
Sample records for maculans-brassica napus pathosystem

  1. Genomes and transcriptomes of partners in plant-fungal-interactions between canola (Brassica napus and two Leptosphaeria species.

    Directory of Open Access Journals (Sweden)

    Rohan G T Lowe

    Full Text Available Leptosphaeria maculans 'brassicae' is a damaging fungal pathogen of canola (Brassica napus, causing lesions on cotyledons and leaves, and cankers on the lower stem. A related species, L. biglobosa 'canadensis', colonises cotyledons but causes few stem cankers. We describe the complement of genes encoding carbohydrate-active enzymes (CAZys and peptidases of these fungi, as well as of four related plant pathogens. We also report dual-organism RNA-seq transcriptomes of these two Leptosphaeria species and B. napus during disease. During the first seven days of infection L. biglobosa 'canadensis', a necrotroph, expressed more cell wall degrading genes than L. maculans 'brassicae', a hemi-biotroph. L. maculans 'brassicae' expressed many genes in the Carbohydrate Binding Module class of CAZy, particularly CBM50 genes, with potential roles in the evasion of basal innate immunity in the host plant. At this time, three avirulence genes were amongst the top 20 most highly upregulated L. maculans 'brassicae' genes in planta. The two fungi had a similar number of peptidase genes, and trypsin was transcribed at high levels by both fungi early in infection. L. biglobosa 'canadensis' infection activated the jasmonic acid and salicylic acid defence pathways in B. napus, consistent with defence against necrotrophs. L. maculans 'brassicae' triggered a high level of expression of isochorismate synthase 1, a reporter for salicylic acid signalling. L. biglobosa 'canadensis' infection triggered coordinated shutdown of photosynthesis genes, and a concomitant increase in transcription of cell wall remodelling genes of the host plant. Expression of particular classes of CAZy genes and the triggering of host defence and particular metabolic pathways are consistent with the necrotrophic lifestyle of L. biglobosa 'canadensis', and the hemibiotrophic life style of L. maculans 'brassicae'.

  2. Attack modes and defence reactions in pathosystems involving Sclerotinia sclerotiorum, Brassica carinata, B. juncea and B. napus. (United States)

    Uloth, Margaret B; Clode, Peta L; You, Ming Pei; Barbetti, Martin J


    Sclerotinia stem rot (SSR, Sclerotinia sclerotiorum) is a damaging disease of oilseed brassicas world-wide. Host resistance is urgently needed to achieve control, yet the factors that contribute to stem resistance are not well understood. This study investigated the mechanisms of resistance to SSR. Stems of 5-week-old Brassica carinata, B. juncea and B. napus of known resistance were infected via filter paper discs impregnated with S. sclerotiorum mycelium under controlled conditions. Transverse sections of the stem and portions of the stem surface were examined using optical and scanning electron microscopy. The association of anatomical features with the severity of disease (measured by mean lesion length) was determined. Several distinct resistance mechanisms were recorded for the first time in these Brassica-pathogen interactions, including hypersensitive reactions and lignification within the stem cortex, endodermis and in tissues surrounding the lesions. Genotypes showing a strong lignification response 72 h post-infection (hpi) tended to have smaller lesions. Extensive vascular invasion by S. sclerotiorum was observed only in susceptible genotypes, especially in the vascular fibres and xylem. Mean lesion length was negatively correlated with the number of cell layers in the cortex, suggesting progress of S. sclerotiorum is impeded by more cell layers. Hyphae in the centre of lesions became highly vacuolate 72 hpi, reflecting an ageing process in S. sclerotiorum hyphal networks that was independent of host resistance. The infection process of S. sclerotiorum was analogous in B. carinata and B. napus. Infection cushions of the highly virulent isolate of S. sclerotiorum MBRS-1 were grouped together in dense parallel bundles, while hyphae in the infection cushions of a less aggressive isolate WW-3 were more diffuse, and this was unaffected by host genotype. A variety of mechanisms contribute to host resistance against S. sclerotiorum across the three

  3. Different myrosinase and idioblast distribution in Arabidopsis and Brassica napus

    DEFF Research Database (Denmark)

    Andreasson, Erik; Jørgensen, Lise Bolt; Höglund, Anna-Stina


    Arabidopsis, Brassica napus, Myrosinase, Myrosinase Binding Protein, Glucosinolates, Myrosin Cell, Immunocytochemistry......Arabidopsis, Brassica napus, Myrosinase, Myrosinase Binding Protein, Glucosinolates, Myrosin Cell, Immunocytochemistry...

  4. NAPUS 2000 Rapeseed (Brassica napus breeding for improved human nutrition

    Directory of Open Access Journals (Sweden)

    Friedt Wolfgang


    Full Text Available Following a competition announcement of the Federal Ministry of Research and Education (BMBF a project dealing with the improvement of the nutritional value of oilseed rape (Brassica napus for food applications and human nutrition was worked out and started in autumn 1999. A number of partners (Figure 2 are carrying out a complex project reaching from the discovery, characterisation, isolation and transfer of genes of interest up to breeding of well performing varieties combined with important agronomic traits. Economic studies and processing trials as well as nutritional investigations of the new qualities are undertaken. B. napus seed quality aspects with respect to seed coat colour, oil composition, lecithin and protein fractions and antioxidants like tocopherols and resveratrol will be improved.

  5. Current and future molecular approaches to investigate the white pine blister rust pathosystem (United States)

    B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein


    Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...

  6. Suppressiveness of 18 composts against 7 pathosystems: Variability in pathogen response

    NARCIS (Netherlands)

    Termorshuizen, A.J.; Rijn, van E.; Gaag, van der D.J.; Alabouvette, C.; Chen, Y.; Lagerlöf, J.; Malandrakis, A.A.; Paplomatas, E.J.; Rämert, B.; Ryckeboer, J.; Steinberg, C.; Zmora-Nahum, S.


    Compost is often reported as a substrate that is able to suppress soilborne plant pathogens, but suppression varies according to the type of compost and pathosystem. Reports often deal with a single pathogen while in reality crops are attacked by multiple plant pathogens. The goal of the present

  7. Characterization of a Francisella tularensis-Caenorhabditis elegans Pathosystem for the Evaluation of Therapeutic Compounds


    Jayamani, Elamparithi; Tharmalingam, Nagendran; Rajamuthiah, Rajmohan; Coleman, Jeffrey J.; Kim, Wooseong; Okoli, Ikechukwu; Hernandez, Ana M.; Lee, Kiho; Nau, Gerard J.; Ausubel, Frederick M.; Mylonakis, Eleftherios


    Francisella tularensis is a highly infectious Gram-negative intracellular pathogen that causes tularemia. Because of its potential as a bioterrorism agent, there is a need for new therapeutic agents. We therefore developed a whole-animal Caenorhabditis elegans-F. tularensis pathosystem for high-throughput screening to identify and characterize potential therapeutic compounds. We found that the C. elegans p38 mitogen-activate protein (MAP) kinase cascade is involved in the immune response to F...

  8. Cultivar Variation in Hormonal Balance Is a Significant Determinant of Disease Susceptibility to Xanthomonas campestris pv. campestris in Brassica napus

    Directory of Open Access Journals (Sweden)

    Md. Tabibul Islam


    Full Text Available This study aimed to directly elucidate cultivar variation in disease susceptibility and disease responses in relation to hormonal status in the interaction of Brassica napus cultivars and Xanthomonas campestris pv. campestris (Xcc, the causal agent of black rot disease. Fully expanded leaves of six B. napus cultivars (cvs. Capitol, Youngsan, Saturnin, Colosse, Tamra, and Mosa were inoculated with Xcc. At 14 days post-inoculation with Xcc, cultivar variation in susceptibility or resistance was interpreted with defense responses as estimated by redox status, defensive metabolites, and expression of phenylpropanoid synthesis-related genes in relation to endogenous hormonal status. Disease susceptibility of six cultivars was distinguished by necrotic lesions in the Xcc-inoculated leaves and characterized concurrently based on the higher increase in reactive oxygen species and lipid peroxidation. Among these cultivars, as the susceptibility was higher, the ratios of abscisic acid (ABA/jasmonic acid (JA and salicylic acid (SA/JA tended to increase with enhanced expression of SA signaling regulatory gene NPR1 and transcriptional factor TGA1 and antagonistic suppression of JA-regulated gene PDF 1.2. In the resistant cultivar (cv. Capitol, accumulation of defensive metabolites with enhanced expression of genes involved in flavonoids (chalcone synthase, proanthocyanidins (anthocyanidin reductase, and hydroxycinnamic acids (ferulate-5-hydroxylase biosynthesis and higher redox status were observed, whereas the opposite results were obtained for susceptible cultivars (cvs. Mosa and Tamra. These results clearly indicate that cultivar variation in susceptibility to infection by Xcc was determined by enhanced alteration of the SA/JA ratio, as a negative regulator of redox status and phenylpropanoid synthesis in the Brasica napus–Xcc pathosystem.

  9. Phenotyping of Brassica napus for high oil content (United States)

    Multi-trait and multi-growth stage phenotyping may improve our ability to assess the dynamic changes in the B. napus phenome under spatiotemporal field conditions. A minimum set of phenotypic traits that can integrate ontogeny and architecture of Brassica napus L. is required for breeding and select...

  10. Isolation of an ascorbate peroxidase in Brassica napus and analysis ...

    African Journals Online (AJOL)



    Apr 5, 2010 ... domain; APX, ascorbate peroxidase; Bn-APX, Brassica napus ascorbate ... Brassica napus, which is widely grown as the oilseed crop of rape or canola, .... grew on the SD-Leu-Trp-His-Ade medium and were verified by PCR.

  11. Biotrophy at Its Best: Novel Findings and Unsolved Mysteries of the Arabidopsis-Powdery Mildew Pathosystem. (United States)

    Kuhn, Hannah; Kwaaitaal, Mark; Kusch, Stefan; Acevedo-Garcia, Johanna; Wu, Hongpo; Panstruga, Ralph


    It is generally accepted in plant-microbe interactions research that disease is the exception rather than a common outcome of pathogen attack. However, in nature, plants with symptoms that signify colonization by obligate biotrophic powdery mildew fungi are omnipresent. The pervasiveness of the disease and the fact that many economically important plants are prone to infection by powdery mildew fungi drives research on this interaction. The competence of powdery mildew fungi to establish and maintain true biotrophic relationships renders the interaction a paramount example of a pathogenic plant-microbe biotrophy. However, molecular details underlying the interaction are in many respects still a mystery. Since its introduction in 1990, the Arabidopsis-powdery mildew pathosystem has become a popular model to study molecular processes governing powdery mildew infection. Due to the many advantages that the host Arabidopsis offers in terms of molecular and genetic tools this pathosystem has great capacity to answer some of the questions of how biotrophic pathogens overcome plant defense and establish a persistent interaction that nourishes the invader while in parallel maintaining viability of the plant host.

  12. Genetics of Resistance and Pathogenicity in the Maize/Setosphaeria turcica Pathosystem and Implications for Breeding

    Directory of Open Access Journals (Sweden)

    Ana L. Galiano-Carneiro


    Full Text Available Northern corn leaf blight (NCLB, the most devastating leaf pathogen in maize (Zea mays L., is caused by the heterothallic ascomycete Setosphaeria turcica. The pathogen population shows an extremely high genetic diversity in tropical and subtropical regions. Varietal resistance is the most efficient technique to control NCLB. Host resistance can be qualitative based on race-specific Ht genes or quantitative controlled by many genes with small effects. Quantitative resistance is moderately to highly effective and should be more durable combatting all races of the pathogen. Quantitative resistance must, however, be analyzed in many environments (= location × year combinations to select stable resistances. In the tropical and subtropical environments, quantitative resistance is the preferred option to manage NCLB epidemics. Resistance level can be increased in practical breeding programs by several recurrent selection cycles based on disease severity rating and/or by genomic selection. This review aims to address two important aspects of the NCLB pathosystem: the genetics of the fungus S. turcica and the modes of inheritance of the host plant maize, including successful breeding strategies regarding NCLB resistance. Both drivers of this pathosystem, pathogen, and host, must be taken into account to result in more durable resistance.

  13. Interaction between the moss Physcomitrella patens and Phytophthora : a novel pathosystem for live-cell imaging of subcellular defence

    NARCIS (Netherlands)

    Overdijk, Elysa J R; DE Keijzer, Jeroen; DE Groot, Deborah; Schoina, Charikleia; Bouwmeester, K.; Ketelaar, Tijs; Govers, Francine

    Live-cell imaging of plant-pathogen interactions is often hampered by the tissue complexity and multicell layered nature of the host. Here, we established a novel pathosystem with the moss Physcomitrella patens as host for Phytophthora. The tip-growing protonema cells of this moss are ideal for

  14. Recognitional specificity and evolution in the tomato-Cladosporium fulvum pathosystem. (United States)

    Wulff, B B H; Chakrabarti, A; Jones, D A


    The interactions between plants and many biotrophic or hemibiotrophic pathogens are controlled by receptor proteins in the host and effector proteins delivered by the pathogen. Pathogen effectors facilitate pathogen growth through the suppression of host defenses and the manipulation of host metabolism, but recognition of a pathogen-effector protein by a host receptor enables the host to activate a suite of defense mechanisms that limit pathogen growth. In the tomato (Lycopersicon esculentum syn. Solanum lycopersicum)-Cladosporium fulvum (leaf mold fungus syn. Passalora fulva) pathosystem, the host receptors are plasma membrane-anchored, leucine-rich repeat, receptor-like proteins encoded by an array of Cf genes conferring resistance to C. fulvum. The pathogen effectors are mostly small, secreted, cysteine-rich, but otherwise largely dissimilar, extracellular proteins encoded by an array of avirulence (Avr) genes, so called because of their ability to trigger resistance and limit pathogen growth when the corresponding Cf gene is present in tomato. A number of Cf and Avr genes have been isolated, and details of the complex molecular interplay between tomato Cf proteins and C. fulvum effector proteins are beginning to emerge. Each effector appears to have a different role; probably most bind or modify different host proteins, but at least one has a passive role masking the pathogen. It is, therefore, not surprising that each effector is probably detected in a distinct and specific manner, some by direct binding, others as complexes with host proteins, and others via their modification of host proteins. The two papers accompanying this review contribute further to our understanding of the molecular specificity underlying effector perception by Cf proteins. This review, therefore, focuses on our current understanding of recognitional specificity in the tomato-C. fulvum pathosystem and highlights some of the critical questions that remain to be addressed. It also

  15. Citric acid assisted phytoremediation of copper by Brassica napus L. (United States)

    Zaheer, Ihsan Elahi; Ali, Shafaqat; Rizwan, Muhammad; Farid, Mujahid; Shakoor, Muhammad Bilal; Gill, Rafaqa Ali; Najeeb, Ullah; Iqbal, Naeem; Ahmad, Rehan


    Use of organic acids for promoting heavy metals phytoextraction is gaining worldwide attention. The present study investigated the influence of citric acid (CA) in enhancing copper (Cu) uptake by Brassica napus L. seedlings. 6 Weeks old B. napus seedlings were exposed to different levels of copper (Cu, 0, 50 and 100µM) alone or with CA (2.5mM) in a nutrient medium for 40 days. Exposure to elevated Cu levels (50 and 100µM) significantly reduced the growth, biomass production, chlorophyll content, gas exchange attributes and soluble proteins of B. napus seedlings. In addition, Cu toxicity increased the production of hydrogen peroxide (H2O2), malondialdehyde (MDA) and electrolyte leakage (EL) in leaf and root tissues of B. napus. Activities of antioxidant enzymes such as guaiacol peroxidase (POD), superoxide dismutase (SOD), catalases (CAT), ascorbate peroxidase (APX) in root and shoot tissues of B. napus were increased in response to lower Cu concentration (50µM) but increased under higher Cu concentration (100µM). Addition of CA into nutrient medium significantly alleviated Cu toxicity effects on B. napus seedlings by improving photosynthetic capacity and ultimately plant growth. Increased activities of antioxidant enzymes in CA-treated plants seems to play a role in capturing of stress-induced reactive oxygen species as was evident from lower level of H2O2, MDA and EL in CA-treated plants. Increasing Cu concentration in the nutrient medium significantly increased Cu concentration in in B. napus tissues. Cu uptake was further increased by CA application. These results suggested that CA might be a useful strategy for increasing phytoextraction of Cu from contaminated soils. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Co-evolutionary interactions between host resistance and pathogen avirulence genes in rice-Magnaporthe oryzae pathosystem. (United States)

    Singh, Pankaj Kumar; Ray, Soham; Thakur, Shallu; Rathour, Rajeev; Sharma, Vinay; Sharma, Tilak Raj


    Rice and Magnaporthe oryzae constitutes an ideal pathosystem for studying host-pathogen interaction in cereals crops. There are two alternative hypotheses, viz. Arms race and Trench warfare, which explain the co-evolutionary dynamics of hosts and pathogens which are under continuous confrontation. Arms race proposes that both R- and Avr- genes of host and pathogen, respectively, undergo positive selection. Alternatively, trench warfare suggests that either R- or Avr- gene in the pathosystem is under balanced selection intending to stabilize the genetic advantage gained over the opposition. Here, we made an attempt to test the above-stated hypotheses in rice-M. oryzae pathosystem at loci of three R-Avr gene pairs, Piz-t-AvrPiz-t, Pi54-AvrPi54 and Pita-AvrPita using allele mining approach. Allele mining is an efficient way to capture allelic variants existing in the population and to study the selective forces imposed on the variants during evolution. Results of nucleotide diversity, neutrality statistics and phylogenetic analyses reveal that Piz-t, Pi54 and AvrPita are diversified and under positive selection at their corresponding loci, while their counterparts, AvrPiz-t, AvrPi54 and Pita are conserved and under balancing selection, in nature. These results imply that rice-M. oryzae populations are engaged in a trench warfare at least at the three R/Avr loci studied. It is a maiden attempt to study the co-evolution of three R-Avr gene pairs in this pathosystem. Knowledge gained from this study will help in understanding the evolutionary dynamics of host-pathogen interaction in a better way and will also aid in developing new durable blast resistant rice varieties in future. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Laurel Wilt in Natural and Agricultural Ecosystems: Understanding the Drivers and Scales of Complex Pathosystems

    Directory of Open Access Journals (Sweden)

    Randy C. Ploetz


    Full Text Available Laurel wilt kills members of the Lauraceae plant family in the southeastern United States. It is caused by Raffaelea lauricola T.C. Harr., Fraedrich and Aghayeva, a nutritional fungal symbiont of an invasive Asian ambrosia beetle, Xyleborus glabratus Eichhoff, which was detected in Port Wentworth, Georgia, in 2002. The beetle is the primary vector of R. lauricola in forests along the southeastern coastal plain of the United States, but other ambrosia beetle species that obtained the pathogen after the initial introduction may play a role in the avocado (Persea americana Miller pathosystem. Susceptible taxa are naïve (new-encounter hosts that originated outside Asia. In the southeastern United States, over 300 million trees of redbay (P. borbonia (L. Spreng. have been lost, and other North American endemics, non-Asian ornamentals and avocado—an important crop that originated in MesoAmerica—are also affected. However, there are no reports of laurel wilt on the significant number of lauraceous endemics that occur in the Asian homeland of R. lauricola and X. glabratus; coevolved resistance to the disease in the region has been hypothesized. The rapid spread of laurel wilt in the United States is due to an efficient vector, X. glabratus, and the movement of wood infested with the insect and pathogen. These factors, the absence of fully resistant genotypes, and the paucity of effective control measures severely constrain the disease’s management in forest ecosystems and avocado production areas.

  18. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    Brassica napus L. (canola, rapeseed) is one of the most important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and thought to have originated from a cross where the maternal donor was closely related to two diploid species, B. oleracea (CC, 2n = 18) and B. rapa (AA, 2n = 20). Here, molecular ...

  19. Factors affecting the density of Brassica napus seeds

    NARCIS (Netherlands)

    Young, L.; Jalink, H.; Denkert, R.; Reaney, M.


    Brassica napus seed is composed of low density oil (0.92 and higher density solids (1.3-1.45 Seed buoyant density may potentially be used to determine seed oil content and to separate seeds with different oil contents, however, we have found that seeds with the lowest buoyant

  20. Immunopurification and characterization of a rape ( Brassica napus L.)

    African Journals Online (AJOL)

    Lipase or triacylglycerol acylhydrolase (E.C. was purified to homogeneity from rapeseed-germinated cotyledons (Brassica napus L.). The purification scheme involved homogenization, centrifugation, ultracentrifugation and affinity chromatography using polyclonal antibodies raised against porcine pancreatic lipase.

  1. Characterization of a Francisella tularensis-Caenorhabditis elegans Pathosystem for the Evaluation of Therapeutic Compounds (United States)

    Jayamani, Elamparithi; Tharmalingam, Nagendran; Rajamuthiah, Rajmohan; Kim, Wooseong; Okoli, Ikechukwu; Hernandez, Ana M.; Lee, Kiho; Nau, Gerard J.; Ausubel, Frederick M.


    ABSTRACT Francisella tularensis is a highly infectious Gram-negative intracellular pathogen that causes tularemia. Because of its potential as a bioterrorism agent, there is a need for new therapeutic agents. We therefore developed a whole-animal Caenorhabditis elegans-F. tularensis pathosystem for high-throughput screening to identify and characterize potential therapeutic compounds. We found that the C. elegans p38 mitogen-activate protein (MAP) kinase cascade is involved in the immune response to F. tularensis, and we developed a robust F. tularensis-mediated C. elegans killing assay with a Z′ factor consistently of >0.5, which was then utilized to screen a library of FDA-approved compounds that included 1,760 small molecules. In addition to clinically used antibiotics, five FDA-approved drugs were also identified as potential hits, including the anti-inflammatory drug diflunisal that showed anti-F. tularensis activity in vitro. Moreover, the nonsteroidal anti-inflammatory drug (NSAID) diflunisal, at 4× MIC, blocked the replication of an F. tularensis live vaccine strain (LVS) in primary human macrophages and nonphagocytic cells. Diflunisal was nontoxic to human erythrocytes and HepG2 human liver cells at concentrations of ≥32 μg/ml. Finally, diflunisal exhibited synergetic activity with the antibiotic ciprofloxacin in both a checkerboard assay and a macrophage infection assay. In conclusion, the liquid C. elegans-F. tularensis LVS assay described here allows screening for anti-F. tularensis compounds and suggests that diflunisal could potentially be repurposed for the management of tularemia. PMID:28652232

  2. RNA-Seq analysis of the Sclerotinia homoeocarpa--creeping bentgrass pathosystem.

    Directory of Open Access Journals (Sweden)

    Angela M Orshinsky

    Full Text Available Sclerotinia homoeocarpa causes dollar spot disease, the predominate disease on highly-maintained turfgrass. Currently, there are major gaps in our understanding of the molecular interactions between S. homoeocarpa and creeping bentgrass. In this study, 454 sequencing technology was used in the de novo assembly of S. homoeocarpa and creeping bentgrass transcriptomes. Transcript sequence data obtained using Illumina's first generation sequencing-by-synthesis (SBS were mapped to the transcriptome assemblies to estimate transcript representation in different SBS libraries. SBS libraries included a S. homoeocarpa culture control, a creeping bentgrass uninoculated control, and a library for creeping bentgrass inoculated with S. homoeocarpa and incubated for 96 h. A Fisher's exact test was performed to determine transcripts that were significantly different during creeping bentgrass infection with S. homoeocarpa. Fungal transcripts of interest included glycosyl hydrolases, proteases, and ABC transporters. Of particular interest were the large number of glycosyl hydrolase transcripts that target a wide range of plant cell wall compounds, corroborating the suggested wide host range and saprophytic abilities of S. homoeocarpa. Several of the multidrug resistance ABC transporters may be important for resistance to both fungicides and plant defense compounds. Creeping bentgrass transcripts of interest included germins, ubiquitin transcripts involved in proteasome degradation, and cinnamoyl reductase, which is involved in lignin production. This analysis provides an extensive overview of the S. homoeocarpa-turfgrass pathosystem and provides a starting point for the characterization of potential virulence factors and host defense responses. In particular, determination of important host defense responses may assist in the development of highly resistant creeping bentgrass varieties.

  3. Characterization of a Francisella tularensis-Caenorhabditis elegans Pathosystem for the Evaluation of Therapeutic Compounds. (United States)

    Jayamani, Elamparithi; Tharmalingam, Nagendran; Rajamuthiah, Rajmohan; Coleman, Jeffrey J; Kim, Wooseong; Okoli, Ikechukwu; Hernandez, Ana M; Lee, Kiho; Nau, Gerard J; Ausubel, Frederick M; Mylonakis, Eleftherios


    Francisella tularensis is a highly infectious Gram-negative intracellular pathogen that causes tularemia. Because of its potential as a bioterrorism agent, there is a need for new therapeutic agents. We therefore developed a whole-animal Caenorhabditis elegans - F. tularensis pathosystem for high-throughput screening to identify and characterize potential therapeutic compounds. We found that the C. elegans p38 mitogen-activate protein (MAP) kinase cascade is involved in the immune response to F. tularensis , and we developed a robust F. tularensis -mediated C. elegans killing assay with a Z' factor consistently of >0.5, which was then utilized to screen a library of FDA-approved compounds that included 1,760 small molecules. In addition to clinically used antibiotics, five FDA-approved drugs were also identified as potential hits, including the anti-inflammatory drug diflunisal that showed anti- F. tularensis activity in vitro Moreover, the nonsteroidal anti-inflammatory drug (NSAID) diflunisal, at 4× MIC, blocked the replication of an F. tularensis live vaccine strain (LVS) in primary human macrophages and nonphagocytic cells. Diflunisal was nontoxic to human erythrocytes and HepG2 human liver cells at concentrations of ≥32 μg/ml. Finally, diflunisal exhibited synergetic activity with the antibiotic ciprofloxacin in both a checkerboard assay and a macrophage infection assay. In conclusion, the liquid C. elegans - F. tularensis LVS assay described here allows screening for anti- F. tularensis compounds and suggests that diflunisal could potentially be repurposed for the management of tularemia. Copyright © 2017 American Society for Microbiology.

  4. The Arabidopsis thaliana-Alternaria brassicicola pathosystem: A model interaction for investigating seed transmission of necrotrophic fungi

    Directory of Open Access Journals (Sweden)

    Pochon Stephanie


    Full Text Available Abstract Background Seed transmission constitutes a major component of the parasitic cycle for several fungal pathogens. However, very little is known concerning fungal or plant genetic factors that impact seed transmission and mechanisms underlying this key biological trait have yet to be clarified. Such lack of available data could be probably explained by the absence of suitable model pathosystem to study plant-fungus interactions during the plant reproductive phase. Results Here we report on setting up a new pathosystem that could facilitate the study of fungal seed transmission. Reproductive organs of Arabidopsis thaliana were inoculated with Alternaria brassicicola conidia. Parameters (floral vs fruit route, seed collection date, plant and silique developmental stages that could influence the seed transmission efficiency were tested to define optimal seed infection conditions. Microscopic observations revealed that the fungus penetrates siliques through cellular junctions, replum and stomata, and into seed coats either directly or through cracks. The ability of the osmosensitive fungal mutant nik1Δ3 to transmit to A. thaliana seeds was analyzed. A significant decrease in seed transmission rate was observed compared to the wild-type parental strain, confirming that a functional osmoregulation pathway is required for efficient seed transmission of the fungus. Similarly, to test the role of flavonoids in seed coat protection against pathogens, a transparent testa Arabidopsis mutant (tt4-1 not producing any flavonoid was used as host plant. Unexpectedly, tt4-1 seeds were infected to a significantly lower extent than wild-type seeds, possibly due to over-accumulation of other antimicrobial metabolites. Conclusions The Arabidopsis thaliana-Alternaria brassicicola pathosystem, that have been widely used to study plant-pathogen interactions during the vegetative phase, also proved to constitute a suitable model pathosystem for detailed analysis

  5. Molecular regulation and genetic improvement of seed oil content in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Wei HUA,Jing LIU,Hanzhong WANG


    Full Text Available As an important oil crop and a potential bioenergy crop, Brassica napus L. is becoming a model plant for basic research on seed lipid biosynthesis as well as seed oil content, which has always been the key breeding objective. In this review, we present current progress in understanding of the regulation of oil content in B. napus, including genetics, biosynthesis pathway, transcriptional regulation, maternal effects and QTL analysis. Furthermore, the history of breeding for high oil content in B. napus is summarized and the progress in breeding ultra-high oil content lines is described. Finally, prospects for breeding high oil content B. napus cultivars are outlined.

  6. Interaction between the moss Physcomitrella patens and Phytophthora: a novel pathosystem for live-cell imaging of subcellular defence. (United States)

    Overdijk, Elysa J R; DE Keijzer, Jeroen; DE Groot, Deborah; Schoina, Charikleia; Bouwmeester, Klaas; Ketelaar, Tijs; Govers, Francine


    Live-cell imaging of plant-pathogen interactions is often hampered by the tissue complexity and multicell layered nature of the host. Here, we established a novel pathosystem with the moss Physcomitrella patens as host for Phytophthora. The tip-growing protonema cells of this moss are ideal for visualizing interactions with the pathogen over time using high-resolution microscopy. We tested four Phytophthora species for their ability to infect P. patens and showed that P. sojae and P. palmivora were only rarely capable to infect P. patens. In contrast, P. infestans and P. capsici frequently and successfully penetrated moss protonemal cells, showed intracellular hyphal growth and formed sporangia. Next to these successful invasions, many penetration attempts failed. Here the pathogen was blocked by a barrier of cell wall material deposited in papilla-like structures, a defence response that is common in higher plants. Another common response is the upregulation of defence-related genes upon infection and also in moss we observed this upregulation in tissues infected with Phytophthora. For more advanced analyses of the novel pathosystem we developed a special set-up that allowed live-cell imaging of subcellular defence processes by high-resolution microscopy. With this set-up, we revealed that Phytophthora infection of moss induces repositioning of the nucleus, accumulation of cytoplasm and rearrangement of the actin cytoskeleton, but not of microtubules. © 2016 The Authors Journal of Microscopy © 2016 Royal Microscopical Society.

  7. Genetic differentiation among sexually compatible relatives of Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Pipan Barbara


    Full Text Available Analysis of gene flow between Brassica napus L. and its sexually compatible relatives that could be found in the wild in Slovenia was performed by microsatellite analysis using fifteen selected primer pairs. Genotypes included in the study were obtained from the field survey of sexually compatible relatives of B. napus in natural habitats around Slovenia and from reference collections. Two different wild species of all the presented sexually compatible relatives of B. napus were found in Slovenia, B. rapa and Sinapis arvensis. The reference genotypes included varieties and wild forms from internal collections as marketable seeds or from gene banks. Reference genotypes were represented by the following species and subspecies: B. napus ssp. napobrassica, B. napus ssp. napus, B. nigra, B. oleracea, B. rapa ssp. oleifera, Diplotaxis muralis; D. tenuifolia, Raphanus raphanistrum, R. sativus, R. sativus var. oleiformis, Rapistrum rugosum, S. alba and S. arvensis. Estimation of gene flow described by average number of migrants was 0.72 followed by 0.20 migrants. Due to the observed gene migrations, genetic drift and selection, Hardy-Weinberg equilibrium was not met. The mean number of alleles over all loci was 16.9, the average polymorphic information content was 0.43. We found four highly divergent and polymorphic loci (Na12-C08, Na10-A08, Ni3-G04b and BRMS-050 at statistically significant level (p<0.05 of gene flow detected. Over all gene diversity intra-individual among populations (0.55 was lower than inter-individual among population (0.77. The results of genetic linkages based standard genetic distance and unweighted pair group method with arithmetic mean clustering method, generally divided the genotypes in three divergent groups. Similar results were obtained by principal coordinate analysis where three main groups were constructed according to three factors. A real number of genetic clusters demonstrated a clear separation between populations

  8. A novel Arabidopsis-oomycete pathosystem; differential interactions with Phytophthora capsici reveal a role for camalexin, indole glucosinolates and salicylic acid in defense

    NARCIS (Netherlands)

    Wang, Y.; Bouwmeester, K.; Mortel, van de J.E.; Shan, W.; Govers, F.


    Phytophthora capsici causes devastating diseases on a broad range of plant species. To better understand the interaction with its host plants, knowledge obtained from a model pathosystem can be instrumental. Here, we describe the interaction between P.¿capsici and Arabidopsis and the exploitation of

  9. Comparative analysis among the small RNA populations of source, sink and conductive tissues in two different plant-virus pathosystems. (United States)

    Herranz, Mari Carmen; Navarro, Jose Antonio; Sommen, Evelien; Pallas, Vicente


    In plants, RNA silencing plays a fundamental role as defence mechanism against viruses. During last years deep-sequencing technology has allowed to analyze the sRNA profile of a large variety of virus-infected tissues. Nevertheless, the majority of these studies have been restricted to a unique tissue and no comparative analysis between phloem and source/sink tissues has been conducted. In the present work, we compared the sRNA populations of source, sink and conductive (phloem) tissues in two different plant virus pathosystems. We chose two cucurbit species infected with two viruses very different in genome organization and replication strategy; Melon necrotic spot virus (MNSV) and Prunus necrotic ringspot virus (PNRSV). Our findings showed, in both systems, an increase of the 21-nt total sRNAs together with a decrease of those with a size of 24-nt in all the infected tissues, except for the phloem where the ratio of 21/24-nt sRNA species remained constant. Comparing the vsRNAs, both PNRSV- and MNSV-infected plants share the same vsRNA size distribution in all the analyzed tissues. Similar accumulation levels of sense and antisense vsRNAs were observed in both systems except for roots that showed a prevalence of (+) vsRNAs in both pathosystems. Additionally, the presence of overrepresented discrete sites along the viral genome, hot spots, were identified and validated by stem-loop RT-PCR. Despite that in PNRSV-infected plants the presence of vsRNAs was scarce both viruses modulated the host sRNA profile. We compare for the first time the sRNA profile of four different tissues, including source, sink and conductive (phloem) tissues, in two plant-virus pathosystems. Our results indicate that antiviral silencing machinery in melon and cucumber acts mainly through DCL4. Upon infection, the total sRNA pattern in phloem remains unchanged in contrast to the rest of the analyzed tissues indicating a certain tissue-tropism to this polulation. Independently of the

  10. Occurrence of metaxenia and false hybrids in Brassica juncea L. cv. Kikarashina × B. napus (United States)

    Tsuda, Mai; Konagaya, Ken-ichi; Okuzaki, Ayako; Kaneko, Yukio; Tabei, Yutaka


    Imported genetically modified (GM) canola (Brassica napus) is approved by Japanese law. Some GM canola varieties have been found around importation sites, and there is public concern that these may have any harmful effects on related species such as reduction of wild relatives. Because B. juncea is distributed throughout Japan and is known to be high crossability with B. napus, it is assumed to be a recipient of B. napus. However, there are few reports for introgression of cross-combination in B. juncea × B. napus. To assess crossability, we artificially pollinated B. juncea with B. napus. After harvesting a large number of progeny seeds, we observed false hybrids and metaxenia of seed coats. Seed coat color was classified into four categories and false hybrids were confirmed by morphological characteristics and random amplified polymorphic DNA (RAPD) markers. Furthermore, the occurrence of false hybrids was affected by varietal differences in B. napus, whereas that of metaxenia was related to hybridity. Therefore, we suggest that metaxenia can be used as a marker for hybrid identification in B. juncea L. cv. Kikarashina × B. napus. Our results suggest that hybrid productivity in B. juncea × B. napus should not be evaluated by only seed productivity, crossability ought to be assessed the detection of true hybrids. PMID:23136472

  11. Phytoextraction with Brassica napus L.: A tool for sustainable management of heavy metal contaminated soils.

    NARCIS (Netherlands)

    Grispen, V.M.J.; Nelissen, H.J.M.; Verkleij, J.A.C.


    Phytoextraction is a promising tool to extract metals from contaminated soils and Brassica napus L. seems to be a possible candidate species for this purpose. To select accessions with the ability to accumulate cadmium, hydroponically grown 21 day old seedlings of 77 B. napus L. accessions were

  12. GISH and AFLP analyses of novel Brassica napus lines derived from one hybrid between B. napus and Orychophragmus violaceus. (United States)

    Ma, Ni; Li, Zai-Yun; Cartagena, J A; Fukui, K


    New Brassica napus inbred lines with different petal colors and with canola quality and increased levels of oleic (approximately 70%, 10% higher than that of B. napus parent) and linoleic (28%) acids have been developed in the progenies of one B. napus cv. Oro x Orychophragmus violaceus F5 hybrid plant (2n = 31). Their genetic constituents were analyzed by using the methods of genomic in situ hybridization (GISH) and amplified fragments length polymorphism (AFLP). No intact chromosomes of O. violaceus origin were detected by GISH in their somatic cells of ovaries and root tips (2n = 38) and pollen mother cells (PMCs) with normal chromosome pairing (19 bivalents) and segregation (19:19), though signals of variable sizes and intensities were located mainly at terminal and centromeric parts of some mitotic chromosomes and meiotic bivalents at diakinesis or chromosomes in anaphase I groups and one large patch of chromatin was intensively labeled and separated spatially in some telophase I nuclei and metaphase II PMCs. AFLP analysis revealed that substantial genomic changes have occurred in these lines and O. violaceus-specific bands, deleted bands in 'Oro' and novel bands for two parents were detected. The possible mechanisms for these results were discussed.

  13. Origins of the amphiploid species Brassica napus L. investigated by chloroplast and nuclear molecular markers

    Directory of Open Access Journals (Sweden)

    Allender Charlotte J


    Full Text Available Abstract Background The amphiploid species Brassica napus (oilseed rape, Canola is a globally important oil crop yielding food, biofuels and industrial compounds such as lubricants and surfactants. Identification of the likely ancestors of each of the two genomes (designated A and C found in B. napus would facilitate incorporation of novel alleles from the wider Brassica genepool in oilseed rape crop genetic improvement programmes. Knowledge of the closest extant relatives of the genotypes involved in the initial formation of B. napus would also allow further investigation of the genetic factors required for the formation of a stable amphiploid and permit the more efficient creation of fully fertile re-synthesised B. napus. We have used a combination of chloroplast and nuclear genetic markers to investigate the closest extant relatives of the original maternal progenitors of B. napus. This was based on a comprehensive sampling of the relevant genepools, including 83 accessions of A genome B. rapa L. (both wild and cultivated types, 94 accessions of B. napus and 181 accessions of C genome wild and cultivated B. oleracea L. and related species. Results Three chloroplast haplotypes occurred in B. napus. The most prevalent haplotype (found in 79% of accessions was not present within the C genome accessions but was found at low frequencies in B. rapa. Chloroplast haplotypes characteristic of B. napus were found in a small number of wild and weedy B. rapa populations, and also in two accessions of cultivated B. rapa 'brocoletto'. Whilst introgression of the B. napus chloroplast type in the wild and weedy B. rapa populations has been proposed by other studies, the presence of this haplotype within the two brocoletto accessions is unexplained. Conclusions The distribution of chloroplast haplotypes eliminate any of the C genome species as being the maternal ancestor of the majority of the B. napus accessions. The presence of multiple chloroplast

  14. Synthetic Brassica napus L.: Development and Studies on Morphological Characters, Yield Attributes, and Yield

    Directory of Open Access Journals (Sweden)

    M. A. Malek


    Full Text Available Brassica napus was synthesized by hybridization between its diploid progenitor species B. rapa and B. oleracea followed by chromosome doubling. Cross with B. rapa as a female parent was only successful. Among three colchicine treatments (0.10, 0.15, and 0.20%, 0.15% gave the highest success (86% of chromosome doubling in the hybrids (AC; 2=19. Synthetic B. napus (AACC, 2=38 was identified with bigger petals, fertile pollens and seed setting. Synthetic B. napus had increased growth over parents and exhibited wider ranges with higher coefficients of variations than parents for morphological and yield contributing characters, and yield per plant. Siliqua length as well as beak length in synthetic B. napus was longer than those of the parents. Number of seeds per siliqua, 1000-seed weight and seed yield per plant in synthetic B. napus were higher than those of the parents. Although flowering time in synthetic B. napus was earlier than both parents, however the days to maturity was little higher over early maturing B. rapa parent. The synthesized B. napus has great potential to produce higher seed yield. Further screening and evaluation is needed for selection of desirable genotypes having improved yield contributing characters and higher seed yield.

  15. Proteomic and comparative genomic analysis reveals adaptability of Brassica napus to phosphorus-deficient stress. (United States)

    Chen, Shuisen; Ding, Guangda; Wang, Zhenhua; Cai, Hongmei; Xu, Fangsen


    Given low solubility and immobility in many soils of the world, phosphorus (P) may be the most widely studied macronutrient for plants. In an attempt to gain an insight into the adaptability of Brassica napus to P deficiency, proteome alterations of roots and leaves in two B. napus contrasting genotypes, P-efficient 'Eyou Changjia' and P-inefficient 'B104-2', under long-term low P stress and short-term P-free starvation conditions were investigated, and proteomic combined with comparative genomic analyses were conducted to interpret the interrelation of differential abundance protein species (DAPs) responding to P deficiency with quantitative trait loci (QTLs) for P deficiency tolerance. P-efficient 'Eyou Changjia' had higher dry weight and P content, and showed high tolerance to low P stress compared with P-inefficient 'B104-2'. A total of 146 DAPs were successfully identified by MALDI TOF/TOF MS, which were categorized into several groups including defense and stress response, carbohydrate and energy metabolism, signaling and regulation, amino acid and fatty acid metabolism, protein process, biogenesis and cellular component, and function unknown. 94 of 146 DAPs were mapped to a linkage map constructed by a B. napus population derived from a cross between the two genotypes, and 72 DAPs were located in the confidence intervals of QTLs for P efficiency related traits. We conclude that the identification of these DAPs and the co-location of DAPs with QTLs in the B. napus linkage genetic map provide us novel information in understanding the adaptability of B. napus to P deficiency, and helpful to isolate P-efficient genes in B. napus. Low P seriously limits the production and quality of B. napus. Proteomics and genetic linkage map were widely used to study the adaptive strategies of B. napus response to P deficiency, proteomic combined with comparative genetic analysis to investigate the correlations between DAPs and QTLs are scarce. Thus, we herein investigated

  16. Physiological and proteomic analyses on artificially aged Brassica napus seed

    Directory of Open Access Journals (Sweden)

    Pingfang eYang


    Full Text Available Plant seeds lose their viability when they are exposed to long term storage or controlled deterioration treatments, by a process known as seed ageing. Based on previous studies, artificially ageing treatments have been developed to accelerate the process of seed ageing in order to understand its underlying mechanisms. In this study, we used Brassica napus seeds to investigate the mechanisms of ageing initiation. B. napus seeds were exposed to artificially ageing treatment (40 oC and 90% relative humidity and their physio-biochemical characteristics were analyzed. Although the treatment delayed germination, it did not increase the concentration of cellular reactive oxygen species (ROS. Comparative proteomic analysis was conducted among the control and treated seeds at different stages of germination. The proteins responded to the treatment were mainly involved in metabolism, protein modification and destination, stress response, development and miscellaneous enzymes. Except for peroxiredoxin, no changes were observed in the accumulation of other antioxidant enzymes in the artificially aged seeds. Increased content of ABA was observed in the artificially treated seeds which might be involved in the inhibition of germination. Taken together, our results highlight the involvement of ABA in the initiation of seed ageing in addition to the ROS which was previously reported to mediate the seed ageing process.

  17. Characterization and tissue-differential expression of fad2 genes in brassica napus

    International Nuclear Information System (INIS)

    Zhuang, Li.; Cong, Y. S.; Hao, L.; Ze, L. Y.; Cheng, W. Y.; Xing, G. S.; Lili, L.


    In this study, genome DNA and RNA of fad2 genes from three types of oleic acid content from B. napus were isolated by PCR amplification, respectively, the results showed that not only had nucleotides sequences little differences from three types of oleic acid content B. napus, but also that of genome DNA and cDNA had still little differences from B. napus as far as specific one type of rape. Different genotypes fad2-I and fad2-II could be easily distinguished by sequence analysis of the cDNAs in G type and CK type except in D type. By analysis on cDNAs, specific differences could be found in three types of rape when compared with the sequence from Genebank. Conserved domains prediction and phylogenetic analysis showed that both six transmembrane domains and three H boxes could be found in FAD2 protein from three types of oleic acid content B. napus, respectively. BnFAD2-I and BnFAD2-II belonged to different classes and class I could be divided into two kinds. By QPCR, expression pattern of fad2 gene in different tissues showed that simple division of fad2-I and fad2-II was not apply to all oleic acid content B. napus. By southern blot, there were differences in copy numbers of fad2 genes on different oleic acid content B. napus. (author)

  18. Plastic Transcriptomes Stabilize Immunity to Pathogen Diversity: The Jasmonic Acid and Salicylic Acid Networks within the Arabidopsis/Botrytis Pathosystem. (United States)

    Zhang, Wei; Corwin, Jason A; Copeland, Daniel; Feusier, Julie; Eshbaugh, Robert; Chen, Fang; Atwell, Susana; Kliebenstein, Daniel J


    To respond to pathogen attack, selection and associated evolution has led to the creation of plant immune system that are a highly effective and inducible defense system. Central to this system are the plant defense hormones jasmonic acid (JA) and salicylic acid (SA) and crosstalk between the two, which may play an important role in defense responses to specific pathogens or even genotypes. Here, we used the Arabidopsis thaliana - Botrytis cinerea pathosystem to test how the host's defense system functions against genetic variation in a pathogen. We measured defense-related phenotypes and transcriptomic responses in Arabidopsis wild-type Col-0 and JA- and SA-signaling mutants, coi1-1 and npr1-1 , individually challenged with 96 diverse B. cinerea isolates. Those data showed genetic variation in the pathogen influences on all components within the plant defense system at the transcriptional level. We identified four gene coexpression networks and two vectors of defense variation triggered by genetic variation in B. cinerea This showed that the JA and SA signaling pathways functioned to constrain/canalize the range of virulence in the pathogen population, but the underlying transcriptomic response was highly plastic. These data showed that plants utilize major defense hormone pathways to buffer disease resistance, but not the metabolic or transcriptional responses to genetic variation within a pathogen. © 2017 American Society of Plant Biologists. All rights reserved.

  19. Hormones and Pod Development in Oilseed Rape (Brassica napus) 1 (United States)

    de Bouille, Pierre; Sotta, Bruno; Miginiac, Emile; Merrien, André


    The endogenous levels of several plant growth substances (indole acetic acid, IAA; abscisic acid, ABA; zeatin, Z; zeatin riboside, [9R]Z; isopentenyladenine, iP; and isopentenyladenosine, [9R]iP were measured during pod development of field grown oilseed Rape (Brassica napus L. var oleifera cv Bienvenu) with high performance liquid chromatography and immunoenzymic (enzyme-linked immunosorbent assay, ELISA) techniques. Results show that pod development is characterized by high levels of Z and [9R]Z in 3 day old fruits and of IAA on the fourth day. During pod maturation, initially a significant increase of IAA and cytokinins was observed, followed by a progressive rise of ABA levels and a concomitant decline of IAA and cytokinin (except iP) levels. The relationship between hormone levels and development, especially pod number, seed number per pod, and seed weight determination, will be discussed. PMID:16666891


    Directory of Open Access Journals (Sweden)

    Sami Süzer


    Full Text Available Canola (Brassica napus L. is an important edible oilseed crop in the World and in Turkey. It has a healthy vegetable oil because of its balance with omega 3-6-9 essential fatty acids, making canola oil a healthy vegetable oil throughout the World for cooking and processed food industry. Canola production of high yield and good quality usually depends on well-balanced plant nutrition and growing conditions. A well-balanced soil condition also affects canola plants responses to stress factors such as disease and bad weather conditions. Nitrogen, phosphorus and potassium (NPK are some of the major nutrients required to significantly increase canola yield. Fertilizer application dosages in canola production vary because of the variable occurrence of NPK in the soil. A high yielding canola production needs a well-balanced fertilization program.

  1. Mutagenesis and haploid culture for disease resistance in Brassica napus

    Energy Technology Data Exchange (ETDEWEB)

    MacDonald, M V; Ahmad, I; Ingram, D S [Botany School, University of Cambridge, Cambridge (United Kingdom)


    Full text: Most winter oilseed rape cultivars share parentage and therefore show little genetic diversity. There is no known resistance to Alternaria spp. in oilseed rape or in any related Brassica species. Experiments with tissue culture yielded only transient, non-genetic resistance. Therefore, mutagenesis may be used to generate heritable resistance to Alternaria spp. Gamma irradiation was applied to seeds of 'Bienvenue', secondary embryoids of cvs 'Primor' and 'Rapora', and buds of cvs 'Primor' and 'Ariana'. Isolated microspores from cv 'Ariana' and rapid cycling B. napus were also treated. The doses used ranged from 0-100 Gy for isolated microspores and buds, up to 600 Gy for seeds and 960 Gy for secondary embryoids. EMS was used to treat seeds of line WRG-42 (supplied by Nickersons RPB) and microspores of cv 'Bienvenue' and rapid cycling B. napus. Seeds were treated with up to 2.0% EMS for 0.2 h. before plating them on the culture medium. Seed irradiation up to 600 Gy did not reduce germination. M{sub 1} and M{sub 2} progenies were tested both in the laboratory and in field trials, and none of these were found to be resistant to Alternaria. However, considerable variation for other characters was observed. Haploid cultures from these plants were extremely difficult to regenerate, and for this reason no regenerant plants have been tested for resistance. For irradiated secondary embryoids the regeneration capacity decreased with increasing dose. Regenerated plants have been tested for resistance to Alternaria, but stable resistance was not observed. Haploid cultures were obtained from irradiated buds, using both anther and microspore culture. Low irradiation treatment was beneficial to developing embryoids. Some regenerants have been obtained from EMS treated microspores and seeds. Four plants have repeatedly given increased levels of resistance to A. brassicicola, and progenies are being tested to determine the genetic nature of the resistance. (author)

  2. Mutagenesis and haploid culture for disease resistance in Brassica napus

    International Nuclear Information System (INIS)

    MacDonald, M.V.; Ahmad, I.; Ingram, D.S.


    Full text: Most winter oilseed rape cultivars share parentage and therefore show little genetic diversity. There is no known resistance to Alternaria spp. in oilseed rape or in any related Brassica species. Experiments with tissue culture yielded only transient, non-genetic resistance. Therefore, mutagenesis may be used to generate heritable resistance to Alternaria spp. Gamma irradiation was applied to seeds of 'Bienvenue', secondary embryoids of cvs 'Primor' and 'Rapora', and buds of cvs 'Primor' and 'Ariana'. Isolated microspores from cv 'Ariana' and rapid cycling B. napus were also treated. The doses used ranged from 0-100 Gy for isolated microspores and buds, up to 600 Gy for seeds and 960 Gy for secondary embryoids. EMS was used to treat seeds of line WRG-42 (supplied by Nickersons RPB) and microspores of cv 'Bienvenue' and rapid cycling B. napus. Seeds were treated with up to 2.0% EMS for 0.2 h. before plating them on the culture medium. Seed irradiation up to 600 Gy did not reduce germination. M 1 and M 2 progenies were tested both in the laboratory and in field trials, and none of these were found to be resistant to Alternaria. However, considerable variation for other characters was observed. Haploid cultures from these plants were extremely difficult to regenerate, and for this reason no regenerant plants have been tested for resistance. For irradiated secondary embryoids the regeneration capacity decreased with increasing dose. Regenerated plants have been tested for resistance to Alternaria, but stable resistance was not observed. Haploid cultures were obtained from irradiated buds, using both anther and microspore culture. Low irradiation treatment was beneficial to developing embryoids. Some regenerants have been obtained from EMS treated microspores and seeds. Four plants have repeatedly given increased levels of resistance to A. brassicicola, and progenies are being tested to determine the genetic nature of the resistance. (author)

  3. Comparative Analysis of the Brassica napus Root and Leaf Transcript Profiling in Response to Drought Stress

    Directory of Open Access Journals (Sweden)

    Chunqing Liu


    Full Text Available Drought stress is one of the major abiotic factors affecting Brassica napus (B. napus productivity. In order to identify genes of potential importance to drought stress and obtain a deeper understanding of the molecular mechanisms regarding the responses of B. napus to dehydration stress, we performed large-scale transcriptome sequencing of B. napus plants under dehydration stress using the Illumina sequencing technology. In this work, a relatively drought tolerant B. napus line, Q2, identified in our previous study, was used. Four cDNA libraries constructed from mRNAs of control and dehydration-treated root and leaf were sequenced by Illumina technology. A total of 6018 and 5377 differentially expressed genes (DEGs were identified in root and leaf. In addition, 1745 genes exhibited a coordinated expression profile between the two tissues under drought stress, 1289 (approximately 74% of which showed an inverse relationship, demonstrating different regulation patterns between the root and leaf. The gene ontology (GO enrichment test indicated that up-regulated genes in root were mostly involved in “stimulus” “stress” biological process, and activated genes in leaf mainly functioned in “cell” “cell part” components. Furthermore, a comparative network related to plant hormone signal transduction and AREB/ABF, AP2/EREBP, NAC, WRKY and MYC/MYB transcription factors (TFs provided a view of different stress tolerance mechanisms between root and leaf. Some of the DEGs identified may be candidates for future research aimed at detecting drought-responsive genes and will be useful for understanding the molecular mechanisms of drought tolerance in root and leaf of B. napus.

  4. Multiple evolutionary events involved in maintaining homologs of Resistance to Powdery Mildew 8 in Brassica napus

    Directory of Open Access Journals (Sweden)

    Qin Li


    Full Text Available The Resistance to Powdery Mildew 8 (RPW8 locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs in Brassica rapa and three in B. oleracea (BoHRs. B. napus (Bn is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs. It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane (EHM encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  5. Multiple Evolutionary Events Involved in Maintaining Homologs of Resistance to Powdery Mildew 8 in Brassica napus. (United States)

    Li, Qin; Li, Jing; Sun, Jin-Long; Ma, Xian-Feng; Wang, Ting-Ting; Berkey, Robert; Yang, Hui; Niu, Ying-Ze; Fan, Jing; Li, Yan; Xiao, Shunyuan; Wang, Wen-Ming


    The Resistance to Powdery Mildew 8 (RPW8) locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs) in Brassica rapa and three in Brassica oleracea (BoHRs). Brassica napus (Bn) is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs). It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here, we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion, and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  6. Phytoextraction with Brassica napus L.: A tool for sustainable management of heavy metal contaminated soils

    International Nuclear Information System (INIS)

    Grispen, Veerle M.J.; Nelissen, Hans J.M.; Verkleij, Jos A.C.


    Phytoextraction is a promising tool to extract metals from contaminated soils and Brassica napus L. seems to be a possible candidate species for this purpose. To select accessions with the ability to accumulate cadmium, hydroponically grown 21 day old seedlings of 77 B. napus L. accessions were exposed to 0.2 μM CdSO 4 for an additional 10 days. The effects of Cd on several parameters were quantified i.e.; shoot Cd concentration ([Cd] shoot ), total amount of Cd in shoots (Total Cd) and the shoot to root Cd concentration ratio (S/R ratio). Though generally natural variation was low for [Cd] shoot , Total Cd and S/R ratio, a number of accessions could be selected. Our results indicated that Total Cd and S/R ratio are independent parameters for Cd accumulation and translocation. The selected varieties were then tested in field experiments on two locations nearby metal smelters. The two locations differed in extractable soil Cd, Zn, Ca concentration and pH levels. On both locations B. napus L. accessions showed significant differences in [Cd] shoot and Total Cd. Furthermore we found significant correlations between Cd and Zn accumulation in shoots. There were site-specific effects with respect to Cd accumulation in the B. napus L. accessions, however, two accessions seem to perform equally well on both sites. The results of the field experiment suggest that certain B. napus L. accessions are suitable for phytoextraction of moderately heavy metal contaminated soils. - A screening for natural variation in Cd accumulated by 77 Brassica napus L. yielded candidate phytoextraction accessions for agricultural practice

  7. Phytoextraction with Brassica napus L.: A tool for sustainable management of heavy metal contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Grispen, Veerle M.J. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands); Nelissen, Hans J.M. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands); Verkleij, Jos A.C. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands)]. E-mail:


    Phytoextraction is a promising tool to extract metals from contaminated soils and Brassica napus L. seems to be a possible candidate species for this purpose. To select accessions with the ability to accumulate cadmium, hydroponically grown 21 day old seedlings of 77 B. napus L. accessions were exposed to 0.2 {mu}M CdSO{sub 4} for an additional 10 days. The effects of Cd on several parameters were quantified i.e.; shoot Cd concentration ([Cd]{sub shoot}), total amount of Cd in shoots (Total Cd) and the shoot to root Cd concentration ratio (S/R ratio). Though generally natural variation was low for [Cd]{sub shoot}, Total Cd and S/R ratio, a number of accessions could be selected. Our results indicated that Total Cd and S/R ratio are independent parameters for Cd accumulation and translocation. The selected varieties were then tested in field experiments on two locations nearby metal smelters. The two locations differed in extractable soil Cd, Zn, Ca concentration and pH levels. On both locations B. napus L. accessions showed significant differences in [Cd]{sub shoot} and Total Cd. Furthermore we found significant correlations between Cd and Zn accumulation in shoots. There were site-specific effects with respect to Cd accumulation in the B. napus L. accessions, however, two accessions seem to perform equally well on both sites. The results of the field experiment suggest that certain B. napus L. accessions are suitable for phytoextraction of moderately heavy metal contaminated soils. - A screening for natural variation in Cd accumulated by 77 Brassica napus L. yielded candidate phytoextraction accessions for agricultural practice.

  8. Transcriptomic basis for drought-resistance in Brassica napus L. (United States)

    Wang, Pei; Yang, Cuiling; Chen, Hao; Song, Chunpeng; Zhang, Xiao; Wang, Daojie


    Based on transcriptomic data from four experimental settings with drought-resistant and drought-sensitive cultivars under drought and well-watered conditions, statistical analysis revealed three categories encompassing 169 highly differentially expressed genes (DEGs) in response to drought in Brassica napus L., including 37 drought-resistant cultivar-related genes, 35 drought-sensitive cultivar-related genes and 97 cultivar non-specific ones. We provide evidence that the identified DEGs were fairly uniformly distributed on different chromosomes and their expression patterns are variety specific. Except commonly enriched in response to various stimuli or stresses, different categories of DEGs show specific enrichment in certain biological processes or pathways, which indicated the possibility of functional differences among the three categories. Network analysis revealed relationships among the 169 DEGs, annotated biological processes and pathways. The 169 DEGs can be classified into different functional categories via preferred pathways or biological processes. Some pathways might simultaneously involve a large number of shared DEGs, and these pathways are likely to cross-talk and have overlapping biological functions. Several members of the identified DEGs fit to drought stress signal transduction pathway in Arabidopsis thaliana. Finally, quantitative real-time PCR validations confirmed the reproducibility of the RNA-seq data. These investigations are profitable for the improvement of crop varieties through transgenic engineering.

  9. Testing Projected Climate Change Conditions on the Endoconidiophora polonica / Norway spruce Pathosystem Shows Fungal Strain Specific Effects

    Directory of Open Access Journals (Sweden)

    Riikka Linnakoski


    to a limited body of empirical research on the effects of projected climate changes on forestry pathosystems, and is the first to investigate interactions between Norway spruce and E. polonica. The results indicate the potential for future climate changes to alter the impact of forest pathogens with implications for productivity, while highlighting the need for a strain-specific level of understanding of the disease agents.

  10. Cloning and expression study of BnaLCR78 in Brassica napus

    International Nuclear Information System (INIS)

    Zhuang, L.; Ze, L. Y.; Cheng, W. Y.


    BnaLCR78 genes of three types of rape were cloned in rape (Brassica napus), and encoded protein structure was analyzed, the Results showed that the protein had a conserved coding domain which was analogues among LCR family of Arabidopsis. The expression patterns of genes of three types of rape in varying tissues and in specific same tissues were analyzed using quantitative method. The Results showed that their expression patterns differ from that of former research in Brassica napus, which may result from the difference of sampling time. We speculated that the gene might be involved in transpiration and transportation and distribution of nutrient, oil content in seed. (author)

  11. Inheritance of oilseed rape (Brassica napus) RAPD markers in a backcross progeny with Brassica campestris

    DEFF Research Database (Denmark)

    Mikkelsen, T.R.; Jensen, J.; Bagger Jørgensen, Rikke


    Different cultivars/transgenic lines of oilseed rape (Brassica napus) were crossed (as females) with different cultivars/populations of Brassica campestris. All cross combinations produced seed, with an average seed set per pollination of 9.8. Backcrossing of selected interspecific hybrids (as...... females) to B. campestris resulted in a much lower seed set, average 0.7 seed per pollination. In the single backcross progeny where a large enough population (92 plants) was obtained for analysis, 33 B. napus specific RAPD markers were investigated to determine the extent of transfer of oilseed rape...

  12. Cytological and morphological analysis of hybrids between Brassicoraphanus, and Brassica napus for introgression of clubroot resistant trait into Brassica napus L. (United States)

    Zhan, Zongxiang; Nwafor, Chinedu Charles; Hou, Zhaoke; Gong, Jianfang; Zhu, Bin; Jiang, Yingfen; Zhou, Yongming; Wu, Jiangsheng; Piao, Zhongyun; Tong, Yue; Liu, Chao; Zhang, Chunyu


    Interspecific hybridization is a powerful tool for improvement of crop species, it has the potential to broaden the genetic base and create new plant forms for breeding programs. Synthetic allopolyploid is a widely-used model for the study of genetic recombination and fixed heterosis in Brassica. In Brassica napus breeding, identification and introgression of new sources of clubroot resistance trait from wild or related species into it by hybridization is a long-term crop management strategy for clubroot disease. Radish (Raphanus sativus L.) is a close relative of the Brassica and most radish accessions are immune to the clubroot disease. A synthesized allotetraploid Brassicoraphanus (RRCC, 2n = 36) between R. sativus cv. HQ-04 (2n = 18, RR) and Brassica oleracea var. alboglabra (L.H Bailey) (2n = 18, CC) proved resistant of multiple clubroot disease pathogen P. brassicae. To predict the possibility to transfer the clubroot resistance trait from the RR subgenome of allotetraploid Brassicoraphanus (RRCC, 2n = 36) into Brassica napus (AACC, 2n = 38), we analyzed the frequency of chromosome pairings in the F1 hybrids produced from a cross between B. napus cv. HS5 and the allotetraploid, characterize the genomic composition of some backcrossed progeny (BC1) using GISH, BAC-FISH and AFLP techniques. The level of intergenomic pairing between A and R genomes in the F1 hybrid was high, allosyndetic bivalents formed in 73.53% PMCs indicative of significant level of homeologous recombination between two genomes and high probability of incorporating chromosomal segments/genes from R-genome into A/C-genomes. The BC1 plants inherited variant extra R chromosomes or fragments from allotetraploid as revealed by GISH and AFLP analysis. 13.51% BC2 individuals were resistant to clubroot disease, and several resistance lines had high pollen fertility, Overall, the genetic material presented in this work represents a potential new genetic resource for practical use in breeding B. napus

  13. Genome-Wide Association Mapping of Seed Coat Color in Brassica napus. (United States)

    Wang, Jia; Xian, Xiaohua; Xu, Xinfu; Qu, Cunmin; Lu, Kun; Li, Jiana; Liu, Liezhao


    Seed coat color is an extremely important breeding characteristic of Brassica napus. To elucidate the factors affecting the genetic architecture of seed coat color, a genome-wide association study (GWAS) of seed coat color was conducted with a diversity panel comprising 520 B. napus cultivars and inbred lines. In total, 22 single-nucleotide polymorphisms (SNPs) distributed on 7 chromosomes were found to be associated with seed coat color. The most significant SNPs were found in 2014 near Bn-scaff_15763_1-p233999, only 43.42 kb away from BnaC06g17050D, which is orthologous to Arabidopsis thaliana TRANSPARENT TESTA 12 (TT12), an important gene involved in the transportation of proanthocyanidin precursors into the vacuole. Two of eight repeatedly detected SNPs can be identified and digested by restriction enzymes. Candidate gene mining revealed that the relevant regions of significant SNP loci on the A09 and C08 chromosomes are highly homologous. Moreover, a comparison of the GWAS results to those of previous quantitative trait locus (QTL) studies showed that 11 SNPs were located in the confidence intervals of the QTLs identified in previous studies based on linkage analyses or association mapping. Our results provide insights into the genetic basis of seed coat color in B. napus, and the beneficial allele, SNP information, and candidate genes should be useful for selecting yellow seeds in B. napus breeding.

  14. Proteomic dissection of seed germination and seedling establishment in Brassica napus

    Directory of Open Access Journals (Sweden)

    Jianwei Gu


    Full Text Available The success of seed germination and the establishment of a normal seedling are key determinants of plant species propagation. At present, only few studies have focused on the genetic control of the seed germination by proteomic approach in Brassica napus. In the present study, the protein expression pattern of seed germination was investigated using differential fluorescence two-dimensional gel electrophoresis (2-D DIGE in B. napus. One hundred thirteen differentially expressed proteins (DEPs, which were mainly involved in storage proteins (23.4%, energy metabolism (18.9%, protein metabolism (16.2%, defense/disease (12.6%, seed maturation (11.7%, carbohydrate metabolism (4.5%, lipid metabolism (4.5%, amino acids metabolism (3.6%, cell growth/division (3.6%, and some unclear proteins (2.7% were observed by proteomic analysis. Seventeen genes corresponding to 11 DEPs were identified within or near the associated linkage disequilibrium regions related to seed germination and vigor quantitative traits reported in B. napus in previous studies. The expression pattern of proteins showed the heterotrophic metabolism could be activated in the process of seed germination and the onset of defense system might start during seed germination. These findings will help us more in-depth understanding of the mobilization of seed storage reserves and regulation mechanisms of germination process in B. napus.

  15. Glyphosate drift promotes changes in fitness and transgene flow in canola (Brassica napus) and hybrids (United States)

    1. With the advent of transgenic crops, genetically modified, herbicide resistant B. napus has become a model system for examining the risks of escape of transgenes from cultivation and for evaluating potential ecological consequences of novel genes in wild species. 2. We exam...

  16. Cadmium uptake potential of Brassica napus cocropped with Brassica parachinensis and Zea mays

    International Nuclear Information System (INIS)

    Selvam, Ammaiyappan; Wong, Jonathan Woon-Chung


    Cadmium uptake potential of Brassica napus cocropped with B. parachinensis or Zea mays plants in split pot (allow the solutes to pass but prevent the interaction of roots between compartments) experiments was evaluated. Plants were grown in split pots filled with soil spiked at 0, 3, 6, 12, 25 and 50 mg Cd/kg soil. Biomass and Cd uptake were detemined after 6 weeks, and rhizospheric soil solutions, extracted using soil probes, were analyzed for pH and water soluble Cd at weekly intervals. Cadmium treatments affected the biomass. Cadmium concentration in the shoots of B. napus was higher when cocropped with B. parachinensis and significantly higher with Z. mays; however, the biomass was negatively affected implying the higher nutrient apportionment to the crop plants than B. napus. Concentration of Cd in B. napus was higher in shoots than in roots as revealed by shoot/root Cd quotient and was always >1; the quotient for B. parachinensis was ∼1 and that of Z. mays was <1, indicating the potential of Brassicaceae members to translocate the Cd to aboveground tissue. Results indicate the feasibility of cocropping method to clean the Cd contaminated soils.

  17. Cloning and characterization of a pathogen-induced chitinase in Brassica napus

    DEFF Research Database (Denmark)

    Rasmussen, U.; Bojsen, K.; Collinge, D.B.


    A chitinase cDNA clone from rapeseed (Brassica napus L. ssp. oleifera) was isolated. The cDNA clone, ChB4, represents a previously purified and characterized basic chitinase isozyme. The longest open reading frame in ChB4 encodes a polypeptide of 268 amino acids. This polypeptide consists of a 24...

  18. Amplification of the active site of BnLIP3 gene of Brassica napus L ...

    African Journals Online (AJOL)

    Lipases are useful enzymes that are responsible for the hydrolysis of triacylglycerides and play an important role in plant growth. In this study, we report a rapid molecular method to amplify a partial sequence of the lipase class 3 family designated BnLIP3 gene of Brassica napus L. in order to follow its expression and ...

  19. Cadmium uptake potential of Brassica napus cocropped with Brassica parachinensis and Zea mays

    Energy Technology Data Exchange (ETDEWEB)

    Selvam, Ammaiyappan [Sino-Forest Applied Research Centre for Pearl River Delta Environment, Department of Biology, Hong Kong Baptist University, Hong Kong, (Hong Kong); Wong, Jonathan Woon-Chung, E-mail: [Sino-Forest Applied Research Centre for Pearl River Delta Environment, Department of Biology, Hong Kong Baptist University, Hong Kong (Hong Kong)


    Cadmium uptake potential of Brassica napus cocropped with B. parachinensis or Zea mays plants in split pot (allow the solutes to pass but prevent the interaction of roots between compartments) experiments was evaluated. Plants were grown in split pots filled with soil spiked at 0, 3, 6, 12, 25 and 50 mg Cd/kg soil. Biomass and Cd uptake were detemined after 6 weeks, and rhizospheric soil solutions, extracted using soil probes, were analyzed for pH and water soluble Cd at weekly intervals. Cadmium treatments affected the biomass. Cadmium concentration in the shoots of B. napus was higher when cocropped with B. parachinensis and significantly higher with Z. mays; however, the biomass was negatively affected implying the higher nutrient apportionment to the crop plants than B. napus. Concentration of Cd in B. napus was higher in shoots than in roots as revealed by shoot/root Cd quotient and was always >1; the quotient for B. parachinensis was {approx}1 and that of Z. mays was <1, indicating the potential of Brassicaceae members to translocate the Cd to aboveground tissue. Results indicate the feasibility of cocropping method to clean the Cd contaminated soils.

