
Sample records for macrofungal basidiomycete blackwell

  1. Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests (United States)

    Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco


    We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

  2. Diversity of macrofungal community in Bifeng Gorge: the core giant ...

    African Journals Online (AJOL)

    Macrofungi not only play an important role in pollution control and other environmental protection measures, but also an important resource in food and pharmaceutical industries. However, the diversity of the macrofungal community in the core habitat of the giant panda in Bifeng Gorge, China is still inadequate. In the ...

  3. Logged peat swamp forest supports greater macrofungal biodiversity than large-scale oil palm plantations and smallholdings. (United States)

    Shuhada, Siti Noor; Salim, Sabiha; Nobilly, Frisco; Zubaid, Akbar; Azhar, Badrul


    Intensive land expansion of commercial oil palm agricultural lands results in reducing the size of peat swamp forests, particularly in Southeast Asia. The effect of this land conversion on macrofungal biodiversity is, however, understudied. We quantified macrofungal biodiversity by identifying mushroom sporocarps throughout four different habitats; logged peat swamp forest, large-scale oil palm plantation, monoculture, and polyculture smallholdings. We recorded a total of 757 clusters of macrofungi belonging to 127 morphospecies and found that substrates for growing macrofungi were abundant in peat swamp forest; hence, morphospecies richness and macrofungal clusters were significantly greater in logged peat swamp forest than converted oil palm agriculture lands. Environmental factors that influence macrofungi in logged peat swamp forests such as air temperature, humidity, wind speed, soil pH, and soil moisture were different from those in oil palm plantations and smallholdings. We conclude that peat swamp forests are irreplaceable with respect to macrofungal biodiversity. They host much greater macrofungal biodiversity than any of the oil palm agricultural lands. It is imperative that further expansion of oil palm plantation into remaining peat swamp forests should be prohibited in palm oil producing countries. These results imply that macrofungal distribution reflects changes in microclimate between habitats and reduced macrofungal biodiversity may adversely affect decomposition in human-modified landscapes.

  4. Fungicide selective for basidiomycetes. (United States)

    Edgington, L V; Walton, G S; Miller, P M


    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  5. Noncommutative Blackwell-Ross martingale inequality (United States)

    Talebi, Ali; Moslehian, Mohammad Sal; Sadeghi, Ghadir

    We establish a noncommutative Blackwell-Ross inequality for supermartingales under a suitable condition which generalizes Khan’s work to the noncommutative setting. We then employ it to deduce an Azuma-type inequality.

  6. The Wiley Blackwell companion to political geography

    NARCIS (Netherlands)

    Agnew, J.; Mamadouh, V.; Secor, A.J.; Sharp, J.


    The Wiley Blackwell Companion to Political Geography aims to account for the intellectual and worldly developments that have taken place in and around political geography in the last 10 years. Bringing together established names in the field as well as new scholars, it highlights provocative

  7. The importance of plot size and the number of sampling seasons on capturing macrofungal species richness. (United States)

    Li, Huili; Ostermann, Anne; Karunarathna, Samantha C; Xu, Jianchu; Hyde, Kevin D; Mortimer, Peter E


    The species-area relationship is an important factor in the study of species diversity, conservation biology, and landscape ecology. A deeper understanding of this relationship is necessary, in order to provide recommendations on how to improve the quality of data collection on macrofungal diversity in different land use systems in future studies, a systematic assessment of methodological parameters, in particular optimal plot sizes. The species-area relationship of macrofungi in tropical and temperate climatic zones and four different land use systems were investigated by determining the macrofungal species richness in plot sizes ranging from 100 m 2 to 10 000 m 2 over two sampling seasons. We found that the effect of plot size on recorded species richness significantly differed between land use systems with the exception of monoculture systems. For both climate zones, land use system needs to be considered when determining optimal plot size. Using an optimal plot size was more important than temporal replication (over two sampling seasons) in accurately recording species richness. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  8. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M D


    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  9. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina


    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  10. The macrofungal diversity and community of Atlantic oak (Quercus petraea and Q. robur forests in Ireland

    Directory of Open Access Journals (Sweden)

    Harrington, Thomas J.


    Full Text Available The oak species Quercus petraea and Q. Robur are dominant canopy tree species of native deciduous forests in Ireland and coastal regions of Western Europe. These forests are typically plant species-rich, and can also have a rich fungal flora. This survey examined macrofungi found in five native oak sites across Ireland over three years. Overall, 94 macrofungal species belonging to 39 genera were discovered with Mycena, Lactarius, Russula and Cortinarius the most species-rich genera. The species accumulation curve did not show signs of levelling off, indicating that more sampling would reveal more new species. Species richness estimation using the Chao2 estimator indicated that up to 135 species may be present across all of our plots, with individual plots receiving estimates from 19 to 61 species per plot. Sampled-based rarefaction analysis showed no significant differences in macrofungal species richness between our plots. The five most common species were Laccaria amethystina, L. laccata, Stereum hirsutum, Armillaria mellea and Cortinarius flexipes. Comparisons of the results with results from oak forests in similar regions found that the communities in Great Britain were most similar to those found in Ireland. There were some key oak forest distinguishing fungal species from the family Boletaceae lacking from Irish oak forests. It is hypothesised that the historic deforestation of Ireland, caused a reduction of suitable habitats for Irish oak associated macrofungi, leading to the unspecific mycota found in the oak forests of this study. The threats to Atlantic oak forests in Ireland are briefly discussed.Las especies de Quercus petraea y Q. Robur se encuentran en bosques de Irlanda y regiones de influencia atlántica de Europa Occidental. Estos bosques, típicamente ricos en especies de plantas, presentan una abundante micobiota. Este estudio examina la diversidad de macromicetes en cinco bosques naturales de roble en Irlanda durante un

  11. Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes (United States)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.


    SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

  12. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor


    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  13. Terrestrial Macrofungal Diversity from the Tropical Dry Evergreen Biome of Southern India and Its Potential Role in Aerobiology. (United States)

    Priyamvada, Hema; Akila, M; Singh, Raj Kamal; Ravikrishna, R; Verma, R S; Philip, Ligy; Marathe, R R; Sahu, L K; Sudheer, K P; Gunthe, S S


    Macrofungi have long been investigated for various scientific purposes including their food and medicinal characteristics. Their role in aerobiology as a fraction of the primary biological aerosol particles (PBAPs), however, has been poorly studied. In this study, we present a source of macrofungi with two different but interdependent objectives: (i) to characterize the macrofungi from a tropical dry evergreen biome in southern India using advanced molecular techniques to enrich the database from this region, and (ii) to assess whether identified species of macrofungi are a potential source of atmospheric PBAPs. From the DNA analysis, we report the diversity of the terrestrial macrofungi from a tropical dry evergreen biome robustly supported by the statistical analyses for diversity conclusions. A total of 113 macrofungal species belonging to 54 genera and 23 families were recorded, with Basidiomycota and Ascomycota constituting 96% and 4% of the species, respectively. The highest species richness was found in the family Agaricaceae (25.3%) followed by Polyporaceae (15.3%) and Marasmiaceae (10.8%). The difference in the distribution of commonly observed macrofungal families over this location was compared with other locations in India (Karnataka, Kerala, Maharashtra, and West Bengal) using two statistical tests. The distributions of the terrestrial macrofungi were distinctly different in each ecosystem. We further attempted to demonstrate the potential role of terrestrial macrofungi as a source of PBAPs in ambient air. In our opinion, the findings from this ecosystem of India will enhance our understanding of the distribution, diversity, ecology, and biological prospects of terrestrial macrofungi as well as their potential to contribute to airborne fungal aerosols.

  14. The macrofungal diversity and community of Atlantic oak (Quercus petraea and Q. robur) forests in Ireland


    Harrington, Thomas J.; O’Hanlon, Richard


    The oak species Quercus petraea and Q. Robur are dominant canopy tree species of native deciduous forests in Ireland and coastal regions of Western Europe. These forests are typically plant species-rich, and can also have a rich fungal flora. This survey examined macrofungi found in five native oak sites across Ireland over three years. Overall, 94 macrofungal species belonging to 39 genera were discovered with Mycena, Lactarius, Russula and Cortinarius the most species-rich genera. The speci...

  15. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.


    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  16. Log-Optimal Portfolio Selection Using the Blackwell Approachability Theorem


    V'yugin, Vladimir


    We present a method for constructing the log-optimal portfolio using the well-calibrated forecasts of market values. Dawid's notion of calibration and the Blackwell approachability theorem are used for computing well-calibrated forecasts. We select a portfolio using this "artificial" probability distribution of market values. Our portfolio performs asymptotically at least as well as any stationary portfolio that redistributes the investment at each round using a continuous function of side in...

  17. The Rao-Blackwellized Particle Filter: A Filter Bank Implementation

    Directory of Open Access Journals (Sweden)

    Karlsson Rickard


    Full Text Available For computational efficiency, it is important to utilize model structure in particle filtering. One of the most important cases occurs when there exists a linear Gaussian substructure, which can be efficiently handled by Kalman filters. This is the standard formulation of the Rao-Blackwellized particle filter (RBPF. This contribution suggests an alternative formulation of this well-known result that facilitates reuse of standard filtering components and which is also suitable for object-oriented programming. Our RBPF formulation can be seen as a Kalman filter bank with stochastic branching and pruning.

  18. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula


    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  19. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor


    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  20. Rao-Blackwellization for Adaptive Gaussian Sum Nonlinear Model Propagation (United States)

    Semper, Sean R.; Crassidis, John L.; George, Jemin; Mukherjee, Siddharth; Singla, Puneet


    each component weight during the nonlinear propagation stage an approximation of the true pdf can be successfully reconstructed. Particle filtering (PF) methods have gained popularity recently for solving nonlinear estimation problems due to their straightforward approach and the processing capabilities mentioned above. The basic concept behind PF is to represent any pdf as a set of random samples. As the number of samples increases, they will theoretically converge to the exact, equivalent representation of the desired pdf. When the estimated qth moment is needed, the samples are used for its construction allowing further analysis of the pdf characteristics. However, filter performance deteriorates as the dimension of the state vector increases. To overcome this problem Ref. [5] applies a marginalization technique for PF methods, decreasing complexity of the system to one linear and another nonlinear state estimation problem. The marginalization theory was originally developed by Rao and Blackwell independently. According to Ref. [6] it improves any given estimator under every convex loss function. The improvement comes from calculating a conditional expected value, often involving integrating out a supportive statistic. In other words, Rao-Blackwellization allows for smaller but separate computations to be carried out while reaching the main objective of the estimator. In the case of improving an estimator's variance, any supporting statistic can be removed and its variance determined. Next, any other information that dependents on the supporting statistic is found along with its respective variance. A new approach is developed here by utilizing the strengths of the adaptive Gaussian sum propagation in Ref. [2] and a marginalization approach used for PF methods found in Ref. [7]. In the following sections a modified filtering approach is presented based on a special state-space model within nonlinear systems to reduce the dimensionality of the optimization problem in


    Directory of Open Access Journals (Sweden)

    Fedotov О. V.


    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  2. Preservation of live cultures of basidiomycetes - recent methods. (United States)

    Homolka, Ladislav


    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.


    Directory of Open Access Journals (Sweden)

    N. P.


    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  4. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David


    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  5. Diversity and evolution of ABC proteins in basidiomycetes. (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O


    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  6. AGU and Wiley-Blackwell to partner on publication of journals and books (United States)

    McEntee, Chris


    AGU has signed a memorandum of understanding (MOU) with Wiley-Blackwell to partner in journal and book publishing. The agreement, effective 1 January 2013, is a significant step forward in transforming AGU publishing consistent with our strategic plan goal of scientific leadership and collaboration. Wiley-Blackwell is the international scientific, technical, medical, and scholarly publishing business of John Wiley & Sons, Inc. Family-owned and publicly traded on the New York Stock Exchange, the company is strong in every major academic and professional field and partners with many of the world's leading societies. Wiley-Blackwell, a leader in developing models for open access and providing developing nations with access to science, publishes nearly 1500 peer-reviewed journals and more than 1500 new books annually. The company publishes approximately 700 society titles.

  7. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel


    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  8. Bacterial communities in the fruit bodies of ground basidiomycetes (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.


    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  9. Application of the Engel, Kollat and Blackwell Model to Consumers of Automobile Insurance


    Joseph C. Bonnice


    A significant stage of the analysis of consumer behavior was reached in the 1960s with the development of three models of consumer behavior in the following studies: Nicosia], Howard and Sheth, Engel Koolat, and Blackwell (EKB), all of which attempted to present a conceptual framework for the analysis of consumer behavior . This article focuses on the examination of these conceptual models of consumer behavior and the determination of whether these models accurately depict the behavior of con...

  10. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes. (United States)

    Johnson, Eric A


    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary





    ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

  12. Autoregressive Model with Partial Forgetting within Rao-Blackwellized Particle Filter

    Czech Academy of Sciences Publication Activity Database

    Dedecius, Kamil; Hofman, Radek


    Roč. 41, č. 5 (2012), s. 582-589 ISSN 0361-0918 R&D Projects: GA MV VG20102013018; GA ČR GA102/08/0567 Grant - others:ČVUT(CZ) SGS 10/099/OHK3/1T/16 Institutional research plan: CEZ:AV0Z10750506 Keywords : Bayesian methods * Particle filters * Recursive estimation Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 0.295, year: 2012 model with partial forgetting within rao-blackwellized particle filter.pdf

  13. Particle rejuvenation of Rao-Blackwellized sequential Monte Carlo smoothers for conditionally linear and Gaussian models (United States)

    Nguyen, Ngoc Minh; Corff, Sylvain Le; Moulines, Éric


    This paper focuses on sequential Monte Carlo approximations of smoothing distributions in conditionally linear and Gaussian state spaces. To reduce Monte Carlo variance of smoothers, it is typical in these models to use Rao-Blackwellization: particle approximation is used to sample sequences of hidden regimes while the Gaussian states are explicitly integrated conditional on the sequence of regimes and observations, using variants of the Kalman filter/smoother. The first successful attempt to use Rao-Blackwellization for smoothing extends the Bryson-Frazier smoother for Gaussian linear state space models using the generalized two-filter formula together with Kalman filters/smoothers. More recently, a forward-backward decomposition of smoothing distributions mimicking the Rauch-Tung-Striebel smoother for the regimes combined with backward Kalman updates has been introduced. This paper investigates the benefit of introducing additional rejuvenation steps in all these algorithms to sample at each time instant new regimes conditional on the forward and backward particles. This defines particle-based approximations of the smoothing distributions whose support is not restricted to the set of particles sampled in the forward or backward filter. These procedures are applied to commodity markets which are described using a two-factor model based on the spot price and a convenience yield for crude oil data.

  14. Memories of Miles – Miles Blackwell and his contribution to South African librarianship

    Directory of Open Access Journals (Sweden)

    A.S.C. Hooper


    Full Text Available The contribution of BH Blackwell (BHB, and specifically of Miles Blackwell, to the development of libraries and librarians in South Africa is explored based on available literature sources and personal reminiscences. This article tells how Miles was true to his personal values and how he demonstrated his integrity in the exercise of his office. Miles integrated in his mind the history of the “firm” of BHB and the times that it lived though with his sense of his responsibility to his customers. He was prepared to stand up against enormous political pressure from his peers in Europe and North America, and perhaps his fellow board members in BHB, to make sure that the channels of published information flow remained open to his customers in South Africa. The value of books and information was what he believed in. His service to his customers in South Africa reflected the self-sacrificing service ethic that he understood to be the essence of the family firm of which he had the great privilege of leading. He contributed to the development of the new, post-apartheid South Africa by ensuring that the people who needed the enlightened word to become part of the global society, benefited by what he had done.

  15. Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning. (United States)

    Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G


    Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

  16. Gating Techniques for Rao-Blackwellized Monte Carlo Data Association Filter

    Directory of Open Access Journals (Sweden)

    Yazhao Wang


    Full Text Available This paper studies the Rao-Blackwellized Monte Carlo data association (RBMCDA filter for multiple target tracking. The elliptical gating strategies are redesigned and incorporated into the framework of the RBMCDA filter. The obvious benefit is the reduction of the time cost because the data association procedure can be carried out with less validated measurements. In addition, the overlapped parts of the neighboring validation regions are divided into several separated subregions according to the possible origins of the validated measurements. In these subregions, the measurement uncertainties can be taken into account more reasonably than those of the simple elliptical gate. This would help to achieve higher tracking ability of the RBMCDA algorithm by a better association prior approximation. Simulation results are provided to show the effectiveness of the proposed gating techniques.

  17. Analysis of basidiomycete pigments in situ by Raman spectroscopy. (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen


    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Evaluation of the flathead catfish population and fishery on Lake Carl Blackwell, Oklahoma, with emphasis on the effects of noodling (United States)

    Winkelman, Dana L.; Michaletz, Paul H.; Travnichek, Vincent H.


    I conducted a 3-year study at Lake Carl Blackwell, Oklahoma to estimate effects of various fishing gears on the flathead catfish Pylodictis olivaris population. Managers were particularly interested in the effect of handfishing or noodling on this population. I used a phone survey to assess angler effort and electrofishing and gill nets to calculate standard population metrics to assess composition of the current population. Survey data indicated that fishing effort and harvest were highest for trotlines and juglines and lowest for noodling. Size distribution of fish harvested by noodlers was not different from sizes that were available in the fishery and was similar to those fish harvested with other gears. Flathead catfish Sampled in Lake Carl Blackwell ranged in size from 38 to 1,220 mm total length, and 77% of the population was less than 508 mm (minimum legal size). Estimated total annual mortality was about 11%. Proportional size distribution (PSD) of flathead catfish for Lake Carl Blackwell indicates that about 70% of legal-sized flathead catfish were over the preferred size of 710 mm. Overall, the Lake Carl Blackwell flathead catfish population appeared healthy. There were a wide range of sizes and ages in the population, and PSD indicated a well-balanced population with many preferred and memorable-sized fish. Due to its rarity, noodling is probably not adversely influencing the population. Additionally, noodling at Lake Carl Blackwell does not appear to be as size-selective as previously thought. 

  19. Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi. (United States)

    Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C


    The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.


    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ


    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  1. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja


    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  2. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum. (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming


    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  3. An Example of an Improvable Rao-Blackwell Improvement, Inefficient Maximum Likelihood Estimator, and Unbiased Generalized Bayes Estimator. (United States)

    Galili, Tal; Meilijson, Isaac


    The Rao-Blackwell theorem offers a procedure for converting a crude unbiased estimator of a parameter θ into a "better" one, in fact unique and optimal if the improvement is based on a minimal sufficient statistic that is complete. In contrast, behind every minimal sufficient statistic that is not complete, there is an improvable Rao-Blackwell improvement. This is illustrated via a simple example based on the uniform distribution, in which a rather natural Rao-Blackwell improvement is uniformly improvable. Furthermore, in this example the maximum likelihood estimator is inefficient, and an unbiased generalized Bayes estimator performs exceptionally well. Counterexamples of this sort can be useful didactic tools for explaining the true nature of a methodology and possible consequences when some of the assumptions are violated. [Received December 2014. Revised September 2015.].


    International Nuclear Information System (INIS)

    Rudjord, Oe.; Groeneboom, N. E.; Eriksen, H. K.; Huey, Greg; Gorski, K. M.; Jewell, J. B.


    We introduce a new cosmic microwave background (CMB) temperature likelihood approximation called the Gaussianized Blackwell-Rao estimator. This estimator is derived by transforming the observed marginal power spectrum distributions obtained by the CMB Gibbs sampler into standard univariate Gaussians, and then approximating their joint transformed distribution by a multivariate Gaussian. The method is exact for full-sky coverage and uniform noise and an excellent approximation for sky cuts and scanning patterns relevant for modern satellite experiments such as the Wilkinson Microwave Anisotropy Probe (WMAP) and Planck. The result is a stable, accurate, and computationally very efficient CMB temperature likelihood representation that allows the user to exploit the unique error propagation capabilities of the Gibbs sampler to high ls. A single evaluation of this estimator between l = 2 and 200 takes ∼0.2 CPU milliseconds, while for comparison, a singe pixel space likelihood evaluation between l = 2 and 30 for a map with ∼2500 pixels requires ∼20 s. We apply this tool to the five-year WMAP temperature data, and re-estimate the angular temperature power spectrum, C l , and likelihood, L(C l ), for l ≤ 200, and derive new cosmological parameters for the standard six-parameter ΛCDM model. Our spectrum is in excellent agreement with the official WMAP spectrum, but we find slight differences in the derived cosmological parameters. Most importantly, the spectral index of scalar perturbations is n s = 0.973 ± 0.014, 1.9σ away from unity and 0.6σ higher than the official WMAP result, n s = 0.965 ± 0.014. This suggests that an exact likelihood treatment is required to higher ls than previously believed, reinforcing and extending our conclusions from the three-year WMAP analysis. In that case, we found that the suboptimal likelihood approximation adopted between l = 12 and 30 by the WMAP team biased n s low by 0.4σ, while here we find that the same approximation

  5. 77 FR 14010 - Rocky Ridge Wind Project, LLC, Blackwell Wind, LLC, CPV Cimarron Renewable Energy Company, LLC... (United States)


    ..., EG12-18-000, EG12-19-000, EG12- 20-000, EG12-21-000, EG12-22-000, EG12-23-000] Rocky Ridge Wind Project, LLC, Blackwell Wind, LLC, CPV Cimarron Renewable Energy Company, LLC, Minco Wind Interconnection Services, LLC, Shiloh III Lessee, LLC, California Ridge Wind Energy LLC, Perrin Ranch Wind, LLC, Erie Wind...

