell’Agli, G. [Department of Civil and Mechanical Engineering, INSTM Research Unit, University of Cassino and Southern Lazio, Via G. Di Biasio 43, 03043 Cassino, FR (Italy)
2017-02-01
Gadolinium (10%)-doped ceria was successfully synthesized by using an urea-based co-precipitation method (UBHP). A single fluorite phase was obtained after a low temperature (400 °C) calcination treatment. The resulting powders showed grains of nanometric size with some agglomerations and an overall good sinterability. Pellets were sintered at 1300 and 1500 °C for 3 h. The ionic conductivity was measured by electrochemical impedance spectroscopy measurements and a correlation between electrical properties and microstructure was revealed. The promising conductivity values showed that the synthesized powders are suitable for intermediate temperature solid oxide fuel cells (IT-SOFCs) applications. - Highlights: • Urea-based homogeneous co-precipitation is applied to synthesize nanocrystalline GDC. • Dense GDC samples at different sintering temperatures were characterized. • SEM and TEM revealed a well define microstructure and controlled composition. • Correlation between electrochemical properties by EIS and microstructure was discussed. • UBHP method can be used to prepare high performance GDC electrolytes.
Lun Li, Oi; Lee, Hoonseung; Ishizaki, Takahiro
2018-01-01
Carbon-based materials have been widely utilized as the electrode materials in energy conversion and storage technologies, such as fuel cells and metal-air batteries. In these systems, the oxygen reduction reaction is an important step that determines the overall performance. A novel synthesis route, named the solution plasma process, has been recently utilized to synthesize various types of metal-based and heteroatom-doped carbon catalysts. In this review, we summarize cutting-edge technologies involving the synthesis and modeling of carbon-supported catalysts synthesized via solution plasma process, followed by current progress on the electrocatalytic performance of these catalysts. This review provides the fundamental and state-of-the-art performance of solution-plasma-synthesized electrode materials, as well as the remaining scientific and technological challenges for this process.
Granulometric analysis of metallic oxide in ceramic powder form synthesized by different methods
International Nuclear Information System (INIS)
Neiva, L.S.; Simoes, A.N.; Simoes, V.N.; Bispo, A.; Gama, L.
2012-01-01
The aim of this work is to synthesize ceramic powders based on CuO/CeO 2 by means two different synthesis methods, they are: the combustion reaction method and Pechini method. It's part of the aim of this work subject all samples to a synthesized qualitative and quantitative chemical analysis, using the technique EDX and then to a granulometric analysis. The samples of the ceramic powder based on CuO/CeO 2 synthesized in this work by means of the two above synthesis methods, contain various concentrations of CuO ranging between 0 and 0.5 mol. According to the results, only the Pechini method of synthesis exerted a significant and defined influence on the capacity of particle unit agglomeration in these powders (author)
International Nuclear Information System (INIS)
Belkin, V.M.; Volodarskaya, S.M.
1986-01-01
The fibronectin-synthesizing activity of membrane-bound and free polyribosomes in a cell-free system was studied using immunochemical methods. It was found that fibronectin biosynthesis on membrane-bound polyribosomes from human embryonic fibroblasts accounts for 4.9% and those from 10-day-old chick embryos for 1.1% of the total amount of newly synthesized proteins, whereas on free polyribosomes it is 1.0 and 0.3%, respectively. Fibronectin monomers with a molecular weight of 220,000 were found only in the material of the cell-free system containing heavy fractions of membrane-bound polyribosomes newly synthesized in the presence of spermidine. Thus, it was shown that fibronectin is synthesized primarily on membrane-bound polyribosomes
Concrete Embedded Dye-Synthesized Photovoltaic Solar Cell
Hosseini, T.; Flores-Vivian, I.; Sobolev, K.; Kouklin, N.
2013-01-01
This work presents the concept of a monolithic concrete-integrated dye-synthesized photovoltaic solar cell for optical-to-electrical energy conversion and on-site power generation. The transport measurements carried out in the dark revealed the presence of VOC of ~190?mV and ISC of ~9??A, induced by the electrochemical conversion of concrete-supplied ionic impurities at the electrodes. The current-voltage measurements performed under illumination at incident optical powers of ~46?mW confirmed...
Syntheses and spectroscopic properties of mercury(II) and nickel(II ...
African Journals Online (AJOL)
Syntheses and spectroscopic properties of mercury(II) and nickel(II) ... The complexes were characterized by IR, diffuse reflectance, 1H NMR spectra and elemental ... coordinating through thiolato sulphur and hydrazinic nitrogen atoms.
Writing syntheses for managers: Lessons from the Rainbow Series and Fire Effects Information System
Jane Kapler Smith; Kristin L. Zouhar; Janet Fryer
2009-01-01
Scientific knowledge is essential for sound wildland management, but this knowledge is a complex, ever-expanding resource. Managers often request syntheses or reviews of available knowledge, and scientists have responded with an increasing number of syntheses for managers. Unfortunately, little guidance is available for this kind of writing. While most scientists have...
Accuracy of Repetition of Digitized and Synthesized Speech for Young Children in Background Noise
Drager, Kathryn D. R.; Clark-Serpentine, Elizabeth A.; Johnson, Kate E.; Roeser, Jennifer L.
2006-01-01
Purpose: The present study investigated the intelligibility of digitized and synthesized speech output in background noise for children 3-5 years old. The purpose of the study was to determine whether there was a difference in the intelligibility (ability to repeat) of 3 types of speech output (digitized, DECTalk synthesized, and MacinTalk…
Cheung, Mike W. L.; Chan, Wai
2009-01-01
Structural equation modeling (SEM) is widely used as a statistical framework to test complex models in behavioral and social sciences. When the number of publications increases, there is a need to systematically synthesize them. Methodology of synthesizing findings in the context of SEM is known as meta-analytic SEM (MASEM). Although correlation…
Institute of Scientific and Technical Information of China (English)
翟宏琛; 王明伟; 刘福民; 母国光
2002-01-01
We report for the first time the theoretical analysis and experimental results of a white-light reconstructed monochromatic 3-D image synthesizing tomograms by multiple rainbow holo-graphy with vertical-area partition (VAP) approach. The theoretical and experimental results show that 3-D monochromatic image can be synthesized by recording the master hologram by VAP ap-proach without any distortions either in gray scale or in geometrical position. A 3-D monochromatic image synthesized from a series of medical tomograms is presented in this paper for the first time.
Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp.
Thomas, Roshmi; Janardhanan, Anju; Varghese, Rintu T; Soniya, E V; Mathew, Jyothis; Radhakrishnan, E K
2014-01-01
Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM) and scanning electron microscope (SEM). The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm - 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus.
Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp.
Directory of Open Access Journals (Sweden)
Roshmi Thomas
2014-12-01
Full Text Available Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM and scanning electron microscope (SEM. The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm - 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus.
Development of an Intelligent System to Synthesize Petrophysical Well Logs
Directory of Open Access Journals (Sweden)
Morteza Nouri Taleghani
2013-07-01
Full Text Available Porosity is one of the fundamental petrophysical properties that should be evaluated for hydrocarbon bearing reservoirs. It is a vital factor in precise understanding of reservoir quality in a hydrocarbon field. Log data are exceedingly crucial information in petroleum industries, for many of hydrocarbon parameters are obtained by virtue of petrophysical data. There are three main petrophysical logging tools for the determination of porosity, namely neutron, density, and sonic well logs. Porosity can be determined by the use of each of these tools; however, a precise analysis requires a complete set of these tools. Log sets are commonly either incomplete or unreliable for many reasons (i.e. incomplete logging, measurement errors, and loss of data owing to unsuitable data storage. To overcome this drawback, in this study several intelligent systems such as fuzzy logic (FL, neural network (NN, and support vector machine are used to predict synthesized petrophysical logs including neutron, density, and sonic. To accomplish this, the petrophysical well logs data were collected from a real reservoir in one of Iran southwest oil fields. The corresponding correlation was obtained through the comparison of synthesized log values with real log values. The results showed that all intelligent systems were capable of synthesizing petrophysical well logs, but SVM had better accuracy and could be used as the most reliable method compared to the other techniques.
A novel nanostructure of cadmium oxide synthesized by mechanochemical method
Energy Technology Data Exchange (ETDEWEB)
Tadjarodi, A., E-mail: tajarodi@iust.ac.ir [Research Laboratory of Inorganic Materials Synthesis, Department of Chemistry, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of); Imani, M. [Research Laboratory of Inorganic Materials Synthesis, Department of Chemistry, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of)
2011-11-15
Highlights: {yields} A novel nanostructure of CdO was synthesized by mechanochemical reaction followed by calcination. {yields} Mechanochemical method is a simple and low-cost to synthesize nanomaterials. {yields} The obtained precursor was characterized by FT-IR, NMR techniques and elemental analysis. {yields} SEM images showed cauliflower-like shape of sample with components average diameter of 68 nm. {yields} The rods and tubes bundles with single crystalline nature were revealed by ED pattern and TEM images. -- Abstract: Cauliflower-like cadmium oxide (CdO) nanostructure was synthesized by mechanochemical reaction followed calcination procedure. Cadmium acetate dihydrate and acetamide were used as reagents and the resulting precursor was calcinated at 450 {sup o}C for 2 h in air. The structures of the precursor and resultant product of the heating treatment were characterized using Fourier transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy and elemental analysis, X-ray powder diffraction (XRD), energy-dispersive X-ray spectroscopy analysis (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction pattern (ED). SEM and TEM images revealed the cauliflower-like morphology of the sample. This structure includes the bundles of rods and tubes in nanoscale, which combine with each other and form the resulting morphology with the average diameter, 68 nm of the components. ED pattern indicated the single crystal nature of the formed bundles.
A novel nanostructure of cadmium oxide synthesized by mechanochemical method
International Nuclear Information System (INIS)
Tadjarodi, A.; Imani, M.
2011-01-01
Highlights: → A novel nanostructure of CdO was synthesized by mechanochemical reaction followed by calcination. → Mechanochemical method is a simple and low-cost to synthesize nanomaterials. → The obtained precursor was characterized by FT-IR, NMR techniques and elemental analysis. → SEM images showed cauliflower-like shape of sample with components average diameter of 68 nm. → The rods and tubes bundles with single crystalline nature were revealed by ED pattern and TEM images. -- Abstract: Cauliflower-like cadmium oxide (CdO) nanostructure was synthesized by mechanochemical reaction followed calcination procedure. Cadmium acetate dihydrate and acetamide were used as reagents and the resulting precursor was calcinated at 450 o C for 2 h in air. The structures of the precursor and resultant product of the heating treatment were characterized using Fourier transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy and elemental analysis, X-ray powder diffraction (XRD), energy-dispersive X-ray spectroscopy analysis (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction pattern (ED). SEM and TEM images revealed the cauliflower-like morphology of the sample. This structure includes the bundles of rods and tubes in nanoscale, which combine with each other and form the resulting morphology with the average diameter, 68 nm of the components. ED pattern indicated the single crystal nature of the formed bundles.
Combustion synthesized hierarchically porous WO{sub 3} for selective acetone sensing
Energy Technology Data Exchange (ETDEWEB)
Dong, Chengjun; Liu, Xu; Guan, Hongtao; Chen, Gang; Xiao, Xuechun [Department of Materials Science and Engineering, Yunnan University, 650091, Kunming (China); Djerdj, Igor [Ruđer Bošković Institute, Bijenička 54, 10000, Zagreb (Croatia); Wang, Yude, E-mail: ydwang@ynu.edu.cn [Department of Materials Science and Engineering, Yunnan University, 650091, Kunming (China); Yunnan Province Key Lab of Mico-Nano Materials and Technology, Yunnan University, 650091, Kunming (China)
2016-12-01
An easy, inexpensive combustion route was designed to synthesize hierarchically porous WO{sub 3}. The tungsten source was fresh peroxiotungstic acid by dissolving tungsten powder into hydrogen peroxide. To promote the combustion reaction, a combined fuel of both glycine and hydrazine hydrate was used. The microstructure was well-connected pores comprised of subunit nanoparticles. Upon exposing towards acetone gas, the porous WO{sub 3} based sensor exhibits high gas response, rapid response and recovery, and good selectivity in the range of 5–1000 ppm under working temperature of 300 °C. This excellent sensing performance was plausibly attributed to the porous morphology, which hence provides more active sites for the gas molecules' reaction. - Graphical abstract: Hierarchically porous WO{sub 3} synthesized by combustion process exhibits high gas response, rapid response and recovery, and excellent selectivity for acetone, making it to be promising candidates for practical detectors for acetone. - Highlights: • Hierarchically porous WO{sub 3} synthesized by combustion process. • Hierarchically porous WO{sub 3} exhibits high gas response and excellent selectivity for acetone. • The excellent sensing property was plausibly attributed to the porous morphology.
Fan, Haiyan; Ru, Jinjiang; Zhang, Yuanyuan; Wang, Qi; Li, Yan
2017-06-01
Apple ring rot, caused by Botryosphaeria dothidea, is a serious apple disease in China. Bacillus subtilis 9407 was isolated from healthy apples and showed strong antifungal activity against B. dothidea. To identify the primary antifungal compound of B. subtilis 9407 and determine its role in controlling apple ring rot, a transposon mutant library was constructed using TnYLB-1, and a mutant completely defective in antifungal activity was obtained. The gene inactivated in the antifungal activity mutant had 98.5% similarity to ppsB in B. subtilis subsp. subtilis str. 168, which encodes one of the five synthetases responsible for synthesizing fengycin. A markerless ppsB deletion mutant was constructed. Compared with the wild-type strain, lipopeptide crude extracts from ΔppsB showed almost no inhibition of B. dothidea mycelial growth. Furthermore, fengycin-like lipopeptides (retention factor 0.1-0.2) that exhibited antifungal activity against B. dothidea were observed in the wild-type strain by thin-layer chromatography (TLC)-bioautography analysis, but not in ΔppsB. Semipreparative reverse-phase high performance liquid chromatography (RP-HPLC) detection revealed that ΔppsB lost the ability to synthesize fengycin. These results suggest that ppsB is responsible for synthesizing fengycin and that fengycin is the major antifungal compound produced by B. subtilis 9407 against B. dothidea. Moreover, a biocontrol assay showed that the control efficacy of ΔppsB was reduced by half compared with the wild-type strain, indicating that fengycin plays a major role in controlling apple ring rot disease. This is the first report on the use of a B. subtilis strain as a potential biological control agent to control apple ring rot disease by the production of fengycin. Copyright © 2017 Elsevier GmbH. All rights reserved.
Radiolitically Synthesized Hybrid Nanosystems for Bio-Nano-Technologies
Energy Technology Data Exchange (ETDEWEB)
Krkljes, A., E-mail: krkljes@vinca.rs [Vinca Institute of Nuclear Sciences, Laboratory for Radiation Chemistry and Physics, ' ' GAMMA' ' (030), P.O. Box 522, 11001 Belgrade (Serbia)
2010-07-01
In this report a review of the main results and the studies carried out under the scope of the IAEA CRP project: Nanoscale Radiation Engineering of Advanced Materials for Potential Biomedical Application is presented. In particular two topics are discussed: radiation synthesizing of Ag nanoparticles in hydrogels for potential biomedical application and decoration of carbon nanotubes with Ag clusters by gamma irradiation. (author)
Radiolitically Synthesized Hybrid Nanosystems for Bio-Nano-Technologies
International Nuclear Information System (INIS)
Krkljes, A.
2010-01-01
In this report a review of the main results and the studies carried out under the scope of the IAEA CRP project: Nanoscale Radiation Engineering of Advanced Materials for Potential Biomedical Application is presented. In particular two topics are discussed: radiation synthesizing of Ag nanoparticles in hydrogels for potential biomedical application and decoration of carbon nanotubes with Ag clusters by gamma irradiation. (author)
Syntheses and pyrolytic studies of salicylate derivatives of ...
African Journals Online (AJOL)
New salicylate derivatives of heteronucleic-μ-oxoisopropoxide [SnO2AlB(OPri)4] have been synthesized by the thermal condensation of μ-oxoisopropoxide and methyl/ethyl/phenyl/phenyl ethyl salicylates in different molar ratios (1:1-1:2) yielding the compounds of the type [SnO2AlB(OPri)4-n(RSAL)n] (where n is 1-2 and ...
Synthesis of Zeolite from Fly Ash and Removal of Heavy Metal Ions from Newly Synthesized Zeolite
Solanki, Parag; Gupta, Vikal; Kulshrestha, Ruchi
2010-01-01
Coal fly ash was used to synthesize X-type zeolite by alkali fusion followed by hydrothermal treatment. Characteristics of the various Fly ash samples were carried out. Coal proximate analysis was done. Batch experiment was carried out for the adsorption of some heavy metal ions on to synthesized Zeolite. The cost of synthesized zeolite was estimated to be almost one-fifth of that of commercial 13X zeolite available in the market.
Schmid, Ulrike
1999-01-01
In der vorliegenden Arbeit wurde zum einen die Lipase-Katalysierte Synthese strukturierter Triglyceride, zum anderen die Veränderung der Kettenlängenselektivität der slip1-Lipase aus C. rugosa durch gerichtete Evolution untersucht. Besonderes Interesse galt der Synthese von strukturierten Triglyceriden des ABA-Typs, die aufgrund ihrer symmetrischen Struktur zur Therapie von Fettabsorptionsproblemen wie z.B. Pankreasinsuffizienz eingesetzt werden können. Besonderes Interesse galt dabei der ...
Accurate simulation of Raman amplified lightwave synthesized frequency sweeper
DEFF Research Database (Denmark)
Pedersen, Anders Tegtmeier; Olesen, Anders Sig; Rottwitt, Karsten
2011-01-01
A lightwave synthesized frequency sweeper using a Raman amplifier for loss compensation is presented together with a numerical model capable of predicting the shape of individual pulses as well as the overall envelope of more than 100 pulses. The generated pulse envelope consists of 116 pulses wi...
Mechanochemically synthesized Al2O3-TiC nanocomposite
International Nuclear Information System (INIS)
Mohammad Sharifi, E.; Karimzadeh, F.; Enayati, M.H.
2010-01-01
Al 2 O 3 -TiC nanocomposite was synthesized by ball milling of aluminum, titanium oxide and graphite powder mixtures. Effect of the milling time and heat treatment temperatures were investigated. The structural evolution of powder particles after different milling times was studied by X-ray diffractometry and scanning electron microscopy. The results showed that after 40 h of ball milling the Al/TiO 2 /C reacted with a self-propagating combustion mode producing Al 2 O 3 -TiC nanocomposite. In final stage of milling, alumina and titanium carbide crystallite sizes were less than 10 nm. After annealing at 900 o C for 1 h, Al 2 O 3 and TiC crystallite sizes remained constant, however increasing annealing temperature to 1200 o C increased Al 2 O 3 and TiC crystallite size to 65 and 30 nm, respectively. No phase change was observed after annealing of the synthesized Al 2 O 3 -TiC powder.
Nanocrystals-based Macroporous Materials Synthesized by Freeze-drying Combustion
International Nuclear Information System (INIS)
Yan, Ruiqiang; Chen, Yu; Lin, Ye; Chen, Fanglin
2016-01-01
We present a novel freeze-drying combustion method for synthesis of macroporous powders with nano-network, using Sm 0.2 Ce 0.8 O 1.9 (SDC) as an example. The metal nitrate salt solution mixed with glycine is frozen to form homogeneous nitrate/glycine mixture and then freeze-dried through sublimation of ice crystals. Upon combustion of the freeze-dried mixture, SDC powders with macroporous microstructure consisting of 10–20 nm nanocrystals, high surface area and excellent sinterability are achieved. High resolution transmission electron microscopy (HRTEM) analysis indicates that nanodomains due to aggregation/segregation of dopants in the SDC powders obtained from freeze-drying combustion are much smaller than those in the SDC powders synthesized by the conventional nitrate solution combustion approach, demonstrating better elemental homogeneity and improved conductivity. Using low cost precursors and simple processing conditions, freeze-drying combustion can be a versatile method to synthesize nanocrystalline powders with excellent composition homogeneity for broad applications.
Dynamic balancing of mechanisms and synthesizing of parallel robots
Wei, Bin
2016-01-01
This book covers the state-of-the-art technologies in dynamic balancing of mechanisms with minimum increase of mass and inertia. The synthesis of parallel robots based on the Decomposition and Integration concept is also covered in detail. The latest advances are described, including different balancing principles, design of reactionless mechanisms with minimum increase of mass and inertia, and synthesizing parallel robots. This is an ideal book for mechanical engineering students and researchers who are interested in the dynamic balancing of mechanisms and synthesizing of parallel robots. This book also: · Broadens reader understanding of the synthesis of parallel robots based on the Decomposition and Integration concept · Reinforces basic principles with detailed coverage of different balancing principles, including input torque balancing mechanisms · Reviews exhaustively the key recent research into the design of reactionless mechanisms with minimum increase of mass a...
Power, John D; Scott, Kenneth R; Gardner, Elizabeth A; Curran McAteer, Bronagh M; O'Brien, John E; Brehon, Margaret; Talbot, Brian; Kavanagh, Pierce V
2014-01-01
Three legal highs; nitracaine (3-(diethylamino)-2,2-dimethylpropyl 4-nitrobenzoate), methoxypiperamide (MEOP, (4-methoxyphenyl)(4-methylpiperazin-1-yl)methanone) and mephtetramine (MTTA, 2-((methylamino)methyl)-3,4-dihydronaphthalen-1(2H)-one) appeared in 2013 as new psychoactive substances (NPS) on Internet websites selling 'research chemicals'. These compounds were synthesized and analyzed via our synthesize, analyze, and metabolize (SAM) protocol. Nitracaine was synthesized by the transesterification of methyl 4-nitrobenzoate with 3-(diethylamino)-2,2-dimethylpropan-1-ol. Methoxypiperamide was synthesized by the reaction of 4-methoxybenzoyl chloride with 1-methylpiperazine, and mephtetramine through the Mannich reaction of 1-tetralone with paraformaldehyde and methylamine hydrochloride. Each compound was characterized by nuclear magnetic resonance (NMR), gas chromatography with electron impact mass spectrometry (GC-EIMS), liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS), and high resolution electrospray ionization mass spectrometry (HR-ESI-MS). A sample of nitracaine was also test-purchased from an Internet vendor and its structure confirmed by GC-EIMS and LC-ESI-MS. Finally, the in vitro metabolism of the nitracaine, mephtetramine, and methoxypiperamide was investigated, using a human microsomal liver extract, in order to tentatively identify potential metabolites that may be encountered in the analysis of biological samples in clinical or toxicology labs. The use of our SAM protocol highlights the ability of academic research labs to quickly respond to and disseminate information about emerging NPS. Copyright © 2014 John Wiley & Sons, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Lee, Don-Sung; Choe, Dong-Hoe; Jeong, Hyun-Dam [Chonnam National University, Gwangju (Korea, Republic of); Yoo, Seung-Wan; Kim, Jung-Hyung [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)
2016-05-15
Octadecyl-terminated silicon nanocrystals (ODE-Si NCs) are obtained via a surface-initiated thermal hydrosilylation reaction on hydride-terminated Si NCs (H-Si NCs). Pristine Si NCs were synthesized at the gram scale by using inductively coupled plasma chemical vapor deposition (ICP-CVD) . The H-Si NCs were produced through a chemical etching process with hydrofluoric acid (HF), ethanol (EtOH), and distilled water (d-H{sub 2}O). The results obtained from X-ray diffraction (XRD) and field emission scanning electron microscopy (FE-SEM) indicate that the synthesized Si NCs obtained via ICP-CVD have diamond cubic-structured silicon with a grain size of 10 nm and a densely packed Si NC array consisting of individual NCs. Organo-functionalized Si NCs, i.e., ODE-Si NCs, are well soluble in organic solvent whereas pristine Si NCs synthesized through ICP-CVD are not. The surface chemistry of the ODE-Si NCs was confirmed via Fourier transform infrared spectroscopy (FT-IR), proton nuclear magnetic resonance spectroscopy ({sup 1}H-NMR), and field emission transmission electron microscopy (FE-TEM). Thereby, these newly synthesized and scalable organo-functionalized Si NCs are applicable as raw materials for practical use in devices by tuning the surface chemistry with various capping molecules.
High quantum yield ZnO quantum dots synthesizing via an ultrasonication microreactor method.