  20. Phosphate-assisted phytoremediation of arsenic by Brassica napus and Brassica juncea: Morphological and physiological response. (United States)

    Niazi, Nabeel Khan; Bibi, Irshad; Fatimah, Ayesha; Shahid, Muhammad; Javed, Muhammad Tariq; Wang, Hailong; Ok, Yong Sik; Bashir, Safdar; Murtaza, Behzad; Saqib, Zulfiqar Ahmad; Shakoor, Muhammad Bilal


    In this study, we examined the potential role of phosphate (P; 0, 50, 100 mg kg -1 ) on growth, gas exchange attributes, and photosynthetic pigments of Brassica napus and Brassica juncea under arsenic (As) stress (0, 25, 50, 75 mg kg -1 ) in a pot experiment. Results revealed that phosphate supplementation (P100) to As-stressed plants significantly increased shoot As concentration, dry biomass yield, and As uptake, in addition to the improved morphological and gas exchange attributes and photosynthetic pigments over P0. However, phosphate-assisted increase in As uptake was substantially (up to two times) greater for B. napus, notably due to higher shoot As concentration and dry biomass yield, compared to B. juncea at the P100 level. While phosphate addition in soil (P100) led to enhanced shoot As concentration in B. juncea, it reduced shoot dry biomass, primarily after 50 and 75 mg kg -1 As treatments. The translocation factor and bioconcentration factor values of B. napus were higher than B. juncea for all As levels in the presence of phosphate. This study demonstrates that phosphate supplementation has a potential to improve As phytoextraction efficiency, predominantly for B. napus, by minimizing As-induced damage to plant growth, as well as by improving the physiological and photosynthetic attributes.

  1. Induction and purification of chitinase in Brassica napus L. ssp. oleifera infected with Phoma lingam

    DEFF Research Database (Denmark)

    Rasmussen, U.; Giese, H.; Dalgaard Mikkelsen, J.


    A pathogen-induced chitinase (EC was isolated from cotyledons of oilseed rape (Brassica napus cv. Bienvenu) 8 d after inoculation with Phoma lingam. The purified chitinase has a molecular weight of 30 kDa, and an isoelectric point of approx. 9.1. A partial amino-acid sequence obtained a...

  2. Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa (United States)

    While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

  3. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline


    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  4. Impact of biogenic terpene emissions from Brassica napus on tropospheric ozone over Saxony (Germany): numerical investigation. (United States)

    Renner, Eberhard; Münzenberg, Annette


    The role of biogenic emissions in tropospheric ozone production is currently under discussion and major aspects are not well understood yet. This study aims towards the estimation of the influence of biogenic emissions on tropospheric ozone concentrations over Saxony in general and of biogenic emissions from brassica napus in special. MODELLING TOOLS: The studies are performed by utilizing a coupled numerical modelling system consisting of the meteorological model METRAS and the chemistry transport model MUSCAT. For the chemical part, the Euro-RADM algorithm is used. EMISSIONS: Anthropogenic and biogenic emissions are taken into account. The anthropogenic emissions are introduced by an emission inventory. Biogenic emissions, VOC and NO, are calculated within the chemical transport model MUSCAT at each time step and in each grid cell depending on land use type and on the temperature. The emissions of hydrocarbons from forest areas as well as biogenic NO especially from agricultural grounds are considered. Also terpene emissions from brassica napus fields are estimated. SIMULATION SETUP AND METEOROLOGICAL CONDITIONS: The simulations were performed over an area with an extension of 160 x 140 km2 which covers the main parts of Saxony and neighboring areas of Brandenburg, Sachsen-Anhalt and Thuringia. Summer smog with high ozone concentrations can be expected during high pressure conditions on hot summer days. Typical meteorological conditions for such cases were introduced in an conceptual way. It is estimated that biogenic emissions change tropospheric ozone concentrations in a noticeable way (up to 15% to 20%) and, therefore, should not be neglected in studies about tropospheric ozone. Emissions from brassica napus do have a moderate potential to enhance tropospheric ozone concentrations, but emissions are still under consideration and, therefore, results vary to a high degree. Summing up, the effect of brassica napus terpene emissions on ozone concentrations is

  5. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik


    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  6. A- or C-chromosomes, does it matter for the transfer of transgenes from ¤Brassica napus¤

    DEFF Research Database (Denmark)

    Tomiuk, J.; Hauser, T.P.; Bagger Jørgensen, Rikke


    of herbicide-tolerant plants was explained by selection against the C-chromosomes of B. napus in favor of the homeologous ii-chromosomes. Obviously, such C-chromosomes could be potential candidates as safe integration sites for transgenes. We considered these safety aspects using a simple population genetic...... model. Theory and experiments, however, do not favor the chromosomes of B. napus as safe candidates with respect to the introgression of transgenes into wild populations of B. rapa....

  7. Agronomic performance of rape seed (brassica napus L.) mutant lines under drought conditions

    International Nuclear Information System (INIS)

    Shah, S.A.; Ali, I.; Shah, S.J.A.; Rehman, K.; Rashid, A.


    Oil seed forms of Brassica napus are not well adapted to drought and the warner environments of Pakistan. Induced mutations were, therefore, utilized for improving drought tolerance efficiency of two napus cultivars. Induction of genetic variability, selection of desirable mutants and stabilization of mutants in acceptable agronomic background were carried out during 1988-1991. Fourteen promising mutants each of cv. Pak-cheen and Tower were evaluated for different agronomic characters in separate yield trials, under extremely drought conditions. The results demonstrated that yield potential of some mutants was very high and 9 mutants of cv. Pak-cheen and 8 mutants of cv. Tower significantly (P<0.05) out yield the local commercial cultivar. Eleven mutants in both the trials matured significantly earlier than the check. Nevertheless, more extensive testing of the drought tolerant lines under diversified environs of the country will help confirm these findings. (author)

  8. Analysis of morphology, DNA and isozyme of leaf mutation in Brassica napus L

    International Nuclear Information System (INIS)

    Luo Zhen; Hu Dongwei; Li Xiaobai


    This paper aims to study the rule of irradiating effects, provide the effective way of analyzing mutant, and discuss the production application of mutant. By irradiating the 040B of Brassica napus L with . 0Co γ- ray, an obvious leaf mutation (ML) with large leaf area was found. The ML which has been inherited stably after three generations was compared with wide-type (CK) on the morphologic, DNA and isozymic levels. Results showed that S 4 and S17 from RAPD were two molecular markers which can express good polymorphism and have close relationships with leaf mutation sites. And in the analysis of EST and POD between ML and CK, the polymorphisms also proved that many discrepancies exist between ML and CK on the protein level. In addition, the research results in question can be applied to the breeding and genetic research of Brassica napus L

  9. Dissecting quantitative trait loci for boron efficiency across multiple environments in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Zunkang Zhao

    Full Text Available High yield is the most important goal in crop breeding, and boron (B is an essential micronutrient for plants. However, B deficiency, leading to yield decreases, is an agricultural problem worldwide. Brassica napus is one of the most sensitive crops to B deficiency, and considerable genotypic variation exists among different cultivars in response to B deficiency. To dissect the genetic basis of tolerance to B deficiency in B. napus, we carried out QTL analysis for seed yield and yield-related traits under low and normal B conditions using the double haploid population (TNDH by two-year and the BQDH population by three-year field trials. In total, 80 putative QTLs and 42 epistatic interactions for seed yield, plant height, branch number, pod number, seed number, seed weight and B efficiency coefficient (BEC were identified under low and normal B conditions, singly explaining 4.15-23.16% and 0.53-14.38% of the phenotypic variation. An additive effect of putative QTLs was a more important controlling factor than the additive-additive effect of epistatic interactions. Four QTL-by-environment interactions and 7 interactions between epistatic interactions and the environment contributed to 1.27-4.95% and 1.17-3.68% of the phenotypic variation, respectively. The chromosome region on A2 of SYLB-A2 for seed yield under low B condition and BEC-A2 for BEC in the two populations was equivalent to the region of a reported major QTL, BE1. The B. napus homologous genes of Bra020592 and Bra020595 mapped to the A2 region and were speculated to be candidate genes for B efficiency. These findings reveal the complex genetic basis of B efficiency in B. napus. They provide a basis for the fine mapping and cloning of the B efficiency genes and for breeding B-efficient cultivars by marker-assisted selection (MAS.

  10. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays (United States)


    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

  11. miR395 is involved in detoxification of cadmium in Brassica napus

    International Nuclear Information System (INIS)

    Zhang, Liu Wei; Song, Jian Bo; Shu, Xia Xia; Zhang, Yun; Yang, Zhi Min


    Highlights: ► Involvement of miR395 in sulfate uptake and assimilation in B. napus. ► miR395 regulation of Cd accumulation and distribution in B. napus. ► Depression of Cd-induced oxidative stress by miR395. -- Abstract: The toxic metal cadmium (Cd) constitutes one of the major inorganic contaminants in environments. microRNAs (miRNAs) are a class of endogenous non-coding small RNAs. miR395 is conserved and regulates sulfate assimilation and distribution in higher plants, but whether it is involved in detoxification of Cd in plants has not been described. In this study, transgenic rapeseed (Brassica napus) over-expressing miR395 was identified under Cd stress. miR395-over-expressing plants showed a lower degree of Cd-induced oxidative stress than wild type. By contrast, chlorophyll, glutathione and non-protein thiols contents were higher in the transformants than wild type. Determination of growth response showed that 35S::MIR395 plants accumulated higher levels of biomass and sulfur than wild type under Cd exposure. miR395 transgenic plants had higher levels of Cd in plants, particularly at the high supply of Cd in the medium, but they tended to repress Cd translocation from roots to shoots. Simultaneously, expression of metal-tolerance genes such as BnPCS1, BnHO1 and Sultr1;1 was up-regulated under Cd stress, and the expression of the genes was more pronounced in 35S::MIR395 plants than in wild type. These results suggest that miR395 would be involved in detoxification of Cd in B. napus

  12. miR395 is involved in detoxification of cadmium in Brassica napus

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Liu Wei; Song, Jian Bo; Shu, Xia Xia; Zhang, Yun [Department of Biochemistry and Molecular Biology, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China); Yang, Zhi Min, E-mail: [Department of Biochemistry and Molecular Biology, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China)


    Highlights: ► Involvement of miR395 in sulfate uptake and assimilation in B. napus. ► miR395 regulation of Cd accumulation and distribution in B. napus. ► Depression of Cd-induced oxidative stress by miR395. -- Abstract: The toxic metal cadmium (Cd) constitutes one of the major inorganic contaminants in environments. microRNAs (miRNAs) are a class of endogenous non-coding small RNAs. miR395 is conserved and regulates sulfate assimilation and distribution in higher plants, but whether it is involved in detoxification of Cd in plants has not been described. In this study, transgenic rapeseed (Brassica napus) over-expressing miR395 was identified under Cd stress. miR395-over-expressing plants showed a lower degree of Cd-induced oxidative stress than wild type. By contrast, chlorophyll, glutathione and non-protein thiols contents were higher in the transformants than wild type. Determination of growth response showed that 35S::MIR395 plants accumulated higher levels of biomass and sulfur than wild type under Cd exposure. miR395 transgenic plants had higher levels of Cd in plants, particularly at the high supply of Cd in the medium, but they tended to repress Cd translocation from roots to shoots. Simultaneously, expression of metal-tolerance genes such as BnPCS1, BnHO1 and Sultr1;1 was up-regulated under Cd stress, and the expression of the genes was more pronounced in 35S::MIR395 plants than in wild type. These results suggest that miR395 would be involved in detoxification of Cd in B. napus.

  13. Genetic Diversity in Commercial Rapeseed (Brassica napus L.) Varieties from Turkey as Revealed by RAPD


    Özlem ÖZBEK; Betül Uçar GIDIK


    In cultivated commercial crop species, genetic diversity tends to decrease because of the extensive breeding processes. Therefore, germplasm of commercial crop species, such as Brassica napus L. should be evaluated and the genotypes, which have higher genetic diversity index, should be addressed as potential parental cross materials in breeding programs. In this study, the genetic diversity was analysed by using randomly amplified polymorphic DNA analysis (RAPD) technique in nine Turkish com...

  14. Agronomic and seed quality traits dissected by genome-wide association mapping in Brassica napus

    Directory of Open Access Journals (Sweden)

    Niklas eKörber


    Full Text Available In Brassica napus breeding, traits related to commercial success are of highest importance for plant breeders. However, such traits can only be assessed in an advanced developmental stage. % as well as require high experimental effort due to their quantitative inheritance and the importance of genotype*environment interaction. Molecular markers genetically linked to such traits have the potential to accelerate the breeding process of B. napus by marker-assisted selection. Therefore, the objectives of this study were to identify (i genome regions associated with the examined agronomic and seed quality traits, (ii the interrelationship of population structure and the detected associations, and (iii candidate genes for the revealed associations. The diversity set used in this study consisted of 405 Brassica napus inbred lines which were genotyped using a 6K single nucleotide polymorphism (SNP array and phenotyped for agronomic and seed quality traits in field trials. In a genome-wide association study, we detected a total of 112 associations between SNPs and the seed quality traits as well as 46 SNP-trait associations for the agronomic traits with a P-value 100 and a sequence identity of > 70 % to A. thaliana or B. rapa could be found for the agronomic SNP-trait associations and 187 hits of potential candidate genes for the seed quality SNP-trait associations.

  15. Chelate-assisted phytoextraction: effect of EDTA and EDDS on copper uptake by Brassica napus L.

    Directory of Open Access Journals (Sweden)



    Full Text Available Chelate-assisted phytoextraction is proposed as an effective approach for the removal of heavy metals from contaminated soil through the use of high biomass plants. The aim of the present study was to compare the efficiency of the two chelators: EDTA and biodegradable EDDS in enhancing Cu uptake and translocation by Brassica napus L. grown on moderately contaminated soil and treated with increasing concentrations of EDTA or EDDS. Increasing amounts of EDDS caused serious growth suppression of B. napus and an increase in shoot metal concentrations. Growth suppression limited the actual amount of phytoextracted Cu at high concentrations of EDDS. The maximum amount of extracted Cu was achieved by the application of 8.0 and 4.0+4.0 mmol kg-1 EDDS. The shoot Cu concentrations after EDTA application were much lower than with EDDS at the same doses. According to these experiments, EDTA does not appear to be an efficient amendment if Cu phytoextraction with B. napus is considered but EDDS is.

  16. LMI1-like genes involved in leaf margin development of Brassica napus. (United States)

    Ni, Xiyuan; Liu, Han; Huang, Jixiang; Zhao, Jianyi


    In rapeseed (Brassica napus L.), leaf margins are variable and can be entire, serrate, or lobed. In our previous study, the lobed-leaf gene (LOBED-LEAF 1, BnLL1) was mapped to a 32.1 kb section of B. napus A10. Two LMI1-like genes, BnaA10g26320D and BnaA10g26330D, were considered the potential genes that controlled the lobed-leaf trait in rapeseed. In the present study, these two genes and another homologous gene (BnaC04g00850D) were transformed into Arabidopsis thaliana (L.) Heynh. plants to identify their functions. All three LMI1-like genes of B. napus produced serrate leaf margins. The expression analysis indicated that the expression level of BnaA10g26320D determined the difference between lobed- and entire-leaved lines in rapeseed. Therefore, it is likely that BnaA10g26320D corresponds to BnLL1.

  17. Effects of plant densities on yield, yield components and some morphological characters of two cultivators of oilseed rape (Brassica napus L.)

    DEFF Research Database (Denmark)

    Al-Barzinjy, M.; Stölen, O.; Christiansen, Jørgen Lindskrog


    Effects of Plant Densities on Yield, Yield Components and some Morphological Characters of two Cultivators of Oilseed Rape (Brassica napus L.)......Effects of Plant Densities on Yield, Yield Components and some Morphological Characters of two Cultivators of Oilseed Rape (Brassica napus L.)...

  18. Production of intertribal somatic hybrids between Brassica napus L. and Lesquerella fendleri (Gray) Wats

    International Nuclear Information System (INIS)

    Skarzhinskaya, M.; Landgren, M.; Glimelius, K.


    Intertribal Brassica napus (+) Lesquerella fendleri hybrids have been produced by polyethylene glycol-induced fusions of B. napus hypocotyl and L. fendleri mesophyll protoplasts. Two series of experiments were performed. In the first, symmetric fusion experiments, protoplasts from the two materials were fused without any pretreatments. In the second, asymmetric fusion experiments, X-ray irradiation at doses of 180 and 200 Gy were used to limit the transfer of the L. fendleri genome to the hybrids. X-ray irradiation of L. fendleri mesophyll protoplasts did not suppress the proliferation rate and callus formation of the fusion products but did significantly decrease growth and differentiation of non-fused L. fendleri protoplasts. In total, 128 regenerated plants were identified as intertribal somatic hybrids on the basis of morphological criteria. Nuclear DNA analysis performed on 80 plants, using species specific sequences, demonstrated that 33 plants from the symmetric fusions and 43 plants from the asymmetric fusions were hybrids. Chloroplast and mitochondrial DNA analysis revealed a biased segregation that favoured B. napus organelles in the hybrids from the symmetric fusion experiments. The bias was even stronger in the hybrids from the asymmetric fusion experiments where no hybrids with L. fendleri organelles were found. X-ray irradiation of L. fendleri protoplasts increased the possibility of obtaining mature somatic hybrid plants with improved fertility. Five plants from the symmetric and 24 plants from the asymmetric fusion experiments were established in the greenhouse. From the symmetric fusions 2 plants could be fertilised and set seeds after cross-pollination with B. napus. From the asymmetric fusions 9 plants could be selfed as well as fertilised when backcrossed with B. napus. Chromosome analysis was performed on all of the plants but 1 that were transferred to the greenhouse. Three plants from the symmetric fusions contained 50 chromosomes, which

  19. Genetic and Epigenetic Changes in Oilseed Rape (Brassica napus L.) Extracted from Intergeneric Allopolyploid and Additions with Orychophragmus. (United States)

    Gautam, Mayank; Dang, Yanwei; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun


    Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n = 38, genomes AACC) was extracted from its intergeneric allohexaploid (2n = 62, genomes AACCOO) with another crucifer Orychophragmus violaceus (2n = 24, genome OO), by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism, sequence-specific amplified polymorphism, and methylation-sensitive amplified polymorphism. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments) and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent.

  20. Genetic and epigenetic changes in oilseed rape (Brassica napus L. extracted from intergeneric allopolyploid and additions with Orychophragmus

    Directory of Open Access Journals (Sweden)

    Mayank eGautam


    Full Text Available ABSTRACT Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n=38, genomes AACC was extracted from its intergeneric allohexaploid (2n=62, genomes AACCOO with another crucifer Orychophragmus violaceus (2n=24, genome OO, by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism (AFLP, sequence-specific amplified polymorphism (SSAP, and methylation-sensitive amplified polymorphism (MSAP. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent.

  1. Population genomic analysis reveals differential evolutionary histories and patterns of diversity across subgenomes and subpopulations of Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Elodie eGazave


    Full Text Available The allotetraploid species Brassica napus L. is a global crop of major economic importance, providing canola oil (seed and vegetables for human consumption and fodder and meal for livestock feed. Characterizing the genetic diversity present in the extant germplasm pool of B. napus is fundamental to better conserve, manage and utilize the genetic resources of this species. We used sequence-based genotyping to identify and genotype 30,881 SNPs in a diversity panel of 782 B. napus accessions, representing samples of winter and spring growth habits originating from 33 countries across Europe, Asia and America. We detected strong population structure broadly concordant with growth habit and geography, and identified three major genetic groups: spring (SP, winter Europe (WE, and winter Asia (WA. Subpopulation-specific polymorphism patterns suggest enriched genetic diversity within the WA group and a smaller effective breeding population for the SP group compared to WE. Interestingly, the two subgenomes of B. napus appear to have different geographic origins, with phylogenetic analysis placing WE and WA as basal clades for the other subpopulations in the C and A subgenomes, respectively. Finally, we identified 16 genomic regions where the patterns of diversity differed markedly from the genome-wide average, several of which are suggestive of genomic inversions. The results obtained in this study constitute a valuable resource for worldwide breeding efforts and the genetic dissection and prediction of complex B. napus traits.

  2. Effects of EDTA on phytoextraction of heavy metals (Zn, Mn and Pb) from sludge-amended soil with Brassica napus. (United States)

    Zaier, Hanen; Ghnaya, Tahar; Ben Rejeb, Kilani; Lakhdar, Abdelbasset; Rejeb, Salwa; Jemal, Fatima


    Sludge application is a reliable practice to ameliorate soil fertility. However, repetitive sludge addition represents a potential soil contamination source with heavy metals, which must be extracted. The aim of this study was to evaluate the capacity of Brassica napus to remove metals from soils amended with sludge, and to study the effect of EDTA on this process. Seedlings were cultivated in presence of sludge combined or not with EDTA. Results showed that sludge ameliorate significantly biomass production. This effect was accompanied with an increase in Pb, Zn and Mn shoot concentrations. EDTA application does not affect significantly plant growth. However, this chelator enhances shoot metals accumulation. It's therefore concluded that sludge has a beneficial effect on soil fertility, B. napus can be used for the decontamination of affected soils and that the EDTA addition increases the ability of B. napus to accumulate heavy metals. Published by Elsevier Ltd.

  3. Preliminary study of Tl and Cd uptake in the heavy metal accumulating Brassica napus using the Debrecen proton microprobe

    International Nuclear Information System (INIS)

    Kertesz, Zs.; Haag-Kerwer, A.; Povh, B.


    The high biomass producing crop plants, Brassica juncea L. and Brassica napus are very promising plant species for phytoremediation. The aim of further research is to help a better understanding of the transport mechanism within roots and roots to shoots of heavy metals, and to find out their distribution and translocation among different cell types in the root of these species. The distribution and concentration of major and trace elements was determined along the roots of Cd and Tl treated as well as control plants of Brassica napus on the ATOMKI proton microprobe. (R.P.)

  4. Scale up of 2,4-dichlorophenol removal from aqueous solutions using Brassica napus hairy roots

    Energy Technology Data Exchange (ETDEWEB)

    Angelini, Vanina A. [Departamento de Biologia Molecular, FCEFQN, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina); Orejas, Joaquin [Facultad de Ingenieria, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina); Medina, Maria I. [Departamento de Biologia Molecular, FCEFQN, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina); Agostini, Elizabeth, E-mail: [Departamento de Biologia Molecular, FCEFQN, Universidad Nacional de Rio Cuarto, 5800 Rio Cuarto, Cordoba (Argentina)


    Research highlights: {yields}B. napus hairy roots were effectively used for a large scale removal of 2,4-DCP. {yields} High removal efficiencies were obtained (98%) in a short time (30 min). {yields} Roots were re-used for six consecutive cycles with high efficiency. {yields} Post removal solutions showed no toxicity. {yields} This method could be used for continuous and safe treatment of phenolic effluents. - Abstract: Chlorophenols are harmful pollutants, frequently found in the effluents of several industries. For this reason, many environmental friendly technologies are being explored for their removal from industrial wastewaters. The aim of the present work was to study the scale up of 2,4-dichlorophenol (2,4-DCP) removal from synthetic wastewater, using Brassica napus hairy roots and H{sub 2}O{sub 2} in a discontinuous stirred tank reactor. We have analyzed some operational conditions, because the scale up of such process was poorly studied. High removal efficiencies were obtained (98%) in a short time (30 min). When roots were re-used for six consecutive cycles, 2,4-DCP removal efficiency decreased from 98 to 86%, in the last cycle. After the removal process, the solutions obtained from the reactor were assessed for their toxicity using an acute test with Lactuca sativa L. seeds. Results suggested that the treated solution was less toxic than the parent solution, because neither inhibition of lettuce germination nor effects in root and hypocotyl lengths were observed. Therefore, we provide evidence that Brassica napus hairy roots could be effectively used to detoxify solutions containing 2,4-DCP and they have considerable potential for a large scale removal of this pollutant. Thus, this study could help to design a method for continuous and safe treatment of effluents containing chlorophenols.

  5. Studies on the use of gamma irradiation and tissue culture in improving brassica napus

    International Nuclear Information System (INIS)

    Khedr, E.K.A.


    The objectives of this study were to:1- Studying the effect of different doses of gamma rays on some growth and yield component traits of three Brassica napus cultivars (Serow6, Serow4 and Pactol) during four consecutive generations aiming to create new genotypes characterized with high yielding traits. 2- Studying the effect of different doses of gamma rays on in vitro biotechnology technique (tissue culture) used in improving Brassica napus. Seeds of three Brassica napus cultivars were irradiated with different gamma ray doses then sown for four consecutive seasons. Data were collected and recorded to clarify the effect gamma irradiation on some yield component traits which were days to flowering , plant height, number of main branches per plant, number of secondary branches per plant, number of pods per plant, number of seeds per pod, weight of 1000-seed, weight of grain yield/plant and oil content of seeds). Results showed that high doses of gamma radiation had enhanced all of the studied traits for each of the three tested cultivars (except the plant height trait for Serow6 and Pactol cultivars). Seven new mutant lines were selected for their superiority in one or more of the studied yield component traits. Regarding the effect of gamma rays on tissue culture techniques, the applied gamma radiation doses did not affect the percentage of seed germination of the three studied cultivars, whereas the percentage of callus induction decreased by increasing the dose of gamma rays for each of the three cultivars and in both types of explants (hypocotyl and cotyledons) used in this experiment.

  6. Substoichiometrically different mitotypes coexist in mitochondrial genomes of Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Jianmei Chen

    Full Text Available Cytoplasmic male sterility (CMS has been identified in numerous plant species. Brassica napus CMS plants, such as Polima (pol, MI, and Shaan 2A, have been identified independently by different researchers with different materials in conventional breeding processes. How this kind of CMS emerges is unclear. Here, we report the mitochondrial genome sequence of the prevalent mitotype in the most widely used pol-CMS line, which has a length of 223,412 bp and encodes 34 proteins, 3 ribosomal RNAs, and 18 tRNAs, including two near identical copies of trnH. Of these 55 genes, 48 were found to be identical to their equivalents in the "nap" cytoplasm. The nap mitotype carries only one copy of trnH, and the sequences of five of the six remaining genes are highly similar to their equivalents in the pol mitotype. Forty-four open reading frames (ORFs with unknown function were detected, including two unique to the pol mitotype (orf122 and orf132. At least five rearrangement events are required to account for the structural differences between the pol and nap sequences. The CMS-related orf224 neighboring region (∼5 kb rearranged twice. PCR profiling based on mitotype-specific primer pairs showed that both mitotypes are present in B. napus cultivars. Quantitative PCR showed that the pol cytoplasm consists mainly of the pol mitotype, and the nap mitotype is the main genome of nap cytoplasm. Large variation in the copy number ratio of mitotypes was found, even among cultivars sharing the same cytoplasm. The coexistence of mitochondrial mitotypes and substoichiometric shifting can explain the emergence of CMS in B. napus.

  7. Brassica napus seed endosperm - metabolism and signaling in a dead end tissue. (United States)

    Lorenz, Christin; Rolletschek, Hardy; Sunderhaus, Stephanie; Braun, Hans-Peter


    Oilseeds are an important element of human nutrition and of increasing significance for the production of industrial materials. The development of the seeds is based on a coordinated interplay of the embryo and its surrounding tissue, the endosperm. This study aims to give insights into the physiological role of endosperm for seed development in the oilseed crop Brassica napus. Using protein separation by two-dimensional (2D) isoelectric focusing (IEF)/SDS polyacrylamide gel electrophoresis (PAGE) and protein identification by mass spectrometry three proteome projects were carried out: (i) establishment of an endosperm proteome reference map, (ii) proteomic characterization of endosperm development and (iii) comparison of endosperm and embryo proteomes. The endosperm proteome reference map comprises 930 distinct proteins, including enzymes involved in genetic information processing, carbohydrate metabolism, environmental information processing, energy metabolism, cellular processes and amino acid metabolism. To investigate dynamic changes in protein abundance during seed development, total soluble proteins were extracted from embryo and endosperm fractions at defined time points. Proteins involved in sugar converting and recycling processes, ascorbate metabolism, amino acid biosynthesis and redox balancing were found to be of special importance for seed development in B. napus. Implications for the seed filling process and the function of the endosperm for seed development are discussed. The endosperm is of key importance for embryo development during seed formation in plants. We present a broad study for characterizing endosperm proteins in the oilseed plant B. napus. Furthermore, a project on the biochemical interplay between the embryo and the endosperm during seed development is presented. We provide evidence that the endosperm includes a complete set of enzymes necessary for plant primary metabolism. Combination of our results with metabolome data will further

  8. A candidate gene-based association study of tocopherol content and composition in rapeseed (Brassica napus

    Directory of Open Access Journals (Sweden)

    Steffi eFritsche


    Full Text Available Rapeseed (Brassica napus L. is the most important oil crop of temperate climates. Rapeseed oil contains tocopherols, also known as vitamin E, which is an indispensable nutrient for humans and animals due to its antioxidant and radical scavenging abilities. Moreover, tocopherols are also important for the oxidative stability of vegetable oils. Therefore, seed oil with increased tocopherol content or altered tocopherol composition is a target for breeding. We investigated the role of nucleotide variations within candidate genes from the tocopherol biosynthesis pathway. Field trials were carried out with 229 accessions from a worldwide B. napus collection which was divided into two panels of 96 and 133 accessions. Seed tocopherol content and composition were measured by HPLC. High heritabilities were found for both traits, ranging from 0.62 to 0.94. We identified polymorphisms by sequencing selected regions of the tocopherol genes from the 96 accession panel. Subsequently, we determined the population structure (Q and relative kinship (K as detected by genotyping with genome-wide distributed SSR markers. Association studies were performed using two models, the structure-based GLM+Q and the PK mixed model. Between 26 and 12 polymorphisms within two genes (BnaX.VTE3.a, BnaA.PDS1.c were significantly associated with tocopherol traits. The SNPs explained up to 16.93 % of the genetic variance for tocopherol composition and up to 10.48 % for total tocopherol content. Based on the sequence information we designed CAPS markers for genotyping the 133 accessions from the 2nd panel. Significant associations with various tocopherol traits confirmed the results from the first experiment. We demonstrate that the polymorphisms within the tocopherol genes clearly impact tocopherol content and composition in B. napus seeds. We suggest that these nucleotide variations may be used as selectable markers for breeding rapeseed with enhanced tocopherol quality.

  9. Scale up of 2,4-dichlorophenol removal from aqueous solutions using Brassica napus hairy roots

    International Nuclear Information System (INIS)

    Angelini, Vanina A.; Orejas, Joaquin; Medina, Maria I.; Agostini, Elizabeth


    Research highlights: →B. napus hairy roots were effectively used for a large scale removal of 2,4-DCP. → High removal efficiencies were obtained (98%) in a short time (30 min). → Roots were re-used for six consecutive cycles with high efficiency. → Post removal solutions showed no toxicity. → This method could be used for continuous and safe treatment of phenolic effluents. - Abstract: Chlorophenols are harmful pollutants, frequently found in the effluents of several industries. For this reason, many environmental friendly technologies are being explored for their removal from industrial wastewaters. The aim of the present work was to study the scale up of 2,4-dichlorophenol (2,4-DCP) removal from synthetic wastewater, using Brassica napus hairy roots and H 2 O 2 in a discontinuous stirred tank reactor. We have analyzed some operational conditions, because the scale up of such process was poorly studied. High removal efficiencies were obtained (98%) in a short time (30 min). When roots were re-used for six consecutive cycles, 2,4-DCP removal efficiency decreased from 98 to 86%, in the last cycle. After the removal process, the solutions obtained from the reactor were assessed for their toxicity using an acute test with Lactuca sativa L. seeds. Results suggested that the treated solution was less toxic than the parent solution, because neither inhibition of lettuce germination nor effects in root and hypocotyl lengths were observed. Therefore, we provide evidence that Brassica napus hairy roots could be effectively used to detoxify solutions containing 2,4-DCP and they have considerable potential for a large scale removal of this pollutant. Thus, this study could help to design a method for continuous and safe treatment of effluents containing chlorophenols.

  10. Induction of microspore embryogenesis in Brassica napus L. by gamma irradiation and ethanol stress

    International Nuclear Information System (INIS)

    Pechan, P.M.; Keller, W.A.


    Summary Gamma irradiation and ethanol stress treatments redirected pollen development to an embryo formation pathway in Brassica napus. Less than 0.01% of microspores developed into embryos at 25°C compared to approximately 2% at 32°C. However, subsequent to gamma irradiation and ethanol treatments up to 1% and 0.7% of microspores formed embryos at 25°C, respectively. Gamma irradiation also enhanced embryogenesis at 32°C. The possible importance of these findings is discussed in relation to microspore embryogenesis

  11. Induction of microspore embryogenesis in Brassica napus L. by gamma irradiation and ethanol stress

    Energy Technology Data Exchange (ETDEWEB)

    Pechan, P. M. [Max Planck Institute für Zuchtungsforschung, Köln (Germany); Keller, W. A.


    Summary Gamma irradiation and ethanol stress treatments redirected pollen development to an embryo formation pathway in Brassica napus. Less than 0.01% of microspores developed into embryos at 25°C compared to approximately 2% at 32°C. However, subsequent to gamma irradiation and ethanol treatments up to 1% and 0.7% of microspores formed embryos at 25°C, respectively. Gamma irradiation also enhanced embryogenesis at 32°C. The possible importance of these findings is discussed in relation to microspore embryogenesis.

  12. Chromosomal aberration induced by gamma rays in winter rape (Brassica napus L.)

    International Nuclear Information System (INIS)

    Luczkiewicz, T.; Rogalska, S.M.


    Winter rape seeds (Brassica napus L. cv. Jet Neuf) were irradiated twice with gamma rays. In γ 1-2 generation (dose 50.0 kR) plants with reduced fertility were selected. Offspring of these plants, in the following generations, were segregated into fertile plants, partly fertile and sterile plants. Analysis of meiosis in PCM revealed presence of a great number of cells (in prophase 1. and metaphase 1.) with crosses, rings and chains of multivalents. It is a proof of vast heterozygous translocation. (author)

  13. Construction of an integrated genetic linkage map for the A genome of Brassica napus using SSR markers derived from sequenced BACs in B. rapa

    Directory of Open Access Journals (Sweden)

    King Graham J


    Full Text Available Abstract Background The Multinational Brassica rapa Genome Sequencing Project (BrGSP has developed valuable genomic resources, including BAC libraries, BAC-end sequences, genetic and physical maps, and seed BAC sequences for Brassica rapa. An integrated linkage map between the amphidiploid B. napus and diploid B. rapa will facilitate the rapid transfer of these valuable resources from B. rapa to B. napus (Oilseed rape, Canola. Results In this study, we identified over 23,000 simple sequence repeats (SSRs from 536 sequenced BACs. 890 SSR markers (designated as BrGMS were developed and used for the construction of an integrated linkage map for the A genome in B. rapa and B. napus. Two hundred and nineteen BrGMS markers were integrated to an existing B. napus linkage map (BnaNZDH. Among these mapped BrGMS markers, 168 were only distributed on the A genome linkage groups (LGs, 18 distrubuted both on the A and C genome LGs, and 33 only distributed on the C genome LGs. Most of the A genome LGs in B. napus were collinear with the homoeologous LGs in B. rapa, although minor inversions or rearrangements occurred on A2 and A9. The mapping of these BAC-specific SSR markers enabled assignment of 161 sequenced B. rapa BACs, as well as the associated BAC contigs to the A genome LGs of B. napus. Conclusion The genetic mapping of SSR markers derived from sequenced BACs in B. rapa enabled direct links to be established between the B. napus linkage map and a B. rapa physical map, and thus the assignment of B. rapa BACs and the associated BAC contigs to the B. napus linkage map. This integrated genetic linkage map will facilitate exploitation of the B. rapa annotated genomic resources for gene tagging and map-based cloning in B. napus, and for comparative analysis of the A genome within Brassica species.

  14. A spatial assessment of Brassica napus gene flow potential to wild and weedy relatives in the Fynbos Biome

    Directory of Open Access Journals (Sweden)

    J. M. Kalwij


    Full Text Available Gene flow between related plant species, and between transgenic and non-transgenic crop varieties, may be considered a form of biological invasion. Brassica napus (oilseed rape or canola and its relatives are well known for intra- and inter-specific gene flow, hybridisation and weediness. Gene flow associated with B. napus poses a potential ecological risk in the Fynbos Biome of South Africa, because of the existence of both naturalised (alien, weedy and native relatives in this region. This risk is particularly pertinent given the proposed use of B. napus for biofuel and the potential future introduction of herbicide-tolerant transgenic B. napus. Here we quantify the presence and co-occurrence of B. napus and its wild and weedy relatives in the Fynbos Biome, as a first step in the ecological risk assessment for this crop. Several alien and at least one native relative of B. napus were found to be prevalent in the region, and to be spatially congruent with B. napus fields. The first requirement for potential gene flow to occur has thus been met. In addition, a number of these species have elsewhere been found to be reproductively compatible with B. napus. Further assessment of the potential ecological risks associated with B. napus in South Africa is constrained by uncertainties in the phylogeny of the Brassicaceae, difficulties with morphology-based identification, and poor knowledge of the biology of several of the species involved, particularly under South African conditions.

  15. Involvement of phospholipases C and D in early response to SAR and ISR inducers in Brassica napus plants

    Czech Academy of Sciences Publication Activity Database

    Profotová, Bronislava; Burketová, Lenka; Novotná, Z.; Martinec, Jan; Valentová, O.


    Roč. 44, 2-3 (2006), s. 143-151 ISSN 0981-9428 R&D Projects: GA ČR GA522/03/0353 Institutional research plan: CEZ:AV0Z50380511 Keywords : Brassica napus * Induced resistance * Phospholipase C and D Subject RIV: CE - Biochemistry Impact factor: 1.847, year: 2006

  16. Progressive introgression between ¤Brassica napus¤ (oilseed rape) and ¤B-rapa¤

    DEFF Research Database (Denmark)

    Hansen, L.B.; Siegismund, H.R.; Bagger Jørgensen, Rikke


    We have earlier shown extensive introgression between oilseed rape (Brassica napus) and B. rapa in a weedy population using AFLP markers specific for the nuclear genomes. In order to describe the progress of this introgression, we examined 117 offspring from 12 maternal plants from the introgress...

  17. Separation and identification of candidate protein elicitors from the cultivation medium of Leptosphaeria maculans inducing resistance in Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Nováková, Miroslava; Kim, P.D.; Šašek, Vladimír; Burketová, Lenka; Jindřichová, Barbora; Šantrůček, J.; Valentová, O.


    Roč. 32, č. 4 (2016), s. 918-928 ISSN 8756-7938 R&D Projects: GA ČR GA522/08/1581; GA MZe QH81201; GA MŠk LD14093 Institutional support: RVO:61389030 Keywords : elicitor * Brassica napus * Leptosphaeria maculans Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 1.986, year: 2016

  18. In vitro distribution and characterization of membrane-associated PLD and PI-PLC in Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Novotná, Z.; Martinec, Jan; Profotová, Bronislava; Žďárová, Štěpánka; Kader, J. K.; Valentová, O.


    Roč. 54, č. 383 (2003), s. 691-698 ISSN 0022-0957 R&D Projects: GA ČR GA522/00/1332; GA MŠk LN00A081 Institutional research plan: CEZ:AV0Z5038910 Keywords : Brassica napus * phospholipases * plasma membrane Subject RIV: CE - Biochemistry Impact factor: 3.180, year: 2003

  19. Genome-Wide Identification and Structural Analysis of bZIP Transcription Factor Genes in Brassica napus. (United States)

    Zhou, Yan; Xu, Daixiang; Jia, Ledong; Huang, Xiaohu; Ma, Guoqiang; Wang, Shuxian; Zhu, Meichen; Zhang, Aoxiang; Guan, Mingwei; Lu, Kun; Xu, Xinfu; Wang, Rui; Li, Jiana; Qu, Cunmin


    The basic region/leucine zipper motif (bZIP) transcription factor family is one of the largest families of transcriptional regulators in plants. bZIP genes have been systematically characterized in some plants, but not in rapeseed ( Brassica napus ). In this study, we identified 247 BnbZIP genes in the rapeseed genome, which we classified into 10 subfamilies based on phylogenetic analysis of their deduced protein sequences. The BnbZIP genes were grouped into functional clades with Arabidopsis genes with similar putative functions, indicating functional conservation. Genome mapping analysis revealed that the BnbZIPs are distributed unevenly across all 19 chromosomes, and that some of these genes arose through whole-genome duplication and dispersed duplication events. All expression profiles of 247 bZIP genes were extracted from RNA-sequencing data obtained from 17 different B . napus ZS11 tissues with 42 various developmental stages. These genes exhibited different expression patterns in various tissues, revealing that these genes are differentially regulated. Our results provide a valuable foundation for functional dissection of the different BnbZIP homologs in B . napus and its parental lines and for molecular breeding studies of bZIP genes in B . napus .

  20. Citric acid improves lead (pb) phytoextraction in brassica napus L. by mitigating pb-induced morphological and biochemical damages. (United States)

    Shakoor, Muhammad Bilal; Ali, Shafaqat; Hameed, Amjad; Farid, Mujahid; Hussain, Sabir; Yasmeen, Tahira; Najeeb, Ullah; Bharwana, Saima Aslam; Abbasi, Ghulam Hasan


    Phytoextraction is an environmentally friendly and a cost-effective strategy for remediation of heavy metal contaminated soils. However, lower bioavailability of some of the metals in polluted environments e.g. lead (Pb) is a major constraint of phytoextraction process that could be overcome by applying organic chelators. We conducted a glasshouse experiment to evaluate the role of citric acid (CA) in enhancing Pb phytoextraction. Brassica napus L. seedlings were grown in hydroponic media and exposed to various treatments of Pb (50 and 100 μM) as alone or in combination with CA (2.5mM) for six weeks. Pb-induced damage in B. napus toxicity was evident from elevated levels of malondialdehyde (MDA) and H2O2 that significantly inhibited plant growth, biomass accumulation, leaf chlorophyll contents and gas exchange parameters. Alternatively, CA application to Pb-stressed B. napus plants arrested lipid membrane damage by limiting MDA and H2O2 production and by improving antioxidant enzyme activities. In addition, CA significantly increased the Pb accumulation in B. napus plants. The study concludes that CA has a potential to improve Pb phytoextraction without damaging plant growth. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Metabolome classification of Brassica napus L. organs via UPLC-QTOF-PDA-MS and their anti-oxidant potential. (United States)

    Farag, Mohamed A; Sharaf Eldin, Mohamed G; Kassem, Hanaa; Abou el Fetouh, Mohamed


    Brassica napus L. is a crop widely grown for its oil production and other nutritional components in the seed. In addition to the seed, other organs contain a wide range of phenolic metabolites although they have not been investigated to the same extent as in seeds. To define and compare the phytochemical composition of B. napus L. organs, namely the root, stem, leaf, inflorescence and seeds. Non-targeted metabolomic analysis via UPLC-QTOF-MS was utilised in order to localise compounds belonging to various chemical classes (i.e. oxygenated fatty acids, flavonols, phenolic acids and sinapoyl choline derivatives). The vast majority of identified metabolites were flavonol glycosides that accumulated in most of the plant organs. Whereas other classes were detected predominantly in specific organs, i.e. sinapoyl cholines were present uniquely in seeds. Furthermore, variation in the accumulation pattern of metabolites from the same class was observed, particularly in the case of quercetin, kaempferol and isorhamnetin flavonols. Anti-oxidant activity, based on 2,2-diphenyl-1-picrylhdrazyl analysis was observed for all extracts, and correlated to some extent with total flavonoid content. This study provides the most complete map for polyphenol composition in B. napus L. organs. By describing the metabolites profile in B. napus L., this study provides the basis for future investigations of seeds for potential health and/or medicinal use. Copyright © 2012 John Wiley & Sons, Ltd.

  2. Alteration of gene expression during the induction of freezing tolerance in Brassica napus suspension cultures

    International Nuclear Information System (INIS)

    Johnson-Flanagan, A.M.; Singh, J.


    Brassica napus suspension-cultured cells can be hardened to a lethal temperature for 50% of the sample of -20 0 C in eight days at room temperature with abscisic acid. During the induction of freezing tolerance, changes were observed in the electrophoretic pattern of [ 35 S]methionine labeled polypeptides. In hardening cells, a 20 kilodalton polypeptide was induced on day 2 and its level increased during hardening. The induction of freezing tolerance with nonmaximal hardening regimens also resulted in increases in the 20 kilodalton polypeptide. The 20 kilodalton polypeptide was associated with a membrane fraction enriched in endoplasmic reticulum and was resolved as a single spot by two-dimensional electrophoresis. In vitro translation of mRNA indicate alteration of gene expression during abscisic acid induction of freezing tolerance. The new mRNA encodes a 20 kilodalton polypeptide associated with increased freezing tolerance induced by either abscisic acid or high sucrose. A 20 kilodalton polypeptide was also translated by mRNA isolated from cold-hardened B. napus plants

  3. Genetic Diversity in Commercial Rapeseed (Brassica napus L. Varieties from Turkey as Revealed by RAPD

    Directory of Open Access Journals (Sweden)

    Özlem ÖZBEK


    Full Text Available In cultivated commercial crop species, genetic diversity tends to decrease because of the extensive breeding processes. Therefore, germplasm of commercial crop species, such as Brassica napus L. should be evaluated and the genotypes, which have higher genetic diversity index, should be addressed as potential parental cross materials in breeding programs. In this study, the genetic diversity was analysed by using randomly amplified polymorphic DNA analysis (RAPD technique in nine Turkish commercial rapeseed varieties. The RAPD primers (10-mer oligonucleotides produced 51 scorable loci, 31 loci of which were polymorphic (60.78% and 20 loci (39.22% were monomorphic The RAPD bands were scored as binary matrix data and were analysed using POPGENE version 1.32. At locus level, the values of genetic diversity within population (Hs and total (HT were 0.15 and 0.19 respectively. The genetic differentiation (GST and the gene flow (Nm values between the populations were 0.20 and 2.05 respectively. The mean number of alleles (na, the mean number of effective alleles (nae, and the mean value of genetic diversity (He were 2.00, 1.26, and 0.19 respectively. According to Pearson’s correlation, multiple regression and principal component analyses, eco-geographical conditions in combination had significant effect on genetic indices of commercial B. napus L. varieties were discussed.

  4. Effect of different sulfur levels from various sources on brassica napus growth and soil sulfur fractions

    International Nuclear Information System (INIS)

    Khalid, R.; Khan, K.S.; Islam, M.; Yousaf, M.; Shabbir, G.


    A two year field study was conducted at two different locations in northern rain fed Punjab, Pakistan to assess the effect of different rates of sulfur application from various sources on soil sulfur fractions and growth of Brassica napus. The treatments included three sulfur sources i. e., single super phosphate, ammonium sulfate and gypsum each applied at five different rates (0, 10, 20, 30 and 40 kg S ha/sup -1/ ). Sulfur application had a significant positive effect on the growth and yield parameters of Brassica napus. Among the sulfur sources ammonium sulfate resulted in maximum increase in plant growth and yield parameters, followed by single super phosphate. Sulfur content and uptake by crop plants was significantly higher with ammonium sulfate application as compared to other two sulfur sources. Sulfur application also exerted a significant positive effect on different S fractions in the soils. On an average, 18.0% of the applied sulfur got incorporated into CaCl/sub 2/ extractable sulfur fraction, while 15.6% and 35.5% entered into adsorbed and organic sulfur fractions in the soils, respectively. The value cost ratio increased significantly by sulfur application up to 30 kg ha/sup -1/. Among sulfur sources, ammonium sulfate performed best giving the highest net return. (author)

  5. Effects of Salinity on Yield and Component Characters in Canola (Brassica napus L. Cultivars

    Directory of Open Access Journals (Sweden)

    Ahmad BYBORDI


    Full Text Available Cultivars �Okapi�, �SLM046�, �Elite�, �Fornax� and �Licord� Brassica napus were tested for yield and component characters under different levels of salinity. The variations due to salinity levels, cultivars and cultivarxsalinity (interaction were significant for different characters. The variable degrees of increase and decrease of regression coefficient estimate mates (curve estimation showed the performance as influenced by different salinity levels. The performance of Brassica napus variety in plant height and days to first flowering was the best for �SLM046�, �Okapi� �SLM046� and �Okapi� cultivars. �SLM046� showed the best performance in days to maturity, followed by �Licord� and �Elite�. �Okapi� performed better than others regarding the increased number of seeds per plant and seed yield per plant, followed by �Fornax�. Considering all characters, the most tolerance ability was found in �SLM046� and �Okapi�, against different levels of salinity.

  6. Impacts of adding different components of wood vinegar on rape (Brassica napus L.) seed germiantion (United States)

    Shan, Xue; Liu, Xia; Zhang, Qian


    In recent years, wood vinegar has been widely used in the agricultural production. It can be used as the soil amendment, antibacterial agent and organic fertilizer. This study investigated the effect of wood vinegar on rape (Brassica napus L.) seed germination. The results in this study showed that 1% (v/v) wood vinegar had the greatest inhibition effect on the seed germination of rape (Brassica napus L.). The wood vinegar (WV) and the distilled wood vinegar at 98 - 130 °C (D2) significantly inhibited seed germination by 100%, compared to the control treatment. However, the distilled wood vinegar (D1) had significantly increased the shoot length and root length by 58.4% and 31.7%, respectively. These positive effects could be attributed to the improved soil fertility, increased nutrient supply, and further stimulated plant growth. Overall, the D1 could be a promising soil amendment to promote plants growth and enhance crop yields. Effect of adding different components of distilled wood vinegar on the seed germination of rape

  7. Biochemical and histopathological profiling of Wistar rat treated with Brassica napus as a supplementary feed

    Directory of Open Access Journals (Sweden)

    Kazi Md. Mahmudul Hasan


    Full Text Available Metabolic changes together with cardiovascular and hepatic factors are related to the development of diseases like myocardial lipidosis, heart disease, and profound toxicity. The aim of this animal study is to determine the effects of high erucic acid containing rapeseed oil (Brassica napus L. varieties on liver, kidney and heart muscles in Wistar rats. Male Wistar rats were divided into three groups where each group containing four rats. Group A was considered as control diet group, while Group B rapeseed wild oil group and Group C rapeseed hybrid oil group were considered as experimental diet groups. The levels of aspartate aminotransferase (AST, alanine aminotransferase (ALT,alkaline phosphatase(ALP, creatine kinase-MB (CK-MB and creatinine of two experimental groups were significantly elevated while compared to the control groups (p  0.05. Noticeable tissue injury observed in this study is a sign of the relative toxicity of erucic acid containing rapeseed oil to mammalian species. The use of Brassica napus as a supplementary feed ingredient should be, therefore, thoroughly considered Keywords: Rapeseed oil, Rattus norvegicus, Serum enzymes, Erucic acid, Tissue profiling

  8. Purification and protein composition of oil bodies from Brassica napus seeds

    Directory of Open Access Journals (Sweden)

    Jolivet Pascale


    Full Text Available Seed oil bodies are intracellular particles to store lipids as food reserves in oleaginous plants. Description of oil body-associated proteins of Arabidopsis thaliana has been recently reported whereas only few data are available in the case of rapeseed. Oil bodies have been prepared from two double-low varieties of Brassica napus seeds, a standard variety (Explus and an oleic variety (Cabriolet. Oil bodies have been purified using floatation technique in the successive presence of high salt concentration, detergent or urea in order to remove non-specifically trapped proteins. The integrity of the oil bodies has been verified and their size estimated. Their protein and fatty acid contents have been determined. The proteins composing these organelles were extracted, separated by denaturing gel electrophoresis, digested by trypsin and their peptides were subsequently analyzed by liquid chromatography-tandem mass spectrometry. Protein identification was performed using Arabidopsis thaliana protein sequence database and a collection of Expressed Sequence Tag (EST of Brassica napus generated from the framework of the French plant genomics programme “Genoplante”. This led to the identification of a limited number of proteins: eight oleosins showing a high similarity each other and representing up to 75% of oil body proteins, a 11 β hydroxysteroid dehydrogenase-like protein highly homologous to the same protein from A. thaliana, and only few contaminating proteins associated with myrosinase activity.

  9. Genome-wide identification, functional prediction, and evolutionary analysis of the R2R3-MYB superfamily in Brassica napus. (United States)

    Hajiebrahimi, Ali; Owji, Hajar; Hemmati, Shiva


    R2R3-MYB transcription factors (TFs) have been shown to play important roles in plants, including in development and in various stress conditions. Phylogenetic analysis showed the presence of 249 R2R3-MYB TFs in Brassica napus, called BnaR2R3-MYB TFs, clustered into 38 clades. BnaR2R3-MYB TFs were distributed on 19 chromosomes of B. napus. Sixteen gene clusters were identified. BnaR2R3-MYB TFs were characterized by motif prediction, gene structure analysis, and gene ontology. Evolutionary analysis revealed that BnaR2R3-MYB TFs are mainly formed as a result of whole-genome duplication. Orthologs and paralogs of BnaR2R3-MYB TFs were identified in B. napus, B. rapa, B. oleracea, and Arabidopsis thaliana using synteny-based methods. Purifying selection was pervasive within R2R3-MYB TFs. K n /K s values lower than 0.3 indicated that BnaR2R3-MYB TFs are being functionally converged. The role of gene conversion in the formation of BnaR2R3-MYB TFs was significant. Cis-regulatory elements in the upstream regions of BnaR2R3-MYB genes, miRNA targeting BnaR2R3MYB TFs, and post translational modifications were identified. Digital expression data revealed that BnaR2R3-MYB genes were highly expressed in the roots and under high salinity treatment after 24 h. BnaMYB21, BnaMYB141, and BnaMYB148 have been suggested for improving salt-tolerant B. napus. BnaR2R3-MYB genes were mostly up regulated on the 14th day post inoculation with Leptosphaeria biglobosa and L. maculan. BnaMYB150 is a candidate for increased tolerance to Leptospheria in B. napus.

  10. Genome-wide survey of flavonoid biosynthesis genes and gene expression analysis between black- and yellow-seeded Brassica napus

    Directory of Open Access Journals (Sweden)

    Cunmin Qu


    Full Text Available Flavonoids, the compounds that impart color to fruits, flowers, and seeds, are the most widespread secondary metabolites in plants. However, a systematic analysis of these loci has not been performed in Brassicaceae. In this study, we isolated 649 nucleotide sequences related to flavonoid biosynthesis, i.e., the Transparent Testa (TT genes, and their associated amino acid sequences in 17 Brassicaceae species, grouped into Arabidopsis or Brassicaceae subgroups. Moreover, 36 copies of 21 genes of the flavonoid biosynthesis pathway were identified in A. thaliana, 53 were identified in B. rapa, 50 in B. oleracea, and 95 in B. napus, followed the genomic distribution, collinearity analysis and genes triplication of them among Brassicaceae species. The results showed that the extensive gene loss, whole genome triplication, and diploidization that occurred after divergence from the common ancestor. Using qRT-PCR methods, we analyzed the expression of eighteen flavonoid biosynthesis genes in 6 yellow- and black-seeded B. napus inbred lines with different genetic background, found that 12 of which were preferentially expressed during seed development, whereas the remaining genes were expressed in all B. napus tissues examined. Moreover, fourteen of these genes showed significant differences in expression level during seed development, and all but four of these (i.e., BnTT5, BnTT7, BnTT10, and BnTTG1 had similar expression patterns among the yellow- and black-seeded B. napus. Results showed that the structural genes (BnTT3, BnTT18 and BnBAN, regulatory genes (BnTTG2 and BnTT16 and three encoding transfer proteins (BnTT12, BnTT19, and BnAHA10 might play an crucial roles in the formation of different seed coat colors in B. napus. These data will be helpful for illustrating the molecular mechanisms of flavonoid biosynthesis in Brassicaceae species.

  11. Expression of the C3-C 4 intermediate character in somatic hybrids between Brassica napus and the C3-C 4 species Moricandia arvensis. (United States)

    O'Neill, C M; Murata, T; Morgan, C L; Mathias, R J


    The wild crucifer Moricandia arvensis is a potential source of alien genes for the genetic improvement of related Brassica crops. In particular M. arvensis has a C3-C4 intermediate photosynthetic mechanism which results in enhanced recapture of photorespired CO2 and may increase plant water-use efficiency. In order to transfer this trait into Brassica napus, somatic hybridisations were made between leaf mesophyll protoplasts from cultured M. arvensis shoot tips and hypocotyl protoplasts from three Brassica napus cultivars, 'Ariana', 'Cobra' and 'Westar'. A total of 23 plants were recovered from fusion experiments and established in the greenhouse. A wide range of chromosome numbers were observed among the regenerated plants, including some apparent mixoploids. Thirteen of the regenerated plants were identified as nuclear hybrids between B. napus and M. arvensis on the basis of isozyme analysis. The phenotypes of these hybrids were typically rather B. napus-like, but much variability was observed, including variation in flower colour, leaf shape and colour, leaf waxiness, fertility and plant vigour. CO2 compensation point measurements on the regenerated plants demonstrated that 3 of the hybrids express the M. arvensis C3-C4 intermediate character at the physiological level. Semi-thin sections through leaf tissues of these 3 plants revealed the presence of a Kranz-like leaf anatomy characteristic of M. arvensis but not found in B. napus. This is the first report of the expression of this potentially important agronomic trait, transferred from Moricandia, in M. arvensis x B. napus hybrids.

  12. Genome-Wide Identification and Expression Analysis of WRKY Transcription Factors under Multiple Stresses in Brassica napus. (United States)

    He, Yajun; Mao, Shaoshuai; Gao, Yulong; Zhu, Liying; Wu, Daoming; Cui, Yixin; Li, Jiana; Qian, Wei


    WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related QTL regions

  13. Genome-Wide Identification and Expression Analysis of WRKY Transcription Factors under Multiple Stresses in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Yajun He

    Full Text Available WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related

  14. The use of protein patterns in genetic diversity analysis in some Brassica napus cultivars

    Directory of Open Access Journals (Sweden)

    Roya Razavizadeh


    Full Text Available In this study, protein variations of seeds and five-day old cotyledonal leaves of four selected Brassica napus cultivars including Elite, Ocapy, Tasilo and Zarfam were analyzed by SDS-PAGE to identify protein markers. The amount of total soluble protein of seed storage proteins did not show significant differences in all cultivars whereas it was different in cotyledonal leaves. Protein patterns of seeds and cotyledonal leaves showed significant differences using SDS-PAGE and consequence analysis of bands by ImageJ program. Relative expression of six protein bands in seeds and five-day old cotyledonal leaves were significantly different. Three protein markers were identified by protein patterns of seed and cotyledonal leaves. The results of relationship analysis based on presence and absence of the specific protein bands in protein pattern of seed storage proteins showed that Tasilo and Elite cultivars had the highest similarities.

  15. NMR metabolomics of ripened and developing oilseed rape (Brassica napus) and turnip rape (Brassica rapa). (United States)

    Kortesniemi, Maaria; Vuorinen, Anssi L; Sinkkonen, Jari; Yang, Baoru; Rajala, Ari; Kallio, Heikki


    The oilseeds of the commercially important oilseed rape (Brassica napus) and turnip rape (Brassica rapa) were investigated with (1)H NMR metabolomics. The compositions of ripened (cultivated in field trials) and developing seeds (cultivated in controlled conditions) were compared in multivariate models using principal component analysis (PCA), partial least squares discriminant analysis (PLS-DA), and orthogonal partial least squares discriminant analysis (OPLS-DA). Differences in the major lipids and the minor metabolites between the two species were found. A higher content of polyunsaturated fatty acids and sucrose were observed in turnip rape, while the overall oil content and sinapine levels were higher in oilseed rape. The genotype traits were negligible compared to the effect of the growing site and concomitant conditions on the oilseed metabolome. This study demonstrates the applicability of NMR-based analysis in determining the species, geographical origin, developmental stage, and quality of oilseed Brassicas. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Maghemite Nanoparticles Acts as Nanozymes, Improving Growth and Abiotic Stress Tolerance in Brassica napus (United States)

    Palmqvist, N. G. Martin; Seisenbaeva, Gulaim A.; Svedlindh, Peter; Kessler, Vadim G.


    Yttrium doping-stabilized γ-Fe2O3 nanoparticles were studied for its potential to serve as a plant fertilizer and, through enzymatic activity, support drought stress management. Levels of both hydrogen peroxide and lipid peroxidation, after drought, were reduced when γ-Fe2O3 nanoparticles were delivered by irrigation in a nutrient solution to Brassica napus plants grown in soil. Hydrogen peroxide was reduced from 151 to 83 μM g-1 compared to control, and the malondialdehyde formation was reduced from 36 to 26 mM g-1. Growth rate of leaves was enhanced from 33 to 50% growth compared to fully fertilized plants and SPAD-measurements of chlorophyll increased from 47 to 52 suggesting improved agronomic properties by use of γ-Fe2O3 nanoparticles as fertilizer as compared to chelated iron.

  17. Tissue-specific distribution of secondary metabolites in rapeseed (Brassica napus L..

    Directory of Open Access Journals (Sweden)

    Jingjing Fang

    Full Text Available Four different parts, hypocotyl and radicle (HR, inner cotyledon (IC, outer cotyledon (OC, seed coat and endosperm (SE, were sampled from mature rapeseed (Brassica napus L. by laser microdissection. Subsequently, major secondary metabolites, glucosinolates and sinapine, as well as three minor ones, a cyclic spermidine conjugate and two flavonoids, representing different compound categories, were qualified and quantified in dissected samples by high-performance liquid chromatography with diode array detection and mass spectrometry. No qualitative and quantitative difference of glucosinolates and sinapine was detected in embryo tissues (HR, IC and OC. On the other hand, the three minor compounds were observed to be distributed unevenly in different rapeseed tissues. The hypothetic biological functions of the distribution patterns of different secondary metabolites in rapeseed are discussed.

  18. Indications of selenium protection against cadmium and lead toxicity in oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Zhilin Wu


    Full Text Available The present study investigated the beneficial role of selenium (Se in protecting oilseed rape (Brassica napus L. plants from cadmium (Cd+2 and lead (Pb+2 toxicity. Exogenous Se markedly reduced Cd and Pb concentration in both roots and shoots. Supplementation of the medium with Se (5, 10 and 15 mg kg-1 alleviated the negative effect of Cd and Pb on growth and led to a decrease in oxidative damages caused by Cd and Pb. Furthermore, Se enhanced superoxide free radicals (O2-, hydrogen peroxide (H2O2 and lipid peroxidation, as indicated by malondialdehyde (MDA accumulation, but decreased superoxide dismutase (SOD and glutathione peroxidase (GPx activities. Meanwhile, the presence of Cd and Pb in the medium affected Se speciation in shoots. The results suggest that Se could alleviate Cd and Pb toxicity by preventing oxidative stress in oilseed rape plant.

  19. Availability of phosphorus from ground phosphate rocks for rape (Brassica napus L.)

    International Nuclear Information System (INIS)

    Zhu Yongyi; Yang Juncheng; Chen Jingjian; Liu Delin; Zhu Zhaomin; Wu Ming


    The availability of phosphorus from the ground phosphate rock, which is provided by Kaiyang mining plant, Guizhou Province of China, is investigated in pot experiment with acid red soil for rape (Brassica napus L. No. 13 Xingyou, Chinese Olive Group) by 32 P indirect labelling method. The results show that the yield increased significantly by applying ground phosphate rock (GPR) and the efficiency of GPR is equal to 17.1% of that from calcium superphosphate. It is calculated as that the fertilizer efficiency of 1 kg of calcium superphosphate is the same as that of 8.53 kg ground phosphate rock in Guizhou Province of China. The effect on the grain yield is evaluated by pot and field microplot experiments, and it is found that the main effect is to increase the pod number. The fertilizer efficiency in field experiment is the same as that in pot experiment. (9 refs., 1 fig., 7 tabs.)

  20. Studies on nitrogen uptake and utilization by rape (Brassica napus L.) under different sowing dates

    International Nuclear Information System (INIS)

    Liu Qixin; Nie Guangming


    The nitrogen uptake and utilization by low erucic acid variety, Zhong You Di Gai No.2, of rape (Brassica napus L.) under different sowing dates were studied. Total N uptake, the percentage N derived from the fertilizer, the rate of utilization of nitrogenous fertilizer, the production efficiency of N-fertilizer (seed yield g/gN derived by rape plant from the fertilizer), total P uptake and the production efficiency of phosphorus (seed yield g/gP derived by rape plant from fertilizer and soil) were all significantly higher at early sowing than that at later sowing within the range of normal sowing dates. Therefore, the biomass yield, the seed yield and oil content all increased significantly at early sowing treatment, but erucic acid content showed no significant difference

  1. Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil. (United States)

    Marchiol, L; Assolari, S; Sacco, P; Zerbi, G


    Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels.

  2. Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil

    International Nuclear Information System (INIS)

    Marchiol, L.; Assolari, S.; Sacco, P.; Zerbi, G.


    Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels

  3. Microspore culture of winter oilseed rape (Brassica napus L.) in conjunction with other in vitro technologies

    International Nuclear Information System (INIS)

    Cegielska-Taras, T.; Szala, L.; Bartkowiak-Broda, I.


    Microspore culture in conjunction with other technologies such as selection, mutagenesis and transformation has been used for the production of novel genotypes of Brassica napus L. for crop improvement. The example of in vitro selection of microspore - derived embryos includes: a) ploidy level, b) seed oil composition (for example: high level of erucic acid), c) genotypes with restorer gene for CMS-ogura system (by means of isozyme marker PGI-2 ), d) herbicide resistant forms. Efficiency of microspore mutagenesis has been tested by the treatment of freshly isolated microspores with UV and MNU. Direct delivery of foreign gene to the microspores (microprojectile bombardment) combined with the use of Agrobacterium tumefaciens to microspore derived embryos seems to be a promising way of oilseed rape transformation. (author)

  4. Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Marchiol, L.; Assolari, S.; Sacco, P.; Zerbi, G


    Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels.

  5. Effects of helium ions of an early embryo on postembryonic leaf development in Brassica napus L.

    Energy Technology Data Exchange (ETDEWEB)

    Sakurai, Noboru [Tokyo Metropolitan Industrial Technology Research Institute, Tokyo (Japan); Minami, Harufumi [Tokyo Metropolitan Agricultural Experiment Station, Tachikawa, Tokyo (Japan); Shikazono, Naoya; Tanaka, Atsushi; Watanabe, Hiroshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment


    We examined postembryonic effects after helium ion and gamma ray irradiation of an isolated whole flower (a flower with pedicel) of Brassica napus through a flower organ culture, and estimated the effects of irradiation on embryogenesis in sexual reproductive stages. The whole flowers were irradiated with 30 Gy of helium ions and gamma rays in the early globular embryo and/or torpedo embryo stages. The helium ion and gamma ray irradiation of early globular embryos caused some drastic malformations in the first true leaves. Those malformations were classified into four types: cup-shaped, funnel-shaped, shrunk and the other varied leaves. The types were observed in 40% of plants that developed first true leaves. Both cup-shaped and funnel-shaped types were observed in over 15%. On the other hand, the irradiation of gamma rays of torpedo embryos caused sectors lacking chlorophyll in first true leaves. (author)

  6. Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L.). (United States)

    Wang, Xingxing; Zhang, Chunyu; Li, Lingjuan; Fritsche, Steffi; Endrigkeit, Jessica; Zhang, Wenying; Long, Yan; Jung, Christian; Meng, Jinling


    Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38) is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL) detection, genome-wide association analysis, and homologous gene mapping. We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH) population, its reconstructed F(2) (RC-F(2)) population, and a panel of 142 rapeseed accessions (association panel). Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2) populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used for marker-assisted selection of oilseed rape lines with superior tocopherol

  7. Comparative transcript profiling of the fertile and sterile flower buds of pol CMS in B. napus. (United States)

    An, Hong; Yang, Zonghui; Yi, Bin; Wen, Jing; Shen, Jinxiong; Tu, Jinxing; Ma, Chaozhi; Fu, Tingdong


    The Polima (pol) system of cytoplasmic male sterility (CMS) and its fertility restoration gene Rfp have been used in hybrid breeding in Brassica napus, which has greatly improved the yield of rapeseed. However, the mechanism of the male sterility transition in pol CMS remains to be determined. To investigate the transcriptome during the male sterility transition in pol CMS, a near-isogenic line (NIL) of pol CMS was constructed. The phenotypic features and sterility stage were confirmed by anatomical analysis. Subsequently, we compared the genomic expression profiles of fertile and sterile young flower buds by RNA-Seq. A total of 105,481,136 sequences were successfully obtained. These reads were assembled into 112,770 unigenes, which composed the transcriptome of the bud. Among these unigenes, 72,408 (64.21%) were annotated using public protein databases and classified into functional clusters. In addition, we investigated the changes in expression of the fertile and sterile buds; the RNA-seq data showed 1,148 unigenes had significantly different expression and they were mainly distributed in metabolic and protein synthesis pathways. Additionally, some unigenes controlling anther development were dramatically down-regulated in sterile buds. These results suggested that an energy deficiency caused by orf224/atp6 may inhibit a series of genes that regulate pollen development through nuclear-mitochondrial interaction. This results in the sterility of pol CMS by leading to the failure of sporogenous cell differentiation. This study may provide assistance for detailed molecular analysis and a better understanding of pol CMS in B. napus.

  8. Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

    International Nuclear Information System (INIS)

    Cen Yan-Ping.


    In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m -2 day -1 biologically effective UV-B radiation (UV-B BE ). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 μm paradermal leaf sections. The first adaxial section (40μm) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m -2 day -1 UV-B BE with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation

  9. Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Cen Yan-Ping


    In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m{sup -2} day{sup -1} biologically effective UV-B radiation (UV-B{sub BE}). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 {mu}m paradermal leaf sections. The first adaxial section (40{mu}m) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m{sup -2} day{sup -1} UV-B{sub BE} with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation.

  10. Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L..

    Directory of Open Access Journals (Sweden)

    Xingxing Wang

    Full Text Available BACKGROUND: Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38 is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL detection, genome-wide association analysis, and homologous gene mapping. METHODOLOGY/PRINCIPAL FINDINGS: We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH population, its reconstructed F(2 (RC-F(2 population, and a panel of 142 rapeseed accessions (association panel. Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2 populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. CONCLUSIONS/SIGNIFICANCE: This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used

  11. Adventitious presence of other varieties in oilseed rape (¤Brassica napus¤) from seed banks and certified seed

    DEFF Research Database (Denmark)

    Jørgensen, T.; Hauser, Thure Pavlo; Bagger Jørgensen, Rikke


    To obtain information on possible sources of contamination of the seed harvest of oilseed rape (Brassica napus L., spp. napus) by other varieties (adventitious presence), we investigated the purity of certified seed lots; the abundance and origin of volunteers; and longevity and origin of seeds...... in the soil seed-bank. This information was acquired through DNA analysis of volunteers collected in the field and seedlings derived from the soil seed-bank. DNA profiles of the volunteers and seedlings were obtained using Inter Simple Sequence Repeat (ISSR) markers, and the profiles were compared with ISSR...... profiles from an assortment of 14 of the most commonly cultivated oilseed rape varieties from 1985 to 2004. This comparison was performed using the assignment program, AFLPOP. The age of the seed bank germinating to become volunteers was assumed from information on previously cultivated oilseed rape...