  6. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.


    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  7. [The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris]. (United States)

    Terekhova, V A; Semenova, T A


    We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

  8. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  9. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev


    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...


    Directory of Open Access Journals (Sweden)

    А. Бухало


    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  11. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains. (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E


    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  12. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki


    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  13. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa. (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A


    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.


    Directory of Open Access Journals (Sweden)

    Chaika A. V.


    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  15. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna


    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  16. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel


    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  17. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.


    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  18. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes (United States)

    Chiaki Hori; Daniel Cullen


    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  19. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.


    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  20. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka


    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  1. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.


    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  2. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands. (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik


    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  3. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F


    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  4. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

  5. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp. (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R


    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  6. A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore. (United States)

    Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk


    The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

  7. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.


    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  8. Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

    International Nuclear Information System (INIS)

    Takimoto, K.


    The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

  9. Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus




    Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

  10. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans


    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.


    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  11. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle. (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C


    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  12. Gibbs Sampler-Based λ-Dynamics and Rao-Blackwell Estimator for Alchemical Free Energy Calculation. (United States)

    Ding, Xinqiang; Vilseck, Jonah Z; Hayes, Ryan L; Brooks, Charles L


    λ-dynamics is a generalized ensemble method for alchemical free energy calculations. In traditional λ-dynamics, the alchemical switch variable λ is treated as a continuous variable ranging from 0 to 1 and an empirical estimator is utilized to approximate the free energy. In the present article, we describe an alternative formulation of λ-dynamics that utilizes the Gibbs sampler framework, which we call Gibbs sampler-based λ-dynamics (GSLD). GSLD, like traditional λ-dynamics, can be readily extended to calculate free energy differences between multiple ligands in one simulation. We also introduce a new free energy estimator, the Rao-Blackwell estimator (RBE), for use in conjunction with GSLD. Compared with the current empirical estimator, the advantage of RBE is that RBE is an unbiased estimator and its variance is usually smaller than the current empirical estimator. We also show that the multistate Bennett acceptance ratio equation or the unbinned weighted histogram analysis method equation can be derived using the RBE. We illustrate the use and performance of this new free energy computational framework by application to a simple harmonic system as well as relevant calculations of small molecule relative free energies of solvation and binding to a protein receptor. Our findings demonstrate consistent and improved performance compared with conventional alchemical free energy methods.

  13. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.


    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466


    Directory of Open Access Journals (Sweden)

    Veligodska A. K.


    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  15. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)



    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  16. [Oil degradation by basidiomycetes in soil and peat at low temperatures]. (United States)

    Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V


    A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

  17. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  18. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav


    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  19. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet


    Directory of Open Access Journals (Sweden)

    A. K. Veligodska


    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  1. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov


    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  2. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata


    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  3. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment. (United States)

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato


    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  4. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes. (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E


    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Aza Kobakhidze


    Full Text Available This paper reports regulation of endoglucanase (EC and xylanase (EC production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

  6. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo


    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  7. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  8. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek


    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  9. Combined state and parameter identification of nonlinear structural dynamical systems based on Rao-Blackwellization and Markov chain Monte Carlo simulations (United States)

    Abhinav, S.; Manohar, C. S.


    The problem of combined state and parameter estimation in nonlinear state space models, based on Bayesian filtering methods, is considered. A novel approach, which combines Rao-Blackwellized particle filters for state estimation with Markov chain Monte Carlo (MCMC) simulations for parameter identification, is proposed. In order to ensure successful performance of the MCMC samplers, in situations involving large amount of dynamic measurement data and (or) low measurement noise, the study employs a modified measurement model combined with an importance sampling based correction. The parameters of the process noise covariance matrix are also included as quantities to be identified. The study employs the Rao-Blackwellization step at two stages: one, associated with the state estimation problem in the particle filtering step, and, secondly, in the evaluation of the ratio of likelihoods in the MCMC run. The satisfactory performance of the proposed method is illustrated on three dynamical systems: (a) a computational model of a nonlinear beam-moving oscillator system, (b) a laboratory scale beam traversed by a loaded trolley, and (c) an earthquake shake table study on a bending-torsion coupled nonlinear frame subjected to uniaxial support motion.

  10. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity. (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina


    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  11. Du personnel au politique : construction d’une identité militante dans le journal d’Alice Stone Blackwell (1872-1874

    Directory of Open Access Journals (Sweden)

    Claire Sorin


    Full Text Available Le militantisme n’est pas seulement affaire de scène publique ; les coulisses, qui sont en interaction permanente avec cette scène, forment un espace crucial où les enjeux se tissent et les acteurs se fabriquent. Alice Stone Blackwell, la fille de la célèbre féministe américaine Lucy Stone, a laissé un certain nombre de journaux mais c’est dans celui qu’elle écrivit adolescente (1872-1874 que l’on voit clairement s’ébaucher et s’incarner la voix militante de l’auteur. L’étude d’un texte « privé » (dont le statut est en fait beaucoup plus complexe ne présente pas seulement l’intérêt d’un regard intime et particulier sur le mouvement féministe américain de la fin du dix-neuvième siècle. Elle permet aussi de comprendre comment l’écriture autorise le sujet à tester et à s’approprier un ensemble de discours sur la nature féminine qui rompent avec l’idéal de domesticité et le culte de la fragilité. Le journal permet à Alice Blackwell de construire son identité de militante et de l’articuler avec d’autres facettes de son existence. Loin d’être simplement le reflet conventionnel d’une pratique bourgeoise essentiellement réservée au sexe féminin, l’écriture du journal chez Blackwell participe d’un acte militant, dont le trait le plus saillant est sans doute de mettre en scène un corps vigoureux et triomphant, apte à investir la sphère publique.El militantismo no sólo es un asunto de la escena pública ; los arcanos, en continua interacción con esa escena, forman un espacio donde se trama lo que está en juego y donde se fabrican los actores. Alice Stone Blackwell, hija de la famosa feminista americana Lucy Stone, ha dejado varios diarios, pero es en él que escribió de joven (1872-1874 donde claramente se esboza y se encarna la voz militante de la autora. El estudiar un texto « privado » no sólo presenta el interés de una mirada intima sobre el movimiento


    Directory of Open Access Journals (Sweden)

    Veligodska A. K.


    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  13. Hydraulic and biological analysis of the passability of select fish species at the U.S. Geological Survey streamgaging weir at Blackwells Mills, New Jersey (United States)

    Haro, Alexander J.; Mulligan, Kevin; Suro, Thomas P.; Noreika, John; McHugh, Amy


    Recent efforts to advance river connectivity for the Millstone River watershed in New Jersey have led to the evaluation of a low-flow gauging weir that spans the full width of the river. The methods and results of a desktop modelling exercise were used to evaluate the potential ability of three anadromous fish species (Alosa sapidissima [American shad], Alosa pseudoharengus [alewife], and Alosa aestivalis [blueback herring]) to pass upstream over the U.S. Geological Survey Blackwells Mills streamgage (01402000) and weir on the Millstone River, New Jersey, at various streamflows, and to estimate the probability that the weir will be passable during the spring migratory season. Based on data from daily fishway counts downstream from the Blackwells Mills streamgage and weir between 1996 and 2014, the general migratory period was defined as April 14 to May 28. Recorded water levels and flow data were used to theoretically estimate water depths and velocities over the weir, as well as flow exceedances occurring during the migratory period.Results indicate that the weir is a potential depth barrier to fish passage when streamflows are below 200 cubic feet per second using a 1-body-depth criterion for American shad (the largest fish among the target species). Streamflows in that range occur on average 35 percent of the time during the migratory period. An increase of the depth criterion to 2 body depths causes the weir to become a possible barrier to passage when flows are below 400 cubic feet per second. Streamflows in that range occur on average 73 percent of the time during the migration season. Average cross-sectional velocities at several points along the weir do not seem to be limiting to the fish migration, but maximum theoretical velocities estimated without friction loss over the face of the weir could be potentially limiting.

  14. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.


    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  15. Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process. (United States)

    Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D


    Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

  16. De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Lundquist, K; Kirk, T K


    In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

  17. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol. (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen


    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  18. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova


    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  19. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa


    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  20. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska


    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  1. Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Hong, J. S.; Kim, D.H.


    Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

  2. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)


    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  3. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils. (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G


    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  4. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing. (United States)

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin


    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  5. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.


    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  6. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi. (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas


    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  7. Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study (United States)

    Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.


    The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

  8. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum. (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong


    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  9. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes. (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P


    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  10. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)


    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

  11. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi. (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M


    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  12. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes. (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas


    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  13. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.


    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  14. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI


    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  15. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)


    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  16. Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi. (United States)

    Steffen, K T; Hofrichter, M; Hatakka, A


    Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

  17. Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

    Directory of Open Access Journals (Sweden)

    Andrej Liner


    Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

  18. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki


    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  19. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette


    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  20. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr


    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  1. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto


    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  2. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.


    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  3. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat


    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  4. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes). (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra


    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  5. Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

    Directory of Open Access Journals (Sweden)

    E.P. Vetchinkina


    Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

  6. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B. (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai


    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  7. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.


    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  8. Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value. (United States)

    Han, J R; An, C H; Yuan, J M


    The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

  9. Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value. (United States)

    Han, Jianrong


    The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

  10. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases. (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E


    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  11. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.


    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  12. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo


    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  13. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song


    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  14. Macrofungal diversity of Babadağ (Denizli, Turkey)

    African Journals Online (AJOL)


    5 Şub 2008 ... area was chosen as a research area. Babadağ is a town in the province of Denizli, bordered by Tavas on the south, Sarayköy on the north, Aydın on the west, and Denizli on the east (Figure 1). The collection area, located in the Aegean region, has a. Mediterranean-alpine climate. The investigated area is a.

  15. Data on macrofungal diversity from the Danube Delta iosphere Reserve

    Directory of Open Access Journals (Sweden)

    SZASZ Balazs


    Full Text Available Despite de fact that the Danube Delta has a great biodiversity with more than 2300 plants and more than 4000 animals registered (, the study of macromycetes is rather scanty, and the number of macromycetes species found so far in the Reserve is 58. As a result of the mycological investigations done by the authors in 2016 May 7-8 and October 21-22 in the Danube Delta Biosphere Reserve in the Letea Forest, Caraorman Forest and at the forest district’s former premises near C.A. Rosetti, the list of the recorded 130 species is presented, out of which 110 species are documented for the first time in the Danube Delta Biosphere Reserve (DDBR. The number of the macrofungi species that occur in the formentioned Reserve - including the buffer zone from Enisala - has grown to 168. Based on the red list of the romanian macromycetes (Tănase and Pop, 2005 we have found three species in the near threatened category (NT: Helvella acetabulum, Morchella esculenta and Pluteus petasatus, and one species in the vulnerable category (VU: Myriostoma coliforme. A short survey from 1932 to 2012 about the former mycological studies concerning the DDBR is presented, and the nomenclaturally updated list of the 38 species not found by us, but present in the DDBR is given.

  16. Macrofungal diversity of Bolu Abant Nature Park (Turkey) | Servi ...

    African Journals Online (AJOL)

    This study was based on materials of macrofungi collected from Bolu Abant Nature Park between 2008 and 2009. As a result of field and laboratory studies, 103 taxa belonging to 34 families were identified. Five (5) taxa belong to Ascomycota and 98 to Basidiomycota.

  17. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.


    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  18. Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis. (United States)

    Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina


    The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

  19. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  20. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy


    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 A further increment in LccH activity of 5671.30 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  1. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.


    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  2. Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw. (United States)

    Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony


    Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

  3. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo


    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  4. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus. (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske


    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune. (United States)

    Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir


    Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Microbial competition, lack in macronutrients, and acidity as main obstacles to the transfer of basidiomycetous ground fungi into (organically or heavy-metal contaminated) soils. (United States)

    Gramss, Gerhard; Bergmann, Hans


    Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.

  7. Type studies in Basidiomycetes. X

    NARCIS (Netherlands)

    Singer, R.


    For the first time a systematic study of the types and authentic specimens of agarics and boletes preserved in the Persoon Herbarium has been carried out. Some aspects of the possibilities of type analysis with regard to specimens over 130 year old are discussed. 137 species were analyzed. The

  8. The Blackwell Handbook of Internet Studies

    DEFF Research Database (Denmark)

    The Handbook of Internet Studies brings together scholars from a variety of fields to explore the profound shift that has occurred in how we communicate and experience our world as we have moved from the industrial era into the age of digital media. Original essays address issues within topics...

  9. Impact of fire on the macrofungal diversity in scrub jungles of south-west India

    Directory of Open Access Journals (Sweden)

    Ammatanda A. Greeshma


    Full Text Available Fortnightly survey in control and fire-impacted regions of scrub jungle of south-west coast of India during south-west monsoon (50 m2 quadrats up to 10 weeks yielded 34 and 25 species of macrofungi, respectively. The species as well as sporocarp richness were the highest during the fourth week, while the diversity attained the highest during the second week in control region. In fire-impacted region, the species and sporocarp richness and diversity peaked at sixth week. Seven species common to both regions were Chlorophyllum molybdites, Lepiota sp., Leucocoprinus birnbaumii, Marasmius sp. 3, Polyporus sp., Schizophyllum commune and Tetrapyrgos nigripes. The overall sporocarp richness was higher in fire-impacted than in control region. The Jaccard’s similarity between regions was 13.5%, while fortnights of regions ranged from 0% (10th week to 11.7% (eighth week. Control region showed single-species dominance by Xylaria hypoxylon, while multispecies dominance by Cyathus striatus and Lentinus squarrosulus in fire-impacted region. Except for air temperature, nine abiotic factors significantly differed between control and fire-impacted regions. The Pearson correlation was positive between species richness and phosphorus content in fire-impacted region (r = 0.696, while sporocarp richness was negatively correlated with pH in control region (r = −0.640. Economically viable species were 12 and 10 without overlap in control and fire-impacted regions, respectively.

  10. Quantifying beetle-macrofungal associations in a temperate biodiversity hot spot. (United States)

    Epps, Mary Jane; Arnold, A Elizabeth


    Beetles (Coleoptera) are often among the most abundant and diverse insects that feed on sporocarps of macrofungi, but little is known regarding their relative specialism or generalism in most communities. We surveyed >9000 sporocarps in montane hardwood forest in the Appalachian Mountains (USA) to characterize associations of mycophagous beetles and macrofungi. We used traditional metrics and network analyses to quantify relationships between sporocarp traits (mass, age, persistence, and toughness) and assemblages of adult beetles, drawing from >50 000 beetles collected over two survey years. Strict-sense specificity was rare in these associations: most beetle species were found on multiple fungal genera, and most fungi hosted multiple beetle species. Sporocarp age and fresh mass were positively associated with beetle diversity in fungi with ephemeral sporocarps (here including 12 genera of Agaricales and Russulales), but sporocarp persistence was not. In Polyporales, beetle diversity was greater in softer sporocarps than in tough or woody sporocarps. The increase of beetle diversity in aging sporocarps could not be attributed to increases in sporocarp mass or sampling point in the growing season, suggesting that age-related changes in chemistry or structure may support increasingly diverse beetle communities. Interaction networks differed as a function of sporocarp age, revealing that community-wide measures of generalism (i.e., network connectance) and evenness (i.e., variance in normalized degree) change as sporocarps mature and senesce. Beetles observed on Agaricales and Russulales with more persistent sporocarps had narrower interaction breadth (i.e., were more host-specific) than those on less persistent sporocarps, and beetles on Polyporales with tougher sporocarps had narrower interaction breadth than those on soft sporocarps. In addition to providing a large-scale evaluation of sporocarp use by adult beetles in this temperate biodiversity hot spot, this study shows that characteristics of food organisms are associated with specialism and generalism in interactions relevant to fungal and forest ecology.

  11. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis* (United States)

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica


    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  12. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  13. Recovering Sample Diversity in Rao-Blackwellized Particle Filters for Simultaneous Localization and Mapping

    National Research Council Canada - National Science Library

    Anderson, Andrew D


    ...) in simultaneous localization and mapping (SLAM) situations that arises when precise feature measurements yield a limited perceptual distribution relative to a motion-based proposal distribution...

  14. Rights, interveners and the Law Lords / Sangeeta Shah, Thomas Poole, Michael Blackwell

    Index Scriptorium Estoniae

    Shah, Sangeeta


    Suurbritannia kõrgeimast kohtust - Lordide Kojast (House of Lords) ning 1994.-2009. aastal tehtud kohtuotsustest. Samuti Apellatsioonikomitee liikmetest - law lord'idest ja nende sekkumisest otsuste tegemisse

  15. H-SLAM: Rao-Blackwellized Particle Filter SLAM Using Hilbert Maps

    Directory of Open Access Journals (Sweden)

    Guillem Vallicrosa


    Full Text Available Occupancy Grid maps provide a probabilistic representation of space which is important for a variety of robotic applications like path planning and autonomous manipulation. In this paper, a SLAM (Simultaneous Localization and Mapping framework capable of obtaining this representation online is presented. The H-SLAM (Hilbert Maps SLAM is based on Hilbert Map representation and uses a Particle Filter to represent the robot state. Hilbert Maps offer a continuous probabilistic representation with a small memory footprint. We present a series of experimental results carried both in simulation and with real AUVs (Autonomous Underwater Vehicles. These results demonstrate that our approach is able to represent the environment more consistently while capable of running online.

  16. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes


    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  17. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado


    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  18. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van


    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

  19. New records of truffle fungi (Basidiomycetes) from Turkey (United States)

    Aziz Turkoglu; Michael Angelo. Castellano


    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  20. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    of their ability to degrade xenobiotic compounds. Owing to extra- cellular non-specific free-radical-based ligninolytic system of WRF, they can completely eliminate a variety of xenobiotics, including synthetic dyes, giving rise to non-toxic compounds (Kuhad et al... and decolorization and ligninolytic enzymes activity was determined in the cell-free supernatant (CS). 2.5 Decolorization Assays The fungal biomass from each 250-ml Erlenmeyer flask was taken after respective incubation period. It was crushed into a paste...

  1. Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, L.


    Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab

  2. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.


    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  3. Rate Growth comparison of basidiomycetous fungi isolated in Mexico

    International Nuclear Information System (INIS)

    Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.


    Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)

  4. Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes (United States)

    Yitzhak Hadar; Daniel Cullen


    Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

  5. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav


    Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015

  6. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav


    Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  7. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav


    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  8. MILROY, Lesley. Observing and Analysing Natural Language: A Critical Account of Sociolinguistic Method. Oxford: Basil Blackwell, 1987. 230pp. MILROY, Lesley. Observing and Analysing Natural Language: A Critical Account of Sociolinguistic Method. Oxford: Basil Blackwell, 1987. 230pp.

    Directory of Open Access Journals (Sweden)

    Iria Werlang Garcia


    Full Text Available Lesley Milroy's Observing and Analysing Natural Language is a recent addition to an ever growing number of publications in the field of Sociolinguistics. It carries the weight of one of the experienced authors in the current days in the specified field and should offer basic information to both newcomers and established investigators in natural language. Lesley Milroy's Observing and Analysing Natural Language is a recent addition to an ever growing number of publications in the field of Sociolinguistics. It carries the weight of one of the experienced authors in the current days in the specified field and should offer basic information to both newcomers and established investigators in natural language.