Yang, Weimin; Yang, Huafang; Ding, Wenhao; Zhang, Bing; Zhang, Le; Wang, Lixi; Yu, Mingxun; Zhang, Qitu
2016-11-01
Green emission ZnO quantum dots were synthesized by an ultrasonic microreactor. Ultrasonic radiation brought bubbles through ultrasonic cavitation. These bubbles built microreactor inside the microreactor. The photoluminescence properties of ZnO quantum dots synthesized with different flow rate, ultrasonic power and temperature were discussed. Flow rate, ultrasonic power and temperature would influence the type and quantity of defects in ZnO quantum dots. The sizes of ZnO quantum dots would be controlled by those conditions as well. Flow rate affected the reaction time. With the increasing of flow rate, the sizes of ZnO quantum dots decreased and the quantum yields first increased then decreased. Ultrasonic power changed the ultrasonic cavitation intensity, which affected the reaction energy and the separation of the solution. With the increasing of ultrasonic power, sizes of ZnO quantum dots first decreased then increased, while the quantum yields kept increasing. The effect of ultrasonic temperature on the photoluminescence properties of ZnO quantum dots was influenced by the flow rate. Different flow rate related to opposite changing trend. Moreover, the quantum yields of ZnO QDs synthesized by ultrasonic microreactor could reach 64.7%, which is higher than those synthesized only under ultrasonic radiation or only by microreactor. Copyright © 2016 Elsevier B.V. All rights reserved.
Novel Evaporation Process for Deposition of Kesterite Thin Films Synthesized by Solvothermal Method
Directory of Open Access Journals (Sweden)
J. A. Estrada-Ayub
2017-01-01
Full Text Available Kesterite, a quaternary compound of Cu2ZnSnS4, is a promising option as a material absorber to reduce the cost of photovoltaic solar cells. The solvothermal method is a way to synthesize nanoparticles of this material. In this work, once synthesized, particles were deposited on a substrate through evaporation, and their morphological, structural, and optical properties were studied. Results show that changes of precursor ratios during solvothermal synthesis result in a modification of particle morphology but not on its size. The deposition of already synthesized kesterite through evaporation preserves kesterite structure and permits the formation of a homogenous film on a substrate. Optical reflectance and transmittance measurements allowed estimating the band-gap energy between 1.41 and 1.46 eV for representative samples, which is near the optimum for the absorber material.
Fast neutron spectrometer with pulse shape discrimination
International Nuclear Information System (INIS)
Verbitsky, S.S.
1978-01-01
A fast neutron spectrometer with a stilbene single crystal designed to operate at high pulsed count rate has been described. Making use of identification and rejection of events, accompanied by pile-up, allowed to increase permissible count rates by an order of magnitude. The results of energy dependence of signal amplitude and shape relative anisotropy in stilbene in the range 4-10 and 2-8 MeV respectively have been presented. Taking into account anisotropy of the detector-scintillation properties allowed to improve particle discrimination. (Auth.)
Graphene oxide catalyzed cis-trans isomerization of azobenzene
Directory of Open Access Journals (Sweden)
Dongha Shin
2014-09-01
Full Text Available We report the fast cis-trans isomerization of an amine-substituted azobenzene catalyzed by graphene oxide (GO, where the amine functionality facilitates the charge transfer from azobenzene to graphene oxide in contrast to non-substituted azobenzene. This catalytic effect was not observed in stilbene analogues, which strongly supports the existence of different isomerization pathways between azobenzene and stilbene. The graphene oxide catalyzed isomerization is expected to be useful as a new photoisomerization based sensing platform complementary to GO-based fluorescence quenching methods.
Gel-combustion-synthesized ZnO nanoparticles for visible light ...
Indian Academy of Sciences (India)
Zinc oxide nanoparticles (ZnO NPs) synthesized by the gel combustion technique using a bio-fuel, cassava starch (root tubers of Manihot esculenta), have been characterized by various techniques. The X-ray diffractionpattern reveals hexagonal wurtzite structure. The particle size averaged around 45nm with an excellent ...
Exploiting hidden symmetry in natural products: total syntheses of amphidinolides C and F.
Mahapatra, Subham; Carter, Rich G
2013-07-24
The total synthesis of amphidinolide C and a second-generation synthesis of amphidinolide F have been accomplished through the use of a common intermediate to access both the C1-C8 and the C18-C25 sections. The development of a Ag-catalyzed cyclization of a propargyl benzoate diol is described to access both trans-tetrahydrofuran rings. The evolution of a Felkin-controlled, 2-lithio-1,3-dienyl addition strategy to incorporate C9-C11 diene as well as C8 stereocenter is detailed. Key controlling aspects in the sulfone alkylation/oxidative desulfurization to join the major subunits, including the exploration of the optimum masking group for the C18 carbonyl motif, are discussed. A Trost asymmetric alkynylation and a stereoselective cuprate addition to an alkynoate have been developed for the rapid construction of the C26-C34 subunit. A Tamura/Vedejs olefination to introduce the C26 side arm of amphidnolides C and F is employed. The late-stage incorporation of the C15, C18 diketone motif proved critical to the successful competition of the total syntheses.
Rosa, Fernanda R; Arruda, Andréa F; Siqueira, Egle M A; Arruda, Sandra F
2016-02-23
This study identified major phenolic compounds of the tucum-do-cerrado (Bactris setosa) peel, as well as antioxidant activity and total phytochemical compound concentration of different extracts of the peel and pulp of this fruit. Phenolic compounds of the different extracts of tucum-do-cerrado peel were identified and quantified using a high-performance liquid chromatography system coupled to a diode array detector (DAD). Total phytochemical compound content was determined by spectrophotometric assays and the antioxidant activity by ferric reducing antioxidant power and β-carotene/linoleic assays. Total phenolic, flavanols, total anthocyanins and yellow flavonoids concentration of tucum-do-cerrado were 122-, 14-, 264- and 61-fold higher in the peel than in the pulp, respectively. The aqueous, methanolic and ethanolic extracts of the tucum-do-cerrado peel exhibited higher antioxidant activity compared to its pulp. Flavanols, anthocyanins, flavones, phenolic acids and stilbenes were the main phenolic classes identified in the tucum-do-cerrado peel extracts. Results suggest that the antioxidant capacity and the phytochemical compound content of the tucum-do-cerrado are mainly associated with the peel. Although flavonoids are the main compounds identified in tucum-do-cerrado peel, other phenolics identified in minor amounts, such as phenolic acids and stilbenes, may be responsible for the high antioxidant capacity of the fruit.
Rosa, Fernanda R.; Arruda, Andréa F.; Siqueira, Egle M. A.; Arruda, Sandra F.
2016-01-01
This study identified major phenolic compounds of the tucum-do-cerrado (Bactris setosa) peel, as well as antioxidant activity and total phytochemical compound concentration of different extracts of the peel and pulp of this fruit. Phenolic compounds of the different extracts of tucum-do-cerrado peel were identified and quantified using a high-performance liquid chromatography system coupled to a diode array detector (DAD). Total phytochemical compound content was determined by spectrophotometric assays and the antioxidant activity by ferric reducing antioxidant power and β-carotene/linoleic assays. Total phenolic, flavanols, total anthocyanins and yellow flavonoids concentration of tucum-do-cerrado were 122-, 14-, 264- and 61-fold higher in the peel than in the pulp, respectively. The aqueous, methanolic and ethanolic extracts of the tucum-do-cerrado peel exhibited higher antioxidant activity compared to its pulp. Flavanols, anthocyanins, flavones, phenolic acids and stilbenes were the main phenolic classes identified in the tucum-do-cerrado peel extracts. Results suggest that the antioxidant capacity and the phytochemical compound content of the tucum-do-cerrado are mainly associated with the peel. Although flavonoids are the main compounds identified in tucum-do-cerrado peel, other phenolics identified in minor amounts, such as phenolic acids and stilbenes, may be responsible for the high antioxidant capacity of the fruit. PMID:26907338
Simple syntheses of 3-substituted indoles and their application for high yield 14C-labelling
International Nuclear Information System (INIS)
Schallenberg, J.; Meyer, E.
1983-01-01
Methods are described which allow the synthesis of several plant indole alkaloids and their metabolites at different scales. Compounds synthesized include gramine (1) (3-dimethylaminomethylindole) which is directly derived from indole, while its biosynthetic precursors 3-aminomethylindole (3) and 3-methylaminomethylindole (2) as well as indole3-carboxylic acid (7) are synthesized via indole-3-aldehyde (6). Slight changes of the experimental conditions allow syntheses with high yields not only at the molar but also at the μmolar level. This is extremely useful when isotope labelled compounds of high specific radioactivity are required for studies of plant metabolism. (orig.)
Patricia Pérez-Salinas; Gabriel Jaramillo-Soto; Alberto Rosas-Aburto; Humberto Vázquez-Torres; María Josefa Bernad-Bernad; Ángel Licea-Claverie; Eduardo Vivaldo-Lima
2017-01-01
There is a debate in the literature on whether or not polymer networks synthesized by reversible deactivation radical polymerization (RDRP) processes, such as reversible addition-fragmentation radical transfer (RAFT) copolymerization of vinyl/divinyl monomers, are less heterogeneous than those synthesized by conventional free radical copolymerization (FRP). In this contribution, the syntheses by FRP and RAFT of hydrogels based on 2-hydroxyethylene methacrylate (HEMA) and ethylene glycol dimet...
hydrazines and their nickel(II) complexes: Syntheses, structures and ...
Indian Academy of Sciences (India)
G Narendra Babu
Abstract. The Schiff bases N-(acyl)-N -(ferrocenylidene)hydrazines (HFcah (1) and HFcbh (2), where acyl = acetyl in 1 and benzoyl in 2 and H represents the dissociable amide proton) were synthesized in high yields (74 and 81%) by condensation reactions of equimolar amounts of ferrocene-carboxaldehyde and the ...
International Nuclear Information System (INIS)
Suyitno; Huda, Sholiehul; Arifin, Zainal; Hadi, Syamsul; Lambang, Raymundus Lullus
2014-01-01
Zinc oxide fibres-based nanogenerators synthesized easily by electrospinning machine are promising to harvest electricity from mechanical energy. However, the repeatability and reproducibility were two major factors needed to be investigated to minimize product failure and to determine the feasibility of mass production of nanogenerators. The green fibres of zinc oxide were produced by electrospinning machine of zinc acetate and polyvinyl alcohol solution at a flow rate of 4 μL/min followed by sintering at temperature 550°C with heating rate 240°C/h. Each 10 nanogenerators was tested by three trained operators with three times of repetition at compressive load 0.5 kg. The nanogenerators revealed the maximum output voltage ranging from 203 to 217 mV. The value of repeatability and reproducibility of nanogenerators was approximately 24.29% showing that nanogenerators were still acceptable to be mass-produced. The relatively low reproducibility was mainly due to the operators, so that the checklist needed to be made easier and simpler for all the variables affecting to the quality of the fibres. Reducing the value of the repeatability and reproducibility is interesting to study further by creating a rotating collector so that the thickness and orientation of fibres can be arranged better
Influence of cooling modes on purity of solid-state synthesized tetracalcium phosphate
International Nuclear Information System (INIS)
Guo Dagang; Xu Kewei; Han Yong
2005-01-01
Pure tetracalcium phosphate powder (TTCP) was prepared by a solid-state phase reaction at 1500 deg. C. Effects of cooling modes on the synthesizing process of TTCP powder and its thermal behavior at different heating temperatures were investigated by XRD and FTIR. The results show that cooling in dry air tends to promote formation of single phase TTCP, while in situ cooling in furnace results in a mixture of hydroxyapatite (HAP) and CaO. The examination of the thermal behavior of TTCP indicates that there exists a decomposing zone in the range of 500 deg. C-1200 deg. C, in which the high-temperature synthesized TTCP phase is transformed during the subsequent cooling process. This was confirmed by three additional cooling treatment routes that provide significant experimental evidence to the cooling modes effect on the purity of TTCP. The phase transformation course of starting materials heated to elevated temperatures was further studied by TGA-DSC analysis with the aid of XRD and FTIR, in order to fully understand the complicated synthesizing process of TTCP
Directory of Open Access Journals (Sweden)
Daniel Kekrt
2012-01-01
Full Text Available This article describes the modelling and implementation of two different variants of direct frequency synthesizer, and evaluation of the performance of the finished design, in terms of memory and speed efficiency. The frequency synthesizer requirement comes from our complex radio transmission system design. The research activity has been focused on finding an optimal balance between simplicity, speed and memory consumption. The modelling was done in MATLAB environment in floating-point and fixed-point arithmetic, and the actual design was implemented and synthesized using the Xilinx ISE suite. The output has been connected to our customized radio front-end built on the Texas Instruments TRF2443 chip. The front-end output signal has been captured and compared with simulation results.
Zhu, Yang; Morisato, Kei; Hasegawa, George; Moitra, Nirmalya; Kiyomura, Tsutomu; Kurata, Hiroki; Kanamori, Kazuyoshi; Nakanishi, Kazuki
2015-08-01
The optimization of a porous structure to ensure good separation performances is always a significant issue in high-performance liquid chromatography column design. Recently we reported the homogeneous embedment of Ag nanoparticles in periodic mesoporous silica monolith and the application of such Ag nanoparticles embedded silica monolith for the high-performance liquid chromatography separation of polyaromatic hydrocarbons. However, the separation performance remains to be improved and the retention mechanism as compared with the Ag ion high-performance liquid chromatography technique still needs to be clarified. In this research, Ag nanoparticles were introduced into a macro/mesoporous silica monolith with optimized pore parameters for high-performance liquid chromatography separations. Baseline separation of benzene, naphthalene, anthracene, and pyrene was achieved with the theoretical plate number for analyte naphthalene as 36,000 m(-1). Its separation function was further extended to cis/trans isomers of aromatic compounds where cis/trans stilbenes were chosen as a benchmark. Good separation of cis/trans-stilbene with separation factor as 7 and theoretical plate number as 76,000 m(-1) for cis-stilbene was obtained. The trans isomer, however, is retained more strongly, which contradicts the long- established retention rule of Ag ion chromatography. Such behavior of Ag nanoparticles embedded in a silica column can be attributed to the differences in the molecular geometric configuration of cis/trans stilbenes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tribology of carbide derived carbon films synthesized on tungsten carbide
Tlustochowicz, Marcin
Tribologically advantageous films of carbide derived carbon (CDC) have been successfully synthesized on binderless tungsten carbide manufactured using the plasma pressure compaction (P2CRTM) technology. In order to produce the CDC films, tungsten carbide samples were reacted with chlorine containing gas mixtures at temperatures ranging from 800°C to 1000°C in a sealed tube furnace. Some of the treated samples were later dechlorinated by an 800°C hydrogenation treatment. Detailed mechanical and structural characterizations of the CDC films and sliding contact surfaces were done using a series of analytical techniques and their results were correlated with the friction and wear behavior of the CDC films in various tribosystems, including CDC-steel, CDC-WC, CDC-Si3N4 and CDC-CDC. Optimum synthesis and treatment conditions were determined for use in two specific environments: moderately humid air and dry nitrogen. It was found that CDC films first synthesized at 1000°C and then hydrogen post-treated at 800°C performed best in air with friction coefficient values as low as 0.11. However, for dry nitrogen applications, no dechlorination was necessary and both hydrogenated and as-synthesized CDC films exhibited friction coefficients of approximately 0.03. A model of tribological behavior of CDC has been proposed that takes into consideration the tribo-oxidation of counterface material, the capillary forces from adsorbed water vapor, the carbon-based tribofilm formation, and the lubrication effect of both chlorine and hydrogen.
Multiblock copolymers synthesized in aqueous dispersions using multifunctional RAFT agents
Bussels, R.; Bergman-Göttgens, C.M.; Meuldijk, J.; Koning, C.E.
2005-01-01
Triblock copolymers were synthesized in aqueous dispersions in two polymerization steps using a low molar mass difunctional dithiocarbamate-based RAFT agent, and in merely one polymerization step using a macromolecular difunctional dithiocarbamate-based RAFT agent. Segmented block copolymers
Characterization of nano-crystalline ZrO{sub 2} synthesized via reactive plasma processing
Energy Technology Data Exchange (ETDEWEB)
Jayakumar, S., E-mail: sjayakumar.physics@gmail.com [Research and Development Centre, Bharathiar University, Coimbatore 641 014 (India); Ananthapadmanabhan, P.V. [Laser and Plasma Technology Division, BARC, Trombay, Mumbai 400 085 (India); Perumal, K. [Department of Physics, Sri Ramakrishna Mission Vidyalaya College of Arts and Science, Coimbatore 641 020 India (India); Thiyagarajan, T.K. [Laser and Plasma Technology Division, BARC, Trombay, Mumbai 400 085 (India); Mishra, S.C. [Department of Metallurgical and Materials Engg, National Institute of Technology, Rourkela 769 008 (India); Su, L.T.; Tok, A.I.Y.; Guo, J. [School of Materials Science and Engg, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639 798 (Singapore)
2011-07-25
Highlights: > Direct conversion of micron-sized zirconium hydride powder to nanocrystalline ZrO{sub 2} powder. > The experimental approach uses reactive plasma processing technique. > The product has been characterized by various analytical tools to support the findings. - Abstract: Nano-crystalline ZrO{sub 2} powder has been synthesized via reactive plasma processing. The synthesized ZrO{sub 2} powders were characterized by X-ray diffraction (XRD), Raman spectroscopy, transmission electron microscopy (TEM) and FTIR spectroscopy. The synthesized powder consists of a mixture of tetragonal and monoclinic phases of zirconia. Average crystallite size calculated from the XRD pattern shows that particles with crystallite size 20 nm or less than 20 nm are in tetragonal phase, whereas particles greater than 20 nm are in the monoclinic phase. TEM results show that particles have spherical morphology with maximum percentage of particles distributed in a narrow size from about 15 nm to 30 nm.
Nanocomposite Ti-B-N coatings synthesized by reactive arc evaporation
International Nuclear Information System (INIS)
Neidhardt, Joerg; Czigany, Zsolt; Sartory, Bernhard; Tessadri, R.; O'Sullivan, Michael; Mitterer, Christian
2006-01-01
Nanocomposite Ti-B-N coatings have been prepared by reactive arc evaporation from Ti-B compound targets. The highly ionized flux of film-forming species was utilized to synthesize a promising nanocrystalline metastable supersaturated solid solution of boron in TiN at lower nitrogen fractions. The combined results from elastic recoil detection, X-ray photoelectron spectroscopy, X-ray diffraction, high-resolution transmission electron microscopy and selected area electron diffraction indicate that the additional nitrogen incorporated at higher partial pressures triggers the formation of a separate amorphous BN matrix phase surrounding the 6-8 nm sized face-centered cubic crystallites. A maximum in the hardness is obtained for the strained TiBN crystallites surrounded by a small fraction of boron synthesized at a nitrogen fraction of 0.1, while the formation of the amorphous BN phase leads to lower values
Morphology and topography study of graphene synthesized from plant oil
Robaiah, M.; Rusop, M.; Abdullah, S.; Khusaimi, Z.; Azhan, H.; Laila, M. O.; Salifairus, M. J.; Asli, N. A.
2018-05-01
The graphene is material consists of bonded atom carbon atoms in sheet form one atom thick. The different types of carbon sources which are refined corn oil, palm oil and waste cooking palm oil were used as carbon feedstock to supply carbon atom for synthesizing graphene on the nickel substrate by thermal chemical vapour deposition. The substrate and carbon sources were placed in double zone furnaces. The carbon sources and the substrate were heated at 300 °C and 900 °C respectively. The both furnaces were switched off after synthesis time for cooling process finish. The formation of the graphene on the Ni surface appears due to segregation and precipitation of a high amount of carbon from the source material during the cooling process. FESEM, AFM, UV-VIS Spectroscopy and Raman Spectroscopy were used to characterize and synthesized graphene.
Characterization and gas sensing properties of CuO synthesized by DC directly applying voltage
International Nuclear Information System (INIS)
Klinbumrung, Arrak; Thongtem, Titipun; Thongtem, Somchai
2014-01-01
Highlights: • CuO as a p-type semiconductor. • It was synthesized by directly applying voltage. • A promising material for ammonia detection. - Abstract: CuO microstructure was successfully synthesized by 50 A and 3.6 V DC directly applying voltage. Crystalline structure was characterized by X-ray diffraction (XRD), morphology by scanning and transmission electron microscopy (SEM, TEM). The sample of the 15 min processing time has an irregular shape with diameter about several hundreds of nanometer. Fourier transform infrared (FTIR) spectroscopy, ultraviolet–visible (UV–vis) absorption spectroscopy and photoluminescence (PL) were used to determine vibrational modes and optical properties of the as-synthesized samples: 529 and 585 cm −1 vibrational modes, 3.95 eV band gap, and 402 nm emitting wavelength in violet region of CuO. X-ray photoelectron (XPS) spectroscopy was used to determine chemical composition, Cu(II)O, of the metal oxide surface. Gas sensing performance exposing to NH 3 mixed with air at various working temperatures and NH 3 concentrations of the as-synthesized CuO has the best response at the optimal working temperature of 250 °C: sensitivity of 56.6% exposed to 5275 ppm NH 3
Syntheses of α and γ-tocopherols selectively labelled with deuterium
International Nuclear Information System (INIS)
Hughes, L.; Slaby, M.; Burton, G.W.; Ingold, K.U.
1990-01-01
Four deuterium-substituted α-tocopherols (dideutero-RRR, nonadeutero-ambo, nonadeutero-all-rac and undecadeutero-all-rac) and a dideutro-RRR-γ-tocopherol have been synthesized for use in studies of the biokinetics, bioavailability and metabolism of vitamin E. (author)
Alhajri, Nawal Saad
2014-01-01
Molybdenum carbide nanocrystals (Mo2C) with sizes ranging from 3 to 20 nm were synthesized within a carbon matrix starting from a mesoporous graphitic carbon nitride (mpg-C3N4) template with confined pores. A molybdenum carbide phase (Mo2C) with a hexagonal structure was formed using a novel synthetic method involving the reaction of a molybdenum precursor with the carbon residue originating from C3N4 under nitrogen at various temperatures. The synthesized nanocomposites were characterized using powder X-ray diffraction (XRD), temperature-programmed reaction with mass spectroscopy (MS), CHN elemental analyses, thermogravimetric analyses (TGA), nitrogen sorption, X-ray photoelectron spectroscopy (XPS), and transmission electron microscopy (TEM). The results indicated that the synthesized samples have different surface structures and compositions, which are accordingly expected to exhibit different electrocatalytic activities toward the hydrogen evolution reaction (HER). Electrochemical measurements demonstrated that the sample synthesized at 1323 K exhibited the highest and most stable HER current in acidic media, with an onset potential of -100 mV vs. RHE, among the samples prepared in this study. This result is attributed to the sufficiently small particle size (∼8 nm on average) and accordingly high surface area (308 m2 g-1), with less oxidized surface entrapped within the graphitized carbon matrix. © 2014 the Partner Organisations.
DEFF Research Database (Denmark)
Shen, Rui; Cai, Longwei; Meng, Dechuan
2014-01-01
Microbial synthesis of functional polymers has become increasingly important for industrial biotechnology. For the first time, it became possible to synthesize controllable composition of poly(3-hydroxyalkanoate) (P3HA) consisting of 3-hydroxydodecanoate (3HDD) and phenyl group on the side......HPhV) and 3-hydroxydodecanoate (3HDD) were synthesized when the strain was grown on mixtures of PVA and dodecanoic acid (DDA). Compositions of 3HPhV in P(3HPhV-co-3HDD) were controllable ranging from 3% to 32% depending on DDDA/PVA ratios. Nuclear magnetic resonance (NMR) spectra clearly indicated...
Neutron spectrometry with organic scintillation detector
International Nuclear Information System (INIS)
Butragueno Casado, J. L.
1972-01-01
This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D 2 (d,n)He 3 , and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs
Energy Technology Data Exchange (ETDEWEB)
Butragueno Casdo, J L
1972-07-01
This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D{sup 2}(d,n)He{sup 3}, and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs.
Ortiz, Diana; Valdés, Raquel; Sanchez, Marco A.; Hayenga, Johanna; Elya, Carolyn; Detke, Siegfried; Landfear, Scott M.
2010-01-01
Leishmania and other parasitic protozoa are unable to synthesize purines de novo and are reliant upon purine nucleoside and nucleobase transporters to import preformed purines from their hosts. To study the roles of the four purine permeases NT1-NT4 in Leishmania major, null mutants in each transporter gene were prepared and the effect of each gene deletion on purine uptake was monitored. Deletion of the NT3 purine nucleobase transporter gene or both NT3 and the NT2 nucleoside transporter gen...
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
Energy Technology Data Exchange (ETDEWEB)
Na, Ye-Seul; Yoo, Hyeonseok; Kim, Tae-Hee; Choi, Jinsub; Lee, Wan In; Choi, Sooseok, E-mail: sooseok@jejunu.ac.kr; Park, Dong-Wha, E-mail: dwpark@inha.ac.kr
2015-07-31
Lithium-ion (Li-ion) batteries are widely used in electric devices and vehicles. Silicon is a promising material for the anode of Li-ion battery due to high theoretical specific capacity. However, it shows large volume changes during charge–discharge cycles leading to the pulverization of electrode. In order to improve such disadvantage, a multiwall carbon nanotube (MWCNT) has been used with silicon as composite material. In this work, Si-MWCNT nanocomposite was prepared in thermal plasma by attaching silicon nanoparticles to MWCNT column. Electrochemical tests for raw materials and synthesized nanocomposites were carried out. The discharge capacities of silicon, MWCNT, synthesized nanocomposites collected from a reaction tube, and a chamber were 4000, 310, 200, and 1447 mAh/g, respectively. - Highlights: • Si-Multiwall carbon nanotube nanocomposite was synthesized by thermal plasma. • The effect on the collection position of product after experiment was examined. • Cycle performance of electrodes was measured. • Product collected from chamber showed good electrochemical performance.