  12. Data for iTRAQ-based quantitative proteomics analysis of Brassica napus leaves in response to chlorophyll deficiency

    Directory of Open Access Journals (Sweden)

    Pu Chu


    Full Text Available The essential pigment chlorophyll (Chl plays important roles in light harvesting and energy transfer during photosynthesis. Here we present the data from a comparative proteomic analysis of chlorophyll-deficient Brassica napus mutant cde1 and its corresponding wild-type using the iTRAQ approach (Pu Chu et al., 2014 [1]. The distribution of length and number of peptides, mass and sequence coverage of proteins identified was calculated, and the repeatability of the replicates was analyzed. A total of 443 differentially expressed proteins were identified in B. napus leaves, including 228 down-accumulated proteins mainly involved in photosynthesis, porphyrin and chlorophyll metabolism, biosynthesis of secondary metabolites, carbon fixation and 215 up-accumulated proteins that enriched in the spliceosome, mRNA surveillance and RNA degradation.

  13. Molecular mapping of QTL alleles of Brassica oleracea affecting days to flowering and photosensitivity in spring Brassica napus. (United States)

    Rahman, Habibur; Bennett, Rick A; Kebede, Berisso


    Earliness of flowering and maturity are important traits in spring Brassica napus canola-whether grown under long- or short-day condition. By use of a spring B. napus mapping population carrying the genome content of B. oleracea and testing this population under 10 to 18 h photoperiod and 18 to 20 0C (day) temperature conditions, we identified a major QTL on the chromosome C1 affecting flowering time without being influenced by photoperiod and temperature, and a major QTL on C9 affecting flowering time under a short photoperiod (10 h); in both cases, the QTL alleles reducing the number of days to flowering in B. napus were introgressed from the late flowering species B. oleracea. Additive effect of the C1 QTL allele at 14 to18 h photoperiod was 1.1 to 2.9 days; however, the same QTL allele exerted an additive effect of 6.2 days at 10 h photoperiod. Additive effect of the C9 QTL at 10 h photoperiod was 2.8 days. These two QTL also showed significant interaction in the control of flowering only under a short-day (10 h photoperiod) condition with an effect of 2.3 days. A few additional QTL were also detected on the chromosomes C2 and C8; however, none of these QTL could be detected under all photoperiod and temperature conditions. BLASTn search identified several putative flowering time genes on the chromosomes C1 and C9 and located the physical position of the QTL markers in the Brassica genome; however, only a few of these genes were found within the QTL region. Thus, the molecular markers and the genomic regions identified in this research could potentially be used in breeding for the development of early flowering photoinsensitive B. napus canola cultivars, as well as for identification of candidate genes involved in flowering time variation and photosensitivity.

  14. The high-quality genome of Brassica napus cultivar 'ZS11' reveals the introgression history in semi-winter morphotype. (United States)

    Sun, Fengming; Fan, Guangyi; Hu, Qiong; Zhou, Yongming; Guan, Mei; Tong, Chaobo; Li, Jiana; Du, Dezhi; Qi, Cunkou; Jiang, Liangcai; Liu, Weiqing; Huang, Shunmou; Chen, Wenbin; Yu, Jingyin; Mei, Desheng; Meng, Jinling; Zeng, Peng; Shi, Jiaqin; Liu, Kede; Wang, Xi; Wang, Xinfa; Long, Yan; Liang, Xinming; Hu, Zhiyong; Huang, Guodong; Dong, Caihua; Zhang, He; Li, Jun; Zhang, Yaolei; Li, Liangwei; Shi, Chengcheng; Wang, Jiahao; Lee, Simon Ming-Yuen; Guan, Chunyun; Xu, Xun; Liu, Shengyi; Liu, Xin; Chalhoub, Boulos; Hua, Wei; Wang, Hanzhong


    Allotetraploid oilseed rape (Brassica napus L.) is an agriculturally important crop. Cultivation and breeding of B. napus by humans has resulted in numerous genetically diverse morphotypes with optimized agronomic traits and ecophysiological adaptation. To further understand the genetic basis of diversification and adaptation, we report a draft genome of an Asian semi-winter oilseed rape cultivar 'ZS11' and its comprehensive genomic comparison with the genomes of the winter-type cultivar 'Darmor-bzh' as well as two progenitors. The integrated BAC-to-BAC and whole-genome shotgun sequencing strategies were effective in the assembly of repetitive regions (especially young long terminal repeats) and resulted in a high-quality genome assembly of B. napus 'ZS11'. Within a short evolutionary period (~6700 years ago), semi-winter-type 'ZS11' and the winter-type 'Darmor-bzh' maintained highly genomic collinearity. Even so, certain genetic differences were also detected in two morphotypes. Relative to 'Darmor-bzh', both two subgenomes of 'ZS11' are closely related to its progenitors, and the 'ZS11' genome harbored several specific segmental homoeologous exchanges (HEs). Furthermore, the semi-winter-type 'ZS11' underwent potential genomic introgressions with B. rapa (A r ). Some of these genetic differences were associated with key agronomic traits. A key gene of A03.FLC3 regulating vernalization-responsive flowering time in 'ZS11' was first experienced HE, and then underwent genomic introgression event with A r , which potentially has led to genetic differences in controlling vernalization in the semi-winter types. Our observations improved our understanding of the genetic diversity of different B. napus morphotypes and the cultivation history of semi-winter oilseed rape in Asia. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  15. A Novel Cytoplasmic Male Sterility in Brassica napus (inap CMS) with Carpelloid Stamens via Protoplast Fusion with Chinese Woad. (United States)

    Kang, Lei; Li, Pengfei; Wang, Aifan; Ge, Xianhong; Li, Zaiyun


    A novel cytoplasmic male sterility (CMS) in Brassica napus (inap CMS) was selected from the somatic hybrid with Isatis indigotica (Chinese woad) by recurrent backcrossing. The male sterility was caused by the conversion of tetradynamous stamens into carpelloid structures with stigmatoid tissues at their tips and ovule-like tissues in the margins, and the two shorter stamens into filaments without anthers. The feminized development of the stamens resulted in the complete lack of pollen grains, which was stable in different years and environments. The pistils of inap CMS displayed normal morphology and good seed-set after pollinated by B. napus . Histological sections showed that the developmental alteration of the stamens initiated at the stage of stamen primordium differentiation. AFLP analysis of the nuclear genomic composition with 23 pairs of selective primers detected no woad DNA bands in inap CMS. Twenty out of 25 mitochondrial genes originated from I. indigotica , except for cox2-2 which was the recombinant between cox2 from woad and cox2-2 from rapeseed. The novel cox2-2 was transcribed in flower buds of inap CMS weakly and comparatively with the fertile B. napus addition line Me harboring one particular woad chromosome. The restorers of other autoplasmic and alloplasmic CMS systems in rapeseed failed to restore the fertility of inap CMS and the screening of B. napus wide resources found no fertility restoration variety, showing its distinct origin and the related mechanism of sterility. The reasons for the mitochondrial rearrangements and the breeding of the restorer for the novel CMS system were discussed.

  16. Homoeologous exchange is a major cause of gene presence/absence variation in the amphidiploid Brassica napus. (United States)

    Hurgobin, Bhavna; Golicz, Agnieszka A; Bayer, Philipp E; Chan, Chon-Kit Kenneth; Tirnaz, Soodeh; Dolatabadian, Aria; Schiessl, Sarah V; Samans, Birgit; Montenegro, Juan D; Parkin, Isobel A P; Pires, J Chris; Chalhoub, Boulos; King, Graham J; Snowdon, Rod; Batley, Jacqueline; Edwards, David


    Homoeologous exchanges (HEs) have been shown to generate novel gene combinations and phenotypes in a range of polyploid species. Gene presence/absence variation (PAV) is also a major contributor to genetic diversity. In this study, we show that there is an association between these two events, particularly in recent Brassica napus synthetic accessions, and that these represent a novel source of genetic diversity, which can be captured for the improvement of this important crop species. By assembling the pangenome of B. napus, we show that 38% of the genes display PAV behaviour, with some of these variable genes predicted to be involved in important agronomic traits including flowering time, disease resistance, acyl lipid metabolism and glucosinolate metabolism. This study is a first and provides a detailed characterization of the association between HEs and PAVs in B. napus at the pangenome level. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Potential impact of genetically modified Lepidoptera-resistant Brassica napus in biodiversity hotspots: Sicily as a theoretical model. (United States)

    Manachini, Barbara; Bazan, Giuseppe; Schicchi, Rosario


    The general increase of the cultivation and trade of Bt transgenic plants resistant to Lepidoptera pests raises concerns regarding the conservation of animal and plant biodiversity. Demand for biofuels has increased the cultivation and importation of oilseed rape (Brassica napus L.), including transgenic lines. In environmental risk assessments (ERAs) for its potential future cultivation as well as for food and feed uses, the impact on wild Brassicaeae relatives and on non-target Lepidoptera should be assessed. Here we consider the potential exposure of butterflies as results of possible cultivation or naturalization of spilled seed in Sicily (Italy). Diurnal Lepidoptera, which are pollinators, can be exposed directly to the insecticidal proteins as larvae (mainly of Pieridae) through the host and through the pollen that can deposit on other host plants. Adults can be exposed via pollen and nectar. The flight periods of butterflies were recorded, and they were found to overlap for about 90% of the flowering period of B. napus for the majority of the species. In addition, B. napus has a high potential to hybridise with endemic taxa belonging to the B. oleracea group. This could lead to an exposure of non-target Lepidoptera if introgression of the Bt gene into a wild population happens. A rank of the risk for butterflies and wild relatives of oilseed rape is given. We conclude that, in environmental risk assessments, attention should be paid to plant-insect interaction especially in a biodiversity hotspot such as Sicily. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  18. DNA Methylation Alterations at 5'-CCGG Sites in the Interspecific and Intraspecific Hybridizations Derived from Brassica rapa and B. napus.

    Directory of Open Access Journals (Sweden)

    Wanshan Xiong

    Full Text Available DNA methylation is an important regulatory mechanism for gene expression that involved in the biological processes of development and differentiation in plants. To investigate the association of DNA methylation with heterosis in Brassica, a set of intraspecific hybrids in Brassica rapa and B. napus and interspecific hybrids between B. rapa and B. napus, together with parental lines, were used to monitor alterations in cytosine methylation at 5'-CCGG sites in seedlings and buds by methylation-sensitive amplification polymorphism analysis. The methylation status of approximately a quarter of the methylation sites changed between seedlings and buds. These alterations were related closely to the genomic structure and heterozygous status among accessions. The methylation status in the majority of DNA methylation sites detected in hybrids was the same as that in at least one of the parental lines in both seedlings and buds. However, the association between patterns of cytosine methylation and heterosis varied among different traits and between tissues in hybrids of Brassica, although a few methylation loci were associated with heterosis. Our data suggest that changes in DNA methylation at 5'-CCGG sites are not associated simply with heterosis in the interspecific and intraspecific hybridizations derived from B. rapa and B. napus.

  19. Effect of arabinogalactan proteins from the root caps of pea and Brassica napus on Aphanomyces euteiches zoospore chemotaxis and germination. (United States)

    Cannesan, Marc Antoine; Durand, Caroline; Burel, Carole; Gangneux, Christophe; Lerouge, Patrice; Ishii, Tadashi; Laval, Karine; Follet-Gueye, Marie-Laure; Driouich, Azeddine; Vicré-Gibouin, Maïté


    Root tips of many plant species release a number of border, or border-like, cells that are thought to play a major role in the protection of root meristem. However, little is currently known on the structure and function of the cell wall components of such root cells. Here, we investigate the sugar composition of the cell wall of the root cap in two species: pea (Pisum sativum), which makes border cells, and Brassica napus, which makes border-like cells. We find that the cell walls are highly enriched in arabinose and galactose, two major residues of arabinogalactan proteins. We confirm the presence of arabinogalactan protein epitopes on root cap cell walls using immunofluorescence microscopy. We then focused on these proteoglycans by analyzing their carbohydrate moieties, linkages, and electrophoretic characteristics. The data reveal (1) significant structural differences between B. napus and pea root cap arabinogalactan proteins and (2) a cross-link between these proteoglycans and pectic polysaccharides. Finally, we assessed the impact of root cap arabinogalactan proteins on the behavior of zoospores of Aphanomyces euteiches, an oomycetous pathogen of pea roots. We find that although the arabinogalactan proteins of both species induce encystment and prevent germination, the effects of both species are similar. However, the arabinogalactan protein fraction from pea attracts zoospores far more effectively than that from B. napus. This suggests that root arabinogalactan proteins are involved in the control of early infection of roots and highlights a novel role for these proteoglycans in root-microbe interactions.

  20. Genome-Wide Analysis of Seed Acid Detergent Lignin (ADL) and Hull Content in Rapeseed (Brassica napus L.) (United States)

    Wei, Lijuan; Qu, Cunmin; Xu, Xinfu; Lu, Kun; Qian, Wei; Li, Jiana; Li, Maoteng; Liu, Liezhao


    A stable yellow-seeded variety is the breeding goal for obtaining the ideal rapeseed (Brassica napus L.) plant, and the amount of acid detergent lignin (ADL) in the seeds and the hull content (HC) are often used as yellow-seeded rapeseed screening indices. In this study, a genome-wide association analysis of 520 accessions was performed using the Q + K model with a total of 31,839 single-nucleotide polymorphism (SNP) sites. As a result, three significant associations on the B. napus chromosomes A05, A09, and C05 were detected for seed ADL content. The peak SNPs were within 9.27, 14.22, and 20.86 kb of the key genes BnaA.PAL4, BnaA.CAD2/BnaA.CAD3, and BnaC.CCR1, respectively. Further analyses were performed on the major locus of A05, which was also detected in the seed HC examination. A comparison of our genome-wide association study (GWAS) results and previous linkage mappings revealed a common chromosomal region on A09, which indicates that GWAS can be used as a powerful complementary strategy for dissecting complex traits in B. napus. Genomic selection (GS) utilizing the significant SNP markers based on the GWAS results exhibited increased predictive ability, indicating that the predictive ability of a given model can be substantially improved by using GWAS and GS. PMID:26673885

  1. A mutant Brassica napus (canola population for the identification of new genetic diversity via TILLING and next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Erin J Gilchrist

    Full Text Available We have generated a Brassica napus (canola population of 3,158 EMS-mutagenised lines and used TILLING to demonstrate that the population has a high enough mutation density that it will be useful for identification of mutations in genes of interest in this important crop species. TILLING is a reverse genetics technique that has been successfully used in many plant and animal species. Classical TILLING involves the generation of a mutagenised population, followed by screening of DNA samples using a mismatch-specific endonuclease that cleaves only those PCR products that carry a mutation. Polyacrylamide gel detection is then used to visualise the mutations in any gene of interest. We have used this TILLING technique to identify 432 unique mutations in 26 different genes in B. napus (canola cv. DH12075. This reflects a mutation density ranging from 1/56 kb to 1/308 kb (depending on the locus with an average of 1/109 kb. We have also successfully verified the utility of next generation sequencing technology as a powerful approach for the identification of rare mutations in a population of plants, even in polyploid species such as B. napus. Most of the mutants we have identified are publically available.

  2. Quantitative Trait Locus Mapping of Salt Tolerance and Identification of Salt-Tolerant Genes in Brassica napus L

    Directory of Open Access Journals (Sweden)

    Lina Lang


    Full Text Available Salinity stress is one of typical abiotic stresses that seriously limit crop production. In this study, a genetic linkage map based on 532 molecular markers covering 1341.1 cM was constructed to identify the loci associated with salt tolerance in Brassica napus. Up to 45 quantitative trait loci (QTLs for 10 indicators were identified in the F2:3 populations. These QTLs can account for 4.80–51.14% of the phenotypic variation. A major QTL, qSPAD5 on LG5 associated with chlorophyll can be detected in three replicates. Two intron polymorphic (IP markers in this QTL region were developed successfully to narrow down the QTL location to a region of 390 kb. A salt tolerance related gene Bra003640 was primary identified as the candidate gene in this region. The full length of the candidate gene was 1,063 bp containing three exons and two introns in B. napus L. The open reading frame (ORF is 867 bp and encodes 287 amino acids. Three amino acid differences (34, 54, and 83 in the conserved domain (B-box were identified. RT-qPCR analysis showed that the gene expression had significant difference between the two parents. The study laid great foundation for salt tolerance related gene mapping and cloning in B. napus L.

  3. Brassica napus

    Indian Academy of Sciences (India)


    Dec 16, 2011 ... 2School of Agriculture and Food Science, Zhejiang A & F University, Lin'an, 311300, People's Republic of China ... was affected by the environmental conditions on 15, 22, 29 or 36 days after ... Journal of Genetics, Vol. 90, No ...

  4. Systemic Resistance to Powdery Mildew in Brassica napus (AACC) and Raphanus alboglabra (RRCC) by Trichoderma harzianum TH12. (United States)

    Alkooranee, Jawadayn Talib; Yin, Yongtai; Aledan, Tamarah Raad; Jiang, Yingfen; Lu, Guangyuan; Wu, Jiangsheng; Li, Maoteng


    Trichoderma harzianum TH12 is a microbial pesticide for certain rapeseed diseases. The mechanism of systemic resistance induced by TH12 or its cell-free culture filtrate (CF) in Brassica napus (AACC) and Raphanus alboglabra (RRCC) to powdery mildew disease caused by ascomycete Erysiphe cruciferarum was investigated. In this study, we conducted the first large-scale global study on the cellular and molecular aspects of B. napus and R. alboglabra infected with E. cruciferarum. The histological study showed the resistance of R. alboglabra to powdery mildew disease. The growth of fungal colonies was not observed on R. alboglabra leaves at 1, 2, 4, 6, 8, and 10 days post-inoculation (dpi), whereas this was clearly observed on B. napus leaves after 6 dpi. In addition, the gene expression of six plant defense-related genes, namely, PR-1, PR-2 (a marker for SA signaling), PR-3, PDF 1.2 (a marker for JA/ET signaling), CHI620, and CHI570, for both genotypes were analyzed in the leaves of B. napus and R. alboglabra after treatment with TH12 or CF and compared with the non-treated ones. The qRT-PCR results showed that the PR-1 and PR-2 expression levels increased in E. cruciferarum-infected leaves, but decreased in the TH12-treated leaves compared with leaves treated with CF. The expression levels of PR-3 and PDF1.2 decreased in plants infected by E. cruciferarum. However, expression levels increased when the leaves were treated with TH12. For the first time, we disclosed the nature of gene expression in B. napus and R. alboglabra to explore the resistance pathways in the leaves of both genotypes infected and non-infected by powdery mildew and inoculated or non-inoculated with elicitor factors. Results suggested that R. alboglabra exhibited resistance to powdery mildew disease, and the application of T. harzianum and its CF are a useful tool to facilitate new protection methods for resist or susceptible plants.

  5. Analysis of the a genome genetic diversity among brassica napus, b. rapa and b. juncea accessions using specific simple sequence repeat markers

    International Nuclear Information System (INIS)

    Tian, H.; Yan, J.; Zhang, R.; Guo, Y.; Hu, S.; Channa, S.A.


    This investigation was aimed at evaluating the genetic diversity of 127 accessions among Brassica napus, B. rapa, and B. juncea by using 15 pairs of the A genome specific simple sequence repeat primers. These 127 accessions could be clearly separated into three groups by cluster analysis, principal component analysis, and population structure analysis separately, and the results analyzed by the three methods were very similar. Group I comprised of mainly B. napus accessions and the most of B. juncea accessions formed Group II, Group III included nearly all of the B. rapa accessions. The result showed that 36.86% of the variance was due to significant differences among populations of species, indicated that abundance genetic diversity existed among the A genome of B. napus, B. rapa, and B. juncea accessions. B. napus, B. rapa, and B. juncea have the abundant genetic diversity in the A genome, and some elite genes can be used to broaden the genetic base of them, especially for B. napus, in future rapeseed breeding program. (author)

  6. Analysis of gene expression in resynthesized Brassica napus Allopolyploids using arabidopsis 70mer oligo microarrays.

    Directory of Open Access Journals (Sweden)

    Robert T Gaeta

    Full Text Available BACKGROUND: Studies in resynthesized Brassica napus allopolyploids indicate that homoeologous chromosome exchanges in advanced generations (S(5ratio6 alter gene expression through the loss and doubling of homoeologous genes within the rearrangements. Rearrangements may also indirectly affect global gene expression if homoeologous copies of gene regulators within rearrangements have differential affects on the transcription of genes in networks. METHODOLOGY/PRINCIPAL FINDINGS: We utilized Arabidopsis 70mer oligonucleotide microarrays for exploring gene expression in three resynthesized B. napus lineages at the S(0ratio1 and S(5ratio6 generations as well as their diploid progenitors B. rapa and B. oleracea. Differential gene expression between the progenitors and additive (midparent expression in the allopolyploids were tested. The S(5ratio6 lines differed in the number of genetic rearrangements, allowing us to test if the number of genes displaying nonadditive expression was related to the number of rearrangements. Estimates using per-gene and common variance ANOVA models indicated that 6-15% of 26,107 genes were differentially expressed between the progenitors. Individual allopolyploids showed nonadditive expression for 1.6-32% of all genes. Less than 0.3% of genes displayed nonadditive expression in all S(0ratio1 lines and 0.1-0.2% were nonadditive among all S(5ratio6 lines. Differentially expressed genes in the polyploids were over-represented by genes differential between the progenitors. The total number of differentially expressed genes was correlated with the number of genetic changes in S(5ratio6 lines under the common variance model; however, there was no relationship using a per-gene variance model, and many genes showed nonadditive expression in S(0ratio1 lines. CONCLUSIONS/SIGNIFICANCE: Few genes reproducibly demonstrated nonadditive expression among lineages, suggesting few changes resulted from a general response to polyploidization

  7. Development of a novel Sinapis arvensis disomic addition line in Brassica napus containing the restorer gene for Nsa CMS and improved resistance to Sclerotinia sclerotiorum and pod shattering. (United States)

    Wei, Wenhui; Li, Yunchang; Wang, Lijun; Liu, Shengyi; Yan, Xiaohong; Mei, Desheng; Li, Yinde; Xu, Yusong; Peng, Pengfei; Hu, Qiong


    An allo-cytoplasmic male sterile line, which was developed through somatic hybridization between Brassica napus and Sinapis arvensis (thus designated as Nsa CMS line), possesses high potential for hybrid production of rapeseed. In order to select for restorer lines, fertile plants derived from the same somatic hybridization combination were self-pollinated and testcrossed with the parental Nsa CMS line for six generations. A novel disomic alien addition line, B. napus-S. arvensis, has been successfully developed. GISH analysis showed that it contains one pair of chromosomes from S. arvensis and 19 pairs from B. napus, and retains stable and regular mitotic and meiotic processes. The addition line displays very strong restoration ability to Nsa CMS line, high resistance to Sclerotinia sclerotiorum and a low incidence of pod shattering. Because the addition line shares these very important agricultural characters, it is a valuable restorer to Nsa CMS line, and is named NR1 here (Nsa restorer no. 1).

  8. High-throughput multiplex cpDNA resequencing clarifies the genetic diversity and genetic relationships among Brassica napus, Brassica rapa and Brassica oleracea. (United States)

    Qiao, Jiangwei; Cai, Mengxian; Yan, Guixin; Wang, Nian; Li, Feng; Chen, Binyun; Gao, Guizhen; Xu, Kun; Li, Jun; Wu, Xiaoming


    Brassica napus (rapeseed) is a recent allotetraploid plant and the second most important oilseed crop worldwide. The origin of B. napus and the genetic relationships with its diploid ancestor species remain largely unresolved. Here, chloroplast DNA (cpDNA) from 488 B. napus accessions of global origin, 139 B. rapa accessions and 49 B. oleracea accessions were populationally resequenced using Illumina Solexa sequencing technologies. The intraspecific cpDNA variants and their allelic frequencies were called genomewide and further validated via EcoTILLING analyses of the rpo region. The cpDNA of the current global B. napus population comprises more than 400 variants (SNPs and short InDels) and maintains one predominant haplotype (Bncp1). Whole-genome resequencing of the cpDNA of Bncp1 haplotype eliminated its direct inheritance from any accession of the B. rapa or B. oleracea species. The distribution of the polymorphism information content (PIC) values for each variant demonstrated that B. napus has much lower cpDNA diversity than B. rapa; however, a vast majority of the wild and cultivated B. oleracea specimens appeared to share one same distinct cpDNA haplotype, in contrast to its wild C-genome relatives. This finding suggests that the cpDNA of the three Brassica species is well differentiated. The predominant B. napus cpDNA haplotype may have originated from uninvestigated relatives or from interactions between cpDNA mutations and natural/artificial selection during speciation and evolution. These exhaustive data on variation in cpDNA would provide fundamental data for research on cpDNA and chloroplasts. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  9. The Vascular Pathogen Verticillium longisporum Does Not Affect Water Relations and Plant Responses to Drought Stress of Its Host, Brassica napus. (United States)

    Lopisso, Daniel Teshome; Knüfer, Jessica; Koopmann, Birger; von Tiedemann, Andreas


    Verticillium longisporum is a host-specific vascular pathogen of oilseed rape (Brassica napus L.) that causes economic crop losses by impairing plant growth and inducing premature senescence. This study investigates whether plant damage through Verticillium stem striping is due to impaired plant water relations, whether V. longisporum affects responses of a susceptible B. napus variety to drought stress, and whether drought stress, in turn, affects plant responses to V. longisporum. Two-factorial experiments on a susceptible cultivar of B. napus infected or noninfected with V. longisporum and exposed to three watering levels (30, 60, and 100% field capacity) revealed that drought stress and V. longisporum impaired plant growth by entirely different mechanisms. Although both stresses similarly affected plant growth parameters (plant height, hypocotyl diameter, and shoot and root dry matter), infection of B. napus with V. longisporum did not affect any drought-related physiological or molecular genetic plant parameters, including transpiration rate, stomatal conductance, photosynthesis rate, water use efficiency, relative leaf water content, leaf proline content, or the expression of drought-responsive genes. Thus, this study provides comprehensive physiological and molecular genetic evidence explaining the lack of wilt symptoms in B. napus infected with V. longisporum. Likewise, drought tolerance of B. napus was unaffected by V. longisporum, as was the level of disease by drought conditions, thus excluding a concerted action of both stresses in the field. Although it is evident that drought and vascular infection with V. longisporum impair plant growth by different mechanisms, it remains to be determined by which other factors V. longisporum causes crop loss.

  10. Comparative transcriptomic analysis of two Brassica napus near-isogenic lines reveals a network of genes that influences seed oil accumulation

    Directory of Open Access Journals (Sweden)

    Jingxue Wang


    Full Text Available Rapeseed (Brassica napus is an important oil seed crop, providing more than 13% of the world’s supply of edible oils. An in-depth knowledge of the gene network involved in biosynthesis and accumulation of seed oil is critical for the improvement of B. napus. Using available genomic and transcriptomic resources, we identified 1,750 acyl lipid metabolism (ALM genes that are distributed over 19 chromosomes in the B. napus genome. B. rapa and B. oleracea, two diploid progenitors of B. napus, contributed almost equally to the ALM genes. Genome collinearity analysis demonstrated that the majority of the ALM genes have arisen due to genome duplication or segmental duplication events. In addition, we profiled the expression patterns of the ALM genes in four different developmental stages. Furthermore, we developed two B. napus near isogenic lines (NILs. The high oil NIL, YC13-559, accumulates more than 10% of seed oil compared to the other, YC13-554. Comparative gene expression analysis revealed upregulation of lipid biosynthesis-related regulatory genes in YC13-559, including SHOOTMERISTEMLESS, LEAFY COTYLEDON 1 (LEC1, LEC2, FUSCA3, ABSCISIC ACID INSENSITIVE 3 (ABI3, ABI4, ABI5, and WRINKLED1, as well as structural genes, such as ACETYL-CoA CARBOXYLASE, ACYL-CoA DIACYLGLYCEROL ACYLTRANSFERASE, and LONG-CHAIN ACYL-CoA SYNTHETASES. We observed that several genes related to the phytohormones, gibberellins, jasmonate, and indole acetic acid, were differentially expressed in the NILs. Our findings provide a broad account of the numbers, distribution, and expression profiles of acyl lipid metabolism genes, as well as gene networks that potentially control oil accumulation in B. napus seeds. The upregulation of key regulatory and structural genes related to lipid biosynthesis likely plays a major role for the increased seed oil in YC13-559.

  11. Apis mellifera (Hymenoptera: Apidae as a potential Brassica napus pollinator (cv. Hyola 432 (Brassicaceae, in Southern Brazil Apis mellifera (Hymenoptera: Apidae como potencial polinizador de Brassica napus (cv. Hyola 432 (Brassicaceae, no Sul do Brasil

    Directory of Open Access Journals (Sweden)

    AS. Rosa


    Full Text Available Brassica napus Linnaeus is considered a self-compatible crop; however, studies show that bee foraging elevates their seed production. Considering bee food shortages during the winter season and that the canola is a winter crop, this study aimed to evaluate the foraging behaviour of Apis mellifera Linnaeus, 1758 regarding those flowers, and to verify if it presents adequate behaviour for successfully pollinating this crop in Rio Grande do Sul State. The study was carried out in a canola field, in Southern Brazil. The anthesis stages were morphologically characterised and then related to stigma receptivity and pollen grain viability. Similarly, the behaviour of A. mellifera individuals on flowers was followed, considering the number of flowers visited per plant, the amount of time spent on the flowers, touched structures, and collected resources. Floral fidelity was inferred by analysing the pollen load of bees collected on flowers. The bees visited from 1-7 flowers/plant (x = 2.02; sd = 1.16, the time spent on the flowers varied between 1-43 seconds (x = 3.29; sd = 2.36 and, when seeking nectar and pollen, they invariably touched anthers and stigmas. The pollen load presented 100% of B. napus pollen. The bees' attendance to a small number of flowers/plants, their short permanence on flowers, their contact with anthers and stigma and the integral floral constancy allows their consideration as potential B. napus pollinators.Brassica napus Linnaeus é considerada uma cultura autocompatível, entretanto, estudos indicam que o forrageio de abelhas eleva sua produtividade de sementes. Considerando-se a escassez de alimento para abelhas no inverno e a canola sendo uma cultura desse período, objetivou-se avaliar o comportamento de forrageio de Apis mellifera Linnaeus, 1758 nas suas flores e verificar se apresenta comportamento propício ao sucesso de polinização dessa cultura no Rio Grande do Sul. O estudo foi desenvolvido em lavoura de canola, no Sul

  12. Ameliorating influence of sulfur on germination attributes of canola (brassica napus l.) under chromium stress

    International Nuclear Information System (INIS)

    Jahan, S.; Iqbal, S.; Jabeen, K.; Sadaf, S.


    An experiment was performed to evaluate the role of sulfur to induce tolerance in Brassica napus L. against chromium stress by estimating the changes in germination parameters. Petriplates were assembled in Randomized Complete Block Design. A total 9 sets of treatments viz., control, chromium treated (40 and 160ppm), sulfur treated (50 and 150ppm) and sulfur (50 and 150ppm) combined with chromium (40 and 160ppm) with three replicates was used. Chromium under both concentrations was responsible for significant decline in germination parameters i.e. germination percentage, germination rate, seedling vigor index, shoot and root length, fresh weight and dry weight of seedlings. Sulfur application under chromium stress resulted in improvement of germination parameters such as germination percentage, germination rate, seedling vigor index, shoot and root length, fresh weight and dry weight of seedlings in contrast to chromium treatment. So, it can be concluded that sulfur in appropriate dose can be used to ameliorate the negative effects of chromium by increasing the germination potential of canola. (author)

  13. Effect of rhizobacteria inoculation and humic acid application on canola (Brassica napus L.) crop

    International Nuclear Information System (INIS)

    Ahmad, S.; Duar, I.; Solaimani, S.G.A.; Mahmood, S.


    This study investigated eco-friendly approach of utilizing plant growth promoting rhizobacteria (PGPR) and humic acid (HA) as bio-stimulants to improve the growth, yield and nutrition of canola (Brassica napus L.). In this study, we isolated 20 indigenous rhizobacterial strains that were subsequently screened and characterized for their plant growth promoting traits. After that one promising PGPR strain identified as Acinetobacter pittii by 16S rRNA gene sequencing was selected for field trial. The field experiment was conducted using RCB design with split-plot arrangement that was replicated four times. Three levels of humic acid (0, 10 and 20 kg ha-1) as main plot factor and two treatments of PGPR (with and without PGPR) as sub-plot factor were used. Data was recorded on plant height (cm), root dry matter plant-1, number of lateral root plant-1, number of pods plant-1, number of seeds pod-1, 1000 seed weight (g), seed yield(kg ha-1), oil content (%), nitrogen (N), phosphorus (P) and potassium (K) contents and uptake. For most of the above mentioned parameters, significant enhancement was observed with the increment of humic acid, and also PGPR treatments were better than their respective control treatments. Maximum values of these parameters were recorded for the interaction of 20 kg HA ha-1 with the PGPR strain. It can be concluded that integrated application of HA and PGPR is a better strategy to improve nutrition and yield of canola. (author)

  14. Effects of thermal stress of protein synthesis and gene expression in Brassica napus

    International Nuclear Information System (INIS)

    Halle, J.R.; Ghosh, S.; Dumbroff, E.B.; Heikkila, J.J.


    Leaf segments of Brassica napus were exposed to 22 degrees, 35 degrees, 38 degrees or 40 degrees C for up to 4 h. Analysis of radiolabelled proteins by 2-D SDS-PAGE and fluorography revealed two major groups of heat shock proteins (HSPs). One group comprised HSPs, 70, 76 and 87, with pIs ranging from 5.7 to 6.1, whereas the second group had molecular weights ranging from 23 to 16 kD and pIs from 5.6 to 6.9. Immunoblot analysis using antibodies directed against the large (RLSU) and small (RSSU) subunits of ribulose-1,5-bisphosphate carboxylase (RUBISCO) showed that increasing temperatures from 35 degrees to 38 degrees or 40 degrees C or the duration of thermal stress from 1 to 5 h did not affect levels of the RSSU (15 kd) whereas levels of the RLSU (52 kD) fell sharply. Nevertheless, RUBISCO activity was not adversely affected at 38 degree C for periods of up to 5 h. The increase observed in HSP 70 during heat shock was transcriptionally regulated, but the decrease in the RLSU was not accompanied by any detectable change in levels of its mRNA

  15. Origination, expansion, evolutionary trajectory, and expression bias of AP2/ERF superfamily in Brassica napus

    Directory of Open Access Journals (Sweden)

    Xiaoming Song


    Full Text Available The AP2/ERF superfamily, one of the most important transcription factor families, plays crucial roles in response to biotic and abiotic stresses. So far, a comprehensive evolutionary inference of its origination and expansion has not been available. Here, we identified 515 AP2/ERF genes in B. napus, a neo-tetraploid forming ~7500 years ago, and found that 82.14% of them were duplicated in the tetraploidization. A prominent subgenome bias was revealed in gene expression, tissue-specific, and gene conversion. Moreover, a large-scale analysis across plants and alga suggested that this superfamily could have been originated from AP2 family, expanding to form other families (ERF, and RAV. This process was accompanied by duplicating and/or alternative deleting AP2 domain, intragenic domain sequence conversion, and/or by acquiring other domains, resulting in copy number variations, alternatively contributing to functional innovation. We found that significant positive selection occurred at certain critical nodes during the evolution of land plants, possibly responding to changing environment. In conclusion, the present research revealed origination, functional innovation, and evolutionary trajectory of the AP2/ERF superfamily, contributing to understanding their roles in plant stress tolerance.

  16. Refined global methyl halide budgets with respect to rapeseed (Brassica napus) by life-cycle measurements (United States)

    Jiao, Y.; Acdan, J.; Xu, R.; Deventer, M. J.; Rhew, R. C.


    A precise quantification of global methyl halide budgets is needed to evaluate the ozone depletion potential of these compounds and to predict future changes of stratospheric ozone. However, the global budgets of methyl halides are not balanced between currently identified and quantified sources and sinks. Our study re-evaluated the methyl bromide budget from global cultivated rapeseed (Brassica napus) through life-cycle flux measurements both in the greenhouse and in the field, yielding a methyl bromide emission rate that scales globally to 1.0 - 1.2 Gg yr-1. While this indicates a globally significant source, it is much smaller than the previously widely cited value of 5 - 6 Gg yr-1(Mead et al., 2008), even taking into account the near tripling of annual global yield of rapeseed since the previous evaluation was conducted. Our study also evaluated the methyl chloride and methyl iodide emission levels from rapeseed, yielding emission rates that scale to 5.4 Gg yr-1 for methyl chloride and 1.8 Gg yr-1 of methyl iodide. The concentrations of the methyl donor SAM (S-adenosyl methionine) and the resultant product SAH (S-Adenosyl-L-homocysteine) were also analyzed to explore their role in biogenic methyl halide formation. Halide gradient incubations showed that the magnitude of methyl halide emissions from rapeseed is highly correlated to soil halide levels, thus raising the concern that the heterogeneity of soil halide contents geographically should be considered when extrapolating to global budget.

  17. Proteomic Analysis of Pollen and Blossom Honey from Rape Seed Brassica Napus L.

    Directory of Open Access Journals (Sweden)

    Borutinskaitė Veronika


    Full Text Available In the study, honey from oilseed rape Brassica napus L., and both hand-collected (winter rape Visby and Cult and bee-collected pollen of oilseed rape were analyzed for their proteome content, in order to see if any plant proteins were present to allow the proteo-typing of the oilseed rape honey. Proteins were fractionated by two-dimensional gel electrophoresis (2DE, stained by Coomassie blue and then analyzed by mass spectrometry. All identified proteins were divided into few groups due to their biological function. In 2DE gels with separated proteins from blossom honey, only bee (Apis mellifera main proteins (Major royal jelly protein 1-5 and Glucosidase were found. So we analyzed all proteins using gel-free based analysis with the SYNAPT G2 high definition mass spectrometry. We identified proteins that were present in both oilseed rape pollen and honey (Bna, Polygalacturonase, Non-specific lipid-transfer protein, GAPDH and others. We believe that these proteins are important for the nutritional value of plant pollen-enriched honey and further research is required on honey and honeybee pollen protein.

  18. Effects of Gamma Irradiation on Quality Characteristic and Microbiological Safety of Rape (Brassica napus) Pollen

    International Nuclear Information System (INIS)

    Kim, Kyoung-Hee; Jeong, Su-Ji; Kim, Dam; Yook, Hong-Sun; Kim, Kwang-Hun


    This study is carried out to sanitize rape (Brassica napus) pollen by gamma irradiation. Rape pollens were treated with 0, 5, 10 and 15 kGy gamma irradiations, and then analyzed for the following: general composition, microbial population, reducing sugar, Hunter color values, TBARS (2-thiobarbituric acid reactive substances) values, and VBN (volatile basic nitrogen). Mold and coliform bacteria were not detected in the samples irradiated at 5 kGy or more. Yeasts and total aerobic bacteria were not detected in the samples irradiated at 10 kGy or more (102 CFU/g). Moisture, ash, crude protein, crude fat, carbohydrate, reducing sugar and the contents of volatile basic nitrogen in the irradiated pollen did not show any significant changes by irradiation. Hunter color values, L, a and b values were decreased with increment of irradiation dose. TBARS values were increased with an increment of irradiation dose. In conclusion, gamma irradiation at 5 kGy was considered to be an effective treatment to control for mycotoxin producing fungi in rape pollen to minimize changes of general composition and physicochemical properties. Further studies should be investigated to reduce the detrimental effects induced by irradiation

  19. Effect of Pre-culture Irradiation and Explant Types on Efficiency of Brassica napus Genetic Transformation

    International Nuclear Information System (INIS)

    Amer, I.M.; Moustafa, H.A.M.; Azzam, C.R.


    The irradiated seeds of canola cv. Drakkar ( Brassica napus l. ) were germinated under aspect conditions, cotyledonary petioles and hypocotyl of 6 days old seedlings were used for Agrobacterium-mediated transformation. Agrobacterium tumefaciens has construct with the selectable marker gene (NPT II) and the desirable gene (HPPD). Direct and indirect shoot organogenesis were obtained from the both explants. Cotyledonary petioles was higher responded than hypocotyl with respective 26% and 14% of the explants producing NPT II-positive shoots after the selection on 50mg/l kanamycin. Calli might develop on and not in the agar medium were un transformation. This explains the higher number of escapes detected in hypocotyl explants than in experiments with cotyledons. The frequency of transformation plants as a function of indirect organogenesis was more than direct shoot regeneration from explants. The pre- irradiation with 75 Gy of gamma rays enhanced the genetic transformation frequencies by about 10 % as compared to that of the un-irradiated material. The obtained shoots were rooted and regenerated mature plants

  20. Different roles of glutathione in copper and zinc chelation in Brassica napus roots. (United States)

    Zlobin, Ilya E; Kartashov, Alexander V; Shpakovski, George V


    We investigated the specific features of copper and zinc excess action on the roots of canola (Brassica napus L.) plants. Copper rapidly accumulated in canola root cells and reached saturation during several hours of treatment, whereas the root zinc content increased relatively slowly. Excessive copper and zinc entry inside the cell resulted in significant cell damage, as evidenced by alterations in plasmalemma permeability and decreases in cellular enzymatic activity. Zinc excess specifically damaged root hair cells, which correlated with a pronounced elevation of their labile zinc level. In vitro, we showed that reduced glutathione (GSH) readily reacted with copper ions to form complexes with blocked sulfhydryl groups. In contrast, zinc ions were ineffective as glutathione blockers, and glutathione molecules did not lose their specific chemical activity in the presence of Zn 2+ ions. The effect of copper and zinc excess on the glutathione pool in canola root cells was analysed by a combination of biochemical determination of total and oxidized glutathione contents and fluorescent staining of free reduced glutathione with monochlorobimane dye. Excess copper led to dose-dependent diminution of free reduced glutathione contents in the root cells, which could not be explained by the loss of total cellular glutathione or its oxidation. In contrast, we observed little effect of much higher intracellular zinc concentrations on the free reduced glutathione content. We concluded that GSH plays an important role in copper excess, but not zinc excess chelation, in canola root cells. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. Foliar K application delays leaf senescence of winter rape-seed (Brassica napus L.) under waterlogging

    Institute of Scientific and Technical Information of China (English)

    Lin Wan; Chao Hu; Chang Chen; Liyan Zhang; Ni Ma; Chunlei Zhang


    To better understand waterlogging effect on leaf senescence in winter rapseed (Brassica napus L.) during flowering stage, experiments were designed to explore foliar K application influences on adverse effects of waterlogging stress. Winter rapeseed was sprayed with K after waterlogging at initial flowering stage. Results indicated that waterlog-ging significantly decreased leaf net photosynthetic rate (Pn), stomatal conductance (Gs), intercellular CO2 concentration (Ci) and transpiration rate (Tr). It also declined maximum quantum yield of PS II (Fv/Fm), quantum yield of electron transport (ΦPS II) and pho-tochemical quenching (qP), but increased leaf non-photochemical quenching (NPQ) and minimal fluorescence (Fo). Interestingly, exogenous application of K significantly alleviated waterlogging-induced photosynthesis inhibition. Foliar K application increased RuBisCO activation, chlorophyll and soluble protein contents, while significantly decreased MDA con-tent under waterlogging stress. Moreover, K supplementation improved accumulation of K+, Ca2+, Mg2+, N, Zn2+, Mn2+, Fe2+ in leaves. In general, foliar K application is effective in alleviating deleterious effects of waterlogging stress and delays leaf senescence of winter rapeseed.

  2. Cadmium stress alters the redox reaction and hormone balance in oilseed rape (Brassica napus L.) leaves. (United States)

    Yan, Hui; Filardo, Fiona; Hu, Xiaotao; Zhao, Xiaomin; Fu, DongHui


    In order to understand the physiological response of oilseed rape (Brassica napus L.) leaves to cadmium (Cd) stress and exploit the physiological mechanisms involved in Cd tolerance, macro-mineral and chlorophyll concentrations, reactive oxygen species (ROS) accumulation, activities of enzymatic antioxidants, nonenzymatic compounds metabolism, endogenous hormonal changes, and balance in leaves of oilseed rape exposed to 0, 100, or 200 μM CdSO4 were investigated. The results showed that under Cd exposure, Cd concentrations in the leaves continually increased while macro-minerals and chlorophyll concentrations decreased significantly. Meanwhile, with increased Cd stress, superoxide anion (O2(• -)) production rate and hydrogen peroxide (H2O2) concentrations in the leaves increased significantly, which caused malondialdehyde (MDA) accumulation and oxidative stress. For scavenging excess accumulated ROS and alleviating oxidative injury in the leaves, the activity of enzymatic antioxidants, such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), was increased significantly at certain stress levels. However, with increased Cd stress, the antioxidant enzyme activities all showed a trend towards reduction. The nonenzymatic antioxidative compounds, such as proline and total soluble sugars, accumulated continuously with increased Cd stress to play a long-term role in scavenging ROS. In addition, ABA levels also increased continuously with Cd stress while ZR decreased and the ABA/ZR ratio increased, which might also be providing a protective role against Cd toxicity.

  3. Differential flavonoid response to enhanced UV-B radiation in Brassica napus

    International Nuclear Information System (INIS)

    Olsson, L.C.; Veit, M.; Weissenböck, G.; Bornman, J.F.


    We have examined the qualitative and quantitative differences in methanol-soluble flavonoids of leaves of two cultivars of Brassica napus, which were grown with or without (control) supplemental UV-B radiation. The flavonoids were identified using HPLC-diode array spectroscopy (-DAS), -electrospray ionization-mass spectroscopy (-ESI-MS) and 1H and 13C NMR, and quantitatively analysed by HPLC-DAS. After exposure to supplementary UV-B radiation, the overall amount of soluble flavonoids, kaempferol and quercetin glycosides, increased by ca 150% in cv. Paroll, compared to control plants. Cultivar Stallion showed a 70% increase, and also a lower overall content of soluble flavonoids compared to Paroll. The supplementary UV-B radiation resulted in a marked, specific increase in the amount of quercetin glycosides relative to the kaempferol glycosides with a 36- and 23-fold increase in cvs Paroll and Stallion, respectively. Four of the flavonol glycosides appearing after supplemental UV-B exposure were identified as quercetin- and kaempferol 3-sophoroside-7-glucoside and 3-(2″′-E-sinapoylsophoroside)-7-glucoside. (author)

  4. Persistence of seeds from crops of conventional and herbicide tolerant oilseed rape (Brassica napus). (United States)

    Lutman, Peter J W; Berry, Kate; Payne, Roger W; Simpson, Euan; Sweet, Jeremy B; Champion, Gillian T; May, Mike J; Wightman, Pat; Walker, Kerr; Lainsbury, Martin


    A series of rotation experiments at five sites over four years has explored the environmental and agronomic implications of growing herbicide tolerant oilseed rape and sugar beet. This paper reports on the population dynamics of volunteer rape (Brassica napus). The experiments compared four winter oilseed rape (WOSR) cultivars: a conventional cultivar (Apex) and three developmental cultivars either genetically modified (GM) to be tolerant to glyphosate or glufosinate, or conventionally bred to be tolerant to herbicides of the imidazolinone group. Seed losses at harvest averaged 3575 seeds m(-2) but ranged from less than 2000 up to more than 10000 seeds m(-2). There was a rapid decline in seed numbers during the first few months after harvest, resulting in a mean loss of seeds of 60%. In subsequent seasons, the seedbank declined much more slowly at four of the five sites (ca 20% per year) and the models predicted 95% seed loss after approximately 9 years. Seed decline was much faster at the fifth site. There were no clear differences between the four cultivars in either the numbers of seeds shed at harvest or in their subsequent persistence. The importance of the persistence of GM rape seeds, in the context of the coexistence of GM and non-GM crops and the role of good management practices that minimize seed persistence, are discussed.

  5. Sequential light programs shape kale (Brassica napus) sprout appearance and alter metabolic and nutrient content (United States)

    Carvalho, Sofia D; Folta, Kevin M


    Different light wavelengths have specific effects on plant growth and development. Narrow-bandwidth light-emitting diode (LED) lighting may be used to directionally manipulate size, color and metabolites in high-value fruits and vegetables. In this report, Red Russian kale (Brassica napus) seedlings were grown under specific light conditions and analyzed for photomorphogenic responses, pigment accumulation and nutraceutical content. The results showed that this genotype responds predictably to darkness, blue and red light, with suppression of hypocotyl elongation, development of pigments and changes in specific metabolites. However, these seedlings were relatively hypersensitive to far-red light, leading to uncharacteristically short hypocotyls and high pigment accumulation, even after growth under very low fluence rates (<1 μmol m−2 s−1). General antioxidant levels and aliphatic glucosinolates are elevated by far-red light treatments. Sequential treatments of darkness, blue light, red light and far-red light were applied throughout sprout development to alter final product quality. These results indicate that sequential treatment with narrow-bandwidth light may be used to affect key economically important traits in high-value crops. PMID:26504531

  6. Phospholipase Dε enhances Braasca napus growth and seed production in response to nitrogen availability. (United States)

    Lu, Shaoping; Yao, Shuaibing; Wang, Geliang; Guo, Liang; Zhou, Yongming; Hong, Yueyun; Wang, Xuemin


    Phospholipase D (PLD), which hydrolyses phospholipids to produce phosphatidic acid, has been implicated in plant response to macronutrient availability in Arabidopsis. This study investigated the effect of increased PLDε expression on nitrogen utilization in Brassica napus to explore the application of PLDε manipulation to crop improvement. In addition, changes in membrane lipid species in response to nitrogen availability were determined in the oil seed crop. Multiple PLDε over expression (PLDε-OE) lines displayed enhanced biomass accumulation under nitrogen-deficient and nitrogen-replete conditions. PLDε-OE plants in the field produced more seeds than wild-type plants but have no impact on seed oil content. Compared with wild-type plants, PLDε-OE plants were enhanced in nitrate transporter expression, uptake and reduction, whereas the activity of nitrite reductase was higher under nitrogen-depleted, but not at nitrogen-replete conditions. The level of nitrogen altered membrane glycerolipid metabolism, with greater impacts on young than mature leaves. The data indicate increased expression of PLDε has the potential to improve crop plant growth and production under nitrogen-depleted and nitrogen-replete conditions. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  7. High oleic acid content materials of rapeseed (Brassica napus) produced by radiation breeding

    International Nuclear Information System (INIS)

    Guan Chunyun; Liu Chunlin; Chen Sheyuan


    High oleic acid content rapeseed breeding has great significance, because high oleic acid oil is a healthy and nutritious oil, which is of a long shelflife and also propitious to producing biodiesel fuel. The high oleic acid content breeding materials of rapeseed (B. napus) were obtained by 80-100 kR ~(60)Co gamma ray ionizing radiation treatment of dry seeds and continuous selection. The results showed that the oleic acid contents of M (2), M (3) and M (4) progenies increased by different grades. Moreover, the oleic acid content of M (5) progeny increased greatly. The oleic acid contents were higher than 70% in the most of the plants and the highest one reached 93.5 %. The base G was transited by base A in fad (2) gene at the 270 site of high oleic acid mutation (M(6) 04-855). The location is at the beta folding area and conservative area of this protein. Base mutation at sites 1 044 and 1 062 also led to produce a stop condon. These changes in structure led to loss the function of fad (2). According to molecular mechanism of gene mutation, no matter what transvertion or transition happens, several replications are needed. That is to say several generations are needed. That was also the reason why high oleic acid content mutation occurred in later generations

  8. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.


    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  9. Functional characterization of Brassica napus DNA topoisomerase Iα-1 and its effect on flowering time when expressed in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Gao, Chenhao; Qi, Shuanghui; Liu, Kaige; Li, Dong; Jin, Changyu; Duan, Shaowei; Zhang, Meng; Chen, Mingxun


    Previous studies have shown that DNA topoisomerase Iα (AtTOP1α) has specific developmental functions during growth and development in Arabidopsis thaliana. However, little is known about the roles of DNA topoisomerases in the closely related and commercially important plant, rapeseed (Brassica napus). Here, the full-length BnTOP1α-1 coding sequence was cloned from the A2 subgenome of the Brassica napus inbred line L111. We determine that all BnTOP1α paralogs showed differing patterns of expression in different organs of L111, and that when expressed in tobacco leaves as a fusion protein with green fluorescent protein, BnTOP1α-1 localized to the nucleus. We further showed that ectopic expression of BnTOP1α-1 in the A. thaliana top1α-7 mutant fully complemented the early flowering phenotype of the mutant. Moreover, altered expression levels in top1α-7 seedlings of several key genes controlling flowering time were restored to wild type levels by ectopic expression of BnTOP1α-1. These results provide valuable insights into the roles of rapeseed DNA topoisomerases in flowering time, and provide a promising target for genetic manipulation of this commercially significant process in rapeseed. - Highlights: • BnTOP1α-1 was cloned from the A2 subgenome of Brassica napus inbred line L111. • BnTOP1α-1 rescued the early flowering phenotype of the Attop1α-7 mutant. • BnTOP1α-1 rescued the altered expression of flowering time genes in the Attop1α-mutant. • The functions of BnTOP1α-1 and AtTOP1α are likely conserved.

  10. Integration of linkage maps for the Amphidiploid Brassica napus and comparative mapping with Arabidopsis and Brassica rapa

    Directory of Open Access Journals (Sweden)

    Delourme Régine


    Full Text Available Abstract Background The large number of genetic linkage maps representing Brassica chromosomes constitute a potential platform for studying crop traits and genome evolution within Brassicaceae. However, the alignment of existing maps remains a major challenge. The integration of these genetic maps will enhance genetic resolution, and provide a means to navigate between sequence-tagged loci, and with contiguous genome sequences as these become available. Results We report the first genome-wide integration of Brassica maps based on an automated pipeline which involved collation of genome-wide genotype data for sequence-tagged markers scored on three extensively used amphidiploid Brassica napus (2n = 38 populations. Representative markers were selected from consolidated maps for each population, and skeleton bin maps were generated. The skeleton maps for the three populations were then combined to generate an integrated map for each LG, comparing two different approaches, one encapsulated in JoinMap and the other in MergeMap. The BnaWAIT_01_2010a integrated genetic map was generated using JoinMap, and includes 5,162 genetic markers mapped onto 2,196 loci, with a total genetic length of 1,792 cM. The map density of one locus every 0.82 cM, corresponding to 515 Kbp, increases by at least three-fold the locus and marker density within the original maps. Within the B. napus integrated map we identified 103 conserved collinearity blocks relative to Arabidopsis, including five previously unreported blocks. The BnaWAIT_01_2010a map was used to investigate the integrity and conservation of order proposed for genome sequence scaffolds generated from the constituent A genome of Brassica rapa. Conclusions Our results provide a comprehensive genetic integration of the B. napus genome from a range of sources, which we anticipate will provide valuable information for rapeseed and Canola research.

  11. In silico studies on structure-function of DNA GCC- box binding domain of brassica napus DREB1 protein

    International Nuclear Information System (INIS)

    Qamarunnisa, S.; Hussain, M.


    DREB1 is a transcriptional factor, which selectively binds with the promoters of the genes involved in stress response in the plants. Homology of DREB protein and its binding element have been detected in the genome of many plants. However, only a few reports exist that discusses the binding properties of this protein with the gene (s) promoter. In the present study, we have undertaken studies exploring the structure-function relationship of Brassica napus DREB1. Multiple sequence alignment, protein homology modeling and intermolecular docking of GCC-box binding domain (GBD) of the said protein was carried out using atomic coordinates of GBD from Arabdiopsis thaliana and GCC-box containing DNA respectively. Similarities and/or identities in multiple, sequence alignment, particularly at the functionally important amino acids, strongly suggested the binding specificity of B. napus DREB1 to GCC-box. Similarly, despite 56% sequence homology, tertiary structures of both template and modeled protein were found to be extremely similar as indicated by root mean square deviation of 0.34 A. More similarities were established between GBD of both A. thaliana and B. napus DREB1 by conducting protein docking with the DNA containing GCC-box. It appears that both proteins interact through their beta-sheet with the major DNA groove including both nitrogen bases and phosphate and sugar moieties. Additionally, in most cases the interacting residues were also found to be identical. Briefly, this study attempts to elucidate the molecular basis of DREB1 interaction with its target sequence in the promoter. (author)

  12. Overexpression of Three Glucosinolate Biosynthesis Genes in Brassica napus Identifies Enhanced Resistance to Sclerotinia sclerotiorum and Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Zhang

    Full Text Available Sclerotinia sclerotiorum and Botrytis cinerea are notorious plant pathogenic fungi with an extensive host range including Brassica crops. Glucosinolates (GSLs are an important group of secondary metabolites characteristic of the Brassicales order, whose degradation products are proving to be increasingly important in plant protection. Enhancing the defense effect of GSL and their associated degradation products is an attractive strategy to strengthen the resistance of plants by transgenic approaches. We generated the lines of Brassica napus with three biosynthesis genes involved in GSL metabolic pathway (BnMAM1, BnCYP83A1 and BnUGT74B1, respectively. We then measured the foliar GSLs of each transgenic lines and inoculated them with S. sclerotiorum and B. cinerea. Compared with the wild type control, over-expressing BnUGT74B1 in B. napus increased the aliphatic and indolic GSL levels by 1.7 and 1.5 folds in leaves respectively; while over-expressing BnMAM1 or BnCYP83A1 resulted in an approximate 1.5-fold higher only in the aliphatic GSL level in leaves. The results of plant inoculation demonstrated that BnUGT74B1-overexpressing lines showed less severe disease symptoms and tissue damage compared with the wild type control, but BnMAM1 or BnCYP83A1-overexpressing lines showed no significant difference in comparison to the controls. These results suggest that the resistance to S. sclerotiorum and B. cinerea in B. napus could be enhanced through tailoring the GSL profiles by transgenic approaches or molecular breeding, which provides useful information to assist plant breeders to design improved breeding strategies.

  13. A high-density SNP map for accurate mapping of seed fibre QTL in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Liezhao Liu

    Full Text Available A high density genetic linkage map for the complex allotetraploid crop species Brassica napus (oilseed rape was constructed in a late-generation recombinant inbred line (RIL population, using genome-wide single nucleotide polymorphism (SNP markers assayed by the Brassica 60 K Infinium BeadChip Array. The linkage map contains 9164 SNP markers covering 1832.9 cM. 1232 bins account for 7648 of the markers. A subset of 2795 SNP markers, with an average distance of 0.66 cM between adjacent markers, was applied for QTL mapping of seed colour and the cell wall fiber components acid detergent lignin (ADL, cellulose and hemicellulose. After phenotypic analyses across four different environments a total of 11 QTL were detected for seed colour and fiber traits. The high-density map considerably improved QTL resolution compared to the previous low-density maps. A previously identified major QTL with very high effects on seed colour and ADL was pinpointed to a narrow genome interval on chromosome A09, while a minor QTL explaining 8.1% to 14.1% of variation for ADL was detected on chromosome C05. Five and three QTL accounting for 4.7% to 21.9% and 7.3% to 16.9% of the phenotypic variation for cellulose and hemicellulose, respectively, were also detected. To our knowledge this is the first description of QTL for seed cellulose and hemicellulose in B. napus, representing interesting new targets for improving oil content. The high density SNP genetic map enables navigation from interesting B. napus QTL to Brassica genome sequences, giving useful new information for understanding the genetics of key seed quality traits in rapeseed.

  14. Mechanism of Salt-Induced Self-Compatibility Dissected by Comparative Proteomic Analysis in Brassica napus L. (United States)

    Yang, Yong; Liu, Zhiquan; Zhang, Tong; Zhou, Guilong; Duan, Zhiqiang; Li, Bing; Dou, Shengwei; Liang, Xiaomei; Tu, Jinxing; Shen, Jinxiong; Yi, Bin; Fu, Tingdong; Dai, Cheng; Ma, Chaozhi


    Self-incompatibility (SI) in plants genetically prevents self-fertilization to promote outcrossing and genetic diversity. Its hybrids in Brassica have been widely cultivated due to the propagation of SI lines by spraying a salt solution. We demonstrated that suppression of Brassica napus SI from edible salt solution treatment was ascribed to sodium chloride and independent of S haplotypes, but it did not obviously change the expression of SI - related genes. Using the isobaric tags for relative and absolute quantitation (iTRAQ) technique, we identified 885 differentially accumulated proteins (DAPs) in Brassica napus stigmas of un-pollinated (UP), pollinated with compatible pollen (PC), pollinated with incompatible pollen (PI), and pollinated with incompatible pollen after edible salt solution treatment (NA). Of the 307 DAPs in NA/UP, 134 were unique and 94 were shared only with PC/UP. In PC and NA, some salt stress protein species, such as glyoxalase I , were induced, and these protein species were likely to participate in the self-compatibility (SC) pathway. Most of the identified protein species were related to metabolic pathways, biosynthesis of secondary metabolites, ribosome, and so on. A systematic analysis implied that salt treatment-overcoming SI in B. napus was likely conferred by at least five different physiological mechanisms: (i) the use of Ca 2+ as signal molecule; (ii) loosening of the cell wall to allow pollen tube penetration; (iii) synthesis of compatibility factor protein species for pollen tube growth; (iv) depolymerization of microtubule networks to facilitate pollen tube movement; and (v) inhibition of protein degradation pathways to restrain the SI response.

  15. Influence of a Vertical Cutting Device on Brassica Napus Seed Loss in Direct Combining

    Energy Technology Data Exchange (ETDEWEB)

    Pari, L.; Fedrizzi, M.; Assirelli, A. (Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Unita di Ricerca per l' Ingegneria Agraria, Monterotondo, RM (Italy))


    EU requires that by 2010 5.65% of diesel fuel must be of vegetable origin. To reduce Italian dependence from imported palm oil, it is necessary to increase national production of vegetable oils: together with sunflower and soybean, canola (Brassica napus or Brassica napus oleifera) is an interesting possibility to satisfy vegetable oil demand, that is rapidly increasing for its use in biodiesel production. In Italy potential areas are available for the cultivation in relation to adequate rainfall and mild winters, that are very promising factors for canola production. However, the long period of seed maturity, non uniform growth, natural dehiscent process and variable weather conditions, such as wind and rain, are some of the factors which can lead to large seed losses: this is the main problem limiting this specie diffusion. Amongst available harvesting techniques, direct harvest of canola is an hazardous practice because there are several important questions related to it. The success of canola may depend on research initiatives to reduce some of the obstacles associated with its growing. The objective of this study is to determine if different cropping heads in direct combining can reduce seed losses. In Northern Italy (Piedmont) the trials were conducted in a 16 ha canola cultivation, in which was seeded the -Lion variety of canola. In order to realize direct harvest, the combine cylinder speed was regulated as slow as possible (500 rpm), the concave was opened at 3/4 of the way (about 25 mm clearance) and the fan speed was set at 2/3 of small grain settings (800 rpm). Only one combine was used for the trials, a New Holland CX 9080, in order to avoid any influence on seed losses. The combine was equipped with two different cutting heads: a common wheat type (type 1) and another, similar to the first, but equipped with vertical cutting devices on both ends of the head (type 2), because the plants are very dense and entangled. The losses of seeds were measured

  16. Consequences of gene flow between oilseed rape (Brassica napus) and its relatives. (United States)

    Liu, Yongbo; Wei, Wei; Ma, Keping; Li, Junsheng; Liang, Yuyong; Darmency, Henri


    Numerous studies have focused on the probability of occurrence of gene flow between transgenic crops and their wild relatives and the likelihood of transgene escape, which should be assessed before the commercial release of transgenic crops. This review paper focuses on this issue for oilseed rape, Brassica napus L., a species that produces huge numbers of pollen grains and seeds. We analyze separately the distinct steps of gene flow: (1) pollen and seeds as vectors of gene flow; (2) spontaneous hybridization; (3) hybrid behavior, fitness cost due to hybridization and mechanisms of introgression; (4) and fitness benefit due to transgenes (e.g. herbicide resistance and Bt toxin). Some physical, biological and molecular means of transgene containment are also described. Although hybrids and first generation progeny are difficult to identify in fields and non-crop habitats, the literature shows that transgenes could readily introgress into Brassica rapa, Brassica juncea and Brassica oleracea, while introgression is expected to be rare with Brassica nigra, Hirschfeldia incana and Raphanus raphanistrum. The hybrids grow well but produce less seed than their wild parent. The difference declines with increasing generations. However, there is large uncertainty about the evolution of chromosome numbers and recombination, and many parameters of life history traits of hybrids and progeny are not determined with satisfactory confidence to build generic models capable to really cover the wide diversity of situations. We show that more studies are needed to strengthen and organize biological knowledge, which is a necessary prerequisite for model simulations to assess the practical and evolutionary outputs of introgression, and to provide guidelines for gene flow management. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  17. Properties of a membrane-bound triglyceride lipase of rapeseed (Brassica napus L.) cotyledons. (United States)

    Rosnitschek, I; Theimer, R R


    The properties of the alkaline lipase activity (EC that was recovered almost completely from a microsomal membrane fraction of 4-d-old rapeseed (Brassica napus L.) cotyledons were studied employing a titrimetric test procedure. The apparent KM was 6.5 mmol l(-1), with emulgated sunflower oil as the substrate. The products of triglyceride hydrolysis in vitro were glycerol, free fatty acids, and minor amounts of mono- and diglycerides. Maximum lipase activity depended on the preincubation of the lipolytic membrane fraction in 0.15 mol l(-1) NaCl and on the presence of at least 0.1 mol l(-1) NaCl in the test mixture. Desoxycholate and up to 0.1 mol l(-1) CaCl2 also activated the enzyme while EDTA and detergents such as trito x-100, digitonin, tween 85, and sodium dodecylsulfate were inhibitory. The rapeseed lipase displayed a conspicuous substrate selectivity among different plant triglycerides; the activity was inversely correlated with the oleic acid content of the oils. Water-soluble triacetin and the phospholipid lecithin were not hydrolyzed. Increasing amounts of free fatty acids reduced lipase activity; erucic acid, a major component of rapeseed oil, exhibited the strongest effect, suggesting a possible role in the regulation of lipase activity in vivo. The data demonstrate that the lipolytic membrane fraction houses a triglyceride lipase with properties similar to other plant and animal lipases. It can both qualitatively and quantitatively account for the fat degradation in rapeseed cotyledons. The evidence that provides further reason to acknowledge the membranous appendices of the spherosomes as the intracellular site of lipolysis is discussed.

  18. Sulphur Nutrition and its Effect on Yield and Oil Content of Oilseed Rape (Brassica Napus L.

    Directory of Open Access Journals (Sweden)

    Mária Varényiová


    Full Text Available The aim of the experiment was to study the importance of sulphur in oilseed rape (Brassica napus L. nutrition as well as the effect of rising doses of sulphur in combination with nitrogen on yield, oiliness, oil production, nutrients content in seed and nutrients uptake by rapeseed. The plot–scale experiment was established in years 2013/14 and 2014/15 within the agricultural cooperative in Mojmírovce. There were four fertilization treatments on 600 m2 experimental plots in three replications in this experiment. The first treatment was unfertilized control. Other three treatments were fertilized by the same nitrogen dose of 160 kg.ha−1 and by increasing doses of sulphur. The second treatment was fertilized by a dose of 15 kg.ha−1 S, the third by a dose of 40 kg.ha−1 and a dose of 65 kg.ha−1 S was applied at the fourth treatment. The highest average yield 3.96 t.ha-1 was found when a dose of 40 kg.ha−1 S was applied. The application of sulphur in a dose of 65 kg.ha−1 was accompanied by a yield decrease by 11.4 % as compared to the treatment where a sulphur dose of 40 kg.ha−1 was used. An average oil content of 45.1, 45.5, and 44.0 % was found in treatments in which the doses of sulphur of 15, 40 and 65 kg.ha−1 were applied. No significant difference among the treatments fertilized by sulphur was found. The average oil production reached 1809, 1802 and 1595 kg.ha−1 in cases of treatments fertilized by sulphur doses of 15, 40 and 65 kg.ha−1.

  19. Fatty Acid and Transcript Profiling in Developing Seeds of Three Brassica napus Cultivars

    Directory of Open Access Journals (Sweden)

    Petkova Mariana


    Full Text Available Fatty acid levels and gene expression profiles for selected genes associated with the synthesis of fatty acids (FA, triacylglycerol, and oil body proteins were examined in three oilseed rape (Brassica napus cultivars that have utility for cultivar development in our spring canola breeding program. The seed oil content of Bronowski, Q2, and Westar was 39.0, 40.1, and 40.6%, respectively at 40 days after flowering (DAF. During the 20 to 40 day period of seed development, cultivars had varying levels of palmitic, stearic, oleic, linoleic, α-linolenic, eicosenoic, and erucic acid. In general, the percentage of each FA was similar among the cultivars during seed development. However, the level of oleic acid was lower and the levels of eicosenoic acid and erucic acid were higher in Bronowski than in Q2 and Westar seeds; linoleic acid also tended to be lower in Bronowski. Gene expression among the cultivars was similar from 10 to 40 DAF. The few exceptions were that expression of KAS1 and SAD were higher in Westar and Q2 than in Bronowski at 25 DAF, SAD was highest in Q2, intermediate in Westar, and lowest in Bronowski at 35 DAF, FAD2 was higher in Q2 than in Bronowski at 35 DAF, FAD3 was higher in Q2 than in Bronowski at 15 DAF and Q2 and Westar at 25 and 30 DAF, and FAE1 was higher in Westar and Q2 than in Bronowski at 30 DAF. Correlation analysis for gene expression against DAF for each genotype supported a common trend in gene expression among the three cultivars with gene expression tending to decrease over time; except for LPAAT, which tended to increase. The correlation between the level of FAs and expression of genes by genotype indicated no general trend; rather correlations seem to depend on the genotype.

  20. Methyl jasmonate regulates antioxidant defense and suppresses arsenic uptake in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Muhammad A Farooq


    Full Text Available Methyl jasmonate (MJ is an important plant growth regulator, involved in plant defense against abiotic stresses, however its possible function in response to metal stress is poorly understood. In the present study, the effect of MJ on physiological and biochemical changes of the plants exposed to arsenic (As stress were investigated in two Brassica napus L. cultivars (ZS 758 – a black seed type, and Zheda 622 – a yellow seed type. The As treatment at 200 µM was more phytotoxic, however its combined application with MJ resulted in significant increase in leaf chlorophyll fluorescence, biomass production and reduced malondialdehyde content compared with As stressed plants. The application of MJ minimized the oxidative stress, as revealed via a lower level of reactive oxygen species (ROS synthesis (H2O2 and OH- in leaves and the maintenance of high redox states of glutathione and ascorbate. Enhanced enzymatic activities and gene expression of important antioxidants (SOD, APX, CAT, POD, secondary metabolites (PAL, PPO, CAD and induction of lypoxygenase gene suggest that MJ plays an effective role in the regulation of multiple transcriptional pathways which were involved in oxidative stress responses. The content of As was higher in yellow seeded plants (cv. Zheda 622 as compared to black seeded plants (ZS 758. The application of MJ significantly reduced the As content in leaves and roots of both cultivars. Findings of the present study reveal that MJ improves ROS scavenging through enhanced antioxidant defense system, secondary metabolite and reduced As contents in both the cultivars.