  9. 75 FR 41276 - US Rail Partners, Ltd. and Blackwell Northern Gateway Railroad Company-Continuance in Control... (United States)


    ... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. FD 35384] US Rail Partners...). Applicants state that EBGR intends to file a notice for a modified certificate of public convenience and... the Colebrookdale Line, from Berks County, Pa. USRP currently controls through stock ownership two...

  10. Health care research by degrees N Reid Health care research by degrees Blackwell Scientific 162pp £13.99 0632-03466-1 [Formula: see text]. (United States)


    Inadequately understood statistics so often cloud both the argument of the researcher and the judgement of the reader. Norma Reid brings a refreshing clarity to a complex topic; she takes the mystification and mystique out of statistics. Her basic premiss that theory ought to be based on practical utility and relevance shines through her text and helps to make the subject accessible co clinicians who want to understand the underpinnings of their practice. Research methods, particularly qualitative approaches, are sketchily dealt with when compared with the wealth of detail on the mechanics of computing. Also, it is awkward to find methods and analysis not clearly separated in places (eg, Delphi studies), but ample references direct the reader to more expansive sources. Any attempt to steer the uninitiated through the minefields of computing is fraught with difficulties, and some will be disappointed to find one system used exclusively, but, perhaps, it serves as an illustration rather than a course to be slavishly followed.

  11. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes). (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia


    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  12. Xylobolus subpileatus, a specialized basidiomycete functionally linked to old canopy gaps

    DEFF Research Database (Denmark)

    Taudiere, A.; Bellanger, J. M.; Moreau, P. A.


    Documenting succession in forest canopy gaps provides insights into the ecological processes governing the temporal dynamics of species within communities. We analyzed the fruiting patterns of a rare but widely distributed saproxylic macromycete, Xylobolus subpileatus, during the ageing of natura...

  13. Hydrophobins in the Life Cycle of the Ectomycorrhizal Basidiomycete Tricholoma vaccinum.

    Directory of Open Access Journals (Sweden)

    Dominik Sammer

    Full Text Available Hydrophobins-secreted small cysteine-rich, amphipathic proteins-foster interactions of fungal hyphae with hydrophobic surfaces, and are involved in the formation of aerial hyphae. Phylogenetic analyses of Tricholoma vaccinum hydrophobins showed a grouping with hydrophobins of other ectomycorrhizal fungi, which might be a result of co-evolution. Further analyses indicate angiosperms as likely host trees for the last common ancestor of the genus Tricholoma. The nine hydrophobin genes in the T. vaccinum genome were investigated to infer their individual roles in different stages of the life cycle, host interaction, asexual and sexual development, and with respect to different stresses. In aerial mycelium, hyd8 was up-regulated. In silico analysis predicted three packing arrangements, i.e., ring-like, plus-like and sheet-like structure for Hyd8; the first two may assemble to rodlets of hydrophobin covering aerial hyphae, whereas the third is expected to be involved in forming a two-dimensional network of hydrophobins. Metal stress induced hydrophobin gene hyd5. In early steps of mycorrhization, induction of hyd4 and hyd5 by plant root exudates and root volatiles could be shown, followed by hyd5 up-regulation during formation of mantle, Hartig' net, and rhizomorphs with concomitant repression of hyd8 and hyd9. During fruiting body formation, mainly hyd3, but also hyd8 were induced. Host preference between the compatible host Picea abies and the low compatibility host Pinus sylvestris could be linked to a stronger induction of hyd4 and hyd5 by the preferred host and a stronger repression of hyd8, whereas the repression of hyd9 was comparable between the two hosts.

  14. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila


    Roč. 102, č. 20 (2011), s. 9409-9415 ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  15. Wood decay by Chlorociboria aeruginascens (Nyl.) Kanouse (Helotiales, Leotiaceae) and associated basidiomycete fungi (United States)

    Dana L. Richter; Jessie A. Glaeser


    Two isolates of Chlorociboria aeruginascens (Nyl.) Kanouse incubated axenically on aspen wood blocks resulted in 18% and 32% mass loss after 134 wks (2 yrs 8 mo). Aspen wood decayed by C. aeruginascens contained cavities in the S2 layer of the secondary cell wall, similar to Type I soft rot attack, as well as erosion troughs and...

  16. Gram-scale production of a basidiomycetous laccase in Aspergillus niger. (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry


    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan


    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  18. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    seen, but LIP production either was not seen or was minimal. LME rpoduction was also seen in media prepared with artificial seawater. Fast rpotein liquid chromatography and isoelectric focusing resolved LMEs into four isozymes each of MNP and LIP, while...

  19. Cd and Zn interactions and toxicity in ectomycorrhizal basidiomycetes in axenic culture

    Directory of Open Access Journals (Sweden)

    Vinicius H. De Oliveira


    Full Text Available Background Metal contamination in soils affects both above- and belowground communities, including soil microorganisms. Ectomycorrhizal (ECM fungi are an important component in belowground community and tolerant strains have great potential in enhancing plant-based remediation techniques. We assessed cadmium and zinc toxicity in five ECM species in liquid media (Hebeloma subsaponaceum; H. cylindrosporum; H. crustuliniforme; Scleroderma sp.; Austroboletus occidentalis and investigated the potential of Zn to alleviate Cd toxicity. Due to highly divergent results reported in the literature, liquid and solid media were compared experimentally for the first time in terms of differential toxicity thresholds in Cd and Zn interactions. Methods A wide range of Cd and Zn concentrations were applied to ectomycorrhizal fungi in axenic cultures (in mg L−1: 0; 1; 3; 9; 27; 81; 243 for the Cd treatments, and 0; 1; 30; 90; 270; 810; 2,430 for Zn. Combined Zn and Cd treatments were also applied to H. subsaponaceum and Scleroderma sp. Dry weight was recorded after 30 days, and in case of solid medium treatments, radial growth was also measured. Results and Discussion All species were adversely affected by high levels of Cd and Zn, and A. occidentalis was the most sensitive, with considerable biomass decrease at 1 mg L−1 Cd, while Scleroderma sp. and H. subsaponaceum were the most tolerant, which are species commonly found in highly contaminated sites. Cd was generally 10 times more toxic than Zn, which may explain why Zn had little impact in alleviating Cd effects. In some cases, Cd and Zn interactions led to a synergistic toxicity, depending on the concentrations applied and type of media used. Increased tolerance patterns were detected in fungi grown in solid medium and may be the cause of divergent toxicity thresholds found in the literature. Furthermore, solid medium allows measuring radial growth/mycelial density as endpoints which are informative and in this case appeared be related to the high tolerance indices found in H. subsaponaceum.

  20. Indole compounds in some culinary-medicinal higher basidiomycetes from Poland. (United States)

    Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina


    Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.

  1. Cytotoxic activity of methanol extracts from Basidiomycete mushrooms on murine cancer cell lines. (United States)

    Tomasi, S; Lohézic-Le Dévéhat, F; Sauleau, P; Bézivin, C; Boustie, J


    Crude methanol extracts of 58 mushroom species were screened for their cytotoxic activities against two murine cancer cell lines, L1210 and 3LL, using the tetrazolium assay. A majority of extracts (74%) exhibited IC50 > 100 microg/ml against both cell lines. A most marked activity against one of the cell lines was noted for nine species (14% of the tested species). While Amanitales and Russulales tested were not found active, Polyporales and Boletales gave better results. Four species exhibited a significant cytotoxic activity (IC50 Suillus granulatus, S. luteus). The last one had never been investigated for its cytotoxic compounds before.

  2. Highly-efficient liposome-mediated transformation system for the basidiomycetous fungus Flammulina velutipes. (United States)

    Shi, Liang; Chen, Dongdong; Xu, Chao; Ren, Ang; Yu, Hanshou; Zhao, Mingwen


    Flammulina velutipes is a well-known edible mushroom cultivated all over the world. However, because of the low transformation frequency, the expensive instruments required, and the complicated, time-consuming procedures necessary, there is insufficient genetic research on F. velutipes. In this study, we report a liposome-mediated transformation (LMT) system for the genetic transformation of F. velutipes. Using the LMT system, we obtained 82 ± 4 stable F. velutipes transformants per 10 5 protoplasts, which is a clear increase in transformation frequency compared to the other methods used. We were able to detect the expression of an EGFP reporter gene in the F. velutipes transformants using fluorescence imaging assays. Furthermore, we used this method to transfer the laccase gene into F. velutipes and found that the transcriptional level and enzymatic activity increased in these transformants. Mitotic stability analysis showed that all of the selected transformants remained mitotically stable, even after five successive rounds of sub-culturing. These results demonstrate a new transgenic approach that will facilitate F. velutipes research.

  3. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete


    Kerem, Zohar; Bao, Wuli; Hammel, Kenneth E.


    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes....

  4. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete. (United States)

    Kerem, Z; Bao, W; Hammel, K E


    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes. Analyses of degraded PEOs by gel permeation chromatography showed that the fungus cleaved PEO rapidly by an endo route. 13C NMR analyses of unlabeled and perdeuterated PEOs recovered from G. trabeum cultures showed that a major route for depolymerization was oxidative C---C bond cleavage, a reaction diagnostic for hydrogen abstraction from a PEO methylene group by a radical oxidant. Fenton reagent (Fe(II)/H2O2) oxidized PEO by the same route in vitro and therefore might account for PEO biodegradation if it is produced by the fungus, but the data do not rule out involvement of less reactive radicals. The reactivity and extrahyphal location of this PEO-degrading system suggest that its natural function is to participate in the brown rot of wood and that it may enable brown-rot fungi to degrade recalcitrant organopollutants.

  5. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa. (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M


    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  6. Effect of phenol on the mycelial growth and fructification in some of basidiomycetous fungi. (United States)

    Upadhyay, R C; Hofrichter, M


    Cometabolic growth studies with phenol were undertaken to screen 32 strains of white and brown rot fungi. All the cultures studied grew well up to 4 mM of phenol on Czapekdox agar except Agaricus bisporus (white button mushroom) and Pleurotus cystidiosus. Most of them could grow even up to 6 mM of phenol. Phenol induced a brown pigmentation of the culture medium. P. flabellatus and P. pulmonarius metabolized 67 and 64 mg/l phenol in 10 days. Studies have indicated that phenol (0.1 to 1.0 mM) incorporated in malt-extract agar has no inhibitory effect on fruitbody formation. Preliminary studies indicate that soaking of wheat straw with phenol solution up to 1600 mg/l give better mycelial growth and fructification of P. cornucopiae, P. ostreatus Z-15 and Calocybe indica than water soaked. Soaking of wheat straw in phenol inhibited the growth of common competitor weed fungi like Stachybotrys sp. and Coprinus sp.

  7. Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan. (United States)

    Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree


    Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

  8. Cytotoxic grifolin derivatives isolated from the wild mushroom Boletus pseudocalopus (Basidiomycetes). (United States)

    Song, Junsik; Manir, Md Maniruzzaman; Moon, Surk-Sik


    Activity-guided purification of a MeOH extract of the Korean wild mushroom Boletus pseudocalopus afforded three new grifolin derivatives, 1-3, along with four known phenolic compounds 4-7. Their structures were established by a combination of 1H- and 13C-NMR, NOESY, and extensive two-dimensional NMR spectroscopic experiments such as gCOSY, gHSQC, gHMBC, and ROESY. The major metabolites 4 and 5 were subjected to reduction to provide the side chain-reduced compounds 8 and 9 for biological testing. All of the compounds except compound 6 showed anticancer activities in the range of IC(50) 3.5-11.0 microg/ml against human lung carcinoma A549 and mouse melanoma B16F1 cell lines. In addition, all compounds showed moderate radical-scavenging activities determined by DPPH assay.

  9. Concentration and behavior of radiocesium in higher basidiomycetes in some Kanto and the Koshin districts, Japan

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Iwashima, Kiyoshi; Shibata, Hisashi.


    Concentration of 137 Cs, 134 Cs and potassium were measured in several higher fungi and in substrates, soils, woods and litters in some Kanto and the Koshin districts, Japan, following the Chernobyl accident during October to November 1989. 137 Cs concentrations in fungi were in the range of 0.7-101 Bq kg -1 · fresh. Maximum 137 Cs level in them was observed in Boletopsis leucomelas (Pers.: Fr.) Fayod. Significantly higher levels of concentration ratios of 137 Cs in fungi to substrates (e.g.; 137 Cs concentration · fresh in fungus/ 137 Cs concentration · dry in soil), 10 -1 to 10 x 10 -1 , were found nearly 10 to 1000 times as much as leaf vegetables, root crops and potatoes to substrates. It was confirmed that levels of concentration ratios of potassium were similar to those of 137 Cs. In all fungi, 134 Cs which released from the Chernobyl accident and is not present in nuclear weapons fallout was not detected. (author)

  10. Hydrolysis of residuals of barley straw using white-rot basidiomycetes

    International Nuclear Information System (INIS)

    Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.


    The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)

  11. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr


    Roč. 78, č. 1 (2011), s. 80-90 ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  12. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr


    Roč. 4, č. 6 (2011), s. 417-426 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  13. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński


    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  14. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr


    Roč. 158, č. 5 (2007), s. 447-455 ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  15. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr


    Roč. 54, č. 1 (2009), s. 74-80 ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  16. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří


    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  17. Comparative Study of Worldwide Species of Genus Lentinus (=Lentinula, Higher Basidiomycetes) Based on Linear Mycelium Growth. (United States)

    Mata, Juan Luis; Mishra, Nutan Tulapurkar


    Species of mushroom genus Lentinus (=Lentinula) are best known for the commercially important and extensively studied culinary-medicinal shiitake, L. edodes. A few mycelium growth studies have focused on Lentinus boryana, but information is lacking for L. raphanica and L. aciculospora, endemic to the Americas. In this study, 14 dikaryon strains representing 5 Lentinus species were grown on 5 nutritive agar media at increments of 5°C. Growth for each species was significantly slower on corn meal agar, but no differences were found among malt extract, potato dextrose, malt peptone, and yeast malt extract agars. Lentinus aciculospora and L. boryana consistently exhibited the slowest mycelium growth rates among all species and across all temperatures tested, with optima at 15°C and 20°C. The fastest mycelium growth rates for L. edodes, L. novaezelandiae, and L. raphanica occurred at 25°C. Strains of the latter continued to grow well at 30°C, whereas growth of the other 2 species declined significantly. Differences in mycelium growth rates for American strains could be partially explained by their geographic locations, indicating that understanding this physiological parameter has important ramifications for the edible mushroom industry.

  18. Cellulase production by white-rot basidiomycetous fungi: solid-state versus submerged cultivation

    DEFF Research Database (Denmark)

    Bentil, Joseph A.; Thygesen, Anders; Mensah, Moses


    fungi for improved enzyme expression, as well as on-site approaches for production of enzyme blends for industrial biomass conversion. The quantitative comparisons made have implications for selection of the most appropriate cultivation method for WRB fungi for attaining maximal cellulase production....... on different biomass residues in SSC or SmC systems. Although some variation in cellulase production yields have been reported for certain substrates, the analysis convincingly shows that SmC is generally more efficient than SSC for obtaining high cellulase production yields and high cellulase production rates......) or submerged cultivation (SmC) systems. In this review, we quantitatively assess the data available in the literature on cellulase production yields by WRB fungi cultivated by SSC or SmC. The review also assesses cellulolytic enzyme production rates and enzyme recovery when WRB fungi are cultivated...

  19. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop


    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2,6-dichloroindophenol. While L. shimeji P2Ox is the least thermostable of these three enzymes (melting temperature Tm of 54.9°C; half-life time of activity τ1/2 of 0.12 at 50°C and pH 6.5, P. chrysosporium P2Ox showed remarkable thermostability with Tm of 75.4°C and τ1/2 of 96 h under identical conditions.

  20. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr


    Roč. 1, č. 1 (2008), s. 4-12 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  1. Decomposition, nitrogen and phosphorus mineralization from beech leaf litter colonized with ectomycorrhizal or litter decomposing basidiomycetes




    The decomposition and the nitrogen and phosphorus mineralization of fresh beech (Fagus sylvatica L.) leaf litter are described. Leaves were buried for up to 6 months in plant containers in which Scots pine (Pinus sylvestris L.) seedlings were cultivated at a low rate of nutrient addition. The saprotrophic abilities of three ectomycorrhizal fungi, Thelephora terrestris Ehrh.: Fr., Suillus bovinus (L.: Fr.) O. Kuntze and Paxillus involutes (Batsch: Fr) Fr., were compared with the degradation ca...

  2. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India. (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind


    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  3. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India. (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram


    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p < 0.01). A positive correlation existed between the phenolic content and antioxidant activity. Our results indicated that fruiting bodies of G. lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application.

  4. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  5. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes). (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun


    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  6. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats. (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo


    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  7. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  8. Effect of cultural conditions on antrodin C production by basidiomycete Antrodia camphorata in solid-state fermentation. (United States)

    Xia, Yongjun; Wang, Yuanlong; Zhang, Bobo; Xu, Ganrong; Ai, Lianzhong


    Antrodia camphorata is a medicinal fungus and antrodin C is one of the main bioactive components of A. camphorata in the submerged fermentation (SmF). To optimize the culture conditions, the factors influencing the production of antrodin C by A. camphorata under solid-state fermentation (SSF) were investigated in this study. Different solid substrates and external nitrogen sources were tested for their efficiency in producing antrodin C. The response surface methodology was applied to evaluate the influence of several variables, namely, the concentrations of soybean meal, initial moisture content, and inoculum density on antrodin C production in solid-state fermentation. The experimental results show that the optimum fermentation medium for antrodin C production by A. camphorata was composed of 0.578 g soybean meal, 0.05 g Na2 HPO4 , 0.05 g MgSO4 for 100 g rice, with 51.83% initial moisture content, 22 day culture time, 28 °C culture temperature, and 35.54% inoculum density. At optimized conditions, 6,617.36 ± 92.71 mg kg(-1) yield of antrodin C was achieved. Solid-state fermentation is one good cultural method to improve the production of antrodin C by A. camphorata. © 2014 International Union of Biochemistry and Molecular Biology, Inc.

  9. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Helbert David Siabatto F.


    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  10. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes). (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan


    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  11. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes). (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi


    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  12. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy


    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  13. Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal basidiomycete Pisolithus tinctorius during colonization of Eucalyptus globulus roots

    NARCIS (Netherlands)

    Tagu, D; De Bellis, R; Balestrini, R; De Vries, OMH; Piccoli, G; Stocchi, [No Value; Bonfante, P; Martin, F

    The immunolocalization of one of the hydrophobins of Pisolithus tinctorius (HYDPt-1) is reported. Hydrophobin proteins play key roles in adhesion and aggregation of fungal hyphae, and it is already known that formation of ectomycorrhizas on eucalypt roots enhances the accumulation of hydrophobin

  14. Cryptococcus haglerorum, sp. nov., an anamorphic basidiomycetous yeast isolated from nests of the leaf-cutting ant Atta sexdens.

    NARCIS (Netherlands)

    Middelhoven, W.J.; Fonseca, A.; Carreiro, S.C.; Pagnocca, F.C.; Bueno, O.C.


    A yeast strain (CBS 8902) was isolated from the nest of a leaf-cutting ant and was shown to be related to Cryptococcus humicola. Sequencing of the D1/D2 region of the 26S ribosomal DNA and physiological characterization revealed a separate taxonomic position. A novel species named Cryptococcus

  15. Immunomodulatory activities of different solvent extracts from Tricholoma matsutake (S. Ito et S. Imai) singer (higher basidiomycetes) on normal mice. (United States)

    Yin, Xiulian; You, Qinghong; Jiang, Zhonghai


    The immunomodulatory activities of different solvent extracts from the culinary-medicinal mushroom Tricholoma matsutake were studied in vivo in normal mice. The extracts were prepared using different solvents in an order of increasing polarity. The immunomodulatory activities were investigated by measuring the thymus and spleen index, phagocytic rate of macrophage phagocytosis, delayed-type hypersensitivity, plaque-forming cell, and proliferation of splenocytes. Results demonstrated that water extract (WE) and n-butyl alcohol extract (BAE) of T. matsutake could enhance the immunity of mice significantly compared with the control group. Main components of WE and BAE were polysaccharides, proteins, and flavonoids; we presume that these may be the main immunomodulating and immuno-enhancing agents in T. matsutake.