A fully-differential phase-locked loop frequency synthesizer for 60-GHz wireless communication
International Nuclear Information System (INIS)
Kuang Lixue; Chi Baoyong; Chen Lei; Wang Zhihua; Jia Wen
2014-01-01
A 40-GHz phase-locked loop (PLL) frequency synthesizer for 60-GHz wireless communication applications is presented. The electrical characteristics of the passive components in the VCO and LO buffers are accurately extracted with an electromagnetic simulator HFSS. A differential tuning technique is utilized in the voltage controlled oscillator (VCO) to achieve higher common-mode noise rejection and better phase noise performance. The VCO and the divider chain are powered by a 1.0 V supply while the phase-frequency detector (PFD) and the charge pump (CP) are powered by a 2.5 V supply to improve the linearity. The measurement results show that the total frequency locking range of the frequency synthesizer is from 37 to 41 GHz, and the phase noise from a 40 GHz carrier is −97.2 dBc/Hz at 1 MHz offset. Implemented in 65 nm CMOS, the synthesizer consumes a DC power of 62 mW, including all the buffers. (semiconductor integrated circuits)
A fully-differential phase-locked loop frequency synthesizer for 60-GHz wireless communication
Lixue, Kuang; Baoyong, Chi; Lei, Chen; Wen, Jia; Zhihua, Wang
2014-12-01
A 40-GHz phase-locked loop (PLL) frequency synthesizer for 60-GHz wireless communication applications is presented. The electrical characteristics of the passive components in the VCO and LO buffers are accurately extracted with an electromagnetic simulator HFSS. A differential tuning technique is utilized in the voltage controlled oscillator (VCO) to achieve higher common-mode noise rejection and better phase noise performance. The VCO and the divider chain are powered by a 1.0 V supply while the phase-frequency detector (PFD) and the charge pump (CP) are powered by a 2.5 V supply to improve the linearity. The measurement results show that the total frequency locking range of the frequency synthesizer is from 37 to 41 GHz, and the phase noise from a 40 GHz carrier is -97.2 dBc/Hz at 1 MHz offset. Implemented in 65 nm CMOS, the synthesizer consumes a DC power of 62 mW, including all the buffers.
Evaluation of plant-mediated synthesized silver nanoparticles against vector mosquitoes.
Veerakumar, Kaliyan; Govindarajan, Marimuthu; Hoti, S L
2014-12-01
Diseases transmitted by blood-feeding mosquitoes, such as dengue fever, dengue hemorrhagic fever, Japanese encephalitis, malaria, and filariasis, are increasing in prevalence, particularly in tropical and subtropical zones. To control mosquitoes and mosquito-borne diseases, which have worldwide health and economic impacts, synthetic insecticide-based interventions are still necessary, particularly in situations of epidemic outbreak and sudden increases of adult mosquitoes. Green nanoparticle synthesis has been achieved using environmentally acceptable plant extract and eco-friendly reducing and capping agents. In view of the recently increased interest in developing plant origin insecticides as an alternative to chemical insecticide, in the present study, the adulticidal activity of silver nanoparticles (AgNPs) synthesized using Heliotropium indicum plant leaf extract against adults of Anopheles stephensi, Aedes aegypti, and Culex quinquefasciatus was determined. Adult mosquitoes were exposed to varying concentrations of aqueous extract of H. indicum and synthesized AgNPs for 24 h. AgNPs were rapidly synthesized using the leaf extract of H. indicum, and the formation of nanoparticles was observed within 6 h. The results recorded from UV-vis spectrum, Fourier transform infrared, X-ray diffraction, scanning electron microscopy, and transmission electron microscopy support the biosynthesis and characterization of AgNPs. The maximum efficacy was observed in synthesized AgNPs against the adult of A. stephensi (lethal dose (LD)₅₀ = 26.712 μg/mL; LD₉₀ = 49.061 μg/mL), A. aegypti (LD₅₀ = 29.626 μg/mL; LD₉₀ = 54.269 μg/mL), and C. quinquefasciatus (LD₅₀ = 32.077 μg/mL; LD₉₀ = 58.426 μg/mL), respectively. No mortality was observed in the control. These results suggest that the leaf aqueous extracts of H.indicum and green synthesis of AgNPs have the potential to be used as an ideal eco-friendly approach for the control of
A facile mechanochemical approach to synthesize Zn-Al layered double hydroxide
Energy Technology Data Exchange (ETDEWEB)
Qu, Jun, E-mail: forsjun@whut.edu.cn [School of Resources and Environmental Engineering, Wuhan University of Technology, Luoshi Road 122, Wuhan, Hubei 430070 (China); He, Xiaoman; Chen, Min; Huang, Pengwu [School of Resources and Environmental Engineering, Wuhan University of Technology, Luoshi Road 122, Wuhan, Hubei 430070 (China); Zhang, Qiwu, E-mail: zhangqw@whut.edu.cn [School of Resources and Environmental Engineering, Wuhan University of Technology, Luoshi Road 122, Wuhan, Hubei 430070 (China); Liu, Xinzhong [College of Ecological Environment and Urban Construction, Fujian University of Technology, Fuzhou 350118 (China)
2017-06-15
In this study, a mechanochemical route to synthesize Zn-Al layered double hydroxide (LDH) was introduced, in which Zn basic carbonate and Al hydroxide were first dry milled into an activated state and then agitated in water to obtain the final products. The as-prepared samples were characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), Thermogravimetry (TG) and Scanning electron microscopy (SEM). The products possessed a high crystallinity of Zn–Al LDH phase without any other impurities, proving a facile and effective preparation of Zn–Al LDH by using non-heating mechanochemical approach. - Highlights: • A non-heating mechanochemical route to synthesize Zn-Al LDH. • The products possessed high crystalline Zn-Al LDH phase. • No emission of other impurities or wastewater.
Method and apparatus for synthesizing hydrocarbons
Colmenares, C.A.; Somorjai, G.A.; Maj, J.J.
1985-04-16
A method and apparatus for synthesizing a mixture of aliphatic alcohols having five carbons or less is disclosed. An equal molar ratio of CO and H/sub 2/ gases is caused to pass through a ThO/sub 2/ catalyst having a surface area of about 80 to 125 m/sup 2//g. The catalyst further optionally includes Na ions present as substitutional cations in an amount of about 5 to 10 atom %. At a temperature of about 570 to 630/sup 0/K, and at pressures of about 20 to 50 atm, methanol and isobutanol are the predominant products and are produced in amounts of about 90 wt % of the total hydrocarbon mixture. 6 figs.
Parametric Audio Based Decoder and Music Synthesizer for Mobile Applications
Oomen, A.W.J.; Szczerba, M.Z.; Therssen, D.
2011-01-01
This paper reviews parametric audio coders and discusses novel technologies introduced in a low-complexity, low-power consumption audiodecoder and music synthesizer platform developed by the authors. Thedecoder uses parametric coding scheme based on the MPEG-4 Parametric Audio standard. In order to
Salaheldin, Hosam I.
2017-12-01
Gold nanoparticles (AuNPs) in polymeric polyacrylamide (PAAm) matrix were synthesized using conventional heating and autoclaving thermal techniques. The synthesized Au/PAAm nanocomposite was characterized using UV-vis spectroscopy and high-resolution transmission electron microscopy. The size of the synthesized particles was approximately 6.37 nm and 8.19 nm with the conventional heating and autoclaving thermal techniques, respectively. Electron diffraction x-ray spectroscopy and the Fourier transformation infrared spectroscopy were used for the composition and elemental studies, which confirmed that the Au metallic atoms were synthesized and embedded within a PAAm matrix via a coordination bond between the carbonyl (-CONH2) group and the metallic NPs. X-ray diffraction confirmed the crystalline nature of the fabricated AuNPs with face centered cubic of nanocrystals. The catalytic activity of the as-prepared Au/PAAm nanocomposite for the reduction of 4-nitrophenol to 4-aminophenol was studied in the presence of sodium borohydrate. The synthesized AuNPs had an effective catalytic activity; the smaller NPs synthesized NPs with the conventional heating technique had a higher reaction kinetic rate in comparation with those synthesized with the autoclaving technique. Therefore, the Au/PAAm nanocomposite can be widely used as an eco-friendly, non-toxic, a fast and cost-effective product to remove versatile organic pollutants such as aromatic nitro compounds.
The Mossbauer spectra of carbon nanotubes synthesize using ferrite catalyst
International Nuclear Information System (INIS)
Zhang Haiyan; Lin Jiapeng; Peng Zuxiong; Zeng Guoxun; Pang Jinshan; Chen Yiming
2009-01-01
The ferrite powder with honeycombed structure obtained by chemical combustion was used as catalyst to synthesize multi-walled carbon nanotubes by chemical vapor deposition. The magnetic components and characters of the the carbon nanotubes synthesized were investigated by X-ray diffraction (XRD), Mossbauer spectra and vibrating-sample magnetometer (VSM). The ferric components of the carbon nanotubes samples can be identified by Mossbauer spectra. The Mossbauer spectra of carbon nanotubes sample after purification contains two ferromagnetic sextet components corresponding to α-Fe species and Fe 3 C (cementite) species. While the Mossbauer spectra of the carbon nanotubes sample before purification contains three ferromagnetic sextet components corresponding to α-Fe species, Fe 3 C species and γ-Fe 2 O 3 . The saturation magnetization intensity Ms of carbon nanotubes sample after purification is decreased from 46.61 to 2.94 emu/g, but the coercive force increasd and reached 328Oe.
International Nuclear Information System (INIS)
Park, Gyung Se; Kim, Hyun Uk; Kim, Ki Moon; Lee, Gang Ho; Park, Sang Kyu
2006-01-01
A new 2-D coordination polymer has been synthesized and characterized by using a novel 4,4'-stilbene dicarboxylic acid and Co(ClO 4 ) 2 ·6H 2 O. The title complex has an unique Co 3 pin-wheel cluster in which central Co has octahedral geometry and two surrounding Co have tetrahedral geometry. The Co 3 pin-wheel clusters, the building unit, are linked through carboxylate oxygens to generate a 2-D layered coordination polymer in ABCABC packing mode. Variable-temperature magnetic susceptibility data of the title compound confirms the high spin splitting of Co with S=3/2. Syntheses of MOF by using SDA and other transition metal ions, Zn, Cd, and Mn, are on progress in this lab. Metal-organic frameworks (MOF) have attracted much more attention in the past decade owing to their various intriguing framework topologies and potential applications as functional materials in gas storage, separation, and catalysis. Because high framework stability is fundamental and essential property for many practical applications, multi-dentate linkers such as carboxylates have been extensively investigated for the formation of more rigid frameworks due to their ability to aggregate metal ions into M-O-C clusters called secondary building units (SBUs) rather than N-bound organic linkers such as 4,4-bipyridine (bipy)
International Nuclear Information System (INIS)
Wang Shuyu; Tang Wei; Wang Hui
1993-09-01
After developing a procedure for somatic embryogenesis in Fritillaria ussuriensis, dynamics on the syntheses of DNA, RNA, and protein during globular, heart-shaped, torpedo-shaped, cotyledonary, and mature somatic embryo stages was demonstrated by both autoradiography and scintillation counting. The rates of syntheses of DNA, RNA, and protein gradually increase between the globular and cotyledonary somatic embryos stages. DNA, RNA, and protein synthesis rates are in peak at the cotyledonary later stage, precotyledonary stage, and cotyledonary stage, respectively. It appears that more DNA, RNA, and protein are synthesized in the cotyledonary somatic embryo stage than in other stages. All these results indicate that an increased syntheses of DNA, RNA, and protein is associated with the differentiation of embryogenic cells and organogenesis in somatic embryos
THE INFLUENCE OF RECUPIRATION’S METHODS OF GRAPHITE TO PROPERTIES OF SYNTHESIZED DIAMONDS
Directory of Open Access Journals (Sweden)
G. P. Bogatyreva
2015-03-01
Full Text Available The graphite’s waste can be used for synthesis of diamonds. It is established, that activation of graphite’s waste essential influence on a degree of transition of graph-ite in diamond and their physico-chemical properties. The activation of th graphite’s waste changes essentially their absorption and structural characteristics and to a great extent affect the characteristics of synthesized diamond. Thermal activation of graphite’s waste leads to that are synthesized, basically, diamond micropowders, and electrochemical — diamond grinding powders.
Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA
DEFF Research Database (Denmark)
Ostergaard, P; Phan, H; Johansen, L B
1998-01-01
The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....
International Nuclear Information System (INIS)
Keefe, D.J.; McDowell, W.P.
1980-01-01
A speech synthesizer is being used to differentiate eight separate safety alarms on a high energy accelerator at Argonne National Laboratory. A single board microcomputer monitors eight signals from an existing radiation safety logic circuit. The microcomputer is programmed to output the proper code at the proper time and sequence to a speech synthesizer which supplies the audio input to a local public address system. This eliminates the requirement for eight different alarm tones and the personnel training required to differentiate among them. A twenty-word vocabulary was found adequate to supply the necessary safety announcements. The article describes the techniques used to interface the speech synthesizer into the existing safety logic circuit
Adsorption and redox reactions of heavy metals on synthesized Mn oxide minerals
International Nuclear Information System (INIS)
Feng Xionghan; Zhai Limei; Tan Wenfeng; Liu Fan; He Jizheng
2007-01-01
Several Mn oxide minerals commonly occurring in soils were synthesized by modified or optimized methods. The morphologies, structures, compositions and surface properties of the synthesized Mn oxide minerals were characterized. Adsorption and redox reactions of heavy metals on these minerals in relation to the mineral structures and surface properties were also investigated. The synthesized birnessite, todorokite, cryptomelane, and hausmannite were single-phased minerals and had the typical morphologies from analyses of XRD and TEM/ED. The PZCs of the synthesized birnessite, todorokite and cryptomelane were 1.75, 3.50 and 2.10, respectively. The magnitude order of their surface variable negative charge was: birnessite ≥ cryptomelane > todorokite. The hausmannite had a much higher PZC than others with the least surface variable negative charge. Birnessite exhibited the largest adsorption capacity on heavy metals Pb 2+ , Cu 2+ , Co 2+ , Cd 2+ and Zn 2+ , while hausmannite the smallest one. Birnessite, cryptomelane and todorokite showed the greatest adsorption capacity on Pb 2+ among the tested heavy metals. Hydration tendency (pK 1 ) of the heavy metals and the surface variable charge of the Mn minerals had significant impacts on the adsorption. The ability in Cr(III) oxidation and concomitant release of Mn 2+ varied greatly depending on the structure, composition, surface properties and crystallinity of the minerals. The maximum amounts of Cr(III) oxidized by the Mn oxide minerals in order were (mmol/kg): birnessite (1330.0) > cryptomelane (422.6) > todorokite (59.7) > hausmannite (36.6). - The characteristics of heavy metal adsorption and Cr(III) oxidation on Mn oxide minerals are determined by their structure, composition, surface property and crystallinity
International Nuclear Information System (INIS)
Bera, Anuradha; Misra, R.K.; Singh, Shailendra K.
2013-01-01
Copolymeric hydrogels of polyacrylic acid (PAA) – polyacrylonitrile (PAN) was radiolytically synthesized from their respective monomers with trimethyloltrimethacrylate (TMPTMA) as the crosslinker wherein both polymerization and crosslinking could be achieved in a single step reaction using 60 Co γ-radiation under varying doses and dose rates. The formation of the hydrogels was confirmed by their FT-IR analysis, while their thermal degradation patterns were investigated through thermogravimetric analysis in both the dry and swelled state. The water sorption studies showed rapid swelling behavior of these hydrogels, where swelling (%EWC) was found to be strongly dependent on the ratio of the two monomers in the hydrogels and the swelling kinetics dependent on the dose rates of hydrogel synthesis. These radiolytically synthesized hydrogels responded to electrical stimulus both in terms of the bending speed as well as bending angle under an applied voltage. The nature of the deformation was reversible and can be controlled through switching the voltage on and off. - Highlights: • Polyacrylic acid – polyacrilonitrile copolymeric hydrogel has been radiolytically synthesized. • Trimethyloltrimethacrylate (TMPTMA) used as crosslinker. • Hydrogel has been characterized and tested for electroresponsive character. • Bending angles and bending speed were found dependent upon applied voltage
Directory of Open Access Journals (Sweden)
Patricia Pérez-Salinas
2017-05-01
Full Text Available There is a debate in the literature on whether or not polymer networks synthesized by reversible deactivation radical polymerization (RDRP processes, such as reversible addition-fragmentation radical transfer (RAFT copolymerization of vinyl/divinyl monomers, are less heterogeneous than those synthesized by conventional free radical copolymerization (FRP. In this contribution, the syntheses by FRP and RAFT of hydrogels based on 2-hydroxyethylene methacrylate (HEMA and ethylene glycol dimethacrylate (EGDMA in supercritical carbon dioxide (scCO2, using Krytox 157 FSL as the dispersing agent, and the properties of the materials produced, are compared. The materials were characterized by differential scanning calorimetry (DSC, swelling index (SI, infrared spectroscopy (FTIR and scanning electron microscopy (SEM. Studies on ciprofloxacin loading and release rate from hydrogels were also carried out. The combined results show that the hydrogels synthesized by FRP and RAFT are significantly different, with apparently less heterogeneity present in the materials synthesized by RAFT copolymerization. A ratio of experimental (Mcexp to theoretical (Mctheo molecular weight between crosslinks was established as a quantitative tool to assess the degree of heterogeneity of a polymer network.
Bio-inspired routes for synthesizing efficient nanoscale platinum electrocatalysts
Energy Technology Data Exchange (ETDEWEB)
Cha, Jennifer N. [Univ. of California, San Diego, CA (United States); Wang, Joseph [Univ. of California, San Diego, CA (United States)
2014-08-31
The overall objective of the proposed research is to use fundamental advances in bionanotechnology to design powerful platinum nanocrystal electrocatalysts for fuel cell applications. The new economically-viable, environmentally-friendly, bottom-up biochemical synthetic strategy will produce platinum nanocrystals with tailored size, shape and crystal orientation, hence leading to a maximum electrochemical reactivity. There are five specific aims to the proposed bio-inspired strategy for synthesizing efficient electrocatalytic platinum nanocrystals: (1) isolate peptides that both selectively bind particular crystal faces of platinum and promote the nucleation and growth of particular nanocrystal morphologies, (2) pattern nanoscale 2-dimensional arrays of platinum nucleating peptides from DNA scaffolds, (3) investigate the combined use of substrate patterned peptides and soluble peptides on nanocrystal morphology and growth (4) synthesize platinum crystals on planar and large-area carbon electrode supports, and (5) perform detailed characterization of the electrocatalytic behavior as a function of catalyst size, shape and morphology. Project Description and Impact: This bio-inspired collaborative research effort will address key challenges in designing powerful electrocatalysts for fuel cell applications by employing nucleic acid scaffolds in combination with peptides to perform specific, environmentally-friendly, simultaneous bottom-up biochemical synthesis and patterned assembly of highly uniform and efficient platinum nanocrystal catalysts. Bulk synthesis of nanoparticles usually produces a range of sizes, accessible catalytic sites, crystal morphologies, and orientations, all of which lead to inconsistent catalytic activities. In contrast, biological systems routinely demonstrate exquisite control over inorganic syntheses at neutral pH and ambient temperature and pressures. Because the orientation and arrangement of the templating biomolecules can be precisely
Directory of Open Access Journals (Sweden)
Piotr Gołek
2011-01-01
Full Text Available The aim of this study is to describe the adhesive capability of Lactobacillus fermenti 126 and Lactobacillus rhamnosus CCM 1825 as well as to isolate and evaluate the functional properties of their synthesized biosurfactants. Fourier transform infrared spectroscopy shows that both crude biosurfactants contain three components: protein, polysaccharide and phosphate in different ratio. The crude biosurfactants synthesized by Lactobacillus fermenti 126 and Lactobacillus rhamnosus CCM 1825 contain 8 and 9 fractions analyzed by capillary gel electrophoresis. Lactobacillus fermenti 126 and Lactobacillus rhamnosus CCM 1825 strains used in this study synthesize biosurfactants with low effectiveness, critical micelle concentration of 9.0 and 6.0 g/L, and surface tension of (45.1±0.1 and (43.6±0.6 mN/m, respectively. Biosurfactant synthesized by Lactobacillus rhamnosus CCM 1825 demonstrated higher emulsifying and froth-forming activity than that obtained from Lactobacillus fermenti 126, which resulted in better antiadhesive properties. The advantageous adhesive properties of these Lactobacillus strains were confirmed. A positive effect of the impregnation of polystyrene surface with an aqueous solution of biosurfactants on the inhibition of adhesion of Escherichia coli 22, Klebsiella pneumoniae 2 and Pseudomonas aeruginosa W2 to the impregnated surface was found.
Characterization and gas sensing properties of CuO synthesized by DC directly applying voltage
Energy Technology Data Exchange (ETDEWEB)
Klinbumrung, Arrak [Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thongtem, Titipun [Department of Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Materials Science Research Center, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thongtem, Somchai, E-mail: schthongtem@yahoo.com [Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Materials Science Research Center, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2014-09-15
Highlights: • CuO as a p-type semiconductor. • It was synthesized by directly applying voltage. • A promising material for ammonia detection. - Abstract: CuO microstructure was successfully synthesized by 50 A and 3.6 V DC directly applying voltage. Crystalline structure was characterized by X-ray diffraction (XRD), morphology by scanning and transmission electron microscopy (SEM, TEM). The sample of the 15 min processing time has an irregular shape with diameter about several hundreds of nanometer. Fourier transform infrared (FTIR) spectroscopy, ultraviolet–visible (UV–vis) absorption spectroscopy and photoluminescence (PL) were used to determine vibrational modes and optical properties of the as-synthesized samples: 529 and 585 cm{sup −1} vibrational modes, 3.95 eV band gap, and 402 nm emitting wavelength in violet region of CuO. X-ray photoelectron (XPS) spectroscopy was used to determine chemical composition, Cu(II)O, of the metal oxide surface. Gas sensing performance exposing to NH{sub 3} mixed with air at various working temperatures and NH{sub 3} concentrations of the as-synthesized CuO has the best response at the optimal working temperature of 250 °C: sensitivity of 56.6% exposed to 5275 ppm NH{sub 3}.
Selective Oxidation Using Flame Aerosol Synthesized Iron and Vanadium-Doped Nano-TiO2
Directory of Open Access Journals (Sweden)
Zhong-Min Wang
2011-01-01
Full Text Available Selective photocatalytic oxidation of 1-phenyl ethanol to acetophenone using titanium dioxide (TiO2 raw and doped with Fe or V, prepared by flame aerosol deposition method, was investigated. The effects of metal doping on crystal phase and morphology of the synthesized nanostructured TiO2 were analyzed using XRD, TEM, Raman spectroscopy, and BET nitrogen adsorbed surface area measurement. The increase in the concentration of V and Fe reduced the crystalline structure and the anatase-to-rutile ratios of the synthesized TiO2. Synthesized TiO2 became fine amorphous powder as the Fe and V concentrations were increased to 3 and 5%, respectively. Doping V and Fe to TiO2 synthesized by the flame aerosol increased photocatalytic activity by 6 folds and 2.5 folds, respectively, compared to that of pure TiO2. It was found that an optimal doping concentration for Fe and V were 0.5% and 3%, respectively. The type and concentration of the metal dopants and the method used to add the dopant to the TiO2 are critical parameters for enhancing the activity of the resulting photocatalyst. The effects of solvents on the photocatalytic reaction were also investigated by using both water and acetonitrile as the reaction medium.