  1. Introduction of beet cyst nematode resistance from Sinapis alba L. and Raphanus sativus L. into Brassica napus L. (oil-seed rape) through sexual and somatic hybridization

    NARCIS (Netherlands)

    Lelivelt, C.L.C.


    Experiments were performed to select for beet cyst nematode (Heterodera schachtii Schm., abbrev. BCN) resistant genotypes of Brassica napus L. (oilseed rape), and to introduce BCN-resistance from the related species Raphanus

  2. Increased [CO2] does not compensate for negative effects on yield caused by higher temperature and [O3] in Brassica napus L

    DEFF Research Database (Denmark)

    Frenck, Georg; van der Linden, Leon Gareth; Mikkelsen, Teis Nørgaard


    in existing genotypes is vital. In this study, the responses in yield and biomass production of four different cultivars of oilseed rape (Brassica napus L.) were tested under five different combinations of increased [CO2] (700 ppm), temperature (+5 °C) and [O3] (+40 ppb). Especially the multifactor treatments...

  3. Functional analysis and tissue-differential expression of four FAD2 genes in amphidiploid Brassica napus derived from Brassica rapa and Brassica oleracea. (United States)

    Lee, Kyeong-Ryeol; In Sohn, Soo; Jung, Jin Hee; Kim, Sun Hee; Roh, Kyung Hee; Kim, Jong-Bum; Suh, Mi Chung; Kim, Hyun Uk


    Fatty acid desaturase 2 (FAD2), which resides in the endoplasmic reticulum (ER), plays a crucial role in producing linoleic acid (18:2) through catalyzing the desaturation of oleic acid (18:1) by double bond formation at the delta 12 position. FAD2 catalyzes the first step needed for the production of polyunsaturated fatty acids found in the glycerolipids of cell membranes and the triacylglycerols in seeds. In this study, four FAD2 genes from amphidiploid Brassica napus genome were isolated by PCR amplification, with their enzymatic functions predicted by sequence analysis of the cDNAs. Fatty acid analysis of budding yeast transformed with each of the FAD2 genes showed that whereas BnFAD2-1, BnFAD2-2, and BnFAD2-4 are functional enzymes, and BnFAD2-3 is nonfunctional. The four FAD2 genes of B. napus originated from synthetic hybridization of its diploid progenitors Brassica rapa and Brassica oleracea, each of which has two FAD2 genes identical to those of B. napus. The BnFAD2-3 gene of B. napus, a nonfunctional pseudogene mutated by multiple nucleotide deletions and insertions, was inherited from B. rapa. All BnFAD2 isozymes except BnFAD2-3 localized to the ER. Nonfunctional BnFAD2-3 localized to the nucleus and chloroplasts. Four BnFAD2 genes can be classified on the basis of their expression patterns. © 2013.

  4. Plant hormones in defense response of Brassica napus to Sclerotinia sclerotiorum - Reassessing the role of salicylic acid in the interaction with a necrotroph

    Czech Academy of Sciences Publication Activity Database

    Nováková, Miroslava; Šašek, Vladimír; Dobrev, Petre; Valentová, O.; Burketová, Lenka


    Roč. 80, JUL 2014 (2014), s. 308-317 ISSN 0981-9428 R&D Projects: GA ČR GA13-26798S Institutional support: RVO:61389030 Keywords : Brassica napus * Chorismate mutase * Defense signaling pathways Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 2.756, year: 2014

  5. Leptosphaeria maculans effector AvrLm4-7 affects salicylic acid (SA) and ethylene (ET) signalling and hydrogen peroxide (H2O2) accumulation in Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Nováková, Miroslava; Šašek, Vladimír; Trdá, Lucie; Krutinová, Hana; Mongin, T.; Valentová, O.; Balesdent, M.H.; Rouxel, T.; Burketová, Lenka


    Roč. 17, č. 6 (2016), s. 818-831 ISSN 1464-6722 R&D Projects: GA ČR GA13-26798S Institutional support: RVO:61389030 Keywords : AvrLm4-7 * Brassica napus * effector Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 4.697, year: 2016

  6. Genome-Wide Identification of MicroRNAs in Response to Cadmium Stress in Oilseed Rape (Brassica napus L. Using High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Hongju Jian


    Full Text Available MicroRNAs (miRNAs have important roles in regulating stress-response genes in plants. However, identification of miRNAs and the corresponding target genes that are induced in response to cadmium (Cd stress in Brassica napus remains limited. In the current study, we sequenced three small-RNA libraries from B. napus after 0 days, 1 days, and 3 days of Cd treatment. In total, 44 known miRNAs (belonging to 27 families and 103 novel miRNAs were identified. A comprehensive analysis of miRNA expression profiles found 39 differentially expressed miRNAs between control and Cd-treated plants; 13 differentially expressed miRNAs were confirmed by qRT-PCR. Characterization of the corresponding target genes indicated functions in processes including transcription factor regulation, biotic stress response, ion homeostasis, and secondary metabolism. Furthermore, we propose a hypothetical model of the Cd-response mechanism in B. napus. Combined with qRT-PCR confirmation, our data suggested that miRNAs were involved in the regulations of TFs, biotic stress defense, ion homeostasis and secondary metabolism synthesis to respond Cd stress in B. napus.

  7. Enhancing freezing tolerance of Brassica napus L. by overexpression of a stearoyl-acyl carrier protein desaturase gene (SAD) from Sapium sebiferum (L.) Roxb. (United States)

    Peng, Dan; Zhou, Bo; Jiang, Yueqiao; Tan, XiaoFeng; Yuan, DeYi; Zhang, Lin


    Sapium sebiferum (L.) Roxb. is an important woody oil tree and traditional herbal medicine in China. Stearoyl-acyl carrier protein desaturase (SAD) is a dehydrogenase enzyme that plays a key role in the transformation of saturated fatty acids into unsaturated fatty acids in oil; these fatty acids greatly influence the freezing tolerance of plants. However, it remains unclear whether freezing tolerance can be regulated by the expression level of SsSAD in S. sebiferum L. Our research indicated that SsSAD expression in S. sebiferum L. increased under freezing stress. To further confirm this result, we constructed a pEGAD-SsSAD vector and transformed it into B. napus L. W10 by Agrobacterium tumefaciens-mediated transformation. Transgenic plants that overexpressed the SsSAD gene exhibited significantly higher linoleic (18:2) and linolenic acid (18:3) content and advanced freezing tolerance. These results suggest that SsSAD overexpression in B. napus L. can increase the content of polyunsaturated fatty acids (PUFAs) such as linoleic (18:2) and linolenic acid (18:3), which are likely pivotal in improving freezing tolerance in B. napus L. plants. Thus, SsSAD overexpression could be useful in the production of freeze-tolerant varieties of B. napus L. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Differences between winter oilseed rape (Brassica napus L.) cultivars in nitrogen starvation-induced leaf senescence are governed by leaf-inherent rather than root-derived signals

    Czech Academy of Sciences Publication Activity Database

    Koeslin-Findeklee, F.; Becker, M. A.; van der Graaff, E.; Roitsch, Thomas; Horst, W. J.


    Roč. 66, č. 13 (2015), s. 3669-3681 ISSN 0022-0957 Institutional support: RVO:67179843 Keywords : Brassica napus * cytokinins * genotypic differences * leaf senescence * nitrogen efficiency * nitrogen starvation * reciprocal grafting * stay-green Subject RIV: EH - Ecology, Behaviour Impact factor: 5.677, year: 2015

  9. Conserved Function of ACYL–ACYL CARRIER PROTEIN DESATURASE 5 on Seed Oil and Oleic Acid Biosynthesis between Arabidopsis thaliana and Brassica napus

    Directory of Open Access Journals (Sweden)

    Changyu Jin


    Full Text Available Previous studies have shown that several ACYL–ACYL CARRIER PROTEIN DESATURASE (AtAAD members in Arabidopsis thaliana are responsible for oleic acid (C18:1 biosynthesis. Limited research has been conducted on another member, AtAAD5, and its paralog BnAAD5 in the closely related and commercially important plant, Brassica napus. Here, we found that AtAAD5 was predominantly and exclusively expressed in developing embryos at the whole seed developmental stages. The aad5 mutation caused a significant decrease in the amounts of oil and C18:1, and a considerable increase in the content of stearic acid (C18:0 in mature seeds, suggesting that AtAAD5 functioned as an important facilitator of seed oil biosynthesis. We also cloned the full-length coding sequence of BnAAD5-1 from the A3 subgenome of the B. napus inbred line L111. We showed that ectopic expression of BnAAD5-1 in the A. thaliana aad5-2 mutant fully complemented the phenotypes of the mutant, such as lower oil content and altered contents of C18:0 and C18:1. These results help us to better understand the functions of AAD members in A. thaliana and B. napus and provide a promising target for genetic manipulation of B. napus.

  10. An RNA-seq transcriptome analysis of floral buds of an interspecific Brassica hybrid between B. carinata and B. napus. (United States)

    Chu, Pu; Liu, Huijuan; Yang, Qing; Wang, Yankun; Yan, Guixia; Guan, Rongzhan


    Interspecific hybridizations promote gene transfer between species and play an important role in plant speciation and crop improvement. However, hybrid sterility that commonly found in the first generation of hybrids hinders the utilization of interspecific hybridization. The combination of divergent parental genomes can create extensive transcriptome variations, and to determine these gene expression alterations and their effects on hybrids, an interspecific Brassica hybrid of B. carinata × B. napus was generated. Scanning electron microscopy analysis indicated that some of the hybrid pollen grains were irregular in shape and exhibited abnormal exine patterns compared with those from the parents. Using the Illumina HiSeq 2000 platform, 39,598, 32,403 and 42,208 genes were identified in flower buds of B. carinata cv. W29, B. napus cv. Zhongshuang 11 and their hybrids, respectively. The differentially expressed genes were significantly enriched in pollen wall assembly, pollen exine formation, pollen development, pollen tube growth, pollination, gene transcription, macromolecule methylation and translation, which might be associated with impaired fertility in the F1 hybrid. These results will shed light on the mechanisms underlying the low fertility of the interspecific hybrids and expand our knowledge of interspecific hybridization.

  11. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.). (United States)

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na


    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  12. The effect of plant growth-promoting rhizobacteria on the phytoextraction of Cd and Zn by Brassica napus L. (United States)

    Dąbrowska, G; Hrynkiewicz, K; Trejgell, A; Baum, C


    The test strains Bacteroidetes bacterium (Ba), Pseudomonas fluorescens (Pf) and Variovorax sp. (Va) were selected in advance for their in vitro capability for growth promotion of rapeseed in the presence of increased concentrations of Cd, Cu, Pb and Zn in the medium. In the pot experiment, the strains were used for single Ba, Pf, Va or combined Ba + Pf, Ba + Va, Pf + Va, and Ba + Pf + Va inoculation of B. napus growing in contaminated soil from alluvial deposits. The positive effect of bacterial strains on plant growth was observed in vitro, but was not confirmed in situ in the contaminated soil, where the tested strains inhibited biomass production, rather than stimulating it. However, single inoculation with Ba significantly increased the chlorophyll content and K + concentration in the leaves. The inoculation of rapeseed with Ba and Va strains was indicated to be the most promising combination for phytoextraction of Cd and Zn from contaminated soil. Combined inoculation with Pf+Va and Pf + Ba+Va significantly decreased the concentration of heavy metals in the roots of rapeseed. We conclude that suitable combinations of PGPR can control the metal uptake of B. napus, selectively increasing either metal extraction or metal stabilization in the rhizosphere and offering promising applications in soil remediation.

  13. The effects of seed size on hybrids formed between oilseed rape (Brassica napus and wild brown mustard (B. juncea.

    Directory of Open Access Journals (Sweden)

    Yong-Bo Liu

    Full Text Available Seed size has significant implications in ecology, because of its effects on plant fitness. The hybrid seeds that result from crosses between crops and their wild relatives are often small, and the consequences of this have been poorly investigated. Here we report on plant performance of hybrid and its parental transgenic oilseed rape (Brassica napus and wild B. juncea, all grown from seeds sorted into three seed-size categories.Three seed-size categories were sorted by seed diameter for transgenic B. napus, wild B. juncea and their transgenic and non-transgenic hybrids. The seeds were sown in a field at various plant densities. Globally, small-seeded plants had delayed flowering, lower biomass, fewer flowers and seeds, and a lower thousand-seed weight. The seed-size effect varied among plant types but was not affected by plant density. There was no negative effect of seed size in hybrids, but it was correlated with reduced growth for both parents.Our results imply that the risk of further gene flow would probably not be mitigated by the small size of transgenic hybrid seeds. No fitness cost was detected to be associated with the Bt-transgene in this study.

  14. Wrinkled1 accelerates flowering and regulates lipid homeostasis between oil accumulation and membrane lipid anabolism in Brassica napus

    Directory of Open Access Journals (Sweden)

    Qing eLi


    Full Text Available Wrinkled1 (WRI1 belongs to the APETALA2 transcription factor family; it is unique to plants and is a central regulator of oil synthesis in Arabidopsis. The effects of WRI1 on comprehensive lipid metabolism and plant development were unknown, especially in crop plants. This study found that BnWRI1 in Brassica napus accelerated flowering and enhanced oil accumulation in both seeds and leaves without leading to a visible growth inhibition. BnWRI1 decreased storage carbohydrates and increased soluble sugars to facilitate the carbon flux to lipid anabolism. BnWRI1 is localized to the nucleus and directly binds to the AW-box at proximal upstream regions of genes involved in fatty acid synthesis and lipid assembly. The overexpression (OE of BnWRI1 resulted in the up-regulation of genes involved in glycolysis, fatty acid synthesis, lipid assembly, and flowering. Lipid profiling revealed increased galactolipid monogalactosyldiacylglycerol (MGDG, digalactosyldiacylglycerol (DGDG, and phosphatidylcholine (PC in the leaves of OE plants, whereas it exhibited a reduced level of the galactolipids DGDG and MGDG and increased levels of PC, phosphatidylethanolamide (PE, and oil (triacylglycerol, TAG in the siliques of OE plants during the early seed development stage. These results suggest that BnWRI1 is important for homeostasis among TAG, membrane lipids and sugars, and thus facilitates flowering and oil accumulation in B. napus.

  15. The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity

    Directory of Open Access Journals (Sweden)

    Lisong eMa


    Full Text Available AbstractThe fungus Leptosphaeria maculans (L. maculans is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localised cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR. However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1. Silencing of NbSOBIR1 or NbSERK3 (BAK1 compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signalling complex and were able to define the AvrLm1 effector domain.

  16. Breeding response of transcript profiling in developing seeds of Brassica napus

    Directory of Open Access Journals (Sweden)

    Li Xiaodan


    Full Text Available Abstract Background The upgrading of rapeseed cultivars has resulted in a substantial improvement in yield and quality in China over the past 30 years. With the selective pressure against fatty acid composition and oil content, high erucic acid- and low oil-content cultivars have been replaced by low erucic acid- and high oil-content cultivars. The high erucic acid cultivar Zhongyou 821 and its descendent, low erucic acid cultivar Zhongshuang 9, are representatives of two generations of the most outstanding Chinese rapeseed cultivars (B. napus developed the past 2 decades. This paper compares the transcriptional profiles of Zhongshuang 9 and Zhongyou 821 for 32 genes that are principally involved in lipid biosynthesis during seed development in order to elucidate how the transcriptional profiles of these genes responded to quality improvement over the past 20 years. Results Comparison of the cultivar Zhongyou 821 with its descendent, Zhongshuang 9, shows that the transcriptional levels of seven of the 32 genes were upregulated by 30% to 109%, including FAD3, ACCase, FAE1, GKTP, Caleosin, GAPDH, and PEPC. Of the 32 genes, 10 (KAS3, β-CT, BcRK6, P450, FatA, Oleosin, FAD6, FatB, α-CT and SUC1 were downregulated by at least 20% and most by 50%. The Napin gene alone accounted for over 75% of total transcription from all 32 genes assessed in both cultivars. Most of the genes showed significant correlation with fatty acid accumulation, but the correlation in ZS9 was significantly different from that in ZY821. Higher KCR2 activity is associated with higher C16:0, C18:0, and C18:2 in both cultivars, lower C22:1 and total fatty acid content in ZY821, and lower 18:1 in ZS9. Conclusion This paper illustrates the response of the transcription levels of 32 genes to breeding in developing rapeseed seeds. Both cultivars showed similar transcription profiles, with the Napin gene predominantly transcribed. Selective pressure for zero erucic acid, low

  17. Genetic diversity analysis of brassica napus/brassica campestris progenies using microsatellite markers

    International Nuclear Information System (INIS)

    Fayyaz, L.; Farhatullah, A.; Iqbal, S.; Kanwal, M.; Nawaz, I.


    Genetic diversity and relationship of F2 segregating progenies of interspecific crosses between B. napus N-501/B. campestris C-118 were studied. A set of 90 genotypes (2 parental lines and their 88 F2 progenies) was characterized separately using 24 microsatellite or SSR markers to cover the diversity as broadly as possibly present in them. In initial screening only 12 out of 24 SSR primers combination amplified DNA fragments, while the remaining 12 SSR primers did not amplify DNA fragment therefore those 12 SSR molecular markers were not used for further analysis. The 12 SSR primer combinations generated a total of 33 alleles, of that 32 were polymorphic loci, whereas only one was monomorphic locus. Primers BRMS-19 and BRMS-40 were highly polymorphic producing 4 bands each. Primer Ra2-D04 was less polymorphic and it produced only one band. The proportion of polymorphic loci was 95.83% which indicates high genetic diversity among the progenies. The average number of polymorphic alleles per locus was 2.66. The PIC values ranged from 0.395 for primer Ra2-E03 to 0.726 for primer BRMS-019 with an average genetic diversity (PIC value) of 0.584 per locus. Seven primers showed PIC values above 0.5 (50%) indicating high genetic diversity in the studied plant materials. Pair-wise similarity indices among 90 genotypes ranged from 0.3 to 0.95. Dendrogram obtained through UPGMA clustering of F2 progenies depicted eight main groups using similarity coefficient of 0.70. The progenies could be similar to their parents if they have the same banding patterns as that of the parents and could be distinguished from each other by the combination of fragments which are repeatedly present in one progeny and absent in the other. Considerable genetic diversity has been found among the F2 segregating progenies and their parents using SSR markers thus, SSR analysis proved to be a useful tool. (author)

  18. Wastewater impact on physiology, biomass and yield of canola (brassica napus L.)

    International Nuclear Information System (INIS)

    Khan, I.U.; Khan, M.J.


    The impact of domestic/municipal wastewater (mww) of Dera Ismail Khan, Pakistan was assessed through its effects on biomass, physiology and yield of canola (Brassica napus L.). The pot experiments were conducted in a completely randomized design with three replications in net house during winter season 2006-07 and 2007-08 at Gomal University, Dera Ismail Khan, Pakistan. Treatments included were T0 (tube well/tap water), T/sub 1/ (20% mww), T/sub 2/ (40% mww), T/sub 3/ (80% mww) and T/sub 4/ (100% mww/raw-form municipal wastewater). The quality and chemical composition of wastewater was deviating from international (Anon., 1985) as well as NEQS (2005) standard. Analysis of wastewater showed that biochemical oxygen demand (BOD), chemical oxygen demand (COD), sodium adsorption ratio (SAR) and total suspended solids (TSS) were above the permissible limit of irrigation. In pods per plant, the reduction was 61.55% by recording 110 pods per plant with T/sub 4/ (100% mww) as compared to control T0 (286.1 pods per plant). Similarly pod length (reduced by 59.72%), seeds per pod (reduced by 42.53%), Seeds per plant (reduced by 82%), seed weight per plant (reduced by 88%), 100-seed weight (reduced by 19.54%) and straw yield (reduced by 54.23%) were significantly reduced by applying 100% wastewater. The most affected yield contributing traits were seeds per plant and seed weight per plant with 82% and 88% reduction, respectively due to T/sub 4/ (100% mww). On average, the decrease was 60% in the first stage and a further decrement of 4.83% was observed when the obtained seeds were re-sown in 2007-08. Results revealed that utilizing municipal wastewater of the area under investigation for irrigation purpose of food and feed crops might not be safe. The major reason seems to be the high salinity and sodium adsorption ratio that restricted crop growth and yield. (author)

  19. Chromium-induced physio-chemical and ultrastructural changes in four cultivars of Brassica napus L. (United States)

    Gill, Rafaqat A; Zang, Lili; Ali, Basharat; Farooq, Muhammad A; Cui, Peng; Yang, Su; Ali, Shafaqat; Zhou, Weijun


    In nature, plants are continuously exposed to several biotic and abiotic stresses. Among these stresses, chromium (Cr) stress is one of the most adverse factors that affects the plant growth, and productivity, and imposes a severe threat for sustainable crop production. In the present study, toxic effects of Cr were studied in hydroponically grown seedlings of four different cultivars of Brassica napus L. viz. ZS 758, Zheda 619, ZY 50 and Zheda 622. The study revealed that elevated Cr concentrations reduced the plant growth rate and biomass as compared to respective controls in all the cultivars and this decline was more obvious in Zheda 622. It was observed that reduction of photosynthetic attributes was more pronounced in Zheda 622 as compared to other cultivars; while, cultivar ZS 758 performed better under Cr-toxicity. Results showed that Cr contents in different parts of seedlings were higher in Zheda 622 as compared to other cultivars and Cr contents were higher in roots than shoots in all the cultivars. Accumulation of reactive oxygen species (ROS) and malondialdehyde (MDA) were induced under different Cr concentrations. Results showed that some of anti-oxidant enzyme activities in leaves and roots were increased under the Cr-toxicity. The electron microscopic study showed that ultrastructural damages in leaf mesophyll and root tip cells were more prominent in Zheda 622 as compared to other cultivars under 400 μM Cr stress. Under 400 μM Cr concentration, changes like broken cell wall, immature nucleus, a number of mitochondria, ruptured thylakoid membranes and large size of vacuole and starch grains were observed in leaf ultrastructures. The damages in root cells were observed in the form of disruption of golgibodies and diffused cell wall under the higher concentration of Cr (400 μM). On the basis of these observations, it was concluded that Zheda 622 was found to be more sensitive as followed by ZY 50, Zheda 619 and ZS 758 under Cr-toxicity. Copyright

  20. Evaluation of Yield Component Traits of Honeybee-Pollinated (Apis mellifera L.Rapeseed Canola (Brassica napus L. Evaluación de Parámetros de Rendimiento del Raps (Brassica napus L. Polinizado por Abejas (Apis mellifera L.

    Directory of Open Access Journals (Sweden)

    Ximena Araneda Durán


    Full Text Available Recent introduction of hybrid varieties raises the question if bees (Apis mellifera L. contribute as pollinator agents in developing the full yield potential of rapeseed (Brassica napus L.. In order to evaluate the yield achieved by B. napus cv. Artus pollinated by A. mellifera testing was carried out in the district of Freire, La Araucanía Region, Chile. This consisted in isolating or excluding rapeseed plants from pollinators with exclusion cages. Treatments applied were total exclusion (T1, partial exclusion (T2 and free pollination (T0 with a density of 6.5 hives ha-1, in order to determine the following yield components traits: grains per silique, siliques per plant, 1000 grain weight and yield. The experimental design used was randomized complete blocks with three treatments and three replicates. Results obtained show that the parameter least affected by bee intervention was the grains per silique variable. In contrast, siliques per plant and 1000 grain weight parameters presented significant differences, contributing to a yield greater than 5 t ha-1; which represented a figure 50.34% higher than in the treatment without bees. It may be concluded that the inclusion of bees in crops is fully justified as a production tool.La reciente introducción de variedades híbridas plantea la interrogante de la contribución que pueda tener la presencia de abejas (Apis mellifera L. como agentes polinizadores para desarrollar en pleno el potencial productivo del raps (Brassica napus L.. Con el objetivo de evaluar el rendimiento alcanzado por B. napus cv. Artus polinizado por A. mellifera, se realizó un ensayo en la localidad de Freire, Región de La Araucanía, Chile. Éste consistió en aislar o excluir las plantas de raps de los polinizadores mediante el uso de jaulas excluidoras. Los tratamientos consistieron en la exclusión total (T1, exclusión parcial (T2 y libre polinización (T0 con una densidad de 6,5 colmenas ha-1, con el fin de determinar

  1. Effects of gamma irradiation of an isolated flower in reproductive stages on seed production of Brassica napus L

    International Nuclear Information System (INIS)

    Minami, Harufumi; Sakurai, Noboru; Muroyama, Takeo; Hogetsu, Daisuke


    We examined seed production after gamma irradiation of an isolated whole flower (a flower with pedicel) of Brassica napus strain 1 through a flower organ culture and estimated the effects of gamma rays on embryogenesis in sexual reproductive stages. The whole flowers were irradiated with 17, 32, 57 and 87 Gy of gamma rays in unpollinated stage at day of anthesis, in stage shortly after fertilization and early embryo stage. The gamma irradiation of flowers in stage shortly after fertilization showed a drastic effect on the mature seed production. The number of seeds per pod began to decrease at 17 Gy and dropped to 15% of that of unirradiated flowers at 32 Gy. On the other hand, the flowers irradiated in the unpollinated and early embryo stages began to reduce the number of seeds at 57 Gy. The ovary elongation was suppressed with increasing irradiation dose when the flower was irradiated in unpollinated stage and stage shortly after fertilization. (author)

  2. Preferential exclusion of hybrids in mixed pollinations between oilseed rape (Brassica napus) and weedy B. campestris (Brassicaceae)

    DEFF Research Database (Denmark)

    Hauser, T.P.; Bagger Jørgensen, Rikke; Østergård, Hanne


    amplified polymorphic DNA analysis. Using data on the proportion of fully developed seeds and the proportion of these seeds that were hybrids, a statistical model was constructed to estimate the fitness of conspecific and heterospecific pollen and the survival of conspecific and heterospecific zygotes...... for competition between male gametophytes and/or seeds within pods. To test whether competition influences the success of hybridization, pollen from the two species was mixed in different proportions and applied to stigmas of both species. The resulting seeds were scored for paternity by isozyme and randomly...... to seeds. B. campestris pollen in B. napus styles had a significantly lower fitness than the conspecific pollen, whereas no difference between pollen types was found in B. campestris styles. Hybrid zygotes survived to significantly lower proportions than conspecific zygotes in both species, with the lowest...

  3. Hydroponics versus field lysimeter studies of urea, ammonium and nitrate uptake by oilseed rape (Brassica napus L.). (United States)

    Arkoun, Mustapha; Sarda, Xavier; Jannin, Laëtitia; Laîné, Philippe; Etienne, Philippe; Garcia-Mina, José-Maria; Yvin, Jean-Claude; Ourry, Alain


    N-fertilizer use efficiencies are affected by their chemical composition and suffer from potential N-losses by volatilization. In a field lysimeter experiment, (15)N-labelled fertilizers were used to follow N uptake by Brassica napus L. and assess N-losses by volatilization. Use of urea with NBPT (urease inhibitor) showed the best efficiency with the lowest N losses (8% of N applied compared with 25% with urea alone). Plants receiving ammonium sulphate, had similar yield achieved through a better N mobilization from vegetative tissues to the seeds, despite a lower N uptake resulting from a higher volatilization (43% of applied N). Amounts of (15)N in the plant were also higher when plants were fertilized with ammonium nitrate but N-losses reached 23% of applied N. In parallel, hydroponic experiments showed a deleterious effect of ammonium and urea on the growth of oilseed rape. This was alleviated by the nitrate supply, which was preferentially taken up. B. napus was also characterized by a very low potential for urea uptake. BnDUR3 and BnAMT1, encoding urea and ammonium transporters, were up-regulated by urea, suggesting that urea-grown plants suffered from nitrogen deficiency. The results also suggested a role for nitrate as a signal for the expression of BnDUR3, in addition to its role as a major nutrient. Overall, the results of the hydroponic study showed that urea itself does not contribute significantly to the N nutrition of oilseed rape. Moreover, it may contribute indirectly since a better use efficiency for urea fertilizer, which was further increased by the application of a urease inhibitor, was observed in the lysimeter study.

  4. Altered Fruit and Seed Development of Transgenic Rapeseed (Brassica napus Over-Expressing MicroRNA394.

    Directory of Open Access Journals (Sweden)

    Jian Bo Song

    Full Text Available Fruit and seed development in plants is a complex biological process mainly involved in input and biosynthesis of many storage compounds such as proteins and oils. Although the basic biochemical pathways for production of the storage metabolites in plants are well characterized, their regulatory mechanisms are not fully understood. In this study, we functionally identified rapeseed (Brassica napus miR394 with its target gene Brassica napus leaf curling responsiveness (BnLCR to dissect a role of miR394 during the fruit and seed development. Transgenic rapeseed plants over-expressing miR394 under the control of the cauliflower mosaic virus 35S promoter were generated. miR394 over-expression plants exhibited a delayed flowering time and enlarged size of plants, leaf blade, pods and seed body, but developed seeds with higher contents of protein and glucosinolates (GLS and lower levels of oil accumulation as compared to wild-type. Over-expression of miR394 altered the fatty acid (FA composition by increasing several FA species such as C16:0 and C18:0 and unsaturated species of C20:1 and C22:1 but lowering C18:3. This change was accompanied by induction of genes coding for transcription factors of FA synthesis including leafy cotyledon1 (BnLEC1, BnLEC2, and FUSCA3 (FUS3. Because the phytohormone auxin plays a crucial role in fruit development and seed patterning, the DR5-GUS reporter was used for monitoring the auxin response in Arabidopsis siliques and demonstrated that the DR5 gene was strongly expressed. These results suggest that BnmiR394 is involved in rapeseed fruit and seed development.

  5. Effects of different roasting conditions on the nutritional value and oxidative stability of high-oleic and yellow-seeded Brassica napus oils

    Directory of Open Access Journals (Sweden)

    Rękas, A.


    Full Text Available This study was conducted to evaluate the possibility of enhancing the nutritional value and oxidative stability of rapeseed oil obtained from seeds subjected to thermal treatment prior to pressing. The yellowseeded and high-oleic B. napus lines, harvested in Poland, were roasted prior to pressing for 1 h at 100 and 150 °C. This study highlighted how rapeseed breeding lines affect the quality profile of the oils obtained both before and after the roasting process. In principle, the high-oleic B. napus was accompanied by a nearly 2-fold increase in oxidative stability compared to the yellow-seeded B. napus, most likely due to a higher content of oxidation-resistant oleic fatty acids (~74.24% vs. ~60.76% and a decreased concentration of oxidizable PUFAs (~16.32% vs. ~31.09%. Similar to the case of roasting black-seeded rapeseed, the thermal pre-treatment of yellow-seeded and high-oleic B. napus prior to pressing did not alter the composition of their fatty acids. Based on the results obtained in this study, it can be concluded that roasting seeds prior to pressing does not reduce the amount of tocopherols in the oil; moreover, a slight increase in γ-tocopherol content was observed.Este estudio se realizó para evaluar la posibilidad de aumentar el valor nutritivo y la estabilidad oxidativa del aceite de colza obtenido a partir de semillas sometidas a tratamiento térmico antes del prensado. Las líneas de B. napus sembrados amarillos y alto oleico, cosechadas en Polonia, fueron tostadas antes de ser prensadas durante 1 hora a 100 y 150 °C. Este estudio pone de relieve cómo las líneas de colza mejoradas ven afectado el perfil de calidad de los aceites obtenidos antes y después del proceso de tostado. En principio, el alto oleico B. napus aumenta casi 2 veces la estabilidad a la oxidación en comparación con semilla amarilla B. napus, muy probablemente debido a un mayor contenido de ácido graso oleico resistente a la oxidación (~74,24% vs

  6. Landscape-scale distribution and persistence of genetically modified oilseed rape (Brassica napus) in Manitoba, Canada. (United States)

    Knispel, Alexis L; McLachlan, Stéphane M


    Genetically modified herbicide-tolerant (GMHT) oilseed rape (OSR; Brassica napus L.) was approved for commercial cultivation in Canada in 1995 and currently represents over 95% of the OSR grown in western Canada. After a decade of widespread cultivation, GMHT volunteers represent an increasing management problem in cultivated fields and are ubiquitous in adjacent ruderal habitats, where they contribute to the spread of transgenes. However, few studies have considered escaped GMHT OSR populations in North America, and even fewer have been conducted at large spatial scales (i.e. landscape scales). In particular, the contribution of landscape structure and large-scale anthropogenic dispersal processes to the persistence and spread of escaped GMHT OSR remains poorly understood. We conducted a multi-year survey of the landscape-scale distribution of escaped OSR plants adjacent to roads and cultivated fields. Our objective was to examine the long-term dynamics of escaped OSR at large spatial scales and to assess the relative importance of landscape and localised factors to the persistence and spread of these plants outside of cultivation. From 2005 to 2007, we surveyed escaped OSR plants along roadsides and field edges at 12 locations in three agricultural landscapes in southern Manitoba where GMHT OSR is widely grown. Data were analysed to examine temporal changes at large spatial scales and to determine factors affecting the distribution of escaped OSR plants in roadside and field edge habitats within agricultural landscapes. Additionally, we assessed the potential for seed dispersal between escaped populations by comparing the relative spatial distribution of roadside and field edge OSR. Densities of escaped OSR fluctuated over space and time in both roadside and field edge habitats, though the proportion of GMHT plants was high (93-100%). Escaped OSR was positively affected by agricultural landscape (indicative of cropping intensity) and by the presence of an

  7. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Li Xu

    Full Text Available Members of the plant NUCLEAR FACTOR Y (NF-Y family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola, each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14 were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12 and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14 were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12 and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14 and two NF-YC members (BnNF-YC2 and BnNF-YC3 were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides

  8. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L. (United States)

    Xu, Li; Lin, Zhongyuan; Tao, Qing; Liang, Mingxiang; Zhao, Gengmao; Yin, Xiangzhen; Fu, Ruixin


    Members of the plant NUCLEAR FACTOR Y (NF-Y) family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola), each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14) were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12) and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14) were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12) and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14) and two NF-YC members (BnNF-YC2 and BnNF-YC3) were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides insight into

  9. Effect of Sugarcane Filter Muds, Chemical and Biological Fertilizers on Absorption of Some Macro- and Micro-Elementsand Heavy Metals by Canola (Brassica napus L.)


    H. Monjezi; M. R Moradi-Telavat; S. A. Siadat; A. Koochakzadeh; H. Hamdi


    In order to evaluate the effect of sugarcane (Sacharum officinarum L.) filter muds and chemical and biological fertilizers application on macro- and micronutrient elements and some heavy metals (Pb and Cd) absorption by canola (Brassica napus L.) grains, a factorial experiment was conducted in 2012 in the Experimental Farm of Ramin (Mollasani) Agriculture and Natural Resources University of Khouzestan, Iran. A complete blocks design was used for the experiment with three replications. Differe...

  10. Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

    Directory of Open Access Journals (Sweden)

    Mohammad S. Khan


    Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

  11. Gene expression profiling via LongSAGE in a non-model plant species: a case study in seeds of Brassica napus

    Directory of Open Access Journals (Sweden)

    Friedt Wolfgang


    Full Text Available Abstract Background Serial analysis of gene expression (LongSAGE was applied for gene expression profiling in seeds of oilseed rape (Brassica napus ssp. napus. The usefulness of this technique for detailed expression profiling in a non-model organism was demonstrated for the highly complex, neither fully sequenced nor annotated genome of B. napus by applying a tag-to-gene matching strategy based on Brassica ESTs and the annotated proteome of the closely related model crucifer A. thaliana. Results Transcripts from 3,094 genes were detected at two time-points of seed development, 23 days and 35 days after pollination (DAP. Differential expression showed a shift from gene expression involved in diverse developmental processes including cell proliferation and seed coat formation at 23 DAP to more focussed metabolic processes including storage protein accumulation and lipid deposition at 35 DAP. The most abundant transcripts at 23 DAP were coding for diverse protease inhibitor proteins and proteases, including cysteine proteases involved in seed coat formation and a number of lipid transfer proteins involved in embryo pattern formation. At 35 DAP, transcripts encoding napin, cruciferin and oleosin storage proteins were most abundant. Over both time-points, 18.6% of the detected genes were matched by Brassica ESTs identified by LongSAGE tags in antisense orientation. This suggests a strong involvement of antisense transcript expression in regulatory processes during B. napus seed development. Conclusion This study underlines the potential of transcript tagging approaches for gene expression profiling in Brassica crop species via EST matching to annotated A. thaliana genes. Limits of tag detection for low-abundance transcripts can today be overcome by ultra-high throughput sequencing approaches, so that tag-based gene expression profiling may soon become the method of choice for global expression profiling in non-model species.

  12. Microwave irradiation and citric acid assisted seed germination and phytoextraction of nickel (Ni) by Brassica napus L.: morpho-physiological and biochemical alterations under Ni stress. (United States)

    Farid, Mujahid; Ali, Shafaqat; Rizwan, Muhammad; Saeed, Rashid; Tauqeer, Hafiz Muhammad; Sallah-Ud-Din, Rasham; Azam, Ahmed; Raza, Nighat


    The complex bio-geochemistry of soil allows pollutant to persist for a longer period of time which further decreased the fertility and natural composition of land. Nickel, an inorganic pollutant, coming from a wide range of industrial and manufacturing units possesses serious threat to soil degradation and crop productivity around the world. The present study was carried to evaluate the combined role of microwave irradiation (MR) and citric acid (CA) on the phytoextraction potential of Brassica napus L. under Ni stress. An initial seed germination test was conducted to select effective time scale of MR exposure. Highest seed germination was observed at exposure of 2.45 GHz frequency for 30 s. Healthy seeds of B. napus L. genotype Faisal Canola (RBN-03060) treated with MR at 2.45 GHz for 30 s were sown in plastic pots filled with 5 kg of soil. Nickel and CA applied exogenously in solution form with different combinations to both MR-treated and untreated B. napus plants. The MR-treated plants showed higher growth, biomass, photosynthetic pigments (Chl a, b, total, and carotenoids) and activities of antioxidant enzymes (SOD, POD, APX, CAT) as compared to untreated plants who showed higher reactive oxygen species (MDA, H 2 O 2 ) and electrolyte leakage. Increasing Ni concentration significantly decreased the physiological and biochemical attributes of B. napus both in MR-treated and untreated plants. The addition of CA alleviated Ni-induced toxic effects in both MR-treated and untreated plants by improving antioxidant defense system. The degree of Ni stress mitigation was higher in MR-treated plants. The Ni concentration was higher in root, stem, and leaves of MR-treated plants under CA application as compared to untreated plants. The present study concluded that seeds treated with MR before sowing showed higher accumulation and concentration of Ni from soil, and this phenomenon boosted with the application of CA.

  13. Application of Endophytic Pseudomonas fluorescens and a Bacterial Consortium to Brassica napus Can Increase Plant Height and Biomass under Greenhouse and Field Conditions

    Directory of Open Access Journals (Sweden)

    Richard D. Lally


    Full Text Available Plant associated bacteria with plant growth promotion (PGP properties have been proposed for use as environmentally friendly biofertilizers for sustainable agriculture; however, analysis of their efficacy in the field is often limited. In this study, greenhouse and field trials were carried out using individual endophytic Pseudomonas fluorescens strains, the well characterized rhizospheric P. fluorescens F113 and an endophytic microbial consortium of 10 different strains. These bacteria had been previously characterized with respect to their PGP properties in vitro and had been shown to harbor a range of traits associated with PGP including siderophore production, 1-aminocyclopropane-1-carboxylic acid (ACC deaminase activity, and inorganic phosphate solubilization. In greenhouse experiments individual strains tagged with gfp and Kmr were applied to Brassica napus as a seed coat and were shown to effectively colonize the rhizosphere and root of B. napus and in addition they demonstrated a significant increase in plant biomass compared with the non-inoculated control. In the field experiment, the bacteria (individual and consortium were spray inoculated to winter oilseed rape B. napus var. Compass which was grown under standard North Western European agronomic conditions. Analysis of the data provides evidence that the application of the live bacterial biofertilizers can enhance aspects of crop development in B. napus at field scale. The field data demonstrated statistically significant increases in crop height, stem/leaf, and pod biomass, particularly, in the case of the consortium inoculated treatment. However, although seed and oil yield were increased in the field in response to inoculation, these data were not statistically significant under the experimental conditions tested. Future field trials will investigate the effectiveness of the inoculants under different agronomic conditions.

  14. Greenhouse gas emissions from the energy crop oilseed rape (Brassica napus); the role of photosynthetically active radiation in diurnal N2O flux variation.


    Keane, J.Ben; Ineson, P.; Vallack, Harry W.; Blei, Emanuel; Howarth, Steve; McNamara, Niall P.; Rowe, Rebecca; Williams, Mathew; Toet, Sylvia


    Oilseed rape (OSR, Brassica napus L.) is an important feedstock for biodiesel; hence, carbon dioxide (CO2), methane (CH4) and particularly fertilizer-derived nitrous oxide (N2O) emissions during cultivation must be quantified to assess putative greenhouse gas (GHG) savings, thus creating an urgent and increasing need for such data. Substrates of nitrification [ammonium (NH4)] and denitrification [nitrate (NO3)], the predominant N2O production pathways, were supplied separately and in combinat...

  15. Do competitive conditions affect introgression of transgenes from oilseed rape (Brassica napus) to weedy Brassica rapa? AS case study with special reference to transplastomic oilseed rape

    DEFF Research Database (Denmark)

    Johannessen, Marina

    In species where chloroplast inheritance is exclusively or predominantly maternal, pollen-mediated flow of transgenes is reduced if transgenes are inserted in chloroplast DNA instead of nuclear DNA. However, transmission of chloroplast-encoded transgeneswill still occur if transgenic individuals ...... affected the thousand-kernel weight significantly. It was concluded that further introgression of transgenes from transplastomic oilseed rape to B. rapa is mostlikely at current field densities of B. napus and when B. rapa is an abundant weed....

  16. Production and genetic analysis of resynthesized Brassica napus from a B. rapa landrace from the Qinghai-Tibet Plateau and B. alboglabra. (United States)

    Liu, H D; Zhao, Z G; Du, D Z; Deng, C R; Fu, G


    This study aimed to reveal the genetic and epigenetic variations involved in a resynthesized Brassica napus (AACC) generated from a hybridization between a B. rapa (AA) landrace and B. alboglabra (CC). Amplified fragment length polymorphism (AFLP), methylation-sensitive amplified polymorphism, and the cDNA-AFLP technique were performed to detect changes between different generations at the genome, methylation, and transcription levels. We obtained 30 lines of resynthesized B. napus with a mean 1000-seed weight of over 7.50 g. All of the lines were self-compatible, probably because both parents were self-compatible. At the genome level, the S0 generation had the lowest frequency of variations (0.18%) and the S3 generation had the highest (6.07%). The main variation pattern was the elimination of amplified restriction fragments on the CC genome from the S0 to the S4 generations. At the methylation level, we found three loci that exhibited altered methylation patterns on the parental A genome; the variance rate was 1.35%. At the transcription level, we detected 43.77% reverse mutations and 37.56% deletion mutations that mainly occurred on the A and C genomes, respectively, in the S3 generation. Our results highlight the genetic variations that occur during the diploidization of resynthesized B. napus.

  17. Effect of Arabinogalactan Proteins from the Root Caps of Pea and Brassica napus on Aphanomyces euteiches Zoospore Chemotaxis and Germination12[C][W (United States)

    Cannesan, Marc Antoine; Durand, Caroline; Burel, Carole; Gangneux, Christophe; Lerouge, Patrice; Ishii, Tadashi; Laval, Karine; Follet-Gueye, Marie-Laure; Driouich, Azeddine; Vicré-Gibouin, Maïté


    Root tips of many plant species release a number of border, or border-like, cells that are thought to play a major role in the protection of root meristem. However, little is currently known on the structure and function of the cell wall components of such root cells. Here, we investigate the sugar composition of the cell wall of the root cap in two species: pea (Pisum sativum), which makes border cells, and Brassica napus, which makes border-like cells. We find that the cell walls are highly enriched in arabinose and galactose, two major residues of arabinogalactan proteins. We confirm the presence of arabinogalactan protein epitopes on root cap cell walls using immunofluorescence microscopy. We then focused on these proteoglycans by analyzing their carbohydrate moieties, linkages, and electrophoretic characteristics. The data reveal (1) significant structural differences between B. napus and pea root cap arabinogalactan proteins and (2) a cross-link between these proteoglycans and pectic polysaccharides. Finally, we assessed the impact of root cap arabinogalactan proteins on the behavior of zoospores of Aphanomyces euteiches, an oomycetous pathogen of pea roots. We find that although the arabinogalactan proteins of both species induce encystment and prevent germination, the effects of both species are similar. However, the arabinogalactan protein fraction from pea attracts zoospores far more effectively than that from B. napus. This suggests that root arabinogalactan proteins are involved in the control of early infection of roots and highlights a novel role for these proteoglycans in root-microbe interactions. PMID:22645070

  18. Embryonal Control of Yellow Seed Coat Locus ECY1 Is Related to Alanine and Phenylalanine Metabolism in the Seed Embryo of Brassica napus. (United States)

    Wang, Fulin; He, Jiewang; Shi, Jianghua; Zheng, Tao; Xu, Fei; Wu, Guanting; Liu, Renhu; Liu, Shengyi


    Seed coat color is determined by the type of pigment deposited in the seed coat cells. It is related to important agronomic traits of seeds such as seed dormancy, longevity, oil content, protein content and fiber content. In Brassica napus, inheritance of seed coat color is related to maternal effects and pollen effects (xenia effects). In this research we isolated a mutation of yellow seeded B. napus controlled by a single Mendelian locus, which is named Embryonal Control of Yellow seed coat 1 (Ecy1). Microscopy of transverse sections of the mature seed show that pigment is deposited only in the outer layer of the seed coat. Using Illumina Hisequation 2000 sequencing technology, a total of 12 GB clean data, 116× coverage of coding sequences of B. napus, was achieved from seeds 26 d after pollination (DAP). It was assembled into 172,238 independent transcripts, and 55,637 unigenes. A total of 139 orthologous genes of Arabidopsis transparent testa (TT) genes were mapped in silico to 19 chromosomes of B. napus Only 49 of the TT orthologous genes are transcribed in seeds. However transcription of all orthologs was independent of embryonal control of seed coat color. Only 55 genes were found to be differentially expressed between brown seeds and the yellow mutant. Of these 55, 50 were upregulated and five were downregulated in yellow seeds as compared to their brown counterparts. By KEGG classification, 14 metabolic pathways were significantly enriched. Of these, five pathways: phenylpropanoid biosynthesis, cyanoamino acid metabolism, plant hormone signal transduction, metabolic pathways, and biosynthesis of secondary metabolites, were related with seed coat pigmentation. Free amino acid quantification showed that Ala and Phe were present at higher levels in the embryos of yellow seeds as compared to those of brown seeds. This increase was not observed in the seed coat. Moreover, the excess amount of free Ala was exactly twice that of Phe in the embryo. The pigment

  19. Comparative analysis of Brassica napus plasma membrane proteins under phosphorus deficiency using label-free and MaxQuant-based proteomics approaches. (United States)

    Chen, Shuisen; Luo, Ying; Ding, Guangda; Xu, Fangsen


    Phosphorus (P) deficiency is a primary constraint for plant growth in terrestrial ecosystems. To better understand the genotypic differences in the adaptation mechanism of Brassica napus to P deficiency, we purified the plasma membrane (PM) from the roots of two genotypes: P-efficient "Eyou Changjia" and P-inefficient "B104-2". Combining label-free quantitative proteomics with the MaxQuant approach, a total of 71 proteins that significantly changed in abundances were identified in the two genotypes in response to P-free starvation, including 31 in "Eyou Changjia" and 40 in "B104-2". Based on comparative genomics study, 28 proteins were mapped to the confidence intervals of quantitative trait loci (QTLs) for P efficiency related traits. Seven decreased proteins with transporter activity were found to be located in the PM by subcellular localization analyses. These proteins involved in intracellular protein transport and ATP hydrolysis coupled proton transport were mapped to the QTL for P content and dry weight. Compared with "B104-2", more decreased proteins referring to transporter activity were found in "Eyou Changjia", showing that substance exchange was decreased in response to short-term P-free starvation. Together with the finding, more decreased proteins functioning in signal transduction and protein synthesis/degradation suggested that "Eyou Changjia" could slow the progression of growth and save more P in response to short-term P-free starvation. P deficiency seriously limits the production and quality of B. napus. Roots absorb water and nutrients and anchor the plant in the soil. Therefore, to study root PM proteome under P stress would be helpful to understand the adaptation mechanism for P deficiency. However, PM proteome analysis in B. napus has been seldom reported due to the high hydrophobicity and low abundance of PM. Thus, we herein investigated the PM proteome alteration of roots in two B. napus genotypes, with different P deficient tolerances, in

  20. Embryonal Control of Yellow Seed Coat Locus ECY1 Is Related to Alanine and Phenylalanine Metabolism in the Seed Embryo of Brassica napus

    Directory of Open Access Journals (Sweden)

    Fulin Wang


    Full Text Available Seed coat color is determined by the type of pigment deposited in the seed coat cells. It is related to important agronomic traits of seeds such as seed dormancy, longevity, oil content, protein content and fiber content. In Brassica napus, inheritance of seed coat color is related to maternal effects and pollen effects (xenia effects. In this research we isolated a mutation of yellow seeded B. napus controlled by a single Mendelian locus, which is named Embryonal Control of Yellow seed coat 1 (Ecy1. Microscopy of transverse sections of the mature seed show that pigment is deposited only in the outer layer of the seed coat. Using Illumina Hisequation 2000 sequencing technology, a total of 12 GB clean data, 116× coverage of coding sequences of B. napus, was achieved from seeds 26 d after pollination (DAP. It was assembled into 172,238 independent transcripts, and 55,637 unigenes. A total of 139 orthologous genes of Arabidopsis transparent testa (TT genes were mapped in silico to 19 chromosomes of B. napus. Only 49 of the TT orthologous genes are transcribed in seeds. However transcription of all orthologs was independent of embryonal control of seed coat color. Only 55 genes were found to be differentially expressed between brown seeds and the yellow mutant. Of these 55, 50 were upregulated and five were downregulated in yellow seeds as compared to their brown counterparts. By KEGG classification, 14 metabolic pathways were significantly enriched. Of these, five pathways: phenylpropanoid biosynthesis, cyanoamino acid metabolism, plant hormone signal transduction, metabolic pathways, and biosynthesis of secondary metabolites, were related with seed coat pigmentation. Free amino acid quantification showed that Ala and Phe were present at higher levels in the embryos of yellow seeds as compared to those of brown seeds. This increase was not observed in the seed coat. Moreover, the excess amount of free Ala was exactly twice that of Phe in the

  1. Effects of Drought Stress on Canola (Brassica napus L. Genotypes Yield and Yield Components

    Directory of Open Access Journals (Sweden)

    R Khani


    Full Text Available Introduction Canola (Brassica napus L. genotypes with wide adaptability to environmental conditions could play a major role in Iran’s oilseed crop production. Selection of high performing genotypes is very important for developing canola cultivation. Water stress can reduce crop yield by affecting both source and sink for assimilation. Canola yield depends on genotype and environmental conditions and response of genotypes to environmental factors. Canola genotypes response to stress depends on the developmental stage and the events occurring prior to and during flowering stage. Resistance to water stress is divided to avoidance and tolerance. Some species are tolerable against water stress. In a while, other species respond ending life cycle, falling leaves and other reactions into water stress. Therefore, investigation of canola genotypes response to water stress in phenological growth stages can be valuable in order to determine resistant or tolerant genotypes. Materials and Methods In order to study the effect of drought stress on canola genotypes yield and its components, an experiment was conducted in 2013-2014 as a split plot based on randomized complete block design with three replications at the research farm, Agricultural and Natural Resources Research Center of East-Azarbaijan, Tabriz-Iran. Three levels of drought stress were considered as main plot (No-stress, stress at the flowering and pod setting growth stages and 18 canola genotypes including HW113, RS12, Karaj1, KR18, L73, L72, HW101, L146, L210, L183, SW101, L5, L201, HW118, KR4, Karaj2, Karaj3 and KS7 as subplots. Flood irrigation was scheduled at 50% field capacity, 30 and 30% field capacity for no-stress, stress at the flowering and pod setting growth stages, respectively; i.e. soil moisture capacity was maintained at 30% by irrigating to 100% field capacity when available moisture reached 30% in drought stress treatments. An ANOVA was conducted using the PROC-GLM procedure

  2. Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

    Directory of Open Access Journals (Sweden)

    Warwick Suzanne I


    Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

  3. Increased Agrobacterium-mediated transformation and rooting efficiencies in canola (Brassica napus L.) from hypocotyl segment explants (United States)

    Cardoza, V.; Stewart, C. N.


    An efficient protocol for the production of transgenic Brassica napus cv. Westar plants was developed by optimizing two important parameters: preconditioning time and co-cultivation time. Agrobacterium tumefaciens-mediated transformation was performed using hypocotyls as explant tissue. Two variants of a green fluorescent protein (GFP)-encoding gene--mGFP5-ER and eGFP--both under the constitutive expression of the cauliflower mosaic virus 35S promoter, were used for the experiments. Optimizing the preconditioning time to 72 h and co-cultivation time with Agrobacterium to 48 h provided the increase in the transformation efficiency from a baseline of 4% to 25%. With mGFP5-ER, the transformation rate was 17% and with eGFP it was 25%. Transgenic shoots were selected on 200 mg/l kanamycin. Rooting efficiency was 100% on half-strength Murashige and Skoog medium with 10 g/l sucrose and 0.5 mg/l indole butyric acid in the presence of kanamycin.

  4. Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations.

    Directory of Open Access Journals (Sweden)

    Xueli Zhang

    Full Text Available Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP, sequence-specific amplification polymorphism (SSAP and methylation-sensitive amplified polymorphism (MSAP were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8% and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

  5. Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations. (United States)

    Zhang, Xueli; Ge, Xianhong; Shao, Yujiao; Sun, Genlou; Li, Zaiyun


    Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP), sequence-specific amplification polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8%) and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

  6. Physiological responses of Brassica napus to fulvic acid under water stress: Chlorophyll a fluorescence and antioxidant enzyme activity

    Directory of Open Access Journals (Sweden)

    Ramin Lotfi


    Full Text Available The ameliorative effect of fulvic acid (0, 300, and 600 mg L− 1 on photosystem II and antioxidant enzyme activity of the rapeseed (Brassica napus L. plant under water stress (60, 100, and 140 mm evaporation from class A pan was studied using split plots in a randomized complete block design with three replications. Results indicated that application of fulvic acid (FA improved the maximum quantum efficiency of PSII (Fv/Fm and performance index (PI of plants under both well-watered and limited-water conditions. The time span from Fo to Fm and the energy necessary for the closure of all reaction centers was significantly increased, but the size of the plastoquinone pool was reduced with increasing water stress levels. Plants treated with FA had higher peroxidase and catalase activities under all irrigation conditions. Activities of ascorbate peroxidase and superoxide dismutase in plants increased with increasing water stress. Malondialdehyde increased under severe water stress, but application of FA significantly decreased lipid peroxidation. Production of reactive oxygen species (ROS is a common phenomenon in plants under stress. Under this condition, the balance between the production of ROS and the quenching activity of antioxidants is upset, often resulting in oxidative damage. In this study, application of FA significantly increased fluorescence of chlorophyll a, inhibiting ROS production and enhancing antioxidant enzymes activity that destroyed ROS. Thus, ROS in plant cells was reduced under water stress by application of FA and consequently lipid peroxidation was reduced.

  7. Cysteine- and glutathione-mediated uptake of lead and cadmium into Zea mays and Brassica napus roots

    International Nuclear Information System (INIS)

    Vadas, Timothy M.; Ahner, Beth A.


    This study examines a new mechanism for the uptake of Pb and Cd into Brassica napus and Zea mays roots. During hydroponic experiments, the uptake of Pb and Cd was enhanced in the presence of cysteine and glutathione, whereas no or very low uptake was observed in EDTA and penicillamine controls. Uptake rates were also enhanced after pre-exposure to cysteine or glutathione and inhibited in the presence of vanadate, suggesting a biological mechanism of uptake. Increasing concentrations of glutathione in solution resulted in decreasing Pb uptake rates, indicating competition for transport between free-glutathione and Pb-glutathione species. Pb uptake in the presence of increasing cysteine concentrations resulted in decreased uptake initially but linearly increasing uptake at higher concentrations. Experimentation showed concentration dependent Pb uptake rates. We speculate that there are specific transporters for these thiol ligands and describe what barriers remain for application of this novel transport mechanism in chelator-assisted phytoremediation. - Cysteine and glutathione mediate the transport of lead and cadmium into plant roots.

  8. Significant reductions in oil quality and lipid content of oilseed rape (Brassica napus L.) under climate change

    DEFF Research Database (Denmark)

    Namazkar, Shahla; Egsgaard, Helge; Frenck, Georg


    Despite of the potential importance to food and bioenergy purposes, effects from climate change on plant oil quality have hardly been characterized.On a global basis Brassica napus L., rapeseed or oilseed rape, is the second largest source of vegetable oil after soybean and the predominant oil crop...... in Europe. We found significant changes in oil quality and quantity of four cultivars of oilseed rape grown in five future climate scenarios with elevated [CO2], [O-3] temperature and combinations hereof (similar to RCP8.5,(1)). Populations of the cultivars were grown under ambient and climate change...... conditions in a climate-phytotron. The treatments were ambient (360 ppm CO2, 19/12 degrees C (day/night), 20/20 ppb O-3 (day/night)), all factors elevated (650 ppm CO2, 24/17 degrees C, 60/20 ppb O-3), as well as two- and single-factor treatments with the elevated factors.The overall trend was that oil...

  9. A comparison of screening methods to identify waterlogging tolerance in the field in Brassica napus L. during plant ontogeny.

    Directory of Open Access Journals (Sweden)

    Xiling Zou

    Full Text Available Waterlogging tolerance is typically evaluated at a specific development stage, with an implicit assumption that differences in waterlogging tolerance expressed in these systems will result in improved yield performance in fields. It is necessary to examine these criteria in fields. In the present study, three experiments were conducted to screen waterlogging tolerance in 25 rapeseed (Brassica napus L. varieties at different developmental stages, such as seedling establishment stage and seedling stage at controlled environment, and maturity stage in the fields. The assessments for physiological parameters at three growth stages suggest that there were difference of waterlogging tolerance at all the development stages, providing an important basis for further development of breeding more tolerant materials. The results indicated that flash waterlogging restricts plant growth and growth is still restored after removal of the stress. Correlation analysis between waterlogging tolerance coefficient (WTC of yield and other traits revealed that there was consistency in waterlogging tolerance of the genotypes until maturity, and good tolerance at seedling establishment stage and seedling stage can guarantee tolerance in later stages. The waterlogging-tolerant plants could be selected using some specific traits at any stage, and selections would be more effective at the seedling establishment stage. Thus, our study provides a method for screening waterlogging tolerance, which would enable the suitable basis for initial selection of a large number of germplasm or breeding populations for waterlogging tolerance and help for verifying their potential utility in crop-improvement.

  10. Radio-sensitivity analysis and selection of useful mutants of rape (Brassica napus L.) by gamma irradiation

    International Nuclear Information System (INIS)

    Goh, Eun Jeong; Kim, Wook Jin; Kim, Jin Baek; Kim, Dong Sub; Kim, Sang Hoon; Kang, Si Yong


    Rape (Brassica napus L.) plants are one of the major oilseed crops. The main components of rapeseed are oil (35 to 47%) and protein (15 to 32%). For the biodiesel production, the development of a new variety of rape plant with high biomass and/or oleic acid contents is required. In order to determine the optimum dose of gamma-ray irradiation, the rape seeds of cvs. Hanra (Hr), Youngsan (Ys), Tammi (Tm), and Tamra (Tr) were irradiated with a 100 ∼ 4,000 Gy dose range of gamma-rays. Considering the growth factors, the optimum doses were determined to be within the range of 600 ∼ 1,000 Gy for the selection of useful mutant lines. Six-hundred and eighty eight (688) M 2 mutant lines were obtained from 600 ∼ 1,000 Gy gamma-ray-irradiated M 1 plants through selfing. The growth characteristics, leaf shape, early flowering, and flower color were all investigated. The selected mutant numbers of early flowering, leaf shape, and flower color were 34, 52, and 3 from the four cultivars, respectively. These mutant lines will be used for the development of a new variety of rape plant with high biomass and oleic acid contents

  11. Variations in fatty acid composition, glucosinolate profile and some phytochemical contents in selected oil seed rape (Brassica napus L. cultivars

    Directory of Open Access Journals (Sweden)

    Amin Mohamed, Amal


    Full Text Available Rapeseed (Brassica napus L. is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1 ranged from 56.31% to 58.67%, linoleic acid (C18:2 from 10.52% to 13.74%, α-linolenic acid (C18:3 from 8.83% to 10.32% and erucic acid (22:1 from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate c ontents (5.97 μmol/g dw. Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively. Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L.La colza (Brassica napus L. es hoy en día el tercer cultivo más importante de aceites comestibles en el mundo tras el aceite de soja y de palma. En este estudio semillas de cinco cultivos diferentes de colza

  12. QTL meta-analysis of root traits in Brassica napus under contrasting phosphorus supply in two growth systems. (United States)

    Zhang, Ying; Thomas, Catherine L; Xiang, Jinxia; Long, Yan; Wang, Xiaohua; Zou, Jun; Luo, Ziliang; Ding, Guangda; Cai, Hongmei; Graham, Neil S; Hammond, John P; King, Graham J; White, Philip J; Xu, Fangsen; Broadley, Martin R; Shi, Lei; Meng, Jinling


    A high-density SNP-based genetic linkage map was constructed and integrated with a previous map in the Tapidor x Ningyou7 (TNDH) Brassica napus population, giving a new map with a total of 2041 molecular markers and an average marker density which increased from 0.39 to 0.97 (0.82 SNP bin) per cM. Root and shoot traits were screened under low and 'normal' phosphate (Pi) supply using a 'pouch and wick' system, and had been screened previously in an agar based system. The P-efficient parent Ningyou7 had a shorter primary root length (PRL), greater lateral root density (LRD) and a greater shoot biomass than the P-inefficient parent Tapidor under both treatments and growth systems. Quantitative trait loci (QTL) analysis identified a total of 131 QTL, and QTL meta-analysis found four integrated QTL across the growth systems. Integration reduced the confidence interval by ~41%. QTL for root and shoot biomass were co-located on chromosome A3 and for lateral root emergence were co-located on chromosomes A4/C4 and C8/C9. There was a major QTL for LRD on chromosome C9 explaining ~18% of the phenotypic variation. QTL underlying an increased LRD may be a useful breeding target for P uptake efficiency in Brassica.

  13. The bioaccumulation of heavy metals in Brassica napus L. in the area around Turów Power Station, Poland

    Directory of Open Access Journals (Sweden)

    Niedźwiecka Alicja


    Full Text Available Brassica napus L. is a known bioaccumulator of copper, zinc, cadmium, lead, chromium, nickel and arsenic from soils. The metal ions are accumulated in the roots, stems, leaves and seeds of the oilseed rape. The samples of soils and plants were collected in the area around the Turów power station (Bogatynia city, Lower Silesia. The soil samples were collected from the surface layer of 0-25 cm. Roots, stems and pods of the oilseed rape were used in the study. The environmental samples were digested in HNO3, 60%, using the Microwave Digestion System. Metal concentrations have been dermined through the FAAS method. Three heavy metals - zinc, copper and lead – have been analyzed. The content of zinc was higher than the content of copper in all samples (plants and soils. In the roots of the oilseed rape higher concentration of metals compared to other parts of the plant was observed. In the soil samples, there was no correlation between the concentration of pollution and the distance from the power plant. Permissible concentrations of heavy metals relative to the standard according to the Polish Ministry of Environment Regulation from September 1st, 2016, have not been exceeded. The permissible pollution indexes (Wn in soils were exceeded compared to the geochemical background in uncontaminated soils of Poland. The bioaccumulation coefficients of heavy metals indicate lower metal concentrations in plants than in soils

  14. Hyperspectral and thermal imaging of oilseed rape (Brassica napus response to fungal species of the genus Alternaria.

    Directory of Open Access Journals (Sweden)

    Piotr Baranowski

    Full Text Available In this paper, thermal (8-13 µm and hyperspectral imaging in visible and near infrared (VNIR and short wavelength infrared (SWIR ranges were used to elaborate a method of early detection of biotic stresses caused by fungal species belonging to the genus Alternaria that were host (Alternaria alternata, Alternaria brassicae, and Alternaria brassicicola and non-host (Alternaria dauci pathogens to oilseed rape (Brassica napus L.. The measurements of disease severity for chosen dates after inoculation were compared to temperature distributions on infected leaves and to averaged reflectance characteristics. Statistical analysis revealed that leaf temperature distributions on particular days after inoculation and respective spectral characteristics, especially in the SWIR range (1000-2500 nm, significantly differed for the leaves inoculated with A. dauci from the other species of Alternaria as well as from leaves of non-treated plants. The significant differences in leaf temperature of the studied Alternaria species were observed in various stages of infection development. The classification experiments were performed on the hyperspectral data of the leaf surfaces to distinguish days after inoculation and Alternaria species. The second-derivative transformation of the spectral data together with back-propagation neural networks (BNNs appeared to be the best combination for classification of days after inoculation (prediction accuracy 90.5% and Alternaria species (prediction accuracy 80.5%.

  15. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply. (United States)

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei


    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  16. Role of nitric oxide in cadmium-induced stress on growth, photosynthetic components and yield of Brassica napus L. (United States)

    Jhanji, Shalini; Setia, R C; Kaur, Navjyot; Kaur, Parminder; Setia, Neelam


    Experiments were carried out to study the effect of cadmium (Cd) and exogenous nitric oxide (NO) on growth, photosynthetic attributes, yield components and structural features of Brassica napus L. (cv. GSL 1). Cadmium in the growth medium at different levels (1, 2 and 4 Mm) retarded plant growth viz. shoot (27%) and root (51%) length as compared to control. The accumulation of total dry matter and its partitioning to different plant parts was also reduced by 31% due to Cd toxicity. Photosynthetic parameters viz., leaf area plant(-1) (51%), total Chl (27%), Chl a / Chl b ratio (22%) and Hill reaction activity of chloroplasts (42%) were greatly reduced in Cd-treated plants. Cd treatments adversely affected various yield parameters viz., number of branches (23) and siliquae plant(-1) (246), seed number siliqua(-1) (10.3), 1000-seed weight (2.30g) and seed yield plant(-1) (7.09g). Different Cd treatments also suppressed the differentiation of various tissues like vessels in the root with a maximum inhibition caused by 4mM Cd. Exogenous application of nitric oxide (NO) improved the various morpho-physiological and photosynthetic parameters in control as well as Cd-treated plants.

  17. Modification of "1"3"7Cs transfer to rape (Brassica napus L.) phytomass under the influence of soil microorganisms

    International Nuclear Information System (INIS)

    Pareniuk, O.; Shavanova, K.; Laceby, J.P.; Illienko, V.; Tytova, L.; Levchuk, S.; Gudkov, I.; Nanba, K.


    After nuclear accidents, such as those experienced in Chernobyl and Fukushima, microorganisms may help purify contaminated soils by changing the mobility of radionuclides and their availability for plants by altering the physical and chemical properties of the substrate. Here, using model experiments with quartz sand as a substrate we investigate the influence of microorganisms on "1"3"7Cs transfer from substrate to plants. The highest transition of "1"3"7Cs from substrate to plants (50% increase compared to the control) was observed after Brassica napus L. seeds were inoculated by Azotobacter chroococcum. The best results for reducing the accumulation of "1"3"7Cs radionuclides (30% less) were noted after the inoculation by Burkholderia sp.. Furthermore, Bacillus megaterium demonstrated an increased ability to accumulate "1"3"7Cs. This research improves our prediction of the behavior of radionuclides in soil and may contribute towards new, microbiological countermeasures for soil remediation following nuclear accidents. - Highlights: • Representatives of soil bacteria can alter "1"3"7Cs soil-to-plant transfer factor. • This ability does not depend on the localization of bacteria on the root surface. • Selection of bacteria to increase or decrease the "1"3"7Cs transfer factor is possible.

  18. Contrastive response of Brassica napus L. to exogenous salicylic acid, selenium and silicon supplementation under water stress

    Directory of Open Access Journals (Sweden)

    Habibi Ghader


    Full Text Available The present research was designed to determine the effects of exogenous salicylic acid (SA, selenium (Se and silicon (Si on the resistance of canola (Brassica napus L. cv Okapi seedlings to salt stress. Foliar application of SA (0.1 mM in canola plants under drought stress for 25 days exhibited a significantly positive effect on shoot dry mass and raised the levels of total chlorophyll as well as boosting the activity of superoxide dismutase (SOD and catalase (CAT. In addition, soil application of silicon (0.35 g Na2SiO3/kg soil had ameliorative effects on canola root growth under drought. It is concluded that SA and Si enhanced the salt tolerance of canola by protecting the cell membrane against lipid peroxidation. However, the foliar application of Se (10 mg/l had no ameliorative effects on canola growth and antioxidant capacity under drought stress, as could be judged by accumulation of malondialdehyde (MDA.

  19. Cysteine- and glutathione-mediated uptake of lead and cadmium into Zea mays and Brassica napus roots

    Energy Technology Data Exchange (ETDEWEB)

    Vadas, Timothy M., E-mail: tvadas@umbc.ed [Department of Biological and Environmental Engineering, Cornell University, 320 Riley-Robb Hall, Ithaca, NY 14853 (United States); Ahner, Beth A., E-mail: baa7@cornell.ed [Department of Biological and Environmental Engineering, Cornell University, 320 Riley-Robb Hall, Ithaca, NY 14853 (United States)


    This study examines a new mechanism for the uptake of Pb and Cd into Brassica napus and Zea mays roots. During hydroponic experiments, the uptake of Pb and Cd was enhanced in the presence of cysteine and glutathione, whereas no or very low uptake was observed in EDTA and penicillamine controls. Uptake rates were also enhanced after pre-exposure to cysteine or glutathione and inhibited in the presence of vanadate, suggesting a biological mechanism of uptake. Increasing concentrations of glutathione in solution resulted in decreasing Pb uptake rates, indicating competition for transport between free-glutathione and Pb-glutathione species. Pb uptake in the presence of increasing cysteine concentrations resulted in decreased uptake initially but linearly increasing uptake at higher concentrations. Experimentation showed concentration dependent Pb uptake rates. We speculate that there are specific transporters for these thiol ligands and describe what barriers remain for application of this novel transport mechanism in chelator-assisted phytoremediation. - Cysteine and glutathione mediate the transport of lead and cadmium into plant roots.