  16. Extraction, Antimicrobial, and Antioxidant Activities of Crude Polysaccharides from the Wood Ear Medicinal Mushroom Auricularia auricula-judae (Higher Basidiomycetes). (United States)

    Cai, Ming; Lin, Yang; Luo, Yin-long; Liang, Han-hua; Sun, Pei-long


    In this study, crude polysaccharides of culinary-medicinal mushroom Auricularia auricular-judae were extracted by hot water extraction and alcohol precipitation, and their antimicrobial and antioxidant activities were investigated. An optimum extraction condition was obtained at a ratio of liquid to solid 70 mL/g, temperature 90°C, time 4 h and extraction number 4. Accordingly, the best yield of crude polysaccharides was 6.89% with 76.12% in purity. Some bacteria and fungi were used for antimicrobial studies. It was found that crude A. auricula-judae had great antimicrobial activities against Escherichia coli and Staphylococcus aureus, but no activities on the others. The inhibitory diameters of antimicrobial zones for the two were 5.55 ± 0.182 and 9.84 ± 0.076 mm, respectively. Moreover, crude A. auricula-judae had significant antioxidant activities in scavenging free radicals, reducing power assays, and Fe2+ chelating ability assay. Results revealed that crude A. auricula-judae has a great potential as antimicrobial and antioxidant, and it can be a supplementary food for human health.

  17. Mating tests among geographically separated collections of the Trametes versicolor (Fr.) Pilát (Basidiomycetes, Polyporales) group

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav


    Roč. 79, 3-4 (2004), s. 425-431 ISSN 0029-5035 R&D Projects: GA ČR GA526/02/1216; GA ČR GD206/03/H137 Institutional research plan: CEZ:AV0Z5020903 Keywords : trametes versicolor * mating tests Subject RIV: EE - Microbiology, Virology Impact factor: 0.594, year: 2004

  18. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr


    Roč. 39, č. 10 (2007), s. 2651-2660 ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  19. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    with Anaeroclip® clips and Anaerotest® indicatorwere incubated at 25ºC, according to the 4 manufacturer’s instructions, either directly orafter oxicpre-incubation for 24 or 48 h. Growth was inspected at regular intervals up to one year. 2.3 Electron... °C. The PCR amplicons were purified using GenEluteTMGel Extraction kit (Sigma Aldrich, USA) and cloned individually for each gene using the TA cloning kit (Invitrogen, USA) according to the manufacturer’s instructions. A representative clone...

  20. Medicinal Mushroom Cracked-Cap Polypore, Phellinus rimosus (Higher Basidiomycetes) Attenuates Acute Ethanol-Induced Lipid Peroxidation in Mice. (United States)

    Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K


    Alcohol abuse and alcoholism remain one of the major health issues worldwide, especially in developing countries. The protective effect of Phellinus rimosus against acute alcohol-induced lipid peroxidation in the liver, kidney, and brain as well as its effect against antioxidant enzyme activity such as superoxide (SOD) and catalase (CAT) in the liver was evaluated in mice. Ethyl acetate extract of Ph. Rimosus (50 mg/kg body wt, p.o.) 1 h before each administration of alcohol (3 mL/kg, p.o.; total 2 doses at 24-h intervals) protected against lipid peroxidation in all organs and attenuated the decline of SOD and CAT activity in the liver. The fold increase in lipid peroxidation, including conjugated diene and thiobarbituric acid reactive substance (TBARS) levels, was highest in the liver. There were 2.6- and 1.5- fold increases in TBARS levels in the liver of the alcohol alone- and alcohol+Ph. Rimosus-treated groups, compared with that of the normal group. Activity of SOD and CAT in the liver of alcohol- and alcohol+Ph. Rimosus- treated animals was 9.05±1.38, 18.76±1.71, and 11.26±1.02, 31.58±3.35 IU/mg protein, respectively. Extract at 1 mg/mL inhibited 50.6% activity of aniline hydroxylase (CYP2E1) in liver homogenate. From these results, we concluded that the extract significantly protected against the lipid peroxidation. Protection in the liver may be due to the inhibitory effect on CYP2E1 as well as the direct radical scavenging effect of Ph. Rimosus, which warrants further research.

  1. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat; Bakkeren, Guus


    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer

  2. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review). (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves


    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  3. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion. (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D


    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  4. Health Visiting: Preparation for Practice (Fourth edition) Luker Karen McHugh Gretl and Bryar Rosamund Health Visiting: Preparation for Practice (Fourth edition) 312pp £32.99 Wiley Blackwell 9781119078586 111907858X [Formula: see text]. (United States)


    Children, families and the communities they live in deserve high-quality care from well-informed health visitors and healthcare staff. Having an understanding of the role and responsibilities of health visitors and the wider influences on their practice has never been more important.

  5. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.


    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  6. Effect of Different Proportions of Agrowaste on Cultivation Yield and Nutritional Composition of the Culinary-Medicinal Jelly Mushroom Auricularia polytricha (Higher Basidiomycetes). (United States)

    Wu, Chiu-Yeh; Liang, Chih-Hung; Wu, Kuan-Jzen; Shih, Hsin-Der; Liang, Zeng-Chin


    In this study, Auricularia polytricha was cultivated on a sawdust basal substrate supplemented with different proportions (30%, 45%, and 60%, respectively) of agrowastes-sugarcane bagasse (SB), rice straw (RS), and rice husk (RH)-to evaluate the alternative substrates. The mycelial growth rate, total colonization time, time to first primordia, biological efficiency, and chemical composition of the fruiting bodies were determined. Results indicated that the 60% SB substrate was the best substrate for mycelial growth of A. polytricha, with a corresponding total colonization period of 35.2 days, followed by the control (35.5 days) and 45% SB (36.2 days) substrates. The most suitable substrate with a high biological efficiency was 60% RS substrate (159.14%), followed by the 45% SB (128.45%), and 20% RH (124.47%) substrates. The nutrient values of fruiting bodies showed the largest amounts of ash, protein, fat, carbohydrates, and energy cultivated on 60% SB, 60% SB, 30% SB, 30% RH, and 30% RH/the control substrates, respectively. The results indicated that 60% RS was an appropriate substrate for A. polytricha cultivation.

  7. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler. (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad


    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  8. Metabolic regulation at the tricarboxylic acid and glyoxylate cycles of the lignin-degrading basidiomycete Phanerochaete chrysosporium against exogenous addition of vanillin. (United States)

    Shimizu, Motoyuki; Yuda, Naoki; Nakamura, Tomofumi; Tanaka, Hiroo; Wariishi, Hiroyuki


    A proteomic differential display technique was utilized to study cellular responses of Phanerochaete chrysosporium exposed to vanillin, one of the key intermediates found during lignin biodegradation. Intracellular proteins were resolved by 2-DE and target protein spots were identified using MALDI-MS after in-gel tryptic digestions. Upon addition of vanillin to P. chrysosporium, up-regulation of homogentisate 1,2-dioxygenase, 1,4-benzoquinone reductases, aldehyde dehydrogenase, and aryl-alcohol dehydrogenase, which seem to play roles in vanillin metabolism, was observed. Furthermore, enzymes involved in glycolysis, the tricarboxylic acid cycle, the pentose-phosphate cycle, and heme biosynthesis were also activated. Up-regulation of extracellular peroxidase was also observed. One of the most unique phenomena against exogenous vanillin was a switch from the glyoxylate cycle to the tricarboxylic acid cycle, where a drastic increase in isocitrate dehydrogenase activity was observed. The exogenous addition of other aromatic compounds also caused an increase in its activity, which in turn triggered NAD(P)H production via the action of dehydrogenases in the tricarboxylic acid cycle, heme biosynthesis via the action of aminolevulinic acid synthase on succinyl-CoA, and energy production via activation of the mitochondrial electron transfer system. These metabolic shifts seem to be required for activating a metabolic system for aromatic compounds.

  9. Production of biomass and polysaccharides of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), by submerged cultivation. (United States)

    Habijanic, Jozica; Berovic, Marin; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka


    Submerged batch and repeated fed-batch cultivation techniques were used for mycelia cultivation and polysaccharide production of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum. Although most publications use various Asiatic G. lucidum strains, the growth of the strain Ga.l 4 (Biotechnical Faculty Strain Collection, Ljubljana, Slovenia), originally isolated from the Slovenian forest, is much faster. The results between the batch and repeated fed-batch cultivation are compared with the polysaccharide production in batch cultivation. From the aspect of biomass production, the best results were obtained in repeated fed-batch after 44 days, where 12.4 g/L of dry fungal biomass was obtained.

  10. The Effects of Light Intensity, Casing Layers, and Layering Styles on Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) Cultivation in Turkey. (United States)

    Adanacioglu, Neşe; Boztok, Kaya; Akdeniz, Ramazan Cengiz


    The aim of this research is to evaluate the effects of light intensity, casing layers, and layering styles on the production of the culinary-medicinal mushroom Agaricus brasiliensis in Turkey. The experiments were designed in split-split plots and replicated twice. Three different light intensities-I1, 350 lux; I2, 450 lux; and I3, 750 lux-were used in main plots as environmental factors. A mixture of 4 different casing layers- peat (100%), peat-perlite (75%:25%), peat-clinoptilolite (75%:25%), and peat-perlite-clinoptilolite (60%:20%:20%)-were used at split plots and at split plots. S1, a flat, 3-cm casing layer; S2, a flat, 5-cm casing layer; and S3, casing soil ridges 10 cm wide × 4 cm high, 10 cm apart, were deposited on top of 1-cm overall soil casing layers. At the end of the harvest phase, the total yield was estimated per 100 kg of substrate. Biological efficiency (percentage) was determined from the fresh weight of the mushrooms and the dry weight of the compost at the end of the harvesting period. The highest total yield (7.2 kg/100 kg compost) and biological efficiency (27.63%) were achieved from I2 × peat-perlite-clinoptilolite × S2 treatment. Influence of light intensity, casing layer, layering style, and their interaction in treatments with color values (L*, a*, b*, chroma*, and hue*) also were examined. It has been shown that within color values, chroma* (saturation) values of mushroom caps were affected by light intensity, casing layer, and layering style treatments and light intensity × casing layer treatments and the brightness of mushroom caps tended to increase as light intensity increased.

  11. Optimization of cultivation conditions of fermented shaggy ink cap culinary-medicinal mushroom, Coprinus comatus (O.Mull.:Fr.) Pers. (higher Basidiomycetes) rich in Vanadium. (United States)

    Zhang, Chunjing; Qi, Xiaodan; Shi, Yan; Sun, Yan; Li, Shuyan; Gao, Xiulan; Yu, Haitao


    The present paper is mainly aimed at optimization of cultivation conditions of fermented mushrooms of Coprinus comatus rich in vanadium (CCRV). Initial screening of effects of carbon source, temperature, pH, and inoculum size were done by using a one-factor-at-a-time method. The results obtained in that study showed that the optimal medium composition was 30 g glucose/Lin YEPG medium, initial pH 6.0, inoculum volume 10%, and incubation time 120 h. Then the medium was subjected to screening of the most significant parameters using the L9 orthogonal array to solve multivariable equations simultaneously. The results obtained in this study showed that the optimal medium composition was 0.4% V and 30 g glucose/Lin YEPG medium, initial pH 5.0, inoculum volume 15%, and incubation time 120 h. At this medium composition, the mycelial biomass and V content were 7.18 ± 0.24 g/L and 3786.0 ± 17 μg/g, respectively. The anti-diabetic potential of CCRV produced with the optimal level was tested in alloxan-induced diabetes. After the mice were administered (i.g.) with CCRV, the level of blood sugar in the CCRV group was very close to that of the control group. These findings suggested that CCRV produced with the optimal level is useful in the control of diabetes mellitus.

  12. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition. (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun


    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  13. Systemic Screening of Strains of the Lion's Mane Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) and Its Protective Effects on Aβ-Triggered Neurotoxicity in PC12 Cells. (United States)

    Liu, Zongying; Wang, Qinglong; Cui, Jian; Wang, Lili; Xiong, Lili; Wang, Wei; Li, Diqiang; Liu, Na; Wu, Yiran; Mao, Canquan


    Hericium erinaceus possesses multiple medicinal values. To date, however, there have been few studies of the systemic screening of H. erinaceus strains, and the neuroprotective effects of H. erinaceus prepared from homogenized, fresh fruiting bodies are not fully understood. In this study, 4 random primers were selected and used in random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) to screen and evaluate the genetic diversity of 19 commercial strains of H. erinaceus from different localities in China. A total of 66 bands were obtained, and the percentage of polymorphic loci reached 80.30%. Five dendrograms were constructed based on RAPD by Jaccard cluster and within-group linkage analysis. Primer S20 as well as all 4 primers had great potential as specific primers for RAPD-PCR molecular identification and differentiation of H. erinaceus strains. Based on the results of submerged culture and fruiting body cultivation, strains HT-N, HT-J1, HT-C, and HT-M were identified as superior among the 19 H. erinaceus strains. Further study showed that the oral preparation of homogenized, fresh fruiting bodies of H. erinaceus could attenuate the Aβ25-35-triggered damage in PC12 cells by significantly increasing cell viability and by decreasing the release of lactate dehydrogenase. In conclusion, RAPD-PCR combined with liquid and solid cultures can be used well in the screening and identification of H. erinaceus strains, and products prepared from homogenized, fresh fruiting bodies of H. erinaceus had neuroprotective effects on PC12 cells.


    Theobroma cacao (cacao), the source of chocolate, is a tropical understory tree. Fungal diseases such as Witches’ Broom Disease (WBD) and Frosty Pod Rot Disease (FPRD) of cacao have devastated cacao production in much of the Western Hemisphere and are threats to the main cacao producing regions in A...

  15. Structural elucidation of novel bioactive compound (2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone from basidiomycetous fungus Lentinus squarrosulus

    Directory of Open Access Journals (Sweden)

    Usha N.


    Full Text Available While screening for bioactive compounds from macrofungi of Western Ghats of Karnataka, Lentinus squarrosulus a member of polyporaceae was collected and mycelium of the fungus was obtained on potato dextrose agar medium and cultured in a liquid medium (containing 2% glucose, 1% peptone and 2% yeast extract for 20 days on a rotary shaker for the production of secondary metabolites. The cell free culture fluid (100ml was subjected to solvent extraction with dichloromethane (100ml and the extract was evaluated for antimicrobial activity by agar diffusion method and cytotoxic activity of the extract was also determined by MTT and SRB assay on MCF7 cell line. The results revealed that the dichloromethane extract was inhibitory against Escherichia coli, Enterobacter aerogenes, Staphylococcus aureus and Bacillus subtilus and also fungi such as Aspergillus niger, Fusarium solani and Trichoderma harzianum. The extract showed 13-27% cell inhibition at 63-1000 µg/ml concentration by MTT and SRB assays on MCF7 cell line. The structural elucidation of the compound by spectroscopic NMR (1H and C13, IR and mass spectrometric analysis confirmed the presence of 2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone responsible for antimicrobial and cytotoxic activity.

  16. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound. (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H


    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  17. Antitumor and Immunomodulating Activities of Exopolysaccharide Produced by Big Cup Culinary- Medicinal Mushroom Clitocybe maxima (Higher Basidiomycetes) in Liquid Submerged Culture. (United States)

    Hu, Shu-Hui; Cheung, Peter Chi Keung; Hung, Raw-Pou; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan


    Water-soluble polysaccharides extracted from mushrooms have been found to have some physiological effects. In this study, exopolysaccharides (EPSs) were extracted by alcohol precipitation from cultivated broth of the mushroom Clitocybe maxima. EPSs with molecular weights of 10(4) and 10(5) Da were obtained by ultrafiltration; they are referred to as EPA and EPB, respectively. The major components of these EPSs were glucose, galactose, mannose, rhamnose, and arabinose. ICR mice with artificially induced metastatic pulmonary tumors were fed a daily diet containing EPA or EPB at doses of 8, 20, or 50 mg/kg. Results showed that the proliferation of pulmonary sarcoma lesions was lower in the groups fed EPS. In addition, the numbers of total T cells, CD4+ cells, CD8+ cells, and macrophages significantly increased in EPS-fed mice compared with the negative control group. The antitumor and immunomodulating effects observed in the EPB-fed groups were higher than those of EPA-fed groups. These results demonstrate the ability of EPSs of C. maxima to inhibit tumor cells while enhancing immune response.

  18. Inoculation with a ligninolytic basidiomycete, but not root symbiotic ascomycetes, positively affects growth of highbush blueberry (Ericaceae) grown in a pine litter substrate

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Lukešová, Tereza; Albrechtová, Jana; Vosátka, Miroslav


    Roč. 355, č. 1-2 (2012), s. 341-352 ISSN 0032-079X R&D Projects: GA ČR GP206/09/P340; GA MŠk OE08019 Institutional research plan: CEZ:AV0Z60050516 Keywords : ericoid mycorrhiza * saprotrophic fungi * Ericaceae Subject RIV: EF - Botanics Impact factor: 2.638, year: 2012

  19. Chemical Compositions and Macrophage Activation of Polysaccharides from Leon's Mane Culinary-Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) in Different Maturation Stages. (United States)

    Li, Qiao-Zhen; Wu, Di; Chen, Xia; Zhou, Shuai; Liu, Yanfang; Yang, Yan; Cui, Fengjie


    We studied the effect of the maturation stage on the chemical compositions and macrophage activation activity of polysaccharides from the culinary-medicinal mushroom Hericium erinaceus. Results showed that total polysaccharides increased, whereas protein content decreased with the maturation stage development of fruiting body. Nine polysaccharide fractions, 3 from each of the maturity stages IV (small fungal spine stage), V (mid-fungal spine stage) and VI (mature), were prepared using the gradient ethanol precipitation method. The polysaccharide fraction HP4A isolated from the maturating-stage (stage IV) fruiting body had a significant difference from the fractions HP5A (stage V) and HP6A (stage VI) in the molecular weight distribution and monosaccharide compositions. Immunostimulating tests revealed that the polysaccharide fraction HP6 isolated from the mature stage (stage VI) fruiting body presented higher macrophage activation activity. Our findings provided important information for the harvest and use of H. erinaceus with higher qualities and functional benefits.

  20. A shift in nuclear state as the result of natural interspecific hybridization between two North American taxa of the basidiomycete complex Heterobasidion (United States)

    Matteo Garbelotto; Paolo Gonthier; Rachel Linzer; Giovanni Nicolotti; William Otrosina


    A natural first generation hybrid fungus shows interspecific heterozygosity. The nuclear condition of a rare natural hybrid between two taxa of the Heterobasidion complex is investigated. Heterobasidion species are known to be either homokaryotic (haploid) or heterokaryotic (n + n), but heterokaryons are made up of both...

  1. Oxalic acid overproduction by copper-tolerant brown-rot basidiomycetes on southern yellow pine treated with copper-based preservatives (United States)

    Carol A. Clausen; Frederick Green


    Accumulation of oxalic acid (OA) by brown-rot fungi and precipitation of copper oxalate crystals in wood decayed by copper-tolerant decay fungi has implicated OA in the mechanism of copper tolerance. Understanding the role of OA in copper tolerance is important due to an increasing reliance on copper-based wood preservatives. In this study, four copper-tolerant brown-...

  2. HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes). (United States)

    Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel


    The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

  3. Transformation of 14C-labelled lignin and humic substances in forest soil by the saprobic basidiomycetes Gymnopus erythropus and Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr


    Roč. 42, č. 9 (2010), s. 1541-1548 ISSN 0038-0717 R&D Projects: GA MŠk LC06066; GA MŠk OC 155; GA MŠk OC08050 Institutional research plan: CEZ:AV0Z50200510 Keywords : Forest soil * Humic acid * Gymnopus erythropus Subject RIV: EE - Microbiology, Virology Impact factor: 3.242, year: 2010

  4. Hypoglycemic and Hypolipidemic Effects of the Cracked-Cap Medicinal Mushroom Phellinus rimosus (Higher Basidiomycetes) in Streptozotocin-Induced Diabetic Rats. (United States)

    Rony, Kuttikkadan A; Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K


    Phellinus rimosus is a parasitic host specific polypore mushroom with profound antioxidant, antihepatotoxic, anti-inflammatory, antitumor, and antimutagenic activities. This study investigated the hypoglycemic and hypolipidemic activities of the wood-inhabiting polypore mushroom Ph. Rimosus in streptozotocin (STZ)-induced diabetic rats. Diabetes was induced by single intraperitoneal injection of STZ (45 mg/kg) to Wistar rats. The effects of 30 days treatment with Ph. Rimosus (50 and 250 mg/ kg) and glibenclamide (0.65 mg/kg) on blood glucose level, serum insulin, serum lipid profile, liver glycogen, liver function enzymes, and non-enzymic and enzymic antioxidants activities in pancreas, liver, and kidney were evaluated in STZ-induced diabetic rats. Oral administration of Ph. Rimosus extract exhibited a significant reduction in blood glucose, triacylglycerol, total cholesterol, LDL-cholesterol, and liver function enzymes, and increased serum insulin, liver glycogen, and HDL-cholesterol levels in STZ-induced diabetic rats. Furthermore, Ph. Rimosus treatment increased antioxidant status in pancreas, liver, and kidney tissues with concomitant decreases in levels of thiobarbituric acid- reactive substances. Results of this study indicated that Ph. Rimosus possessed significant hypoglycemic and hypolipidemic activities and this effect may be related to its insulinogenic and antioxidant effect.