Energy Technology Data Exchange (ETDEWEB)
Gholami, Mehrdad, E-mail: mehrdad897@um.edu.my [Department of Chemistry, University of Malaya, Kuala Lumpur 50603 (Malaysia); Department of Chemistry, Marvdasht Branch, Islamic Azad University, P.O. Box 465, Marvdasht (Iran, Islamic Republic of); Nia, Pooria Moozarm, E-mail: pooriamn@yahoo.com [Department of Chemistry, University of Malaya, Kuala Lumpur 50603 (Malaysia); Alias, Yatimah, E-mail: yatimah70@um.edu.my [Department of Chemistry, University of Malaya, Kuala Lumpur 50603 (Malaysia)
2015-12-01
Graphical abstract: - Highlights: • The (Py–co-FPy) copolymer was synthesized electrochemically. • This copolymer has 1.6 times higher surface coverage compared to polypyrrole. • This copolymer showed 2.5 times lower resistance compared to polypyrrole. • The conjugated structure between Py and FPy causes enhancement of conductivity. • This conducting copolymer has a strong potential to be used in various applications. - Abstract: A direct electrochemical copolymerization of pyrrole–formyl pyrrole (Py–co-FPy) was carried out by oxidative copolymerization of formyl pyrrole and pyrrole in LiClO{sub 4} aqueous solution through galvanostatic method. The (Py–co-FPy) copolymer was characterized using Fourier-transform infrared spectroscopy (FT-IR), field emission scanning electron microscope (FESEM), energy-filtering transmission electron microscope (EFTEM), thermal gravimetric analysis (TGA), X-ray photoelectron spectroscopy (XPS), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The FESEM images showed that the synthesized copolymer had a hollow whelk-like helixes structure, which justifies the enhancement of charge transportation through the copolymer film. Cyclic voltammetry studies revealed that the electrocatalytic activity of synthesized copolymer has improved and the surface coverage in copolymer enhanced 1.6 times compared to polypyrrole alone. Besides, (Py–co-FPy) copolymer showed 2.5 times lower electrochemical charge transfer resistance (R{sub ct}) value in impedance spectroscopy. Therefore, this copolymer has a strong potential to be used in several applications such as sensor applications.
Cytotoxic Effect on Cancerous Cell Lines by Biologically Synthesized Silver Nanoparticles
Directory of Open Access Journals (Sweden)
Balaji Kulandaivelu
Full Text Available The biosynthesis of nanoparticles has been proposed as an environmental friendly and cost effective alternative to chemical and physical methods. Silver nanoparticles are biologically synthesized and characterized were used in the study. The invitro cytotoxic effect of biologically synthesized silver nanoparticles against MCF-7 cancer cell lines were assessed. The cytotoxic effects of the silver nanoparticles could significantly inhibited MCF-7 cancer cell lines proliferation in a time and concentration-dependent manner by MTT assay. Acridine orange, ethidium bromide (AO/EB dual staining, caspase-3 and DNA fragmentation assays were carried out using various concentrations of silver nanoparticles ranging from 1 to 100 μg/mL. At 100 μg/mL concentration, the silver nanoparticles exhibited significant cytotoxic effects and the apoptotic features were confirmed through caspase-3 activation and DNA fragmentation assays. Western blot analysis has revealed that nanoparticle was able to induce cytochrome c release from the mitochondria, which was initiated by the inhibition of Bcl-2 and activation of Bax. Thus, the results of the present study indicate that biologically synthesized silver nanoparticles might be used to treat breast cancer. The present studies suggest that these nanoparticles could be a new potential adjuvant chemotherapeutic and chemo preventive agent against cytotoxic cells. However, it necessitates clinical studies to ascertain their potential as anticancer agents.
Lokina, S.; Suresh, R.; Giribabu, K.; Stephen, A.; Lakshmi Sundaram, R.; Narayanan, V.
2014-08-01
The gold nanoparticles (AuNPs) were synthesized by using naturally available Punica Granatum fruit extract as reducing and stabilizing agent. The biosynthesized AuNPs was characterized by using UV-Vis, fluorescence, high resolution transmission electron microscopy (HRTEM), X-ray diffraction (XRD), Fourier transform infrared (FTIR) and thermogravimetric (TGA) analysis. The surface plasmon resonance (SPR) band at 585 nm confirmed the reduction of auric chloride to AuNPs. The crystalline nature of the biosynthesized AuNPs was confirmed from the HRTEM images, XRD and selected area electron diffraction (SAED) pattern. The HRTEM images showed the mixture of triangular and spherical-like AuNPs having size between 5 and 20 nm. The weight loss of the AuNPs was measured by TGA as a function of temperature under a controlled atmosphere. The biomolecules are responsible for the reduction of AuCl4- ions and the formation of stable AuNPs which was confirmed by FTIR measurement. The synthesized AuNPs showed an excellent antibacterial activity against Candida albicans (ATCC 90028), Aspergillus flavus (ATCC 10124), Staphylococcus aureus (ATCC 25175), Salmonella typhi (ATCC 14028) and Vibrio cholerae (ATCC 14033). The minimum inhibitory concentration (MIC) of AuNPs was recorded against various microorganisms. Further, the synthesized AuNPs shows an excellent cytotoxic result against HeLa cancer cell lines at different concentrations.
Rana, Deepti; Wang, Xiumei; Webster, Thomas J; Ramalingam, Murugan
2018-06-01
Nano hydroxyapatite (nHAp) mimics the inorganic phase of hard tissue such as bone and teeth and, thus, has a wide range of clinical applications. The present study reports on the biomimetic synthesis of nHAp with and without Tris-buffered simulated body fluid (SBF) and investigated the role of buffering conditions on nHAp formation. The hypothesis of this study was that the nucleation and growth rate of nHAp may depend on buffering conditions during the precipitation process. The results of this study suggest that both of the above methods effectively synthesized carbonated "bone-like" nHAp. However, an increased incubation period of 8 hrs was necessary for nHAp synthesized using non Tris-buffered SBF as compared to Tris-buffered SBF which synthesized nHAp in just 3 hrs. Interestingly, there was no change in the chemical functionality for both samples. XRD and TGA analysis confirmed that Tris-buffered SBF facilitated more carbonate ion substitution than the non-Tris-buffered SBF approach. Therefore, this study concluded for the first time that the addition of Tris in SBF accelerates nHAp formation with more carbonate ion substitution. Nevertheless, carbonate ion substituted nHAp could also be synthesized using non Tris-buffered SBF, but would require longer incubation periods. This analysis highlights the importance of pH stability in the SBF for biomimetic nHAp synthesis which is useful for the synthesis of nHAp for a wide range of biomedical applications.
Samrot, Antony V.; Justin, C.; Padmanaban, S.; Burman, Ujjala
2017-02-01
Most look into the benefits of the nanoparticles, but keeping aside the benefits; this study focuses on the impacts of nanoparticles on living systems. Improper disposal of nanoparticles into the environment is a subject of pollution or nano-pollution which in turn affects the flora and fauna in the ecosystem, particularly soil ecosystem. Thus, this study was done to understand the impacts of chemically synthesized magnetite nanoparticles on earthworm— Eudrilus eugeniae, a soil-dependent organism which acquires food and nutrition from decaying matters. The chemically synthesized magnetite nanoparticles were characterized by UV-visible spectrophotometry, Fourier transform infrared spectroscopy and field emission scanning electron microscopy. Earthworms were allowed to interact with different concentrations of synthesized nanoparticles and the effect of the nanoparticles was analysed by studying the phenotypic changes followed by histology and inductively coupled plasma optical emission spectrometry analyses.
Babu, Keshak; Pal, Nilanjan; Bera, Achinta; Saxena, V. K.; Mandal, Ajay
2015-10-01
New synthesized polymeric surfactants have immensely attracted the researchers for further development of chemical enhanced oil recovery method particularly in surfactant flooding. Contact angle and interfacial tension measurement tests are the effective ways to identify proper chemicals/surfactants for enhanced oil recovery by chemical/surfactant flooding. In the present study a new polymeric surfactant was synthesized from pre-synthesized sodium methyl ester sulfonate (surfactant) and acrylamide for application in chemical enhanced oil recovery. The synthesized surfactant and polymeric surfactant were used to measure interfacial tension between their aqueous phase and crude oil phase to investigate the efficiency of the surfactants in reduction of interfacial tension. The synthesized polymeric surfactant has also ability to control the mobility because of its viscous nature in aqueous solution. Contact angles of solid-crude oil-surfactant interface were also measured to study the effect of the synthesized surfactant and polymeric surfactant on wettability alteration mechanism. Synergistic effect was studied by using NaCl and synthesized surfactants on interfacial tension. Dynamic interfacial tensions of the surfactant and polymeric surfactant solutions with crude oil were measured at different NaCl concentrations. Interfacial tension was found to be lowered up to 10-2 to 10-3 mN/m which is effective for oil recovery. Measurement of contact angle indicates the wettability change of the quartz surface. Comparative studies on efficiencies of synthesized sodium methyl ester sulfonate surfactant and polymeric surfactant were also carried out with respect to interfacial tension reduction and contact angle change.
Hybrid metal organic scintillator materials system and particle detector
Bauer, Christina A.; Allendorf, Mark D.; Doty, F. Patrick; Simmons, Blake A.
2011-07-26
We describe the preparation and characterization of two zinc hybrid luminescent structures based on the flexible and emissive linker molecule, trans-(4-R,4'-R') stilbene, where R and R' are mono- or poly-coordinating groups, which retain their luminescence within these solid materials. For example, reaction of trans-4,4'-stilbenedicarboxylic acid and zinc nitrate in the solvent dimethylformamide (DMF) yielded a dense 2-D network featuring zinc in both octahedral and tetrahedral coordination environments connected by trans-stilbene links. Similar reaction in diethylformamide (DEF) at higher temperatures resulted in a porous, 3-D framework structure consisting of two interpenetrating cubic lattices, each featuring basic to zinc carboxylate vertices joined by trans-stilbene, analogous to the isoreticular MOF (IRMOF) series. We demonstrate that the optical properties of both embodiments correlate directly with the local ligand environments observed in the crystal structures. We further demonstrate that these materials produce high luminescent response to proton radiation and high radiation tolerance relative to prior scintillators. These features can be used to create sophisticated scintillating detection sensors.
Magnetic zeolites a and p synthesized from kaolin: synthesis and characterization
Energy Technology Data Exchange (ETDEWEB)
Bessa, R.A.; Oliveira, C.P.; Nascimento, R.F.; Bohn, F.; Loiola, A.R. [Universidade Federal do Ceara (UFCE), CE (Brazil)
2016-07-01
Full text: Zeolites are hydrated aluminosilicates of open chain, formed by silica and alumina tetrahedral structures linked by common oxygen atoms, generating interconnected pores and cages with molecular dimensions and well defined sizes that limit matter transference between internal surface and application medium. They can be found naturally or synthesized using different aluminum and silicon sources that may modify the produced zeolite. Their industrial application has grown enormously over the last century. However, a big issue that still remains is the difficulty in retrieving zeolite powders when used in aqueous media. This work reports the use of kaolin as an alternative raw material for zeolite syntheses by means of hydrothermal route and subsequent preparation of magnetic composites through magnetite impregnation. The syntheses of two different zeolites were carried out by mixing appropriate amounts of metakaolin (kaolin previously calcined at 600 deg C for 2 h), sodium metasilicate and sodium hydroxide solution, aged for 18 h and heated at 100 °C for 4-48 h. After these processes, the final materials were washed several times with distilled water, filtered and dried at 80 deg C for 12 h. Magnetic composites were prepared by impregnating the zeolites with of Fe3O4 nanoparticles (NP) synthesized by the partial oxidation and precipitation of Fe2+ ions. The obtained materials were characterized by X-ray diffraction, scanning electron microscopy, FTIR spectroscopy and magnetization measurements. The results of XRD and FTIR provide evidence of the success in the synthesis of both zeolites A and P as well as Fe3O4. Subsequently, composites were formed by mixtures of zeolite A + NP and zeolite P + NP. The existence of secondary crystalline phases was also confirmed. However, it did not interfered significantly in the results as these phases appear as minor amounts and are most likely residues from the clay used as the main silica and alumina sources. Scanning
Annual reports in inorganic and general syntheses 1974
Niedenzu, Kurt
1975-01-01
Annual Reports in Inorganic and General Syntheses-1974 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses the chemistry of simple and complex metal hydrides of main groups I, II, and III, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, lead, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens, and pseudohalogens. The text also describes the chemistry of scandium, yttrium, lanthanides, actinides, titanium, zirconium, hafnium, vanadium, niobium, tantalum, chromium, molybdenum, tungsten, ma
Total syntheses of Prelactone V and Prelactone B.
Raghavendra, S; Tadiparthi, Krishnaji; Yadav, J S
2017-04-10
The total syntheses of natural products Prelactone-V and Prelactone-B have been accomplished by a novel Chiron approach starting from d-glucose. The synthesis involves isopropylidene acetal formation of d-glucose using Poly(4-vinylpyridine) supported iodine as a catalyst, Tebbe olefination, Grignard reaction, Wittig olefination, selective mono deprotection of acetal using PMA/SiO 2 , hydrogenation and anti-1,3-diol formation are as key steps. Copyright © 2017 Elsevier Ltd. All rights reserved.
Annual reports in inorganic and general syntheses 1972
Niedenzu, Kurt
1973-01-01
Annual Reports in Inorganic and General Syntheses-1972 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses alkali and alkaline earth elements, alloys, silver, gold, zinc, cadmium, mercury, boron, aluminum, gallium, indium, thallium, yttrium, scandium, lanthanides, actinides, titanium, zirconium, hafnium, Group V and VI transition elements, manganese, technetium, rhenium, iron, cobalt, nickel, ruthenium, osmium, rhodium, and iridium. The text also describes the chemistry of palladium, platinum, silicon, germanium, tin,
Interaction Studies between Newly Synthesized Photosensitive Polymer and Ionic Liquids
Directory of Open Access Journals (Sweden)
In Tae Kim
2015-01-01
Full Text Available In this information age, different kinds of photosensitive materials have been used in the manufacture of information storage devices. But these photosensitive materials have the bane of low diffraction efficiency. In order to solve this problem, we have synthesized a novel photosensitive polymer from epoxy-based azopolymers (with three types of azochromophores. Furthermore, we have studied the interaction between this newly synthesized azopolymer and ionic liquids (ILs. For this purpose, we have used the ammonium and imidazolium families of ILs, such as diethylammonium dihydrogen phosphate (DEAP, tributylammonium methyl sulfate (TBMS, triethylammonium 4-aminotoluene-3-sulfonic acid (TASA, and 1-methylimidazolium chloride ([Mim]Cl. To investigate the molecular interaction between azopolymer and ILs, we have used the following spectroscopic methods of analysis: UV-visible spectroscopy, photoluminescence (PL spectroscopy, Fourier transformed infrared spectroscopy (FT-IR, and confocal Raman spectroscopy. In this study, we have developed new photosensitive materials by combining polymer with ILs.
Two step continuous method to synthesize colloidal spheroid gold nanorods.
Chandra, S; Doran, J; McCormack, S J
2015-12-01
This research investigated a two-step continuous process to synthesize colloidal suspension of spheroid gold nanorods. In the first step; gold precursor was reduced to seed-like particles in the presence of polyvinylpyrrolidone and ascorbic acid. In continuous second step; silver nitrate and alkaline sodium hydroxide produced various shape and size Au nanoparticles. The shape was manipulated through weight ratio of ascorbic acid to silver nitrate by varying silver nitrate concentration. The specific weight ratio of 1.35-1.75 grew spheroid gold nanorods of aspect ratio ∼1.85 to ∼2.2. Lower weight ratio of 0.5-1.1 formed spherical nanoparticle. The alkaline medium increased the yield of gold nanorods and reduced reaction time at room temperature. The synthesized gold nanorods retained their shape and size in ethanol. The surface plasmon resonance was red shifted by ∼5 nm due to higher refractive index of ethanol than water. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Krzysztof Regulski
Full Text Available Peptidoglycan (PG is the major component of Gram positive bacteria cell wall and is essential for bacterial integrity and shape. Bacteria synthesize PG hydrolases (PGHs which are able to cleave bonds in their own PG and play major roles in PG remodelling required for bacterial growth and division. Our aim was to identify the main PGHs in Lactobacillus casei BL23, a lactic acid bacterium with probiotic properties.The PGH complement was first identified in silico by amino acid sequence similarity searches of the BL23 genome sequence. Thirteen PGHs were detected with different predicted hydrolytic specificities. Transcription of the genes was confirmed by RT-PCR. A proteomic analysis combining the use of SDS-PAGE and LC-MS/MS revealed the main seven PGHs synthesized during growth of L. casei BL23. Among these PGHs, LCABL_02770 (renamed Lc-p75 was identified as the major one. This protein is the homolog of p75 (Msp1 major secreted protein of Lactobacillus rhamnosus GG, which was shown to promote survival and growth of intestinal epithelial cells. We identified its hydrolytic specificity on PG and showed that it is a γ-D-glutamyl-L-lysyl-endopeptidase. It has a marked specificity towards PG tetrapeptide chains versus tripeptide chains and for oligomers rather than monomers. Immunofluorescence experiments demonstrated that Lc-p75 localizes at cell septa in agreement with its role in daughter cell separation. It is also secreted under an active form as detected in zymogram. Comparison of the muropeptide profiles of wild type and Lc-p75-negative mutant revealed a decrease of the amount of disaccharide-dipeptide in the mutant PG in agreement with Lc-p75 activity. As a conclusion, Lc-p75 is the major L. casei BL23 PGH with endopeptidase specificity and a key role in daughter cell separation. Further studies will aim at investigating the role of Lc-p75 in the anti-inflammatory potential of L. casei BL23.
Regulski, Krzysztof; Courtin, Pascal; Meyrand, Mickael; Claes, Ingmar J J; Lebeer, Sarah; Vanderleyden, Jos; Hols, Pascal; Guillot, Alain; Chapot-Chartier, Marie-Pierre
2012-01-01
Peptidoglycan (PG) is the major component of Gram positive bacteria cell wall and is essential for bacterial integrity and shape. Bacteria synthesize PG hydrolases (PGHs) which are able to cleave bonds in their own PG and play major roles in PG remodelling required for bacterial growth and division. Our aim was to identify the main PGHs in Lactobacillus casei BL23, a lactic acid bacterium with probiotic properties.The PGH complement was first identified in silico by amino acid sequence similarity searches of the BL23 genome sequence. Thirteen PGHs were detected with different predicted hydrolytic specificities. Transcription of the genes was confirmed by RT-PCR. A proteomic analysis combining the use of SDS-PAGE and LC-MS/MS revealed the main seven PGHs synthesized during growth of L. casei BL23. Among these PGHs, LCABL_02770 (renamed Lc-p75) was identified as the major one. This protein is the homolog of p75 (Msp1) major secreted protein of Lactobacillus rhamnosus GG, which was shown to promote survival and growth of intestinal epithelial cells. We identified its hydrolytic specificity on PG and showed that it is a γ-D-glutamyl-L-lysyl-endopeptidase. It has a marked specificity towards PG tetrapeptide chains versus tripeptide chains and for oligomers rather than monomers. Immunofluorescence experiments demonstrated that Lc-p75 localizes at cell septa in agreement with its role in daughter cell separation. It is also secreted under an active form as detected in zymogram. Comparison of the muropeptide profiles of wild type and Lc-p75-negative mutant revealed a decrease of the amount of disaccharide-dipeptide in the mutant PG in agreement with Lc-p75 activity. As a conclusion, Lc-p75 is the major L. casei BL23 PGH with endopeptidase specificity and a key role in daughter cell separation. Further studies will aim at investigating the role of Lc-p75 in the anti-inflammatory potential of L. casei BL23.
Biocompatibility of poly allylamine synthesized by plasma
International Nuclear Information System (INIS)
Colin, E.; Enriquez, M.A.; Olayo, M.G.; Cruz, G.J.; Morales, J.; Olayo, R.
2007-01-01
A study of the electric and hydrophilic properties of poly allylamine (PAI) synthesized by plasma whose structure contains N-H, C-H, C-O and O-H bonds is presented, that promote the biocompatibility with the human body. To study the PAI hydrolytic affinity, solutions of salt concentration similar to those of the human body were used. The results indicate that the solutions modify the charge balance in the surfaces reducing the hydrophobicity in the poly allylamine whose contact angle oscillates among 10 and 16 degrees and the liquid-solid surface tension between 4 and 8 dina/cm. (Author)
The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme
Diaz-Sanchez, V.; F. Estrada, A.; Limon, M. C.; Al-Babili, Salim; Avalos, J.
2013-01-01
The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.
The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme
Diaz-Sanchez, V.
2013-07-26
The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.
Antibacterial activity of magnetic iron oxide nanoparticles synthesized by laser ablation in liquid
International Nuclear Information System (INIS)
Ismail, Raid A.; Sulaiman, Ghassan M.; Abdulrahman, Safa A.; Marzoog, Thorria R.
2015-01-01
In this study, (50–110 nm) magnetic iron oxide (α-Fe 2 O 3 ) nanoparticles were synthesized by pulsed laser ablation of iron target in dimethylformamide (DMF) and sodium dodecyl sulfate (SDS) solutions. The structural properties of the synthesized nanoparticles were investigated by using Fourier Transform Infrared (FT-IR) spectroscopy, UV–VIS absorption, scanning electron microscopy (SEM), atomic force microscopy (AFM), and X-ray diffraction (XRD). The effect of laser fluence on the characteristics of these nanoparticles was studied. Antibacterial activities of iron oxide nanoparticles were tested against Gram-positive; Staphylococcus aureus and Gram-negative; Escherichia coli, Pseudomonas aeruginosa and Serratia marcescens. The results showed a noteworthy inhibition on both bacterial strains. The preparation conditions were found to affect significantly the antibacterial activity of these nanoparticles. The synthesized magnetic nanoparticles were used to capture rapidly S. aureus bacteria under the magnetic field effect. - Highlights: • Synthesis magnetic iron oxide nanoparticles by pulsed laser ablation • Antibacterial activity against Gram-positive and Gram-negative bacteria • Captured magnetic nanoparticles by S. aureus bacteria under effect of magnetic field
Antibacterial activity of magnetic iron oxide nanoparticles synthesized by laser ablation in liquid
Energy Technology Data Exchange (ETDEWEB)
Ismail, Raid A., E-mail: raidismail@yahoo.com [Laser Physics Division, Applied Science Department, University of Technology, Baghdad (Iraq); Sulaiman, Ghassan M. [Biotechnology Division, Applied Science Department, University of Technology, Baghdad (Iraq); Abdulrahman, Safa A. [Laser Physics Division, Applied Science Department, University of Technology, Baghdad (Iraq); Marzoog, Thorria R. [Biotechnology Division, Applied Science Department, University of Technology, Baghdad (Iraq)
2015-08-01
In this study, (50–110 nm) magnetic iron oxide (α-Fe{sub 2}O{sub 3}) nanoparticles were synthesized by pulsed laser ablation of iron target in dimethylformamide (DMF) and sodium dodecyl sulfate (SDS) solutions. The structural properties of the synthesized nanoparticles were investigated by using Fourier Transform Infrared (FT-IR) spectroscopy, UV–VIS absorption, scanning electron microscopy (SEM), atomic force microscopy (AFM), and X-ray diffraction (XRD). The effect of laser fluence on the characteristics of these nanoparticles was studied. Antibacterial activities of iron oxide nanoparticles were tested against Gram-positive; Staphylococcus aureus and Gram-negative; Escherichia coli, Pseudomonas aeruginosa and Serratia marcescens. The results showed a noteworthy inhibition on both bacterial strains. The preparation conditions were found to affect significantly the antibacterial activity of these nanoparticles. The synthesized magnetic nanoparticles were used to capture rapidly S. aureus bacteria under the magnetic field effect. - Highlights: • Synthesis magnetic iron oxide nanoparticles by pulsed laser ablation • Antibacterial activity against Gram-positive and Gram-negative bacteria • Captured magnetic nanoparticles by S. aureus bacteria under effect of magnetic field.
Investigation of formation constant of complex of a new synthesized ...
African Journals Online (AJOL)
The complex formation between a newly synthesized tripodal ligand and the cation Cu2+ in water and surfactant media was studied spectrophotometrically using rank annihilation factor analysis (RAFA). According to molar ratio data the stoichiometry of complexation between the ligand and the cation Cu2+ was 1:1.
Singh, Priyanka; Kim, Yeon Ju; Wang, Chao; Mathiyalagan, Ramya; El-Agamy Farh, Mohamed; Yang, Deok Chun
2016-05-01
In the present study, we report a green methodology for the synthesis of silver and gold nanoparticles, using the root extract of the herbal medicinal plant Korean red ginseng. The silver and gold nanoparticles were synthesized within 1 h and 10 min respectively. The nanoparticles generated were not aggregated, and remained stable for a long time, which suggests the nature of nanoparticles. The phytochemicals and ginsenosides present in the root extract assist in reducing and stabilizing the synthesized nanoparticles. The red ginseng root extract-generated silver nanoparticles exhibit antimicrobial activity against pathogenic microorganisms including Vibrio parahaemolyticus, Staphylococcus aureus, Bacillus cereus, and Candida albicans. In addition, the silver nanoparticles exhibit biofilm degrading activity against S. aureus and Pseudomonas aeruginosa. Thus, the present study opens up a new possibility of synthesizing silver and gold nanoparticles in a green and rapid manner using Korean red ginseng root extract, and explores their biomedical applications.