  20. Brassica napusGLABRA3-1 promotes anthocyanin biosynthesis and trichome formation in true leaves when expressed in Arabidopsis thaliana. (United States)

    Gao, C; Guo, Y; Wang, J; Li, D; Liu, K; Qi, S; Jin, C; Duan, S; Gong, J; Li, Z; Chen, M


    Previous studies have shown that GLABRA3 (AtGL3), a bHLH transcription factor, plays essential roles in anthocyanin biosynthesis and trichome formation in Arabidopsis thaliana. However, there have been no such studies of a homologue, BnGL3, from the closely related crop, Brassica napus. Here, we analysed the BnGL3-1 coding domain sequence from the B. napus cultivar QINYOU Seven, identified conserved protein domains and performed a phylogenetic analysis to elucidate its relationship with homologues form a range of plant species. When expressed in tobacco leaves as a fusion protein with green fluorescent protein, BnGL3-1 accumulated in the nucleus, consistent with its predicted function as a transcription factor. Ectopic expression of the BnGL3-1 gene in the A. thaliana gl3-3 mutant resulted in levels of anthocyanins and numbers of trichomes in true leaves that were higher than in wild-type plants. Moreover, overexpression of BnGL3-1 in gl3-3 compensated for the promotion and repression of genes involved in anthocyanin biosynthesis and trichome formation, respectively, that has been reported in gl3-3 young shoots and expanding true leaves. This study provides new insights into GL3 function in anthocyanin biosynthesis and trichome formation in crucifers, and represents a promising target for genetic manipulation of B. napus. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

  1. Mass spectrometric amino acid sequencing of a mixture of seed storage proteins (napin) from Brassica napus, products of a multigene family.


    Gehrig, P M; Krzyzaniak, A; Barciszewski, J; Biemann, K


    The amino acid sequences of a number of closely related proteins ("napin") isolated from Brassica napus were determined by mass spectrometry without prior separation into individual components. Some of these proteins correspond to those previously deduced (napA, BngNAP1, and gNa), chiefly from DNA sequences. Others were found to differ to a varying extent (BngNAP1', BngNAP1A, BngNAP1B, BngNAP1C, gNa', and gNaA). The short chains of gNa and gNa' and of BngNAP1 and BngNAP1' differ by the replac...

  2. Variations in fatty acid composition, glucosinolate profile and some phytochemical contents in selected oil seed rape (Brassica napus L.) cultivars


    Amin Mohamed, Amal; El-Din Saad El-Beltagi, Hossam


    Rapeseed (Brassica napus L.) is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1) ranged from 56.31% to 58.67%, linoleic acid (C1...

  3. Brassica napus has a key role in the recovery of the health of soils contaminated with metals and diesel by rhizoremediation. (United States)

    Lacalle, Rafael G; Gómez-Sagasti, María T; Artetxe, Unai; Garbisu, Carlos; Becerril, José M


    Contaminated soils are frequently characterized by the simultaneous presence of organic and inorganic contaminants, as well as a poor biological and nutritional status. Rhizoremediation, the combined use of phytoremediation and bioremediation, has been proposed as a Gentle Remediation Option to rehabilitate multi-contaminated soils. Recently, newer techniques, such as the application of metallic nanoparticles, are being deployed in an attempt to improve traditional remediation options. In order to implement a phytomanagement strategy on calcareous alkaline peri-urban soils simultaneously contaminated with several metals and diesel, we evaluated the effectiveness of Brassica napus L., a profitable crop species, assisted with organic amendment and zero-valent iron nanoparticles (nZVI). A two-month phytotron experiment was carried out using two soils, i.e. amended and unamended with organic matter. Soils were artificially contaminated with Zn, Cu and Cd (1500, 500 and 50mgkg -1 , respectively) and diesel (6000mgkg -1 ). After one month of stabilization, soils were treated with nZVI and/or planted with B. napus. The experiment was conducted with 16 treatments resulting from the combination of the following factors: amended/unamended, contaminated/non-contaminated, planted/unplanted and nZVI/no-nZVI. Soil physicochemical characteristics and biological indicators (plant performance and soil microbial properties) were determined at several time points along the experiment. Carbonate content of soils was the crucial factor for metal immobilization and, concomitantly, reduction of metal toxicity. Organic amendment was essential to promote diesel degradation and to improve the health and biomass of B. napus. Soil microorganisms degraded preferably diesel hydrocarbons of biological origin (biodiesel). Plants had a remarkable positive impact on the activity and functional diversity of soil microbial communities. The nZVI were ineffective as soil remediation tools, but did not

  4. Dynamic Metabolic Profiles and Tissue-Specific Source Effects on the Metabolome of Developing Seeds of Brassica napus.

    Directory of Open Access Journals (Sweden)

    Helin Tan

    Full Text Available Canola (Brassica napus is one of several important oil-producing crops, and the physiological processes, enzymes, and genes involved in oil synthesis in canola seeds have been well characterized. However, relatively little is known about the dynamic metabolic changes that occur during oil accumulation in seeds, as well as the mechanistic origins of metabolic changes. To explore the metabolic changes that occur during oil accumulation, we isolated metabolites from both seed and silique wall and identified and characterized them by using gas chromatography coupled with mass spectrometry (GC-MS. The results showed that a total of 443 metabolites were identified from four developmental stages. Dozens of these metabolites were differentially expressed during seed ripening, including 20 known to be involved in seed development. To investigate the contribution of tissue-specific carbon sources to the biosynthesis of these metabolites, we examined the metabolic changes of silique walls and seeds under three treatments: leaf-detachment (Ld, phloem-peeling (Pe, and selective silique darkening (Sd. Our study demonstrated that the oil content was independent of leaf photosynthesis and phloem transport during oil accumulation, but required the metabolic influx from the silique wall. Notably, Sd treatment resulted in seed senescence, which eventually led to a severe reduction of the oil content. Sd treatment also caused a significant accumulation of fatty acids (FA, organic acids and amino acids. Furthermore, an unexpected accumulation of sugar derivatives and organic acid was observed in the Pe- and Sd-treated seeds. Consistent with this, the expression of a subset of genes involved in FA metabolism, sugar and oil storage was significantly altered in Pe and Sd treated seeds. Taken together, our studies suggest the metabolite profiles of canola seeds dynamically varied during the course of oil accumulation, which may provide a new insight into the mechanisms

  5. Effects of abscisic acid and high osmoticum on storage protein gene expression in microspore embryos of Brassica napus

    International Nuclear Information System (INIS)

    Wilen, R.W.; Mandel, R.M.; Pharis, R.P.; Moloney, M.M.; Holbrook, L.A.


    Storage protein gene expression, characteristic of mid- to late embryogenesis, was investigated in microspore embryos of rapeseed (Brassica napus). These embryos, derived from the immature male gametophyte, accumulate little or no detectable napin or cruciferin mRNA when cultured on hormone-free medium containing 13% sucrose. The addition of abscisic acid (ABA) to the medium results in an increase in detectable transcripts encoding both these polypeptides. Storage protein mRNA is induced at 1 micromolar ABA with maximum stimulation occurring between 5 and 50 micromolar. This hormone induction results in a level of storage protein mRNA that is comparable to that observed in zygotic embryos of an equivalent morphological stage. Effects similar to that of ABA are noted when 12.5% sorbitol is added to the microspore embryo medium (osmotic potential = 25.5 bars). Time course experiments, to study the induction of napin and cruciferin gene expression demonstrated that the ABA effect occurred much more rapidly than the high osmoticum effect, although after 48 hours, the levels of napin or cruciferin mRNA detected were similar in both treatments. This difference in the rates of induction is consistent with the idea that the osmotic effect may be mediated by ABA which is synthesized in response to the reduced water potential. Measurements of ABA (by gas chromatography-mass spectrometry using [ 2 H 6 ]ABA as an internal standard) present in microspore embryos during sorbitol treatment and in embryos treated with 10 micromolar ABA were performed to investigate this possibility. Within 2 hours of culture on high osmoticum the level of ABA increased substantially and significantly above control and reached a maximum concentration within 24 hours. This elevated concentration was maintained for 48 hours after culturing and represents a sixfold increase over control embryos

  6. Growth and physiological responses of canola (Brassica napus) to three components of global climate change: temperature, carbon dioxide and drought

    Energy Technology Data Exchange (ETDEWEB)

    Qaderi, M.M.; Kurepin, L.V.; Reid, D.M. [Univ. of Calgary, Dept. of Biological Sciences, Calgary, Alberta (Canada)


    Elevated CO{sub 2} appears to be a significant factor in global warming, which will likely lead to drought conditions in many areas. Few studies have considered the interactive effects of higher CO{sub 2}, temperature and drought on plant growth and physiology. We grew canola (Brassica napus cv. 45H72) plants under lower (22/18 deg. C) and higher (28/24 deg. C) temperature regimes in controlled-environment chambers at ambient (370 {mu}mol mol-1) and elevated (740 {mu}mol mol-1) CO{sub 2} levels. One half of the plants were watered to field capacity and the other half at wilting point. In three separate experiments, we determined growth, various physiological parameters and content of abscisic acid (ABA), indole-3-acetic acid and ethylene. Drought-stressed plants grown under higher temperature at ambient CO{sub 2} had decreased stem height and diameter, leaf number and area, dry matter, leaf area ratio, shoot/root weight ratio, net CO{sub 2} assimilation and chlorophyll fluorescence. However, these plants had increased specific leaf weight, leaf weight ratio and chlorophyll concentration. Elevated CO{sub 2} generally had the opposite effect. and partially reversed the inhibitory effects of higher temperature and drought on leaf dry weight accumulation. This study showed that higher temperature and drought inhibit many processes but elevated CO{sub 2} partially mitigate some adverse effects. As expected, drought stress increased ABA but higher temperature inhibited the ability of plants to produce ABA in response to drought. (au)

  7. QTL for phytosterol and sinapate ester content in Brassica napus L. collocate with the two erucic acid genes (United States)

    Amar, Samija; Ecke, Wolfgang; Becker, Heiko C.


    Improving oil and protein quality for food and feed purposes is an important goal in rapeseed (Brassica napus L.) breeding programs. Rapeseed contains phytosterols, used to enrich food products, and sinapate esters, which are limiting the utilization of rapeseed proteins in the feed industry. Increasing the phytosterol content of oil and lowering sinapate ester content of meal could increase the value of the oilseed rape crop. The objective of the present study was to identify quantitative trait loci (QTL) for phytosterol and sinapate ester content in a winter rapeseed population of 148 doubled haploid lines, previously found to have a large variation for these two traits. This population also segregated for the two erucic acid genes. A close negative correlation was found between erucic acid and phytosterol content (Spearman’s rank correlation, rs = −0.80**). For total phytosterol content, three QTL were detected, explaining 60% of the genetic variance. The two QTL with the strongest additive effects were mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. For sinapate ester content four QTL were detected, explaining 53% of the genetic variance. Again, a close negative correlation was found between erucic acid and sinapate ester content (rs = −0.66**) and the QTL with the strongest additive effects mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. The results suggests, that there is a pleiotropic effect of the two erucic acid genes on phytosterol and sinapate ester content; the effect of the alleles for low erucic acid content is to increase phytosterol and sinapate ester content. Possible reasons for this are discussed based on known biosynthetic pathways. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0734-2) contains supplementary material, which is available to authorized users. PMID:18335203

  8. Exploring genotypic variations for improved oil content and healthy fatty acids composition in rapeseed (Brassica napus L.). (United States)

    Ishaq, Muhammad; Razi, Raziuddin; Khan, Sabaz Ali


    Development of new genotypes having high oil content and desirable levels of fatty acid compositions is a major objective of rapeseed breeding programmes. In the current study combining ability was determined for oil, protein, glucosinolates and various fatty acids content using 8 × 8 full diallel in rapeseed (Brassica napus). Highly significant genotypic differences were observed for oil, protein, glucosinolates, oleic acid, linolenic acid and erucic acid content. Mean squares due to general combining ability (GCA), specific combining ability (SCA) and reciprocal combining ability (RCA) were highly significant (P ≤ 0.01) for biochemical traits. Parental line AUP-17 for high oil content and low glucosinolates, genotype AUP-2 for high protein and oleic acids, and AUP-18 for low lenolenic and erucic acid were best general combiners. Based on desirable SCA effects, F 1 hybrids AUP-17 × AUP-20; AUP-2 × AUP-8; AUP-7 × AUP-14; AUP-2 × AUP-9; AUP-7 × AUP-14 and AUP-2 × AUP-9 were found superior involving at least one best general combiner. F 1 hybrids AUP-17 × AUP-20 (for oil content); AUP-2 × AUP-8 (for protein content); AUP-7 × AUP-14 (for glucosinolates); AUP-2 × AUP-9 (for oleic acid); AUP-7 × AUP-14 (for linolenic acid) and AUP-2 × AUP-9 (for erucic acid) were found superior involving at least one best general combiner. As reciprocal crosses of AUP-14 with AUP-7 and AUP-8 were superior had low × low and low × high GCA effects for glucosinolates and oleic acid, respectively therefore, these could be exploited in future rapeseed breeding programmes to develop new lines with good quality. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  9. Cerium oxide nanoparticles alter the salt stress tolerance of Brassica napus L. by modifying the formation of root apoplastic barriers. (United States)

    Rossi, Lorenzo; Zhang, Weilan; Ma, Xingmao


    Rapidly growing global population adds significant strains on the fresh water resources. Consequently, saline water is increasingly tapped for crop irrigation. Meanwhile, rapid advancement of nanotechnology is introducing more and more engineered nanoparticles into the environment and in agricultural soils. While some negative effects of ENPs on plant health at very high concentrations have been reported, more beneficial effects of ENPs at relatively low concentrations are increasingly noticed, opening doors for potential applications of nanotechnology in agriculture. In particular, we found that cerium oxide nanoparticles (CeO 2 NPs) improved plant photosynthesis in salt stressed plants. Due to the close connections between salt stress tolerance and the root anatomical structures, we postulated that CeO 2 NPs could modify plant root anatomy and improve plant salt stress tolerance. This study aimed at testing the hypothesis with Brassica napus in the presence of CeO 2 NPs (0, 500 mg kg -1 dry sand) and/or NaCl (0, 50 mM) in a growth chamber. Free hand sections of fresh roots were taken every seven days for three weeks and the suberin lamellae development was examined under a fluorescence microscope. The results confirmed the hypothesis that CeO 2 NPs modified the formation of the apoplastic barriers in Brassica roots. In salt stressed plants, CeO 2 NPs shortened the root apoplastic barriers which allowed more Na + transport to shoots and less accumulation of Na + in plant roots. The altered Na + fluxes and transport led to better physiological performance of Brassica and may lead to new applications of nanotechnology in agriculture. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Flowering Without Vernalization in Winter Canola (Brassica napus: use of Virus-Induced Gene Silencing (VIGS to accelerate genetic gain

    Directory of Open Access Journals (Sweden)

    Raúl Álvarez-Venegas


    Full Text Available Ciclos de reproducción cortos y la oportunidad de incrementar la ganancia genética, junto con el estudio de las bases moleculares de la vernalización, son áreas esenciales de investigación dentro de la biología de plantas. Varios métodos se han empleado para lograr el silenciamiento génico en plantas, pero ninguno reportado a la fecha para canola (Brassica napus, y en particular para inducir la floración sin vernalización en líneas de invierno a través del uso de secuencias sentido de DNA en vectores diseñados para el silenciamiento génico inducido por virus (VIGS. La presente investigación provee los métodos para transitoriamente regular a la baja, por medio de VIGS, genes de la vernalización en plantas anuales de invierno, específicamente la familia de genes de Flowering Locus C (FLC en canola de invierno (BnFLC1 a BnFLC5. La regulación a la baja de estos genes permite a las plantas anuales de invierno florecer sin vernalización y, consecuentemente, provee los medios para acelerar la ganancia genética. El sistema de silenciamiento propuesto puede ser utilizado para regular a la baja familias de genes, para determinar la función génica, y para inducir la floración sin la vernalización en líneas de invierno tanto del género Brassica como de muchos cultivos importantes de invierno.

  11. Low level impurities in imported wheat are a likely source of feral transgenic oilseed rape (Brassica napus L.) in Switzerland. (United States)

    Schulze, Juerg; Brodmann, Peter; Oehen, Bernadette; Bagutti, Claudia


    In Switzerland, the cultivation of genetically modified (GM) oilseed rape (Brassica napus L.) and the use of its seeds for food and feed are not permitted. Nevertheless, the GM oilseed rape events GT73, MS8×RF3, MS8 and RF3 have recently been found in the Rhine port of Basel, Switzerland. The sources of GM oilseed rape seeds have been unknown. The main agricultural good being imported at the Rhine port of Basel is wheat and from 2010 to 2013, 19% of all Swiss wheat imports originated from Canada. As over 90% of all oilseed rape grown in Canada is GM, we hypothesised that imports of Canadian wheat may contain low level impurities of GM oilseed rape. Therefore, waste fraction samples gathered during the mechanical cleaning of Canadian wheat from two Swiss grain mills were analysed by separating oilseed rape seeds from waste fraction samples and testing DNA of pooled seeds for the presence of transgenes by real-time PCR. Furthermore, oilseed rape seeds from each grain mill were sown in a germination experiment, and seedling DNA was tested for the presence of transgenes by real-time PCR. GT73, MS8×RF3, MS8 and RF3 oilseed rape was detected among seed samples and seedlings of both grain mills. Based on this data, we projected a mean proportion of 0.005% of oilseed rape in wheat imported from Canada. Besides Canadian wheat, the Rhine port of Basel does not import any other significant amounts of agricultural products from GM oilseed rape producing countries. We therefore conclude that Canadian wheat is the major source of unintended introduction of GM oilseed rape seeds into Switzerland.

  12. Combining Ability Analysis and Genetic-Effects Studies for Some Important Quality Characters in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Aamar Shehzad


    Full Text Available Combining ability analysis has an important position in rapeseed breeding. To evaluate genetic and combining ability effects, three Brassica napus L. testers “Punjab Sarson, Legend and Durre-NIFA” and five lines “Duncled, K-258, ZN-R-1, ZN-R-8, ZN-M-6” were crossed using line × tester design in Randomized Complete Block Design (RCBD with three replications. Mean sum of squares of the analysis of variances (ANOVA for genotypes was highly significant for all of the traits. Most of the lines and testers exhibited significant results of mean sum of squares for combining ability. Line ‘Duncled’ was proved good general combiner for oil (8.8, protein (3.7, erucic acid (33.0, oleic acid (13.0 and glucosinolate (-19.3 over other lines and tester ‘Durree-NIFA’ for protein (6.6, erucic acid (-23.4, and linolenic acid (-5.3 over other testers. Significant specific combining ability effects were also observed. The best hybrid combinations were Legend × ZN-R-1 for oil (9.6, Punjab Sarson × Duncled for minimum erucic acid (-14.0 and linolenic acid contents (-6.0, and Legend × ZN-M-6 for maximum protein (8.2 and minimum glucosinolate contents (-11.1. The maximum oil contents were observed in ‘Legend × ZN-R-1’ (52.4%. The cross ‘Punjab Sarson × Duncled’ expressed maximum values of protein (26.5% and oleic acid (62.5% while minimum for erucic acid (2.3%, linolenic acid (5.4% and glucosinolate contents (19.3µmol/g. This research discloses the significance of non-additive genetic effects for most of the studied traits except oil contents. These studies will also help to improve nutritional values of rapeseed crop by selecting noble crosses.

  13. Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L. despite a cultivation and import ban in Switzerland.

    Directory of Open Access Journals (Sweden)

    Juerg Schulze

    Full Text Available Despite cultivation and seed import bans of genetically modified (GM oilseed rape (Brassica napus L., feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto. The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

  14. Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L.) despite a cultivation and import ban in Switzerland. (United States)

    Schulze, Juerg; Frauenknecht, Tina; Brodmann, Peter; Bagutti, Claudia


    Despite cultivation and seed import bans of genetically modified (GM) oilseed rape (Brassica napus L.), feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto). The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer) at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

  15. Effects of Glucosinolates and Flavonoids on Colonization of the Roots of Brassica napus by Azorhizobium caulinodans ORS571 (United States)

    O'Callaghan, Kenneth J.; Stone, Philip J.; Hu, Xiaojia; Griffiths, D. Wynne; Davey, Michael R.; Cocking, Edward C.


    Plants of Brassica napus were assessed quantitatively for their susceptibility to lateral root crack colonization by Azorhizobium caulinodans ORS571(pXLGD4) (a rhizobial strain carrying the lacZ reporter gene) and for the concentration of glucosinolates in their roots by high-pressure liquid chromatography (HPLC). High- and low-glucosinolate-seed (HGS and LGS) varieties exhibited a relatively low and high percentage of colonized lateral roots, respectively. HPLC showed that roots of HGS plants contained a higher concentration of glucosinolates than roots of LGS plants. One LGS variety showing fewer colonized lateral roots than other LGS varieties contained a higher concentration of glucosinolates than other LGS plants. Inoculated HGS plants treated with the flavonoid naringenin showed significantly more colonization than untreated HGS plants. This increase was not mediated by a naringenin-induced lowering of the glucosinolate content of HGS plant roots, nor did naringenin induce bacterial resistance to glucosinolates or increase the growth of bacteria. The erucic acid content of seed did not appear to influence colonization by azorhizobia. Frequently, leaf assays are used to study glucosinolates and plant defense; this study provides data on glucosinolates and bacterial colonization in roots and describes a bacterial reporter gene assay tailored easily to the study of ecologically important phytochemicals that influence bacterial colonization. These data also form a basis for future assessments of the benefits to oilseed rape plants of interaction with plant growth-promoting bacteria, especially diazotrophic bacteria potentially able to extend the benefits of nitrogen fixation to nonlegumes. PMID:10788398

  16. Response to multi-generational selection under elevated [CO2] in two temperature regimes suggests enhanced carbon assimilation and increased reproductive output in Brassica napus L

    DEFF Research Database (Denmark)

    Frenck, Georg; van der Linden, Leon; Mikkelsen, Teis Nørgaard


    Functional plant traits are likely to adapt under the sustained pressure imposed by environmental changes through natural selection. Employing Brassica napus as a model, a multi-generational study was performed to investigate the potential trajectories of selection at elevated [CO2] in two differ...... ameliorate depressions in plant reproductive fitness caused by higher temperatures in situations where both factors co-occur....

  17. BraLTP1, a lipid transfer protein gene involved in epicuticular wax deposition, cell proliferation and flower development in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available Plant non-specific lipid transfer proteins (nsLTPs constitute large multigene families that possess complex physiological functions, many of which remain unclear. This study isolated and characterized the function of a lipid transfer protein gene, BraLTP1 from Brassica rapa, in the important oilseed crops Brassica napus. BraLTP1 encodes a predicted secretory protein, in the little known VI Class of nsLTP families. Overexpression of BnaLTP1 in B. napus caused abnormal green coloration and reduced wax deposition on leaves and detailed wax analysis revealed 17-80% reduction in various major wax components, which resulted in significant water-loss relative to wild type. BnaLTP1 overexpressing leaves exhibited morphological disfiguration and abaxially curled leaf edges, and leaf cross-sections revealed cell overproliferation that was correlated to increased cytokinin levels (tZ, tZR, iP, and iPR in leaves and high expression of the cytokinin biosynthsis gene IPT3. BnaLTP1-overexpressing plants also displayed morphological disfiguration of flowers, with early-onset and elongated carpel development and outwardly curled stamen. This was consistent with altered expression of a a number of ABC model genes related to flower development. Together, these results suggest that BraLTP1 is a new nsLTP gene involved in wax production or deposition, with additional direct or indirect effects on cell division and flower development.

  18. Plant hormones in defense response of Brassica napus to Sclerotinia sclerotiorum - reassessing the role of salicylic acid in the interaction with a necrotroph. (United States)

    Nováková, Miroslava; Sašek, Vladimír; Dobrev, Petre I; Valentová, Olga; Burketová, Lenka


    According to general model, jasmonic acid (JA) and ethylene (ET) signaling pathways are induced in Arabidopsis after an attack of necrotroph, Sclerotinia sclerotiorum (Lib.) de Bary. However, abscisic acid (ABA) and salicylic acid (SA) also seem to play a role. While signaling events in Arabidopsis have been intensively studied recently, information for the natural host Brassica napus is limited. In this study, multiple plant hormone quantification and expression analysis of marker genes of the signaling pathways was used to gain a complete view of the interaction of B. napus with S. sclerotiorum. Strong response of ET biosynthetic gene ACS2 was observed, accompanied by increases of SA and JA levels that correspond to the elevated expression of marker genes PR1 and LOX3. Interestingly, the level of ABA and the expression of its marker gene RD26 were also elevated. Furthermore, induction of the SA-dependent defense decreased disease symptoms. In addition, SA signaling is suggested as a possible target for manipulation by S. sclerotiorum. A gene for putative chorismate mutase SS1G_14320 was identified that is highly expressed during infection but not in vitro. Our results bring the evidence of SA involvement in the interaction of plant with the necrotroph that conflict with the current model. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  19. Identification of the Relationship between Oil Body Morphology and Oil Content by Microstructure Comparison Combining with QTL Analysis in Brassica napus. (United States)

    Gu, Jianwei; Chao, Hongbo; Wang, Hao; Li, Yonghong; Li, Dianrong; Xiang, Jun; Gan, Jianping; Lu, Guangyuan; Zhang, Xuekun; Long, Yan; Li, Maoteng


    Oil bodies (OBs) are relatively simple but very important organelles comprising a matrix of triacylglycerol (TAG) surrounded by a phospholipid monolayer embedded and covered with unique proteins. The OB structure in Brassica napus with different oil content and the relationship between the oil content and the OB structure needs to be better understood. In this paper, the characteristics of OBs in the embryo of a series of B. napus materials with different oil content ranging from 34% to over 60% were studied. The results indicated that the OB size was significantly positively correlated with the oil content but was significantly negatively correlated with the glucosinolates and the protein content. Many genes associated with TAG synthesis, OB-membrane proteins, and the cell progress regulatory pathway were identified in the confidence interval of co-located QTLs for oil content, fatty acid (FA) compositions, and protein content. Our results suggested that the morphology of OBs might be directly controlled by the genes associated with OB-membrane proteins and indirectly controlled by the genes associated with TAG synthesis and cell progress regulatory pathway.

  20. Structural Properties of Cruciferin and Napin of Brassica napus (Canola Show Distinct Responses to Changes in pH and Temperature

    Directory of Open Access Journals (Sweden)

    Suneru P. Perera


    Full Text Available The two major storage proteins identified in Brassica napus (canola were isolated and studied for their molecular composition, structural characteristics and the responses of structural features to the changes in pH and temperature. Cruciferin, a complex of six monomers, has a predominantly β-sheet-containing secondary structure. This protein showed low pH unstable tertiary structure, and distinctly different solubility behaviour with pH when intact in the seed cellular matrix. Cruciferin structure unfolds at pH 3 even at ambient temperature. Temperature-induced structure unfolding was observed above the maximum denaturation temperature of cruciferin. Napin was soluble in a wider pH range than cruciferin and has α-helices dominating secondary structure. Structural features of napin showed less sensitivity to the changes in medium pH and temperature. The surface hydrophobicity (S0 and intrinsic fluorescence of tryptophan residue appear to be good indicators of cruciferin unfolding, however they were not the best to demonstrate structural changes of napin. These two storage proteins of B. napus have distinct molecular characteristics, therefore properties and functionalities they provide are contrasting rather than complementary.

  1. BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus. (United States)

    Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong


    Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.

  2. of integrated application of farmyard manure, plant growth promoting rhizobacteria and chemical fertilizers on production of canola (Brassica napus L. in saline soil of Qum

    Directory of Open Access Journals (Sweden)

    H. Sabahi


    Full Text Available Canola (Brassica napus L. is one of the most important oil seed crops. In order to evaluate the effects of integrated fertilization (chemical, manure and biofertilizers on canola (B. napus variety Hyola 401 yield and uptake of mineral nutrients in saline soil and water, a field experiment was conducted in randomized complete blocks (RCBD arrangement with eight treatments in three replications in Qum Province, Iran. Treatments were: (1 Control, P%100 (Phosphorus %100, (2 P%75B1 (Phosphorus %75+ Barvar biofertilizer, (3 P%75B2 (Phosphorus %75+ Nitroxin biofertilizer, (4 P%75M (Phosphorus %75+ farmyard manure, (5 P%75B1M (Phosphorus %75+ Barvar + Farmyard manure, (6 P%75B2M (Phosphorus %75+ Nitroxin+ Farmyard manure, (7 P%100B1 (Phosphorus %100 + Barvar and (8 P%125B2 (Phosphorus %125+ Nitroxin. The results showed that the highest yield was obtained from P%75B1M. Difference between integrated fertilization of farmyard manure and other treatments was significant. Farmyard manure increased canola yield which was attributed to increase in availability of mineral nutrients, decreasing effects of salinity and toxic ions. Integrated application of 5 t. ha-1 of farmyard manure and %75 recommended chemical P increased yield and decreased fertilizer consumption. The results revealed that integrated applications of farmyard manure and chemical fertilizer and after that integrated use of bio- and chemical fertilizer are the best strategies to increase nutrient availability and improving canola yield in saline soil.

  3. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus

    Directory of Open Access Journals (Sweden)

    Cuizhu Zhao


    Full Text Available As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 (DGAT1 genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG biosynthesis in plants. While all four BnDGAT1s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content.

  4. Ideotype population exploration: growth, photosynthesis, and yield components at different planting densities in winter oilseed rape (Brassica napus L.). (United States)

    Ma, Ni; Yuan, Jinzhan; Li, Ming; Li, Jun; Zhang, Liyan; Liu, Lixin; Naeem, Muhammad Shahbaz; Zhang, Chunlei


    Rapeseed is one of the most important edible oil crops in the world and the seed yield has lagged behind the increasing demand driven by population growth. Winter oilseed rape (Brassica napus L.) is widely cultivated with relatively low yield in China, so it is necessary to find the strategies to improve the expression of yield potential. Planting density has great effects on seed yield of crops. Hence, field experiments were conducted in Wuhan in the Yangtze River basin with one conventional variety (Zhongshuang 11, ZS11) and one hybrid variety (Huayouza 9, HYZ9) at five planting densities (27.0×10(4), 37.5×10(4), 48.0×10(4), 58.5×10(4), 69.0×10(4) plants ha(-1)) during 2010-2012 to investigate the yield components. The physiological traits for high-yield and normal-yield populations were measured during 2011-2013. Our results indicated that planting densities of 58.5×10(4) plants ha(-1) in ZS11 and 48.0×10(4) plants ha(-1) in HYZ9 have significantly higher yield compared with the density of 27.0×10(4) plants ha(-1) for both varieties. The ideal silique numbers for ZS11 and HYZ9 were ∼0.9×10(4) (n m(-2)) and ∼1×10(4) (n m(-2)), respectively, and ideal primary branches for ZS11 and HYZ9 were ∼250 (n m(-2)) and ∼300 (n m(-2)), respectively. The highest leaf area index (LAI) and silique wall area index (SAI) was ∼5.0 and 7.0, respectively. Moreover, higher leaf net photosynthetic rate (Pn) and water use efficiency (WUE) were observed in the high-yield populations. A significantly higher level of silique wall photosynthesis and rapid dry matter accumulation were supposed to result in the maximum seed yield. Our results suggest that increasing the planting density within certain range is a feasible approach for higher seed yield in winter rapeseed in China.

  5. Transpiration flow controls Zn transport in Brassica napus and Lolium multiflorum under toxic levels as evidenced from isotopic fractionation (United States)

    Couder, Eléonore; Mattielli, Nadine; Drouet, Thomas; Smolders, Erik; Delvaux, Bruno; Iserentant, Anne; Meeus, Coralie; Maerschalk, Claude; Opfergelt, Sophie; Houben, David


    Stable zinc (Zn) isotope fractionation between soil and plant has been used to suggest the mechanisms affecting Zn uptake under toxic conditions. Here, changes in Zn isotope composition in soil, soil solution, root and shoot were studied for ryegrass (Lolium multiflorum L.) and rape (Brassica napus L.) grown on three distinct metal-contaminated soils collected near Zn smelters (total Zn 0.7-7.5%, pH 4.8-7.3). The Zn concentrations in plants reflected a toxic Zn supply. The Zn isotopic fingerprint of total soil Zn varied from -0.05‰ to +0.26 ± 0.02‰ (δ66Zn values relative to the JMC 3-0749L standard) among soils, but the soil solution Zn was depleted in 66Zn, with a constant Zn isotope fractionation of about -0.1‰ δ66Zn unit compared to the bulk soil. Roots were enriched with 66Zn relative to soil solution (δ66Znroot - δ66Znsoil solution = Δ66Znroot-soil solution = +0.05 to +0.2 ‰) and shoots were strongly depleted in 66Zn relative to roots (Δ66Znshoot-root = -0.40 to -0.04 ‰). The overall δ66Zn values in shoots reflected that of the bulk soil, but were lowered by 0.1-0.3 ‰ units as compared to the latter. The isotope fractionation between root and shoot exhibited a markedly strong negative correlation (R2 = 0.83) with transpiration per unit of plant weight. Thus, the enrichment with light Zn isotopes in shoot progressed with increasing water flux per unit plant biomass dry weight, showing a passive mode of Zn transport by transpiration. Besides, the light isotope enrichment in shoots compared to roots was larger for rape than for rye grass, which may be related to the higher Zn retention in rape roots. This in turn may be related to the higher cation exchange capacity of rape roots. Our finding can be of use to trace the biogeochemical cycles of Zn and evidence the tolerance strategies developed by plants in Zn-excess conditions.

  6. Growth of Verticillium longisporum in Xylem Sap of Brassica napus is Independent from Cultivar Resistance but Promoted by Plant Aging. (United States)

    Lopisso, Daniel Teshome; Knüfer, Jessica; Koopmann, Birger; von Tiedemann, Andreas


    late maturity stages of plants in the field. While falsifying the presence of antifungal activity in xylem sap of resistant cultivars, this study strengthens previous findings that indicated a significant role of physical cell wall bound resistance factors involved in quantitative, cultivar-related resistance of B. napus to V. longisporum.


    Directory of Open Access Journals (Sweden)

    Raldugina G.N.


    Full Text Available This work aims to study the response of the transgenic spring rape plants (Brassica napus L. var. ‘Westar’ with the rice transfactor-encoding gene Osmyb4 to treatment with salts of heavy metals (HM CuSO4 or ZnSO4 and accumulation in the leaves of biomass, metals, photosynthetic pigments, lipid peroxidation, and antioxidant compounds: total phenols, anthocyanins, and antioxidant enzyme activity superoxide dismutase (SOD and guaiacol peroxidase (POX were determined. Vegetatively propagated transgenic plants and wild-type plants were grown on Hoagland-Snyder medium at 24°C, then at the 5-6th leaves-stage, CuSO4 (in concentration 25-150 mM or ZnSO4 (500 - 5000 mM were added to the growth medium, and plants were exposed to the salts for 15 days. Under the action of small concentrations of salts, the results obtained for the transgenic and untransformed plants did not differ, but at high concentrations strong differences between transgenic and untransformed plants were observed. In transgenic plants, accumulation of biomass was greater. Carotene and xanthophyll were destroyed in transgenic plants less than in the untransformed plants. They have accumulated in their leaves more metal, especially Zn, reaching almost to the accumulation of 7 mg per g of dry biomass, bringing these plants to the hyperaccumulation of Zn. In the tissues of transgenic plants exposed to high concentrations of salts, the content of total phenols, anthocyanins, and low molecular weight compounds, that are responsible for protection against ROS, increased significantly. All these results indicate a greater stability of the transgenic plants to the action of heavy metals, as evidenced also by less activity of lipid peroxidases in their tissue: at high salt concentrations, malondialdehyde (MDA accumulated significantly less in transgenic plants than in non-transformed plant tissues. The greater stability of transgenic plants to stressful effect of HM is also evidenced by the

  8. Impact of municipal waste water of Quetta city on biomass, physiology and yield of canola (brassica napus l.)

    International Nuclear Information System (INIS)

    Kakar, S.R.; Tareen, R.B.; Kayani, S.A.; Tariq, M.


    The present study was carried out in order to investigate the impact of municipal wastewater effluents of Quetta city on the biomass, physiology, and productivity of two canola (Brassica napus L.) cultivars viz., Oscar and Rainbow. Plants were grown in pots from seed to maturity during 2005-2006 growth season. Different concentrations of effluents (T1: 20% ,T2: 40%, T3: 60% T4: 80; T5: 100%) were supplied to plants as a soil drench compared to control plants (T0) receiving normal tap water. The wastewater effluents were highly alkaline in nature along with very high Electrical Conductivity, Biological Oxygen Demand; Chemical Oxygen Demand; Sodium Adsorption Ratio, Total Suspended Solids and minerals concentrations have found well above threshold limits set for the usage of municipal wastewater for irrigation purposes. Growth performance of both canola cultivars showed statistically significant effects on some physiological attributes. All treated plants showed reductions in growth and yield parameters, but T5 treated plants were most affected compared to control. There were significantly higher reductions in stomatal conductance (49% in Oscar; 53% in Rainbow), transpiration rate (62% Oscar; 67% in Rainbow), and photosynthetic rate (62% in Oscar; 69% in Rainbow) of T5 treatment plants compared with control. Both pigments of chlorophyll (a and b) responded efficiently to the applied stress of wastewater effluents showing reductions in chlorophyll a and b by 68-82% in cv. Oscar and 74-86% in cv. Rainbow. Similarly, fresh and dry biomass also showed reductions in different effluents treated plants (T1 to T5) ranging from 2-78% in both the cultivars of canola. Drastic reductions were recorded in the number of siliqua per plant (70-72%), seeds per plant (84-85%), seed weight per plant (87-90), and in the harvest index (72-74%) in cultivars Oscar and Rainbow, respectively than that of control. The overall result of the municipal wastewater impacts on canola cultivars are

  9. Functional characterization of a heterologously expressed Brassica napus WRKY41-1 transcription factor in regulating anthocyanin biosynthesis in Arabidopsis thaliana. (United States)

    Duan, Shaowei; Wang, Jianjun; Gao, Chenhao; Jin, Changyu; Li, Dong; Peng, Danshuai; Du, Guomei; Li, Yiqian; Chen, Mingxun


    Previous studies have shown that a plant WRKY transcription factor, WRKY41, has multiple functions, and regulates seed dormancy, hormone signaling pathways, and both biotic and abiotic stress responses. However, it is not known about the roles of AtWRKY41 from the model plant, Arabidopsis thaliana, and its ortholog, BnWRKY41, from the closely related and important oil-producing crop, Brassica napus, in the regulation of anthocyanin biosynthesis. Here, we found that the wrky41 mutation in A. thaliana resulted in a significant increase in anthocyanin levels in rosette leaves, indicating that AtWRKY41 acts as repressor of anthocyanin biosynthesis. RNA sequencing and quantitative real-time PCR analysis revealed increased expression of three regulatory genes AtMYB75, AtMYB111, and AtMYBD, and two structural genes, AT1G68440 and AtGSTF12, all of which contribute to anthocyanin biosynthesis, in the sixth rosette leaves of wrky41-2 plants at 20 days after germination. We cloned the full length complementary DNA of BnWRKY41-1 from the C2 subgenome of the B. napus genotype Westar and observed that, when overexpressed in tobacco leaves as a fusion protein with green fluorescent protein, BnWRKY41-1 is localized to the nucleus. We further showed that overexpression of BnWRKY41-1 in the A. thaliana wrky41-2 mutant rescued the higher anthocyanin content phenotype in rosette leaves of the mutant. Moreover, the elevated expression levels in wrky41-2 rosette leaves of several important regulatory and structural genes regulating anthocyanin biosynthesis were not observed in the BnWRKY41-1 overexpressing lines. These results reveal that BnWRKY41-1 has a similar role with AtWRKY41 in regulating anthocyanin biosynthesis when overexpressed in A. thaliana. This gene represents a promising target for genetically manipulating B. napus to increase the amounts of anthocyanins in rosette leaves. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. High Density Linkage Map Construction and QTL Detection for Three Silique-Related Traits in Orychophragmus violaceus Derived Brassica napus Population

    Directory of Open Access Journals (Sweden)

    Yi Yang


    Full Text Available Seeds per silique (SS, seed weight (SW, and silique length (SL are important determinant traits of seed yield potential in rapeseed (Brassica napus L., and are controlled by naturally occurring quantitative trait loci (QTLs. Mapping QTLs to narrow chromosomal regions provides an effective means of characterizing the genetic basis of these complex traits. Orychophragmus violaceus is a crucifer with long siliques, many SS, and heavy seeds. A novel B. napus introgression line with many SS was previously selected from multiple crosses (B. rapa ssp. chinesis × O. violaceus × B. napus. In present study, a doubled haploid (DH population with 167 lines was established from a cross between the introgression line and a line with far fewer SS, in order to detect QTLs for silique-related traits. By screening with a Brassica 60K single nucleotide polymorphism (SNP array, a high-density linkage map consisting of 1,153 bins and spanning a cumulative length of 2,209.1 cM was constructed, using 12,602 high-quality polymorphic SNPs in the DH population. The average recombination bin densities of the A and C subgenomes were 1.7 and 2.4 cM, respectively. 45 QTLs were identified for the three traits in all, which explained 4.0–34.4% of the total phenotypic variation; 20 of them were integrated into three unique QTLs by meta-analysis. These unique QTLs revealed a significant positive correlation between SS and SL and a significant negative correlation between SW and SS, and were mapped onto the linkage groups A05, C08, and C09. A trait-by-trait meta-analysis revealed eight, four, and seven consensus QTLs for SS, SW, and SL, respectively, and five major QTLs (cqSS.A09b, cqSS.C09, cqSW.A05, cqSW.C09, and cqSL.C09 were identified. Five, three, and four QTLs for SS, SW, and SL, respectively, might be novel QTLs because of the existence of alien genetic loci for these traits in the alien introgression. Thirty-eight candidate genes underlying nine QTLs for silique

  11. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Hou Jinna


    Full Text Available Abstract Background Rapeseed (Brassica napus L. has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL for flowering time, qFT10-4,in a doubled haploid (DH mapping population of rapeseed derived from a cross between Tapidor (winter-type and Ningyou7 (semi-winter and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50. This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i BnFLC.A10 is the gene underlying qFT10

  12. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.). (United States)

    Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling


    Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in

  13. Response to multi-generational selection under elevated [CO2] in two temperature regimes suggests enhanced carbon assimilation and increased reproductive output in Brassica napus L

    DEFF Research Database (Denmark)

    Frenck, Georg; van der Linden, Leon; Mikkelsen, Teis Nørgaard


    different temperature regimes. To reveal phenotypic divergence at the manipulated [CO2] and temperature conditions, a full-factorial natural selection regime was established in a phytotron environment over the range of four generations. It is demonstrated that a directional response to selection at elevated......Functional plant traits are likely to adapt under the sustained pressure imposed by environmental changes through natural selection. Employing Brassica napus as a model, a multi-generational study was performed to investigate the potential trajectories of selection at elevated [CO2] in two...... subjected to increased levels of CO2 over the generational range investigated. The results of this study suggest that phenotypic divergence of plants selected under elevated atmospheric CO2 concentration may drive the future functions of plant productivity to be different from projections that do...

  14. Irradiation effect on the seed vigor, SOD activity and MDA content in germinating seeds of yellow-seeded and black-seeded rape seed (Brassica napus L.)

    International Nuclear Information System (INIS)

    Han Jixiang; Hu Danhong; Liu Houli


    Seeds of a set of near-isogenic lines (Brassica napus L.) with different seed coat color from yellow to black were irradiated by 60 Co γ-rays of 150 krad. Seed vigor, superoxide dismutase (SOD) and malondialdehyde (MDA) in germinating seeds were analysed. In these characters, no significant difference between yellow-seeded lines (YLs) and black-seeded lines (BLs) showed before irradiation. But after irradiation, SOD activity in YLs was lower than that in BLs. While MDA content in YLs was obviously higher that that in DLs. As a result of irradiation, seed vigor of YLs was lower than that in BLs. these results indicated that the irradiation resistance of rape seed was related to the level of SOD as well as protective structure or substances in seed coat and that the radiosensitivity of YLs was higher than that of DLs

  15. Diversity and Genome Analysis of Australian and Global Oilseed Brassica napus L. Germplasm Using Transcriptomics and Whole Genome Re-sequencing

    Directory of Open Access Journals (Sweden)

    M. Michelle Malmberg


    Full Text Available Intensive breeding of Brassica napus has resulted in relatively low diversity, such that B. napus would benefit from germplasm improvement schemes that sustain diversity. As such, samples representative of global germplasm pools need to be assessed for existing population structure, diversity and linkage disequilibrium (LD. Complexity reduction genotyping-by-sequencing (GBS methods, including GBS-transcriptomics (GBS-t, enable cost-effective screening of a large number of samples, while whole genome re-sequencing (WGR delivers the ability to generate large numbers of unbiased genomic single nucleotide polymorphisms (SNPs, and identify structural variants (SVs. Furthermore, the development of genomic tools based on whole genomes representative of global oilseed diversity and orientated by the reference genome has substantial industry relevance and will be highly beneficial for canola breeding. As recent studies have focused on European and Chinese varieties, a global diversity panel as well as a substantial number of Australian spring types were included in this study. Focusing on industry relevance, 633 varieties were initially genotyped using GBS-t to examine population structure using 61,037 SNPs. Subsequently, 149 samples representative of global diversity were selected for WGR and both data sets used for a side-by-side evaluation of diversity and LD. The WGR data was further used to develop genomic resources consisting of a list of 4,029,750 high-confidence SNPs annotated using SnpEff, and SVs in the form of 10,976 deletions and 2,556 insertions. These resources form the basis of a reliable and repeatable system allowing greater integration between canola genomics studies, with a strong focus on breeding germplasm and industry applicability.

  16. Major Co-localized QTL for Plant Height, Branch Initiation Height, Stem Diameter, and Flowering Time in an Alien Introgression Derived Brassica napus DH Population

    Directory of Open Access Journals (Sweden)

    Yusen Shen


    Full Text Available Plant height (PH, branch initiation height (BIH, and stem diameter (SD are three stem-related traits that play crucial roles in plant architecture and lodging resistance. Herein, we show one doubled haploid (DH population obtained from a cross between Y689 (one Capsella bursa-pastoris derived Brassica napus intertribal introgression and Westar (B. napus cultivar that these traits were significantly positively correlated with one another and with flowering time (FT. Based on a high-density SNP map, a total of 102 additive quantitative trait loci (QTL were identified across six environments. Seventy-two consensus QTL and 49 unique QTL were identified using a two-round strategy of QTL meta-analysis. Notably, a total of 19 major QTL, including 11 novel ones, were detected for these traits, which comprised two QTL clusters on chromosomes A02 and A07. Conditional QTL mapping was performed to preliminarily evaluate the genetic basis (pleiotropy or tight linkage of the co-localized QTL. In addition, QTL by environment interactions (QEI mapping was performed to verify the additive QTL and estimate the QEI effect. In the genomic regions of all major QTL, orthologs of the genes involved in phytohormone biosynthesis, phytohormone signaling, flower development, and cell differentiation in Arabidopsis were proposed as candidate genes. Of these, BnaA02g02560, an ortholog of Arabidopsis GASA4, was suggested as a candidate gene for PH, SD, and FT; and BnaA02g08490, an ortholog of Arabidopsis GNL, was associated with PH, BIH and FT. These results provide useful information for further genetic studies on stem-related traits and plant growth adaptation.

  17. Variations in fatty acid composition, glucosinolate profile and some phyto chemical contents in selected oil seed rape (Brassica napus L.) cultivars

    Energy Technology Data Exchange (ETDEWEB)

    El-Din Saad El-Beltag, H.; Mohamed, A. A.


    Rapeseed (Brassica napus L.) is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1) ranged from 56.31% to 58.67%, linoleic acid (C18:2) from 10.52% to 13.74%, {alpha}-linolenic acid (C18:3) from 8.83% to 10.32% and erucic acid (22:1) from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate contents (5.97 {mu}mol/g dw). Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively). Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L. (Author)

  18. Generation and characterization of tribenuron-methyl herbicide-resistant rapeseed (Brasscia napus) for hybrid seed production using chemically induced male sterility. (United States)

    Li, Haitao; Li, Juanjuan; Zhao, Bo; Wang, Jing; Yi, Licong; Liu, Chao; Wu, Jiangsheng; King, Graham J; Liu, Kede


    Identification and molecular analysis of four tribenuron-methyl resistant mutants in Brassica napus , which would be very useful in hybrid production using a Chemically induced male sterility system. Chemically induced male sterility (CIMS) systems dependent on chemical hybridization agents (CHAs) like tribenuron-methyl (TBM) represent an important approach for practical utilization of heterosis in rapeseed. However, when spraying the female parents with TBM to induce male sterility the male parents must be protected with a shield to avoid injury to the stamens, which would otherwise complicate the seed production protocol and increase the cost of hybrid seed production. Here we report the first proposed application of a herbicide-resistant cultivar in hybrid production, using a CIMS system based on identifying four TBM-resistant mutants in Brassica napus. Genetic analysis indicated that the TBM resistance was controlled by a single dominant nuclear gene. An in vitro enzyme activity assay for acetohydroxyacid synthase (AHAS) suggested that the herbicide resistance is caused by a gain-of-function mutation in a copy of AHAS genes. Comparative sequencing of the mutants and wild type BnaA.AHAS.a coding sequences identified a C-to-T transition at either position 535 or 536 from the translation start site, which resulted in a substitution of proline with serine or leucine at position 197 according to the Arabidopsis thaliana protein sequence. An allele-specific dCAPS marker developed from the C536T variation co-segregated with the herbicide resistance. Transgenic A. thaliana plants expressing BnaA.ahas3.a conferred herbicide resistance, which confirmed that the P197 substitution in BnaA.AHAS.a was responsible for the herbicide resistance. Moreover, the TBM-resistant lines maintain normal male fertility under TBM treatment and can be of practical value in hybrid seed production using CIMS.

  19. Overexpression of phyA and appA Genes Improves Soil Organic Phosphorus Utilisation and Seed Phytase Activity in Brassica napus (United States)

    Wang, Yi; Ye, Xiangsheng; Ding, Guangda; Xu, Fangsen


    Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P) in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT) controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg–1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals. PMID:23573285

  20. Overexpression of phyA and appA genes improves soil organic phosphorus utilisation and seed phytase activity in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Yi Wang

    Full Text Available Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg(-1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals.

  1. Male fitness of oilseed rape (¤Brassica napus¤), weedy ¤B-rapa¤ and their F1 hybrids when pollinating ¤B-rapa¤ seeds

    DEFF Research Database (Denmark)

    Pertl, M.; Hauser, T.P.; Damgaard, C.


    The likelihood that two species hybridise and backcross may depend strongly on environmental conditions, and possibly on competitive interactions between parents and hybrids. We studied the paternity of seeds produced by weedy Brassica rapa growing in mixtures with oilseed rape (B. napus) and the...... is strongly influenced by their local frequencies, and that male fitness of F(1)hybrids, when pollinating B. rapa seeds, is low even when their female fitness (seed set) is high.......The likelihood that two species hybridise and backcross may depend strongly on environmental conditions, and possibly on competitive interactions between parents and hybrids. We studied the paternity of seeds produced by weedy Brassica rapa growing in mixtures with oilseed rape (B. napus......) and their F(1) hybrids at different frequencies and densities. Paternity was determined by the presence of a transgene, morphology, and AFLP markers. In addition, observations of flower and pollen production, and published data on pollen fertilisation success, zygote survival, and seed germination, allowed us...

  2. Identification of QTLs for resistance to sclerotinia stem rot and BnaC.IGMT5.a as a candidate gene of the major resistant QTL SRC6 in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Jian Wu

    Full Text Available Stem rot caused by Sclerotinia sclerotiorum in many important dicotyledonous crops, including oilseed rape (Brassica napus, is one of the most devastating fungal diseases and imposes huge yield loss each year worldwide. Currently, breeding for Sclerotinia resistance in B. napus, as in other crops, can only rely on germplasms with quantitative resistance genes. Thus, the identification of quantitative trait locus (QTL for S. sclerotiorum resistance/tolerance in this crop holds immediate promise for the genetic improvement of the disease resistance. In this study, ten QTLs for stem resistance (SR at the mature plant stage and three QTLs for leaf resistance (LR at the seedling stage in multiple environments were mapped on nine linkage groups (LGs of a whole genome map for B. napus constructed with SSR markers. Two major QTLs, LRA9 on LG A9 and SRC6 on LG C6, were repeatedly detected across all environments and explained 8.54-15.86% and 29.01%-32.61% of the phenotypic variations, respectively. Genotypes containing resistant SRC6 or LRA9 allele showed a significant reduction in disease lesion after pathogen infection. Comparative mapping with Arabidopsis and data mining from previous gene profiling experiments identified that the Arabidopsis homologous gene of IGMT5 (At1g76790 was related to the SRC6 locus. Four copies of the IGMT5 gene in B. napus were isolated through homologous cloning, among which, only BnaC.IGMT5.a showed a polymorphism between parental lines and can be associated with the SRC6. Furthermore, two parental lines exhibited a differential expression pattern of the BnaC.IGMT5.a gene in responding to pathogen inoculation. Thus, our data suggested that BnaC.IGMT5.a was very likely a candidate gene of this major resistance QTL.

  3. (Brassica napus L.) cultivars

    African Journals Online (AJOL)



    Mar 7, 2011 ... African Journal of Biotechnology Vol. 10(10), pp. 1827-1832, 7 ... and even death (Zhu, 2001). ... as a nitrogen fertilizer equivalent to 150 kg N ha-1 and triple- super- ... negatively the plant fresh weight, but the effect ratio.

  4. Induced accumulation of Au, Ag and Cu in Brassica napus grown in a mine tailings with the inoculation of Aspergillus niger and the application of two chemical compounds. (United States)

    González-Valdez, Eduardo; Alarcón, Alejandro; Ferrera-Cerrato, Ronald; Vega-Carrillo, Héctor René; Maldonado-Vega, María; Salas-Luévano, Miguel Ángel; Argumedo-Delira, Rosalba


    This study evaluated the ability of Brassica napus for extracting gold (Au), silver (Ag) and copper (Cu) from a mine tailings, with the inoculation of two Aspergillus niger strains, and the application of ammonium thiocyanate (NH 4 SCN) or ammonium thiosulfate [(NH 4 ) 2 S 2 O 3 ]. After seven weeks of growth inoculated or non-inoculated plants were applied with 1 or 2 g kg -1 of either NH 4 SCN or (NH 4 ) 2 S 2 O 3 , respectively. Eight days after the application of the chemical compounds, plants were harvested for determining the total dry biomass, and the content of Au, Ag, and Cu in plant organs. Application of (NH 4 ) 2 S 2 O 3 or NH 4 SCN resulted in enhanced Au-accumulation in stems (447% and 507%, respectively), while either (NH 4 ) 2 S 2 O 3 +Aspergillus, or NH 4 SCN increased the Au-accumulation in roots (198.5% and 404%, respectively) when compared to the control. Treatments with (NH 4 ) 2 S 2 O 3 or (NH 4 ) 2 S 2 O 3 +Aspergillus significantly increased (P ≤ 0.001) the accumulation of Ag in leaves (677% and 1376%, respectively), while NH 4 SCN + Aspergillus, and (NH 4 ) 2 S 2 O 3 enhanced the accumulation in stems (7153% and 6717.5%). The Ag-accumulation in roots was stimulated by NH 4 SCN+ Aspergillus, and (NH 4 ) 2 S 2 O 3 + Aspergillus (132.5% and 178%, respectively), when compared to the control. The combination of NH 4 SCN+Aspergillus significantly enhanced the Cu-accumulation in leaves (228%); whereas NH 4 SCN+ Aspergillus, or (NH 4 ) 2 S 2 O 3 + Aspergillus resulted in greater accumulation of Cu in stems (1233.5% and 1580%, respectively) than the control. Results suggest that either NH 4 SCN or (NH 4 ) 2 S 2 O 3 (with or without Aspergillus) improved the accumulation of Au and Ag by B. napus. Accumulation of Au and Ag in plant organs overpassed the hyperaccumulation criterion (> 1 mg kg -1 of plant biomass); whereas Cu-accumulation in stems and roots also overpassed such criterion (> 1000 mg kg -1 ) by applying

  5. Comparative transcriptome analysis reveals carbohydrate and lipid metabolism blocks in Brassica napus L. male sterility induced by the chemical hybridization agent monosulfuron ester sodium. (United States)

    Li, Zhanjie; Cheng, Yufeng; Cui, Jianmin; Zhang, Peipei; Zhao, Huixian; Hu, Shengwu


    Chemical hybridization agents (CHAs) are often used to induce male sterility for the production of hybrid seeds. We previously discovered that monosulfuron ester sodium (MES), an acetolactate synthase (ALS) inhibitor of the herbicide sulfonylurea family, can induce rapeseed (Brassica napus L.) male sterility at approximately 1% concentration required for its herbicidal activity. To find some clues to the mechanism of MES inducing male sterility, the ultrastructural cytology observations, comparative transcriptome analysis, and physiological analysis on carbohydrate content were carried out in leaves and anthers at different developmental stages between the MES-treated and mock-treated rapeseed plants. Cytological analysis revealed that the plastid ultrastructure was abnormal in pollen mother cells and tapetal cells in male sterility anthers induced by MES treatment, with less material accumulation in it. However, starch granules were observed in chloroplastids of the epidermis cells in male sterility anthers. Comparative transcriptome analysis identified 1501 differentially expressed transcripts (DETs) in leaves and anthers at different developmental stages, most of these DETs being localized in plastid and mitochondrion. Transcripts involved in metabolism, especially in carbohydrate and lipid metabolism, and cellular transport were differentially expressed. Pathway visualization showed that the tightly regulated gene network for metabolism was reprogrammed to respond to MES treatment. The results of cytological observation and transcriptome analysis in the MES-treated rapeseed plants were mirrored by carbohydrate content analysis. MES treatment led to decrease in soluble sugars content in leaves and early stage buds, but increase in soluble sugars content and decrease in starch content in middle stage buds. Our integrative results suggested that carbohydrate and lipid metabolism were influenced by CHA-MES treatment during rapeseed anther development, which might

  6. Effect of Sugarcane Filter Muds, Chemical and Biological Fertilizers on Absorption of Some Macro- and Micro-Elementsand Heavy Metals by Canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    H. Monjezi


    Full Text Available In order to evaluate the effect of sugarcane (Sacharum officinarum L. filter muds and chemical and biological fertilizers application on macro- and micronutrient elements and some heavy metals (Pb and Cd absorption by canola (Brassica napus L. grains, a factorial experiment was conducted in 2012 in the Experimental Farm of Ramin (Mollasani Agriculture and Natural Resources University of Khouzestan, Iran. A complete blocks design was used for the experiment with three replications. Different integrated treatments of filter muds and chemical fertilizers (A1: 100% filter muds, A2: 75% filter muds + 25% chemical fertilizers, A3: 50% filter muds + 50% chemical fertilizers, A4: 25% filter muds + 75% chemical fertilizers and A5: 100% chemical fertilizers along with two levels of biological fertilizers application (with and without biological fertilizers were investigated. The biological fertilizers investigated in this study were Nitroxin and Barvar2. Application of filter muds led to decreases in nitrogen, phosphorus and Cd of canola seeds. On the other hand, increase of filter muds application led to increase of Zn, Cu, Fe and Pb content in canola seeds. Biological and chemical fertilizers application resulted in increases of nitrogen, phosphorus and cadmium contents in canola seeds. Biofertilizers also increased phosphorus and cadmium contents in canola seeds.

  7. Integrative RNA- and miRNA-Profile Analysis Reveals a Likely Role of BR and Auxin Signaling in Branch Angle Regulation of B. napus

    Directory of Open Access Journals (Sweden)

    Hongtao Cheng


    Full Text Available Oilseed rape (Brassica napus L. is the second largest oilseed crop worldwide and one of the most important oil crops in China. As a component of plant architecture, branch angle plays an important role in yield performance, especially under high-density planting conditions. However, the mechanisms underlying the regulation of branch angle are still largely not understood. Two oilseed rape lines with significantly different branch angles were used to conduct RNA- and miRNA-profiling at two developmental stages, identifying differential expression of a large number of genes involved in auxin- and brassinosteroid (BR-related pathways. Many auxin response genes, including AUX1, IAA, GH3, and ARF, were enriched in the compact line. However, a number of genes involved in BR signaling transduction and biosynthesis were down-regulated. Differentially expressed miRNAs included those involved in auxin signaling transduction. Expression patterns of most target genes were fine-tuned by related miRNAs, such as miR156, miR172, and miR319. Some miRNAs were found to be differentially expressed at both developmental stages, including three miR827 members. Our results provide insight that auxin- and BR-signaling may play a pivotal role in branch angle regulation.

  8. Comparative field evaluation of some newer versus conventional insecticides for the control of aphids (homoptera: aphididae) on oilseed rape (brassica napus l.)

    International Nuclear Information System (INIS)

    Sarwar, M.; Ahmad, N.; Bux, M.; Nasrullah, A.; Tofique, M.


    This study was designed to evaluate the effects of new insecticides like, Imidacloprid (Confidor 200 EC), Thiomethoxam (Actara 25 WG) and Acetamiprid (Megamos 20 SL) belonging to Nitroguanidine group along with conventional insecticides such as, Chlorpyrifos (Lorsban 40 EC) and Dimethoate (Systoate 40 EC) belonging to Organophosphate group against aphids' population on oilseed rape (Brassica napus L.). A perusal of data, based on the overall performance of the test compounds, reflected that newer insecticides were superior in reducing the population of aphids and yield enhancement as compared to conventional insecticides. The best results were achieved with the application of Imidacloprid by recording the lowest number of aphids (2.2 per plant) than obtained with Thiomethoxam and Acetamiprid (3.22 and 4.66, respectively). Other insecticides, viz., Chlorpyrifos and Dimethoate were also found to be effective in maintaining the aphids' population at lower levels per plant (16.2 and 17.5, respectively) over untreated control (227.7). Imidacloprid was responsible for increasing the grain yield to 3722.85 Kg per Hectare, approached by Thiomethoxam, Acetamiprid, Chlorpyrifos and Dimethoate as against unsprayed control (2980.0, 2542.85, 1542.85, 540.0 and 604.85 Kg per Hectare, respectively). Study indicated that selective use of newer insecticides would seem a reasonable strategy in aphids controlling and integration of such chemicals in insects' management package could help to reduce pest densities. (author)

  9. Investigation of growth indices and yield of canola (Brassica napus L. in competition with wild mustard (Sinapis arvensis L. as influenced by different amount of nitrogen application

    Directory of Open Access Journals (Sweden)

    F. Soleymani


    Full Text Available To evaluate the effect of different levels of nitrogen fertilizer on growth indices and competitive ability of canola (Brassica napus L. against wild mustard (Sinapis arvensis L., a split plot trial based on a randomized complete block design with three replications, was carried out at Agricultural Faculty of Bu-Ali Sina University, during 2008-2009. Experimental factors were amounts of nitrogen fertilizer of urea at four levels (100, 150, 200 and 250 kgN.ha-1 and five wild mustard plant densities (0, 4, 8, 16 and 32 plants.m-2. The results showed that wild mustard interference led to reduction of leaf area index (LAI, dry matter accumulation, crop growth rate (CGR, leaf area index duration (LAID, dry matter duration (BMD and seed yield of canola, while these characteristics were increased with more nitrogen fertilizer application. The maximum indices were obtained at 250 kg N.ha-1 and weed-free condition, but generally, the least reduction in maximum LAI, CGR, LAID and BMD of canola affected by wild mustard competition occurred at 200 kg N.ha-1. In conclusion, the results showed that optimum level of fertilizer 200 kg N.ha-1, increased competitive ability of canola against wild mustard and improved yield and growth indices.

  10. Responses of the cabbage seedpod weevil, Ceutorhynchus obstrictus (Marsham) (Coleoptera: Curculionidae), to seed treatments of canola (Brassica napus L.) with the neonicotinoid compounds clothianidin and imidacloprid. (United States)

    Dosdall, Lloyd M


    The cabbage seedpod weevil, Ceutorhynchus obstrictus (Marsham), is a major pest in the production of canola (Brassica napus L.) in North America and Europe, and effective population control is often essential for economical crop production. In North America, neonicotinoid insecticides have been used for several years in canola as seed treatments for reducing herbivory by flea beetles. The neonicotinoids clothianidin and imidacloprid were investigated to determine their effects on preimaginal development and on emergence of new-generation adults of C. obstrictus in comparison with effects of lindane, a chlorinated hydrocarbon seed treatment. Mean numbers of second- and third-instar larvae were significantly higher in plants seed-treated with lindane than in plants treated with the neonicotinoid compounds, even though weevil oviposition was similar for all treatments. Emergence of new-generation adults was reduced by 52 and 39% for plants seed-treated with clothianidin and imidacloprid, respectively, compared with emergence from plants treated with lindane. Seed treatment with both clothianidin and imidacloprid produced systemic insecticidal effects on larvae of C. obstrictus, with clothianidin slightly more effective than imidacloprid. Use of clothianidin or imidacloprid as seed treatments can comprise an important component in the integrated management of cabbage seedpod weevil in canola. (c) 2009 Society of Chemical Industry.

  11. The effect of exposure to enhanced UV-B radiation on the penetration of monochromatic and polychromatic UV-B radiation in leaves of Brassica napus

    International Nuclear Information System (INIS)

    Cen, Y.-P.; Bornman, J.F.


    Using quartz optical fibres, penetration of both monochromatic (310 nm) and polychromatic UV-B (280–320 nm) radiation in leaves of Brassica napus L. (cv. Ceres) was measured. Plants were grown under either visible light (750 μmol m −2 s −1 photosynthetically active radiation) or with the addition of 8. 9 KJ m −2 day −1 biologically effective UV-B (UV-B BE ) radiation. Results showed that of the 310 nm radiation that penetreated the leaf, 90% was within the intial one third of the leaf with high attenuation in the leaf epidermis, especially in UV-treated plants. Polychromatic UV-B radiation, relative to incident radiation, showed a relatively uniform spectral distribution within the leaf, except for collimated radiation. Over 30% of the UV-screening pigments in the leaf, including flavonoids, were found in the adaxial epidermal layer, making this layer less transparent to UV-B radiation than the abaxial epidermis, which contained less than 12% of the UV-screening pigments. UV-screening pigments increased by 20% in UV-treated leaves relative to control leaves. Densely arranged epicuticular wax on the adaxial leaf surface of UV-treated plants may have further decreased penetration of UV-B radiation by reflectance. An increased leaf thickness, and decreases in leaf area and leaf dry weight were also found for UV-treated plants. (author)

  12. Tolerance of transgenic canola plants (Brassica napus) amended with plant growth-promoting bacteria to flooding stress at a metal-contaminated field site

    International Nuclear Information System (INIS)

    Farwell, Andrea J.; Vesely, Susanne; Nero, Vincent; Rodriguez, Hilda; McCormack, Kimberley; Shah, Saleh; Dixon, D. George; Glick, Bernard R.


    The growth of transgenic canola (Brassica napus) expressing a gene for the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase was compared to non-transformed canola exposed to flooding and elevated soil Ni concentration, in situ. In addition, the ability of the plant growth-promoting bacterium Pseudomonas putida UW4, which also expresses ACC deaminase, to facilitate the growth of non-transformed and transgenic canola under the above mentioned conditions was examined. Transgenic canola and/or canola treated with P. putida UW4 had greater shoot biomass compared to non-transformed canola under low flood-stress conditions. Under high flood-stress conditions, shoot biomass was reduced and Ni accumulation was increased in all instances relative to low flood-stress conditions. This is the first field study to document the increase in plant tolerance utilizing transgenic plants and plant growth-promoting bacteria exposed to multiple stressors. - Using transgenic plants and plant growth-promoting bacteria as phytoremediation methods increased plant tolerance at a metal-contaminated field site under low flood conditions

  13. Effects on Brassica napus L. Yield and Yield Components of Super Absorbent Polymer under Different Irrigation Regimes

    Directory of Open Access Journals (Sweden)

    Alireza PIRZAD


    Full Text Available For evaluation of the effects of super absorbent polymer under different irrigation regimes on the yield and yield components of Brassica napus L., a factorial experiment was carried out, based on randomized complete block design with four replicas. Treatments included super absorbent polymer (0, 1, 2, 3, 4 and 5 g/kg soil and induced drought stress (irrigation at 25, 50 and 75 mm evaporation from class A pan. The experiment was conducted in pots with 5 kg of soil. Data analysis of variance showed the significant interaction effect between polymer and irrigation on the stem length, width and weight, the number of seeds per sheath, number of seeds per plant, the number of sterile and fertile sheath per plant, fertile sheath percentage (fertile sheath/ total sheath ×100, 1000 seeds weight, seed weight per plant, sheath weight per plant and the number of total sheath. The present study revealed that indifferent from the applied amounts of the super absorbent polymer, in all cases the measured characters have been more affected by induced drought stress.

  14. Senescence-specific alteration of hydrogen peroxide levels in Arabidopsis thaliana and oilseed rape spring variety Brassica napus L. cv. Mozart. (United States)

    Bieker, Stefan; Riester, Lena; Stahl, Mark; Franzaring, Jürgen; Zentgraf, Ulrike


    In order to analyze the signaling function of hydrogen peroxide (H(2)O(2)) production in senescence in more detail, we manipulated intracellular H(2)O(2) levels in Arabidopsis thaliala (L.) Heynh by using the hydrogen-peroxide-sensitive part of the Escherichia coli transcription regulator OxyR, which was directed to the cytoplasm as well as into the peroxisomes. H(2)O(2) levels were lowered and senescence was delayed in both transgenic lines, but OxyR was found to be more effective in the cytoplasm. To transfer this knowledge to crop plants, we analyzed oilseed rape plants Brassica napus L. cv. Mozart for H(2)O(2) and its scavenging enzymes catalase (CAT) and ascorbate peroxidase (APX) during leaf and plant development. H(2)O(2) levels were found to increase during bolting and flowering time, but no increase could be observed in the very late stages of senescence. With increasing H(2)O(2) levels, CAT and APX activities declined, so it is likely that similar mechanisms are used in oilseed rape and Arabidopsis to control H(2)O(2) levels. Under elevated CO(2) conditions, oilseed rape senescence was accelerated and coincided with an earlier increase in H(2)O(2) levels, indicating that H(2)O(2) may be one of the signals to inducing senescence in a broader range of Brassicaceae. © 2012 Institute of Botany, the Chinese Academy of Sciences.