  5. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor


    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  6. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities. (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin


    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  7. Evaluation of the antigenotoxic effects of the royal sun mushroom, agaricus brasiliensis (Higher basidiomycetes) in human lymphocytes treated with thymol in the comet assay

    NARCIS (Netherlands)

    Radaković, Milena; Stevanović, Jevrosima; Soković, Marina; Radović, Dejan; Griensven, Van Leo J.L.D.; Stanimirović, Zoran


    The aim of this investigation was to evaluate the possible protective activity of Agaricus brasiliensis (=A. blazei sensu Murrill) ethanol extract against thymol-induced DNA damage in human lymphocytes. Before we studied the possible interaction of thymol and A. brasiliensis extract, each

  8. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom. (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia


    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  9. Higher marine fungi from mangroves (Manglicolous fungi)

    Digital Repository Service at National Institute of Oceanography (India)

    ChinnaRaj, S.

    of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...

  10. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro


    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  11. Rhodotorula glutinis meningitis: a case report and review of literature. (United States)

    Menon, Sarala; Gupta, H R; Sequeira, R; Chavan, Shazia; Gholape, D; Amandeep, S; Bhilave, N; Chowdhary, A S


    Rhodotorula is ubiquitous saprophytic yeast belonging to phylum Basidiomycota. These encapsulated basidiomycetes are being increasingly recognised as important emerging human pathogens. There are scanty reports of meningitis caused by Rhodurorula spp in HIV infected patients. We present one such case of meningitis by Rhodutorula glutinis in HIV-infected patient. The patient also had a past history of abdominal tuberculosis. The diagnosis of Rhodotorula was confirmed by Gram staining and culture of the cerebrospinal fluid (CSF). Contamination was ruled out by repeated culturing of CSF from the same patient. Therapy with Amphotericin B showed good results. Patient was discharged from the hospital. However, in the seventh month of follow-up patient was readmitted with complaints of fever, breathlessness, altered sensorium, vomiting and succumbed to his illness. This time the CSF cultures remained negative for Rhodotorula, acid fast bacilli and other pyogenic organisms. Our last 11-year retrospective analysis of 8197 specimens received for mycological work-up showed that this is the first report of R. glutinis isolation from our institute. © 2014 Blackwell Verlag GmbH.

  12. Effect of L-Cysteine Pretreatment on the Control of Formaldehyde and Browning of the Culinary-Medicinal Shiitake Mushroom, Lentinus edodes (Higher Basidiomycetes) during Drying and Canning Processes. (United States)

    Li, Guijie; Wang, Qiang; Sun, Peng; Chen, Feng; Chen, Xiaolin; Wang, Cun; Zhao, Xin


    Fresh culinary-medicinal Shiitake mushrooms (Lentinus edodes) were pretreated by soaking in 0.1 mg/mL of L-cysteine solution for 1 hour; then the variation in formaldehyde content and browning degree were studied during hot air-drying and canning processes. The results indicated that L-cysteine pretreatment significantly inhibited the increase of formaldehyde content and browning during the drying process; these increases in the pretreatment groups ranged from 7.0% to 14.0% and 65.4% to 68.9%, respectively, of that of the control groups. While the L-cysteine pretreatment did not seem to have a significant effect on controlling the formaldehyde content during the canning process, the increase of the browning degree of the canned products of the pretreatment groups ranged from 64.8% to 78.5% of that of the control groups, indicating the inhibitive effect of L-cysteine on browning during the canning process of L. edodes. Overall, L-cysteine pretreatment improved the sensory quality of both dried and canned L. edodes.

  13. The protective effects of aqueous extracts of wild-growing and fermented Royal Sun mushroom, Agaricus brasiliensis S. Wasser et al. (higher basidiomycetes), in CCl4-induced oxidative damage in rats. (United States)

    Zhang, Chunjing; Han, Chunchao; Zhao, Baosheng; Yu, Haitao


    Culinary-medicinal Royal Sun mushroom, Agaricus brasiliensis (AbS), has traditionally been used for the prevention of a range of diseases, including cancer, hepatitis, atherosclerosis, hypercholesterolemia, diabetes, and dermatitis. The hepatoprotective effect of the fermented mushroom of A. brasiliensis (FMAE) and wild-growing A. brasiliensis (WMAE) were studied in this paper. An in vivo study of carbon tetrachloride (CCl4)-induced antioxidant activity in 2-month-old rats was conducted by examining the levels of activities of alanine aminotransaminase (ALT) and aspartate aminotransaminase (AST) and the antioxidant enzymes, including glutathione peroxidase (GSHPx) and catalase (CAT). Rats were divided into four groups, each containing six rats. The first group served as a control group. The second group was the CCl4 group. Group I and group II were treated orally with distilled water for 14 days respectively. Group III and Group IV were treated orally by WMAE and FMAE at oral doses of 50 mg/kg-day, respectively. Both WMAE and FMAE could reduce CCl4-induced toxicity, particularly hepatotoxicity, by suppressing ALT and AST activities, and increasing antioxidant enzyme activity. The studies demonstrate that both the fermented and wild-growing A. brasiliensis could protect the liver against CCl4-induced oxidative damage in rats.

  14. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia


    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  15. The influence of the hot water extract from shiitake medicinal mushroom, Lentinus edodes (higher Basidiomycetes) on the food intake, life span, and age-related locomotor activity of Drosophila melanogaster. (United States)

    Matjuskova, Natalya; Azena, Elena; Serstnova, Ksenija; Muiznieks, Indrikis


    Shiitake medicinal mushroom, Lentinus edodes, is among the most widely cultivated edible mushrooms in the world and is a well-studied source of nutrients and biologically active compounds. We have studied the influence of the dietary supplement of the polysaccharides containing a hot water extract of the mushroom L. edodes on the fruit fly Drosophila melanogaster in terms of food intake, body weight, life span, and age-related locomotor activity. L. edodes extract, when added to the D. melanogaster feeding substrate at a 0.003-0.030% concentration (calculated for the dry weight of the polysaccharide fraction) did not influence food intake or body weight of the flies. It increased the life span and locomotor activities of male flies but was associated with early mortality and decreased locomotor activity of female flies. We conclude that the observed anti-aging effects of L. edodes extracts in the male D. melanogaster are not the result of dietary restriction. We propose that D. melanogaster is a suitable model organism for researching the molecular basis of the anti-aging effect of the shiitake mushroom extracts and sex linkage of these effects.

  16. The Anti-Inflammatory Effects of Lion's Mane Culinary-Medicinal Mushroom, Hericium erinaceus (Higher Basidiomycetes) in a Coculture System of 3T3-L1 Adipocytes and RAW264 Macrophages. (United States)

    Mori, Koichiro; Ouchi, Kenji; Hirasawa, Noriyasu


    Chronic low-grade inflammation in the adipose tissue accompanying obesity is thought to be an underlying driver of metabolic diseases. In this study, we aimed to investigate the efficacy of Hericium erinaceus on adipose tissue inflammation. The anti-inflammatory effects of the ethyl acetate soluble fraction of H. erinaceus (EAHE) were examined using cocultures of 3T3-L1 adipocytes and RAW264 macrophages. EAHE significantly suppressed tumor necrosis factor (TNF)-α and interleukin (IL)-6 production in cultured RAW264 macrophages stimulated by lipopolysaccharide (LPS). EAHE also caused notable inhibition of c-Jun N-terminal kinase (JNK) activation, which is thought to be involved in the suppression of proinflammatory cytokines by EAHE. In a coculture system with 3T3-L1 and RAW264 cells stimulated with LPS, EAHE reduced TNF-α and IL-6 concentrations in the conditioned medium and lowered the gene expression levels of these cytokines in 3T3-L1 adipocytes. Furthermore, EAHE suppressed the LPS-induced reduction of adiponectin mRNA levels in 3T3-L1 adipocytes cocultured with RAW264 macrophages. However, in 3T3-L1 adipocytes cultured alone, the concentration of LPS used in this study did not affect the gene expression levels of these adipokines. We attributed the anti-inflammatory effects of EAHE on 3T3-L1 adipocytes cocultured with RAW264 macrophages to the suppression of Toll-like receptor 4 (TLR4) signaling and subsequent proinflammatory cytokine secretion in RAW264 cells. Our findings indicate the possibility that H. erinaceus exerts anti-inflammatory effects on macrophages through the inhibition of TLR4-JNK signaling and prevents or ameliorates adipose tissue inflammation associated with obesity.

  17. Lion's Mane, Hericium erinaceus and Tiger Milk, Lignosus rhinocerotis (Higher Basidiomycetes) Medicinal Mushrooms Stimulate Neurite Outgrowth in Dissociated Cells of Brain, Spinal Cord, and Retina: An In Vitro Study. (United States)

    Samberkar, Snehlata; Gandhi, Sivasangkary; Naidu, Murali; Wong, Kah-Hui; Raman, Jegadeesh; Sabaratnam, Vikineswary


    Neurodegenerative disease is defined as a deterioration of the nervous system in the intellectual and cognitive capabilities. Statistics show that more than 80-90 million individuals age 65 and above in 2050 may be affected by neurodegenerative conditions like Alzheimer's and Parkinson's disease. Studies have shown that out of 2000 different types of edible and/or medicinal mushrooms, only a few countable mushrooms have been selected until now for neurohealth activity. Hericium erinaceus is one of the well-established medicinal mushrooms for neuronal health. It has been documented for its regenerative capability in peripheral nerve. Another mushroom used as traditional medicine is Lignosus rhinocerotis, which has been used for various illnesses. It has been documented for its neurite outgrowth potential in PC12 cells. Based on the regenerative capabilities of both the mushrooms, priority was given to select them for our study. The aim of this study was to investigate the potential of H. erinaceus and L. rhinocerotis to stimulate neurite outgrowth in dissociated cells of brain, spinal cord, and retina from chick embryo when compared to brain derived neurotrophic factor (BDNF). Neurite outgrowth activity was confirmed by the immu-nofluorescence method in all tissue samples. Treatment with different concentrations of extracts resulted in neuronal differentiation and neuronal elongation. H. erinaceus extract at 50 µg/mL triggered neurite outgrowth at 20.47%, 22.47%, and 21.70% in brain, spinal cord, and retinal cells. L. rhinocerotis sclerotium extract at 50 µg/mL induced maximum neurite outgrowth of 20.77% and 24.73% in brain and spinal cord, whereas 20.77% of neurite outgrowth was observed in retinal cells at 25 µg/mL, respectively.

  18. Books received by the Rijksherbarium library

    NARCIS (Netherlands)



    A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well

  19. 26 - 30 Kutama

    African Journals Online (AJOL)


    wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).

  20. In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood. (United States)

    Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S


    The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.

  1. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.


    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

  2. Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador. (United States)

    Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A


    Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.

  3. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  4. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.


    Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  5. 782-IJBCS-Article-Rose Masalu

    African Journals Online (AJOL)


    Cantharellus miomboensis is a new basidiomycete fungus recently found in Miombo woodlands in. Tanzania. .... bacterial and fungal contamination and ..... functions of secondary metabolites. In ... metabolites from marine actinomycetes. Curr.

  6. Books received by the Rijksherbarium library

    NARCIS (Netherlands)



    Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

  7. Bioleaching of copper, aluminum, magnesium and manganese from ...

    African Journals Online (AJOL)



    Sep 12, 2011 ... Takao screened organic acid producing strains of basidiomycetes and found that oxalic acid was the main acid along with citric and tartaric acid. .... process by using nitric acid and hydrogen peroxide. Statistical analysis.

  8. 12038_2016_9614_Article_print 265..275

    Indian Academy of Sciences (India)


    May 13, 2016 ... The stimulatory effect of the aqueous extract of G. lucidum, a basidiomycetes class fungus ... activity of GL extract was observed through the inhibition of ...... ides and its effect on antioxidant enzymes and immunity activities in.

  9. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  10. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC No. 2a, isolated from mangrove wood

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.

    Carbon and nitrogen sources in the growth medium play an important role in the production of lignin-degrading enzymes in the white-rot basidiomyceteous fungi. The role of nutrient nitrogen sources in growth media on production of lignin...

  11. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  12. octadecenoic acid in tomato

    African Journals Online (AJOL)


    bly involved in plant defense responses is synthesized in tomato fruits and subjected to metabo- lism. Its catabolism or .... stored at -20°C. Enzymatic in vitro synthesis of radiolabeled ..... with nematicidal activity from Culture of basidiomycetes.

  13. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J


    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  14. Formation and cell wall regeneration of protoplasts from Schizophyllum commune

    NARCIS (Netherlands)

    de Vries, Onno Minne Hotze


    Osmotically sensitive protoplasts were released from the mycelium of the basidiomycete Schizophyllum commune through the action ofan extracellular enzyme preparation isolated from the culture filtrate of Trichoderma viride (recently renamed T. harzianum) grown on hyphal walls of the former organism.

  15. Characterization and cultivation of a wild mushroom species isolated in Brazil
    Caracterização e cultivo de uma espécie de cogumelo silvestre isolado no Brasil


    Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki


    Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...

  16. Decolorization of six synthetic dyes by fungi


    Hartikainen, E. Samuel; Miettinen, Otto; Hatakka, Annele; Kähkönen, Mika A.


    To find out ability of fourteen basidiomycetes and four ascomycetes strains to grow in the presence of synthetic colour dyes and to degrade them, fungi were cultivated on the malt agar plates containing 0.5 g kg-1 dye, either Remazol Brilliant Blue R, Remazol Brilliant Yellow GL, Remazol Brilliant Orange 3 R, Reactive Blue 4, Remazol Brilliant Red F3B or Reactive Black 5. Fungi representing basidiomycetes were Phlebia radiata (FBCC 43), Tremella encephala (FBCC 1145), Dichomitus squalens (FBC...

  17. Effect of Trichoderma-enriched organic charcoal in the integrated wood protection strategy.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The gradual elimination of chromium from wood preservative formulations results in higher Cu leaching and increased susceptibility to wood decay fungi. Finding a sustainable strategy in wood protection has become of great interest among researchers. The objective of these in vitro studies was to demonstrate the effect of T-720-enriched organic charcoal (biochar against five wood decay basidiomycetes isolated from strongly damaged poles. For this purpose, the antagonistic potential of Trichoderma harzianum (strain T-720 was confirmed among other four Trichoderma spp. against five brown-rot basidiomycetes in dual culture tests. T-720 was genetically transformed and tagged with the green fluorescent protein (GFP in order to study its antagonistic mechanism against wood decay basidiomycetes. It was also demonstrated that T-720 inhibits the oxalic acid production by basidiomycetes, a well-known mechanism used by brown-rot fungi to detoxify Cu from impregnated wood. Additionally, this study evaluated the effect of biochar, alone or in combination with T-720, on Cu leaching by different preservatives, pH stabilization and prevention of wood decay caused by five basidiomycetes. Addition of biochar resulted in a significant Cu binding released from impregnated wood specimens. T-720-enriched biochar showed a significant reduction of wood decay caused by four basidiomycetes. The addition of T-720-enriched biochar to the soil into which utility poles are placed may improve the efficiency of Cr-free wood preservatives.

  18. Gelatinomyces conus sp. nov. (Ascomycota, Leotiomycetes: a new bambusicolous fungal species from North-East India

    Directory of Open Access Journals (Sweden)

    Vipin Parkash


    Full Text Available This study represents a newly discovered and described macro-fungal species under family Leotiomycetes (Ascomycota named as Gelatinomyces conus sp. nov. The fungal species was collected from decayed bamboo material (leaves, culms and branches during the survey in Upper Assam, India. It looks like a pine-cone with gelatinous ascostroma. The asci are thin-walled and arise in scattered discoid apothecia which are aggregated and clustered to form round gelatinous structure on decayed bamboo material. The study also brings the first record of fungal species from north east region of India. A taxonomic description, illustrations and isolation and culture of Gelatinomyces conus sp. nov. are provided in this study.

  19. A new representative of star-shaped fungi: Astraeus sirindhorniae sp. nov. from Thailand. (United States)

    Phosri, Cherdchai; Watling, Roy; Suwannasai, Nuttika; Wilson, Andrew; Martín, María P


    Phu Khieo Wildlife Sanctuary (PKWS) is a major hotspot of biological diversity in Thailand but its fungal diversity has not been thouroughly explored. A two-year macrofungal study of this remote locality has resulted in the recognition of a new species of a star-shaped gasteroid fungus in the genus Astraeus. This fungus has been identified based on a morphological approach and the molecular study of five loci (LSU nrDNA, 5.8S nrDNA, RPB1, RPB2 and EF1-a). Multigene phylogenetic analysis of this new species places it basal relative to other Astraeus, providing additional evidence for the SE Asian origin of the genus. The fungus is named in honour of Her Majesty Princess Sirindhorn on the occasion the 84th birthday of her father, who have both been supportive of natural heritage studies in Thailand.

  20. Hugo and Russell's pharmaceutical microbiology

    National Research Council Canada - National Science Library

    Denyer, S. P; Hugo, W. B


    ... Publishing was acquired by John Wiley & Sons in February 2007. Blackwell's publishing program has been merged with Wiley's global Scientific, Technical and Medical business to form Wiley-Blackwel...

  1. Uusi raamatuid : a companion to the history of the book

    Index Scriptorium Estoniae


    Tutvustus: A companion to the history of the book / edited by Simon Eliot and Jonathan Rose. - Malden, MA : Blackwell Pub., 2007. - xvi, 599 lk. : ill. - (Blackwell companions to literature and culture ; 48)

  2. Organizational Behaviour in Construction

    DEFF Research Database (Denmark)

    Kreiner, Kristian


    Review of: Organizational Behaviour in Construction / Anthony Walker (Wiley-Blackwell,2011 336 pp)......Review of: Organizational Behaviour in Construction / Anthony Walker (Wiley-Blackwell,2011 336 pp)...

  3. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa. (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa


    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.


    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  5. Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie. (United States)

    Kozar, F; MacDonald, B R; Weijer, J


    The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.

  6. Antibiotics in the chemical communication of fungi. (United States)

    Kettering, Melanie; Sterner, Olov; Anke, Timm


    In dual cultures Oudemansiella mucida and Xerula melanotricha (basidiomycetes) react to the presence of living Penicillium notatum or P. turbatum with an increased production of strobilurin A (1) or X (2). P. notatum in turn reacts to the two basidiomycetes or their antibiotic strobilurin A alone with the production of N-(2-hydroxypropanoyl)-2-aminobenzoic acid amide (3) or chrysogine (4). P. melinii and P. urticae overgrow O. mucida due to complete resistance to strobilurin A. P. brevicompactum, P. citrinum, P. janczewskii and the other Penicillium strains are all sensitive but apparently do not induce O. mucida to produce the amounts of strobilurin A needed to inhibit their growth.

  7. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.


    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  8. [Characterization of an extracellular glycolipid from Lentinus edodes (Berk.) Sing [Lentinula edodes (Berk.) Pegler (United States)

    Tsivileva, O M; Nikitina, V E; Makarov, O E


    Submerged mycelium of a xylotrophic basidiomycete Lentinus edodes produces an extracellular glycolipid, S3, associated with a lectin. Galactose glycan residue, as well as the lipid pool composition, which includes nonhydroxylated short-chain fatty acids, is uncommon for basidiomycetes. The glycolipid consists of D-galactopyranose (15% of S3 contains galactose sulfate) acylated by octadecanoic and nonadecanoic fatty acid residues (28 and 72%, respectively). The glycolipid structure and composition are confirmed by physicochemical analysis. The glycolipid is assumed to be a regulator of lectin activity.

  9. Mycorrhizal fungi of aspen forests: Natural occurrence and potential applications (United States)

    Cathy L. Cripps


    Native mycorrhizal fungi associated with aspen were surveyed on three soil types in the north-central Rocky Mountains. Selected isolates were tested for the ability to enhance aspen seedling growth in vitro. Over 50 species of ectomycorrhizal fungi occur with Populus tremuloides in this region, primarily basidiomycete fungi in the Agaricales. Almost one-third (30%)...