Do Biology Majors Really Differ from Non–STEM Majors?
Cotner, Sehoya; Thompson, Seth; Wright, Robin
2017-01-01
Recent calls to action urge sweeping reform in science education, advocating for improved learning for all students—including those majoring in fields beyond the sciences. However, little work has been done to characterize the differences—if any exist—between students planning a career in science and those studying other disciplines. We describe an attempt to clarify, in broad terms, how non–STEM (science, technology, engineering, and mathematics) majors differ from life sciences majors, and how they are similar. Using survey responses and institutional data, we find that non–STEM majors are not unilaterally science averse; non–STEM majors are more likely than biology majors to hold misconceptions about the nature of science, yet they are not completely ignorant of how science works; non–STEM majors are less likely than biology majors to see science as personally relevant; and non–STEM majors populations are likely to be more diverse—with respect to incoming knowledge, perceptions, backgrounds, and skills—than a biology majors population. We encourage science educators to consider these characteristics when designing curricula for future scientists or simply for a well-informed citizenry. PMID:28798210
Alternative methods of synthesizing 99Tcm-labelled ciprofloxacin
International Nuclear Information System (INIS)
Kumar, V.; Choong, K.K.L.; Evans, S.; Olma, T.R.
1999-01-01
Full text: 99 Tc m -labelled ciprofloxacin (Infecton) is a new class of radiopharmaceutical designed for imaging live bacterial infection. We synthesized Infecton by modifying the procedure described by Keith Britton's group (Lancet 1996; 347: 233-235) and reported our findings at the ANZSNM meeting last year. Since the methodology was cumbersome, we investigated simpler alternative ways of labelling ciprofloxacin with 99 Tc m -pertechnetate for routine imaging. There were several limitations in the previously described method: (1) Need to prepare pure ciprofloxacin which was unstable on storage. (2) Synthetic procedure using formimidine sulphinic acid (FSA) was complicated and required boiling step. (3) The radiochemical purity (RCP) of the product was low (45-50%) requiring purification. (4) Biodistribution studies showed a marked uptake by the liver which could interfere with scan interpretation in this region. The results of our present studies showed that Infecton could be prepared by a simple two-step method: (1) Reduce 99 Tc m -pertechnetate with stannous salt (SnCl 2 or Sn-tartrate). (2) Mix with Ciproxin IV-100. The RCP of the product was up to 98%, which obviates the need for further purification. Infecton synthesized by the above method showed avid localization in abscesses induced with Staphylococcus aureus in rats. The biodistribution studies showed that Infecton was renally excreted with minimal accumulation in the liver or other organs
International Nuclear Information System (INIS)
Khot, V.M.; Salunkhe, A.B.; Thorat, N.D.; Phadatare, M.R.; Pawar, S.H.
2013-01-01
The structural, magnetic and ac magnetically induced heating characteristics of combustion synthesized MgFe 2 O 4 nanoparticles have been investigated for application in magnetic particle hyperthermia. As prepared nanoparticles showed ferrimagnetic behavior at room temperature with magnetization of about 33.83 emu/g at ±15 kOe. The solid state MgFe 2 O 4 nanoparticles exhibited specific absorption rate (SAR) of about 297 W/g at physiological safe range of frequency and amplitude. The increase in SAR and heating temperature in ac magnetic field was thought to be due to enhancement in magnetic hysteresis loss caused by dipole–dipole interactions in combustion synthesized MgFe 2 O 4 nanoparticles. - Highlights: ► Highly crystalline pure MgFe 2 O 4 nanoparticles were synthesized by low temperature combustion. ► Effect of ac magnetic field and nanoparticles concentration on heating characteristics of MgFe 2 O 4 nanoparticles was studied. ► Combustion synthesized MgFe 2 O 4 nanoparticles show highest specific absorption rate of 297 Wg −1 . ► The reported high value of specific absorption rate is advantageous for its use in magnetic particle hyperthermia
Fast synthesize ZnO quantum dots via ultrasonic method.
Yang, Weimin; Zhang, Bing; Ding, Nan; Ding, Wenhao; Wang, Lixi; Yu, Mingxun; Zhang, Qitu
2016-05-01
Green emission ZnO quantum dots were synthesized by an ultrasonic sol-gel method. The ZnO quantum dots were synthesized in various ultrasonic temperature and time. Photoluminescence properties of these ZnO quantum dots were measured. Time-resolved photoluminescence decay spectra were also taken to discover the change of defects amount during the reaction. Both ultrasonic temperature and time could affect the type and amount of defects in ZnO quantum dots. Total defects of ZnO quantum dots decreased with the increasing of ultrasonic temperature and time. The dangling bonds defects disappeared faster than the optical defects. Types of optical defects first changed from oxygen interstitial defects to oxygen vacancy and zinc interstitial defects. Then transformed back to oxygen interstitial defects again. The sizes of ZnO quantum dots would be controlled by both ultrasonic temperature and time as well. That is, with the increasing of ultrasonic temperature and time, the sizes of ZnO quantum dots first decreased then increased. Moreover, concentrated raw materials solution brought larger sizes and more optical defects of ZnO quantum dots. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesized of 2,7 dihydroxyxanthone from xanthone and antimalarial activities
Amanatie; Jumina; Mustofa; Hanafi
2018-03-01
The purpose of the research is to synthesize 2,7-di-hydroxyxanthone compounds from xanthone and to evaluate antiplasmodial against activities. The synthesize of 2,7-di-hydroxyxanthone compounds worked with chromatogramphy methods including Thin Layer Chromatography (TLC), Vacuum Liquid Chromatography (VLC). A compound structures were determined based on the spectroscopic evidences including, Infrared (IR), one dimension (1-D) and two dimension (2-D) Nuclear Magnetic Resonance (NMR) spectra and comparison the spectroscopy data with related data from references. The biological properties of compounds are evaluated towards antiplasmodial against activity. The result of the product was obtained as white solid in 63.49% yield. The IR spectrum showed the absorption at 3433 cm-1 Which was reinforced with a sharp attack at 1087cm-1 indicating the stretching of OH, while the stretching of aromatic C=C appeared at 1620 cm-1. The 1H-NMR (500MHz, and DMSO –d6) spectrum showed that the aryl protons appeared in the region of δ12.98 ppm. In this region, there were 2 singlet at δH 12.98 ppm (1H, 2-OH) and (1H,7-OH) and shows the presence of two OH groups. Based on spectroscopy analyses, it could be started that the reaction of 2.7 di-aminoxanthone with NaNO2/HCl and H3PO4 produced 2.7-di-hydroxyxanthone. In vitro antiplasmodial assay of the product synthesized 2,7 di-hydroxyxanthones against. Falciparum strain of 3D7 showed that the IC50 values of 2,7-di-hydroxy xanthone, were 0.31 μg/mL, respectively.
Kinetics of oxygen adsorption on ZnS nanoparticles synthesized by precipitation process
Directory of Open Access Journals (Sweden)
Ahmadi Reza
2016-06-01
Full Text Available ZnS nanoparticles were synthesized through a one-step precipitation process. Effect of time and temperature on the formation reaction was investigated. The synthesized samples were characterized by X-ray diffraction (XRD, ultraviolet (UV visible absorption and photoluminescence (PL spectrophotometry. Based on XRD and UV-Vis data, the particles produced at 70 °C had a mean particle size of about 5 nm. Increasing time and temperature of the synthesis reaction resulted in photoluminescence intensification. PL spectroscopy helped understanding the adsorption kinetics of oxygen on ZnS nanoparticles during the precipitation synthesis process. Fabrication of ZnS structures with appropriate oxygen adsorption capacity was suggested as a means of PL emission intensity control.
A 6-9 GHz 5-band CMOS synthesizer for MB-OFDM UWB
International Nuclear Information System (INIS)
Chen Pufeng; Li Zhiqiang; Wang Xiaosong; Zhang Haiying; Ye Tianchun
2010-01-01
An ultra-wideband frequency synthesizer is designed to generate carrier frequencies for 5 bands distributed from 6 to 9 GHz with less than 3 ns switching time. It incorporates two phase-locked loops and one single-sideband (SSB) mixer. A 2-to-1 multiplexer with high linearity is proposed. A modified wideband SSB mixer, quadrature VCO, and layout techniques are also employed. The synthesizer is fabricated in a 0.18 μm CMOS process and operates at 1.5-1.8 V while consuming 40 mA current. The measured phase noise is -128 dBc/Hz at 10 MHz offset, and the sideband rejection is -22 dBc at 7.656 GHz.
A 6-9 GHz 5-band CMOS synthesizer for MB-OFDM UWB
Energy Technology Data Exchange (ETDEWEB)
Chen Pufeng; Li Zhiqiang; Wang Xiaosong; Zhang Haiying; Ye Tianchun, E-mail: chenpufeng@ime.ac.c [Institute of Microelectronics, Chinese Academy of Sciences, Beijing 100029 (China)
2010-07-15
An ultra-wideband frequency synthesizer is designed to generate carrier frequencies for 5 bands distributed from 6 to 9 GHz with less than 3 ns switching time. It incorporates two phase-locked loops and one single-sideband (SSB) mixer. A 2-to-1 multiplexer with high linearity is proposed. A modified wideband SSB mixer, quadrature VCO, and layout techniques are also employed. The synthesizer is fabricated in a 0.18 {mu}m CMOS process and operates at 1.5-1.8 V while consuming 40 mA current. The measured phase noise is -128 dBc/Hz at 10 MHz offset, and the sideband rejection is -22 dBc at 7.656 GHz.
Study on synthesizing Mg/Al layered double hydroxides at different pHs
Directory of Open Access Journals (Sweden)
E Otgonjargal
2014-12-01
Full Text Available Mg/Al layered double hydroxide (LDH was successfully synthesized at different pHs values. The Mg/AL LDH was well characterized by X-Ray diffraction and Fourier transform infrared analysis. The morphology of the LDH was observed using Scanning electron microscopy with energy dispersive X-ray spectroscopy. The influence of pH values on the morphology of the Mg/Al LDHs were studied. The result showed that the well-synthesized Mg/Al LDHs could be obtained when the pH value was about 10.0 at room temperature.DOI: http://doi.dx.org/10.5564/mjc.v15i0.319 Mongolian Journal of Chemistry 15 (41, 2014, p36-39
InTaO4-based nanostructures synthesized by reactive pulsed laser ablation
International Nuclear Information System (INIS)
Yoshida, Takehito; Toyoyama, Hirokazu; Umezu, Ikurou; Sugimura, Akira
2008-01-01
Nanostructured Ni-doped indium-tantalum-oxides (InTaO 4 ) were synthesized by a reactive pulsed laser ablation process, aiming at the final goal of direct splitting of water under visible sunbeam irradiation. The third harmonics beam of a Nd:YAG laser was focused onto a sintered In 0.9 Ni 0.1 TaO 4-δ target in pure oxygen background gases (0.05-1.00 Torr). Increasing the oxygen gas pressure, via thin films having nanometer-sized strong morphologies, single-crystalline nanoparticles were synthesized in the reactive vapor phases. The nanostructured deposited materials have the monoclinic layered wolframite-type structure of bulk InTaO 4 , without oxygen deficiency. (orig.)
J, Joy Sebastian Prakash; G, Vinitha; Ramachandran, Murugesan; Rajamanickam, Karunanithi
2017-10-01
Three different stabilizing agents, namely, L-cysteine, Thioglycolic acid and cysteamine hydrochloride were used to synthesize Cd(Zn)Se quantum dots (QDs). It was characterized using UV-vis spectroscopy, x-ray diffraction (XRD) and transmission electron microscopy (TEM). The non-linear optical properties (non-linear absorption and non-linear refraction) of synthesized Cd(Zn)Se quantum dots were studied with z-scan technique using diode pumped continuous wavelaser system at a wavelength of 532 nm. Our (organic) synthesized quantum dots showed optical properties similar to the inorganic materials reported elsewhere.
Directory of Open Access Journals (Sweden)
K. Khanra
2016-01-01
Full Text Available Objective(s: For the development of reliable, ecofriendly, less expensive process for the synthesis of silver nanoparticles and to evaluate the bactericidal, and cytotoxicity properties of silver nanoparticles synthesized from root extract of Croton bonplandianum, Baill. Materials and Methods: The synthesis of silver nanoparticles by plant part of Croton bonplandianum was carried out. The formation of nanoparticles was confirmed by Transmission Electron Microscopy (TEM, Scanning Electron Microscopy (SEM, XRD and UV-Vis spectrophotometric analysis. The biochemical properties were assayed by antibacterial study, cytotoxicity assay using cancer cell line. Results: The formation of silver nanoparticles was confirmed by UV-VIS spectroscopic analysis which showed absorbance peak at 425 nm. X-ray diffraction photograph indicated the face centered cubic structure of the synthesized AgNPs. TEM has displayed the different dimensional images of biogenic silver nanoparticles with particle size distribution ranging from 15-40 nm with an average size of 32 nm. Silver particles are spherical in shape, clustered. The EDX analysis was used to identify the elemental composition of synthesized AgNPs. Antibacterial activity of the synthesized AgNPs against three Gram positive and Gram negative bacteria strains like Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa carried out showed significant zones of inhibition. The cytotoxicity study by AgNPS also showed cytotoxicity on ovarian cancer cell line PA-1 and lung epithelial cancer cell line A549. Conclusion: The present study confirms that the AgNPs have great promise as antibacterial, and anticancer agent.
Annual reports in inorganic and general syntheses 1973
Niedenzu, Kurt
1974-01-01
Annual Reports in Inorganic and General Syntheses-1973 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book covers the synthetic aspects and structural or mechanistic features of elements, including the main group hydrides, alkali and alkaline earth elements, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, and lead, nitrogen, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens and pseudohalogens, and noble gases. The text also discusses the synthetic aspects and structural or mechanistic features of
Characterization and Cadmium Ion-Removing Property of Adsorbents Synthesized from Inorganic Wastes
Energy Technology Data Exchange (ETDEWEB)
Ooishi, Kou; Ogino, Kana; Nishioka, Hiroshi; Muramatsu, Yasuji, E-mail: hnisioka@eng.u-hyogo.ac.jp [Department of Material Science and Chemistry, Graduate School of Engineering, University of Hyogo, 2167 Shosha, Himeji, Hyogo (Japan)
2011-10-29
Adsorbents for removing cadmium ions from water were synthesized from inorganic wastes such as oyster shells, drinking-water-treatment sludge (DWTS), and waste glass. The oyster shells and DWTS were pretreated by heating for 2 h at 1173 K before hydrothermal synthesis was started. The Al/(Al+Si) ratio was adjusted, and then, the mixture of pretreated materials was hydrothermally treated in a sodium hydroxide solution for 72 h at 423 K to synthesize the adsorbents. The synthesized adsorbent specimens were characterized by X-ray diffraction (XRD), thermogravimetric-differential thermal analysis (TG-DTA) measurements, and scanning electron microscopy (SEM). The main components of these specimens were aluminum-substituted tobermorite and sodalite. The formation of sodalite was dependent on the mass ratio of DWTS to glass. The maximum amount of cadmium ions were removed when the mass ratio of the pretreated material was 1:1:1. In the cadmium removal test, the adsorbent with this mass ratio removed almost 100% of the cadmium in a solution with a concentration of 10 mg L-1. Even in the presence of a 1000-fold excess of potassium ions or 10000-fold excess of sodium ions, approximately 80% of the cadmium ions were removed.
Strong blue emission from ZnO nanocrystals synthesized in acetone-based solvent
International Nuclear Information System (INIS)
Efafi, B.; Majles Ara, M.H.; Mousavi, S.S.
2016-01-01
In this research, ZnO nanocrystals were synthesized by an improved sol–gel method. UV–vis, FTIR and photoluminescence spectra of the ZnO solution synthesized by this route indicated different properties compared to the other preparation methods. It was observed from FTIR that the sol (prepared using acetone) with the low concentration contains a noticeable amount of the Zn–O bond. The PL spectrum with a strong blue emission confirmed that these nanocrystals are good candidate for use in applications where a monochromatic emission is required. To the best of our knowledge, monochromatic emission ZnO devices have been fabricated through high technology instruments but this paper introduces a simple method for preparation of ZnO with the high intensity blue peak. The size and morphology of ZnO nanocrystals have been studied using FESEM. The nanocrystal size was estimated about 70 nm which was in good agreement with XRD data. - Highlights: • Preparation of ZnO nanocrystals through a novel method by the use of acetone as the solvent. • Observation of the strong blue emission peak from the ZnO prepared solution. • Reduction of green emission in the synthesized sample compared to the other methods of preparation.
Strong blue emission from ZnO nanocrystals synthesized in acetone-based solvent
Energy Technology Data Exchange (ETDEWEB)
Efafi, B. [NanoPhotonics Lab., Physics Department, Kharazmi University, Tehran (Iran, Islamic Republic of); Departments of Physics, Iran University of Science & Technology, Tehran (Iran, Islamic Republic of); Majles Ara, M.H., E-mail: majlesara@gmail.com [NanoPhotonics Lab., Physics Department, Kharazmi University, Tehran (Iran, Islamic Republic of); Mousavi, S.S. [NanoPhotonics Lab., Physics Department, Kharazmi University, Tehran (Iran, Islamic Republic of)
2016-10-15
In this research, ZnO nanocrystals were synthesized by an improved sol–gel method. UV–vis, FTIR and photoluminescence spectra of the ZnO solution synthesized by this route indicated different properties compared to the other preparation methods. It was observed from FTIR that the sol (prepared using acetone) with the low concentration contains a noticeable amount of the Zn–O bond. The PL spectrum with a strong blue emission confirmed that these nanocrystals are good candidate for use in applications where a monochromatic emission is required. To the best of our knowledge, monochromatic emission ZnO devices have been fabricated through high technology instruments but this paper introduces a simple method for preparation of ZnO with the high intensity blue peak. The size and morphology of ZnO nanocrystals have been studied using FESEM. The nanocrystal size was estimated about 70 nm which was in good agreement with XRD data. - Highlights: • Preparation of ZnO nanocrystals through a novel method by the use of acetone as the solvent. • Observation of the strong blue emission peak from the ZnO prepared solution. • Reduction of green emission in the synthesized sample compared to the other methods of preparation.
Song, Bo; Liu, Guanqing; Xu, Rui; Yin, Shouchun; Wang, Zhiqiang; Zhang, Xi
2008-04-15
This article discusses the relationship between the molecular structure of bolaamphiphiles bearing mesogenic groups and their interfacial self-organized morphology. On the basis of the molecular structures of bolaamphiphiles, we designed and synthesized a series of molecules with different hydrophobic alkyl chain lengths, hydrophilic headgroups, mesogenic groups, and connectors between the alkyl chains and the mesogenic group. Through investigating their interfacial self-organization behavior, some experiential rules are summarized: (1) An appropriate alkyl chain length is necessary to form stable surface micelles; (2) different categories of headgroups have a great effect on the interfacial self-organized morphology; (3) different types of mesogenic groups have little effect on the structure of the interfacial assembly when it is changed from biphenyl to azobenzene or stilbene; (4) the orientation of the ester linker between the mesogenic group and alkyl chain can greatly influence the interfacial self-organization behavior. It is anticipated that this line of research may be helpful for the molecular engineering of bolaamphiphiles to form tailor-made morphologies.
Studies on magnetic properties of chemically synthesized crystalline calcium ferrite nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Debnath, A., E-mail: debnathanimesh@gmail.com [Department of Civil Engineering, National Institute of Technology Agartala, Jirania, West Tripura, 799046 India (India); Bera, A.; Saha, B. [Department of Physics, National Institute of Technology Agartala, Jirania, West Tripura 799046 (India); Chattopadhyay, K. K. [Department of Physics, Jadavpur University, Kolkata 700 032 (India)
2016-05-23
Spinel-type ferrites have taken a very important role for modern electronic industry. Most of these ferrites exhibit low-loss dielectric properties, high resistivity, low eddy current and also high temperature ferromagnetism. Calcium ferrite is one such important metal oxide which is environmentally safe, chemically stable, low cost and greatly abundant. This outstanding material of calcium ferrite is synthesized by a simple chemical precipitation method using NaOH as the precipitating agent. Ferric chloride anhydrous (FeCl{sub 3}) and Calcium chloride dihydrate (CaCl{sub 2}.2H{sub 2}O) were used as iron and calcium sources respectively. The samples were heated at 200°C for 8h to obtain homogeneous powder of Calcium ferrite. The powders were characterized by using X-ray diffraction (XRD), field emission scanning electron microscope (FESEM), Transmission electrical microscopy (TEM), and Fourier transform infrared spectroscopic (FTIR) measurements. The polycrystalline nature of the sample was confirmed by X-ray diffraction study. The magnetic properties of the sample were investigated by vibrating sample magnetometer (VSM) measurements. Magnetization curve of the prepared sample depicts that as synthesized calcium ferrite nanoparticles have saturation magnetic moment of 1.74 emu/g and the coercivity of 35.08 Oe with superparamagnetic behavior. The synthesized calcium ferrite nanoparticles with such magnetic properties will be a candidate material for different applications in electronics and exploring its functionality in the field of recently developing semiconductor device physics and spintronics.
Studies on magnetic properties of chemically synthesized crystalline calcium ferrite nanoparticles
International Nuclear Information System (INIS)
Debnath, A.; Bera, A.; Saha, B.; Chattopadhyay, K. K.
2016-01-01
Spinel-type ferrites have taken a very important role for modern electronic industry. Most of these ferrites exhibit low-loss dielectric properties, high resistivity, low eddy current and also high temperature ferromagnetism. Calcium ferrite is one such important metal oxide which is environmentally safe, chemically stable, low cost and greatly abundant. This outstanding material of calcium ferrite is synthesized by a simple chemical precipitation method using NaOH as the precipitating agent. Ferric chloride anhydrous (FeCl_3) and Calcium chloride dihydrate (CaCl_2.2H_2O) were used as iron and calcium sources respectively. The samples were heated at 200°C for 8h to obtain homogeneous powder of Calcium ferrite. The powders were characterized by using X-ray diffraction (XRD), field emission scanning electron microscope (FESEM), Transmission electrical microscopy (TEM), and Fourier transform infrared spectroscopic (FTIR) measurements. The polycrystalline nature of the sample was confirmed by X-ray diffraction study. The magnetic properties of the sample were investigated by vibrating sample magnetometer (VSM) measurements. Magnetization curve of the prepared sample depicts that as synthesized calcium ferrite nanoparticles have saturation magnetic moment of 1.74 emu/g and the coercivity of 35.08 Oe with superparamagnetic behavior. The synthesized calcium ferrite nanoparticles with such magnetic properties will be a candidate material for different applications in electronics and exploring its functionality in the field of recently developing semiconductor device physics and spintronics.
Electrodeposition route to synthesize cigs films – an economical way ...
African Journals Online (AJOL)
Electrodeposition route to synthesize cigs films – an economical way to harness solar energy. ... for solar cells, how the charge separation in this nano scale photovoltaic (PV) materials occurs which help in absorption of radiation, and the electro-deposition route, a low cost one, produces thin film solar cells are analyzed.
A Critical Analysis of Global Competition in Higher Education: Synthesizing Themes
Portnoi, Laura M.; Bagley, Sylvia S.
2014-01-01
In this final chapter of the volume, the editors synthesize key themes that emerge from the preceding chapters. They also highlight the contributions the authors make through emphasizing critical perspectives and the tension between global and local forces.
Titanium nitride coatings synthesized by IPD method with eliminated current oscillations
Directory of Open Access Journals (Sweden)
Chodun Rafał
2016-09-01
Full Text Available This paper presents the effects of elimination of current oscillations within the coaxial plasma accelerator during IPD deposition process on the morphology, phase structure and properties of synthesized TiN coatings. Current observations of waveforms have been made by use of an oscilloscope. As a test material for experiments, titanium nitride TiN coatings synthesized on silicon and high-speed steel substrates were used. The coatings morphology, phase composition and wear resistance properties were determined. The character of current waveforms in the plasma accelerator electric circuit plays a crucial role during the coatings synthesis process. Elimination of the current oscillations leads to obtaining an ultrafine grained structure of titanium nitride coatings and to disappearance of the tendency to structure columnarization. The coatings obtained during processes of a non-oscillating character are distinguished by better wear-resistance properties.
Syntheses and in Vitro Antiplasmodial Activity of Aminoalkylated Chalcones and Analogues.