  15. Genetic diversity of notary-national uniform rape seed yield trial and brassica napus varieties using raped markers and biochemical analysis

    International Nuclear Information System (INIS)

    Bakhat, J.; Fareed, A.; Swati, Z.A.; Shafi, M.


    In Pakistan, Brassica is the second most important source of oil after cotton. Seventeen NURYT (National Uniform Rape Seed Yield Trial) lines and 5 Brassica napus varieties were assessed through RAPD primers and biochemical assays. Seven different Randomly Amplified Polymorphic DNA markers (RAPD) were employed during the present study. A total of 30 RAPD bands were scored by these primers. Size of the scorable fragments ranged from approximately 250 to 2000 bp. Diversity index was estimated to be 42%. Mean genetic distance estimates ranged between 0.10 and 1.00. For the assessment of various biochemical parameters, Near Infrared Reflectance Spectroscopy (NIRS) was used. Oil content ranged from 38.30 to 49% and protein content from 19.80 to 29.10% among the 22 genotypes. Maximum protein content was assayed in genotype RBN 3046 while minimum in Hyola 405. Glucosinolates ranged between 2 and 84% for genotype CRH 60/08 and CRH05/08 showing the maximum and minimum values respectively. Oleic acid (52 to 72.5%), linolenic acid (7.07 and 9.90%) and erucic acid content (9.57 to 38.3%) was also recorded during the present study. (author)

  16. Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.). (United States)

    Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na


    Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

  17. Atividade de alguns insetos em flores de Brassica napus L. em Dourados-MS e a interação com fatores climáticos Activity of some insects in Brassica napus L. flowers at Dourados-MS and the interaction with climatic factors

    Directory of Open Access Journals (Sweden)

    Rosilda Mara Mussury


    Full Text Available Objetivou-se estudar a flutuação populacional, horários de visitação e a interação com fatores climáticos de insetos visitantes de flores de Brassica napus L. em diversos estádios fenológicos. O trabalho foi realizado em Dourados, MS, Brasil. Os insetos foram coletados com rede entomológica de 30 cm de diâmetro, a cada duas horas, no período de 7 as 17 horas. Foram coletadas as abelhas Apis mellifera, Linnaeus, 1758, Trigona sp., o vespídeo Brachygastra lecheguana (Latreille - 1824 e uma espécie de Chloropidae (Diptera, que foi a mais abundante e freqüente nas amostragens. O pico populacional da maioria dos insetos foi das 9 às 15 horas; contudo, para Trigona sp., foi entre 9 e 11 horas. A maior frequência de insetos ocorreu durante o estádio fenológico III. A análise de correlação evidenciou que a umidade relativa entre 11 horas (r = 0,57 e 13 horas (r = 0,43 favoreceu a ocorrência do díptero da família Chloropidae. Reduções nas populações de insetos do estádio III para o IV foram devidas, provavelmente, a temperaturas mais baixas, que atingiram a média de 16,1ºC.The objective of this work was to study the populational fluctuation, the preferred visiting time, and the interaction with climatic factors in several phenological stages from visitant insects in Brassica napus L. flowers. The study was accomplished in Dourados-MS, Brazil. The insects were collected with a 30-cm wide entomologic sweep net every 2 hours from 7h00 to 17h00. Apis mellifera L., 1758, Trigona sp., and Brachygastra lecheguana (Latreille - 1824 were gathered in B. napus flowers. A dipterous from the Chloropidae family was the insect with the largest populational density in the samples. The large occurrence of most pollinators was between 9h00 and 15h00, but Trigona sp. was present in larger numbers between 9h00 and 11h00. The largest frequency of pollinator insects occurred during stage III of flowering. The correlation analysis indicated

  18. Determination of Flowering Phenology, Number of Flowers, Nectar and Pollen Potential of Oil Rape (Brassica napus L., Plant in Black Sea Coastal Region

    Directory of Open Access Journals (Sweden)

    Necda Çankaya


    Full Text Available This research was carried out in 2011 and 2012 in order to determine the flowering phenology, number of flowers, nectar and pollen potential in the Samsun province of the oilseed rape (Brassica napus L., which is widely used in agriculture in our country. In the first year of the study (2011, it was determined that the rapeseed plant was in flower for 44 days, there were 2.694 flowers per plant, 1.89 kg/da nectar per day and 1330 kg/da pollen production. In the second year of the research (2012, it was revealed that the rapeseed plant was in flower for 39 days, there were 701 plants/flower in the plant, 0.38 kg/da nectar secreted daily and 331.57 kg/da pollen. According to the results of two years, the yield of rapeseed was found to be 41.5 days, the daily nectar production was 0.23 mg/flower/day, the nectar dry matter level was 20.25% and the pollen production was 0.48 mg/flower/day. In Samsun province, it was determined that rapeseed plants flowered before the flowering of many plants in the vicinity in the early spring, and provided honey bees, Apis mellifera L., and many other honey bees, nectar and pollen. It has been demonstrated that the cultivation of rapeseed is cultivated in the early spring, and it can be a convenient source of food for honey bees and other dusty insects.

  19. Lambs Fed Fresh Winter Forage Rape (Brassica napus L.) Emit Less Methane than Those Fed Perennial Ryegrass (Lolium perenne L.), and Possible Mechanisms behind the Difference (United States)

    Sun, Xuezhao; Henderson, Gemma; Cox, Faith; Molano, German; Harrison, Scott J.; Luo, Dongwen; Janssen, Peter H.; Pacheco, David


    The objectives of this study were to examine long-term effects of feeding forage rape (Brassica napus L.) on methane yields (g methane per kg of feed dry matter intake), and to propose mechanisms that may be responsible for lower emissions from lambs fed forage rape compared to perennial ryegrass (Lolium perenne L.). The lambs were fed fresh winter forage rape or ryegrass as their sole diet for 15 weeks. Methane yields were measured using open circuit respiration chambers, and were 22-30% smaller from forage rape than from ryegrass (averages of 13.6 g versus 19.5 g after 7 weeks, and 17.8 g versus 22.9 g after 15 weeks). The difference therefore persisted consistently for at least 3 months. The smaller methane yields from forage rape were not related to nitrate or sulfate in the feed, which might act as alternative electron acceptors, or to the levels of the potential inhibitors glucosinolates and S-methyl L-cysteine sulfoxide. Ruminal microbial communities in forage rape-fed lambs were different from those in ryegrass-fed lambs, with greater proportions of potentially propionate-forming bacteria, and were consistent with less hydrogen and hence less methane being produced during fermentation. The molar proportions of ruminal acetate were smaller and those of propionate were greater in forage rape-fed lambs, consistent with the larger propionate-forming populations and less hydrogen production. Forage rape contained more readily fermentable carbohydrates and less structural carbohydrates than ryegrass, and was more rapidly degraded in the rumen, which might favour this fermentation profile. The ruminal pH was lower in forage rape-fed lambs, which might inhibit methanogenic activity, shifting the rumen fermentation to more propionate and less hydrogen and methane. The significance of these two mechanisms remains to be investigated. The results suggest that forage rape is a potential methane mitigation tool in pastoral-based sheep production systems. PMID:25803688

  20. Comparison of sugars, iridoid glycosides and amino acids in nectar and phloem sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus. (United States)

    Lohaus, Gertrud; Schwerdtfeger, Michael


    Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus) were compared. Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae) M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of antirrhinoside in nectar could be based on passive secretion from the phloem.

  1. High-throughput phenotyping (HTP) identifies seedling root traits linked to variation in seed yield and nutrient capture in field-grown oilseed rape (Brassica napus L.). (United States)

    Thomas, C L; Graham, N S; Hayden, R; Meacham, M C; Neugebauer, K; Nightingale, M; Dupuy, L X; Hammond, J P; White, P J; Broadley, M R


    Root traits can be selected for crop improvement. Techniques such as soil excavations can be used to screen root traits in the field, but are limited to genotypes that are well-adapted to field conditions. The aim of this study was to compare a low-cost, high-throughput root phenotyping (HTP) technique in a controlled environment with field performance, using oilseed rape (OSR;Brassica napus) varieties. Primary root length (PRL), lateral root length and lateral root density (LRD) were measured on 14-d-old seedlings of elite OSR varieties (n = 32) using a 'pouch and wick' HTP system (∼40 replicates). Six field experiments were conducted using the same varieties at two UK sites each year for 3 years. Plants were excavated at the 6- to 8-leaf stage for general vigour assessments of roots and shoots in all six experiments, and final seed yield was determined. Leaves were sampled for mineral composition from one of the field experiments. Seedling PRL in the HTP system correlated with seed yield in four out of six (r = 0·50, 0·50, 0·33, 0·49;P emergence in three out of five (r = 0·59, 0·22, 0·49;P emergence, general early vigour or yield in the field. Associations between PRL and field performance are generally related to early vigour. These root traits might therefore be of limited additional selection value, given that vigour can be measured easily on shoots/canopies. In contrast, LRD cannot be assessed easily in the field and, if LRD can improve nutrient uptake, then it may be possible to use HTP systems to screen this trait in both elite and more genetically diverse, non-field-adapted OSR. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company.

  2. Analysis of yield and plant traits of oilseed rape (Brassica napus L. cultivated in temperate region in light of the possibilities of sowing in arid areas

    Directory of Open Access Journals (Sweden)

    Tadeusz Zając


    Full Text Available This work is a review of selected literature on the species of Brassica with the greatest economic significance. Oilseed rape (Brassica napus ssp. oleifera currently ranks third worldwide among oilseed crops used for oil production and is the most important in the temperate zone. The manifold uses of rape include not only human consumption of oil, but also the use of post-extraction meal to feed livestock as well as industrial applications as a source of bioenergy or cellulose. The improvement in the economic position of rape among crop plants is also due to the doubling of its yield between 1970 and 2009; the average annual increase in seed yield worldwide was 27 kg ha−1 yr−1. The yield level in Europe exceeds the average yields achieved in the world, particularly in Asia. Recently, the cultivation of oilseed rape was started on a relatively large acreage in Iran where the yield amounted 2.1 t ha−1, exceeding the yields of China and India. In Poland, the acreage of oilseed rape cultivation between 1965 and 2013 increased 3–4 times, and during this period the annual increase in seed yield was 29 kg ha−1 yr−1. Under the field conditions of the temperate climate zone, winter oilseed rape yield is mainly determined by agro-climatic conditions during the growing period, the level of nitrogen fertilization, and the production potential of varieties, which is currently highest in hybrids. There is a noticeable tendency of hybrids towards formation of more siliques by individual oilseed plants. Different production categories of plants appear in a rape crop. Semi-dwarf varieties of winter rapeseed are distinguished by greater silique density, particularly on the main shoot. Moreover, these hybrids are characterized by faster growth of the root system, which enables them to take up nitrogen from the soil more efficiently.

  3. Epidermal transmittance and phenolic composition in leaves of atrazine-tolerant and atrazine-sensitive cultivars of Brassica napus grown under enhanced UV-B radiation

    International Nuclear Information System (INIS)

    Olsson, L.C.; Veit, M.; Bornman, J.F.


    Experiments were conducted on the atrazine-tolerant mutant Stallion and the atrazine-sensitive cv. Paroll of Brassica napus L., which were grown under either visible light or with the addition of UV-B radiation (280–320 nm) for 15 days. The mutant has been shown to be sensitive to high levels of visible light as compared to the atrazine-sensitive cultivar and therefore we wished to determine plant response to UV-B radiation with respect to potential pigment changes, certain anatomical features, radiation penetration and partial photosynthesis. With regard to pigment changes, we were particularly interested in whether the compositional shift in flavonol pigments under enhanced UV-B radiation, previously suggested to favour increased antioxidant activity, is confined to the adaxial epidermis, which generally receives most UV-B radiation or whether the pigment shift is also inducible in the abaxial epidermis.As was to be expected, the penetration of UV-B radiation (310 nm) was lower in the UV-B-exposed plants, which was correlated with an increased amount of UV-screening pigments in the adaxial and abaxial epidermal layers. The main flavonoid glycosides showed the largest shift from kaempferol to quercetin as aglycone moiety in the adaxial epidermal layer. However, in the abaxial epidermal layer the hydroxycinnamic acid (HCA) derivatives and kaempferol glycosides were predominant. Penetration of 430 nm light was higher after UV-B exposure, and probably contributed to the fact that photosynthetic efficiency of photosystem II was unchanged or higher after UV-B exposure. UV-B radiation decreased leaf area in the atrazine-tolerant mutant only. Both cultivars showed an increased leaf thickness after UV-B exposure due to cell elongation mainly of the palisade tissue. This was especially evident in the mutant

  4. Evaluation of Effect of Gamma Rays Irradiation for Increasing of Variation in Germination and Agronomic Traits in Oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    R. Momeni


    Full Text Available Increasing of genetic diversity is one of primary and basic goals of plant breeding programs. Induction of mutation is a method to increase genetic diversity that can be used in accommodate with selection, recombination and or combination of them in plant breeding. The aim of this study was to investigate the impact of different doses of gamma rays (500, 700, 900, 1100 and 1300 Gry on primary growth characters, such as: rate and percentage of germination, the length of rootlet and stemlet in M1 generation, and on agronomic characters such as: plant height, number of lateral branches, number of pods on main and lateral stem, length of pods and weigth of 1000-seed in M2 generation for two varieties of oilseed rape (Brassica napus, PF and Zarfam. Results of lab experiments showed that for both varieties, the germination percentage, the length of rootlet and the length of stemlet were significantly decreased by mutagen in compare with the control. While germination rate was only significantly affected by mutagen in PF. The estimation of "F" showed that there was significant difference between the variance of treatments for the germination rate and germination percentage in PF cultivar and for germination rate and stemlet length in Zarfam cultivar. In fact, increasing of gamma doses causes considerable enhancement in variance of treatment in compare with the control. The maximum relative coefficient of variation was related to 1300 Gry for germination rate of PF. In M2, all traits of study except number of pods on main stem was decreased by different doses of Gamma rays in PF cultivar. In opposition to other traits, Pods on main stem in PF cultivar was increased in different doses of gamma ray in compare with the control. But in Zarfam cultivar, only 1000-seed weight was significantly affected by Gamma rays.

  5. Genome-Wide Gene Expression Disturbance by Single A1/C1 Chromosome Substitution in Brassica rapa Restituted From Natural B. napus

    Directory of Open Access Journals (Sweden)

    Bin Zhu


    Full Text Available Alien chromosome substitution (CS lines are treated as vital germplasms for breeding and genetic mapping. Previously, a whole set of nine Brassica rapa-oleracea monosonic alien addition lines (MAALs, C1-C9 was established in the background of natural B. napus genotype “Oro,” after the restituted B. rapa (RBR for Oro was realized. Herein, a monosomic substitution line with one alien C1 chromosome (Cs1 in the RBR complement was selected in the progenies of MAAL C1 and RBR, by the PCR amplification of specific gene markers and fluorescence in situ hybridization. Cs1 exhibited the whole plant morphology similar to RBR except for the defective stamens without fertile pollen grains, but it produced some seeds and progeny plants carrying the C1 chromosome at high rate besides those without the alien chromosome after pollinated by RBR. The viability of the substitution and its progeny for the RBR diploid further elucidated the functional compensation between the chromosome pairs with high homoeology. To reveal the impact of such aneuploidy on genome-wide gene expression, the transcriptomes of MAAL C1, Cs1 and euploid RBR were analyzed. Compared to RBR, Cs1 had sharply reduced gene expression level across chromosome A1, demonstrating the loss of one copy of A1 chromosome. Both additional chromosome C1 in MAAL and substitutional chromosome C1 in Cs1 caused not only cis-effect but also prevalent trans-effect differentially expressed genes. A dominant gene dosage effects prevailed among low expressed genes across chromosome A1 in Cs1, and moreover, dosage effects for some genes potentially contributed to the phenotype deviations. Our results provided novel insights into the transcriptomic perturbation and gene dosage effects on phenotype in CS related to one naturally evolved allopolyploid.

  6. Comparison of sugars, iridoid glycosides and amino acids in nectar and phloem sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus.

    Directory of Open Access Journals (Sweden)

    Gertrud Lohaus

    Full Text Available BACKGROUND: Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus were compared. METHODOLOGY AND PRINCIPAL FINDINGS: Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. CONCLUSIONS/SIGNIFICANCE: The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of

  7. Identification of microRNAs actively involved in fatty acid biosynthesis in developing Brassica napus seeds using high-throughput sequencing

    Directory of Open Access Journals (Sweden)

    Jia Wang


    Full Text Available Seed development has a critical role during the spermatophyte life cycle. In Brassica napus, a major oil crop, fatty acids are synthesized and stored in specific tissues during embryogenesis, and understanding the molecular mechanism underlying fatty acid biosynthesis during seed development is an important research goal. In this study, we constructed three small RNA libraries from early seeds at 14, 21 and 28 days after flowering (DAF and used high-throughput sequencing to examine microRNA (miRNA expression. A total of 85 known miRNAs from 30 families and 1,160 novel miRNAs were identified, of which 24, including 5 known and 19 novel miRNAs, were found to be involved in fatty acid biosynthesis. bna-miR156b, bna-miR156c, bna-miR156g, novel_mir_1706, novel_mir_1407, novel_mir_173, and novel_mir_104 were significantly down-regulated at 21 DAF and 28 DAF, whereas bna-miR159, novel_mir_1081, novel_mir_19 and novel_mir_555 were significantly up-regulated. In addition, we found that some miRNAs regulate functional genes that are directly involved in fatty acid biosynthesis and that other miRNAs regulate the process of fatty acid biosynthesis by acting on a large number of transcription factors. The miRNAs and their corresponding predicted targets were partially validated by quantitative RT-PCR. Our data suggest that diverse and complex miRNAs are involved in the seed development process and that miRNAs play important roles in fatty acid biosynthesis during seed development.

  8. Effect of different methods of soil fertility increasing via application of organic, chemical and biological fertilizers on grain yield and quality of canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    K. Mohammadi


    Full Text Available Different resource of fertilizers had an effect on grain yield, oil and grain quality. Information regarding the effect of simultaneous application of organic, chemical and biological fertilizers on canola (Brassica napus L. traits is not available. In order to study the effect of different systems of soil fertility on grain yield and quality of canola (Talayeh cultivar, an experiment was conducted at experimental farm of Agricultural Research Center of Sanandaj, Iran, during two growing seasons of 2007-2008 and 2008-2009. The experimental units were arranged as split plots based on randomized complete blocks design with three replications. Main plots consisted of five methods for obtaining the basal fertilizers requirement including (N1: farm yard manure; (N2: compost; (N3: chemical fertilizers; (N4: farm yard manure + compost and (N5: farm yard manure + compost + chemical fertilizers; and control (N6. Sub plots consisted four levels of biofertilizers were (B1: Bacillus lentus and Pseudomonas putida; (B2: Trichoderma harzianum; (B3: Bacillus lentus and Pseudomonas putida and Trichoderma harzianum; and (B4: control, (without biofertilizers. Results showed that basal fertilizers and biofertilizers have a significant effect on grain yield. The highest grain yield was obtained from N5 treatment in which organic and chemical fertilizers were applied simultaneously applied. Basal fertilizers, biofertilizers have a significant effect on leaf chlorophyll. The highest nitrogen content (42.85 mg.g-1 and least amount of (N/S were obtained from N5 treatment. The highest oil percent was obtained from N1 and N2 treatments and highest oil yield was obtained from N5 treatment. Finally, application of organic manure and biofertilizers with chemical fertilizer led to an increase in yield and quality of canola grain.

  9. Conjugated linoleic acid content in milk of Chilean Black Friesian cows under pasture conditions and supplemented with canola seed (Brassica napus concentrate

    Directory of Open Access Journals (Sweden)

    J. P. Avilez Ruiz


    Full Text Available At present, there is limited and contradictory information about the effects of the use of canola (Brassica napus seed as supplement on the contents of conjugated linoleic acid (CLA in milk of grazing cows. The objective of this study was to evaluate the effect of a dietary supplement with canola seed on the production and composition of milk, and CLA concentration in Chilean Black Friesian cows under pasture conditions. Three experiments were done. Experiment 1: control group was fed 5 kg d-1 of commercial concentrate without canola (0-TC1 and treatment group that was fed 3.75 kg of commercial concentrate plus 1.16 kg of whole canola seed (1.16-TC1. Experiment 2: Control group was fed 8 kg d-1 commercial concentrate without canola (0-TC2 and treatment group that was fed 6.2 kg of commercial concentrate plus 1.2 kg of ground canola seed (1.2-TC2. Experiment 3: control group was fed 6 kg d-1 commercial concentrate without canola (0-TC3 and treatment group was fed 6 kg of commercial concentrate with 20% of whole canola seed (1.2 kg d-1, 1.2-TC3. The duration of each experiment was 60 days. No differences in milk production and quality were observed among the experimental groups in every assay. The CLA isomers trans-10, cis-12 and cis-10, cis-12 were higher than those normally found in the scientific literature. There was no effect of the inclusion of canola seed on total CLA content or the content of cis-9, trans-11, trans-10, cis-12 and cis-10, cis-12 isomers.

  10. The microbe-secreted isopeptide poly-γ-glutamic acid induces stress tolerance in Brassica napus L. seedlings by activating crosstalk between H2O2 and Ca2+ (United States)

    Lei, Peng; Pang, Xiao; Feng, Xiaohai; Li, Sha; Chi, Bo; Wang, Rui; Xu, Zongqi; Xu, Hong


    Poly-γ-glutamic acid (γ-PGA) is a microbe-secreted isopeptide that has been shown to promote growth and enhance stress tolerance in crops. However, its site of action and downstream signaling pathways are still unknown. In this study, we investigated γ-PGA-induced tolerance to salt and cold stresses in Brassica napus L. seedlings. Fluorescent labeling of γ-PGA was used to locate the site of its activity in root protoplasts. The relationship between γ-PGA-induced stress tolerance and two signal molecules, H2O2 and Ca2+, as well as the γ-PGA-elicited signaling pathway at the whole plant level, were explored. Fluorescent labeling showed that γ-PGA did not enter the cytoplasm but instead attached to the surface of root protoplasm. Here, it triggered a burst of H2O2 in roots by enhancing the transcription of RbohD and RbohF, and the elicited H2O2 further activated an influx of Ca2+ into root cells. Ca2+ signaling was transmitted via the stem from roots to leaves, where it elicited a fresh burst of H2O2, thus promoting plant growth and enhancing stress tolerance. On the basis of these observation, we propose that γ-PGA mediates stress tolerance in Brassica napus seedlings by activating an H2O2 burst and subsequent crosstalk between H2O2 and Ca2+ signaling. PMID:28198821

  11. Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L. in response to fungal pathogens and hormone treatments

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K


    Full Text Available Abstract Background Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L., no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. Results In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP and we observed the fluorescent green signals in the nucleus only. The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR. Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h. We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA, and cytokinin (6-benzylaminopurine, BAP and the defense signaling molecules jasmonic acid (JA, salicylic acid (SA, and ethylene (ET. We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in

  12. Effect of elevated atmospheric CO/sub 2/on nitrogen distribution and N utilization efficiency in winter rape (brassica napus L.)

    International Nuclear Information System (INIS)

    Zhang, Z. H.; Lu, S.; Wang, W. M.; Song, H. X.; Lepo, J. E.


    We characterized the responses of plant dry biomass, nitrogen (N) distribution and N-utilization efficiency (NUtE) to changes in CO/sub 2/ concentration through exposure and culture of winter rape under normal-(380 mu mol.mol/sup -1/) and elevated-CO/sub 2/ (760 mu mo mol/sup -1/) conditions. Brassica napus (Xiangyou 15) was used as an agriculturally important model plant. Plants were cultivated in a greenhouse with sand culture under normal- (15 mmol.L/sup -1/) and limited-N (5 mmol.L/sup -1/) conditions. NUtE increased with elevated CO/sub 2/ regardless of whether N was limited. NUtE was higher under N limitation than under normal N conditions for both normal- and elevated-CO/sub 2/ conditions. 15N labeling was used to assess the distribution of N from vegetative- to reproductive-organs.N distribution within the plant and during different developmental stages was affected by CO/sub 2/ concentration and the level of N application. A higher proportion of N was found in siliques at the harvest stage for N-limited plants compared to normal-N plants. The proportion of N absorbed into siliques after the stem elongation stage under elevated-CO/sub 2/ conditions was significantly higher than under normal CO/sub 2/. The proportion of N transport, as well as the total amount of N, absorbed at the stem elongation stage from vegetative organs into siliques under elevated CO/sub 2/ was significantly lower than under normal-CO/sub 2/ conditions. However, the proportion of N absorbed at the stem elongation stage and thus lost from the silique under elevated CO/sub 2/ was significantly higher than under normal CO/sub 2/. In conclusion, limited N or elevated CO/sub 2/ generally benefitted plant NUtE. In addition, after the stem elongation stage, elevated CO/sub 2/ promoted the redistribution of N from plant vegetative tissues to reproductive organs; however, elevated CO/sub 2/ during or before stem elongation had the opposite effect. (author)

  13. Early interspecific interference in the wheat/faba bean (Triticum aestivum/ Vicia faba ssp. minor and rapeseed/squarrosum clover (Brassica napus var. oleifera/Trifolium squarrosum intercrops

    Directory of Open Access Journals (Sweden)

    Paolo Benincasa


    Full Text Available Most of research on intercrops evaluate performances and interference between species on the basis of final yield, while little knowledge is available on the interference in early stages and at the root level, at least for cultivated intercrops. In fact, in the few studies on this subject species are often combined minding at experimental needs (e.g. common substrate, temperature and water requirements, easy root separation more than at their actual use in the farm. The present work evaluates interspecific interference during early developmental stages for two intercrops of agricultural interest: soft wheat-faba bean and rapeseed-squarrosum clover. Improving this knowledge would help intercrop growth modelling and rational cultivation. The experiments were carried out on soft wheat (Triticum aestivum, faba bean (Vicia faba var. minor, rapeseed (Brassica napus var. oleifera and squarrosum clover (Trifolium squarrosum, germinated and grown until 32 days after sowing (DAS as one-species stands or as wheat/faba bean and rapeseed/squarrosum clover intercrops, with different densities and proportions for the two species in each couple. Germination was studied in controlled-temperature chamber, plantlet growth was studied on pots in the greenhouse. During germination no interspecific interference was observed for both wheat/faba bean and rapeseed/squarrosum clover intercrops. During plantlet growth, interspecific interference occurred in both intercrops causing variations in whole plant and root dry matter accumulation. In the wheat/faba bean intercrop each species suffered from the competitive effect of the companion species and faba bean was the dominant species when present in lower proportion than wheat. The unexpectedly high aggressivity of faba bean may be explained either with the greater seed size that could have represented an initial advantage within the short duration of the experiment or with the competition towards wheat for substrate N

  14. Depletion of cellular brassinolide decreases embryo production and disrupts the architecture of the apical meristems in Brassica napus microspore-derived embryos. (United States)

    Belmonte, Mark; Elhiti, Mohamed; Waldner, Blaine; Stasolla, Claudio


    Exogenous applications of brassinolide (BL) increased the number and quality of microspore-derived embryos (MDEs) whereas treatments with brassinazole (BrZ), a BL biosynthetic inhibitor, had the opposite effect. At the optimal concentration (4x10(-6) M) BrZ decreased both embryo yield and conversion to less than half the value of control embryos. Metabolic studies revealed that BL levels had profound effects on glutathione and ascorbate metabolism by altering the amounts of their reduced forms (ASC and GSH) and oxidized forms [dehydroascorbate (DHA), ascorbate free radicals (AFRs), and GSSG]. Applications of BL switched the glutathione and ascorbate pools towards the oxidized forms, thereby lowering the ASC/ASC+DHA+AFR and GSH/GSH+GSSG ratios. These changes were ascribed to the ability of BL to increase the activity of ascorbate peroxidase (APX) and decrease that of glutathione reductase (GR). This trend was reversed in a BL-depleted environment, effected by BrZ applications. These metabolic alterations were associated with changes in embryo structure and performance. BL-treated MDEs developed zygotic-like shoot apical meristems (SAMs) whereas embryos treated with BrZ developed abnormal meristems. In the presence of BrZ, embryos either lacked a visible SAM, or formed SAMs in which the meristematic cells showed signs of differentiation, such as vacuolation and storage product accumulation. These abnormalities were accompanied by the lack or misexpression of three meristem marker genes isolated from Brassica napus (denoted as BnSTM, BnCLV1, and BnZLL-1) homologous to the Arabidopsis SHOOTMERISTEMLESS (STM), CLAVATA 1 (CLV1), and ZWILLE (ZLL). The expression of BnSTM and BnCLV1 increased after a few days in cultures in embryos treated with BL whereas an opposite tendency was observed with applications of BrZ. Compared with control embryos where these two genes exhibited abnormal localization patterns, BnSTM and BnCLV1 always localized throughout the subapical domains

  15. Effects of Source and Rate of Nitrogen Fertilizer on Yield, Yield Components and Quality of Winter Rapeseed (Brassica napus L. Efecto de la Fuente y Dosis de Fertilizantes Nitrogenados en el Rendimiento, Componentes de Rendimiento y Calidad de Semilla de Canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Özden Öztürk


    Full Text Available Winter rapeseed (Brassica napus L. has potential to become an alternate oilseed crop both for edible oil production and energy agriculture (biofuel production for Turkey. This study was conducted to determine the effect of year, N sources and doses on the yield and quality traits of winter rapeseed in a cereal system in calcareous soils over two seasons, 2000-2001 and 2001-2002, in Central Anatolia. Three N sources, ammonium sulfate, ammonium nitrate and urea, were applied as hand broadcast on the soil surface at five doses (0, 50, 100, 150, and 200 kg N ha-1. The traits investigated were plant height, number of branches and pods per plant, number of seed per pod, thousand seed weight, seed yield, oil and protein content. There were significantly effects on seed yield, oil and protein content, and other yield components due to N sources and rates. In general, ammonium sulfate and urea gave higher seed yield than ammonium nitrate. Mean values of both seasons indicated that 100 and 150 kg N ha-1 rate increased significantly yield and quality traits with regard to other N treatments. The present results highlight the practical importance of adequate N fertilization and true N source in seed yield in winter rapeseed and suggest that ammonium sulfate at 150 kg N ha-1 will be about adequate to meet crop N requirements.El raps (Brassica napus L. tiene potencial para convertirse en un cultivo oleaginoso alternativo para producción de aceite comestible y agricultura energética (producción de biodiesel en Turquía. Este estudio fue conducido para determinar el efecto del año, fuente y dosis de N en las características de rendimiento y calidad de raps en un sistema cerealero en suelos calcáreos en dos temporadas, 2000-2001 y 2001-2002, en Anatolia Central. Se aplicaron al voleo tres fuentes de N (sulfato de amonio, nitrato de amonio y urea en cinco dosis (0, 50, 100, 150 y 200 kg N ha-1. Las características investigadas fueron altura de planta, n

  16. Occurrence of Diaretiella rapae (Mc´Intosh, 1855 (Hymenoptera: Aphidiidae Parasitising Lipaphis erysimi (Kaltenbach, 1843 and Brevicoryne brassicae (L. 1758 (Homoptera: Aphididae in Brassica napus in Mato Grosso do Sul

    Directory of Open Access Journals (Sweden)

    Mussury Rosilda Mara


    Full Text Available The occurrence of Diaretiella rapae parasitising Lipaphis erysimi and Brevicoryne brassicae in canola field (Brassica napus was evaluated through two sample methods in Dourados-MS. The methods, used weekly, were: entomologic sweep net and plants sacking. The aphids population was observed from initial to the senescence plant development. Aphids were more abundant during the flowering phase, and they were usually located in the stems of the inflorescence and development fruits. In this phase the largest parasitism level for D. rapae (89,7% occurred. The sample method with a sweep net captured significantly (t=4,484, P <= 0,01 more D. rapae while sacking method captured more parasitise aphids (t=2,199 with P <= 0,05 and active aphids (t=3,513, P <= 0,01.

  17. Use of Plackett-Burman design for rapid screening of nitrogen and carbon sources for the production of lipase in solid state fermentation by Yarrowia lipolytica from mustard oil cake (Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarat Babu Imandi


    Full Text Available Mustard oil cake (Brassica napus, the residue obtained after extraction of mustard oil from mustard oil seeds, was investigated for the production of lipase under solid state fermentation (SSF using the marine yeast Yarrowia lipolytica NCIM 3589. Process parameters such as incubation time, biomass concentration, initial moisture content, carbon source concentration and nitrogen source concentration of the medium were optimized. Screening of ten nitrogen and five carbon sources has been accomplished with the help of Plackett-Burman design. The highest lipase activity of 57.89 units per gram of dry fermented substrate (U/gds was observed with the substrate of mustard oil cake in four days of fermentation.

  18. Identification and characterization of microRNAs in oilseed rape (Brassica napus) responsive to infection with the pathogenic fungus Verticillium longisporum using Brassica AA (Brassica rapa) and CC (Brassica oleracea) as reference genomes. (United States)

    Shen, Dan; Suhrkamp, Ina; Wang, Yu; Liu, Shenyi; Menkhaus, Jan; Verreet, Joseph-Alexander; Fan, Longjiang; Cai, Daguang


    Verticillium longisporum, a soil-borne pathogenic fungus, causes vascular disease in oilseed rape (Brassica napus). We proposed that plant microRNAs (miRNAs) are involved in the plant-V. longisporum interaction. To identify oilseed rape miRNAs, we deep-sequenced two small RNA libraries made from V. longisporum infected/noninfected roots and employed Brassica rapa and Brassica oleracea genomes as references for miRNA prediction and characterization. We identified 893 B. napus miRNAs representing 360 conserved and 533 novel miRNAs, and mapped 429 and 464 miRNAs to the AA and CC genomes, respectively. Microsynteny analysis with the conserved miRNAs and their flanking protein coding sequences revealed 137 AA-CC genome syntenic miRNA pairs and 61 AA and 42 CC genome-unique miRNAs. Sixty-two miRNAs were responsive to the V. longisporum infection. We present data for specific interactions and simultaneously reciprocal changes in the expression levels of the miRNAs and their targets in the infected roots. We demonstrate that miRNAs are involved in the plant-fungus interaction and that miRNA168-Argonaute 1 (AGO1) expression modulation might act as a key regulatory module in a compatible plant-V. longisporum interaction. Our results suggest that V. longisporum may have evolved a virulence mechanism by interference with plant miRNAs to reprogram plant gene expression and achieve infection. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  19. Establishment of compatibility in the Ustilago maydis/maize pathosystem

    NARCIS (Netherlands)

    Doehlemann, Gunther; Wahl, Ramon; Vranes, Miroslav; de Vries, Ronald P; Kämper, Jörg; Kahmann, Regine

    The fungus Ustilago maydis is a biotrophic pathogen parasitizing on maize. The most prominent symptoms of the disease are large tumors in which fungal proliferation and spore differentiation occur. In this study, we have analyzed early and late tumor stages by confocal microscopy. We show that

  20. The Venturia Apple Pathosystem: Pathogenicity Mechanisms and Plant Defense Responses

    Directory of Open Access Journals (Sweden)

    Gopaljee Jha


    Full Text Available Venturia inaequalis is the causal agent of apple scab, a devastating disease of apple. We outline several unique features of this pathogen which are useful for molecular genetics studies intended to understand plant-pathogen interactions. The pathogenicity mechanisms of the pathogen and overview of apple defense responses, monogenic and polygenic resistance, and their utilization in scab resistance breeding programs are also reviewed.

  1. Genetic basis of resistance in eucalyptus spp. pathosystems (United States)

    Acelino Couto Alfenas; Lucio Mauro da Silva Guimaraes; Marcos Deon Vilela Resende


    Eucalyptus is the most widely planted hardwood crop in world-wide tropical and subtropical regions because of its high growth rate, broad adaptability, and multipurpose wood properties. Until the 1970s, the Eucalyptus plantations in Brazil were practically disease free. However, plantations have continued to expand into warmer...

  2. Studies on the weed pathosystems Cirsium arvense - Puccinia punctiformis

    NARCIS (Netherlands)

    Frantzen, P.A.M.J.


    The biology and epidemiology of the rust fungus Puccinia punctiformis (Str.) Röhl was investigated to evaluate the potential of this rust as a biological agent against the clonal plant species Cirsium arvense (L) Scop., which is considered

  3. Interacting genes in the pine-fusiform rust forest pathosystem (United States)

    H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li


    Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...

  4. Quality of phytopathometric variables generated from a ranking scale for the CABMV-passionfruit pathosystem = Qualidade de variáveis fitopatométricas geradas a partir de escala de notas para o patossistema CABMV – maracujazeiro ‘amarelo’

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Mota Porto


    Full Text Available The Cowpea aphid-borne mosaic virus (CABMV is one of the most important pathogenic agents in passionfruit culture, causing extensive loss throughout the national territory. Efficient quantification of disease symptoms is highly dependent on the methodology used, and is directly related to the quality of data generated for later manipulation and analysis. Thus, our objective was to evaluate different methods of using the data collected using a scale based on quality of the generated variables, using statistical parameters. Assumptions of additivity, homoscedasticity and normality of the errors in parametric analysis were tested. Experimental quality, for each phytopatometric variable (PV was tested for calculated F (Fc, coefficient of determination (R² and coefficient of variation (CV%. Four different PVs were generated through a ranking scale: AUDPC-III, AUDPC-GS, III and GS. All variables met the assumptions for analysis of variance, with AUDPC-III and III PVs having slightly higher values in terms of adherence to normality, and AUDPC-GS and GS PVs having slightly higher values in terms of significance for additivity and homoscedasticity. AUDPC-III and III had the highest calculated R² and F values, and the highest coefficients of variation. We recorded the inverse for AUDPC-GS and GS, with lower coefficients of variation and higher R² and F values. A lower correlation, though still significant, was observed between AUDPC-GS and AUDPC-III, while a higher correlation was recorded between III and GS. Overall the PVs III and AUDPC-III systems were the best for use in the analyzes of the studied pathosystem. = O Cowpea aphid-borne mosaic virus (CABMV, responsável pelo endurecimento dos frutos do maracujazeiro, é um dos mais importantes agentes patogênicos na passicultura, pois causa grandes perdas em todo território nacional. A eficiência na quantificação dos sintomas foliares da doença é altamente dependente da metodologia empregada

  5. Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus

    Directory of Open Access Journals (Sweden)

    Yan Xiaohong


    Full Text Available Abstract Background The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. Results In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste and 253,507 (Fer distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs. In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE data. Conclusions A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in

  6. Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus. (United States)

    Yan, Xiaohong; Dong, Caihua; Yu, Jingyin; Liu, Wanghui; Jiang, Chenghong; Liu, Jia; Hu, Qiong; Fang, Xiaoping; Wei, Wenhui


    The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste) and 253,507 (Fer) distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs). In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE) data. A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in Nsa line, fertility restoration and improved agronomic

  7. VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

    Directory of Open Access Journals (Sweden)

    M. R. Barrón-Yánez


    (Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

  8. Genome-wide identification of QTL for seed yield and yield-related traits and construction of a high-density consensus map for QTL comparison in Brassica napus

    Directory of Open Access Journals (Sweden)

    Weiguo eZhao


    Full Text Available Seed yield (SY is the most important trait in rapeseed, which was determined by multiple seed yield-related traits (SYRTs and also easily subject to environmental influence. Lots of quantitative trait loci (QTL for SY and SYRTs were reported in Brassica napus. However, no studies have focused on SY and seven agronomic traits affecting SY simultaneous. Genome-wide QTL analysis for SY and seven SYRTs in eight environments was conducted in a doubled haploid population containing 348 lines. Totally, 18 and 208 QTLs for SY and SYRTs were observed, respectively, and then these QTLs were integrated into 144 consensus QTLs by a meta-analysis. Three major QTLs for SY were observed, including cqSY-C6-2 and cqSY-C6-3 that expressed stably in winter cultivation area for three years and cqSY-A2-2 only expressed in spring rapeseed area. Trait-by-trait meta-analysis revealed that the 144 consensus QTLs were integrated into 72 pleiotropic unique QTLs. Among them, all the unique QTLs affected SY, except for uq-A6-1, including uq.A2-3, uq.C1-2, uq.C1-3, uq.C6-1, uq.C6-5 and uq.C6-6 could also affect more than two SYRTs. According to high density consensus map construction and QTL comparison from literature, 36 QTLs from five populations were co-localized with QTLs identified in this study. In addition, 13 orthologs genes were observed, including five each genes for SY and SW, one each gene for BY, BH and PH, respectively. The genomic information of these QTLs would be valuable in hybrid cultivar breeding, and be helpful to analyze QTL expression in different environments.

  9. Effects of derived meals from juncea (Brassica juncea, yellow and black seeded canola (Brassica napus and multicarbohydrase enzymes supplementation on apparent metabolizable energy in broiler chickens

    Directory of Open Access Journals (Sweden)

    Balachandar Jayaraman


    Full Text Available Two experiments were conducted to determine the nitrogen-corrected apparent metabolizable energy (AMEn of differently processed meals from Juncea (Brassica juncea, yellow and black seeded canola (Brassica napus, with or without supplementation of multi-carbohydrase enzymes (Enz in diets for broiler chickens. The first experiment was a 3 × 2 × 2 factorial arrangement with the main factors being seed type (yellow [Yellow] or black [B1] canola seeds and Juncea seeds, processed at two temperatures (high temperature desolventized-toasted [HTDT] at 95°C or low temperature desolventized-toasted [LTDT] at 57°C, with or without Enz. In Exp. 1, a total of 384 one-day-old male broiler chicks were randomly assigned to 64 battery cages, with 6 birds/cage. The second experiment was a 2 × 2 × 2 factorial arrangement with the main factors being seed type (Yellow or black [B2], seed source (Scott, Saskatchewan or Truro, Nova Scotia and Enz (with or without supplementation. A total of 264 one-day-old male broiler chicks were randomly assigned to 44 battery cages, with 6 birds per cage. In Exp. 1 and 2, all birds were fed a common starter diet from 1 to 14 days of age. From d 15 to 21, the birds were fed one of the test treatments, a basal grower diet or the basal grower diet replaced with 30% test ingredient with celite (0.8% added as an inert marker. Excreta was collected on d 20 and 21. In Exp. 1, there were no interactions (P > 0.05 among seed type, processing temperature and Enz. Processing temperature and dietary Enz did not affect (P > 0.05 AMEn of different canola meals. The AMEn of prepress solvent extracted canola and juncea meals (PSEM from Yellow (11.2 MJ/kg was higher (P  0.05 among seed color, location and Enz. Supplementation of dietary Enz did not affect (P > 0.05 AMEn of different cold press canola meals. The AMEn of cold press canola meals (CPM from Yellow (14.7 MJ/kg was higher (P < 0.05 compared with B2 (12.2

  10. Growth and "1"3"7Cs uptake and accumulation among 56 Japanese cultivars of Brassica rapa, Brassica juncea and Brassica napus grown in a contaminated field in Fukushima: Effect of inoculation with a Bacillus pumilus strain

    International Nuclear Information System (INIS)

    Djedidi, Salem; Kojima, Katsuhiro; Ohkama-Ohtsu, Naoko; Bellingrath-Kimura, Sonoko Dorothea; Yokoyama, Tadashi


    Fifty six local Japanese cultivars of Brassica rapa (40 cultivars), Brassica juncea (10 cultivars) and Brassica napus (6 cultivars) were assessed for variability in growth and "1"3"7Cs uptake and accumulation in association with a Bacillus pumilus strain. Field trial was conducted at a contaminated farmland in Nihonmatsu city, in Fukushima prefecture. Inoculation resulted in different responses of the cultivars in terms of growth and radiocesium uptake and accumulation. B. pumilus induced a significant increase in shoot dry weight in 12 cultivars that reached up to 40% in one B. rapa and three B. juncea cultivars. Differences in radiocesium uptake were observed between the cultivars of each Brassica species. Generally, inoculation resulted in a significant increase in "1"3"7Cs uptake in 22 cultivars, while in seven cultivars it was significantly decreased. Regardless of plant cultivar and bacterial inoculation, the transfer of "1"3"7Cs to the plant shoots (TF) varied by a factor of up to 5 and it ranged from to 0.011 to 0.054. Five inoculated cultivars, showed enhanced shoot dry weights and decreased "1"3"7Cs accumulations, among which two B. rapa cultivars named Bitamina and Nozawana had a significantly decreased "1"3"7Cs accumulation in their shoots. Such cultivars could be utilized to minimize the entry of radiocesium into the food chain; however, verifying the consistency of their radiocesium accumulation in other soils is strongly required. Moreover, the variations in growth and radiocesium accumulation, as influenced by Bacillus inoculation, could help selecting well grown inoculated Brassica cultivars with low radiocesium accumulation in their shoots. - Highlights: • Out of 56 Brassica cultivars, inoculation significantly increased shoot dry weight in 12 cultivars. • Inoculation triggered a significant increase and decrease in "1"3"7Cs uptake, respectively in 22 and 7 cultivars. • Five cultivars had an enhanced shoot dry weight and decreased "1"3"7Cs

  11. Cluster Analysis in Rapeseed (Brassica Napus L.)

    International Nuclear Information System (INIS)

    Mahasi, J.M


    With widening edible deficit, Kenya has become increasingly dependent on imported edible oils. Many oilseed crops (e.g. sunflower, soya beans, rapeseed/mustard, sesame, groundnuts etc) can be grown in Kenya. But oilseed rape is preferred because it very high yielding (1.5 tons-4.0 tons/ha) with oil content of 42-46%. Other uses include fitting in various cropping systems as; relay/inter crops, rotational crops, trap crops and fodder. It is soft seeded hence oil extraction is relatively easy. The meal is high in protein and very useful in livestock supplementation. Rapeseed can be straight combined using adjusted wheat combines. The priority is to expand domestic oilseed production, hence the need to introduce improved rapeseed germplasm from other countries. The success of any crop improvement programme depends on the extent of genetic diversity in the material. Hence, it is essential to understand the adaptation of introduced genotypes and the similarities if any among them. Evaluation trials were carried out on 17 rapeseed genotypes (nine Canadian origin and eight of European origin) grown at 4 locations namely Endebess, Njoro, Timau and Mau Narok in three years (1992, 1993 and 1994). Results for 1993 were discarded due to severe drought. An analysis of variance was carried out only on seed yields and the treatments were found to be significantly different. Cluster analysis was then carried out on mean seed yields and based on this analysis; only one major group exists within the material. In 1992, varieties 2,3,8 and 9 didn't fall in the same cluster as the rest. Variety 8 was the only one not classified with the rest of the Canadian varieties. Three European varieties (2,3 and 9) were however not classified with the others. In 1994, varieties 10 and 6 didn't fall in the major cluster. Of these two, variety 10 is of Canadian origin. Varieties were more similar in 1994 than 1992 due to favorable weather. It is evident that, genotypes from different geographical areas fell in the same clusters suggesting that they have genetic similarity. Interestingly, varieties from Europe fell in the same cluster as introductions from Canada. This was expected since rapeseed material has moved around the world with other breeding programs. The groupings indicated no correspondence between geographical diversity and clustering pattern

  12. Xerophilic mycopopulations isolated from rapeseeds (Brassica napus

    Directory of Open Access Journals (Sweden)

    Škrinjar Marija M.


    Full Text Available This paper presents the results of an investigation related to mycological populations of rapeseed samples produced in the Institute of Field and Vegetable Crops in Novi Sad (location: Rimski Šančevi, Novi Sad, with a special emphasis on the potentially toxigenic mycopopulations. Mycological investigations were performed on the samples that were treated with 4% solution of Na-hypochlorite, and on the ones that were not submitted to this treatment. Isolation and determination of total mould count was carried out using Dichloran Glycerol Agar (DG18. The identification of isolated moulds was done according to modern keys for fungal determination. From 20 untreated tested samples, 17 were contaminated with moulds (10.0 to 4.7x102 cfu/g. When the samples were treated with 4% solution of Na-hypochlorite, moulds were isolated only form 4 samples, and the total mould count ranged from 10.0 to 60.0 cfu/g. In the isolated mycopopulations, xerophilic moulds dominated, especially those from the genera Aspergillus, Eurotium and Penicillium. In the isolated mycopopulations, high degree of isolated species belonged to toxigenic species from the genera Alternaria, Aspergillus, Fusarium, Eurotium and Penicillium. [Projekat Ministarstva nauke Republike Srbije, br. III46009 i br.TR31025

  13. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box. (United States)

    Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L


    The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

  14. Evidence for resistance polymorphism in the Bromus tectorum/Ustilago bullata pathosystem: implications for biocontrol (United States)

    S. E. Meyer; D. L. Nelson; S. Clement


    Bromus tectorum L. (cheatgrass or downy brome) is an important exotic weed in natural ecosystems as well as in winter cereal cropland in semiarid western North America. The systemic, seedling-infecting head smut pathogen Ustilago bullata Berk. commonly infects cheatgrass stands, often at epidemic levels. We examined factors...

  15. Genome-Wide Association Studies In Plant Pathosystems: Toward an Ecological Genomics Approach

    Directory of Open Access Journals (Sweden)

    Claudia Bartoli


    Full Text Available The emergence and re-emergence of plant pathogenic microorganisms are processes that imply perturbations in both host and pathogen ecological niches. Global change is largely assumed to drive the emergence of new etiological agents by altering the equilibrium of the ecological habitats which in turn places hosts more in contact with pathogen reservoirs. In this context, the number of epidemics is expected to increase dramatically in the next coming decades both in wild and crop plants. Under these considerations, the identification of the genetic variants underlying natural variation of resistance is a pre-requisite to estimate the adaptive potential of wild plant populations and to develop new breeding resistant cultivars. On the other hand, the prediction of pathogen's genetic determinants underlying disease emergence can help to identify plant resistance alleles. In the genomic era, whole genome sequencing combined with the development of statistical methods led to the emergence of Genome Wide Association (GWA mapping, a powerful tool for detecting genomic regions associated with natural variation of disease resistance in both wild and cultivated plants. However, GWA mapping has been less employed for the detection of genetic variants associated with pathogenicity in microbes. Here, we reviewed GWA studies performed either in plants or in pathogenic microorganisms (bacteria, fungi and oomycetes. In addition, we highlighted the benefits and caveats of the emerging joint GWA mapping approach that allows for the simultaneous identification of genes interacting between genomes of both partners. Finally, based on co-evolutionary processes in wild populations, we highlighted a phenotyping-free joint GWA mapping approach as a promising tool for describing the molecular landscape underlying plant - microbe interactions.

  16. Calcium oxalate crystals: an integral component of the Sclerotinia sclerotiorum/Brassica carinata pathosystem.

    Directory of Open Access Journals (Sweden)

    Margaret B Uloth

    Full Text Available Oxalic acid is an important virulence factor for disease caused by the fungal necrotrophic pathogen Sclerotinia sclerotiorum, yet calcium oxalate (CaOx crystals have not been widely reported. B. carinata stems were infected with S. sclerotiorum and observed using light microscopy. Six hours post inoculation (hpi, CaOx crystals were evident on 46% of stem sections and by 72 hpi on 100%, demonstrating that the secretion of oxalic acid by S. sclerotiorum commences before hyphal penetration. This is the first time CaOx crystals have been reported on B. carinata infected with S. sclerotiorum. The shape of crystals varied as infection progressed. Long tetragonal rods were dominant 12 hpi (68% of crystal-containing samples, but by 72 hpi, 50% of stems displayed bipyramidal crystals, and only 23% had long rods. Scanning electron microscopy from 24 hpi revealed CaOx crystals in all samples, ranging from tiny irregular crystals (< 0.5 μm to large (up to 40 μm highly organized arrangements. Crystal morphology encompassed various forms, including tetragonal prisms, oval plates, crystal sand, and druses. Large conglomerates of CaOx crystals were observed in the hyphal mass 72 hpi and these are proposed as a strategy of the fungus to hold and detoxify Ca2+ions. The range of crystal morphologies suggests that S. sclerotiorum growth and infection controls the form taken by CaOx crystals.

  17. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result of the corresponding up- and down-regulation of these genes.

  18. Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem (United States)

    Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo


    The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

  19. Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem. (United States)

    Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo


    The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

  20. Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

    Directory of Open Access Journals (Sweden)

    Felix E Enciso-Rodríguez

    Full Text Available The Cape gooseberry (Physalisperuviana L is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site, CC (Coiled-Coil, TIR (Toll/Interleukin-1 Receptor. We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene architecture, 17 Receptor like kinase (RLKs candidates related to PAMP-Triggered Immunity (PTI, eight (TIR-NBS-LRR, or TNL and nine (CC-NBS-LRR, or CNL candidates related to Effector-Triggered Immunity (ETI genes among others. These candidate genes were categorized by molecular function (98%, biological process (85% and cellular component (79% using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

  1. The FonSIX6 gene acts as an avirulence effector in the Fusarium oxysporum f. sp. niveum - watermelon pathosystem (United States)

    There are three generally accepted Fusarium oxysporum f. sp. niveum (Fon) physiological races (0, 1, and 2) that infect watermelon (Citrullus lanatus). Among them, race 1 is the most prevalent on watermelon throughout the world, while race 2 is highly aggressive to all commercial watermelon cultivar...

  2. Simultaneous transcriptome analysis of Colletotrichum gloeosporioides and tomato fruit pathosystem reveals novel fungal pathogenicity and fruit defense strategies. (United States)

    Alkan, Noam; Friedlander, Gilgi; Ment, Dana; Prusky, Dov; Fluhr, Robert


    The fungus Colletotrichum gloeosporioides breaches the fruit cuticle but remains quiescent until fruit ripening signals a switch to necrotrophy, culminating in devastating anthracnose disease. There is a need to understand the distinct fungal arms strategy and the simultaneous fruit response. Transcriptome analysis of fungal-fruit interactions was carried out concurrently in the appressoria, quiescent and necrotrophic stages. Conidia germinating on unripe fruit cuticle showed stage-specific transcription that was accompanied by massive fruit defense responses. The subsequent quiescent stage showed the development of dendritic-like structures and swollen hyphae within the fruit epidermis. The quiescent fungal transcriptome was characterized by activation of chromatin remodeling genes and unsuspected environmental alkalization. Fruit response was portrayed by continued highly integrated massive up-regulation of defense genes. During cuticle infection of green or ripe fruit, fungi recapitulate the same developmental stages but with differing quiescent time spans. The necrotrophic stage showed a dramatic shift in fungal metabolism and up-regulation of pathogenicity factors. Fruit response to necrotrophy showed activation of the salicylic acid pathway, climaxing in cell death. Transcriptome analysis of C. gloeosporioides infection of fruit reveals its distinct stage-specific lifestyle and the concurrent changing fruit response, deepening our perception of the unfolding fungal-fruit arms and defenses race. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  3. Ascorbate peroxidase gene from Brassica napus enhances salt and ...

    African Journals Online (AJOL)



    Dec 12, 2011 ... enhances salt and drought tolerances in Arabidopsis ... Laboratory of Hydraulics and Mountain River Engineering, Sichuan University, Chengdu, .... CCTTCGCAAGACCCTTCCTC-3′) and the reverse primer annealed.

  4. Expression of human interferon gamma in Brassica napus seeds

    African Journals Online (AJOL)



    Aug 9, 2010 ... resulted band was purified using the agarose gel DNA extraction kit. (Roche). ..... rape seed napin structure and potential roles of the storage protein. ... the sensitivity of progressive multiple sequence alignment through.

  5. Bee assemblage in habitats associated with Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Rosana Halinski


    Full Text Available ABSTRACTAssessments in agricultural crops indicate that alterations in the landscape adjacent to the crops can result in reduced productivity due to loss or low abundance of pollinating agents. In the canola crop, production is partially dependent on insect pollination. Therefore, knowledge of the faunal diversity within and near crop fields is key for the management of these insects and consequently for the increase in productivity. This study aimed to determine and compare the diversity of bees in habitats associated with canola fields in southern Brazil. Bees were captured in four agricultural areas using pan traps in three habitat classes: (1 flowering canola crop, (2 forest remnant, and (3 grassland vegetation. The highest abundance of bees was observed in the grassland vegetation (50% and in the flowering canola field (47%. Eight species common to the three habitat classes were recorded, four of which are represented by native social bees. In addition, a single or a few individuals represented species that were exclusive to a specific habitat class; eight species were collected exclusively in the interior of the canola field, 51 in the grassland vegetation, and six in the forest remnant. The majority of the rare species recorded exhibits subsocial or solitary behaviour and inhabit open places. The composition of bee groups differed between the habitats showing the importance of maintaining habitat mosaics with friendly areas for pollinators, which promote the pollination service for canola flowers.

  6. A new time-saving transformation system for Brassica napus

    African Journals Online (AJOL)



    Jun 3, 2009 ... blotting analysis and green fluorescent protein assay. Key words: ... ammonium bromide; GFP, green fluorescent protein; NAA, naphthalene acetic ... This method has many advantages such as an efficient introduction and ...

  7. Ascorbate peroxidase gene from Brassica napus enhances salt and ...

    African Journals Online (AJOL)

    Moreover, under the drought stress, BnAPX transgenic seeds displayed higher germination rate and the seedlings showed reduced wither and apoptosis phenomena. Therefore, our studies revealed that BnAPX was able to enhance the environmental tolerance of Arabidopsis to salt and drought stresses. In addition ...

  8. Rapeseed (Brassica napus L. as a protein plant species

    Directory of Open Access Journals (Sweden)

    Marinković Radovan


    Full Text Available Proteins of plant origin have a profound impact on human and animal lives. It is impossible to solve worldwide nutrition problem without taking into concern needs for proteins. Inadequate nutrition can only be improved by providing adequate proteins. Humans need c. 120g proteins daily, a third of which should come from meat and milk. Certain population categories, such as the sick, children, pregnant women and sportspeople are more sensitive to lack of protein. Oil crops synthesise oil, which is the basic reserve material in seed, but they also synthesise high levels of protein and can serve as protein source for human and animal nutrition. Generally speaking, protein content in seed of rapeseed at site R. Šančevi was from 19.60% (NS-L-74 to 25.93% JR-NS-36, and at site Sombor from 19.26% (NS-L-74 to 24.06% and 24.09% (NS-L-46 and cultivar Mira. Genotype NS-L-74 had the lowest protein content at both testing sites. Higher protein content was evident with spring genotypes than with winter gentypes. .

  9. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and ... 2008). DNA markers have essential role in the reconstruction of evolutionary rela- ... Genomic DNA was extracted from fresh leaves using. Gene JET Plant ...

  10. Applying Mendelian rules in rapeseed (Brassica napus breeding

    Directory of Open Access Journals (Sweden)

    Marjanović-Jeromela Ana


    Full Text Available Rapeseed is one of the most important sources of edible oil, raw material for industry, as well as feed. The yield and quality of rapeseed have significantly been improved in recent decades as a result of intensive breeding and optimized production technology. The application of Mendel's rules in introducing monogenic traits has also contributed to success in rapeseed breeding. Rule 1, which refers to the uniformity of F1 generation, is now the basis of widespread development of rapeseed hybrids. Rule 2, dealing with genetic segregation in the F2 generation, is the basis for understanding the process of breeding lines. Rule 3, regarding the independent segregation of genes and traits, while exempting linked traits, is the basis of combining different desirable properties by selection. In the last few decades, the systematic use of Mendel's rules has contributed to the improvement of many properties of rapeseed, including tolerance to biotic and abiotic stress, yield and seed quality. Particular progress has been made in breeding for resistance to diseases, including the identification of molecular markers for marker-assisted selection. The next objective of rapeseed breeding is to create varieties with improved tolerance to environmental stress (e.g. frost, heat, and drought. Based on Mendel's rules, classical breeding methods and the latest developments in the field of molecular genetics and breeding, future progress is expected in the field of rapeseed breeding with an emphasis on polygenic, quantitative traits such as biomass, seed, and oil yield.

  11. Immunopurification and characterization of a rape (Brassica napus L.)

    African Journals Online (AJOL)


    centrifugation, ultracentrifugation and affinity chromatography using polyclonal antibodies raised against porcine ... on plant lipases, particularly from oil seeds, have been essentially ..... crude extract (lanes 2 and 3) as found in the sunflower.

  12. Genomic Prediction of Testcross Performance in Canola (Brassica napus) (United States)

    Jan, Habib U.; Abbadi, Amine; Lücke, Sophie; Nichols, Richard A.; Snowdon, Rod J.


    Genomic selection (GS) is a modern breeding approach where genome-wide single-nucleotide polymorphism (SNP) marker profiles are simultaneously used to estimate performance of untested genotypes. In this study, the potential of genomic selection methods to predict testcross performance for hybrid canola breeding was applied for various agronomic traits based on genome-wide marker profiles. A total of 475 genetically diverse spring-type canola pollinator lines were genotyped at 24,403 single-copy, genome-wide SNP loci. In parallel, the 950 F1 testcross combinations between the pollinators and two representative testers were evaluated for a number of important agronomic traits including seedling emergence, days to flowering, lodging, oil yield and seed yield along with essential seed quality characters including seed oil content and seed glucosinolate content. A ridge-regression best linear unbiased prediction (RR-BLUP) model was applied in combination with 500 cross-validations for each trait to predict testcross performance, both across the whole population as well as within individual subpopulations or clusters, based solely on SNP profiles. Subpopulations were determined using multidimensional scaling and K-means clustering. Genomic prediction accuracy across the whole population was highest for seed oil content (0.81) followed by oil yield (0.75) and lowest for seedling emergence (0.29). For seed yieId, seed glucosinolate, lodging resistance and days to onset of flowering (DTF), prediction accuracies were 0.45, 0.61, 0.39 and 0.56, respectively. Prediction accuracies could be increased for some traits by treating subpopulations separately; a strategy which only led to moderate improvements for some traits with low heritability, like seedling emergence. No useful or consistent increase in accuracy was obtained by inclusion of a population substructure covariate in the model. Testcross performance prediction using genome-wide SNP markers shows considerable potential for pre-selection of promising hybrid combinations prior to resource-intensive field testing over multiple locations and years. PMID:26824924

  13. Cytokinins in shoot apices of Brassica napus plants during vernalization

    Czech Academy of Sciences Publication Activity Database

    Tarkowská, Danuše; Filek, M.; Biesaga-Koscielniak, J.; Marcinska, I.; Macháčková, Ivana; Krekule, Jan; Strnad, Miroslav


    Roč. 187, č. 1 (2012), s. 105-112 ISSN 0168-9452 R&D Projects: GA AV ČR KAN200380801; GA MŠk ED0007/01/01 Keywords : Cytokinins * Vernalization * Winter rape * Flowering Subject RIV: EF - Botanics Impact factor: 2.922, year: 2012


    Gene exchange between cultivated crops and wild species has gained significance in recent years because of concerns regarding the potential for gene flow between genetically modified (GM) crops and their domesticated and wild relatives. As part of our ecological effects of gene ...

  15. Temporal Gene Expression Profiling of the Wheat Leaf Rust Pathosystem Using cDNA Microarray Reveals Differences in Compatible and Incompatible Defence Pathways


    Fofana, Bourlaye; Banks, Travis W.; McCallum, Brent; Strelkov, Stephen E.; Cloutier, Sylvie


    In this study, we detail the construction of a custom cDNA spotted microarray containing 7728 wheat ESTs and the use of the array to identify host genes that are differentially expressed upon challenges with leaf rust fungal pathogens. Wheat cultivar RL6003 (Thatcher Lr1) was inoculated with Puccinia triticina virulence phenotypes BBB (incompatible) or TJB (7-2) (compatible) and sampled at four different time points (3, 6, 12, and 24 hours) after inoculation. Transcript expression levels rela...

  16. A Network Approach of Gene Co-expression in the Zea mays/Aspergillus flavus Pathosystem to Map Host/Pathogen Interaction Pathways (United States)

    Musungu, Bryan M.; Bhatnagar, Deepak; Brown, Robert L.; Payne, Gary A.; OBrian, Greg; Fakhoury, Ahmad M.; Geisler, Matt


    A gene co-expression network (GEN) was generated using a dual RNA-seq study with the fungal pathogen Aspergillus flavus and its plant host Zea mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network revealed a high degree of connectivity in many of the previously recognized pathways in Z. mays such as jasmonic acid, ethylene, and reactive oxygen species (ROS). For the pathogen A. flavus, a link between aflatoxin production and vesicular transport was identified within the network. There was significant interspecies correlation of expression between Z. mays and A. flavus for a subset of 104 Z. mays, and 1942 A. flavus genes. This resulted in an interspecies subnetwork enriched in multiple Z. mays genes involved in the production of ROS. In addition to the ROS from Z. mays, there was enrichment in the vesicular transport pathways and the aflatoxin pathway for A. flavus. Included in these genes, a key aflatoxin cluster regulator, AflS, was found to be co-regulated with multiple Z. mays ROS producing genes within the network, suggesting AflS may be monitoring host ROS levels. The entire GEN for both host and pathogen, and the subset of interspecies correlations, is presented as a tool for hypothesis generation and discovery for events in the early stages of fungal infection of Z. mays by A. flavus. PMID:27917194

  17. A Network Approach of Gene Co-expression in the Zea mays/Aspergillus flavus Pathosystem to Map Host/Pathogen Interaction Pathways


    Musungu, Bryan M.; Bhatnagar, Deepak; Brown, Robert L.; Payne, Gary A.; OBrian, Greg; Fakhoury, Ahmad M.; Geisler, Matt


    A gene co-expression network (GEN) was generated using a dual RNA-seq study with the fungal pathogen Aspergillus flavus and its plant host Zea mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network revealed a high degree of connectivity in many of the previously recognized pathways in Z. mays such as jasmonic acid, ethylene, and reactive oxygen species (ROS). For the pathogen A. flav...

  18. Characterisation of an Arabidopsis-Leptosphaeria maculans pathosystem: resistance partially requires camalexin biosynthesis and is independent of salicylic acid, ethylene and jasmonic acid signalling

    NARCIS (Netherlands)

    Bohman, S.; Staal, J.; Thomma, B.P.H.J.; Wang, M.; Dixelius, C.


    Out of 168 Arabidopsis accessions screened with isolates of Leptosphaeria maculans, one (An-1) showed clear disease symptoms. In order to identify additional components involved in containment of L. maculans in Arabidopsis, a screen for L. maculans-susceptible (lms) mutants was performed. Eleven lms

  19. A Network Approach of Gene Co-expression in the Zea mays/Aspergillus flavus Pathosystem to Map Host/Pathogen Interaction Pathways. (United States)

    Musungu, Bryan M; Bhatnagar, Deepak; Brown, Robert L; Payne, Gary A; OBrian, Greg; Fakhoury, Ahmad M; Geisler, Matt


    A gene co-expression network (GEN) was generated using a dual RNA-seq study with the fungal pathogen Aspergillus flavus and its plant host Zea mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network revealed a high degree of connectivity in many of the previously recognized pathways in Z. mays such as jasmonic acid, ethylene, and reactive oxygen species (ROS). For the pathogen A. flavus , a link between aflatoxin production and vesicular transport was identified within the network. There was significant interspecies correlation of expression between Z. mays and A. flavus for a subset of 104 Z. mays , and 1942 A. flavus genes. This resulted in an interspecies subnetwork enriched in multiple Z. mays genes involved in the production of ROS. In addition to the ROS from Z. mays , there was enrichment in the vesicular transport pathways and the aflatoxin pathway for A. flavus . Included in these genes, a key aflatoxin cluster regulator, AflS, was found to be co-regulated with multiple Z. mays ROS producing genes within the network, suggesting AflS may be monitoring host ROS levels. The entire GEN for both host and pathogen, and the subset of interspecies correlations, is presented as a tool for hypothesis generation and discovery for events in the early stages of fungal infection of Z. mays by A. flavus .

  20. Phytohormone Involvement in the Ustilago maydis- Zea mays Pathosystem: Relationships between Abscisic Acid and Cytokinin Levels and Strain Virulence in Infected Cob Tissue.

    Directory of Open Access Journals (Sweden)

    Erin N Morrison

    Full Text Available Ustilago maydis is the causative agent of common smut of corn. Early studies noted its ability to synthesize phytohormones and, more recently these growth promoting substances were confirmed as cytokinins (CKs. Cytokinins comprise a group of phytohormones commonly associated with actively dividing tissues. Lab analyses identified variation in virulence between U. maydis dikaryon and solopathogen infections of corn cob tissue. Samples from infected cob tissue were taken at sequential time points post infection and biochemical profiling was performed using high performance liquid chromatography-electrospray ionization tandem mass spectrometry (HPLC-ESI MS/MS. This hormone profiling revealed that there were altered levels of ABA and major CKs, with a marked reduction in CK glucosides, increases in methylthiol CKs and a particularly dramatic increase in cisZ CK forms, in U. maydis infected tissue. These changes were more pronounced in the more virulent dikaryon relative to the solopathogenic strain suggesting a role for cytokinins in moderating virulence during biotrophic infection. These findings highlight the fact that U. maydis does not simply mimic a fertilized seed but instead reprograms the host tissue. Results underscore the suitability of the Ustilago maydis- Zea mays model as a basis for investigating the control of phytohormone dynamics during biotrophic infection of plants.

  1. Derivation of host and pathogen genotypes in the fusiform rust pathosystem on slash pine using a complimentary genetics model and diallel data (United States)

    H.E. Stelzel; Robert L. Doudrick; Thomas L. Kubisiak


    Seedlings from 20, full-sib families five-parent slash pine diallel were inoculated using two, single urediniospore-derived cultures of the fusiform rust fungus on two different dates during the 1994 growing season. Presence or absence of fusiform rust galls was recorded for each inoculated seedling at nine months post-inoculation and percent infection levels for each...

  2. Identification of an A2 population of Phythophthora andina attacking tree tomato in Peru indicates a risk of sexual reproduction in this pathosystem


    Oliva Pérez, Ricardo Francisco


    Tree tomato, Solanum betaceum , is an Andean fruit crop previously shown to be attacked by Phytophthora andina in Ecuador and Colombia. Blight-like symptoms were discovered on tree tomato plants in the central highlands of Peru in 2003 and shown to be caused by P. andina. Isolates of P. andina, collected from three different plantations in Peru over a 6-year time span (2003–2008), were compared genetically with P. andina isolates from Colombia and Ecuador to test whether the pathogen populati...

  3. Inheritance of rapeseed (Brassica napus)-specific RAPD markers and a transgene in the cross B.juncea x (B.juncea x B.napus)

    DEFF Research Database (Denmark)

    Frello, S.; Hansen, K.R.; Jensen, J.


    , with B. juncea as the female parent, was successful both in controlled crosses and spontaneously in the field. The controlled backcrossing of selected hybrids to B. juncea, again with B. juncea as the female parent, also resulted in many seeds. The BC1 plants contained from 0 to 20 of the rapeseed RAPD...