  10. Global warming and mycoflora in the Baltic Region

    Directory of Open Access Journals (Sweden)

    Hanns Kreisel


    Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.

  11. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.


    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  12. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    DEFF Research Database (Denmark)

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter


    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

  13. Novel mandibular gland volatiles from Apterostigma ants

    DEFF Research Database (Denmark)

    Hogan, Conor T.; Jones, Tappey H.; Zhukova, Mariya


    The fungus-farming ants are a well-studied evolutionary radiation within the subfamily Myrmicinae that associate with a web of symbionts that span kingdoms. Members of the Apterostigma pilosum species group cultivate unique basidiomycete fungi belonging to the coral-mushroom family Pterulaceae...

  14. On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune

    NARCIS (Netherlands)

    Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.


    Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this

  15. Molecular identification, genetic diversity, population genetics and genomics of Rhizoctonia solani. In:perspective of plant pathology in genomic era (United States)

    The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...

  16. Phylogenetic position and physiology of Cerinosterus cyanescens

    NARCIS (Netherlands)

    Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.


    Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

  17. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer


    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  18. Clonality and α-a recombination in the Australian Cryptococcus gattii VGII population - an emerging outbreak in Australia

    NARCIS (Netherlands)

    Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland


    Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the

  19. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.


    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
    decaying plant material in forests and grasslands of North America and Europe. It degrades forest
    litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

  20. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.


    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  1. Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

    NARCIS (Netherlands)

    Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko


    The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

  2. [First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile]. (United States)

    Madrid Lorca, Hugo; Muñoz, Mélica


    Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.

  3. Moniliophthora roreri Genome and Transcriptome (United States)

    Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...

  4. Elevated tropospheric CO2 and O3 may not alter initial wood decomposition rate or wood-decaying fungal community composition of Northern hardwoods (United States)

    Emmanuel Ebanyenle; Andrew J. Burton; Andrew J. Storer; Dana L. Richter; Jessie A. Glaeser


    We examined the effects of elevated CO2 and/or O3 on the wood-decaying basidiomycete fungal community and wood decomposition rates at the Aspen Free-Air CO2 and O3 Enrichment (Aspen FACE) project. Mass loss rates were determined after one year of log decomposition on the soil...

  5. Fungal Systematics and Evolution: FUSE 3

    NARCIS (Netherlands)

    Krisai-Greilhuber, Irmgard; Chen, Yun; Jabeen, Sana; Madrid, Hugo; Marincowitz, Seonju; Razaq, Abdul; Sevcíková, Hana; Voglmayr, Hermann; Yazici, Kenan; Aptroot, André; Aslan, Ali; Boekhout, T.; Borovicka, Jan; Crous, P.W.; Ilyas, Sobia; Jami, Fahimeh; Jiang, Yu-Lan; Nasir Khalid, Abdul; Kolecka, Anna; Konvalinková, Tereza; Norphanphoun, Chada; Shaheen, Shabnum; Wang, Yong; Wingfield, Michael J.; Wu, Shi-Ping; Wu, Yue-Ming; Yu, Jie-Ying


    The present study introduces seven new species, one new combination, one new variety and several interesting taxonomical notes and/or geographical records. Most of the new taxa are Ascomycetes, but the study also includes a new variety of a Basidiomycete. Novel species include Gyromitra

  6. Novel Phialophora species from leaf-cutting ants (tribe Attini)

    NARCIS (Netherlands)

    Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.


    Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

  7. Bio-softening of mature coconut husk for facile coir recovery. (United States)

    Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S


    Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

  8. A potential role for an extracellular methanol oxidase secreted by Moniliophthora perniciosa in Witches' broom disease in cacao (United States)

    The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...

  9. Identification and first report of Inonotus (Phellinus) tropicalis as an etiologic agent in a patient with chronic granulomatous disease (United States)

    D.A. Sutton; E.H. Thompson; M.G. Rinaldi; P.C. Iwen; K.K. Nakasone; H.S. Jung; H.M. Rosenblatt; M.E. Paul


    Although isolates of filamentous basidiomycetes can usually be recognized in a clinical laboratory setting, identification is problematic, as they seldom exhibit diagnostic morphological features formed in nature. This paper is the first report of Inonotus (Phellinus ) tropicalis inciting human disease and describes the methods used to support the identification.

  10. Fungal Systematics and Evolution: FUSE 2

    NARCIS (Netherlands)

    Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.


    The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature

  11. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.


    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  12. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    DEFF Research Database (Denmark)

    Aanen, Duur K; Ros, Vera I D; de Fine Licht, Henrik H


    BACKGROUND: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species di...

  13. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    NARCIS (Netherlands)

    Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.


    Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species

  14. The genus Actiniceps Berk. & Br

    NARCIS (Netherlands)

    Boedijn, K.B.


    The genus Actiniceps Berk. & Br. is shown to be a Basidiomycete. Wiesnerina Höhn. and Dimorphocystis Corner are regarded synonymous. The type species A. thwaitesii Berk. & Br. is redescribed with D. capitatus Corner as synonym. The following new combinations are proposed: A. horrida (Höhn.) Boedijn,

  15. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila


    Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015

  16. Temporal Alterations in the Secretome of the Selective Ligninolytic Fungus Ceriporipsis subvermispora during growth on Aspen Wood Reveal this Organism's Strategy for Degrading Lighnocellulose (United States)

    Chiaki Hori; Jill Gaskell; Kiyohiko Igarashi; Phil Kersten; Michael Mozuch; Masahiro Samejima; Dan Cullen


    The white-rot basidiomycetes efficiently degrade all wood cell wall polymers. Generally, these fungi simultaneously degrade cellulose and lignin, but certain organisms, such as Ceriporiopsis subvermispora, selectively remove lignin in advance of cellulose degradation. However, relatively little is known about themechanismof selective ligninolysis. To...

  17. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.


    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  18. First report of frosty pod rot caused by Moniliophthora roreri on cacao in Bolivia (United States)

    Frosty pod rot (FPR) is a devastating cacao disease caused by the basidiomycete Moniliophthora roreri (Aime and Phillips-Mora, 2005). The disease is confined to 13 countries in Central and South America and constitutes a permanent threat for cacao cultivation worldwide. In July 2012, FPR was detect...





    In a screening of Basidiomycete cultures isolated from marine invertebrates collected along the Chilean coastline for the production of antibiotics we identified a Penicillium brevicompactum strain as a producer of metabolites inhibiting the growth of bacteria and fungi. Bioactivity guided purification resulted in the isolation of four known metabolites. Their structures were elucidated by spectroscopic methods.

  20. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis (United States)

    Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen


    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...


    NARCIS (Netherlands)


    Chromosomal DNAs of the basidiomycete Schizophyllum commune were separated by Contour-Clamped Homogeneous Electric Field Electrophoresis (CHEF). The estimated sizes of the chromosomal DNAs ranged from 4.7 Megabase pairs (Mbp) to 1.6 Mbp, totalling 35.6 Mbp. Using sequences from 20 cloned genes we

  2. Epidemiologische trends in cryptokokkose : De Cryptococcus gattii-uitbraak in Canada

    NARCIS (Netherlands)

    Hagen, F; Boekhout, T


    Cryptococcosis is, when untreated, a fatal disease, which in the Netherlands is mainly caused by the basidiomycetous yeast Cryptococcus neoformans, and in more rare cases by Cryptococcus gattii. Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans has a

  3. Two yeast species Cystobasidium psychroaquaticum f.a. sp. nov. and Cystobasidium rietchieii f.a. sp. nov. isolated from natural environments, and the transfer of Rhodotorula minuta clade members to the genus Cystobasidium

    NARCIS (Netherlands)

    Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D

    Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic

  4. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.


    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  5. Enzyme activities of fungi associated with Picea abies needles

    Czech Academy of Sciences Publication Activity Database

    Žifčáková, Lucia; Dobiášová, Petra; Kolářová, Zuzana; Koukol, O.; Baldrian, Petr


    Roč. 4, č. 6 (2011), s. 427-436 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA ČR GA526/08/0751 Institutional research plan: CEZ:AV0Z50200510 Keywords : Ascomycetes * Decomposition * Basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  6. Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

    African Journals Online (AJOL)

    The white-rot, basidiomycete fungus, Phanerochaete chrysosporium, has attracted .... with Congo red (1 mg/ml) solution, incubated at room temperature for 15 min and washed several times with sterile 1 .... white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis and regulation of differential expression.

  7. Proteomic and functional analysis of the cellulase system expressed by Postia placenta during brown rot of solid wood (United States)

    Jae San Ryu; Semarjit Shary; Carl J. Houtman; Ellen A. Panisko; Premsagar Korripally; Franz J. St. John; Casey Crooks; Matti Siika-aho; Jon K. Magnuson; Kenneth E. Hammel


    Brown rot basidiomycetes have an important ecological role in lignocellulose recycling and are notable for their rapid degradation of wood polymers via oxidative and hydrolytic mechanisms. However, most of these fungi apparently lack processive (exo-acting) cellulases, such as cellobiohydrolases, which are generally required for efficient cellulolysis. The recent...

  8. Comparative transcriptome and secretome analysis of wood decay fungi Postia placenta and Phanerochaete chrysosporium (United States)

    Amber J. Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D Mansfield; Robert A. Blanchette; Diego Martinez; Igor Grigoriev; Philip J Kersten; Daniel Cullen


    Cellulose degradation by brown rot fungi, such as Postia placenta, is poorly understood relative to the phylogenetically related white rot basidiomycete, Phanerochaete chrysosporium. To elucidate the number, structure, and regulation of genes involved in lignocellulosic cell wall attack, secretome and transcriptome analyses were performed on both wood decay fungi...


    NARCIS (Netherlands)


    Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted

  10. The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.


    Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median


    NARCIS (Netherlands)


    Fungi typically grow by apical extension of hyphae that penetrate moist substrates. After establishing a branched feeding mycelium, the hyphae differentiate and grow away from the substrate into the air where they form various structures such as aerial hyphae and mushrooms. In the basidiomycete


    NARCIS (Netherlands)



    The spontaneous and recessive mutation thn in the basidiomycete Schizophyllum commune suppresses the formation of aerial hyphae in the monokaryon and, if present as a double dose, the formation of both aerial hyphae and fruit-bodies in the dikaryon. In the monokaryon, the mutation prevents

  13. The SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in the absence of the SC3 hydrophobin

    NARCIS (Netherlands)

    Lugones, L G; de Jong, J F; de Vries, O M H; Jalving, R; Dijksterhuis, J; Wösten, H A B

    Disruption of the SC3 gene in the basidiomycete Schizophyllum commune affected not only formation of aerial hyphae but also attachment to hydrophobic surfaces. However, these processes were not completely abolished, indicating involvement of other molecules. We here show that the SC15 protein

  14. Bioconcentration of manganese and iron in Panaeoloideae Sing

    NARCIS (Netherlands)

    Stijve, T.; Blake, C.


    According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae,

  15. Uncovering the abilities of Agaricus bisporus to degrade plant biomass throughout its life cycle

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, M.; Jurak, E.; Heck, A.J.R.; Hilden, K.S.; Kabel, M.A.; Makela, M.R.; Altenaar, M.A.F.; Vries, de R.P.


    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and con-tributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  16. A New Perspective on Radiation Resistance Based on Deinococcus radiodurans (United States)


    tolerate 3,000–5000 Gy, but are rendered sterile. As a haploid, the basidiomycete fungus Ustilago maydis carries a single set of chromosomes per...salinarum NRC-1. Environ. Microbiol. 5 Jan 2009 (doi:10.1111/j.1462-2920.2008.01828.x). 21. Chan, H. L. et al. Proteomic analysis of UVC irradiation

  17. Enzymology and molecular biology of lignin degradation (United States)

    D. Cullen; P.J. Kersten


    This review provides an overview of the physiology and genetics of lignin degradation by white rot basidiomycetes. Emphasis is on recent advances and the reader is referred to earlier comprehensive reviews for historical perspective and background (Kirk and Farrell 1987; Gold and Alic 1993; Higuchi 1993; Cullen and Kersten 1996; Cullen 1997). Recent completion of a...

  18. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.


    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...

  19. Author Details

    African Journals Online (AJOL)

    Goud, MJP. Vol 2, No 3 (2007) - Articles Antibacterial activity and biomolecular composition of certain fresh water micro-algae from River Godavari (India) Abstract PDF · Vol 3, No 1 (2008) - Articles Replica plate screening method for detecting phosphatase activity in basidiomycetes using 1-Napthyl Phosphate as a ...

  20. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood (United States)

    Chiaki Hori; Takuya Ishida; Kiyohiko Igarashi; Masahiro Samejima; Hitoshi Suzuki; Emma Master; Patricia Ferreira; Francisco J. Ruiz-Duenas; Benjamin Held; Paulo Canessa; Luis F. Larrondo; Monika Schmoll; Irina S. Druzhinina; Christian P. Kubicek; Jill A. Gaskell; Phil Kersten; Franz St. John; Jeremy Glasner; Grzegorz Sabat; Sandra Splinter Bondurant; Khajamohiddin Syed; Jagjit Yadav; Anthony C. Mgbeahuruike; Andriy Kovalchuk; Fred O. Asiegbu; Gerald Lackner; Dirk Hoffmeister; Jorge Recoret; Ana Gutierrez; Hui Sun; Erika Lindquist; Kerrie Barry; Robert Riley; Igor V. Grigoriev; Bernard Henrissat; Ursula Kues; Randy M. Berka; Angel T. Martinez; Sarah F. Covert; Robert A. Blanchette; Daniel Cullen


    Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other...

  1. Transcriptome and secretome analyses of the wood decay fungus Wolfiporia cocos support alternative mechanisms of lignocellulose conversion (United States)

    Jill Gaskell; Robert A. Blanchette; Philip E. Stewart; Sandra Splinter BonDurant; Marie Adams; Grzegorz Sabat; Philip Kersten; Daniel Cullen


    Certain wood decay basidiomycetes, collectively referred to as brown rot fungi, rapidly depolymerize cellulose while leaving behind the bulk of cell wall lignin as a modified residue. The mechanism(s) employed is unclear, but considerable evidence implicates the involvement of diffusible oxidants generated via Fenton-like chemistry. Toward a better understanding of...

  2. Significant alteration of gene expression in wood decay fungi Postia placenta and Phanerochaete chrysosporium by plant species (United States)

    Amber Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Sandra Splinter BonDurant; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Igor Grigoriev; Philip J. Kersten; Daniel Cullen


    Identification of specific genes and enzymes involved in conversion of lignocellulosics from an expanding number of potential feedstocks is of growing interest to bioenergy process development. The basidiomycetous wood decay fungi Phanerochaete chrysosporium and Postia placenta are promising in this regard because they are able to utilize a wide range of simple and...

  3. A rare case of urinary tract infection due to Trichosporonasahii in a ...

    African Journals Online (AJOL)

    Trichosporonasahii is a basidiomycete yeast responsible for white piedra and onychomycosis in the immunocompetent host. In the immunocompromised patients, invasive infections are reported; their diagnosis is difficult and they are associated with high mortality rate. Urinary infection due to Trichosporon Asahi is rare but ...

  4. Cultural characteristics, sexuality and ligninolytic enzyme production of Trametes cervina

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav


    Roč. 25, č. 1 (2004), s. 49-55 ISSN 0181-1584 R&D Projects: GA ČR GA526/02/1216 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * trametes * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.250, year: 2004

  5. Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879 (United States)

    Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia


    Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839

  6. Long-term Maintenance of Fungal Cultures on Perlite in Cryovials – an Alternative for Agar Slants

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila


    Roč. 53, č. 6 (2008), s. 534-536 ISSN 0015-5632 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete * perlite * long-term maintenance Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  7. Draft genome sequence of the white-rot fungus Obba rivulosa 3A-2 (United States)

    Otto Miettinen; Robert Riley; Kerrie Barry; Daniel Cullen; Ronald P. de Vries; Matthieu Hainaut; Annele Hatakka; Bernard Henrissat; Kristiina Hilden; Rita Kuo; Kurt LaButti; Anna Lipzen; Miia R. Makela; Laura Sandor; Joseph W. Spatafora; Igor V. Grigoriev; David S. Hibbett


    We report here the first genome sequence of the white-rot fungus Obba rivulsa (Polyporales, Basidiomycota), a polypore known for its lignin-decomposing ability. The genome is based on the homokaryon 3A-2 originating in Finland. The genome is typical in size and carbohydrate active enzyme (CAZy) content for wood-decomposing basidiomycetes.

  8. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.


    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  9. Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation

    DEFF Research Database (Denmark)

    Sitarz, Anna Katarzyna; Mikkelsen, Jørn Dalgaard; Højrup, Peter


    Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt...

  10. Purification, molecular cloning, and enzymatic properties of a family 12 endoglucanase (EG-II) from fomitopsis palustris: role of EG-II in larch holocellulose hydrolysis. (United States)

    Shimokawa, Tomoko; Shibuya, Hajime; Nojiri, Masanobu; Yoshida, Shigeki; Ishihara, Mitsuro


    A family 12 endoglucanase with a molecular mass of 23,926 Da (EG-II) from the brown-rot basidiomycete Fomitopsis palustris was purified and characterized. One of the roles of EG-II in wood degradation is thought to be to loosen the polysaccharide network in cell walls by disentangling hemicelluloses that are associated with cellulose.

  11. Humic Acid-Like Material from Sewage Sludge Stimulates Culture Growth of Ectomycorrhizal Fungi in Vitro

    Czech Academy of Sciences Publication Activity Database

    Hršelová, Hana; Soukupová, Lucie; Gryndler, Milan


    Roč. 52, č. 6 (2007), s. 627-630 ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540 Institutional research plan: CEZ:AV0Z50200510 Keywords : ectomycorrhizal basidiomycetes * sewage sludge * humic-acid-like materials Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

  12. Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake


    Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana


    The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

  13. Taxonomic studies in Chrysoderma, Corneromyces, Dendrophsellum, Hyphoradulum, and Mycobonia (United States)

    Karen K. Nakasone


    Eight poorly known or unusual crustose and pileate basidiomycete species were studied. These included the type specimens of three monotypic genera: Chrysoderma alboluteum from Réunion is conspecific with Cerocorticium molle; Dendrophysellum amurense from the Russian Far East is a species of Vararia; and ...

  14. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  15. Functional foods from mushroom (United States)

    Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...