Wilhelm, Anke; Kendrekar, Pravin; Noreljaleel, Anwar E M; Abay, Efrem T; Bonnet, Susan L; Wiesner, Lubbe; de Kock, Carmen; Swart, Kenneth J; van der Westhuizen, Jan Hendrik
2015-08-28
A series of readily synthesized and inexpensive aminoalkylated chalcones and diarylpropane analogues (1-55) were synthesized and tested against chloroquinone-sensitive (D10 and NF54) and -resistant (Dd2 and K1) strains of Plasmodium falciparum. Hydrogenation of the enone to a diarylpropane moiety increased antiplasmodial bioactivity significantly. The influence of the structure of the amine moiety, A-ring substituents, propyl vs ethyl linker, and chloride salt formation on further enhancing antiplasmodial activity was investigated. Several compounds have IC₅₀ values similar to or better than chloroquine (CQ). The most active compound (26) had an IC₅₀ value of 0.01 μM. No signs of resistance were detected, as can be expected from compounds with structures unrelated to CQ and other currently used antimalarial drugs. Toxicity tests (in vitro CHO cell assay) gave high SI indices.
Gustini, L.; Lavilla, C.; Finzel, L.; Noordover, B.A.J.; Hendrix, M.M.R.M.; Koning, C.E.
2016-01-01
Bio-based sorbitol-containing polyester polyols were synthesized via enzymatic polycondensation. The selectivity of the biocatalyst for primary vs. secondary hydroxyl groups allowed for the preparation of close to linear renewable polyester polyols with enhanced hydroxyl functionalities, both as
Štimac, Adela; Cvitaš, Jelena TrmĿiĿ; Frkanec, Leo; Vugrek, Oliver; Frkanec, Ruža
2016-09-10
Multivalent mannosyl-lipoconjugates may be of interest for glycosylation of liposomes and targeted drug delivery because the mannose specifically binds to C-type lectin receptors on the particular cells. In this paper syntheses of two types of novel O-mannosides are presented. Conjugates 1 and 2 with a COOH- and NH2-functionalized spacer and the connection to a lysine and FmocNH-PEG-COOH, are described. The coupling reactions of prepared intermediates 6 and 4 with a PEGylated-DSPE or palmitic acid, respectively, are presented. Compounds 5, mono-, 8, di- and 12, tetravalent mannosyl-lipoconjugates, were synthesized. The synthesized compounds were incorporated into liposomes and liposomal preparations featuring exposed mannose units were characterized. Carbohydrate liposomal quartz crystal microbalance based assay has been established for studying carbohydrate-lectin binding. It was demonstrated that liposomes with incorporated mannosyl-lipoconjugates were effectively recognized by Con A and have great potential to be used for targeted liposomal drug delivery systems. Copyright © 2016 Elsevier B.V. All rights reserved.
Doped-carbon composites, synthesizing methods and applications of the same
Viswanathan, Tito
2017-05-09
A method of synthesizing a doped carbon composite includes preparing a solution having a carbon source material and a heteroatom containing additive, evaporating the solution to yield a plurality of powders, and subjecting the plurality of powders to a heat treatment for a duration of time effective to produce the doped carbon composite.
Copper nanoparticles synthesized in polymers by ion implantation
DEFF Research Database (Denmark)
Popok, Vladimir; Nuzhdin, Vladimir; Valeev, Valerij
2015-01-01
nanoparticles are observed to partly tower above the sample surface due to a side effect of high-fluence irradiation leading to considerable sputtering of polymers. Implantation and particle formation significantly change optical properties of both polymers reducing transmittance in the UV-visible range due...... as optical transmission spectroscopy. It is found that copper nanoparticles nucleation and growth are strongly fluence dependent as well as they are affected by the polymer properties, in particular, by radiation stability yielding different nanostructures for the implanted PI and PMMA. Shallow synthesized...
Directory of Open Access Journals (Sweden)
Fernanda R. Rosa
2016-02-01
Full Text Available This study identified major phenolic compounds of the tucum-do-cerrado (Bactris setosa peel, as well as antioxidant activity and total phytochemical compound concentration of different extracts of the peel and pulp of this fruit. Phenolic compounds of the different extracts of tucum-do-cerrado peel were identified and quantified using a high-performance liquid chromatography system coupled to a diode array detector (DAD. Total phytochemical compound content was determined by spectrophotometric assays and the antioxidant activity by ferric reducing antioxidant power and β-carotene/linoleic assays. Total phenolic, flavanols, total anthocyanins and yellow flavonoids concentration of tucum-do-cerrado were 122-, 14-, 264- and 61-fold higher in the peel than in the pulp, respectively. The aqueous, methanolic and ethanolic extracts of the tucum-do-cerrado peel exhibited higher antioxidant activity compared to its pulp. Flavanols, anthocyanins, flavones, phenolic acids and stilbenes were the main phenolic classes identified in the tucum-do-cerrado peel extracts. Results suggest that the antioxidant capacity and the phytochemical compound content of the tucum-do-cerrado are mainly associated with the peel. Although flavonoids are the main compounds identified in tucum-do-cerrado peel, other phenolics identified in minor amounts, such as phenolic acids and stilbenes, may be responsible for the high antioxidant capacity of the fruit.
Do Biology Majors Really Differ from Non-STEM Majors?
Cotner, Sehoya; Thompson, Seth; Wright, Robin
2017-01-01
Recent calls to action urge sweeping reform in science education, advocating for improved learning for all students-including those majoring in fields beyond the sciences. However, little work has been done to characterize the differences-if any exist-between students planning a career in science and those studying other disciplines. We describe an attempt to clarify, in broad terms, how non-STEM (science, technology, engineering, and mathematics) majors differ from life sciences majors, and how they are similar. Using survey responses and institutional data, we find that non-STEM majors are not unilaterally science averse; non-STEM majors are more likely than biology majors to hold misconceptions about the nature of science, yet they are not completely ignorant of how science works; non-STEM majors are less likely than biology majors to see science as personally relevant; and non-STEM majors populations are likely to be more diverse-with respect to incoming knowledge, perceptions, backgrounds, and skills-than a biology majors population. We encourage science educators to consider these characteristics when designing curricula for future scientists or simply for a well-informed citizenry. © 2017 S. Cotner et al. CBE—Life Sciences Education © 2017 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
The effect of the atmosphere on the optical properties of as-synthesized colloidal indium tin oxide
International Nuclear Information System (INIS)
Capozzi, Charles J; Joshi, Salil; Gerhardt, Rosario A; Ivanov, Ilia N
2009-01-01
The optical properties of indium tin oxide (ITO) have often been explored when it is in the form of deposited thin films. In this study, a colloidal chemistry approach is taken to investigate the influence of the atmosphere on the optical properties of ITO nanoparticles. X-ray diffraction (XRD), transmission electron microscopy (TEM), absorption spectroscopy and photoluminescence (PL) were used to characterize colloidal ITO samples, synthesized under aerated and inert conditions, with the same composition. In both cases, the ITO can be completely dispersed in a non-polar solvent without any evidence of agglomeration. For the ITO made in air, the nanoparticle-solvent solution exhibits a pale green color, and XRD and TEM indicate an average particle size of ∼7 nm and small shrinkage in the lattice structure. When the ITO is synthesized under inert conditions, the solution turns blue, and XRD and TEM indicate an average particle size of ∼8 nm and even less strain in the lattice than for the ITO synthesized under aerated conditions. The change in color and lattice strain is attributed to the difference in oxygen vacancy concentration for the ITO nanoparticles synthesized under aerated and inert conditions, which exhibit different optical band gap values of 3.89 eV and 4.05 eV, respectively. Our work here shows that thin film deposition or sintering steps may not be required for studying the optical properties of as-synthesized ITO nanoparticles.
Kaur, Simranjeet; Kaur, Harpreet
2018-05-01
The present work reports the electrochemical synthesis of polysaccharide-functionalized ZnO nanoparticles using sodium hydroxide, starch, and zinc electrodes for the degradation of cationic dye (Rhodamine-B) under sunlight. Physiochemical properties of synthesized sample have been characterized by different techniques such as XRD, TEM, FESEM, EDS, IR, and UV-visible spectroscopic techniques. The influence of various factors such as effect of dye concentration, contact time, amount of photocatalyst, and pH has been studied. The results obtained from the photodegradation study showed that degradation rate of Rhodamine-B dye has been increased with increase of amount of photocatalyst and decreased with increase in initial dye concentration. Furthermore, the kinetics of the degradation has been investigated. It has been found that the photodegradation of Rhodamine-B dye follows pseudo-first-order kinetics and prepared photocatalyst can effectively degrade the cationic dye. Thus, this ecofriendly and efficient photocatalyst can be used for the treatment of dye-contaminated water. This catalyst also showed the antibacterial activity against Bacillus pumilus and Escherichia coli bacterial strains, so the synthesized nanoparticles also have the pharmaceutical properties.
Carbon-14 labelled nitrogen heterocycles; the syntheses of three phosphodiesterase inhibitors
International Nuclear Information System (INIS)
Lawrie, K.W.M.; Novelli, C.E.A.; Saunders, David
1995-01-01
The syntheses of three heterocyclic phosphodiesterase inhibitors are described from a common radiolabelled precursor, namely 2-propoxybenzo[cyano- 14 C] nitrile. Conversion of the nitrile to the corresponding methyl ketone or amidine allows elaboration of the heterocycles radiolabelled within the ring systems. (Author)
International Nuclear Information System (INIS)
Naveenraj, Selvaraj; Asiri, Abdullah M.; Anandan, Sambandam
2013-01-01
Cadmium Sulphide nanoparticles approximately 5–10 nm in size range were synthesized by sonochemical technique, which follows acoustic cavitation phenomenon and generates nanoparticles with a smaller size range and higher surface area. The in vitro binding interaction of these sonochemically synthesized CdS nanoparticles with serum albumins (SA) were investigated using UV–Vis absorption, fluorescence and circular dichroism (CD) spectroscopic techniques since CdS nanoparticles has biological applications such as cellular labelling and deep-tissue imaging. UV–Vis absorption and fluorescence studies confirm that CdS nanoparticles bind with SA through ground state complex formation (static quenching mechanism). The results suggest that sonochemically synthesized CdS nanoparticles interact with HSA more than that of BSA and these nanoparticles can be easily transported and rapidly released to the targets by serum albumins. CD studies confirmed the conformational change of serum albumins on the interaction of CdS nanoparticles.Graphical AbstractThis paper investigates the in vitro binding interaction of Cadmium Sulphide (CdS) nanoparticles with serum albumins (HSA and BSA) using the UV-vis, steady-state fluorescence, time-resolved fluorescence, synchronous fluorescence and circular dichroism (CD) spectral techniques.
Directory of Open Access Journals (Sweden)
Sudipta Panja
2016-07-01
Full Text Available Objective: To synthesize silver nanoparticles (AgNPs from the leaf extract of Rauvolfia serpentina Benth and examination of their various biological activities. Methods: An ecofriendly, easy, one step, non-toxic and inexpensive approach is used, where aqueous plant extract acts as a reducing as well as stabilizing agent of AgNPs. The nanoparticles were characterized by UV-vis spectroscopy, Fourier transform infrared spectroscopy, transmission electron microscopy, X-ray diffraction, and energy-dispersive X-ray spectroscopy analysis. Results: Surface plasmon resonance of the nanoparticles was observed at 427 nm in UV-vis spectroscopy. Fourier transform infrared spectroscopy result confirms that the plant extract acts as the reducing as well as the capping agent of the AgNPs. Transmission electron microscopy indicated that the synthesized nanoparticles are spherical in shape and approximately 7–10 nm in size, whereas the crystalline nature with face-centered cubic structure of the AgNPs was detected by X-ray diffraction analysis. Presence of silver in the AgNPs is 31.43% by weight, as confirmed by energy-dispersive X-ray spectroscopy. The synthesized AgNPs have antimicrobial activities against human pathogenic microorganisms. It also shows larvicidal activity and cytotoxicity against HeLa, MCF-7 cell lines. Conclusions: Synthesized spherical shaped AgNPs from the leaf extract of Rauvolfia serpentina Benth have antimicrobial and larvicidal activities as well as cytotoxicity against HeLa and MCF-7 cell lines.
Sonochemically synthesized MnO2 nanoparticles as electrode material for supercapacitors.
Gnana Sundara Raj, Balasubramaniam; Asiri, Abdullah M; Qusti, Abdullah H; Wu, Jerry J; Anandan, Sambandam
2014-11-01
In this study, manganese oxide (MnO2) nanoparticles were synthesized by sonochemical reduction of KMnO4 using polyethylene glycol (PEG) as a reducing agent as well as structure directing agent under room temperature in short duration of time and characterized by powder X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), Scanning electron microscope (SEM), Transmission electron microscopy (TEM) and Brunauer-Emmett-Teller (BET) analysis. A supercapacitor device constructed using the ultrasonically-synthesized MnO2 nanoparticles showed maximum specific capacitance (SC) of 282Fg(-1) in the presence of 1M Ca(NO3)2 as an electrolyte at a current density of 0.5mAcm(-2) in the potential range from 0.0 to 1.0V and about 78% of specific capacitance was retained even after 1000 cycles indicating its high electrochemical stability. Copyright © 2013 Elsevier B.V. All rights reserved.
A 55 nm CMOS ΔΣ fractional-N frequency synthesizer for WLAN transceivers with low noise filters
International Nuclear Information System (INIS)
Chen Mingyi; Chu Xiaojie; Yu Peng; Yan Jun; Shi Yin
2013-01-01
A fully integrated ΔΣ fractional-N frequency synthesizer fabricated in a 55 nm CMOS technology is presented for the application of IEEE 802.11b/g wireless local area network (WLAN) transceivers. A low noise filter, occupying a small die area, whose power supply is given by a high PSRR and low noise LDO regulator, is integrated on chip. The proposed synthesizer needs no off-chip components and occupies an area of 0.72 mm 2 excluding PAD. Measurement results show that in all channels, the phase noise of the synthesizer achieves −99 dBc/Hz and −119 dBc/Hz in band and out of band respectively with a reference frequency of 40 MHz and a loop bandwidth of 200 kHz. The integrated RMS phase error is no more than 0.6°. The proposed synthesizer consumes a total power of 15.6 mW. (semiconductor integrated circuits)
Kim C.K.; Lee G.-J.; Lee M.K.; Rhee C.K.
2015-01-01
In this study, nickel nanoparticles were synthesized in ethanol using portable pulsed wire evaporation, which is a one-step physical method. From transmission electron microscopy images, it was found that the Ni nanoparticles exhibited a spherical shape with an average diameter of 7.3 nm. To prevent aggregation of the nickel nanoparticles, a polymer surfactant was added into the ethanol before the synthesis of nickel nanoparticles, and adsorbed on the freshly synthesized nickel nanoparticles ...
High-Performance Ink-Synthesized Cu-Gate Thin-Film Transistor with Diffusion Barrier Formation
Woo, Whang Je; Nam, Taewook; Oh, Il-Kwon; Maeng, Wanjoo; Kim, Hyungjun
2018-05-01
The improved electrical properties of Cu-gate thin-film transistors (TFTs) using an ink-synthesizing process were studied; this technology enables a low-cost and large area process for the display industry. We investigated the film properties and the effects of the ink-synthesized Cu layer in detail with respect to device characteristics. The mobility and reliability of the devices were significantly improved by applying a diffusion barrier at the interface between the Cu gate and the gate insulator. By using a TaN diffusion barrier layer, considerably improved and stabilized ink-Cu gated TFTs could be realized, comparable to sputtered-Cu gated TFTs under positive bias temperature stress measurements.
Design Considerations for Autocalibrations of Wide-Band ΔΣ Fractional-N PLL Synthesizers
Directory of Open Access Journals (Sweden)
Jaewook Shin
2011-01-01
Full Text Available Autocalibration of VCO frequency and loop gain is an essential process in PLL frequency synthesizers. In a wide tuning-range fractional-N PLL frequency synthesizer, high-speed and high-precision automatic calibration is especially important for shortening the lock time and improving the phase noise. This paper reviews the design issues of the PLL auto-calibration and discusses on the limitations of the previous techniques. A very simple and efficient auto-calibration method based on a high-speed frequency-to-digital converter (FDC is proposed and verified through simulations. The proposed method is highly suited for a very wide-band ΔΣ fractional-N PLL.
International Nuclear Information System (INIS)
Roy, Anirban; Maitra, Saikat; Ghosh, Sobhan; Chakrabarti, Sampa
2016-01-01
Highlights: • Sonochemical synthesis of iron-doped zinc oxide nanoparticles. • Green synthesis without alkali at room temperature. • Characterization by UV–vis spectroscopy, FESEM, XRD and EDX. • Influence of precursor composition on characteristics. • Composition and characteristics are correlated. - Abstract: Iron-doped zinc oxide nanoparticles have been synthesized sonochemically from aqueous acetyl acetonate precursors of different proportions. Synthesized nanoparticles were characterized with UV–vis spectroscopy, X-ray diffraction and microscopy. Influences of precursor mixture on the characteristics have been examined and modeled. Linear correlations have been proposed between dopant dosing, extent of doping and band gap energy. Experimental data corroborated with the proposed models.
High-Performance Ink-Synthesized Cu-Gate Thin-Film Transistor with Diffusion Barrier Formation
Woo, Whang Je; Nam, Taewook; Oh, Il-Kwon; Maeng, Wanjoo; Kim, Hyungjun
2018-02-01
The improved electrical properties of Cu-gate thin-film transistors (TFTs) using an ink-synthesizing process were studied; this technology enables a low-cost and large area process for the display industry. We investigated the film properties and the effects of the ink-synthesized Cu layer in detail with respect to device characteristics. The mobility and reliability of the devices were significantly improved by applying a diffusion barrier at the interface between the Cu gate and the gate insulator. By using a TaN diffusion barrier layer, considerably improved and stabilized ink-Cu gated TFTs could be realized, comparable to sputtered-Cu gated TFTs under positive bias temperature stress measurements.
Graphene-Molybdenum Disulfide-Graphene Tunneling Junctions with Large-Area Synthesized Materials.
Joiner, Corey A; Campbell, Philip M; Tarasov, Alexey A; Beatty, Brian R; Perini, Chris J; Tsai, Meng-Yen; Ready, William J; Vogel, Eric M
2016-04-06
Tunneling devices based on vertical heterostructures of graphene and other 2D materials can overcome the low on-off ratios typically observed in planar graphene field-effect transistors. This study addresses the impact of processing conditions on two-dimensional materials in a fully integrated heterostructure device fabrication process. In this paper, graphene-molybdenum disulfide-graphene tunneling heterostructures were fabricated using only large-area synthesized materials, unlike previous studies that used small exfoliated flakes. The MoS2 tunneling barrier is either synthesized on a sacrificial substrate and transferred to the bottom-layer graphene or synthesized directly on CVD graphene. The presence of graphene was shown to have no impact on the quality of the grown MoS2. The thickness uniformity of MoS2 grown on graphene and SiO2 was found to be 1.8 ± 0.22 nm. XPS and Raman spectroscopy are used to show how the MoS2 synthesis process introduces defects into the graphene structure by incorporating sulfur into the graphene. The incorporation of sulfur was shown to be greatly reduced in the absence of molybdenum suggesting molybdenum acts as a catalyst for sulfur incorporation. Tunneling simulations based on the Bardeen transfer Hamiltonian were performed and compared to the experimental tunneling results. The simulations show the use of MoS2 as a tunneling barrier suppresses contributions to the tunneling current from the conduction band. This is a result of the observed reduction of electron conduction within the graphene sheets.
Radchenkova, Nadja; Boyadzhieva, Ivanka; Atanasova, Nikolina; Poli, Annarita; Finore, Ilaria; Di Donato, Paola; Nicolaus, Barbara; Panchev, Ivan; Kuncheva, Margarita; Kambourova, Margarita
2018-04-03
Halophilic microorganisms are producers of a lot of new compounds whose properties suggest promising perspectives for their biotechnological exploration. Moderate halophilic bacterium Chromohalobacter canadensis 28 was isolated from Pomorie salterns as an extracellular polymer substance (EP) producer. The best carbon source for extracellular polymer production was found to be lactose, a sugar received as a by-product from the dairy industry. After optimization of the culture medium and physicochemical conditions for cultivation, polymer biosynthesis increased more than 2-fold. The highest level of extracellular polymer synthesis by C. canadensis 28 was observed in an unusually high NaCl concentration (15% w/v). Chemical analysis of the purified polymer revealed the presence of an exopolysaccharide (EPS) fraction (14.3% w/w) and protein fraction (72% w/w). HPLC analysis of the protein fraction showed the main presence of polyglutamic acid (PGA) (75.7% w/w). EPS fraction analysis revealed the following sugar composition (% w/w): glucosamine 36.7, glucose 32.3, rhamnose 25.4, xylose 1.7, and not identified sugar 3.9. The hydrogel formed by PGA and EPS fractions showed high swelling behavior, very good emulsifying and stabilizing properties, and good foaming ability. This is the first report for halophilic bacterium able to synthesize a polymer containing PGA fraction. The synthesized biopolymer shows an extremely high hydrophilicity, due to the simultaneous presence of PGA and EPS. The analysis of its functional properties and the presence of glucosamine in the highest proportion in EPS fraction clearly determine the potential of EP synthesized by C. canadensis 28 for application in the cosmetics industry.
Energy Technology Data Exchange (ETDEWEB)
Ooi, Mahayatun Dayana Johan [Nano - Optoelectronic Research and Technology Laboratory, School of Physics, Universiti Sains Malaysia, 11800, Minden, Pulau Pinang (Malaysia); Aziz, Azlan Abdul [Nano - Optoelectronic Research and Technology Laboratory, School of Physics, Universiti Sains Malaysia, 11800, Minden, Pulau Pinang (Malaysia); Nanobiotechnology Research and Innovation (NanoBRI), INFORMM, Universiti Sains Malaysia, 11800, Minden, Pulau Pinang (Malaysia)
2015-04-24
Flower-like Platinum micro-structures were synthesized from different concentration of the PVP using solvothermal method. At 5.0×10{sup −3} mmol of PVP, well-defined flower-like pattern consists of triangular petals radiating from the centre were produced whereas larger flower network developed at higher PVP concentration. High degree of crystallinity was obtained upon each increment of PVP. The well defined flower like pattern synthesized using 5.0×10{sup −3} mmol PVP exhibit the highest catalytic activity and stability towards electro-oxidation of formic acid.
Syntheses of [ω-11C]-labelled fatty acids using alkyl halides and Grignard reagents
International Nuclear Information System (INIS)
Kihlberg, T.; Malmborg, P.; Langstroem, B.
1990-01-01
A method for synthesizing carbon-11 labelled fatty acids, where the carbon-11 has a mid-chain location, has been developed. Fatty acids labelled thus are less susceptible to early loss of the label through metabolic degradation. Carbon-11 labelled methyl iodide was trapped in a solution of alpha, omega-di(bromo magnesium)alkane in THF. Li 2 CuCl 4 was added and allowed to react. Carbon dioxide was introduced into the mixture, followed by heating and then hydrolysis. Hexanoic, octanoic, and decanoic acids were synthesized with this method
Adsorptive removal of bisphenol A using synthesized magnetite nanoparticles
Orimolade, B. O.; Adekola, F. A.; Adebayo, G. B.
2018-03-01
Bisphenol A (BPA) is an organic compound which is often used as plasticizer and has been reported to be hazardous to man. In this research the efficiency of removal of BPA from water by magnetite through adsorption process was studied. The magnetite was synthesized using reverse co-precipitation method and fully characterized. Various physicochemical parameters affecting the adsorption of BPA using magnetite were studied as well. The optimum time for the adsorption process was found to be 60 min at pH of 6, adsorbent dose of 0.2 g and 50 ppm of BPA. The adsorption data were fitted by the Langmuir adsorption isotherm best with a regression value of 0.957. The R L value was 0.179 which revealed that the process is favorable. The Freundlich constant n which was 1.901 also revealed that the adsorption is normal and favorable. The data were in agreement with the pseudo-second-order kinetics with regression value of 0.98. From the thermodynamic studies, the process was found to be exothermic and the Gibb's free energy value which was negative showed that the adsorption was spontaneous. The synthesized magnetite therefore offers great potential for the remediation of bisphenol A-contaminated media.
Annual reports in inorganic and general syntheses 1976
Zimmer, Hans
2013-01-01
Annual Reports in Inorganic and General Syntheses-1976 presents an annual review of synthetically useful information that would prove beneficial to nearly all organic chemists, both specialist and nonspecialist in synthesis. It should help relieve some of the information storage burden of the specialist and should aid the nonspecialist who is seeking help with a specific problem to become rapidly aware of recent synthetic advances.This is the fifth volume of ARIGS and is organized along the lines developed for the preceding volumes. The authors were encouraged to use synthetic aspects as their
DEFF Research Database (Denmark)
Diez, Patricia; Vogelius, Ivan S; Bentzen, Søren M
2010-01-01
A new method is presented for synthesizing dose-response data for biochemical control of prostate cancer according to study design (randomized vs. nonrandomized) and risk group (low vs. intermediate-high).......A new method is presented for synthesizing dose-response data for biochemical control of prostate cancer according to study design (randomized vs. nonrandomized) and risk group (low vs. intermediate-high)....