  4. Trophic Relationships between the Parasitic Plant Species Phelipanche ramosa (L.) and Different Hosts Depending on Host Phenological Stage and Host Growth Rate (United States)

    Moreau, Delphine; Gibot-Leclerc, Stéphanie; Girardin, Annette; Pointurier, Olivia; Reibel, Carole; Strbik, Florence; Fernández-Aparicio, Mónica; Colbach, Nathalie


    Phelipanche ramosa (L.) Pomel (branched broomrape) is a holoparasitic plant that reproduces on crops and also on weeds, which contributes to increase the parasite seed bank in fields. This parasite extracts all its nutrients at the host’s expense so that host–parasite trophic relationships are crucial to determine host and parasite growth. This study quantified the intensity with which P. ramosa draws assimilates from its host and analyzed whether it varied with host species, host phenological stage and host growth rate. A greenhouse experiment was conducted on three host species: the crop species Brassica napus (L.) (oilseed rape) and two weed species, Capsella bursa-pastoris (L.) Medik. and Geranium dissectum (L.). Plants were grown with or without P. ramosa and under three light levels to modulate host growth rate. The proportion of host biomass loss due to parasitism by P. ramosa differed between host species (at host fructification, biomass loss ranged from 34 to 84%). B. napus and C. bursa-pastoris displayed a similar response to P. ramosa, probably because they belong to the same botanical family. The sensitivity to P. ramosa in each host species could be related to the precocity of P. ramosa development on them. Host compartments could be ranked as a function of their sensitivity to parasitism, with the reproductive compartment being the most severely affected, followed by stems and roots. The proportion of biomass allocated to leaves was not reduced by parasitism. The proportion of pathosystem biomass allocated to the parasite depended on host species. It generally increased with host stage progression but was constant across light induced-host growth rate, showing that P. ramosa adapts its growth to host biomass production. The rank order of host species in terms of sink strength differed from that in terms of host sensitivity. Finally, for B. napus, the biomass of individual parasite shoots decreased with increasing their number per host plant

  5. Trophic relationships between the parasitic plant species Phelipanche ramosa (L. and different hosts depending on host phenological stage and host growth rate

    Directory of Open Access Journals (Sweden)

    Delphine Moreau


    Full Text Available Phelipanche ramosa (L. Pomel (branched broomrape is a holoparasitic plant that reproduces on crops and also on weeds, which contributes to increase the parasite seed bank in fields. This parasite extracts all its nutrients at the host's expense so that host-parasite trophic relationships are crucial to determine host and parasite growth. This study quantified the intensity with which P. ramosa draws assimilates from its host and analyzed whether it varied with host species, host phenological stage and host growth rate. A greenhouse experiment was conducted on three host species: the crop species Brassica napus (L. (oilseed rape and two weed species, Capsella bursa-pastoris (L. Medik. and Geranium dissectum (L.. Plants were grown with or without P. ramosa and under three light levels to modulate host growth rate. The proportion of host biomass loss due to parasitism by P. ramosa differed between host species (at host fructification, biomass loss ranged from 34% to 84%. Brassica napus and C. bursa-pastoris displayed a similar response to P. ramosa, probably because they belong to the same botanical family. The sensitivity to P. ramosa in each host species could be related to the precocity of P. ramosa development on them. Host compartments could be ranked as a function of their sensitivity to parasitism, with the reproductive compartment being the most severely affected, followed by stems and roots. The proportion of biomass allocated to leaves was not reduced by parasitism. The proportion of pathosystem biomass allocated to the parasite depended on host species. It generally increased with host stage progression but was constant across light induced-host growth rate, showing that P. ramosa adapts its growth to host biomass production. The rank order of host species in terms of sink strength differed from that in terms of host sensitivity. Finally, for B. napus, the biomass of individual parasite shoots decreased with increasing their number per

  6. Cell Wall Components of Leptosphaeria maculans Enhance Resistance of Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Kim, P.D.; Šašek, Vladimír; Burketová, Lenka; Čopíková, J.; Synytsya, A.; Jindřichová, Barbora; Valentová, O.


    Roč. 61, č. 22 (2013), s. 5207-5214 ISSN 0021-8561 R&D Projects: GA ČR GA522/08/1581; GA MZe QH81201 Institutional research plan: CEZ:AV0Z50380511 Keywords : elicitor * oligosaccharide * Leptosphaeria maculans Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 3.107, year: 2013

  7. Abnormal spindles in second meiosis in canola (Brassica napus and Brassica campestris

    Directory of Open Access Journals (Sweden)

    Alice Maria de Souza


    Full Text Available Studies were carried out on the occurrence of abnormal spindles in the second meiotic division in some canola cultivars recently introduced in Brazil. Fusion of spindles was observed in metaphase II rejoining the two sets of chromosomes segregated in anaphase I and also sequential and tripolar spindles were discovered rejoining two sets of chromatids segregated in anaphase II. The frequency of cells with abnormal spindles ranged from 3.18 to 8.10%. The results suggested that this abnormality was caused by environmental stress that affected the plants during the blooming period.O presente estudo descreve a ocorrência de fusos anormais na segunda divisão meiótica em algumas cultivares da canola recentemente introduzidas no Brasil. Fusão de fusos foi observada em metáfase II reunindo os dois conjuntos cromossômicos segregados na anáfase I; fusos sequenciais e tripolares reunindo cromátides segregadas na anáfase II também foram observados. A frequência de células com fusos anormais variou de 3,18 a 8,10% entre as variedades. Os resultados sugerem que estas anormalidades foram causadas por condições climáticas adversas que afetaram as plantas no período de florescimento. As implicações genéticas destas anormalidades são descritas.

  8. Evaluation of Application Methods Efficiency of Zinc and Iron for Canola(Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Ahmad BYBORDI


    Full Text Available In order to evaluation of application method efficiency of zinc and iron microelements in canola, an experiment was conducted in the Agricultural Research Station of Eastern Azerbaijan province in 2008. The experimental design was a RCBD with eight treatments (F1: control, F2: iron, F3: zinc, F4: iron + zinc in the form of soil utility, F5: iron, F6: zinc, F7: iron+ zinc in the form of solution foliar application, and F8: iron + zinc in the form of soil utility and foliar application. Analysis of variance showed that there were significant differences among treatments on given traits, antioxidant enzymes activity, fatty acids percentage, plant height, seed weight to capitulum weight ratio, protein percentage, oil percentage, oil yield, 1000 seed weight, seed yield, nitrogen, phosphorous and potassium percentage of leaves, zinc and iron content of leaves and capitulum diameters. The highest seed yield, oil yield, oil percentage, 1000 seed weight, seed weight to capitulum weight ratio and protein percentage were obtained from the soil and foliar application of iron + zinc treatments (F8. Also, the highest amounts of nitrogen, phosphorous and potassium concentration in leaves were achieved from control treatment which was an indication of non-efficiency of iron and zinc on the absorption rate of these substances in the leaves. The correlation between effective traits on the seed yield, such as, capitalism diameter, number of seed rows in capitulum, seed weight to capitulum weight ratio and 1000 seed weight were positively significant. In general, foliar and soil application of zinc and iron had the highest efficiency in aspect of seed production. The comparison of the various methods of fertilization showed that foliar application was more effective than soil application. Also, micronutrient foliar application increased concentration of elements, especially zinc and iron. Antioxidant enzymes activity was different in response to treatments also the highest palmitoleic, oleic and myristic acid were observed in F6 and F7 treatments.

  9. Degradation of polychlorinated biphenyls in the rhizosphere of rape, Brassica napus L. (United States)

    Javorská, Hana; Tlustos, Pavel; Kaliszová, Regina


    The objective of this study was to investigate the rhizosphere effect of rape plants on polychlorinated biphenyls (PCB) dissipation in soils spiked with seven indicator congeners. Depletion of PCB in the rhizosphere was significantly higher in the soil with lower organic matter content. While in the Chernozem soil, 87% of PCB related to bulk soil were found in the 1st mm from roots, only 62%-69% were found in the Fluvisol soil with no significant influence of increased initial PCB concentration. Further from the roots, the concentration of lower chlorinated congeners decreased, which indicates their greater biodegradation in comparison with more chlorinated ones.

  10. Growth and Yield Stimulation of Winter Oilseed Rape (Brasssica Napus L. by Mg-Titanit Fertiliser

    Directory of Open Access Journals (Sweden)

    Kováčik Peter


    Full Text Available The effort to achieve higher yields at the required qualitative level has led to the intensive studying the problems of the rational usage of the titanium containing fertilisers by the agricultural research in the course the previous thirty years. Therefore, the objective of the experiment was to evaluate the impact of two doses of Mg-Titanit (0.2 l/ha and 0.4 l/ha on the formation of the aboveground and underground phytomass, also on the total chlorophyll in leaves, on the titanium and nitrogen content in the seeds and straw, on the quantity and quality of winter rape yield. The doses were applied two or three times on the leaves of winter rape (BBCH 50-52, BBCH 59, BBCH 66-67. The experiment was realized on the Haplic Chernozem (48°42´ N, 17°70´ E - Western Slovakia during two farming years (2009/2010 and 2010/2011. The results showed that all three applications of Mg-Titanit in both doses stimulated the formation of aboveground and underground phytomass of winter rape. The highest growth of phytomass was detected after the second application. The application of Mg-Titanit in the growth phases BBCH 50-52 and BBCH 59 increased the contents of both chlorophylls (a and b, where the growth of chlorophyll b content was more considerable than the growth of chlorophyll a content. The third spraying by Mg-Titanit decreased the content of the total chlorophyll. The application of Mg-Titanit had the positive impact on the yield of seeds, straw and fat content in the winter oilseed rape seeds.

  11. Multiple transgene traits may create un-intended fitness effects in Brassica napus (United States)

    Increasingly, genetically modified crops are being developed to express multiple “stacked” traits for different types of transgenes, for example, herbicide resistance, insect resistance, crop quality and resistance to environmental factors. The release of crops that express mult...

  12. A composite transcriptional signature differentiates responses towards closely related herbicides in Arabidopsis thaliana and brassica napus (United States)

    In this study, genome-wide expression profiling based on Affymetrix ATH1 arrays was used to identify discriminating responses of Arabidopsis thaliana to five herbicides, which contain active ingredients targeting two different branches of amino acid biosynthesis. One herbicide co...

  13. An orthologous transcriptional signature differentiates responses towards closely related chemicals in Arabidopsis thaliana and brassica napus (United States)

    Herbicides are structurally diverse chemicals that inhibit plant-specific targets, however their off-target and potentially differentiating side-effects are less well defined. In this study, genome-wide expression profiling based on Affymetrix AtH1 arrays was used to identify dis...


    The commercial production of genetically modified crops has led to a growing awareness of the difficulties of transgene confinement and of the potential environmental risks associated with the escape of transgenes into naturalized or native plant populations. A potential conseque...

  15. Effect of Different Salinity levels on some Photosynthetic Characters of Canola (Brassica napus L. Cultivars

    Directory of Open Access Journals (Sweden)

    F Tahmasbi


    Full Text Available Introduction Salinity is one of the most important factors limiting crop production in arid and semiarid regions of the world that affects crop yield. Salt tolerance of Brassica species are very complex due to genetic relationships. Because of low erucic acid (less than 2% of total fatty acids and glucosinolates contents (less than 3 µmol g-1, oil of Canola has many consumers around the world. Because Canola have tolerance potential against toxicity of salinity and its minerals, its growth can be successful in saline condition. According to the recent ongoing drought and the need to use low quality irrigation water for crops such as Canola, aim of this experiment was to evaluate the effect of salinity on changes in carbon fixation process and photosynthetic pigments of three Canola genotypes under salinity as well as determine most salt tolerant genotype for use in saline regions. Materials and Methods An experiment was conducted in the greenhouse of Shahid Chamran University during 2007-2008 growing season in factorial test based on a completely randomized design with four replications. The first factor (genotype included Hayola 401, RGS0003 and Shiraly and the second factor (salinity levels had four levels of salinity (50, 100 and 150 mM NaCl as well as distilled water as a control. Sources of salinity were NaCl and CaCl2 with equal ratio as most resembles to lower water quality resources in the region. Date and time of stress were considered four weeks after planting (four-leaf stage. A Stepped irrigation method using saline water was done every 12 days over three steps period. To perform this study 10 liters volume pots were used. Three pots per each treatment, and totally 144 pots were used. SAS (version 9.1, Excel and MSTAT-C software's was used for statistical analysis. The comparison of means was done by Duncan method. Results and Discussion The results showed that content of chlorophyll a, b and carotenoids in all three genotypes increased to 100 mM, while decreased at 150 mM. Health and invulnerability of main photosynthetic pigments at 100 mM NaCl, can be considered as an important reason for salt tolerance in the evaluated canola cultivars. Reducing the absorption of water due to stress caused by salinity reduced nutrient uptake. Toxicity of chlorine and sodium also leads to inhibition of plant growth and dry matter. Magnesium concentration raised with increasing salinity compared to control. It seems that the magnesium concentration in stomatal guard cells decreased osmotic potential and play a role in the biosynthesis of organic compounds such as glutamic acid. So, despite ABA-induced stomatal closure, the stomatal openings, even in small amounts remain photosynthesis activities. Probably, magnesium has a key role in the continuing photosynthesis of Canola under salinity. The leaf starch in the genotype Shiraly significantly increased to 150 mM salinity level. Reduction of starch in high levels of salt stress interferes with enzymes efficiency involved in the starch biosynthesis, such as starch synthase and ADP- glucose pyrophosphorylase. The trend of variation in stomatal conductance was similar to 50 mM in the early flowering, but a sharp decrease was observed at late flowering compare to control. When stress started on the four-leaf stage, the plant for some time kept stomatal conductance at maximum level, but continuation stress period led to close stomata. Thus, reducing the amount of leaf relative water content can be considered as the reason of different stomatal conductance among the different levels of salt stress. A significant positive correlation between relative water content and stomatal conductance confirms this results. On the other hand to avoid stress and better use of the limited amount of available water, the plants closed stomata to prevent more water loss. Conclusions It seems that genotype Shiraly using some mechanisms to avoid stress, such as maintaining relative water content, as well as increase the content of chlorophyll a and b up to 100 mM. Moreover, the concentration of magnesium up to 150 mM, has endured salinity.

  16. Physiological Mechanisms behind Differences in Pod Shattering Resistance in Rapeseed (Brassica napus L. Varieties.

    Directory of Open Access Journals (Sweden)

    Jie Kuai

    Full Text Available Pod shattering resistance index (SRI is a key factor affecting the mechanical harvesting of rapeseed. Research on the differences in pod shattering resistance levels of various rapeseed varieties can provide a theoretical basis for varietal breeding and application in mechanical harvesting. The indicators on pod shattering resistance including pod morphology and wall components were evaluated on eight hybrids and open pollinators, respectively, during 2012-2014. The results showed the following: (1 From the current study, SRI varied greatly with variety, and conventional varieties had stronger resistance than hybrid according to the physiological indexes. and (2 Under the experimental conditions, the SRI was linearly related to pod wall weight and the water content in pod walls, and the goodness-of-fit measurements for the regression model of the SRI based on pod wall weight and water content were 0.584** and 0.377*, respectively, reaching the significant level. This illustrated that pod wall weight and the water content in pod walls determined the SRI. (3 Compared with the relative contents of biochemical components in pod walls, the contents of particular biochemical components in pod walls had closer correlations with SRI. Among the biochemical components, the hemicellulose content was the decisive factor for the SRI.

  17. Silicon Promotes Growth of Brassica napus L. and Delays Leaf Senescence Induced by Nitrogen Starvation

    Directory of Open Access Journals (Sweden)

    Cylia Haddad


    Full Text Available Silicon (Si is the second most abundant element in soil and has several beneficial effects, especially in plants subjected to stress conditions. However, the effect of Si in preventing nitrogen (N starvation in plants is poorly documented. The aim of this work was to study the effect of a short Si supply duration (7 days on growth, N uptake, photosynthetic activity, and leaf senescence progression in rapeseed subjected (or not to N starvation. Our results showed that after 1 week of Si supply, Si improves biomass and increases N uptake and root expression of a nitrate transporter gene. After 12 days of N starvation, compared to -Si plants, mature leaf from +Si plants showed a high chlorophyll content, a maintain of net photosynthetic activity, a decrease of oxidative stress markers [hydrogen peroxide (H2O2 and malondialdehyde (MDA] and a significant delay in senescence. When N-deprived plants were resupplied with N, a greening again associated with an increase of photosynthetic activity was observed in mature leaves of plants pretreated with Si. Moreover, during the duration of N resupply, an increase of N uptake and nitrate transporter gene expression were observed in plants pretreated with Si. In conclusion, this study has shown a beneficial role of Si to alleviate damage associated with N starvation and more especially its role in delaying of leaf senescence.

  18. Study of phospholipases D and C in maturing and germinating seeds of Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Novotná, Z.; Valentová, O.; Martinec, Jan; Feltl, Tomáš; Nokhrina, K.


    Roč. 28, - (2000), s. 817-818 ISSN 0300-5127 R&D Projects: GA ČR GA522/00/1332 Institutional research plan: CEZ:AV0Z5038910 Keywords : phospholipase C * phospholipase D Subject RIV: EF - Botanics Impact factor: 0.975, year: 2000

  19. Vacuolar iron transporter BnMEB2 is involved in enhancing iron tolerance of Brassica napus

    Directory of Open Access Journals (Sweden)

    Wei Zhu


    Full Text Available Iron toxicity is a major nutrient disorder that severely affects crop development and yield. Vacuolar detoxification of metal stress is an important strategy for plants to survive and adapt to this adverse environment. Vacuolar iron transporter (VIT members are involved in this process and play essential roles in iron storage and transport. In this study, a rapeseed VIT gene BnMEB2 (BnaC07g30170D was identified. BnMEB2 is a homolog to Arabidopsis MEB2 (At5g24290 and acts as a detoxifier in vacuolar sequestration of divalent metal. Transient expression analysis revealed that BnMEB2 was localized to the vacuolar membrane. Q-PCR detection showed a high expression of BnMEB2 in mature (60-day-old leaves and could be obviously induced by exogenous iron stress in both roots and leaves. Over-expressed BnMEB2 in both Arabidopsis wild type and meb2 mutant seedlings resulted in greatly improved iron tolerability with no significant changes in the expression level of other vacuolar iron transporter genes. The mutant meb2 grew slowly and its root hair elongation was inhibited under high iron concentration condition while BnMEB2 over-expressed transgenic plants of the mutant restored the phenotypes with apparently higher iron storage in roots and dramatically increased iron content in the whole plant. Taken together, these results suggested that BnMEB2 was a VIT gene in rapeseed which was necessary for safe storage and vacuole detoxification function of excess iron to enhance the tolerance of iron toxicity. This research sheds light on a potentially new strategy for attenuating hazardous metal stress from environment and improving iron biofortification in Brassicaceae crops.

  20. Amplification of the active site of BnLIP3 gene of Brassica napus L ...

    African Journals Online (AJOL)


    production of pharmaceuticals, cosmetics, leathers, detergents, foods, perfume products, medical diagnostics and as well as environmental management (Ling et al.,. 2005). Until now, few data are available concerning molecular level of plant lipases. However, some lipases have been purified from seeds of several plants ...

  1. Rape (Brassica napus L. Growth Monitoring and Mapping Based on Radarsat-2 Time-Series Data

    Directory of Open Access Journals (Sweden)

    Wangfei Zhang


    Full Text Available In this study, 27 polarimetric parameters were extracted from Radarsat-2 polarimetric synthetic aperture radar (SAR at each growth stage of the rape crop. The sensitivity to growth parameters such as stem height, leaf area index (LAI, and biomass were investigated as a function of days after sowing. Based on the sensitivity analysis, five empirical regression models were compared to determine the best model for stem height, LAI, and biomass inversion. Of these five models, quadratic models had higher R2 values than other models in most cases of growth parameter inversions, but when these results were related to physical scattering mechanisms, the inversion results produced overestimation in the performance of some parameters. By contrast, linear and logarithmic models, which had lower R2 values than the quadratic models, had stable performance for growth parameter inversions, particularly in terms of their performance at each growth stage. The best biomass inversion performance was acquired by the volume component of a quadratic model, with an R2 value of 0.854 and root mean square error (RMSE of 109.93 g m−2. The best LAI inversion was also acquired by a quadratic model, but used the radar vegetation index (Cloude, with an R2 value of 0.8706 and RMSE of 0.56 m2 m−2. Stem height was acquired by scattering angle alpha ( α using a logarithmic model, with an R2 of 0.926 value and RMSE of 11.09 cm. The performances of these models were also analysed for biomass estimation at the second growth stage (P2, third growth stage (P3, and fourth growth stage (P4. The results showed that the models built at the P3 stage had better substitutability with the models built during all of the growth stages. From the mapping results, we conclude that a model built at the P3 stage can be used for rape biomass inversion, with 90% of estimation errors being less than 100 g m−2.

  2. Coat protein of Turnip mosaic virus in oilseed rape (Brassica napus)

    African Journals Online (AJOL)


    2Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad,. Iran. Accepted 15 August, 2012 ... led to prevalence of infectious diseases. Turnip mosaic virus (TuMV) is an .... During the sampling of canola plants for the detection of virus, some colonies of aphids were ...

  3. Induction of embryogenesis in [isolated] microspores and pollen of Brassica napus L. cv. Topas

    NARCIS (Netherlands)

    Hause, B.; Hause, G.


    Artificial systems to produce plant embryos are important tools for basic research as well as for plant breeding. It is possible to produce large amounts of embryos by methods like somatic embryogenesis or embryogenic microspore cultures. Such high amounts of embryos, which are easier to

  4. Induction and selection of superior genetic variables of oil seed rape (brassica napus L.)

    International Nuclear Information System (INIS)

    Shah, S.S.; Ali, I.; Rehman, K.


    Dry and uniform seeds of two rape seed varieties, Ganyou-5 and Tower, were subjected to different doses of gamma rays. Genetic variation in yield and yield components generated in M1 was studied in M2 and 30 useful variants were isolated from a large magnetized population. The selected mutants were progeny tested for stability of the characters in M3. Only five out of 30 progenies were identified to be uniform and stable. Further selection was made in the segregating m3 progenies. Results on some of the promising mutants are reported. The effect of irradiation treatment was highly pronounced on pod length, seeds per pod and 1000-seed weight. The genetic changes thus induced would help to evolve high yielding versions of different rape seed varieties under local environmental conditions. (author)

  5. Innovations in microspore embryogenesis in Indonesian hot pepper (Capsicum annuum L.) and Brassica napus L.

    NARCIS (Netherlands)

    Supena, E.D.J.


    Hot pepper (Capsicum annuumL.) is the most important vegetable in

  6. Innovations in microspore embryogenesis in Indonesian hot pepper (Capsicum annuum L.) and Brassica napus L.


    Supena, E.D.J.


    Hot pepper (Capsicum annuumL.) is the most important vegetable inIndonesia, but the yield is low, and the breeding programs are confined to the conventional methods and not efficient. To improve the efficiency of the breeding programs by speeding up the production of homozygous lines, studies were aimed at the introduction of haploid technology, which includes the regeneration and the production of doubled haploid plants from gametes. This technique is well developed in the model speciesBrass...

  7. Qualidade e produtividade de sementes de canola (Brassica napus após aplicação de dessecantes em pré-colheita Quality and yield of canola (Brassica napus seeds after pre-harvest desiccant application

    Directory of Open Access Journals (Sweden)

    O. Marchiori Jr.


    Full Text Available A cultura de canola é indicada nos esquemas de rotação de culturas, bem como para diversificação agrícola e cobertura vegetal do solo no período de inverno na Região Sul do Brasil. Contudo, a colheita mecanizada é uma das operações mais críticas do sistema de produção, uma vez que os frutos do tipo síliqua apresentam maturação desuniforme, gerando grandes perdas de produtividade devido à deiscência natural. O uso de dessecantes químicos permite uma colheita com as síliquas em maturação mais uniforme, porém é importante a manutenção da qualidade do produto obtido. O presente trabalho teve por objetivo avaliar o efeito da aplicação de herbicidas dessecantes na produtividade e na qualidade fisiológica e sanitária das sementes de canola cultivar Hyola 401. Os herbicidas utilizados foram o glufosinato de amônio (0,5 kg ha-1, carfentrazone-ethyl (0,03 kg ha-1, paraquat (0,4 kg ha-1 e diquat (0,3 kg ha-1, mais a testemunha sem aplicação. A qualidade das sementes foi avaliada por meio dos testes de germinação, de envelhecimento acelerado, de condutividade elétrica, de emergência em areia, de velocidade de emergência e de sanidade. A aplicação dos produtos dessecantes permitiu uma antecipação de sete dias na colheita das sementes de canola. A produtividade de sementes não foi afetada pela dessecação. A aplicação do glufosinato de amônio e carfentrazone-ethyl reduziu (PCanola crop is indicated to integrate crop rotation systems, as well as for agricultural diversification and vegetal ground cover during winter in southern Brazil. However, mechanical harvest is critical to crop production, since pods present a non-uniform ripening, leading to great yield losses, due to natural dehiscence. Desiccants are usually applied to provide a more uniform harvest, maintaining the quality of the product. This work aimed to evaluate the effect of desiccant application on productivity and physiological/sanitary quality of canola (cv. Hyola 401 seeds. The desiccants evaluated were ammonium glufosinate (0.5 kg ha-1, carfentrazone-ethyl (0.03 g ha-1, paraquat (0.4 kg ha-1, diquat (0.3 kg ha-1, and a non-sprayed check. Seed quality was evaluated by germination test, accelerated aging, electrical conductivity, emergence in sand seedbank, speed of emergence-index and seed health. Desiccant application provided a seven-day antecipation of canola seed harvest. Seed yield was not affected by desiccation. Application of ammonium glufosinate and carfentrazone-ethyl decreased (P<0.05 the seed protein contents. Chemical desiccation did not have any negative effect on the physiological quality of the seeds.

  8. Genetic Dissection of Root Morphological Traits Related to Nitrogen Use Efficiency in Brassica napus L. under Two Contrasting Nitrogen Conditions

    Directory of Open Access Journals (Sweden)

    Jie Wang


    Full Text Available As the major determinant for nutrient uptake, root system architecture (RSA has a massive impact on nitrogen use efficiency (NUE. However, little is known the molecular control of RSA as related to NUE in rapeseed. Here, a rapeseed recombinant inbred line population (BnaZNRIL was used to investigate root morphology (RM, an important component for RSA and NUE-related traits under high-nitrogen (HN and low-nitrogen (LN conditions by hydroponics. Data analysis suggested that RM-related traits, particularly root size had significantly phenotypic correlations with plant dry biomass and N uptake irrespective of N levels, but no or little correlation with N utilization efficiency (NUtE, providing the potential to identify QTLs with pleiotropy or specificity for RM- and NUE-related traits. A total of 129 QTLs (including 23 stable QTLs, which were repeatedly detected at least two environments or different N levels were identified and 83 of them were integrated into 22 pleiotropic QTL clusters. Five RM-NUE, ten RM-specific and three NUE-specific QTL clusters with same directions of additive-effect implied two NUE-improving approaches (RM-based and N utilization-based directly and provided valuable genomic regions for NUE improvement in rapeseed. Importantly, all of four major QTLs and most of stable QTLs (20 out of 23 detected here were related to RM traits under HN and/or LN levels, suggested that regulating RM to improve NUE would be more feasible than regulating N efficiency directly. These results provided the promising genomic regions for marker-assisted selection on RM-based NUE improvement in rapeseed.

  9. beta-aminobutyric acid protects Brassica napus plants from infection by Leptosphaeria maculans. Resistance induction or a direct antifungal effect?

    Czech Academy of Sciences Publication Activity Database

    Šašek, Vladimír; Nováková, Miroslava; Dobrev, Petre; Valentová, O.; Burketová, Lenka


    Roč. 133, č. 1 (2012), s. 279-289 ISSN 0929-1873 R&D Projects: GA ČR GA522/08/1581; GA MZe QH72117 Institutional research plan: CEZ:AV0Z50380511 Keywords : Antimicrobial * BTH * Gene expression Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 1.610, year: 2012

  10. Growth and stress response in Arabidopsis thaliana, Nicotiana benthamiana, Glycine max, Solanum tuberosum and Brassica napus cultivated under polychromatic LEDs

    Czech Academy of Sciences Publication Activity Database

    Janda, Martin; Navrátil, Oldřich; Haisel, Daniel; Jindřichová, Barbora; Fousek, Jan; Burketová, Lenka; Čeřovská, Noemi; Moravec, Tomáš


    Roč. 11, MAY 3 (2015) ISSN 1746-4811 R&D Projects: GA ČR GA13-26798S; GA ČR(CZ) GAP501/12/1942; GA ČR(CZ) GAP501/12/1761; GA ČR(CZ) GA15-10768S Institutional support: RVO:61389030 Keywords : LED * Fluorescent tubes * Plant physiology Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 3.449, year: 2015

  11. Divergent N Deficiency-Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves

    Directory of Open Access Journals (Sweden)

    Vajiheh Safavi-Rizi


    Full Text Available In the spring oilseed rape (OSR cultivar ‘Mozart’ grown under optimal N supply (NO or mild N deficiency (NL the transcriptome changes associated with progressing age until early senescence in developmentally old lower canopy leaves (leaf #4 and younger higher canopy leaves (leaf #8 were investigated. Twelve weeks old NO and NL plants appeared phenotypically and transcriptomically identical, but thereafter distinct nutrition-dependent differences in gene expression patterns in lower and upper canopy leaves emerged. In NO leaves #4 of 14-week-old compared to 13-week-old plants, ∼600 genes were up- or downregulated, whereas in NL leaves #4 ∼3000 genes were up- or downregulated. In contrast, in 15-week-old compared to 13-week-old upper canopy leaves #8 more genes were up- or downregulated in optimally N-supplied plants (∼2000 genes than in N-depleted plants (∼750 genes. This opposing effect of N depletion on gene regulation was even more prominent among photosynthesis-related genes (PSGs. Between week 13 and 14 in leaves #4, 99 of 110 PSGs were downregulated in NL plants, but none in NO plants. In contrast, from weeks 13 to 16 in leaves #8 of NL plants only 11 PSGs were downregulated in comparison to 66 PSGs in NO plants. Different effects of N depletion in lower versus upper canopy leaves were also apparent in upregulation of autophagy genes and NAC transcription factors. More than half of the regulated NAC and WRKY transcription factor, autophagy and protease genes were specifically regulated in NL leaves #4 or NO leaves #8 and thus may contribute to differences in senescence and nutrient mobilization in these leaves. We suggest that in N-deficient plants the upper leaves retain their N resources longer than in amply fertilized plants and remobilize them only after shedding of the lower leaves.

  12. Use of MSAP markers to analyse the effects of salt stress on DNA methylation in rapeseed (Brassica napus var. oleifera.

    Directory of Open Access Journals (Sweden)

    Gianpiero Marconi

    Full Text Available Excessive soil salinity is a major ecological and agronomical problem, the adverse effects of which are becoming a serious issue in regions where saline water is used for irrigation. Plants can employ regulatory strategies, such as DNA methylation, to enable relatively rapid adaptation to new conditions. In this regard, cytosine methylation might play an integral role in the regulation of gene expression at both the transcriptional and post-transcriptional levels. Rapeseed, which is the most important oilseed crop in Europe, is classified as being tolerant of salinity, although cultivars can vary substantially in their levels of tolerance. In this study, the Methylation Sensitive Amplified Polymorphism (MSAP approach was used to assess the extent of cytosine methylation under salinity stress in salinity-tolerant (Exagone and salinity-sensitive (Toccata rapeseed cultivars. Our data show that salinity affected the level of DNA methylation. In particular methylation decreased in Exagone and increased in Toccata. Nineteen DNA fragments showing polymorphisms related to differences in methylation were sequenced. In particular, two of these were highly similar to genes involved in stress responses (Lacerata and trehalose-6-phosphatase synthase S4 and were chosen to further characterization. Bisulfite sequencing and quantitative RT-PCR analysis of selected MSAP loci showed that cytosine methylation changes under salinity as well as gene expression varied. In particular, our data show that salinity stress influences the expression of the two stress-related genes. Moreover, we quantified the level of trehalose in Exagone shoots and found that it was correlated to TPS4 expression and, therefore, to DNA methylation. In conclusion, we found that salinity could induce genome-wide changes in DNA methylation status, and that these changes, when averaged across different genotypes and developmental stages, accounted for 16.8% of the total site-specific methylation differences in the rapeseed genome, as detected by MSAP analysis.

  13. Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

    DEFF Research Database (Denmark)

    Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.


    Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

  14. Modelling and estimating pollen movement in oilseed rape (Brassica napus) at the landscape scale using genetic markers. (United States)

    Devaux, C; Lavigne, C; Austerlitz, F; Klein, E K


    Understanding patterns of pollen movement at the landscape scale is important for establishing management rules following the release of genetically modified (GM) crops. We use here a mating model adapted to cultivated species to estimate dispersal kernels from the genotypes of the progenies of male-sterile plants positioned at different sampling sites within a 10 x 10-km oilseed rape production area. Half of the pollen clouds sampled by the male-sterile plants originated from uncharacterized pollen sources that could consist of both large volunteer and feral populations, and fields within and outside the study area. The geometric dispersal kernel was the most appropriate to predict pollen movement in the study area. It predicted a much larger proportion of long-distance pollination than previously fitted dispersal kernels. This best-fitting mating model underestimated the level of differentiation among pollen clouds but could predict its spatial structure. The estimation method was validated on simulated genotypic data, and proved to provide good estimates of both the shape of the dispersal kernel and the rate and composition of pollen issued from uncharacterized pollen sources. The best dispersal kernel fitted here, the geometric kernel, should now be integrated into models that aim at predicting gene flow at the landscape level, in particular between GM and non-GM crops.

  15. Study of variation of tocochromanol and phytosterol contents in black and yellow seeds of Brassica napus L. doubled haploid populations. (United States)

    Cegielska-Taras, Teresa; Nogala-Kałucka, Małgorzata; Szala, Laurencja; Siger, Aleksander


    In the study, an analysis of tocopherols, plastochomanol-8 and phytosterols was conducted using DH lines obtained from F1 hybrids of reciprocal crosses between yellow- and black-seeded lines. The biological material for the study consisted of two DH populations of winter oilseed rape obtained from F1 hybrids of reciprocal crosses between two DH lines: yellow- and black-seeded. Seed color was determined using a ColorFlex spectrophotometer. Fat content was determined via pulsed NMR. The levels of tocopherols, and plastochromanol-8 are analyzed using HPLC. Phytosterol contents and composition were determined by the GC method. The fat content of the black-seeded parental line was 49% and this was higher than that of the yellow-seeded parental line (44%). The fat content of DH line populations ranged from 44 to 51%. Total tocopherol content ranged from 460 to 602 mg/kg and the α-T/γ-T ratio was from 0.66 to 1.09. In parental lines H2-26 and Z-114 the total tocopherol content was 534 and 525 mg/kg, but the α-T/γ-T ratios were 0.81 and 1.21, respectively. The yellow-seeded parental line (Z-114) was characterized by a higher PC-8 content (81 mg/kg) than the H2-26 black-seeded parental line (58 mg/kg). The largest part of the total phytosterol content in seeds of both populations was β-sitosterol from 976 to 2148 mg/kg, followed by campasterol, from 636 to 1364 mg/kg, and brassicasterol from 375 to 678 mg/kg. The total tocopherol content ranged from 462 to 595 mg/kg (population HxZ) and from 460 to 602 mg/kg (population ZxH). Significantly positive correlations were observed between the seed color with α-T (r = 0.38, p phytosterol content were not noted. Considering the range of genetic variation among doubled haploids of two populations, selected DH lines may be good parents for further breeding programs focused on increasing the amount and improving the quality of oilseed rapeseed oil. However, further studies will also be made to determine the influence of the environment on bioactive compounds in rapeseed oil. Cross direction of parental DH lines: yellow- and black-seeded has some influence, albeit not statistically significant, on the diversity of doubled haploid in their populations with regard to average fat, tocochromanol and phytosterol content.

  16. Study on Replacement Probability of Organic with Chemical Fertilizers in Canola (Brassica napus under Two Deficit and Full Irrigation Conditions

    Directory of Open Access Journals (Sweden)

    S. J. Azimzadeh


    Full Text Available Introduction In agricultural ecosystems, organic fertilizers play an important role in producing sustainable agricultural production. Considering this Sajjadi Nik et al (2011 reported that with increasing of vermicompost inoculation with nitroxin biofertilizer, capsule number per sesame plant increased, so that the most of capsule number per plant (124.7 was observed in 10 t/h vermicompost with nitroxin inoculation. Seyyedi and Rezvani Moghaddam (2011 reported that seed number per plant and the thousand kernel weight in treatment of 80 t/h mushroom compost in comparison with control were increased by 2.98 and 1.56 fold. In another experiment, Kato and Yamagishi (2011 reported that seed yield of wheat in application of manures equal to 80 t/h/ year more than 10 years in comparison with application of nitrogen fertilizer at the rate of 204 kg/h, showed significant increasing from 725 to 885 gr/m2. In another study, Rezvani Moghaddam et al (2010 reported that the most (74.08 and the least (60.94 seed number per capsule in sesame was obtained in the treatments of cow manure and control treatments respectively. The aim of this experiment was evaluation the effects of municipal waste compost, vermicompost and cow manure fertilizers in comparison with chemical fertilizer on yield and yield components of canola under two levels of deficit and full irrigation. Materials and Methods In order to evaluate the replacement probability of organic fertilizer with chemical fertilizers in canola cultivation, an experiment was conducted at research farm of Mashhad Faculty of Agriculture in year of 2013. Treatments were fertilizer and irrigation. Irrigation treatments included full and deficit irrigation. Fertilizer treatments included municipal waste compost, vermicompost, manure and chemical fertilizer. Chemical fertilizer included Nitrogen and Phosphorus. Experiment was conducted as split plot in randomized complete block design with three replications. Organic fertilizer was scattered in plots and mixed completely with soil. After that in each plot, six rows with distance of 25 cm were designed and canola seeds were placed into the rows and were covered by 3 cm of soil. Through cultivation season and after harvesting the treatments of plant height, pod number per plant, seed number per pod, thousand kernel weight, seed yield and biological yield were recorded. Data were analyzed by MSTAT-C and mean comparison was performed using Duncan's multiple test range. Results and Discussion The highest seed yield was obtained in irrigation treatment and application of chemical fertilizer (1284 kg/h. In all of vermicompost treatments in full irrigation compared with deficit irrigation, seed yield was more but the trend of changes in seed yield was the same in both conditions. It means that seed yield increased with increasing vermicompost application from 7 to 11 t/h, but seed yield decreased with increasing vermicompost from 11 to 15 t/h. In treatment of manure application in both conditions of deficit and full irrigation, increasing the manure fertilizer, increased seed yield. Seed yield reaction in treatments of municipal waste compost in both conditions of full and deficit irrigation was the same as vermicompost. It means that increasing the application of municipal waste compost from 7 to 11 t/h, increased seed yield and increasing the application of municipal waste compost from 11 to 15 t/h, decreased seed yield. Biological yield reaction to fertilizer treatments was the same as seed yield. Overlay application of 50 t/h cow manure in deficit irrigation produced the most seed yield compared with all other fertilizer treatments including chemical fertilizer at the rate of 6%. This yield increment was due to higher pod number per plant and higher seed number per pod. In full irrigation, chemical fertilizer produced the most seed yield compared with all other fertilizer treatments. Conclusions Generally, it is concluded that canola in deficit moisture conditions showed a better reaction to using organic fertilizers and their replacement possibility in same condition with chemical fertilizer is considerable but organic fertilizers in full irrigation condition are not able to produce yield equal with chemical fertilizers in canola cultivation.

  17. Identification of phospholipase D genes in Brassica napus and their transcription after phytohormone treatment and pathogen infection

    Czech Academy of Sciences Publication Activity Database

    Janda, Martin; Ježková, Lucie; Nováková, Miroslava; Valentová, O.; Burketová, Lenka; Šašek, Vladimír


    Roč. 59, č. 3 (2015), s. 581-590 ISSN 0006-3134 R&D Projects: GA ČR GA522/08/1581; GA ČR(CZ) GAP501/11/1654 Institutional support: RVO:61389030 Keywords : benzothiadiazole * Leptosphaeria maculans * methyl jasmonate Subject RIV: ED - Physiology Impact factor: 1.665, year: 2015

  18. Divergent N Deficiency-Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves. (United States)

    Safavi-Rizi, Vajiheh; Franzaring, Jürgen; Fangmeier, Andreas; Kunze, Reinhard


    In the spring oilseed rape (OSR) cultivar 'Mozart' grown under optimal N supply (N O ) or mild N deficiency (N L ) the transcriptome changes associated with progressing age until early senescence in developmentally old lower canopy leaves (leaf #4) and younger higher canopy leaves (leaf #8) were investigated. Twelve weeks old N O and N L plants appeared phenotypically and transcriptomically identical, but thereafter distinct nutrition-dependent differences in gene expression patterns in lower and upper canopy leaves emerged. In N O leaves #4 of 14-week-old compared to 13-week-old plants, ∼600 genes were up- or downregulated, whereas in N L leaves #4 ∼3000 genes were up- or downregulated. In contrast, in 15-week-old compared to 13-week-old upper canopy leaves #8 more genes were up- or downregulated in optimally N-supplied plants (∼2000 genes) than in N-depleted plants (∼750 genes). This opposing effect of N depletion on gene regulation was even more prominent among photosynthesis-related genes (PSGs). Between week 13 and 14 in leaves #4, 99 of 110 PSGs were downregulated in N L plants, but none in N O plants. In contrast, from weeks 13 to 16 in leaves #8 of N L plants only 11 PSGs were downregulated in comparison to 66 PSGs in N O plants. Different effects of N depletion in lower versus upper canopy leaves were also apparent in upregulation of autophagy genes and NAC transcription factors. More than half of the regulated NAC and WRKY transcription factor, autophagy and protease genes were specifically regulated in N L leaves #4 or N O leaves #8 and thus may contribute to differences in senescence and nutrient mobilization in these leaves. We suggest that in N-deficient plants the upper leaves retain their N resources longer than in amply fertilized plants and remobilize them only after shedding of the lower leaves.

  19. TGMS in Rapeseed (Brassica napus Resulted in Aberrant Transcriptional Regulation, Asynchronous Microsporocyte Meiosis, Defective Tapetum, and Fused Sexine

    Directory of Open Access Journals (Sweden)

    Xi-Qiong Liu


    Full Text Available The thermo-sensitive genic male sterility (TGMS line SP2S is a spontaneous rapeseed mutation with several traits that are favorable for the production of two-line hybrids. To uncover the key cellular events and genetic regulation associated with TGMS expression, a combined study using cytological observation, transcriptome profiling, and gene expression analysis was conducted for SP2S and its near-isogenic line SP2F grown under warm conditions. Asynchronous microsporocyte meiosis and abnormal tapetal plastids and elaioplasts were demonstrated in the anther of SP2S. The tetrad microspore did not undergo mitosis before the cytoplasm degenerated. Delayed degradation of the tetrad wall, which led to tetrad microspore aggregation, resulted in postponement of sexine (outer layer of pollen exine formation and sexine fusion in the tetrad. The nexine (foot layer of exine was also absent. The delay of tetrad wall degradation and abnormality of the exine structure suggested that the defective tapetum lost important functions. Based on transcriptomic comparisons between young flower buds of SP2S and SP2F plants, a total of 465 differentially expressed transcripts (DETs were identified, including 303 up-regulated DETs and 162 down-regulated DETs in SP2S. Several genes encoding small RNA degrading nuclease 2, small RNA 2′-O-methyltransferase, thioredoxin reductase 2, regulatory subunit A alpha isoform of serine/threonine-protein phosphatase 2A, glycine rich protein 1A, transcription factor bHLH25, leucine-rich repeat receptor kinase At3g14840 like, and fasciclin-like arabinogalactan proteins FLA19 and FLA20 were greatly depressed in SP2S. Interestingly, a POLLENLESS3-LIKE 2 gene encoding the Arabidopsis MS5 homologous protein, which is necessary for microsporocyte meiosis, was down-regulated in SP2S. Other genes that were up-regulated in SP2S encoded glucanase A6, ethylene-responsive transcription factor 1A-like, pollen-specific SF3, stress-associated endoplasmic reticulum protein 2, WRKY transcription factors and pentatricopeptide repeat (PPR protein At1g07590. The tapetum-development-related genes, including BnEMS1, BnDYT1, and BnAMS, were slightly up-regulated in 3-mm-long flower buds or their anthers, and their downstream genes, BnMS1 and BnMYB80, which affect callose dissolution and exine formation, were greatly up-regulated in SP2S. This aberrant genetic regulation corresponded well with the cytological abnormalities. The results suggested that expression of TGMS associates with complex transcriptional regulation.

  20. Effects of Super-Absorbent Polymer Application on Yield and Yield Components of Rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Fariborz SHEKARI


    Full Text Available Limitation of water resources and its great impact on agricultural and natural resources play a crucial role in the efficiency of water use. Applying super absorbent polymer to the soil may be one of the methods to minimize the stress of weather dryness in arid and semi-arid regions. In order to evaluate the effects of hydrophilic polymer application on yield and water use efficiency of rapeseed plants, an experiment was conducted under field condition in 2012 at the Research Farm of the Faculty of Agriculture, University of Maragheh. Treatments’ factors were: (i 3 super absorbent polymers (SAP (Taravat A200 levels of 0 (without application, 75 and 150 kg ha-1 A200 application, (ii three irrigation levels of 80, 120 and 180 mm evaporation from class A basin in main plots, (iii two cultivars ʻHyola 401ʼ and ʻRVSʼ in sub plots as factorial split plot combination based on completely randomized block design with three replications. The results showed that in all of the measured traits within the experiment there were significant differences between SAP levels. Furthermore, increasing irrigation interval led to an increase in a thousand seeds’ weight, but decreased seed yield. Increasing water stress raised seed oil percent and infertile silique and subsequently resulted in reduced oil yield. ʻHyola 401ʼ was more susceptible to embryo abortion compared with ʻRVSʼ. As a conclusion of the research, SAP (A200 application in quantities smaller than 75 kg ha-1 may be recommended for rapeseed production under field condition.

  1. Determination of Pt, Pd and Rh in Brassica Napus using solid sampling electrothermal vaporization inductively coupled plasma optical emission spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Nischkauer, Winfried [Vienna University of Technology, Institute of Chemical Technologies and Analytics, Division of Instrumental Analytical Chemistry, Getreidemarkt 9/164-IAC, A-1060 Vienna (Austria); Herincs, Esther [Vienna University of Technology, Institute of Chemical Technologies and Analytics, Division of Instrumental Analytical Chemistry, Getreidemarkt 9/164-IAC, A-1060 Vienna (Austria); University of Natural Resources and Life Sciences, Department of Forest and Soil Sciences, Institute of Soil Research, Konrad Lorenz Straße 24, A-3430 Tulln (Austria); Puschenreiter, Markus; Wenzel, Walter [University of Natural Resources and Life Sciences, Department of Forest and Soil Sciences, Institute of Soil Research, Konrad Lorenz Straße 24, A-3430 Tulln (Austria); Limbeck, Andreas, E-mail: [Vienna University of Technology, Institute of Chemical Technologies and Analytics, Division of Instrumental Analytical Chemistry, Getreidemarkt 9/164-IAC, A-1060 Vienna (Austria)


    Conventional approaches for the analysis of platinum group elements (PGEs) in plant material suffer from sample digestion which results in sample dilution and therefore requires high sample intakes to maintain the sensitivity. The presented solid-sampling method avoids sample digestion while improving sensitivity when compared to digestion-based inductively coupled plasma optical emission spectrometry (ICP-OES) methods and allows the analysis of sample masses of 5 mg or less. Detection limits of 0.38 μg g{sup −1}, 0.14 μg g{sup −1} and 0.13 μg g{sup −1} were obtained for Pt, Pd and Rh, respectively using a sample intake of 5 mg. The reproducibility of the procedure ranged between 4.7% (Pd) relative standard deviation (RSD, n = 7) and 7.1% (Rh) RSD for 25 ng analytes. For quantification, aqueous standards were applied on paper filter strips and dried. Only the dried filters were introduced into the electrothermal vaporization unit. This approach successfully removed memory-effects observed during analysis of platinum which occurred only if liquid standards came into contact with the graphite material of the furnace. The presented method for overcoming the Pt-memory-effects may be of further interest for the analysis of other carbide-forming analytes as it does not require any technical modification of the graphite furnace (e.g., metal inlays, pyrolytic coating). Owing to lack of suitable certified reference materials, the proposed method was compared with conventional ICP-OES analysis of digested samples and a good agreement was obtained. As a result of the low sample consumption, it was possible to determine the spatial distribution of PGEs within a single plant. Significant differences in PGE concentrations were observed between the shoots (stem, leaves) and the roots. Pd was mainly found in the roots, whereas Pt and Rh were also found in higher concentrations in the shoots. - Highlights: • The uptake of Pt, Pd and Rh by hydroponically grown plants was investigated. • Due to low sample consumption, differentiation between plant parts was possible. • Calibration via pre-dried aqueous standards on filter paper was applied.

  2. Water and temperature stresses impact canola (Brassica napus L.) fatty acid, protein and yield over nitrogen and sulfur (United States)

    Interactive effects of weather and soil nutrient status often control crop productivity. An experiment was conducted to determine effects of N and S fertilizer rate, soil water, and atmospheric temperature on canola fatty acid (FA), total oil, protein and grain yield. Nitrogen and S were assessed in...

  3. Effect of Different Levels of Sulphur Bentonite on Yield and Yield Components of Canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    B Rahimi


    Full Text Available In order to determine the effect of different levels of sulfur bentonite on yield and yield components of canola a factorial experiment was conducted on the basis of randomized complete block design with three replications in Mashhad in 2009-2010 growing season. Factors included four levels of sulfur bentonite (0, 300, 400 and 500 kg.h-1 and two varieties of canola (Modena and Zarfam. The result showed that the increase in sulfur increased some vegetative traits such as leaf area index and plant height. Using sulfur caused increased pod number, seed weight, in addition of oil and protein content and seed yield. Grain yield increase was due to seed weight and LAI. Two varieties were different to responses the sulfur. While in no sulfur application there was no significant difference in seed yield, in 500 Kg sulfur application yield of Zarfam compared to Modena increased about 29.63. According to the results there are significant differences between cultivars in terms of response to the sulfur fertilizer. Therefore it is necessary to evaluate effect of sulfur application of canola productivity in different climate conditions of Iran.

  4. The use of environmental metabolomics to determine glyphosate level of exposure in rapeseed (Brassica napus L.) seedlings

    International Nuclear Information System (INIS)

    Petersen, Iben Lykke; Tomasi, Giorgio; Sorensen, Hilmer; Boll, Esther S.; Hansen, Hans Christian Bruun; Christensen, Jan H.


    Metabolic profiling in plants can be used to differentiate between treatments and to search for biomarkers for exposure. A methodology for processing Ultra-High-Performance Liquid Chromatography-Diode-Array-Detection data is devised. This methodology includes a scheme for selecting informative wavelengths, baseline removal, retention time alignment, selection of relevant retention times, and principal component analysis (PCA). Plant crude extracts from rapeseed seedling exposed to sublethal concentrations of glyphosate are used as a study case. Through this approach, plants exposed to concentrations down to 5 μM could be distinguished from the controls. The compounds responsible for this differentiation were partially identified and were different from those specific for high exposure samples, which suggests that two different responses to glyphosate are elicited in rapeseed depending on the level of exposure. The PCA loadings indicate that a combination of other metabolites could be more sensitive than the response of shikimate to detect glyphosate exposure. - Highlights: → A method for processing UHPLC-DAD data for plant metabolic profiling is devised. → The metabolic profiling approach is more sensitive to glyphosate exposure than shikimate. → Plants exposed to concentrations down to 5 μM can be distinguished from the controls. → Two different responses to glyphosate may be elicited in rapeseed depending on the level of exposure. - A novel untargeted environmental metabololomic approach is used to detect low-level glyphosate exposure of rapeseed seedlings.

  5. Glyphosate-Resistant and Conventional Canola (Brassica napus L.) Responses to Glyphosate and Aminomethylphosphonic Acid (AMPA) Treatment. (United States)

    Corrêa, Elza Alves; Dayan, Franck E; Owens, Daniel K; Rimando, Agnes M; Duke, Stephen O


    Glyphosate-resistant (GR) canola contains two transgenes that impart resistance to the herbicide glyphosate: (1) the microbial glyphosate oxidase gene (gox) encoding the glyphosate oxidase enzyme (GOX) that metabolizes glyphosate to aminomethylphosphonic acid (AMPA) and (2) cp4 that encodes a GR form of the glyphosate target enzyme 5-enolpyruvylshikimic acid-3-phosphate synthase. The objectives of this research were to determine the phytotoxicity of AMPA to canola, the relative metabolism of glyphosate to AMPA in GR and conventional non-GR (NGR) canola, and AMPA pool sizes in glyphosate-treated GR canola. AMPA applied at 1.0 kg ha(-1) was not phytotoxic to GR or NGR. At this AMPA application rate, NGR canola accumulated a higher concentration of AMPA in its tissues than GR canola. At rates of 1 and 3.33 kg ae ha(-1) of glyphosate, GR canola growth was stimulated. This stimulatory effect is similar to that of much lower doses of glyphosate on NGR canola. Both shikimate and AMPA accumulated in tissues of these glyphosate-treated plants. In a separate experiment in which young GR and NGR canola plants were treated with non-phytotoxic levels of [(14)C]-glyphosate, very little glyphosate was metabolized in NGR plants, whereas most of the glyphosate was metabolized to AMPA in GR plants at 7 days after application. Untreated leaves of GR plants accumulated only metabolites (mostly AMPA) of glyphosate, indicating that GOX activity is very high in the youngest leaves. These data indicate that more glyphosate is transformed to AMPA rapidly in GR canola and that the accumulated AMPA is not toxic to the canola plant.

  6. The use of environmental metabolomics to determine glyphosate level of exposure in rapeseed (Brassica napus L.) seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Petersen, Iben Lykke; Tomasi, Giorgio; Sorensen, Hilmer; Boll, Esther S.; Hansen, Hans Christian Bruun [Department of Basic Sciences and Environment, Faculty of Life Sciences, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C (Denmark); Christensen, Jan H., E-mail: [Department of Basic Sciences and Environment, Faculty of Life Sciences, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C (Denmark)


    Metabolic profiling in plants can be used to differentiate between treatments and to search for biomarkers for exposure. A methodology for processing Ultra-High-Performance Liquid Chromatography-Diode-Array-Detection data is devised. This methodology includes a scheme for selecting informative wavelengths, baseline removal, retention time alignment, selection of relevant retention times, and principal component analysis (PCA). Plant crude extracts from rapeseed seedling exposed to sublethal concentrations of glyphosate are used as a study case. Through this approach, plants exposed to concentrations down to 5 {mu}M could be distinguished from the controls. The compounds responsible for this differentiation were partially identified and were different from those specific for high exposure samples, which suggests that two different responses to glyphosate are elicited in rapeseed depending on the level of exposure. The PCA loadings indicate that a combination of other metabolites could be more sensitive than the response of shikimate to detect glyphosate exposure. - Highlights: > A method for processing UHPLC-DAD data for plant metabolic profiling is devised. > The metabolic profiling approach is more sensitive to glyphosate exposure than shikimate. > Plants exposed to concentrations down to 5 {mu}M can be distinguished from the controls. > Two different responses to glyphosate may be elicited in rapeseed depending on the level of exposure. - A novel untargeted environmental metabololomic approach is used to detect low-level glyphosate exposure of rapeseed seedlings.

  7. Creation of glyphosate-resistant Brassica napus L. plants expressing DesC desaturase of cyanobacterium Synechococcus vulcanus

    Directory of Open Access Journals (Sweden)

    Goldenkova-Pavlova I. V.


    Full Text Available Aim. Creation of glyphosate-resistant canola plants expressing bifunctional hybrid desC::licBM3 gene. In the hybrid gene the sequence of DesC desaturase of cyanobacterium S. vulcanus without plastid targeting was fused with the sequence of thermostable lichenase reporter LicBM3 gene. Methods. Agrobacterium tumefaciens-mediated transformation, PCR, quantitative and qualitative determination of lichenase activity, genetic analysis. Results. Transgenic canola plants, carring the enolpyruvat shikimat phosphate syntase gene (epsps, conferring on plants resistance to phosphonomethyl glycine herbicides (Roundup, as well as the desC::licBM3 gene, were selected. The presence of transgenes was confimed by multiplex PCR. The epsps gene expression in canola was shown at the transcription level, during in vitro growth and after greenhouse herbicide treatment. Activity of the licBM3 gene product as a part of hybrid protein allowed quantitative and qualitative estimation of the desaturase gene expression. Inheritance of heterologous genes and their expression in the first generation were investigated. Conclusions. Transgenic canola plants were obtained, the presence of trangenes in plant genome was proved and expression of the target genes was detected.

  8. The structure of the Brassica napus seed microbiome is cultivar-dependent and affects the interactions of symbionts and pathogens. (United States)

    Rybakova, Daria; Mancinelli, Riccardo; Wikström, Mariann; Birch-Jensen, Ann-Sofie; Postma, Joeke; Ehlers, Ralf-Udo; Goertz, Simon; Berg, Gabriele


    Although the plant microbiome is crucial for plant health, little is known about the significance of the seed microbiome. Here, we studied indigenous bacterial communities associated with the seeds in different cultivars of oilseed rape and their interactions with symbiotic and pathogenic microorganisms. We found a high bacterial diversity expressed by tight bacterial co-occurrence networks within the rape seed microbiome, as identified by llumina MiSeq amplicon sequencing. In total, 8362 operational taxonomic units (OTUs) of 40 bacterial phyla with a predominance of Proteobacteria (56%) were found. The three cultivars that were analyzed shared only one third of the OTUs. The shared core of OTUs consisted mainly of Alphaproteobacteria (33%). Each cultivar was characterized by having its own unique bacterial structure, diversity, and proportion of unique microorganisms (25%). The cultivar with the lowest bacterial abundance, diversity, and the highest predicted bacterial metabolic activity rate contained the highest abundance of potential pathogens within the seed. This data corresponded with the observation that seedlings belonging to this cultivar responded more strongly to the seed treatments with bacterial inoculants than other cultivars. Cultivars containing higher indigenous diversity were characterized as having a higher colonization resistance against beneficial and pathogenic microorganisms. Our results were confirmed by microscopic images of the seed microbiota. The structure of the seed microbiome is an important factor in the development of colonization resistance against pathogens. It also has a strong influence on the response of seedlings to biological seed treatments. These novel insights into seed microbiome structure will enable the development of next generation strategies combining both biocontrol and breeding approaches to address world agricultural challenges.

  9. Micro-pressing of rapeseed (Brassica napus L. and Arabidopsis thaliana seeds for evaluation of the oil extractability

    Directory of Open Access Journals (Sweden)

    Savoire Raphaëlle


    Full Text Available Pressing is a crucial step in the crushing process of rapeseed seeds, regarding its major effect on the oil extraction yield, the energy consumption and the quality of the meal. In order to study and model in a rigorous way the behaviour of rapeseed seeds, and the oil extraction during pressing, the potential of a micro-pressing technique using a instrumented micro press adapted to quantities of seeds as low as 10 g for rapeseed and 3 g for Arabidopsis thaliana was examined and discussed. Using a phenomenological model, data from the pressing process and the material behaviour (compressibility modules were obtained with a good precision, highlighting small differences between samples. The well-known positive effect of the temperature on the oil extraction yield was confirmed with A. thaliana. Micro-pressing of ground and cooked rapeseed seeds did not lead to the results usually reported in the literature for continuous pressing. The results strongly suggest that the performance of the static micro-pressing is related to the macro-and micro-structure of seeds and is less sensitive to the moisture than continuous pressing. Further experiments are needed to confirm that the micro-pressing could be an effective tool for predicting the extractability of oil and therefore, contribute to plant breeding programmes in the future.

  10. Use of chemical mutagen for induction of useful genetic variation in different oil seed rape (brassica napus L.) cultivars

    International Nuclear Information System (INIS)

    Ali, I.; Shah, S.A.; Shah, S.J.A.; Rehman, K.


    Pre soaked seeds for 16 hrs of oil seed Rape cvs. Tower and Wester were treated with 1-3% concentrations of ethylene methane sulphonate (EMS) for 4 hrs with the objective to generate variation in characters of importance such as, early maturity, semi dwarf stature, lodging resistance and different yield components. After post washing (4 hrs) the seeds were filter dried and planted directly in the field as M1. Selection for desirable mutants was carried out in M2 and a number of mutants with desirable traits were selected during 1990-91. The mutants were tested for stability of the selected traits in plant to progenies in M3/M4 during 1992 and 1993. The stable 17 mutants were evaluated for yield and other agronomic characters in M5, in preliminary yield trials, during 1993-94. Eleven mutants exhibited early maturity and high yield potential than parent and local commercial variety. The promising mutants will be further tested in yield trials in future for confirmation of results. (author)

  11. Uptake of soil-, foliar-and pod-applied nitrogen and phosphorus by rape (Brassica napus L.)

    International Nuclear Information System (INIS)

    Zhang Qinzheng; Xi Haifu; Lang Xianhua


    Uptake of soil-applied and foliar-and pod applied N, P by rape was studied by using 32 P and 15 N labelled fertilizer under pot culture condition. Application of phosphorus fertilizer to purplish clayey paddy soil which was poor in available P had influence on utilization of basal-dressed NH 4 HCO 3 by rape and subsequently on its growth and seed yield. Utilization rate of applied N in whole plant and seeds were 3.66 and 5.13 fold respectively as compared with control when 187.5 kg/ha of superphosphate were applied and increased with increasing application of superphosphate (187.5-562.5 kg/ha). Application of P fertilizer not only increased uptake of N but also promoted transportation of N from vegetative organs to seeds. Rape plant uptook 69.09% of foliar-and pod-applied N in form of 2% solution of urea after flowering and transported the N to seeds in greater proportion than that of soil-applied N. In the same period, 60% of foliar- and pod-applied P in form of 0.2% KH 2 PO 4 was absorbed by rape plant, most of which was in leaves. Uptake of N and P by rape increased 17.89% and 27.78% respectively when urea and phosphate was applied together compared with using urea and phosphate alone. Uptake of basal-dressed P by rape plant was 6% at early growing stage

  12. The effects of gamma irradiation on morphological, cytological and biochemical characters of double-low rape (Brassica napus L.)

    International Nuclear Information System (INIS)

    Xu Huajun; He Yuanhui; Chen Xuifang


    The dormant seeds of three varieties of double-low rape were treated with 0, 80, 100, 120, 140 and 160 krad of γ-ray. The dose-effect curves of survival rate, yield, length of pod, rate of bearing pods and oil content in rapeseed fit the equation: y = Exp (-Ax-Bx 2 ). The dose-effect curves of field germination rate, seed bearing rate, number of seeds per pod and chromosome aberration rate fit the equation: y = A + Bx. The dose-effect curve of morphological malformation rate fit the equation: y = Ae Bx . The contents of erucic acid, linolenic acid, glucosinolates and protein in rapeseed changed irregularly with the increase of doses of gamma irradiation. Close correlation were found among the effects of irradiation on morphological, cytological and biochemical characters. The radiosensitivities of rape varieties were apparently different

  13. Genetic and Cytological Analyses of the Natural Variation of Seed Number per Pod in Rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Yuhua Yang


    Full Text Available Seed number is one of the key traits related to plant evolution/domestication and crop improvement/breeding. In rapeseed germplasm, the seed number per pod (SNPP shows a very wide variation from several to nearly 30; however, the underlying causations/mechanisms for this variation are poorly known. In the current study, the genetic and cytological bases for the natural variation of SNPP in rapeseed was firstly and systematically investigated using the representative four high-SNPP and five low-SNPP lines. The results of self- or cross-pollination experiment between the high- and low-SNPP lines showed that the natural variation of SNPP was mainly controlled by maternal effect (mean = 0.79, followed by paternal effect (mean = 0.21. Analysis of the data using diploid seed embryo–cytoplasmic–maternal model further showed that the maternal genotype, embryo, and cytoplasm effects, respectively, explained 47.6, 35.2, and 7.5% of the genetic variance. In addition, the analysis of combining ability showed that for the SNPP of hybrid F1 was mainly determined by the general combining ability of parents (63.0%, followed by special combining ability of parental combination (37.0%. More importantly, the cytological observation showed that the SNPP difference between the high- and low-SNPP lines was attributable to the accumulative differences in its components. Of which, the number of ovules, the proportion of fertile ovules, the proportion of fertile ovules to be fertilized, and the proportion of fertilized ovules to develop into seeds accounted for 30.7, 18.2, 7.1, and 43.9%, respectively. The accordant results of both genetic and cytological analyses provide solid evidences and systematic insights to further understand the mechanisms underlying the natural variation of SNPP, which will facilitate the development of high-yield cultivars in rapeseed.

  14. Leaf Senescence, Root Morphology, and Seed Yield of Winter Oilseed Rape (Brassica napus L. at Varying Plant Densities

    Directory of Open Access Journals (Sweden)

    Ming Li


    Full Text Available In this study, the yield and yield components were studied using a conventional variety Zhongshuang 11 (ZS 11 and a hybrid variety Zhongyouza 12 (ZYZ 12 at varying plant densities. The increase in plant density led to an initial increase in seed yield and pod numbers per unit area, followed by a decrease. The optimal plant density was 58.5 × 104 plants ha−1 in both ZS 11 and ZYZ 12. The further researches on physiological traits showed a rapid decrease in the green leaf area index (GLAI and chlorophyll content and a remarkable increase in malondialdehyde content in high plant density (HPD population than did the low plant density (LPD population, which indicated the rapid leaf senescence. However, HPD had higher values in terms of pod area index (PAI, pod photosynthesis, and radiation use efficiency (RUE after peak anthesis. A significantly higher level of dry matter accumulation and nitrogen utilization efficiency were observed, which resulted in higher yield. HPD resulted in a rapid decrease in root morphological parameters (root length, root tips, root surface area, and root volume. These results suggested that increasing the plant density within a certain range was a promising option for high seed yield in winter rapeseed in China.

  15. Synthesis and Field Evaluation of the Sex Pheromone of Plutella xylostella (L.) (Lepidoptera: Plutellidae) in Canola (Brassica napus L.)


    Tacain, Jimena; Parpal, Florencia; Abbate, Silvana; Silva, Horacio; Ribeiro, Adela; Heguaburu, Viviana


    The diamondback moth Plutella xylostella (L.) is known to cause economic damage to rapeseed, cabbage, and other cruciferous crops worldwide. Sex pheromone components of P. xylostella, including (Z)-11-hexadecenal, (Z)-11-hexadecenol, and (Z)-11-hexadecenyl acetate, were synthesized in a concise and divergent fashion in yields appropriate to develop field tests. Two blends were prepared from these three components (8:18:100 and 10:1:90), and they were used to evaluate the number of P. xylostel...

  16. Effect of Nitrogen Foliar Application on Canola Yield (Brassica napus L. and Nitrogen Efficiency across Different Sowing Dates

    Directory of Open Access Journals (Sweden)

    S Doori


    Full Text Available Introduction Between oil seeds, from the quality, quantity and nutrition index point of view, canola has the top level . Because of the solubility of N fertilizers, the time of urea application, is very important and one of the main reasons of the reduction in N application efficiency is utilization of urea in an inappropriate time. By precisely foliar application of nitrogen, the efficiency of nitrogen transformation to the grain will be very high because in this method the leaf is considered the main organ of nitrogen uptake and a low amount of absorbed nitrogen was transferred to the root and entered the soil. The more division of N application in growth stages and in accordance with plant need and foliar application result in increasing nitrogen use efficiency. The delay in sowing will result in the reduction of yield and this is due to low LAI, and thus low radiation absorb in vegetable phase and shorter reproductive phase with high temperature in flowering and subsequent stages that result in low prolific silique and make disorder in transferring stored material to grain. In this experiment using N foliar application to decrease the adverse effect of delay in sowing is objective. Materials and Methods The experiment was conducted in 2013-2014 in Ramin Agriculture and Natural Resource University of Khuzestan. Experiment was conducted as split plots in a randomized complete blocks design with three replications. In this experiment sowing date]optimum sowing (27 November, 17 December and late sowing (30 December [were assigned to main plots and several time of N-foliar application with 5 percent density from urea (20 liter per ha, ]TO (control, T1 (foliar N application in rosette stage, T2 (foliar N application in budding stage, T3 (foliar N application in flowering stage[ were placed in sub-plots in randomized way. Fertilizing was based on the results of soil examination. Therefore, 162 kg ha-1 of pure nitrogen (from resource urea in the way of dusty application (1/3 after appearance of seedling on the soil, 1/3 in 3-4 leaves stage after thinning and 1/3 at the beginning of steam elongation and 100 kg.ha-1 super phosphate triple in all plot was applied before planting. Each plot was consist of 8 planting line with 20 cm apart from each other and 4 m length. The data were analyzed by using SAS and mean comparison of data based on LSD test in 5% probably level. Results and Discussion Late sowing date and nitrogen foliar have significant effect on the yield and efficiency and uptake index of nitrogen. With delay in sowing because the flowering and silique formation stage faced with the heat tension, the vegetative phase, production of photosynthesis matter and growth all treatment like: yield, oil yield, biological yield, oil seed percent, nitrogen harvest index, nitrogen use efficiency, nitrogen utilization of agronomy efficiency and amount of nitrogen uptake, were decrease. But it should be pointed out that with delay in sowing the percentage of nitrogen seed and nitrogen of all bushes was increased. The highest yield with mean of 3406.6 kg.ha-1 was relevant to first sowing date and least yield with mean 1803 and 1499.1 kg.ha-1 was achieved of second and third sowing date, respectively. In foliar treatment the highest yield was obtained from N foliar in budding and flowering stages and the least yield was obtained from control treatment. Foliar in budding and flowering stages by increasing the green surfaces of plant, more benefit of sun radiation, increasing in photosynthetic activity were increase and in this way the seed yield and oil yield were increase. As well nitrogen harvest index was increased with increasing of assigned nitrogen to silique in canola and the reduction in wasting of nitrogen will be increased by consume it in appropriate time. With nitrogen foliar application because of availability of nitrogen in appropriate amount and adequate utilization of plant of nitrogen, caused to increase the nitrogen utilization of agronomy efficiency and nitrogen uptake amount. Conclusions The results of this experiment showed that with delay in sowing the flowering and grain formation stages were faced to heat tension and can result in reduction in all treatment. The nitrogen foliar in heat stress caused an increase in seed yield, oil yield, dry mater, nitrogen harvest index, nitrogen utilization of agronomy efficiency and amount of nitrogen uptake. As the result, first sowing date and N foliar application in budding and flowering stages were best treatment in this experiment.