  16. On the possible role of macrofungi in the biogeochemical fate of uranium in polluted forest soils

    Energy Technology Data Exchange (ETDEWEB)

    Kubrová, Jaroslava [Institute of Geochemistry, Mineralogy and Mineral Resources, Faculty of Science, Charles University, Albertov 6, CZ-12843 Prague 2 (Czech Republic); Nuclear Physics Institute, v.v.i., Academy of Sciences of the Czech Republic, Husinec–Řež 130, CZ-25068 Řež near Prague (Czech Republic); Žigová, Anna [Institute of Geology, v.v.i., Academy of Sciences of the Czech Republic, Rozvojová 269, CZ-16500 Prague 6 (Czech Republic); Řanda, Zdeněk [Nuclear Physics Institute, v.v.i., Academy of Sciences of the Czech Republic, Husinec–Řež 130, CZ-25068 Řež near Prague (Czech Republic); Rohovec, Jan [Institute of Geology, v.v.i., Academy of Sciences of the Czech Republic, Rozvojová 269, CZ-16500 Prague 6 (Czech Republic); Gryndler, Milan [Institute of Microbiology, v.v.i., Academy of Sciences of the Czech Republic, Vídeňská 1083, CZ-142 20 Prague 4 (Czech Republic); Krausová, Ivana [Nuclear Physics Institute, v.v.i., Academy of Sciences of the Czech Republic, Husinec–Řež 130, CZ-25068 Řež near Prague (Czech Republic); Dunn, Colin E. [8756 Pender Park Drive, Sidney, BC, V8L 3Z5 Canada (Canada); Kotrba, Pavel [Department of Biochemistry and Microbiology, Institute of Chemical Technology, Prague, Technická 3, CZ-166 28 Prague 6 (Czech Republic); and others


    Highlights: • Uranium is not accumulated in ectomycorrhizal and saprotrophic macrofungi. • Uranium is not accumulated in ectomycorrhizal roots of Picea abies. • Accumulation of metals in macrofungi does not depend on their fractionation in soils. - Abstract: Interactions of macrofungi with U, Th, Pb and Ag were investigated in the former ore mining district of Příbram, Czech Republic. Samples of saprotrophic (34 samples, 24 species) and ectomycorrhizal (38 samples, 26 species) macrofungi were collected from a U-polluted Norway spruce plantation and tailings and analyzed for metal content. In contrast to Ag, which was highly accumulated in fruit-bodies, concentrations of U generally did not exceed 3 mg/kg which indicates a very low uptake rate and efficient exclusion of U from macrofungi. In ectomycorrhizal tips (mostly determined to species level by DNA sequencing), U contents were practically identical with those of the non-mycorrhizal fine spruce roots. These findings suggest a very limited role of macrofungi in uptake and biotransformation of U in polluted forest soils. Furthermore, accumulation of U, Th, Pb and Ag in macrofungal fruit-bodies apparently does not depend on total content and chemical fractionation of these metals in soils (tested by the BCR sequential extraction in this study)

  17. On the possible role of macrofungi in the biogeochemical fate of uranium in polluted forest soils

    International Nuclear Information System (INIS)

    Kubrová, Jaroslava; Žigová, Anna; Řanda, Zdeněk; Rohovec, Jan; Gryndler, Milan; Krausová, Ivana; Dunn, Colin E.; Kotrba, Pavel


    Highlights: • Uranium is not accumulated in ectomycorrhizal and saprotrophic macrofungi. • Uranium is not accumulated in ectomycorrhizal roots of Picea abies. • Accumulation of metals in macrofungi does not depend on their fractionation in soils. - Abstract: Interactions of macrofungi with U, Th, Pb and Ag were investigated in the former ore mining district of Příbram, Czech Republic. Samples of saprotrophic (34 samples, 24 species) and ectomycorrhizal (38 samples, 26 species) macrofungi were collected from a U-polluted Norway spruce plantation and tailings and analyzed for metal content. In contrast to Ag, which was highly accumulated in fruit-bodies, concentrations of U generally did not exceed 3 mg/kg which indicates a very low uptake rate and efficient exclusion of U from macrofungi. In ectomycorrhizal tips (mostly determined to species level by DNA sequencing), U contents were practically identical with those of the non-mycorrhizal fine spruce roots. These findings suggest a very limited role of macrofungi in uptake and biotransformation of U in polluted forest soils. Furthermore, accumulation of U, Th, Pb and Ag in macrofungal fruit-bodies apparently does not depend on total content and chemical fractionation of these metals in soils (tested by the BCR sequential extraction in this study)

  18. Three hitherto unreported macro-fungi from Kashmir Himalaya

    International Nuclear Information System (INIS)

    Pala, S.A.; Wana, A.H.; Boda, R.H.


    The Himalayan state, Jammu and Kashmir due to its climate ranging from tropical deciduous forests to temperate and coniferous forests provides congenial habitat for the growth of diverse macro fungal species which in turn gives it the status of 'hub' of macro-fungal species. The macro fungal species richness of the state is directly related to its expansive forest communities and diverse weather patterns, but all the regions of the state have not been extensively surveyed till now. In this backdrop, a systematic survey for exploration and inventorization of macro fungal species of Western Kashmir Himalaya was undertaken during the year 2009 and 2010, which in turn resulted identification of the three species viz., Thelephora caryophyllea (Schaeff.) Pers., Coltricia cinnamomea (Pers.) Murr., and Guepinia helvelloides Fr. as new reports from the Kashmir. These species were identified on the basis of macro and microscopic characters and also the aid of taxonomic keys, field manuals, mushroom herbaria and help from expert taxonomists in the related field was taken into account. (author)

  19. A preliminary checklist of macrofungi of Guatemala, with notes on edibility and traditional knowledge

    Directory of Open Access Journals (Sweden)

    Flores Arzú R


    Full Text Available Despite its biological wealth, current knowledge on the macromycetes inhabiting Guatemala is scant, in part because of the prolonged civil war that has prevented exploration of many ecological niches. We provide a preliminary literature–based checklist of the macrofungi occuring in the various ecological regions of Guatemala, supplemented with original observations reported here for the first time. Three hundred and fifty species, 163 genera, and 20 orders in the Ascomycota and Basidiomycota have been reported from Guatemala. Many of the entries pertain to ectomycorrhizal fungal species that live in symbiosis with the several Pinus and Quercus species that form the extensive pine and mixed forests of the highlands (up to 3600 m a.s.l.. As part of an ongoing study of the ethnomycology of the Maya populations in the Guatemalan highlands, we also report on the traditional knowledge about macrofungi and their uses among native people. These preliminary data confirm the impression that Guatemala hosts a macrofungal diversity that is by no means smaller than that recorded in better studied neighboring Mesoamerican areas, such as Mexico and Costa Rica.

  20. The immobilization of filamentous fungi by cellular adherence and surface film growth on radiopolymerized hydrogels

    International Nuclear Information System (INIS)

    Petre, M.; Zarnea, G.; Adrian, P.; Gheorghiu, E.; Gheordunescu, V.


    The continuous biodegradation processes of cellulose wastes, from wine-producing industry and canned food processing were performed using immobilized fungal cells on complex polyhydrogels such as: collagen-polyacrylamide (CPAA), elastin-polyacrylamide (EPAA), gelatin-polyacrylamide (GPAA) and poly-hydroxy-ethyl-methyl-methacrylate (PHEMA) which were prepared by experimental radiopolymerization methods using a 60 Co radioactive source. The experiments were performed using cellulolytic micro- and macrofungal species and the immobilization methods were applied in connection with morphogenetic characteristics of each one of these species that were used as inoculum. A flow-cascade bioreactor was achieved as a research laboratory tool in order to control the cellulose waste biodegradation in continuous processes using immobilized fungal cells on complex polyhydrogels. In this way the continuous control was possible for fungal metabolic activity during the cellulose biodegradation processes by microscopical hyphal growth measurements inside the polyhydrogels and, also, by mycelial protein content analysis. The tested fungal species were Pleurotus ostreatus and Pleurotus florida from macromycetes and Trichoderma viride from micromycetes. There were noticed significant differences in biodegradation rate of cellulose wastes between 'in vitro' immobilized fungal cultures and free fungal cells cultures used as control samples to be compared with cellulose biodegradation processes in natural conditions of polluted ecosystems. The fungal growth displayed by soluble mycelial protein were compared with cellulose biodegradation rates which were expressed by cellulose weight loss in the culture medium. (authors)

  1. Download this PDF file

    African Journals Online (AJOL)

    Ayodele Azeez A

    management and field personnel on construction health and safety culture were collated to test the hypothesis ... Keywords: Construction Accidents, Construction firms, Corporate Culture, Construction ..... Safety. UK: Blackwell Publishers.

  2. 78 FR 49740 - Combined Notice of Filings #1 (United States)


    .... Applicants: Blackwell Wind, LLC. Description: Blackwell Wind, LLC Amendment to MBR Tariff to be effective 8/8... Numbers: ER13-1710-001. Applicants: Elk City Wind, LLC. Description: Elk City Wind, LLC Amendment to MBR... II Wind, LLC Amendment to MBR Tariff to be effective 8/8/2013. Filed Date: 8/7/13. Accession Number...

  3. [Review of] Fashion - Philosophy for Everyone: Thinking with Style

    DEFF Research Database (Denmark)

    Langkjær, Michael Alexander


    Book review of Fashion - Philosophy for Everyone: Thinking with Style, edited by Jessica Wolfendale and Jeanette Kennett (Oxford: Wiley-Blackwell, 2011).......Book review of Fashion - Philosophy for Everyone: Thinking with Style, edited by Jessica Wolfendale and Jeanette Kennett (Oxford: Wiley-Blackwell, 2011)....

  4. A Curious Case of Caveats and Causes

    DEFF Research Database (Denmark)

    Blyth, Mark


    Review symposium contribution. Banking Across Boundaries: Placing Finance in Capitalism / Brett Christophers. Wiley-Blackwell, Chichester, Sussex, 2013, 302 pages. Participants: Jamie Peck; Fred Block; Mark Blyth; Ewald Engelen; Brett Christophers.......Review symposium contribution. Banking Across Boundaries: Placing Finance in Capitalism / Brett Christophers. Wiley-Blackwell, Chichester, Sussex, 2013, 302 pages. Participants: Jamie Peck; Fred Block; Mark Blyth; Ewald Engelen; Brett Christophers....

  5. Carotene-degrading activities from Bjerkandera adusta possess an application in detergent industries. (United States)

    Linke, Diana; Leonhardt, Robin; Eisele, Nadine; Petersen, Laura M; Riemer, Stephanie; Nimtz, Manfred; Berger, Ralf G


    Four extracellular enzymes, a versatile peroxidase, a manganese peroxidase, a dye-decolorizing peroxidase and a lignin peroxidase were discovered in liquid cultures of the basidiomycete Bjerkandera adusta. All of them cleaved β-carotene effectively. Expression was enhanced in the presence of β-carotene or Coomassie Brilliant Blue and peaked after 7-9 days. The monomeric proteins were purified by ion exchange and size exclusion chromatography and exhibited molecular masses of 41, 43, 51 and 43 kDa, respectively. The coding sequences showed homologies from 61 to 89 % to peroxidases from other basidiomycetes. The novel enzymes retained strong activity even in the absence of hydrogen peroxide and at alkaline pH. De-staining of fabrics using detergent-tolerant enzymes may help to save the most important bio-resources, energy and water, in washing processes and led to green processes in textile cleaning.

  6. Hydrophobins in ectomycorrhizas: heterologous transcription of the Pisolithus HydPt-1 gene in yeast and Hebeloma cylindrosporum

    Directory of Open Access Journals (Sweden)

    D Tagu


    Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.

  7. Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions

    DEFF Research Database (Denmark)

    Tauber, James P.; Gallegos-Monterrosa, Ramses; Kovács, Ákos T.


    Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S...... of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine....... lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S...

  8. A novel expansin protein from the white-rot fungus Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Omar Eduardo Tovar-Herrera

    Full Text Available A novel expansin protein (ScExlx1 was found, cloned and expressed from the Basidiomycete fungus Schizophylum commune. This protein showed the canonical features of plant expansins. ScExlx1 showed the ability to form "bubbles" in cotton fibers, reduce the size of avicel particles and enhance reducing sugar liberation from cotton fibers pretreated with the protein and then treated with cellulases. ScExlx1 was able to bind cellulose, birchwood xylan and chitin and this property was not affected by different sodium chloride concentrations. A novel property of ScExlx1 is its capacity to enhance reducing sugars (N-acetyl glucosamine liberation from pretreated chitin and further added with chitinase, which has not been reported for any expansin or expansin-like protein. To the best of our knowledge, this is the first report of a bona fide fungal expansin found in a basidiomycete and we could express the bioactive protein in Pichia pastoris.

  9. Various Stages of Pink Fungus (Upasia salmonicolor in Java

    Directory of Open Access Journals (Sweden)

    Ambarwati Harsojo Tjokrosoedarmo


    Full Text Available Pink fungus in Java is classified as Upasia salmonicolor (Basidiomycetes: Corticiaceae and its anamorph is Necator decretus. This fungus is a serious pathogen which attacks many woody plants. The pink fungus in Java exhibits five developmental stages on the surface of the host bark: I. An initial cobweb stage as thin, white, cobweb-like hyphal layer, which creeps over the surface of the bark, during which penetration of the host occurs; II. Pseudonodular stage, as conical white pustules occurring only on lenticels or cracks, and only on shady side of branches; III. Teleomorph, occurs as pink incrustation and pink pustules on shady side of branches; IV. Nodular stages, as globose white pustules occurring chiefly on intact bark, but also on the lenticels or cracks, on exposed side of branches; V. Anamorph, as small orange-red sporodochium, on exposed side of branches. Key words: pink fungus, Corticiaceae, Basidiomycetes, Necator

  10. Why Mycophoris is not an orchid seedling, and why Synaptomitus is not a fungal symbiont within this fossil

    DEFF Research Database (Denmark)

    Selosse, Marc-Andre; Brundrett, Mark; Dearnaley, John


    A recent publication in Botany introduced two new taxa: a fossil orchid seed (Mycophoris) and a fossilized basidiomycete fungus (Synaptomitus) in an alleged relationship with this orchid, encased in 15–20 million year old Dominican amber (Poinar, G. 2017. Two new genera, Mycophoris gen. nov......., (Orchidaceae) and Synaptomitus gen. nov. (Basidiomycota) based on a fossil seed with developing embryo and associated fungus in Dominican amber. Botany, 95: 1–8). From the working knowledge of extant orchid seeds, seedlings, and mycorrhiza shared among us, we cannot support these interpretations. Here we...... analyse: (i) why Mycophoris may not be an orchid seed, (ii) why Mycophoris is not a germinating seed, (iii) why fungal hyphae and a symbiotic fungus are absent in Mycophoris, and (iv) why Synaptomitus is likely not a fossil basidiomycete....

  11. Oxidoreductases from Trametes spp. in Biotechnology: A Wealth of Catalytic Activity

    Directory of Open Access Journals (Sweden)

    Gibson S. Nyanhongo


    Full Text Available Those oxidoreductases that are part of the ligninolytic complex of basidiomycete and ascomycete fungi have played an increasingly important role in biotechnological applications during the last decade. The stability of these extracellular enzymes, their good solubility, and a multitude of catalyzed reactions contribute to this trend. This review focuses on a single genus of white-rot basidiomycetes, Trametes, to highlight the numerous possibilities for the application of this microorganism as well as three of its enzymes: laccase, cellobiose dehydrogenase, and pyranose 2-oxidase. Whereas laccase is without doubt a major player in biotechnology, the two other enzymes are less well known, but represent emerging biocatalysts with potential. Both cellobiose dehydrogenase and pyranose 2-oxidase are presumed to participate in lignin breakdown and will be used to exemplify the potential of less prominent oxidoreductases from this genus.

  12. Publishing for Learned Societies: The Secret Life of a Scholarly Publisher (United States)

    Nicholson, David

    Wiley-Blackwell was formed in February 2007 as a result of the acquisition of Blackwell Publishing Ltd. by John Wiley & Sons, Inc. and the merger between Blackwell and Wiley's Scientific, Technical, and Medical business. Wiley-Blackwell publishes approximately 1,250 scholarly peer-reviewed journals including Monthly Notices of the Royal Astronomical Society and Astronomische Nachrichten, and has relationships with over 800 learned societies. The "secret life" of the article's title refers to the two broad areas of activity we undertake for our society partners, namely practical assistance and strategic advice. One of our goals at Wiley-Blackwell is to set the standard for both areas, and this article illustrates how we are doing this with a series of tangible examples.

  13. Genetic recombination in auxotrophic strains of Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Krejci, R.


    Four auxotrophic strains of ligninolytic basidiomycete Phanerochaete chrysosporium were obtained by UV mutagenesis. The heterokaryotic mycelium formed by complementation of different auxotrophic isolates was able to fruit and produce basidiospores. Prototrophic strains and strains with a recombined set of parental nutritional requirements were isolated from the basidiospore progeny of the heterokaryons. Genetic recombination hence takes place in fruit bodies produced by the heterokaryotic mycelium. (author). 3 tabs., 13 refs


    Directory of Open Access Journals (Sweden)

    К. G. Dreval


    Full Text Available Adsorption of cellulases on substrate taking place during the cultivation process was determined. Adsorbed enzymes can be eluted by buffer solution with high ionic strength, but for determine their activity they should be transferred into the aqueous solution. On the basis of the results a method for obtaining of cellulases preparations from cultural liquids of basidiomycetes was developed. This method is the elution of cellulases from the cultivation substrate of basidiomycetes. It was found that using of the last allows to obtain enzymatic preparations with a high degree of purification in 3 stages (salting out of proteins — dialysis — gelchromatography. Cellulase preparations received original products of basidiomycetes strains К-1, А-Дон-02, Д-1 Irpex lacteus and AnSc-1 Daedaleopsis confragosa f. confragosa were obtained. They contained different proteins, enzymes with specific peaks out of column and their activity. However, common to them was a distinct maximum of outing from the column by endoglucanases or cellobiases, which may indicate that the studied cellulolytic complexes of basidiomycetes do not contain multiple forms of cellulases with different molecular mass. This method allowed to obtain preparations with different degree of purification in comparing with the original culture filtrate 7,3 for endoglucanase and 33,3 for cellobiase of strain А-Дон-02 I. lacteus; 13,1 for endoglucanase and 25,5 for cellobiase of strain Д-1 I. lacteus; 29,9 for endoglucanase and 90,1 for cellobiase of strain К-1 I. lacteus; 2,1 for endoglucanase and 30,6 for cellobiase of strain AnSc-1 D. confragosa f. confragosa.

  15. In memoriam Rudolf Arnold Maas Geesteranus Den Haag, 20 january 1911-Oegstgeest, 18 may 2003




    On 18 May 2003 Rudolf Maas Geesteranus died peacefully at the age of 92. With him the mycological world has lost a remarkable and versatile personality, who worked on the taxonomy of fungi for almost 60 years producing papers and books on a wide range of topics, including both asco- and basidiomycetes. The bibliographical notes and publication list printed in this journal on his retirement from active service at the Rijksherbarium in 1976, and on his eightieth birthday in 1991 (Bas, Persoonia...

  16. The use of secondary metabolite profiling in chemotaxonomy of filamentous fungi

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Andersen, Birgitte; Thrane, Ulf


    A secondary metabolite is a chemical compound produced by a limited number of fungal species in a genus, an order, or even phylum. A profile of secondary metabolites consists of all the different compounds a fungus can produce on a given substratum and includes toxins, antibiotics and other outwa......, Xylaria and in few basidiomycete genera, but not in Zygomycota and Chytridiomycota. (C) 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved....

  17. Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations


    MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan


    Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...

  18. The yeast flora of some decaying mushrooms on trunks of living trees


    Middelhoven, W.J.


    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...

  19. New phenyl-ethanediols from the culture broth of Boletus edulis. (United States)

    Yang, Wan-Qiu; Qin, Xiang-Dong; Shao, Hong-Jun; Fang, Li-Zhen; Wang, Fei; Ding, Zhi-Hui; Dong, Ze-Jun; Liu, Ji-Kai


    A new phenyl-ethanediol, (1S)-(4-acetylphenyl)-1, 2-ethanediol (1), and a new natural product, (1S)-(3-ethenylphenyl)-1, 2-ethanediol (2), were isolated from the culture broth of the basidiomycete Boletus edulis together with three related known compounds, 1-(4-ethylphenyl)-1, 2-ethanediol (3), 1-(3-ethylphenyl)-1, 2-ethanediol (4) and 1-(3-formylphenyl)-ethanone (5). Their structures were elucidated by spectroscopic methods including extensive 2D-NMR techniques.

  20. Effects of some added carbohydrates on cellulases and ligninase and decomposition of whole bagasse

    Energy Technology Data Exchange (ETDEWEB)

    Nigam, P; Prabhu, K A


    Two basidiomycetes mould isolates were studied for the production of extracellular cellulases and ligninase in submerged shake culture using whole bagasse as substrate. The effects of some added carbohydrates on enzyme production, substrate decomposition and biomass formation were examined. In both cultures the addition of lactose stimulated biomass production and increased the decomposition of total carbohydrate and lignin contents of bagasse. Lactose was the only sugar which stimulated cellulase and ligninase in both cultures. 19 references.

  1. Laboratory studies of the degradation of chloropyrifos pesticide in soils supplemented by the fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Lopera Mesa, Margarita Maria; Penuela Mesa, Gustavo Antonio; Dominguez Gual, Maria Carolina; Mejia Zapata, Gloria Maria


    Degradation of the insecticide chloropyrifos was investigated in sterilized soil samples supplemented by the white rot basidiomycetes Phanerochaete chrysosporium. Degradation rates were measured during 21-day incubation at pesticide concentrations of 0,95, 5,3, and 9,41 μ/g. Phanerochaete chrysosporium showed ability to biodegrade the insecticide in values of 96,3%, 82,4% and 62,2%, respectively, followed by rapid degradation at low initial concentration of chloropyrifos

  2. Bioconcentration of manganese and iron in Panaeoloideae Sing


    Stijve, T.; Blake, C.


    According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae, as demonstrated by the analysis of 44 collections representing 15 taxons. Carpophores generally contain between 250 and 2500 mg/kg on dry weight, and, with the notable exception of Panaeolus semiova...