Carbon-14 labelled nitrogen heterocycles; the syntheses of three phosphodiesterase inhibitors
Energy Technology Data Exchange (ETDEWEB)
Lawrie, K.W.M.; Novelli, C.E.A.; Saunders, David [SmithKline Beecham Pharmaceuticals Research and Development, Harlow (United Kingdom). Synthetic Isotope Chemistry Dept.; Coates, W.J. [SmithKline Beecham Pharmaceuticals Research and Development, Welwyn (United Kingdom)
1995-09-01
The syntheses of three heterocyclic phosphodiesterase inhibitors are described from a common radiolabelled precursor, namely 2-propoxybenzo[cyano-{sup 14}C] nitrile. Conversion of the nitrile to the corresponding methyl ketone or amidine allows elaboration of the heterocycles radiolabelled within the ring systems. (Author).
Improved chemical syntheses of 5,6-dihydro-5-fluorouracil.
LaFrate, Andrew L; Katzenellenbogen, John A
2007-10-26
5,6-dihydro-5-fluorouracil (5-DHFU) is a metabolite of the chemotherapy drug 5-fluorouracil (5-FU) of importance for biological studies. 5-DHFU has been prepared by enzymatic reduction of 5-FU and in very low yield by hydrogenation of 5-FU; however, a practical chemical synthesis is not available. Facile racemic syntheses of 5-DHFU from 5-FU or uracil, using p-methoxybenzyl protecting groups followed by L-Selectride reduction, are reported.
Porous oxides synthesized by the combustion method
International Nuclear Information System (INIS)
Lugo L, V.
2005-01-01
The result of this work, seeks to be a contribution for the treatment of radioactive wastes, with base to the sorption properties that present those porous oxides, synthesized by a method that allows to increase the sorption capacity. The main objective of the present investigation has been the modification of the structural characteristics of the oxides of Fe, Mg and Zn to increase its capacity of sorption of 60 Co in particular. It was studied the effect of the synthesis method by combustion in the inorganic oxides; the obtained solids were characterized using the following techniques: X-ray diffraction (XRD), scanning electron microscopy (SEM), semiquantitative elementary analysis by Dispersive energy spectroscopy (EDS) and determination of surface area by the Brunauner-Emmett-Teller method (BET). Also was carried out batch type experiments for the sorption of Co 2+ , with the purpose of studying the sorption capacity of each one of the prepared oxides. In accordance with that previously exposed, the working plan that was carried out in this investigation is summarized in the following stages: 1. Preparation of inorganic oxides by two different methods, studying the effect of the temperature in the synthesis process. 2. Characterization of the inorganic oxides by XRD, by means of which those were chosen the solids with better properties. 3. Characterization of the inorganic oxides by SEM and EDS where it was studied the morphology of the synthesized materials and the semiquantitative elemental composition. 4. Realization of a sorption experiment type Batch with non radioactive Co 2+ to simulate the sorption of 60 Co and determination of the sorption capacity by means of neutron activation of the non radioactive cobalt. 5. Determination of the surface area by the (BET) technique of the inorganic oxides with better sorption properties. (Author)
Methods for synthesizing metal oxide nanowires
Sunkara, Mahendra Kumar; Kumar, Vivekanand; Kim, Jeong H.; Clark, Ezra Lee
2016-08-09
A method of synthesizing a metal oxide nanowire includes the steps of: combining an amount of a transition metal or a transition metal oxide with an amount of an alkali metal compound to produce a mixture; activating a plasma discharge reactor to create a plasma discharge; exposing the mixture to the plasma discharge for a first predetermined time period such that transition metal oxide nanowires are formed; contacting the transition metal oxide nanowires with an acid solution such that an alkali metal ion is exchanged for a hydrogen ion on each of the transition metal oxide nanowires; and exposing the transition metal oxide nanowires to the plasma discharge for a second predetermined time period to thermally anneal the transition metal oxide nanowires. Transition metal oxide nanowires produced using the synthesis methods described herein are also provided.
Integrated digital superconducting logic circuits for the quantum synthesizer. Report
International Nuclear Information System (INIS)
Buchholz, F.I.; Kohlmann, J.; Khabipov, M.; Brandt, C.M.; Hagedorn, D.; Balashov, D.; Maibaum, F.; Tolkacheva, E.; Niemeyer, J.
2006-11-01
This report presents the results, which were reached in the framework of the BMBF cooperative plan ''Quantum Synthesizer'' in the partial plan ''Integrated Digital Superconducting Logic Circuits''. As essential goal of the plan a novel instrument on the base of quantum-coherent superconducting circuits should be developed. which allows to generate praxis-relevant wave forms with quantum accuracy, the quantum synthesizer. The main topics of development of the reported partial plan lied at the one hand in the development of integrated, digital, superconducting circuit in rapid-single-flux (RSFQ) quantum logics for the pattern generator of the quantum synthesizer, at the other hand in the further development of the fabrication technology for the aiming of high circuit complexity. In order to fulfil these requirements at the PTB a new design system was implemented, based on the software of Cadence. Together with the required RSFQ extensions for the design of digital superconducting circuits was a platform generated, on which the reachable circuit complexity is exclusively limited by the technology parameters of the available fabrication technology: Physical simulations are with PSCAN up to a complexity of more than 1000 circuit elements possible; furthermore VHDL allows the verification of arbitrarily large circuit architectures. In accordance for this the production line at the PTB was brought to a level, which allows in Nb/Al-Al x O y /Nb SIS technology implementation the fabrication of highly integrable RSFQ circuit architectures. The developed and fabricated basic circuits of the pattern generator have proved correct functionality and reliability in the measuring operation. Thereby for the circular RSFQ shift registers a key role as local memories in the construction of the pattern generator is devolved upon. The registers were realized with the aimed bit lengths up to 128 bit and with reachable signal-processing speeds of above 10 GHz. At the interface RSFQ
Boyce, Jonathan H.
Polycyclic polyprenylated acylphloroglucinols (PPAPs) are structurally complex natural products with promising biological activities. These compounds have interesting anticancer and anti-HIV properties as well as other biological activities making them highly attractive synthetic targets. We report a stereodivergent, asymmetric total synthesis of (-)-clusianone in six steps from commercial materials. We have implemented a challenging cationic cyclization forging a bond between two sterically encumbered quaternary carbon atoms. Mechanistic studies point to the unique ability of formic acid to mediate the cyclization forming the clusianone framework. We also present a biosynthesis-inspired, diversity-oriented synthesis approach for rapid construction of PPAP analogs via palladium-catalyzed dearomative conjunctive allylic alkylation (DCAA). These efficient palladium-catalyzed protocols construct the [3.3.1]-bicyclic PPAP core in a single step from their stable aromatic precursors. The first syntheses of 13,14-didehydroxyisogarcinol and garcimultiflorone A stereoisomers are reported in six steps from a commercially available phloroglucinol. Lewis acid-controlled, diastereoselective cationic oxycyclizations enabled asymmetric syntheses of (-)-6-epi-13,14-didehydroxyisogarcinol and (+)-30-epi-13,14-didehydroxyisogarcinol. A similar strategy enabled production of the meso-derived isomers (+/-)-6,30- epi-13,14-didehydroxyisogarcinol and (+/-)-6,30-epi -garcmultiflorone A. A convenient strategy for gram scale synthesis of these stereoisomers was developed utilizing diastereomer separation at a later stage in the synthesis that minimized the number of necessary synthetic operations to access all possible stereoisomers. Finally, we report cationic rearrangements of dearomatized acylphloroglucinols leading to the formation of unprecedented PPAP scaffolds. A novel type A [3.3.1]-bicyclic PPAP was produced as a major product and the structure confirmed by X-ray crystallographic
[Aerobic methylobacteria are capable of synthesizing auxins].
Ivanova, E G; Doronina, N V; Trotsenko, Iu A
2001-01-01
Obligately and facultatively methylotrophic bacteria with different pathways of C1 metabolism were found to be able to produce auxins, particularly indole-3-acetic acid (IAA), in amounts of 3-100 micrograms/ml. Indole-3-pyruvic acid and indole-3-acetamide were detected only in methylobacteria with the serine pathway of C1 metabolism, Methylobacterium mesophilicum and Aminobacter aminovorans. The production of auxins by methylobacteria was stimulated by the addition of tryptophan to the growth medium and was inhibited by ammonium ions. The methylobacteria under study lacked tryptophan decarboxylase and tryptophan side-chain oxidase. At the same time, they were found to contain several aminotransferases. IAA is presumably synthesized by methylobacteria through indole-3-pyruvic acid.
Shende, Pravin; Patil, Sampada; Gaud, R S
2017-07-01
The aim of the present study was to use a combinatorial approach of inclusion complexation and dendrimer synthesization of gefitinib using solvent-free technique for targeting EGFR-TK to treat Non-Small-Cell Lung Cancer (NSCLC). The inclusion complex of gefitinib with β-cyclodextrin was prepared by trituration method. This complex encapsulated G4 PAMAM dendrimers were synthesized by Michael addition and amidation reactions using green chemistry and then PEGylated by conjugation reaction. FTIR and DSC confirmed the formation of inclusion complex of gefitinib and β-cyclodextrin and PEGylation of G4 PAMAM dendrimers. Gefitinib showed higher solubility, encapsulation efficiency and controlled release profile from PEGylated dendrimers compared to inclusion complex. The PEGylated dendrimers of inclusion complex of gefitinib were found to reduce hemolytic toxicity and lesser GI 50 value on Human lung cancer cell line A-549 by effective targeting EGFR-TK. A combinatorial approach of inclusion complexation and dendrimer synthesization is one of the alternative advanced approaches to treat NSCLC. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Guillaume Marti
2014-09-01
Full Text Available UV-C radiation is known to induce metabolic modifications in plants, particularly to secondary metabolite biosynthesis. To assess these modifications from a global and untargeted perspective, the effects of the UV-C radiation of the leaves of three different model plant species, Cissus antarctica Vent. (Vitaceae, Vitis vinifera L. (Vitaceae and Cannabis sativa L. (Cannabaceae, were evaluated by an LC-HRMS-based metabolomic approach. The approach enabled the detection of significant metabolite modifications in the three species studied. For all species, clear modifications of phenylpropanoid metabolism were detected that led to an increased level of stilbene derivatives. Interestingly, resveratrol and piceid levels were strongly induced by the UV-C treatment of C. antarctica leaves. In contrast, both flavonoids and stilbene polymers were upregulated in UV-C-treated Vitis leaves. In Cannabis, important changes in cinnamic acid amides and stilbene-related compounds were also detected. Overall, our results highlighted phytoalexin induction upon UV-C radiation. To evaluate whether UV-C stress radiation could enhance the biosynthesis of bioactive compounds, the antioxidant activity of extracts from control and UV-C-treated leaves was measured. The results showed increased antioxidant activity in UV-C-treated V. vinifera extracts.
SOMA A Tool for Synthesizing and Optimizing Memory Accesses in ASICs
DEFF Research Database (Denmark)
Venkataramani, Girish; Bjerregaard, Tobias; Chelcea, Tiberiu
2005-01-01
parallelism profile of the application. This is then used to customize the MAN architecture. Depending on the parallelism profile, the MAN may be optimized for latency, throughput or both. The optimized MAN is automatically synthesized into gate-level structural Verilog using a flexible library of network...
Yang, Xiao; van der Donk, Wilfred A.
2013-01-01
Ribosomally synthesized and post-translationally modified peptides (RiPPs) are a major class of natural products with a high degree of structural diversity and a wide variety of bioactivities. Understanding the biosynthetic machinery of these RiPPs will benefit the discovery and development of new molecules with potential pharmaceutical applications. In this review, we discuss the features of the biosynthetic pathways to different RiPP classes, and propose mechanisms regarding recognition of the precursor peptide by the posttranslational modification enzymes. We propose that the leader peptides function as allosteric regulators that bind the active form of the biosynthetic enzymes in a conformational selection process. We also speculate how enzymes that generate polycyclic products of defined topologies may have been selected for during evolution. PMID:23666908
Liu, F.; Chen, S.; Lin, Q.; Wang, X. D.; Cao, J. X.
2018-01-01
The xonotlite crystals were synthesized via the hydrothermal synthesis manner from CaO and SiO2 as the raw materials with their Si/Ca molar ratio of 1.0. Comparative dynamics analysis on xonotlite spherical particles synthesized via hydrothermal synthesis process was explored in this paper. The accuracy of the dynamic equation of xonotlite spherical particles was verified by two methods, one was comparing the production rate of the xonotlite products calculated by the dynamic equation with the experimental values, and the other was comparing the apparent activation energies calculated by the dynamic equation with that calculated by the Kondo model. The results indicated that the production rates of the xonotlite spherical particles calculated by the dynamic equation were in good agreement with the experimental values and the apparent activation energy of the xonotlite spherical particles calculated by dynamic equation (84 kJ·mol-1) was close to that calculated by Kondo model (77 kJ·mol-1), verifying the high accuracy of the dynamic equation.
Low-Entropy States of Neutral Atoms in Polarization-Synthesized Optical Lattices.
Robens, Carsten; Zopes, Jonathan; Alt, Wolfgang; Brakhane, Stefan; Meschede, Dieter; Alberti, Andrea
2017-02-10
We create low-entropy states of neutral atoms by utilizing a conceptually new optical-lattice technique that relies on a high-precision, high-bandwidth synthesis of light polarization. Polarization-synthesized optical lattices provide two fully controllable optical lattice potentials, each of them confining only atoms in either one of the two long-lived hyperfine states. By employing one lattice as the storage register and the other one as the shift register, we provide a proof of concept using four atoms that selected regions of the periodic potential can be filled with one particle per site. We expect that our results can be scaled up to thousands of atoms by employing an atom-sorting algorithm with logarithmic complexity, which is enabled by polarization-synthesized optical lattices. Vibrational entropy is subsequently removed by sideband cooling methods. Our results pave the way for a bottom-up approach to creating ultralow-entropy states of a many-body system.
International Nuclear Information System (INIS)
Kundu, Samapti; Sain, Sumanta; Yoshio, Masaki; Kar, Tanusree; Gunawardhana, Nanda; Pradhan, Swapan Kumar
2015-01-01
Graphical abstract: - Highlights: • ZnO nanorods are synthesized at room temperature via a simple chemical route. • Growth direction of ZnO nanorods has been determined along 〈0 0 2〉. • ZnO nanorods constructed anode shows a high discharge capacity in first cycle. • It retains good reversible capacity compared to other ZnO morphologies. - Abstract: ZnO nanorods are synthesized at room temperature via a simple chemical route without using any template or capping agent and its importance is evaluated as a suitable candidate for anode material in lithium ion battery. Structural and microstructure characterizations of these nanorods are made by analyzing the X-ray diffraction data employing the Rietveld method of powder structure refinement. It reveals that the ZnO nanorods are grown up with a preferred orientation and elongated along 〈0 0 2〉. FESEM images reveal that these uniform cylindrical shaped nanorods are of different lengths and diameters. These synthesized ZnO nanorods are tested as an anode material for lithium ion batteries. The nano grain size of the ZnO rods results in less volume expansion and/or contraction during the alloying/de-alloying process and causes in good cyclability. In addition, synthesized ZnO nanorods deliver high charge/discharge capacities compared to other reported ZnO materials
Energy Technology Data Exchange (ETDEWEB)
Kundu, Samapti; Sain, Sumanta [Materials Science Division, Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Yoshio, Masaki [Advanced Research and Education Centre, Saga University, 1341 Yoga-machi, Saga 840-0047 (Japan); Kar, Tanusree [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata 700032, West Bengal (India); Gunawardhana, Nanda, E-mail: nandagunawardhana@pdn.ac.lk [International Research Centre, Senate Building, University of Peradeniya, Peradeniya 20400 (Sri Lanka); Pradhan, Swapan Kumar, E-mail: skpradhan@phys.buruniv.ac.in [Materials Science Division, Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)
2015-02-28
Graphical abstract: - Highlights: • ZnO nanorods are synthesized at room temperature via a simple chemical route. • Growth direction of ZnO nanorods has been determined along 〈0 0 2〉. • ZnO nanorods constructed anode shows a high discharge capacity in first cycle. • It retains good reversible capacity compared to other ZnO morphologies. - Abstract: ZnO nanorods are synthesized at room temperature via a simple chemical route without using any template or capping agent and its importance is evaluated as a suitable candidate for anode material in lithium ion battery. Structural and microstructure characterizations of these nanorods are made by analyzing the X-ray diffraction data employing the Rietveld method of powder structure refinement. It reveals that the ZnO nanorods are grown up with a preferred orientation and elongated along 〈0 0 2〉. FESEM images reveal that these uniform cylindrical shaped nanorods are of different lengths and diameters. These synthesized ZnO nanorods are tested as an anode material for lithium ion batteries. The nano grain size of the ZnO rods results in less volume expansion and/or contraction during the alloying/de-alloying process and causes in good cyclability. In addition, synthesized ZnO nanorods deliver high charge/discharge capacities compared to other reported ZnO materials.
Recent Progress in Syntheses and Applications of Dumbbell-like Nanoparticles**
Wang, Chao; Xu, Chenjie; Zeng, Hao; Sun, Shouheng
2009-01-01
This paper reviews the recent research progress in syntheses and applications of dumbbell-like nanoparticles. It first describes the general synthesis of dumbbell-like nanoparticles containing noble metal and magnetic NPs/or quantum dots. It then outlines the interesting optical and magnetic properties found in these dumbbell nanoparticles. The review further highlights several exciting application potentials of these nanoparticles in catalysis and biomedicine.
International Nuclear Information System (INIS)
Makarious, A.S.; Maayouf, R.M.A.; Megahid, R.
1978-01-01
Measurements of both angular and energy distributions of secondary gamma resulting from interactions of neutrons emerging from one of the ET-RR-1 reactor beam holes, in barriers from iron, lead and water are reported. The measurements were carried out, both with a bare neutron beam and with the beam being transmitted through a B4C. Filter, using a stilbene crystal gamma spectrometer. The spectrometer applies discrimination between neutrons and gammas according to the difference in decay times of the scintillations produced by them in stilbene. The described angular distributions resulted from measurements made at different angles of neutron incidence and with three different thicknesses of each sample
Study of the effects of heat-treatment of hydroxyapatite synthesized in gelatin matrix
Zaits, A. V.; Golovanova, O. A.; Kuimova, M. V.
2017-01-01
In the study, the isothermal thermogravimetric analysis (TGA) of hydroxyapatite synthesized in gelatin matrix (HAG) has been performed. 3 wt.% HAG samples were synthesized from the solution simulating the human extracellular fluid (SBF). X-ray diffraction and IR spectroscopy were used to determine the composition. During the experiment, increase in the calcination temperature up to 200°C-800°C was found to cause weight loss. The study of phase composition revealed that heat treatment does not affect the phase composition of the solid phase, which is composed of hydroxylapatite (HA). The prepared HAG (3 wt.% gelatin) samples are shown to have low thermal stability; the degradation of the samples occurs at 400°C.
International Nuclear Information System (INIS)
Honda, H.; Sakaguchi, H.; Fukuda, Y.; Esaka, T.
2003-01-01
AlSb was synthesized as an anode active material for lithium secondary battery using mechanical alloying (MA). Electrochemical performance was examined on the electrodes of AlSb synthesized with different MA time. The first charge (lithium-insertion) capacity of the AlSb electrodes decreased with increasing the MA time. The discharge capacity on repeating charge-discharge cycle, however, did not show the same dependence. The electrode, consisting of the 20 h MA sample exhibited the longest charge-discharge life cycle, suggesting that there is the optimum degree of internal energy derived from the strain and/or the amorphization due to mechanical alloying. These results were evaluated using ex situ X-ray diffraction and differential scanning calorimetry
Dhand, Vivek; Prasad, J Sarada; Rao, Venkateswer M; Kalluri, Sujith; Jain, Pawan Kumar; Sreedhar, B
2015-01-01
Carbon nanofibers (CNF) have been synthesized under partial combustion conditions in a flame reactor using different mixtures of hydrocarbon gases in the presence and absence of precursors. The hydrogen (H2) adsorption studies have been carried out using a high pressure Sievert's apparatus maintained at a constant temperature (24 degrees C). The flame synthesized CNFs showed high degree of H2 adsorption capacities at 100 atm pressure. The highest H2 capacities recorded have been 4.1 wt% [for CNF produced by liquefied petroleum gas (LPG)-Air (E-17)], 3.7 wt% [for nano carbons produced by Methane-Acetylene-Air (EMAC-4)] and 5.04 wt% for [Lithium intercalated sample (Li-EMAC-4)] respectively.
Syntheses and characterizations of LiFePO4 powders
Jugović, Dragana; Kuzmanović, Maja; Mitrić, Miodrag; Cvjetićanin, Nikola; Uskoković, Dragan
2011-01-01
The olivine type compositions LiMPO4 (M = Fe, Mn, Co) are among the most attractive materials for the positive electrode of lithium-ion battery. The benefits of using LiFePO4 are excellent cycle life, high structural stability, low cost and environmental friendliness. Here will be presented our efforts to obtain LiFePO4 powders through several synthesis methods. The differences in phase purity, microstructure, morphology, and electrochemical performances of synthesized powders were investigat...
Analysis of Periodic Errors for Synthesized-Reference-Wave Holography
Directory of Open Access Journals (Sweden)
V. Schejbal
2009-12-01
Full Text Available Synthesized-reference-wave holographic techniques offer relatively simple and cost-effective measurement of antenna radiation characteristics and reconstruction of complex aperture fields using near-field intensity-pattern measurement. These methods allow utilization of advantages of methods for probe compensations for amplitude and phasing near-field measurements for the planar and cylindrical scanning including accuracy analyses. The paper analyzes periodic errors, which can be created during scanning, using both theoretical results and numerical simulations.
International Nuclear Information System (INIS)
Chu Maoquan; Sun Ye; Xu Shi
2008-01-01
Nanoscale and microscale silica spheres embedded with multiple CdSe quantum dots (QDs, having average diameters of about 2.4 and 5.0 nm, respectively.) were synthesized by using a quaternary 'water-in-oil' microemulsion. Comparing the uncoated QDs, the quantum yields (QYs) of the silica-coated QD spheres were enhanced when the QD cores were synthesized using mercaptoacetic acid (MA) as a stabilizer, while the QYs were dramatically decreased when the cores were synthesized using citric acid (CA) as a stabilizer. The enhanced QYs could be further improved by heating the silica-coated QDs in aqueous solution. Although the QYs of the silica-coated QDs were not high, these spheres emitted bright fluorescence. The silica shells contained numerous micropores (∼0.58-0.91 nm), and small amounts of toxic ions (such as Cd 2+ ) could be released from the silica spheres. However, the release rate of toxic ions from the silica spheres was significantly reduced compared with that of the uncoated QDs
A 0.13 μm CMOS ΔΣ fractional-N frequency synthesizer for WLAN transceivers
International Nuclear Information System (INIS)
Chu Xiaojie; Jia Hailong; Lin Min; Shi Yin; Foster, Dai Fa
2011-01-01
A fractional-N frequency synthesizer fabricated in a 0.13 μm CMOS technology is presented for the application of IEEE 802.11 b/g wireless local area network (WLAN) transceivers. A monolithic LC voltage controlled oscillator (VCO) is implemented with an on-chip symmetric inductor. The fractional-N frequency divider consists of a pulse swallow frequency divider and a 3rd-order multistage noise shaping (MASH) ΔΣ modulator with noise-shaped dithering techniques. Measurement results show that in all channels, phase noise of the synthesizer achieves −93 dBc/Hz and −118 dBc/Hz in band and out of band respectively with a phase-frequency detector (PFD) frequency of 20 MHz and a loop bandwidth of 100 kHz. The integrated RMS phase error is no more than 0.8°. The proposed synthesizer consumes 8.4 mW from a 1.2 V supply and occupies an area of 0.86 mm 2 . (semiconductor integrated circuits)
A 0.13 μm CMOS ΔΣ fractional-N frequency synthesizer for WLAN transceivers
Xiaojie, Chu; Hailong, Jia; Min, Lin; Yin, Shi; Foster, Dai Fa
2011-10-01
A fractional-N frequency synthesizer fabricated in a 0.13 μm CMOS technology is presented for the application of IEEE 802.11 b/g wireless local area network (WLAN) transceivers. A monolithic LC voltage controlled oscillator (VCO) is implemented with an on-chip symmetric inductor. The fractional-N frequency divider consists of a pulse swallow frequency divider and a 3rd-order multistage noise shaping (MASH) ΔΣ modulator with noise-shaped dithering techniques. Measurement results show that in all channels, phase noise of the synthesizer achieves -93 dBc/Hz and -118 dBc/Hz in band and out of band respectively with a phase-frequency detector (PFD) frequency of 20 MHz and a loop bandwidth of 100 kHz. The integrated RMS phase error is no more than 0.8°. The proposed synthesizer consumes 8.4 mW from a 1.2 V supply and occupies an area of 0.86 mm2.