  17. Determination of Pt, Pd and Rh in Brassica Napus using solid sampling electrothermal vaporization inductively coupled plasma optical emission spectrometry

    International Nuclear Information System (INIS)

    Nischkauer, Winfried; Herincs, Esther; Puschenreiter, Markus; Wenzel, Walter; Limbeck, Andreas


    Conventional approaches for the analysis of platinum group elements (PGEs) in plant material suffer from sample digestion which results in sample dilution and therefore requires high sample intakes to maintain the sensitivity. The presented solid-sampling method avoids sample digestion while improving sensitivity when compared to digestion-based inductively coupled plasma optical emission spectrometry (ICP-OES) methods and allows the analysis of sample masses of 5 mg or less. Detection limits of 0.38 μg g −1 , 0.14 μg g −1 and 0.13 μg g −1 were obtained for Pt, Pd and Rh, respectively using a sample intake of 5 mg. The reproducibility of the procedure ranged between 4.7% (Pd) relative standard deviation (RSD, n = 7) and 7.1% (Rh) RSD for 25 ng analytes. For quantification, aqueous standards were applied on paper filter strips and dried. Only the dried filters were introduced into the electrothermal vaporization unit. This approach successfully removed memory-effects observed during analysis of platinum which occurred only if liquid standards came into contact with the graphite material of the furnace. The presented method for overcoming the Pt-memory-effects may be of further interest for the analysis of other carbide-forming analytes as it does not require any technical modification of the graphite furnace (e.g., metal inlays, pyrolytic coating). Owing to lack of suitable certified reference materials, the proposed method was compared with conventional ICP-OES analysis of digested samples and a good agreement was obtained. As a result of the low sample consumption, it was possible to determine the spatial distribution of PGEs within a single plant. Significant differences in PGE concentrations were observed between the shoots (stem, leaves) and the roots. Pd was mainly found in the roots, whereas Pt and Rh were also found in higher concentrations in the shoots. - Highlights: • The uptake of Pt, Pd and Rh by hydroponically grown plants was investigated. • Due to low sample consumption, differentiation between plant parts was possible. • Calibration via pre-dried aqueous standards on filter paper was applied

  18. To be or not to be biosafe : an evaluation of transgenic phosphinothricin-tolerant oilseed rape (Brassica napus L.)

    NARCIS (Netherlands)

    Metz, P.L.J.


    Genetic modification is an additional tool for conventional plant breeding to improve the application and quality of crop plants. No longer hampered by natural crossing barriers, application of genetic modification results in a nearly infinite pool from which genes, after isolation, can be

  19. Improvement of Canola (Brassica napus L.) Inoculated with Rhizobium, Azospirillum and/or Mycorrhizal Fungi Under Salinity Stress

    International Nuclear Information System (INIS)

    El-Ghandour, I. A.; Galal, Y.G; Ebraheem, Rabab M.M.; Yousef, Khayria A.


    Bio fertilization technology was applied for improving canola plant growth and nutrient acquisition in sandy saline soil ,as a biological mean used to develop plant growth and nutrient uptake under salinity stress. Canola was cultivated in pots packed at rate of 7 kg saline sandy soil pot -1 , and inoculated with Rhizobium leguminosarum biovar viceae, Azospirillum brasilense strain no. 40 and arbuscular mycorrhizal fungi either solely or in combinations of them. Nitrogen fertilizer was added in form ( 15 NH 4 ) 2 SO 4 with 5% 15 N atom excess at rate of 0.99 g N pot -1 . Maximum dry matter accumulation induced by composite inoculation (Rh + Azo + AM). Na concentrations were frequently affected by Rhizobium and /or mycorrhizae while K was affected by Azospirillum and /or mycorrhizae. Azospirillum enhanced Ca uptake whereas Mg content was responded well to composite inoculants of Rh + Azo + AM. Dual inoculation with Rh + Azo resulted in the highest values of N uptake by plant. Similar effect was noticed with P uptake when dual inoculums of Azo + AM were applied. Data of 15 N isotope showed that the highest portion and value of N 2 -fixed was recorded with composite inoculums followed by dual inoculations. On the other hand, the infection with AM fungi gave the highest proportion of N derived from fertilizer as compared to other inoculants or uninoculated control. In the same trend, the fertilizer use efficiency (FUE%) was enhanced by AM infection. Dual inoculums of Rh + Azo induced highest content of proline in leaves. (Authors)

  20. Response of winter rape (Brassica napus L. ssp. oleifera Metzg., Sinsk to foliar fertilization and different seeding rates

    Directory of Open Access Journals (Sweden)

    Cezary A. Kwiatkowski


    Full Text Available A field experiment in growing winter rape was carried out during the period 2009-2011 in a family farm (owned by Mr. M. Bednarczyk located in Jaroszewice (Lublin region, on podzolic soil. Plant biometric features as well as yield and seed qualitative parameters (oil, protein and glucosinolate content were evaluated depending on the following rates of soil NPK fertilizers and on foliar fertilization (autumn spraying with the fertilizer solution: 100% and 75% of NPK as well as urea + nickel chelate + MgSO4H2O; 100% and 75% of NPK as well as urea + Plonvit R + MgSO4H2O. Plots without foliar fertilization (only 100% of NPK were the control treatment. The other experimental factor was the seeding rate (2.5 kg×ha-1 – 30 cm row spacing; 4 kg×ha-1 – 18 cm row spacing. Foliar spraying was done once in the autumn in the second decade of October. Tillage as well as mechanical and chemical control of agricultural pests in the plantation were typical for this plant species and consistent with the recommendations for winter rape protection. A hypothesis was made that the application of foliar fertilizers would have a beneficial effect on winter rape productivity, at the same time maintaining the high quality of raw material. It was also assumed that a reduction in the seeding rate of winter oilseed rape would result in reduced plant lodging and an increased number of siliques per plant; as a consequence, seed and oil productivity would be at a level not lower than that obtained at the higher seeding rate. The present study has proved that foliar fertilization of winter oilseed rape in the autumn period contributes to improved plant winter hardiness and increased productivity. The application of foliar fertilizers also enables the rates of basic mineral NPK fertilizers to be reduced by 25% without detriment to seed yield. Foliar fertilizers have been found to have a weaker effect on changing the chemical composition of rapeseed. The study has shown that, from the productive point of view, it is justified to use the lower seeding rate (2.5 kg×ha-1, since winter rape yield (seed and oil yield did not significantly differ from that found in the case of the higher seeding rate (4.0 kg×ha-1.

  1. Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Sochorova, Jana; Coriton, O.; Kuderová, Alena; Lunerová Bedřichová, Jana; Chevre, A.-M.; Kovařík, Aleš


    Roč. 119, č. 1 (2017), s. 13-26 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA13-10057S Institutional support: RVO:68081707 Keywords : ribosomal-rna genes * concerted evolution * intergenic spacer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 4.041, year: 2016

  2. Application of molecular genetic tools for forest pathology (United States)

    Mee-Sook Kim; John Hanna; Amy Ross-Davis; Ned Klopfenstein


    In recent years, advances in molecular genetics have provided powerful tools to address critical issues in forest pathology to help promote resilient forests. Although molecular genetic tools are initially applied to understand individual components of forest pathosystems, forest pathosystems involve dynamic interactions among biotic and abiotic components of the...

  3. Effect of salinity and priming on seedling growth in rapeseed (Brassica napus var oleifera Del. - doi: 10.4025/actasciagron.v35i4.17655

    Directory of Open Access Journals (Sweden)

    Paolo Benincasa


    Full Text Available Experiments were performed to examine the effect of salt stress and GA3-priming on initial growth of two rapeseed cultivars, one tolerant and one sensitive to salt stress during germination. Seedlings from seeds germinated in salty (as NaCl and non salty substrate were grown in salty and non salty hydroponics. Salt stress reduced seedling growth of the two genotypes consistently with their degree of stress tolerance during germination. Seedlings from stress sensitive seeds germinated under high salinity showed a rapid recover of growth in non stressing conditions. The effect of salt stress on shoot/root ratio was controversial, increased for lab and decreased for greenhouse experiments, probably due to different timing of stress application and additional experimental conditions. Salt stress decreased leaf photosynthesis and increased thermal dissipation in sensitive seedlings (decrease of ΦPSII and qP, increase of NPQ. The GA3-priming did not affect seedling growth of the stress sensitive cultivar subjected to stress, while it greatly improved the performance of the stress tolerant cultivar.

  4. Influence of high latitude light conditions on sensory quality and contents of health and sensory-related compounds in swede roots (Brassica napus L. ssp. rapifera Metzg.). (United States)

    Mølmann, Jørgen Ab; Hagen, Sidsel Fiskaa; Bengtsson, Gunnar B; Johansen, Tor J


    Vegetable growers in Arctic areas must increasingly rely on market strategies based on regional origin and product quality. Swede roots (rutabaga) were grown in a phytotron to investigate the effect of high latitude light conditions on sensory quality and some health and sensory-related compounds. Experimental treatments included modifications of 24 h natural day length (69° 39' N) by moving plants at daily intervals to dark chambers with either no light, fluorescent growth light and/or low intensity photoperiod extension. Shortening the photosynthetic light period to 12 h produced smaller roots than 15.7 h and 18 h, with highest scores for bitter and sulfur taste, and lowest scores for sweetness, acidic taste and fibrousness. The photoperiod in combination with the photosynthetic light period also had an influence on glucosinolate (GLS) contents, with lowest concentrations in 24 h natural light and highest in 12 h natural light. Concentrations of vitamin C, glucose, fructose and sucrose were not significantly influenced by any of the treatments. High latitude light conditions, with long photosynthetic light periods and 24 h photoperiod, can enhance sweet/less bitter taste and reduce GLS contents in swede roots, compared to growth under short day conditions. This influence of light conditions on eating quality may benefit marketing of regional products from high latitudes. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  5. Determination of the Titanium Contents in the Winter Oilseed Rape Plants (Brassica napus L. by the Application of Fertilizer Containing Titanium

    Directory of Open Access Journals (Sweden)

    Peter Kováčik


    Full Text Available In order to obtain the information about changes of titanium contents in the phytomass during the growing season of winter oilseed rape and about the titanium contents drawn by the rape yield during two farming years the small plot field trial was established. In the trial the fertilizer Mg-Titanit (MgTi containing 8.5 g of titanium in 1 liter was used. The experiment consisted of 5 treatments. 0 – control treatment without MgTi fertilizer; 2xTi0.2 – two applications of MgTi in the dose of 0.2 l/ha; 3xTi0.2 – three applications of MgTi in the dose of 0.2 l/ha; 2xTi0.4 – two applications of MgTi in the dose of 0.4 l/ha; 3xTi0.4 – three applications of MgTi in the dose of 0.4 l/ha. The fertilizer was applied in spring during two, or three different growth stages: BBCH 50, BBCH 59, BBCH 66. The first plant sampling was carried out shortly before the first application of fertilizer (BBCH 50. The second, third and fourth sampling was taken 2–3 weeks after the application of Mg-Titanitu (BBCH 59, BBCH 66, BBCH 71. The obtained results showed that the titanium content in the phytomass of rape was falling during the monitored period. The titanium content in the rape aboveground phytomass varied in the interval from 16.81 to 67.6 mg/kg and in the root in the interval from 56.6 to 258.81 mg/kg. The titanium application on plant leaves in the quantities from 3.4 to 10.2 g per hectare of soil did not have the unambiguous impact on the titanium content in the rape phytomass. In the yield of one tonne of seed and appropriate quantity of rape straw on average 20 grams of titanium was taken in.

  6. Effect of Nitrogen and Zinc Sulphate Fertilizers and Azotobacter and Azospirillum Biofertilizer on Yield and Growth Traits of Rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    N. Jafari


    Full Text Available In order to study the effects of simultaneous application of nitrogen (N and ZnSO4 fertilizers and biofertilizer (Azotobacter and Azospirillum on grain yield and growth traits of rapeseed, Hyola308 cultivar, a field experiment, with split plot factorial layout based on randomized complete blocks design with three replications, was conducted at Research Field of Faculty of Agriculture, University of Guilan, Rasht, Iran, during 2007-2008 growing season. Nitrogen fertilizer at four levels (0, 50, 100 and 150 kg/ha were the main plot and ZnSO4 fertilizer at two levels (0 and 50 kg/ha and biofertilizer at two levels (with and without biofertilizer were arranged in sub-plots. Results showed that maximum and minimum leaf area indices at flowering stage (average of 1.29 and 0.95, respectively were obtained in 150 kg/ha N+ZnSO4+ biofertilizer and in 50 kg/ha N+ no ZnSO4+ no biofertilizer treatments. Maximum and minimum crop growth rates at flowering stage (average of 5.89 and 3.19 g/m2.GDD, respectively were obtained in 150 kg/ha N+ZnSO4+ biofertilizer and control treatments. Maximum and minimum grain yields (2568, 2468 and 543 kg/ha, respectively were obtained in 150 kg/ha N+ with/without ZnSO4+ biofertilizer and control (no fertilizer treatments. Maximum and minimum oil yields (42.8 and 37.3%, respectively were measured in 0 kg/ha N+ZnSO4+ biofertilizer and 150 kg/ha N+ no ZnSO4+ no biofertilizer treatments. Since there was no significant difference between 150 and 100 kg/ha N+ZnSO4+ biofertilizer treatments in terms of impact on canola grain yield and growth traits, it seems that application of biofertilizer (Azotobacter and Azospirillum, without any reduction in yield, increased grain production and oil content and saved 50 kg/ha of N fertilizer. Biofertilizer (Azotobacter and Azospirillum, along with zinc and sulfur, produced phytohormones, and N fertilizer increased dry matter accumulation and leaf area index (by increasing carbohydrate conversion to protein, made fertilizer sources available to plants for longer periods of time.

  7. Non-destructive in vitro selection of microspore-derived embryos with the fertility restorer gene for CMS Ogu-INRA in winter oilseed rape (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Lenka Havlíčková


    Conclusion: Technique developed in this study provides early and non-destructive sampling of embryonic tissue and the use of new markers for simple and efficient control of the presence of Rfo gene in all accessions.

  8. Changes in Growth and Oil Yield Indices of Rapeseed (Brassica napus L., cv. Hyola 401 in Different Concentrations andTimes of Application of Supplementary Nitrogen Fertilizer

    Directory of Open Access Journals (Sweden)

    P. Tousi Kehal


    Full Text Available In order to investigate the effect of concentration and time of supplementary nitrogen fertilizer spray on growth indices of rapeseed (cv. Hyola 401, a field experiment was conducted at Rice Research Institute of Iran as a randomized complete blocks design with 16 treatments and 3 replications in 2008-2009. The treatments included concentration of nitrogen fertilizer (urea at two levels (5 and 10 ppm in seven levels of application time:1 spraying at 6-8- leaf stage, 2 beginning of stem elongation, 3 prior to flowering, 4 at 6-8- leaf stage + beginning of stem elongation, 5 at 6-8- leaf + prior to flowering, 6 beginning of stem elongation+ prior to flowering, and 7 at 6-8- leaf + beginning of stem elongation+ prior to flowering, which were compared with two control treatments (no fertilizer nitrogen and conventional soil fertilization. Results showed that significant difference was observed between spray treatments including concentration and times of nitrogen application, between controls and between controls with spray treatments, of grain and oil yield, crop growth rate (CGR, leaf area index (LAI and leaf area duration (LAD. Application of nitrogen (10 ppm at the beginning of stem elongation+ prior to flowering stages produced maximum grain yield (4221.7 kg/ha and oil yield (1771.1 kg/ha. Spray treatments produced maximum oil yield index (15.3% compared to controls. Maximum LAI (6.9 and 5.6 respectively, CGR (15.2 and 14.3 g/m2.10 GDD, respectively and LAD (1204 and 1029 cm2/10 GDD, respectively were also obtained from spray application of nitrogen (10 ppm at the beginning of stem elongation+ prior to flowering stages and at 6-8-leaf stage + beginning of stem elongation + prior to flowering. According to the results of the present investigation, it seems that foliar application of supplementary nitrogen fertilizer at the end growth stages (beginning of stem elongation and prior to flowering of rapeseed plants may help to enhance growth indices, oil yield index and grain yield.

  9. Mitogen-activated protein kinase kinase kinase (MAPKKK) 4 from rapeseed (Brassica napus L.) is a novel member inducing ROS accumulation and cell death

    Energy Technology Data Exchange (ETDEWEB)

    Li, Liang, E-mail:; Ye, Chaofei, E-mail:; Zhao, Rui, E-mail:; Li, Xin, E-mail:; Liu, Wu-zhen, E-mail:; Wu, Feifei, E-mail:; Yan, Jingli, E-mail:; Jiang, Yuan-Qing, E-mail:; Yang, Bo, E-mail:


    MAPKKK is the largest family of MAPK cascade, which is known to play important roles in plant growth, development and immune responses. So far, only a few have been functionally characterized even in the model plant, Arabidopsis due to the potential functional redundancy of MAPKKK. We previously identified and cloned a few MAPKKK family genes from rapeseed. In this study, BnaMAPKKK4 was characterized as a member in eliciting accumulation of reactive oxygen species (ROS) and hypersensitive response (HR)-like cell death. This is accompanied with accumulation of malondialdehyde (MDA), anthocyanin as well as nuclear DNA fragmentation. The transcript abundance of a series of ROS accumulation, cell death, and defense response related genes were up-regulated by the expression of MAPKKK4. Further investigation identified BnaMAPKKK4 elicited ROS through the downstream MPK3. These results indicate that BnaMAPKKK4 and its downstream components function in the ROS-induced cell death. - Highlights: • Expression of rapeseed MAPKKK4 induced ROS accumulation and cell death in leaves. • Cell death induced by MAPKKK4 is associated with membrane lipid peroxidation and DNA fragmentation. • MAPKKK4 interacts with MKK5 and MPK3. • MAPKKK4-induced ROS accumulation and cell death require downstream WIPK and SIPK. • MAPKKK4 is a novel MAPKKK modulating ROS accumulation and cell death.

  10. Effects of Super-Absorbent Polymer Application on Yield and Yield Components of Rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Fariborz SHEKARI


    Full Text Available Limitation of water resources and its great impact on agricultural and natural resources play a crucial role in the efficiency of water use. Applying super absorbent polymer to the soil may be one of the methods to minimize the stress of weather dryness in arid and semi-arid regions. In order to evaluate the effects of hydrophilic polymer application on yield and water use efficiency of rapeseed plants, an experiment was conducted under field condition in 2012 at the Research Farm of the Faculty of Agriculture, University of Maragheh. Treatments’ factors were: (i 3 super absorbent polymers (SAP (Taravat A200 levels of 0 (without application, 75 and 150 kg ha-1 A200 application, (ii three irrigation levels of 80, 120 and 180 mm evaporation from class A basin in main plots, (iii two cultivars ʻHyola 401ʼ and ʻRVSʼ in sub plots as factorial split plot combination based on completely randomized block design with three replications. The results showed that in all of the measured traits within the experiment there were significant differences between SAP levels. Furthermore, increasing irrigation interval led to an increase in a thousand seeds’ weight, but decreased seed yield. Increasing water stress raised seed oil percent and infertile silique and subsequently resulted in reduced oil yield. ʻHyola 401ʼ was more susceptible to embryo abortion compared with ʻRVSʼ. As a conclusion of the research, SAP (A200 application in quantities smaller than 75 kg ha-1 may be recommended for rapeseed production under field condition.

  11. Fixed-route monitoring and a comparative study of the occurrence of herbicide-resistant oilseed rape (Brassica napus L.) along a Japanese roadside (United States)

    Nishizawa, Toru; Nakajima, Nobuyoshi; Tamaoki, Masanori; Aono, Mitsuko; Kubo, Akihiro; Saji, Hikaru


    ABSTRACT Previously, we conducted a roadside survey to reveal the occurrence of genetically modified (GM) oilseed rape along a Japanese roadside (Route 51). In this study, we performed successive and thorough fixed-route monitoring in 5 sections along another road (Route 23). Oilseed rape plants were detected on both sides of the road in each section between autumn 2009 and winter 2013, which included 3 flowering seasons. In four sections, more plants were found on the side of the road leading from the Yokkaichi port than on the opposite side. In the fifth section, the presence of clogged drains on the roadside, where juvenile plants concentrated, caused the opposite distribution: oilseed rape predominantly occurred along the inbound lanes (leading to the Yokkaichi port) in 2010 and 2012. Unlike in our previous survey, glyphosate- or glufosinate-resistant oilseed rape plants were abundant (>75% of analyzed plants over 3 years). Moreover, a few individuals bearing both herbicide resistance traits were also detected in some sections. The spillage of imported seeds may explain the occurrence of oilseed rape on the roadside. The abundance of herbicide-resistant oilseed rape plants may reflect the extent of contamination with GM oilseed rape seed within imports. PMID:26838503

  12. The effect of endo- and exogenous factors on growth and maturation of oilseed rape (Brassica napus cv. Jet Neuf siliques cultured in vitro

    Directory of Open Access Journals (Sweden)

    Lucyna Drozdowska


    Full Text Available The effect of developmental stage of siliques, growth regulators, agar and sucrose concentrations in the medium was investigated on the morphogenesis of the silliques and seed maturation. Regeneration of shoots, roots and callus occurred at the base of siliques during their growth. The developmental stage of the incubated siliques was the most important factor affecting the number of seeds, while the conditions of culture (agar and growth regulators constituted a secondary factor. The reasons for the insignificant number of seeds produced could be the lack of fertilization of some of the ovules, limited ability of siliques to take up nutrients and the unspecific composition of the medium.

  13. Distributions of imidacloprid, imidacloprid-olefin and imidacloprid-urea in green plant tissues and roots of rapeseed (Brassica napus) from artificially contaminated potting soil. (United States)

    Seifrtova, Marcela; Halesova, Tatana; Sulcova, Klara; Riddellova, Katerina; Erban, Tomas


    Imidacloprid-urea is the primary imidacloprid soil metabolite, whereas imidacloprid-olefin is the main plant-relevant metabolite and is more toxic to insects than imidacloprid. We artificially contaminated potting soil and used quantitative UHPLC-QqQ-MS/MS to determine the imidacloprid, imidacloprid-olefin and imidacloprid-urea distributions in rapeseed green plant tissues and roots after 4 weeks of exposure. In soil, the imidacloprid/imidacloprid-urea molar ratios decreased similarly after the 250 and 2500 µg kg -1 imidacloprid treatments. The imidacloprid/imidacloprid-urea molar ratios in the root and soil were similar, whereas in the green plant tissue, imidacloprid-urea increased more than twofold compared with the root. Although imidacloprid-olefin was prevalent in the green plant tissues, with imidacloprid/imidacloprid-olefin molar ratios of 2.24 and 1.47 for the 250 and 2500 µg kg -1 treatments respectively, it was not detected in the root. However, imidacloprid-olefin was detected in the soil after the 2500 µg kg -1 imidacloprid treatment. Significant proportions of imidacloprid-olefin and imidacloprid-urea in green plant tissues were demonstrated. The greater imidacloprid supply increased the imidacloprid-olefin/imidacloprid molar ratio in the green plant tissues. The absence of imidacloprid-olefin in the root excluded its retransport from leaves. The similar imidacloprid/imidacloprid-urea ratios in the soil and root indicated that the root serves primarily for transporting these substances. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  14. Mitogen-activated protein kinase kinase kinase (MAPKKK) 4 from rapeseed (Brassica napus L.) is a novel member inducing ROS accumulation and cell death

    International Nuclear Information System (INIS)

    Li, Liang; Ye, Chaofei; Zhao, Rui; Li, Xin; Liu, Wu-zhen; Wu, Feifei; Yan, Jingli; Jiang, Yuan-Qing; Yang, Bo


    MAPKKK is the largest family of MAPK cascade, which is known to play important roles in plant growth, development and immune responses. So far, only a few have been functionally characterized even in the model plant, Arabidopsis due to the potential functional redundancy of MAPKKK. We previously identified and cloned a few MAPKKK family genes from rapeseed. In this study, BnaMAPKKK4 was characterized as a member in eliciting accumulation of reactive oxygen species (ROS) and hypersensitive response (HR)-like cell death. This is accompanied with accumulation of malondialdehyde (MDA), anthocyanin as well as nuclear DNA fragmentation. The transcript abundance of a series of ROS accumulation, cell death, and defense response related genes were up-regulated by the expression of MAPKKK4. Further investigation identified BnaMAPKKK4 elicited ROS through the downstream MPK3. These results indicate that BnaMAPKKK4 and its downstream components function in the ROS-induced cell death. - Highlights: • Expression of rapeseed MAPKKK4 induced ROS accumulation and cell death in leaves. • Cell death induced by MAPKKK4 is associated with membrane lipid peroxidation and DNA fragmentation. • MAPKKK4 interacts with MKK5 and MPK3. • MAPKKK4-induced ROS accumulation and cell death require downstream WIPK and SIPK. • MAPKKK4 is a novel MAPKKK modulating ROS accumulation and cell death.

  15. Characterization of heavy metal-resistant endophytic bacteria from rape (Brassica napus) roots and their potential in promoting the growth and lead accumulation of rape

    International Nuclear Information System (INIS)

    Sheng Xiafang; Xia Juanjuan; Jiang Chunyu; He Linyan; Qian Meng


    Two lead (Pb)-resistant endophytic bacteria were isolated from rape roots grown in heavy metal-contaminated soils and characterized. A pot experiment was conducted for investigating the capability of the two isolates to promote the growth and Pb uptake of rape from Pb-amended soil. The two isolates were identified as Pseudomonas fluorescens G10 and Microbacterium sp. G16 based on the 16S rDNA gene sequence analysis. Strains G10 and G16 exhibited different multiple heavy metal and antibiotic resistance characteristics and increased water-soluble Pb in solution and in Pb-added soil. Root elongation assays demonstrated increases in root elongation of inoculated rape seedlings compared to the control plants. Strain G16 produced indole acetic acid, siderophores and 1-aminocyclopropane-1-carboxylate deaminase. Increases in biomass production and total Pb uptake in the bacteria-inoculated plants were obtained compared to the control. The two strains could colonize the root interior and rhizosphere soil of rape after root inoculation. - Heavy metal-resistant endophytic bacteria from rape have the potential of promoting the growth and lead uptake of rape

  16. Immediate unidirectional epigenetic reprogramming of NORs occurs independently of rDNA rearrangements in synthetic and natural forms of a polyploid species Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Książczyk, T.; Kovařík, Aleš; Eber, F.; Huteau, V.; Crhák Khaitová, Lucie; Tesaříková, Zuzana; Coriton, O.; Chevre, A.-M.


    Roč. 120, č. 6 (2011), s. 557-571 ISSN 0009-5915 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : allopolyploidy * ribosomal RNA * expression Subject RIV: BO - Biophysics Impact factor: 3.847, year: 2011

  17. Contribution of Nitrogen Uptake and Retranslocation during Reproductive Growth to the Nitrogen Efficiency of Winter Oilseed-Rape Cultivars (Brassica napus L. Differing in Leaf Senescence

    Directory of Open Access Journals (Sweden)

    Fabian Koeslin-Findeklee


    Full Text Available Genotypic variation in N efficiency defined as high grain yield under limited nitrogen (N supply of winter oilseed-rape line-cultivars has been predominantly attributed to N uptake efficiency (NUPT through maintained N uptake during reproductive growth related to functional stay-green. For investigating the role of stay-green, N retranslocation and N uptake during the reproductive phase for grain yield formation, two line cultivars differing in N starvation-induced leaf senescence were grown in a field experiment without mineral N (N0 and with 160 kg N·ha−1 (N160. Through frequent harvests from full flowering until maturity N uptake, N utilization and apparent N remobilization from vegetative plant parts to the pods could be calculated. NUPT proved being more important than N utilization efficiency (NUE for grain yield formation under N-limiting (N0 conditions. For cultivar differences in N efficiency, particularly N uptake during flowering (NUPT and biomass allocation efficiency (HI to the grains, were decisive. Both crop traits were related to delayed senescence of the older leaves. Remobilization of N particularly from stems and leaves was more important for pod N accumulation than N uptake after full flowering. Pod walls (high N concentrations and stems (high biomass mainly contributed to the crop-residue N at maturity. Decreasing the crop-inherent high N budget surplus of winter oilseed-rape requires increasing the low N remobilization efficiency particularly of pod-wall N to the grains. Addressing this conclusion, multi-year and -location field experiments with an extended range of cultivars including hybrids are desirable.

  18. Heterosis and genetic distance in rapeseed (Brasica napus L.). Use of different indicators of genetic divergence in 7x7 diallel


    Lefort-Buson, Marianne; Guillot-Lemoine, Brigitte; Dattée, Yvette


    The paper deals with a comparison of different indicators of genetic divergence between rapeseed parental lines : the relationship coefficient defined by MALÈCOT the generalized distance D2 of Mahalanobis, and a new G2 parameter close to HANSON & CASAS' R2. The purpose of the authors is to discuss the advantages of their simultaneous use in the prediction of both heterosis values and F1 performances of hybrids from parental lines. Relationships between heterosis values and genetic distanc...

  19. Genes encoding biotin carboxylase subunit of acetyl-CoA carboxylase from Brassica napus and parental species: cloning, expression patterns, and evolution (United States)

    Comparative genomics is a useful tool to investigate gene and genome evolution. Biotin carboxylase (BC), an important subunit of heteromeric ACCase that is a rate-limiting enzyme in fatty acid biosynthesis in dicots, catalyzes ATP, biotin-carboxyl-carrier protein and CO2 to form carboxybiotin-carbo...

  20. Symbiotic Effect of Trichoderma atroviride on Growth Characteristics and Yield of two Cultivars of Rapeseed (Brassica napus L. in a Contaminated Soil Treated with Copper Nitrate

    Directory of Open Access Journals (Sweden)

    E TashakoriFard


    Full Text Available Introduction Accumulation of heavy metals in agricultural soils can be a threat to crop production due to plant toxicity. In the recent years, hyperaccumulator plants are cultivated to cleaning up the soils which contaminated with pollutants especially heavy metals. However, the biomass of these plants is low and metal specific. Many studies have shown that microorganisms can be used to significantly reduce the toxicity of heavy metals. Therefore, the present study aimed to determine the role of Trichoderma atroviride on the growth characteristics of tow cultivars of rapeseed in different levels on copper. Materials and Methods In this study, a pot experiment was conducted in factorial arrangement based completely randomized design with three replicates. Treatment were T. atroviride fungi at two levels of inoculated and non-inoculated plants, four levels of copper nitrate including 0, 50, 100 and 150 mg l-1 and two cultivars of rapeseed consist of Hayola 401 and Sarigol. Trichoderma atroviride was prepared from Mycology Lab of Sari Agricultural Science and Natural Resource University. PDA medium (potato extract, dextrose and agar was kept for a week at 25˚C to propagation of fungal strain. The used medium was previously sterilized in autoclave for 30 minutes. So, this fungus propagated in Wheat's bran for five days. Healthy and uniform seeds of rapeseeds were separated from rogues and infertile ones. Seeds disinfected in hypochlorite sodium 0.5% for five minute and then washed with distilled water three times. After preparing fungus spore suspension of 108 CFU per ml water, 50 g wheat' bran mixed to the soil of each pot. Twenty sterilized seeds sown in 2 cm of soil depth in 25×30 cm pot with 10 kg capacity. Copper nitrate was used to pollute treated soil. During this experiment did not used any pesticides and herbicides and all weed controlled manually. Some growth and yield related parameters such as plant height, number of secondary branches, pod number and length of primary and secondary branches, were determined. All statistical analysis were performed using SAS software (version 9.1 and mean comparisons were made by the least significant difference (LSD test. Results and Discussion Results showed that increasing copper content in growth medium markedly decreased pod number in main branches in Hayola 401 while in Sarigol the maximum pod number was recorded at the 50 mg l-1 of copper nitrate. The presence of the Trichoderma, however, increased pod number in branches. Sarigol resulted more pod numbers in branches than Hayola 401 (2.5 times vs. 64%. Also, the maximum pod numbers in branches (about 1.3 fold as compared to the uninoculated control were observed in Trichoderma inoculated plants which received 100 mg/L of copper nitrate. The maximum plant height in Hayola 401 and Sarigol (0 and 100 mg l-1 of copper nitrate, respectively recorded when those plants inoculated with Trichoderma. The presence of the Trichoderma in the growth medium significantly improved the pod length of in main branches in Hayola 401 rather than Sarigol. Conclusions Many researches showed that rapeseed is a hyperaccumulatore plant for heavy metals such as copper, cadmium, nickel, zinc and lead. On the other hand, many researchers confirmed that soil beneficial microorganisms such as Trichoderma spp. could improve the growth and yield attributes of plant especially in polluted soil. In conclusion, inoculation of rapeseed plants with Trichoderma could enhance the growth characteristics of rapeseed particularly under high levels of copper in the soil. Sarigol, however, respond better than Hayola 401 in terms of yield and yield components. Since, important aspect of bioremediation is inhibition of pollutants passes through a food chain, thus, coexistence of beneficial microorganisms that capable to transform contaminants into nontoxic products are very important.

  1. Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana. (United States)

    Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying


    Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. The effect of biological fertilizers on yield, yield components and seed oil contents of three cultivars of canola (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    A Koocheki


    Full Text Available Introduction Canola is the world third oil crop with 25 to 55 percent oil content (Hezbavi & Minaei, 2008. In recent years, tendency towards expansion of the acreage of canola in Iran has been increasing and for the years 2010-2011 an area of 93000 ha with a total production of 190000 tons has been reported (Ministry of Jihad of Agriculture, 2013. Application of biological fertilizers which are environmentally friendly agents have been reported to enhance yield and quality of different crops (Shoghi Kalkhoran et al., 2012; Afrasiabi et al., 2011. The purpose of the present study was to investigate the effects of biological fertilizers on quantitative and quality criteria of canola. Material and methods For this study, a factorial arrangement based on randomized complete block design and three replicates was used. The experimental treatments were three canola cultivars namely Okapi, Zarfam and Modena which was combined with four levels of biological fertilizers: Nitroxin, Phosphat solubilizing bacteria (PSB, Nitroxin+PSB and a control. Seeds were planted in plots of 2×3 m2. All field managements were carried out based on conventional practices. The measured criteria were plant height, number of pods per plant, 1000- seed weight, biomass yield, harvest index, oil content and yield. Results and discussion The results showed that in all studied criteria except 1000- seed weight there were significant differences between cultivars. Different fertilizer treatments had a significant effect on all criteria except 1000- seed weight and HI. Modena cultivar had the highest oil yield and quantitative characteristics. Composition of phosphate solubilizing bacteria+nitroxin also had the highest oil yield and quantitative characteristics. The interactions between biofertilizer treatments and cultivars in all criteria were not significant. The result of this experiment indicated the effectiveness of use of biofertilizers. References Afrasiabi, M., Amini Dehaghi, M., and Modarres Sanavy, A.M. 2011. Effect of phosphate biofertilizer Barvar- 2 and triple super phosphate fertilizer on yield, quality and nutrient uptake of Medicago scutellata, cv. Robinson. Plant Protection (Scientific Journal of Agriculture 4: 43-54. In Persian with English Summary Hezbavi, E., and Minaei, S. 2008. Determination and investigation of some physical properties of seven variety rapeseed. Food Science and Technology Research Journal 5: 21-28. In Persian with English Summary Ministry of Jihad-e-Agriculture. 2013. Available at Web site (verified 12 march 2013 Shoghi Kalkhoran, S., Ghalavand, A., and Modares Sanavi, S.A.M. 2012. Effects of biofertilizer and green manure (winter wheat in combination with integrated nitrogen sources (chemical-farmyard manure on quantitative and qualitative characteristics of sunflower (Helianthus annuus L.. Environmental Sciences 3: 35-52. In Persian with English Summary The effect of organic, biological and chemical fertilizers on yield, essential oil percentage and some agroecological characteristics of summer savory (Satureja hortensis L. under Mashhad conditions E. Gholami Sharafkhane , M. Jahan2, M. Banayan Avval3, A. Koocheki4 and P. Rezvani Moghaddam4 Submitted: 06-05-2013 Accepted: 13-05-2014 Keywords: Cattle manure, Dry matter yield, Low input system, Plant Growth Promoting Rhizobacteria (PGPR, Vermicompost Introduction Savory (Satureja hortensis L. is an annual herbaceous plant that belongs to the Lamiaceae family. Nowadays, the use of biofertilizers is increased in agriculture and their role in increasing the crops production has been demonstrated in many research works (Vessey, 2003; Chen, 2006; Mahfouz & Sharaf- Eldin, 2007. One of the most important visions is sustainable production of enough food plus paying attention to social, economical and environmental aspects. (Gliessman, 1998 stated that the first step to achieve this goal is optimization and improvement of resources use efficiencies. Considering medicinal importance of savory and its role in the food and pharmaceutical industries (Omidbeigi, 2000, beside the limited nutrient resources and need to increase healthy production through using ecological inputs, this study was designed and conducted aimed to evaluate agroecological characteristics of savory as affected by the application of bio fertilizers, chemical and organic fertilizers under Mashhad conditions. Materials and methods In order to study the effects of organic, biological and chemical fertilizers on quantitative and qualitative characteristics of summer savory, a split-plot design based on RCBD with three replications was conducted during the growing season of 2012 at the Agricultural Research Station, College of Agriculture, Ferdowsi University of Mashhad, Iran. Different levels of cattle manure (0 and 25 t.ha-1 were assigned to the main plots and different types of bio fertilizers (Nitroxin, containing Azotobacter sp. and Azospirillum sp., Biophosphor, containing phosphate-solubilizing bacteria (Bacillus sp. and Pseudomonas sp., Biosulfur, containing sulfur-solubilizing bacteria (Thiobacillus ssp., combination of Nitroxin+Biophosphor+ Biosulfur, vermicompost (7 t.ha-1, chemical fertilizers (NPK: 60, 60 and 70 kg.ha-1 and control (no fertilizer were used in the sub- plots. Results and discussion According to the results, all studied characteristics including plant height, lateral branches, flowering shoot yield, stem yield, percentage of essential oil and dry matter yield were affected positively by cattle manure. The highest plant height and number of lateral branches resulted from vermicompost and combination of Nitroxin+Biophosphor+Biosulfur, respectively. Biosulfur fertilizer produced the highest dry matter yield, flowering shoot yield and stem yield. Percentage of essential oil was also significantly affected by fertilizer treatments as the most percentage of essential oil was obtained from Nitroxin, vermicompost and combination of Nitroxin+Biophosphor+Biosulfur. A positive and strong correlation was observed between dry mater yield and flowering shoot yield and stem yield, respectively. Conclusion The results indicated that application of organic and inoculation of biological fertilizers have positive effects on improvement of qualitative and quantitative traits of summer savory, so it could be considered as an alternative method for healthy production of summer savory. Acknowledgements The expenses for this research were funded by the Research and Technology Deputy of the Ferdowsi University of Mashhad, Faculty of agriculture. The financial support is appreciated. References Chen, J. 2006. The combined use of chemical and organic fertilizers and/or biofertilizer for crop growth and soil fertility. International Workshop on Sustained Management of the Soil-Rhizosphere System for Efficient Crop Production and Fertilizer Use. October 16-20. Thailand. 11 pp. Gliessman, S.R. 1998. Agroecology: Ecological Processes in Sustainable Agriculture. CRC Press. ISBN: 1-57504-043-3 Mahfouz, S.A., Sharaf- Eldin, A. 2007. Effect of mineral vs. biofertilizer on growth, yield, and essential oil content of fennel (Foeniculum vulgare Mill.. Agrophysics Journal 21: 361-366. Omidbeigi, R. 2000. Approaches to Production and Processing of Medicinal plants, vol. (3. Beh Nashr Publisher, Mashhad. (In Persian Vessey, J.K. 2003. Plant growth promoting rhizobacteria as biofertilizers. Plant and Soil 255: 571-586.

  3. Potential roles of Labyrinthula spp. in global seagrass population declines

    Digital Repository Service at National Institute of Oceanography (India)

    Sullivan, B.K.; Sherman, T.D.; Damare, V.S.; Lilje, O.; Gleason, F.H.

    are able to cause ecologically significant diseases of protists, plants and animals. Here, the pathosystem model is applied to host–parasite relationships in seagrass ecosystems. Known physical and biological stressors of seagrass are reviewed. Finally, we...

  4. A modelling framework to simulate foliar fungal epidemics using functional-structural plant models. (United States)

    Garin, Guillaume; Fournier, Christian; Andrieu, Bruno; Houlès, Vianney; Robert, Corinne; Pradal, Christophe


    Sustainable agriculture requires the identification of new, environmentally responsible strategies of crop protection. Modelling of pathosystems can allow a better understanding of the major interactions inside these dynamic systems and may lead to innovative protection strategies. In particular, functional-structural plant models (FSPMs) have been identified as a means to optimize the use of architecture-related traits. A current limitation lies in the inherent complexity of this type of modelling, and thus the purpose of this paper is to provide a framework to both extend and simplify the modelling of pathosystems using FSPMs. Different entities and interactions occurring in pathosystems were formalized in a conceptual model. A framework based on these concepts was then implemented within the open-source OpenAlea modelling platform, using the platform's general strategy of modelling plant-environment interactions and extending it to handle plant interactions with pathogens. New developments include a generic data structure for representing lesions and dispersal units, and a series of generic protocols to communicate with objects representing the canopy and its microenvironment in the OpenAlea platform. Another development is the addition of a library of elementary models involved in pathosystem modelling. Several plant and physical models are already available in OpenAlea and can be combined in models of pathosystems using this framework approach. Two contrasting pathosystems are implemented using the framework and illustrate its generic utility. Simulations demonstrate the framework's ability to simulate multiscaled interactions within pathosystems, and also show that models are modular components within the framework and can be extended. This is illustrated by testing the impact of canopy architectural traits on fungal dispersal. This study provides a framework for modelling a large number of pathosystems using FSPMs. This structure can accommodate both

  5. Flowering times in genetically modified Brassica hybrids in the absence of selection (United States)

    Changes in days to flowering (DTF) were observed among reciprocal F1 progeny of Brassica napus ‘RaideRR’ with other B. napus and also with weedy B. rapa. Changes in DTF are presented as factors to consider in evaluating the potential of crop to weed gene flow in different geograp...

  6. Enteric methane production and ruminal fermentation of forage brassica diets fed in continuous culture (United States)

    The aim of the current study was to determine nutrient digestibility, VFA production, N metabolism, and CH4 production of canola (Brassica napus L.), rapeseed (B. napus L.), turnip (B. rapa L.), and annual ryegrass (Lolium multiflorum Lam.) fed with orchardgrass (Dactylis glomerata L.) in continuous...

  7. Genotypic Correlation and Path Analysis of Some Traits related to Oil Yield and Grain Yield in Canola (Brassica napus L. under Non-stress and Water Deficit Stress Conditions

    Directory of Open Access Journals (Sweden)

    A Ismaili


    Full Text Available Introduction Obtaining varieties with acceptable yield and tolerant to different arid and semi-arid climate condition of Iran is an important goal in canola breeding programs. Selection of genotypes base on one or more traits without regarding to correlation between them, could biases the expected results. Therefore, identifying of genetic correlation among traits especially in environmental stress condition is very important. The use of genotypic correlation helps evaluating the magnitude and direction of associations between characters facilitating the application of indirect selection, because genetic changes in a given trait may change other traits, leading to faster and larger genetic gains in plant breeding programs. Therefore, the selection for another trait may result in indirect response in the low heritable trait, provided the following conditions are satisfied: the genetic correlation between them is substantial, and the heritability of the secondary trait is greater than that of the primary trait. The purpose of this study was estimating the total genotypic variability, genotypic correlations, and path analysis among some important traits for selection criteria for improving seed and oil yield in canola under water deficit stress condition. Materials and Methods For evaluation of genetic correlation among traits and identifying important affecting traits on grain yield and oil yield in canola genotypes, an experiment was conducted based on a randomized complete blocks design with three replications in two different conditions of water deficit (stress and non-stress. Different traits were measured including seed yield, 1000-seed weight, number of seeds per pod, number of pods per plant, silique length, oil content, days to maturity, protein content, plant height and water use efficiency. Genotypic and phenotypic correlation coefficients were calculated for ten characters during growing seasons. The genotypic correlation coefficients between seed yield and different characters were subjected to path coefficient analysis separately for partitioning these values into direct and indirect effects. Step-wise regression technique was used to determine the best model, which accounted for variation exist in plant seed and oil yield as dependent variables in separate analysis. Direct and indirect effects of traits entered to regression model were determined by using path coefficient analysis. Results and Discussion Results of this study showed significant differences among all genotypes performances, and also stress condition caused a significant decrease in performance of all studied traits. The highest seed yield obtained from Geronimo and Dante (with 3668 and 3505 kg.ha-1, respectively under non stress condition, and the highest seed yield obtained from Zarfam and Dante (with 2948 and 2860 kg ha-1, respectively under drought stress condition. Genotype Licord produced the highest oil content, which was significantly higher than that produced by other genotypes in either regime. Genotypic and phenotypic correlation coefficients were estimated between all traits and using stepwise regression, best model was introduced for two conditions. Under Non-stress condition, the average of genetic correlations between grain yield and silique length was high and positive (0.92**, suggesting that the selection of prolific plants resulted in a gain of selection for yield. Under water deficit stress condition, a negative average of genetic correlations (-0.28 was observed for grain yield and days to maturity. Path analysis based on the genotypic correlation under non-stress conditions between grain yield and other traits showed that number of pods per plant and pod length had direct effects on grain yield, while under drought conditions, pod length and plant height had important direct effects. Results of path analysis for oil yield under non-stress and stress conditions showed that grain yield had the most direct effect on oil yield. Conclusions Finally, the most important traits in order to select index for grain yield and oil yield improvement under stress condition were pod length and grain yield, respectively. Therefore, selection based on these traits would be more effective to improving seed yield of canola in well-watered and water-deficit stress conditions. So, the method of path coefficients proved useful in analyzing correlation coefficients in this system of interrelated variables.

  8. Diagnóstico del estado nutricional del cultivo de colza (Brassica napus) en base a curvas de dilución de nitrógeno y azufre


    Ferreira, Gonzalo; Ernst, Oswaldo


    Para la obtención de elevados rendimientos en el cultivo de colza es necesaria la complementación del nitrógeno (N) con una adecuada nutrición de azufre (S). El objetivo del presente trabajo fue determinar indicadores de diagnóstico del estado nutricional del cultivo en referencia a nitrógeno y azufre en planta para la óptima producción de grano y aceite. Se obtuvieron las ecuaciones de dilución para la concentración crítica de nitrógeno y azufre (Nc = 5,21 MS-0,36 y Sc = 1,22e-0,18MS respect...

  9. Accumulation of wet-deposited radiocaesium and radiostrontium by spring oilseed rape (Brássica napus L.) and spring wheat (Tríticum aestívum L.)

    International Nuclear Information System (INIS)

    Bengtsson, Stefan B.; Eriksson, Jan; Gärdenäs, Annemieke I.; Vinichuk, Mykhailo; Rosén, Klas


    The accumulation of 134 Cs and 85 Sr within different parts of spring oilseed rape and spring wheat plants was investigated, with a particular focus on transfer to seeds after artificial wet deposition at different growth stages during a two-year field trial. In general, the accumulation of radionuclides in plant parts increased when deposition was closer to harvest. The seed of spring oilseed rape had lower concentrations of 85 Sr than spring wheat grain. The plants accumulated more 134 Cs than 85 Sr. We conclude that radionuclides can be transferred into human food chain at all growing stages, especially at the later stages. The variation in transfer factors during the investigation, and in comparison to previous results, implies the estimation of the risk for possible transfer of radionuclides to seeds in the event of future fallout during a growing season is still subject to considerable uncertainty. -- Highlights: •Accumulation of 134 Cs and 85 Sr in plants increased the closer to harvest the nuclides were deposited. • 134 Cs and 85 Sr concentrations in seeds were highest when deposited after flowering. •Activity concentrations of 134 Cs in spring oilseed rape were higher than the activity concentrations of 85 Sr. •Oilseed rape redistributes 134 Cs and 85 Sr to seed at a lower rate than wheat redistributes 134 Cs and 85 Sr to grain. -- Intercepted radionuclides can be transferred into the food chain for humans

  10. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    International Nuclear Information System (INIS)

    Himanen, Sari J.; Nerg, Anne-Marja; Nissinen, Anne; Stewart, C. Neal; Poppy, Guy M.; Holopainen, Jarmo K.


    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants

  11. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, Sari J. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)], E-mail:; Nerg, Anne-Marja [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); Nissinen, Anne [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); MTT Agrifood Research Finland, Plant Protection, FIN-31600 Jokioinen (Finland); Stewart, C. Neal [University of Tennessee, Department of Plant Sciences, Knoxville, TN 37996-4561 (United States); Poppy, Guy M. [University of Southampton, School of Biological Sciences, Southampton SO16 7PX (United Kingdom); Holopainen, Jarmo K. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)


    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants.

  12. Climate change and genetically modified insecticidal plants. Plant-herbivore interactions and secondary chemistry of Bt Cry1Ac-toxin producing oilseed rape (Brassica napus L.) under elevated CO{sub 2} or O{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, S.


    Transgenic insect-resistant plants producing Bacillus thuringiensis (Bt) crystalline endotoxins are the first commercial applications of genetically modified crops and their use has steadily expanded over the last ten years. Together with the expanding agricultural use of transgenic crops, climate change is predicted to be among the major factors affecting agriculture in the coming years. Plants, herbivores and insects of higher trophic levels are all predicted to be affected by the current atmospheric climate change. However, only very few studies to date have addressed the sustained use and herbivore interactions of Bt-producing plants under the influence of these abiotic factors. The main objective of this study was to comparatively assess the performance of a Bt Cry1Ac toxin-producing oilseed rape line and its non-transgenic parent line in terms of vegetative growth and allocation to secondary defence compounds (glucosinolates and volatile terpenoids), and the performance of Bt-target and nontarget insect herbivores as well as tritrophic interaction functioning on these lines. For this, several growth chamber experiments with vegetative stage non-Bt and Bt plants facing exposures to doubled atmospheric CO{sub 2} level alone or together with increased temperature and different regimes of elevated O{sub 3} were conducted. The main hypothesis of this work was that Bt-transgenic plants have reduced performance or allocation to secondary compounds due to the cost of producing Bt toxin under changed abiotic environments. The Bt-transgenic oilseed rape line exhibited slightly delayed vegetative growth and had increased nitrogen and reduced carbon content compared to the non-transgenic parent line, but the physiological responses (i.e. biomass gain and photosynthesis) of the plant lines to CO{sub 2} and O{sub 3} enhancements were equal. Two aphid species, non-susceptible to Bt Cry1Ac, showed equal performance and reproduction on both plant lines under elevated CO{sub 2} and temperature despite differences in carbon and nitrogen concentrations between the non-Bt and Bt line. Feeding of Bt-susceptible diamondback moth (Plutella xylostella) larvae was equally inhibited on the Bt line in control conditions, under elevated CO{sub 2} and under O{sub 3} exposure. Constitutive glucosinolate and volatile terpenoid profiles of the non-Bt and Bt line plants were equal. Despite reduced feeding by Bt-susceptible P. xylostella on the Bt line, herbivore-induced increases in volatile terpenoids and glucosinolates were mostly comparable to those on the non-Bt line, with the exception of lowered increases in foliar concentration of 4-methoxy-3- indolylmethylglucosinolate and emissions of (E)-4,8-dimethyl-1,3,7-nonatriene, (E,E)-alpha-farnesene and alpha- thujene in the Bt-transgenic line. The effectiveness of the transgenic trait, measured as Bt toxin concentration of leaves, was maintained under elevated CO{sub 2} and temperature, separately and in combination, and enhanced under elevated O{sub 3}. As an effect of elevated CO{sub 2}, increased glucosinolate and volatile terpenoid concentrations were detected in both non-Bt and Bt plant lines, whereas O{sub 3} exposure changed concentrations of specific glucosinolates and decreased total terpenoid emissions in both plant types. In tritrophic bioassays, an endoparasitoid of P. xylostella, Cotesia vestalis, was attracted to host-damaged non-Bt and Bt plants under elevated CO{sub 2} compared to control plants, whereas with elevated O{sub 3} the host-damaged Bt plants, which had reduced feeding damage, did not attract the parasitoids. This is in contrast to non-Bt plants, which also remained attractive under O{sub 3} exposure. To conclude, Bt-producing oilseed rape showed equal responses as the non-Bt parent line to the studied abiotic variations in terms of vegetative growth, allocation to constitutive glucosinolates and volatile terpenoids and nontarget herbivore susceptibility. This suggests that these plants would respond similarly to the studied climate change factors in their vegetative growth stage. The herbivore resistance of the Bt line restricted certain specific herbivore-damage induced defences, which contributed to the disturbance of the tritrophic interaction studied under elevated O{sub 3}. However, even slight feeding damage was sufficient to induce major volatile terpenoid emissions and glucosinolates under control conditions indicating that endogenous defences were not excessively reduced by the transgenic modification rendering insect resistance. Elevated CO{sub 2} and O{sub 3} had clear effects on growth and secondary chemistry of oilseed rape, which promotes the significant role of climate change factors in affecting plant-herbivore interactions in this plant species in the future. (orig.)

  13. Arg156 in the AP2-domain exhibits the highest binding activity among the 20 individuals to the GCC box in BnaERF-B3-hy15, a mutant ERF transcription factor from Brassica napus

    Directory of Open Access Journals (Sweden)

    Jing Zhuang


    Full Text Available To develop mutants of the ERF factor with more binding activities to the GCC box, we performed in vitro directed evolution by using DNA shuffling and screened mutants through yeast one-hybrid assay. Here, a series of mutants were obtained and used to reveal key amino acids that induce changes in the DNA binding activity of the BnaERF-B3 protein. With the BnaERF-B3-hy15 as the template, we produced 12 mutants which host individual mutation of potential key residues. We found that amino acid 156 is the key site, and the other 18 mutants host the 18 corresponding individual amino acid residues at site 156. Among the 20 individuals comprising WT (Gly156, Mu3 (Arg156, and 18 mutants with other 18 amino acid residues, Arg156 in the AP2-domain is the amino acid residue with the highest binding activity to the GCC box. The structure of the α-helix in the AP2-domain affects the binding activity. Other residues within AP2-domain modulated binding activity of ERF protein, suggesting that these positions are important for binding activity. Comparison of the mutant and wild-type transcription factors revealed the relationship of protein function and sequence modification. Our result provides a potential useful resource for understanding the trans-activation of ERF proteins.

  14. Differential growth and yield by canola (Brassica napus L.) and wheat (Triticum aestivum L.) arising from alterations in chemical properties of sandy soils due to additions of fly ash. (United States)

    Yunusa, Isa A M; Manoharan, Veeragathipillai; Harris, Rob; Lawrie, Roy; Pal, Yash; Quiton, Jonathan T; Bell, Richard; Eamus, Derek


    There is a need for field trials on testing agronomic potential of coal fly ash to engender routine use of this technology. Two field trials were undertaken with alkaline and acidic fly ashes supplied at between 3 and 6 Mg ha⁻¹ to acidic soils and sown to wheat and canola at Richmond (Eastern Australia) and to wheat only at Merredin (Western Australia). Ash addition marginally (PAPSIM at Richmond over a 100-year period (1909-2008) predicted yield increases in 52% of years with addition of ash at 3.0 Mg ha⁻¹ compared with 24% of years with addition of ash at 6.0 Mg ha⁻¹. The simulated yield increases did not exceed 40% over the control with addition of 6 Mg ha⁻¹ ash, but was between 40% and 50% with an addition rate of 3 Mg ha⁻¹. We found no evidence of phytotoxicity in either crop in this unusually dry year and there is still a need for further field assessment in years with favourable rainfall to enable development of clear recommendations on fly ash rates for optimum yield benefits. © 2012 Society of Chemical Industry.

  15. Fusarium-induced diseases of tropical, perennial crops. (United States)

    Ploetz, Randy C


    ABSTRACT The world's oldest ecosystems are found in the tropics. They are diverse, highly evolved, but barely understood. This and subsequent papers describe diseases of tropical, perennial plants that are caused by Fusarium spp. Many of these are economically significant, difficult to manage, and of scientific interest. Some represent coevolved patho-systems (e.g., Panama disease, tracheomycosis of coffee, fusariosis of pineapple, and Fusarium wilt of oil palm), whereas others may be new-encounter diseases or are caused by generalist pathogens (cushion gall of cacao). New vector relationships are evident in other pathosystems (e.g., mango malformation), and two or more pathogens have been shown to cause some of the diseases (Panama disease and tracheomycosis of coffee). More work on these pathosystems is warranted as they could reveal much about the evolution of plant pathogens and the important diseases they cause.

  16. Limitations of Cassava Bacterial Blight: New Advances

    Directory of Open Access Journals (Sweden)

    Camilo López


    genomics. The acquired knowledge in the last years for this pathosystem will help to establish better disease control strategies and generate, in a short term, resistant cassava varieties contributing to solve one of the main problems of poor cassava farmers and this effort will open a new horizon to the cassava crop in the world.

  17. Ecological genetics of the Bromus tectorum (Poaceae) - Ustilago Bullata (Ustilaginaceae): A role for frequency dependent selection? (United States)

    Susan E. Meyer; David L. Nelson; Suzette Clement; Alisa Ramakrishnan


    Evolutionary processes that maintain genetic diversity in plants are likely to include selection imposed by pathogens. Negative frequency-dependent selection is a mechanism for maintenance of resistance polymorphism in plant - pathogen interactions. We explored whether such selection operates in the Bromus tectorum - Ustilago bullata pathosystem. Gene-for-gene...

  18. Toward the molecular cloning of the Septoria nodorum blotch susceptibility gene Snn2 in wheat (United States)

    Septoria nodorum blotch is a disease of wheat caused by the necrotrophic fungus Parastagonospora nodorum. In the wheat-P. nodorum pathosystem, recognition of pathogen-produced necrotrophic effectors (NEs) by dominant host genes leads to host cell death, which allows the pathogen to gain nutrients an...

  19. Bemisia tabaci : the whitefly vector of cassava mosaic geminiviruses ...

    African Journals Online (AJOL)

    The ecology of the Bemisia tabaci/cassava/African cassava mosaic virus (ACMV) pathosystem is reviewed briefly with special attention given to the parameters affecting the pattern of population development of B. tabaci. Significant gaps in our understanding of this system remain, particularly concerning the importance of ...

  20. Differential gene expression in loblolly pine (Pinus taeda L.) challenged with the fusiform rust fungus, Cronartium quercuum f.sp. fusiforme (United States)

    Henrietta Myburg; Alison M. Morse; Henry V. Amerson; Thomas L. Kubisiak; Dudley Huber; Jason A. Osborne; Saul A. Garcia; C. Dana Nelson; John M. Davis; Sarah F. Covert; Leonel M. van Zyle


    Cronartium quercuum f.sp. fusiforme is the pathogen that incites fusiform rust disease of southern pine species. To date, a number of host resistance genes have been mapped. Although genomic mapping studies have provided valuable information on the genetic basis of disease interactions in this pine-rust pathosystem, the interaction...

  1. Soil mixture composition alters Arabidopsis susceptibility to Pseudomonas syringae infection (United States)

    Pseudomonas syringae is a Gram-negative bacterial pathogen that causes disease on more than 100 different plant species, including the model plant Arabidopsis thaliana. Dissection of the Arabidopsis thaliana-Pseudomonas syringae pathosystem has identified many factors that contribute to successful ...

  2. Development of transgenic finger millet (Eleusine coracana (L ...

    Indian Academy of Sciences (India)


    Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

  3. African Journal of Biotechnology - Vol 8, No 20 (2009)

    African Journals Online (AJOL)

    Identification of differentially expressed genes in seeds of two Brassica napus ... DNA in burial place remains of Turkey using real time polymerase chain reaction ... Varietal response of four cowpea cultivars (Vigna unguiculata L. Walp) to ...

  4. Download this PDF file

    African Journals Online (AJOL)

    ajl yemi


    Nov 30, 2011 ... Morphological data included plant height (cm), number of days to emergence, number .... Option500 and Fusia; third group contained. Option501 ..... Summer Rapeseed (Brassica napus ssp. oleifera L.) cultivars for yield and ...

  5. Comparative analysis of vitamin C, crude protein, elemental nitrogen ...

    African Journals Online (AJOL)



    Dec 21, 2011 ... greens (Brassica napus L.) and kale (Brassica oleracea var. acephala) ... Nitrogen is essential for protein production, for proper growth of ... Brassica crops. ..... the effect of trace element-amended fertilizers on their Co, Se, and.

  6. Effect of different doses of urea on the uptake of cadmium from soil ...

    African Journals Online (AJOL)



    Jan 19, 2012 ... uptake by canola (Brassica napus L.) applied in full and split doses. Nine different ... production of ruminants being reared on the pasture. Key words: ... combined nitrogen fertilizer used in today's agricultural practices ...

  7. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    genes between O. sativa and B. napus may have consistent function and control similar traits, which may be ..... acea chromosomes reveals islands of conserved organization. ... 1998 Conserved structure and function of the Arabidopsis flow-.

  8. Effects of different combinations and concentrations of growth ...

    African Journals Online (AJOL)



    Nov 16, 2009 ... artificial seed (Büyükalaca and Mavituna, 1995; Vicient and Martinez .... light stimulated somatic embryo formation and maturation in Brassica napus. .... Effects of Abscisic Acid on Somatic Embryogenesis and Induction of.

  9. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    related traits between Brassica napus and Oryza sativa. Fupeng Li, Chaozhi Ma, Qingfang Chen, Touming Liu, Jinxiong Shen, Jinxing Tu, Yongzhong Xing and Tingdong Fu. J. Genet. 91, 163–170. Length of. Position of. Position of. Expect.

  10. The effect of nitrogen and sulphur on the agronomical and water use ...

    African Journals Online (AJOL)

    The effect of nitrogen and sulphur on the agronomical and water use efficiencies of canola (Brassica napus L.) grown in selected localities of the Western Cape province, South Africa. Wonder Ngezimana, Gert A. Agenbag ...

  11. Diversity Analysis of Ethiopian Mustard Breeding Lines Using RAPD ...

    African Journals Online (AJOL)

    Ethiopian mustard (Brassica carinata A. Braun) is an oilseed crop less known to the ... have also been used for cultivar identification in B. napus (Ren et al. ..... of Brassica oleracea L. group (2n=18) using random amplified polymorphic DNA.

  12. Synthesis and Herbicidal Activity of 5-Heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H-pyrazole

    Institute of Scientific and Technical Information of China (English)

    XU Han; HU Xu-hong; ZOU Xiao-mao; ZHU You-quan; LIU Bin; HU Fang-zhong; YANG Hua-zheng


    The authors synthesized a series of novel 5-heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H- pyrazole derivatives.Herbicidal activities of the two intermediate compounds and thirteen target compounds were evaluated via Brassica napus and Echinochloa crusgalli(L.) Beauv tests.Bioassay results show that some of the compounds exhibit better inhibiting activities against Brassica napus and some of the compounds exhibit bleaching activities against Echinochloa crusgalli(L.) Beauv at 100 μg/mL.

  13. Comparative mitochondrial genome analysis reveals the evolutionary rearrangement mechanism in Brassica. (United States)

    Yang, J; Liu, G; Zhao, N; Chen, S; Liu, D; Ma, W; Hu, Z; Zhang, M


    The genus Brassica has many species that are important for oil, vegetable and other food products. Three mitochondrial genome types (mitotype) originated from its common ancestor. In this paper, a B. nigra mitochondrial main circle genome with 232,407 bp was generated through de novo assembly. Synteny analysis showed that the mitochondrial genomes of B. rapa and B. oleracea had a better syntenic relationship than B. nigra. Principal components analysis and development of a phylogenetic tree indicated maternal ancestors of three allotetraploid species in Us triangle of Brassica. Diversified mitotypes were found in allotetraploid B. napus, in which napus-type B. napus was derived from B. oleracea, while polima-type B. napus was inherited from B. rapa. In addition, the mitochondrial genome of napus-type B. napus was closer to botrytis-type than capitata-type B. oleracea. The sub-stoichiometric shifting of several mitochondrial genes suggested that mitochondrial genome rearrangement underwent evolutionary selection during domestication and/or plant breeding. Our findings clarify the role of diploid species in the maternal origin of allotetraploid species in Brassica and suggest the possibility of breeding selection of the mitochondrial genome. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  14. Artificial neural network for prediction of the area under the disease progress curve of tomato late blight

    Directory of Open Access Journals (Sweden)

    Daniel Pedrosa Alves

    Full Text Available ABSTRACT: Artificial neural networks (ANN are computational models inspired by the neural systems of living beings capable of learning from examples and using them to solve problems such as non-linear prediction, and pattern recognition, in addition to several other applications. In this study, ANN were used to predict the value of the area under the disease progress curve (AUDPC for the tomato late blight pathosystem. The AUDPC is widely used by epidemiologic studies of polycyclic diseases, especially those regarding quantitative resistance of genotypes. However, a series of six evaluations over time is necessary to obtain the final area value for this pathosystem. This study aimed to investigate the utilization of ANN to construct an AUDPC in the tomato late blight pathosystem, using a reduced number of severity evaluations. For this, four independent experiments were performed giving a total of 1836 plants infected with Phytophthora infestans pathogen. They were assessed every three days, comprised six opportunities and AUDPC calculations were performed by the conventional method. After the ANN were created it was possible to predict the AUDPC with correlations of 0.97 and 0.84 when compared to conventional methods, using 50 % and 67 % of the genotype evaluations, respectively. When using the ANN created in an experiment to predict the AUDPC of the other experiments the average correlation was 0.94, with two evaluations, 0.96, with three evaluations, between the predicted values of the ANN and they were observed in six evaluations. We present in this study a new paradigm for the use of AUDPC information in tomato experiments faced with P. infestans. This new proposed paradigm might be adapted to different pathosystems.

  15. Chilli anthracnose disease caused by Colletotrichum species§


    Than, Po Po; Prihastuti, Haryudian; Phoulivong, Sitthisack; Taylor, Paul W.J.; Hyde, Kevin D.


    Anthracnose disease is one of the major economic constraints to chilli production worldwide, especially in tropical and subtropical regions. Accurate taxonomic information is necessary for effective disease control management. In the Colletotrichum patho-system, different Colletotrichum species can be associated with anthracnose of the same host. Little information is known concerning the interactions of the species associated with the chilli anthracnose although several Colletotrichum specie...

  16. Fungal endophytes: modifiers of plant disease. (United States)

    Busby, Posy E; Ridout, Mary; Newcombe, George


    Many recent studies have demonstrated that non-pathogenic fungi within plant microbiomes, i.e., endophytes ("endo" = within, "phyte" = plant), can significantly modify the expression of host plant disease. The rapid pace of advancement in endophyte ecology warrants a pause to synthesize our understanding of endophyte disease modification and to discuss future research directions. We reviewed recent literature on fungal endophyte disease modification, and here report on several emergent themes: (1) Fungal endophyte effects on plant disease span the full spectrum from pathogen antagonism to pathogen facilitation, with pathogen antagonism most commonly reported. (2) Agricultural plant pathosystems are the focus of research on endophyte disease modification. (3) A taxonomically diverse group of fungal endophytes can influence plant disease severity. And (4) Fungal endophyte effects on plant disease severity are context-dependent. Our review highlights the importance of fungal endophytes for plant disease across a broad range of plant pathosystems, yet simultaneously reveals that complexity within plant microbiomes presents a significant challenge to disentangling the biotic environmental factors affecting plant disease severity. Manipulative studies integrating eco-evolutionary approaches with emerging molecular tools will be poised to elucidate the functional importance of endophytes in natural plant pathosystems that are fundamental to biodiversity and conservation.

  17. Influence of radiation damage repair inhibitor on superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in different sensitive crops

    International Nuclear Information System (INIS)

    Song Daojun; Xu Dengyi; Wan Zhaoliang; He Shoulin


    The activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) were affected remarkably by 60 Co γ-ray irradiation and radiation damage repair inhibitor (Caf, EDTA). SOD, CAT and POD activities showed the similar change pattern in both soybean (sensitive to radiation) and Brassica napus L. (resistant to radiation) seedlings in all treatments. After reaching the maximum value, SOD activity decreased with the increase of doses. CAT activity had the same change pattern as that of SOD in soybean, while with Brassica napus L., CAT activity remained relatively steady from 300 Gy to 1000 Gy. And POD activity increased with the increase of doses. Compared with H 2 O-treatments, CaF, EDAT post-treatments obviously enhanced SOD, CAT and POD activities. With all the treatments, the three enzyme activities were higher in Brassica napus L. than those in soybean seedlings

  18. Effects of salt stress on phosphorus uptake by european rape sheiaralle

    International Nuclear Information System (INIS)

    Li Guihua; Zhang Jianfeng; Wei Dongpu; Yang Juncheng; Mei Yong


    The effects of different salinity on phosphorus uptake by European rape Sheiaralle were studied under hydroponics and sand culture conditions. The results showed that above ground uptake of instant P increased with the salinity increased, the uptake of 32 P by roots firstly decreased and then increased with the increase salinity. Instant P uptake by Brassica napus was lower under different salinity treatment than in non-saline condition (P - , but the biomass yield decreased much faster than P uptake, so P relatively condensed, and uptake of P by Brassica napus increased as the salinity (including non-saline treatment) was increased (P<0.05). Fresh weight of Brassica napus decreased significantly with the salinity increased (P<0.05). (authors)

  19. Synthesis and Herbicidal Activity of Novel Sulfonylureas Containing 1,2,4-Triazolinone Moiety

    Institute of Scientific and Technical Information of China (English)

    LIU Zhuo; PAN Li; LI Yong-hong; WANG Su-hua; LI Zheng-ming


    A series of new sulfonylureas incorporating 1,2,4-triazolinone moiety was synthesized,which were further bio-assayed for the herbicidal activity against four herbs,representative of monocotyledons and dicotyledons.Some of them exhibited high potency to inhibit the growth of dicotyledons(Bassica napus and Amaranthus retroflexus) in the pot experiment.Compounds 9a and 9b also displayed an excellent herbicidal activity against Bassica napus at a concentration of 15 g/hectare,which were comparable with commercial triasulfuron.

  20. Effects of NaCl treatment on the antioxidant enzymes of oilseed rape ...

    African Journals Online (AJOL)

    The effects of NaCl treatment on the activity of antioxidant enzymes in leaves of oilseed rape seedlings (Brassica napus L.) were studied. The results showed that the relative water content from leaves of oilseed rape see