Localization and movement of newly synthesized cholesterol in rat ovarian granulosa cells
International Nuclear Information System (INIS)
Lange, Y.; Schmit, V.M.; Schreiber, J.R.
1988-01-01
The distribution and movement of cholesterol were studied in granulosa cells from the ovaries of estrogen-stimulated hypophysectomized immature rats cultured in serum-free medium. Plasma membrane cholesterol was distinguished from intracellular cholesterol with cholesterol oxidase, an enzyme that converts cell surface cholesterol to cholestenone, leaving intracellular cholesterol untouched. Using this approach we showed that 82% of unesterified cholesterol was associated with the plasma membrane in granulosa cells cultured for 48 h in serum-free medium in both the presence and absence of added androstenedione and FSH. FSH and androstenedione stimulated a marked increase in steroid hormone (progestin) production. The movement of newly synthesized cholesterol to the plasma membrane also was followed using cholesterol oxidase. Newly synthesized cholesterol reached the plasma membrane too rapidly to be measured in unstimulated cells (t1/2 less than 20 min); however, in cells stimulated by FSH and androstenedione, this rate was considerably slower (t1/2 approximately 2h). Therefore, cholesterol movement to the plasma membrane appears to be regulated by gonadotropins in these cells. We tested whether steroid biosynthesis used all cell cholesterol pools equally. To this end we administered [3H]acetate and [14C]acetate at different times and determined their relative specific contents in various steroids after defined intervals. The relative ages of the steroids (youngest to oldest) were: lanosterol, progestins, intracellular cholesterol, and plasma membrane cholesterol. This finding suggests that progestins use newly synthesized intracellular cholesterol in preference to preexisting intracellular or cell surface cholesterol
Synthesizing biomolecule-based Boolean logic gates.
Miyamoto, Takafumi; Razavi, Shiva; DeRose, Robert; Inoue, Takanari
2013-02-15
One fascinating recent avenue of study in the field of synthetic biology is the creation of biomolecule-based computers. The main components of a computing device consist of an arithmetic logic unit, the control unit, memory, and the input and output devices. Boolean logic gates are at the core of the operational machinery of these parts, and hence to make biocomputers a reality, biomolecular logic gates become a necessity. Indeed, with the advent of more sophisticated biological tools, both nucleic acid- and protein-based logic systems have been generated. These devices function in the context of either test tubes or living cells and yield highly specific outputs given a set of inputs. In this review, we discuss various types of biomolecular logic gates that have been synthesized, with particular emphasis on recent developments that promise increased complexity of logic gate circuitry, improved computational speed, and potential clinical applications.
Synthesizing Biomolecule-based Boolean Logic Gates
Miyamoto, Takafumi; Razavi, Shiva; DeRose, Robert; Inoue, Takanari
2012-01-01
One fascinating recent avenue of study in the field of synthetic biology is the creation of biomolecule-based computers. The main components of a computing device consist of an arithmetic logic unit, the control unit, memory, and the input and output devices. Boolean logic gates are at the core of the operational machinery of these parts, hence to make biocomputers a reality, biomolecular logic gates become a necessity. Indeed, with the advent of more sophisticated biological tools, both nucleic acid- and protein-based logic systems have been generated. These devices function in the context of either test tubes or living cells and yield highly specific outputs given a set of inputs. In this review, we discuss various types of biomolecular logic gates that have been synthesized, with particular emphasis on recent developments that promise increased complexity of logic gate circuitry, improved computational speed, and potential clinical applications. PMID:23526588
[Characteristics of proteins synthesized by hydrogen-oxidizing microorganisms].
Volova, T G; Barashkov, V A
2010-01-01
The study was conducted to determine the biological value of proteins synthesized by hydrogen-oxidizing microorganisms--the hydrogen bacteria Alcaligenes eutrophus Z1 and Ralstonia eutropha B5786 and the CO-resistant strain of carboxydobacterium Seliberia carboxydohydrogena Z1062. Based on a number of significant parameters characterizing the biological value of a product, the proteins of hydrogen-oxidizing microorganisms have been found to occupy an intermediate position between traditional animal and plant proteins. The high total protein in biomass of these microorganisms, their complete amino acid content, and availability to proteolytic enzymes allow for us to consider these microorganisms as potential protein producers.
Structural analysis of nanocrystalline ZnTe alloys synthesized by melt quenching technique
Singh, Harinder; Singh, Tejbir; Thakur, Anup; Sharma, Jeewan
2018-05-01
Nanocrystalline ZnxTe100-x (x=0, 5, 20, 30, 40, 50) alloys have been synthesized using melt quenching technique. Energy-dispersive X-Ray spectroscopy (EDS) has been used to verify the elemental composition of samples. Various absorption modes are recorded from Fourier transform infrared spectroscopy (FTIR) confirming the formation of ZnTe. The structural study has been performed using X-Ray Diffraction (XRD) method. All synthesized samples have been found to be nanocrystalline in nature with average crystallite size in the range from 49.3 nm to 77.1 nm. Results have shown that Zn0Te100 exhibits hexagonal phase that transforms into a cubic ZnTe phase as the amount of zinc is increased. Pure ZnTe phase has been obtained for x = 50. The texture coefficient (Tc) has been calculated to find the prominent orientations of different planes.
Characterization of hematite nanoparticles synthesized via two different pathways
Das, Soumya; Hendry, M. Jim
2014-08-01
Hematite is one of the most common and thermodynamically stable iron oxides found in both natural and anthropogenic systems. Owing to its ubiquity, stability, moderate specific surface area, and ability to sequester metals and metalloids from aquatic systems, it has been the subject of a large number of adsorption studies published during the past few decades. Although preparation techniques are known to affect the surface morphology of hematite nanoparticles, the effects of aging under environmentally relevant conditions have yet to be tested with respect to surface morphology, surface area, and adsorptive capacity. We prepared hematite via two different pathways and aged it under highly alkaline conditions encountered in many mill tailings settings. Crystal habits and morphologies of the hematite nanoparticles were analyzed via scanning electron microscopy and transmission electron microscopy. X-ray diffraction, Raman spectroscopy, and Brunauer-Emmett-Teller surface area analyses were also conducted on the hematite nanoparticles before and after aging. The hematite synthesized via an Fe(III) salt solution (average particle size 37 nm) was morphologically and structurally different from the hematite synthesized via ferrihydrite aging (average particle size 144 nm). Overall, our data demonstrate that the crystallinity of hematite produced via ferrihydrite transformation is susceptible to morphological alterations/modifications. In contrast, the hematite formed via hydrolysis of an Fe(III) salt solution remains very stable in terms of structure, size, and morphology even under extreme experimental conditions.
Major depression and secondhand smoke exposure.
Patten, Scott B; Williams, Jeanne V A; Lavorato, Dina H; Woolf, Benjamin; Wang, Jian Li; Bulloch, Andrew G M; Sajobi, Tolulope
2018-01-01
Epidemiological studies have consistently linked smoking to poor mental health. Among non-smokers, some studies have also reported associations between secondhand smoke exposure and psychological symptoms. However, an association between secondhand smoke exposure and depressive disorders has not been well established. This analysis used cross-sectional data from a series of 10 population surveys conducted in Canada between 2003 and 2013. The surveys targeted the Canadian household population, included a brief structured interview for past year major depressive episode (MDE) and included items assessing secondhand smoke exposure. We used two-stage individual-level random-effects meta-regression to synthesize results from these surveys. Over the study interval, about 20% of non-smokers reported substantial exposure to secondhand smoke. In this group, the pooled annual prevalence of MDE was 6.1% (95% CI 5.3-6.9) compared to 4.0% (95% CI 3.7-4.3) in non-smokers without secondhand smoke exposure. The crude odds ratio was 1.5 (95% CI 1.4-1.7). With adjustment for a set of potential confounding variables the odds ratio was unchanged, 1.4 (95% CI 1.2 - 1.6). These results provide additional support for public health measures aimed at reducing secondhand smoke exposure. A causal connection between secondhand smoke exposure and MDEs cannot be confirmed due to the cross-sectional nature of the data. Longitudinal studies are needed to establish temporal sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Reddy, N. Jayachandra; Nagoor Vali, D.; Rani, M.; Rani, S. Sudha
2014-01-01
Silver nanoparticles synthesized through bio-green method has been reported to have biomedical applications to control pathogenic microbes as it is cost effective compared to commonly used physical and chemical methods. In present study, silver nanoparticles were synthesized using aqueous Piper longum fruit extract (PLFE) and confirmed by UV–visible spectroscopy. The nanoparticles were spherical in shape with an average particle size of 46 nm as determined by scanning electronic microscopy (SEM) and dynamic light scattering (DLS) particle size analyzer respectively. FT-IR spectrum revealed the capping of the phytoconstituents, probably polyphenols from P. longum fruit extract and stabilizing the nanoparticles. Further the ferric ion reducing test, confirmed that the capping agents were condensed tannins. The aqueous P. longum fruit extract (PLFE) and the green synthesized silver nanoparticles (PLAgNPs) showed powerful antioxidant properties in in vitro antioxidant assays. The results from the antimicrobial assays suggested that green synthesized silver nanoparticles (PLAgNPs) were more potent against pathogenic bacteria than the P. longum fruit extract (PLFE) alone. The nanoparticles also showed potent cytotoxic effect against MCF-7 breast cancer cell lines with an IC 50 value of 67 μg/ml/24 h by the MTT assay. These results support the advantages of using bio-green method for synthesizing silver nanoparticles with antioxidant, antimicrobial and cytotoxic activities those are simple and cost effective as well. - Highlights: • 46 nm spherical shaped P. longum fruit silver nanoparticles was prepared. • Capping and reducing bioactive plant compounds with in nanoparticles were condensed tannins. • Particles are potent antioxidant and anti microbial in biological systems. • They are cytotoxic against MCF-7 cell lines
Energy Technology Data Exchange (ETDEWEB)
Reddy, N. Jayachandra; Nagoor Vali, D.; Rani, M.; Rani, S. Sudha, E-mail: sadrassudha@gmail.com
2014-01-01
Silver nanoparticles synthesized through bio-green method has been reported to have biomedical applications to control pathogenic microbes as it is cost effective compared to commonly used physical and chemical methods. In present study, silver nanoparticles were synthesized using aqueous Piper longum fruit extract (PLFE) and confirmed by UV–visible spectroscopy. The nanoparticles were spherical in shape with an average particle size of 46 nm as determined by scanning electronic microscopy (SEM) and dynamic light scattering (DLS) particle size analyzer respectively. FT-IR spectrum revealed the capping of the phytoconstituents, probably polyphenols from P. longum fruit extract and stabilizing the nanoparticles. Further the ferric ion reducing test, confirmed that the capping agents were condensed tannins. The aqueous P. longum fruit extract (PLFE) and the green synthesized silver nanoparticles (PLAgNPs) showed powerful antioxidant properties in in vitro antioxidant assays. The results from the antimicrobial assays suggested that green synthesized silver nanoparticles (PLAgNPs) were more potent against pathogenic bacteria than the P. longum fruit extract (PLFE) alone. The nanoparticles also showed potent cytotoxic effect against MCF-7 breast cancer cell lines with an IC 50 value of 67 μg/ml/24 h by the MTT assay. These results support the advantages of using bio-green method for synthesizing silver nanoparticles with antioxidant, antimicrobial and cytotoxic activities those are simple and cost effective as well. - Highlights: • 46 nm spherical shaped P. longum fruit silver nanoparticles was prepared. • Capping and reducing bioactive plant compounds with in nanoparticles were condensed tannins. • Particles are potent antioxidant and anti microbial in biological systems. • They are cytotoxic against MCF-7 cell lines.
Energy Technology Data Exchange (ETDEWEB)
Koo, Jeongboon; Lee, Jeongeun; Kim, Joonsoo; Jang, Boyun, E-mail: byjang@kier.re.kr
2016-09-01
We synthesized silicon (Si) nanoparticles using an atmospheric microwave plasma process, and investigated the effects of hydrogen (H{sub 2}) injection on their microstructure during the synthesis. Two nozzles were applied to inject H{sub 2} (swirling and rectilinear H{sub 2}). Our microstructural analysis indicated that the amount and method of H{sub 2} injection were critical for completion of the reaction from silicon tetrachloride (SiCl{sub 4}) to Si, as well as to obtain highly crystalline Si nanoparticles. The swirling H{sub 2} was especially critical due to its formation of vortex flow, which allowed relatively long residence time of the H-ions in plasma. The Si nanoparticles synthesized by the atmospheric plasma process had core-shell structures that consisted of crystalline Si cores with amorphous SiO{sub x} shells of 5–15 nm thickness. We also investigated the feasibility of the synthesized Si nanoparticles as anode materials in a lithium-ion battery (LIB). For the core-shell structured Si nanoparticles, we obtained the first reversible capacity of 1204 mAhg{sup −1}, and a capacity retention of 82.2% at the 50{sup th} cycle. - Highlights: • We synthesized Si nanoparticles by an atmospheric microwave plasma process. • We investigated the effects of injected H{sub 2} on the microstructures of Si nanoparticles. • Swirling H{sub 2} was critical, due to the formation of vortex flow in plasma. • The synthesized Si nanoparticles had core (crystalline Si)-shell (SiO{sub x}) structures. • The electrochemical properties depend on its core-shell structures as LIB anode.
Toye, Fran; Seers, Kate; Hannink, Erin; Barker, Karen
2017-08-01
Each year over five million people develop chronic non-malignant pain and can experience healthcare as an adversarial struggle. The aims of this study were: (1) to bring together qualitative evidence syntheses that explore patients' experience of living with chronic non-malignant pain and develop conceptual understanding of what it is like to live with chronic non-malignant pain for improved healthcare; (2) to undertake the first mega-ethnography of qualitative evidence syntheses using the methods of meta-ethnography. We used the seven stages of meta-ethnography refined for large studies. The innovation of mega-ethnography is to use conceptual findings from qualitative evidence syntheses as primary data. We searched 7 bibliographic databases from inception until February 2016 to identify qualitative evidence syntheses that explored patients' experience of living with chronic non-malignant pain. We identified 82 potential studies from 556 titles, screened 34 full text articles and included 11 qualitative evidence syntheses synthesising a total of 187 qualitative studies reporting more than 5000 international participants living with chronic pain. We abstracted concepts into 7 conceptual categories: (1) my life is impoverished and confined; (2) struggling against my body to be me; (3) the quest for the diagnostic 'holy grail'; (4) lost personal credibility; (5) trying to keep up appearances; (6) need to be treated with dignity; and (7) deciding to end the quest for the grail is not easy. Each conceptual category was supported by at least 7 of the 11 qualitative evidence syntheses. This is the first mega-ethnography, or synthesis of qualitative evidence syntheses using the methods of meta-ethnography. Findings help us to understand that the decision to end the quest for a diagnosis can leave patients feeling vulnerable and this may contribute to the adversarial nature of the clinical encounter. This knowledge demonstrates that treating a patient with a sense that they
Concrete embedded dye-synthesized photovoltaic solar cell.
Hosseini, T; Flores-Vivian, I; Sobolev, K; Kouklin, N
2013-09-25
This work presents the concept of a monolithic concrete-integrated dye-synthesized photovoltaic solar cell for optical-to-electrical energy conversion and on-site power generation. The transport measurements carried out in the dark revealed the presence of VOC of ~190 mV and ISC of ~9 μA, induced by the electrochemical conversion of concrete-supplied ionic impurities at the electrodes. The current-voltage measurements performed under illumination at incident optical powers of ~46 mW confirmed the generation of electrical power of ~0.64 μW with almost half generated via battery effect. This work presents a first step towards realizing the additional pathways to low-cost electrical power production in urban environments based on a combined use of organic dyes, nanotitania and concrete technology.
Synthesized Mammography: Clinical Evidence, Appearance, and Implementation.
Durand, Melissa A
2018-04-04
Digital breast tomosynthesis (DBT) has improved conventional mammography by increasing cancer detection while reducing recall rates. However, these benefits come at the cost of increased radiation dose. Synthesized mammography (s2D) has been developed to provide the advantages of DBT with nearly half the radiation dose. Since its F.D.A. approval, multiple studies have evaluated the clinical performance of s2D. In clinical practice, s2D images are not identical to conventional 2D images and are designed for interpretation with DBT as a complement. This article reviews the present literature to assess whether s2D is a practical alternative to conventional 2D, addresses the differences in mammographic appearance of findings, and provides suggestions for implementation into clinical practice.
DEFF Research Database (Denmark)
Willumsen, B M; Papageorge, A G; Hubbert, N
1985-01-01
or increasing it to 50 amino acids has relatively little effect on the capacity of the gene to induce morphological transformation of NIH 3T3 cells. Assays of GTP binding, GTPase and autophosphorylating activities of such mutant v-rasH-encoded proteins synthesized in bacteria indicated that the sequences...... that is required for post-translational processing, membrane localization and transforming activity of the proteins. We have now used the viral oncogene (v-rasH) of Harvey sarcoma virus to study the major variable region by deleting or duplicating parts of the gene. Reducing this region to five amino acids...... that encode these biochemical activities are located upstream from the major variable region. In the context of transformation, we propose that the region of sequence heterogeneity serves principally to connect the N-terminal catalytic domain with amino acids at the C terminus that are required to anchor...
Directory of Open Access Journals (Sweden)
Alhosna Benjdia
2017-11-01
Full Text Available Ribosomally-synthesized and post-translationally modified peptides (RiPPs are a large and diverse family of natural products. They possess interesting biological properties such as antibiotic or anticancer activities, making them attractive for therapeutic applications. In contrast to polyketides and non-ribosomal peptides, RiPPs derive from ribosomal peptides and are post-translationally modified by diverse enzyme families. Among them, the emerging superfamily of radical SAM enzymes has been shown to play a major role. These enzymes catalyze the formation of a wide range of post-translational modifications some of them having no counterparts in living systems or synthetic chemistry. The investigation of radical SAM enzymes has not only illuminated unprecedented strategies used by living systems to tailor peptides into complex natural products but has also allowed to uncover novel RiPP families. In this review, we summarize the current knowledge on radical SAM enzymes catalyzing RiPP post-translational modifications and discuss their mechanisms and growing importance notably in the context of the human microbiota.
Directory of Open Access Journals (Sweden)
Michal Lubas
2015-01-01
Full Text Available The RNA exosome complex constitutes the major nuclear eukaryotic 3′-5′ exonuclease. Outside of nucleoli, the human nucleoplasmic exosome is directed to some of its substrates by the nuclear exosome targeting (NEXT complex. How NEXT targets RNA has remained elusive. Using an in vivo crosslinking approach, we report global RNA binding sites of RBM7, a key component of NEXT. RBM7 associates broadly with RNA polymerase II-derived RNA, including pre-mRNA and short-lived exosome substrates such as promoter upstream transcripts (PROMPTs, enhancer RNAs (eRNAs, and 3′-extended products from snRNA and replication-dependent histone genes. Within pre-mRNA, RBM7 accumulates at the 3′ ends of introns, and pulse-labeling experiments demonstrate that RBM7/NEXT defines an early exosome-targeting pathway for 3′-extended snoRNAs derived from such introns. We propose that RBM7 is generally loaded onto newly synthesized RNA to accommodate exosome action in case of available unprotected RNA 3′ ends.
Energy Technology Data Exchange (ETDEWEB)
Samberg, Joshua P. [Department of Materials Science and Engineering, North Carolina State University, 911 Partners Way, Engineering Building I, Raleigh, NC 27695-7907 (United States); Kajbafvala, Amir, E-mail: amir.kajbafvala@gmail.com [Department of Materials Science and Engineering, North Carolina State University, 911 Partners Way, Engineering Building I, Raleigh, NC 27695-7907 (United States); Koolivand, Amir [Department of Chemistry, North Carolina State University, 2620 Yarbrough Drive, Raleigh, NC 27695 (United States)
2014-03-01
Graphical abstract: - Highlights: • Synthesis of PbO networks through a simple chemical precipitation route. • The synthesis method is rapid and low-cost. • Each network is composed of single crystalline PbO nanosheets. • A possible growth mechanism is proposed for synthesized PbO networks. - Abstract: For the field of energy storage, nanostructured lead oxide (PbO) shows immense potential for increased specific energy and deep discharge for lead acid battery technologies. In this work, PbO networks composed of single crystalline nanosheets were synthesized utilizing a simple, low cost and rapid chemical precipitation method. The PbO networks were prepared in a single reaction vessel from starting reagents of lead acetate dehydrate, ammonium hydroxide and deionized water. Lead acetate dehydrate was chosen as a reagent, as opposed to lead nitrate, to eliminate the possibility of nitrate contamination of the final product. X-ray diffraction (XRD) analysis, high resolution scanning electron microscopy (HRSEM) and high resolution transmission electron microscopy (HRTEM) analysis were used to characterize the synthesized PbO networks. The reproducible method described herein synthesized pure β-PbO (massicot) powders, with no byproducts. A possible formation mechanism for these PbO networks is proposed. The growth is found to proceed predominately in the 〈1 1 1〉 and 〈2 0 0〉 directions while being limited in the 〈0 1 1〉 direction.
International Nuclear Information System (INIS)
Samberg, Joshua P.; Kajbafvala, Amir; Koolivand, Amir
2014-01-01
Graphical abstract: - Highlights: • Synthesis of PbO networks through a simple chemical precipitation route. • The synthesis method is rapid and low-cost. • Each network is composed of single crystalline PbO nanosheets. • A possible growth mechanism is proposed for synthesized PbO networks. - Abstract: For the field of energy storage, nanostructured lead oxide (PbO) shows immense potential for increased specific energy and deep discharge for lead acid battery technologies. In this work, PbO networks composed of single crystalline nanosheets were synthesized utilizing a simple, low cost and rapid chemical precipitation method. The PbO networks were prepared in a single reaction vessel from starting reagents of lead acetate dehydrate, ammonium hydroxide and deionized water. Lead acetate dehydrate was chosen as a reagent, as opposed to lead nitrate, to eliminate the possibility of nitrate contamination of the final product. X-ray diffraction (XRD) analysis, high resolution scanning electron microscopy (HRSEM) and high resolution transmission electron microscopy (HRTEM) analysis were used to characterize the synthesized PbO networks. The reproducible method described herein synthesized pure β-PbO (massicot) powders, with no byproducts. A possible formation mechanism for these PbO networks is proposed. The growth is found to proceed predominately in the 〈1 1 1〉 and 〈2 0 0〉 directions while being limited in the 〈0 1 1〉 direction
A low-jitter RF PLL frequency synthesizer with high-speed mixed-signal down-scaling circuits
International Nuclear Information System (INIS)
Tang Lu; Wang Zhigong; Xue Hong; He Xiaohu; Xu Yong; Sun Ling
2010-01-01
A low-jitter RF phase locked loop (PLL) frequency synthesizer with high-speed mixed-signal down-scaling circuits is proposed. Several techniques are proposed to reduce the design complexity and improve the performance of the mixed-signal down-scaling circuit in the PLL. An improved D-latch is proposed to increase the speed and the driving capability of the DMP in the down-scaling circuit. Through integrating the D-latch with 'OR' logic for dual-modulus operation, the delays associated with both the 'OR' and D-flip-flop (DFF) operations are reduced, and the complexity of the circuit is also decreased. The programmable frequency divider of the down-scaling circuit is realized in a new method based on deep submicron CMOS technology standard cells and a more accurate wire-load model. The charge pump in the PLL is also realized with a novel architecture to improve the current matching characteristic so as to reduce the jitter of the system. The proposed RF PLL frequency synthesizer is realized with a TSMC 0.18-μm CMOS process. The measured phase noise of the PLL frequency synthesizer output at 100 kHz offset from the center frequency is only -101.52 dBc/Hz. The circuit exhibits a low RMS jitter of 3.3 ps. The power consumption of the PLL frequency synthesizer is also as low as 36 mW at a 1.8 V power supply. (semiconductor integrated circuits)
Effects of ultrasonic treatment on zeolite NaA synthesized from by-product silica.
Vaičiukynienė, Danutė; Kantautas, Aras; Vaitkevičius, Vitoldas; Jakevičius, Leonas; Rudžionis, Žymantas; Paškevičius, Mantas
2015-11-01
The synthesis of zeolite NaA from silica by-product was carried out in the presence of 20 kHz ultrasound at room temperature. Zeolites obtained in this type of synthesis were compared to zeolites obtained by performing conventional static syntheses under similar conditions. The sonication effects on zeolite NaA synthesis were characterized by phase identification, crystallinity etc. The effects of different parameters such as crystallization time and initial materials preparation methods on the crystallinity and morphology of the synthesized zeolites were investigated. The final products were characterized by XRD and FT-IR. It was possible to obtain crystalline zeolite NaA from by-product silica in the presence of ultrasound. Copyright © 2015 Elsevier B.V. All rights reserved.