  3. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum (United States)

    Diane Dietrich; Casey Crooks


    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  4. Natural Protection of Wood with Antagonism Fungi

    Directory of Open Access Journals (Sweden)



    Full Text Available Biological environments contain a certain number of microbial populations which, within a givenecological niche, display various relations ranging from symbiosis to parasitism. Researchers have beeninterested in these types of relations for around fifty years, especially in one very particular type ofrelationship: the antagonism exerted between individuals of the same microbial population.Today, the role played by biological agents, bringing into play inhibitive or destructive antibioticsubstances, reveals a certain potential for their use in controlling microorganisms associated with suchdegradation processes.The work undertaken by HydroQuébec and CIRAD involved two types of experiment: 1 in Petri dishes toassess and characterize the antagonistic capacity of Trichoderma against white rot and brown rot fungi; 2on pieces taken from untreated poles in order to study confrontation between the basidiomycete and theantagonistic strain in wood.This study investigated the antagonism of three ascomycetes of the genus Trichoderma against two whiterot basidiomycetes, Pycnoporus sanguineus and Coriolus versicolor, and two brown rot basidiomycetes,Antrodia sp. and Coniophora puteana, through direct confrontation in Petri dishes and in the wood ofHydroQuébec poles.The results obtained seemed to complete each other coherently. They revealed that the Trichodermagroup of fungi was not aggressive to wood and the results obtained after direct confrontation in Petri disheswere confirmed in wood.By directly exposing the different basidiomycetes and antagonists to each other in Petri dishes, two bytwo, we effectively revealed an antagonism effect for a large majority of the pairs. However, there wassubstantial variability in reactions from one pair to the next.

  5. Temperature development and sterilization of red pine poles during CCA treatment, elevated temperature fixation and drying

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, P.; Albright, M.; Srinivasan, U.; Ung, A. [New Brunswick Univ., Fredericton, NB (Canada). Wood Science and Technology Centre


    The application of chromated copper arsenate (CCA) treatment and fixation and drying under the conditions of the study to large red pine poles left for an air seasoning period of 10 months in Quebec, Canada progressively reduced the number of micro-organisms present. A large number of microfungi isolations were effected before the treatment from the sapwood and heartwood of all poles and wood decay fungi on 8 selected poles from the 20 test poles. They originated from the sapwood zone. A reduction of approximately 50 per cent in the number of microfungi isolated from the sapwood was noted after the CCA treatment. In the case of 9 of 30 poles, basidiomycetes were isolated after treatment primarily from the untreated heartwood. There were a few instances where basidiomycetes were isolated from unpenetrated sapwood (wet pockets). Temperatures of 55 to 60 degrees Celsius were achieved under moderate temperature fixation schedules (20 hours) for approximately 5 hours at full sapwood depth. Only by the end of the schedule was a temperature of 55 degrees celsius achieved at the centre of the poles. Most of the microfungi were eliminated by this temperature regime. Trichoderma was eliminated, and only one isolation of basidiomycetes was left from the heartwood of one pole. Temperatures of 55 to 60 degrees Celsius were achieved in the wood core for 9 to 10 days during kiln drying. No basidiomycete isolations remained after this exposure. In several of the poles, there was evidence of Paecilomyces variotii, a thermo-tolerant species and a number of species of Penicillium moulds. It was concluded that there was a negligible probability of decay fungi surviving the sequence of processes as described, given the effectiveness of the fixation exposure and the higher wood temperatures sustained for longer periods. 16 refs., 5 tabs., 2 figs.

  6. Fungal bioremediation of the creosote-contaminated soil: Influence of Pleurotus ostreatus and Irpex lacteus on polycyclic aromatic hydrocarbons removal and soil microbial community composition in the laboratory-scale study

    Czech Academy of Sciences Publication Activity Database

    Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr


    Roč. 2008, č. 73 (2008), s. 1518-1523 ISSN 0045-6535 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60870520; CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Wood-rotting basidiomycetes * Soil microbial community * PLFA, PAH Subject RIV: EH - Ecology, Behaviour Impact factor: 3.054, year: 2008

  7. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts (United States)

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna


    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  8. Test of Lignin and Cellulose Decomposition and Phosphate Solubilization by Soil Fungi of Gunung Halimun


    Suciatmih, Suciatmih


    In order to know the capability of lignin and cellulose degradation and phosphate solubilization by soil fungi of Gunung Halimun National Park, a study was carried out to qualitatively analyse its physiological properties. Out of 35 soil fungi tested, 1 species that belonged to Basidiomycetes degraded lignin, 32 species degraded cellulose, and 31 species dissolved inorganic phosphate.The presence of soil fungi that degraded cellulose and dissolved phosphate could be used as a candidate for bi...

  9. Environmental Assessment for the Continued Exclusive Use of Department of the Army Land Located at U.S. Army Dugway Proving Ground by Members of the U.S. Air Force (United States)


    canned and prepared foods with gamma rays in an effort to kill micro -organisms, trichina in pork, and food-infesting insects (DPG 2001). The Avery...microcommunity consisting of fungi (Basidiomycetes), lichens, soil algae , and mosses typically occurring in semiarid regions. Cyanobacteria-dominated soil... ponds , playas, and wetlands. Constructed surface water features include wastewater lagoons, evaporation ponds , an excavated pond , a bermed pond , and

  10. Overproduction of ligninolytic enzymes (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas


    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  11. Two New Cyathane Diterpenoids from Mycelial Cultures of the Medicinal Mushroom Hericium erinaceus and the Rare Species, Hericium flagellum


    Rupcic, Zeljka; Rascher, Monique; Kanaki, Sae; Köster, Reinhard W.; Stadler, Marc; Wittstein, Kathrin


    Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor (NGF) or (as established more recently) brain-derived neurotrophic factor (BDNF) in cell-based bioassays. The present study reports on the metabolite profiles of a Li...

  12. Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions. (United States)

    Tauber, James P; Gallegos-Monterrosa, Ramses; Kovács, Ákos T; Shelest, Ekaterina; Hoffmeister, Dirk


    Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S. lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S. lacrymans significantly reduced pigmentation indicating that enzymatic hyphal damage and/or released peptides, rather than mechanical injury, was the major cause of systemic pigment induction. Conversely, no significant pigmentation by bacteria was observed from P. involutus. We found additional putative transcriptional composite elements of atromentin synthetase genes in P. involutus and other ectomycorrhiza-forming species that were absent from S. lacrymans and other brown-rotters. Variegatic and its precursor xerocomic acid, but not involutin, in return inhibited swarming and colony biofilm spreading of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine global regulators, signalling pathways and associated transcription factors of basidiomycetes.

  13. Enzymatic saccharification of biologically pre-treated wheat straw with white-rot fungi. (United States)

    Dias, Albino A; Freitas, Gil S; Marques, Guilhermina S M; Sampaio, Ana; Fraga, Irene S; Rodrigues, Miguel A M; Evtuguin, Dmitry V; Bezerra, Rui M F


    Wheat straw was submitted to a pre-treatment by the basidiomycetous fungi Euc-1 and Irpex lacteus, aiming to improve the accessibility of cellulose towards enzymatic hydrolysis via previous selective bio-delignification. This allowed the increase of substrate saccharification nearly four and three times while applying the basidiomycetes Euc-1 and I. lacteus, respectively. The cellulose/lignin ratio increased from 2.7 in the untreated wheat straw to 5.9 and 4.6 after the bio-treatment by the basidiomycetes Euc-1 and I. lacteus, respectively, thus evidencing the highly selective lignin biodegradation. The enzymatic profile of both fungi upon bio-treatment of wheat straw have been assessed including laccase, manganese-dependent peroxidase, lignin peroxidase, carboxymethylcellulase, xylanase, avicelase and feruloyl esterase activities. The difference in efficiency and selectivity of delignification within the two fungi treatments was interpreted in terms of specific lignolytic enzyme profiles and moderate xylanase and cellulolytic activities. (c) 2010 Elsevier Ltd. All rights reserved.

  14. Genetic transformation of the white-rot fungus Dichomitus squalens using a new commercial protoplasting cocktail. (United States)

    Daly, Paul; Slaghek, Gillian G; Casado López, Sara; Wiebenga, Ad; Hilden, Kristiina S; de Vries, Ronald P; Mäkelä, Miia R


    D. squalens, a white-rot fungus that efficiently degrades lignocellulose in nature, can be used in various biotechnological applications and has several strains with sequenced and annotated genomes. Here we present a method for the transformation of this basidiomycete fungus, using a recently introduced commercial ascomycete protoplasting enzyme cocktail, Protoplast F. In protoplasting of D. squalens mycelia, Protoplast F outperformed two other cocktails while releasing similar amounts of protoplasts to a third cocktail. The protoplasts released using Protoplast F had a regeneration rate of 12.5% (±6 SE). Using Protoplast F, the D. squalens monokaryon CBS464.89 was conferred with resistance to the antibiotics hygromycin and G418 via polyethylene glycol mediated protoplast transformation with resistance cassettes expressing the hygromycin phosphotransferase (hph) and neomycin phosphotransferase (nptII) genes, respectively. The hph gene was expressed in D. squalens using heterologous promoters from genes encoding β-tubulin or glyceraldehyde 3-phosphate dehydrogenase. A Southern blot confirmed integration of a resistance cassette into the D. squalens genome. An average of six transformants (±2 SE) were obtained when at least several million protoplasts were used (a transformation efficiency of 0.8 (±0.3 SE) transformants per μg DNA). Transformation of D. squalens demonstrates the suitability of the Protoplast F cocktail for basidiomycete transformation and furthermore can facilitate understanding of basidiomycete gene function and development of improved strains for biotechnological applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Directory of Open Access Journals (Sweden)

    Evelyne Coppin

    Full Text Available Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  16. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body. (United States)

    Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe


    Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  17. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong


    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  18. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  19. Filling gaps in biodiversity knowledge for macrofungi: contributions and assessment of an herbarium collection DNA barcode sequencing project. (United States)

    Osmundson, Todd W; Robert, Vincent A; Schoch, Conrad L; Baker, Lydia J; Smith, Amy; Robich, Giovanni; Mizzan, Luca; Garbelotto, Matteo M


    Despite recent advances spearheaded by molecular approaches and novel technologies, species description and DNA sequence information are significantly lagging for fungi compared to many other groups of organisms. Large scale sequencing of vouchered herbarium material can aid in closing this gap. Here, we describe an effort to obtain broad ITS sequence coverage of the approximately 6000 macrofungal-species-rich herbarium of the Museum of Natural History in Venice, Italy. Our goals were to investigate issues related to large sequencing projects, develop heuristic methods for assessing the overall performance of such a project, and evaluate the prospects of such efforts to reduce the current gap in fungal biodiversity knowledge. The effort generated 1107 sequences submitted to GenBank, including 416 previously unrepresented taxa and 398 sequences exhibiting a best BLAST match to an unidentified environmental sequence. Specimen age and taxon affected sequencing success, and subsequent work on failed specimens showed that an ITS1 mini-barcode greatly increased sequencing success without greatly reducing the discriminating power of the barcode. Similarity comparisons and nonmetric multidimensional scaling ordinations based on pairwise distance matrices proved to be useful heuristic tools for validating the overall accuracy of specimen identifications, flagging potential misidentifications, and identifying taxa in need of additional species-level revision. Comparison of within- and among-species nucleotide variation showed a strong increase in species discriminating power at 1-2% dissimilarity, and identified potential barcoding issues (same sequence for different species and vice-versa). All sequences are linked to a vouchered specimen, and results from this study have already prompted revisions of species-sequence assignments in several taxa.

  20. Kerkwees: Verleentheid of geleentheid?

    African Journals Online (AJOL)


    bases, not merely the historicity of the Church, but the fact that the church is ...... An introduction to Christian theology since 1918, 3rd edn., Wiley-Blackwell, Oxford. Bauer ..... Kallistos, W., 1993, The Orthodox Church, Penguin Books, London.

  1. Evaluation of the anti-inflammatory properties of the hexane extract ...

    African Journals Online (AJOL)

    Maj Obaseki


    Aug 26, 2016 ... side effects to substitute for these chemical therapeutics. The use of plants ...... Occurrence, Structure and Role in the Human Diet. UK: Blackwell .... 1. The effect of histamine and serotonin on vascular permeability: an electron.

  2. Short‑term Effect of Tamsulosin and Finasteride Monotherapy and ...

    African Journals Online (AJOL)


    May 18, 2017 ... and finasteride monotherapies, and their combination in men with benign prostatic ... single‑blind randomized study of ninety men with BPH who were managed ..... United State of America: Blackwell Publishing Company;.

  3. of brain tumours

    African Journals Online (AJOL)

    outline of the important clinical issues related to brain tumours and psychiatry. ... Left-sided, frontal tumours also seem to be associated with higher rates of depression, while those in the frontal lobe of the right .... Oxford: Blackwell Science,.

  4. Zinc availability of two wheat cultivars in soil amended with organic ...

    African Journals Online (AJOL)



    Jan 5, 2012 ... A factorial experiment using randomized complete blocks was used in three replications. A Zn enriched ... they can enter the food chain and the environment. Adding organic ..... Methods in Plant Ecology,. Blackwell Scientific ...

  5. Skin disorders affecting the feet

    African Journals Online (AJOL)

    blistering, with weeping lesions, leading to secondary bacterial infection. ... 2015; 57(4):34-38. Open Access article distributed under the terms of the .... appear as bluish macules and plaques. Late lesions ... Oxford: Blackwell Science,1998; p.

  6. Perihepatitis associated with systemic lupus erythematosus: computed tomography findings

    International Nuclear Information System (INIS)

    Schoenwaelder, M.; Stuckey, S.L.


    The imaging findings of a 29-year-old woman with known systemic lupus erythematosus, and a clinical presentation and CT appearances consistent with perihepatitis are presented Copyright (2005) Blackwell Publishing Asia Pty Ltd

  7. Rupture of the renal pelvis of a ureteropelvic junction hydronephrosis after blunt abdominal trauma

    International Nuclear Information System (INIS)

    Ashebu, Samuel D.; Dahniya, Mohamed H.; Aduh, Prosper; Ramadan, Salwa; Bopaiah, Harini; Elshebiny, Yahaya H.


    In the present case report, we present the unusual occurrence of traumatic rupture of a ureteropelvic junction hydronephrosis, and discuss the potential mechanisms producing such a rupture and the management options Copyright (2004) Blackwell Publishing Asia Pty Ltd

  8. Epidemiological study of small ruminant mange mites in three agro ...

    African Journals Online (AJOL)

    . Parasitology 2nd ed. Blackwell science Ltd. Osneymend, oxford, London, UK, Pp. 180-210. Wolaita Zone Finance and Economic Development Department, WZFEDD, 2003.Socio- economic profiles of Wolaita Zone. pp. 1- 97. Woldemeskel ...

  9. SJP0704Pg001ED

    African Journals Online (AJOL)


    and an updated overview of newer research in this field. It also gives practical ... schizophrenia, manic episodes, major depressive disorder sec- ondary to schizophrenia ..... of Cerebral Disorder. 3rd ed. London: Blackwell Science, 1998. 16.

  10. Basidiomycosis: a review of the literature Basidiomicoses: revisão da literatura

    Directory of Open Access Journals (Sweden)

    Carlos da Silva Lacaz


    Full Text Available The basidiomycosis, fungal infections provoked by basidiomycetes or agaric fungi have been recorded at growing frequencies in the medical literature, especially after the advent of AIDS in 1991. The basidiospores of these fungi, scattered in the atmosphere and transported by winds or air currents, reach the maxillary sinuses through the nasal route, most of the times causing signs and symptoms of chronic sinusitis. Basidiomycetes have also been isolated from sputum, especially Schizophyllum commune. Lesions of the buccal mucosa, brain abscesses, onychomycosis and endocarditis have been described, with a growing interest in this type of deep mycosis on the part of mycologists and infectologists. The present paper reports descriptions of mycetism as well as infectious processes caused by basidiomycetes, such as Schizophyllum commune, Ustilago maydis (= Ustilago zeae and Coprinus cinereusAs basidiomicoses, infecções fúngicas provocadas por basidiomicetos ou agáricos vêm sendo registradas cada vez com maior frequência na literatura médica, principalmente após o advento da AIDS/SIDA, em 1981. Os basidiosporos desses fungos, espalhados na atmosfera e veiculados através do vento ou de correntes aéreas, atingem por via nasal os seios maxilares, provocando quadros de sinusite crônica, na maioria das vezes. Do escarro também têm sido isolados basidiomicetos, principalmente o Schizophyllum commune. Lesões da mucosa da boca, abscessos cerebrais, onicomicoses e endocardites já foram descritas, aumentando o interesse dos micologistas e infectologistas para este tipo de micose profunda. O presente trabalho assinala, ao lado dos quadros dc micetismo, processos infecciosos provocados por basidiomicetos, a exemplo do Schizophyllum commune, Ustilago maydis (= Ustilago zeae e Coprinus cinereus.

  11. Fungal Sex: The Basidiomycota. (United States)

    Coelho, Marco A; Bakkeren, Guus; Sun, Sheng; Hood, Michael E; Giraud, Tatiana


    Fungi of the Basidiomycota, representing major pathogen lineages and mushroom-forming species, exhibit diverse means to achieve sexual reproduction, with particularly varied mechanisms to determine compatibilities of haploid mating partners. For species that require mating between distinct genotypes, discrimination is usually based on both the reciprocal exchange of diffusible mating pheromones, rather than sexes, and the interactions of homeodomain protein signals after cell fusion. Both compatibility factors must be heterozygous in the product of mating, and genetic linkage relationships of the mating pheromone/receptor and homeodomain genes largely determine the complex patterns of mating-type variation. Independent segregation of the two compatibility factors can create four haploid mating genotypes from meiosis, referred to as tetrapolarity. This condition is thought to be ancestral to the basidiomycetes. Alternatively, cosegregation by linkage of the two mating factors, or in some cases the absence of the pheromone-based discrimination, yields only two mating types from meiosis, referred to as bipolarity. Several species are now known to have large and highly rearranged chromosomal regions linked to mating-type genes. At the population level, polymorphism of the mating-type genes is an exceptional aspect of some basidiomycete fungi, where selection under outcrossing for rare, intercompatible allelic variants is thought to be responsible for numbers of mating types that may reach several thousand. Advances in genome sequencing and assembly are yielding new insights by comparative approaches among and within basidiomycete species, with the promise to resolve the evolutionary origins and dynamics of mating compatibility genetics in this major eukaryotic lineage.

  12. Specialized Fungal Parasites and Opportunistic Fungi in Gardens of Attine Ants

    Directory of Open Access Journals (Sweden)

    Fernando C. Pagnocca


    Full Text Available Ants in the tribe Attini (Hymenoptera: Formicidae comprise about 230 described species that share the same characteristic: all coevolved in an ancient mutualism with basidiomycetous fungi cultivated for food. In this paper we focused on fungi other than the mutualistic cultivar and their roles in the attine ant symbiosis. Specialized fungal parasites in the genus Escovopsis negatively impact the fungus gardens. Many fungal parasites may have small impacts on the ants' fungal colony when the colony is balanced, but then may opportunistically shift to having large impacts if the ants' colony becomes unbalanced.

  13. Pre-Cretaceous Agaricomycetes yet to be discovered: Reinvestigation of a putative Triassic bracket fungus from southern Germany

    Directory of Open Access Journals (Sweden)

    A. P. Kiecksee


    Full Text Available Agaricomycetes are major components of extant terrestrial ecosystems; however, their fruiting bodies are exceedingly rare as fossils. Reinvestigation of a peculiar fossil from Late Triassic sediments of southern Germany interpreted as a bracket fungus revealed that this fossil in fact represents a wood abnormality, resulting from injury to the cambium and subsequent callus growth in a Baieroxylon -like ginkgoalean wood. As a result, the fossil record of the Agaricomycetes does not yet pre-date the Early Cretaceous, suggesting a late diversification of basidiomycetes possessing large fruiting bodies. doi:10.1002/mmng.201200006

  14. Checklist of the Mycobiota of Iguazú National Park (Misiones, Argentina Catálogo de los hongos del Parque Nacional Iguazú (Misiones, Argentina

    Directory of Open Access Journals (Sweden)

    Jorge E. Wright


    Full Text Available A check-list of the fungi recorded from Iguazú National Park, one of the best known preserved areas in South America, has been compiled mainly on the basis of Rolf Singer´s and our own collections and publications. Ten species of Dictyosteliales, 4 of Myxomycetes, 4 of Pezizales, 9 of Hypocreales, 31 of other Ascomycetes, 3 Deuteromycotina and 314 of Basidiomycetes are annotated. This last group is by far the best known, and includes 13 species of jelly-fungi, 6 coral fungi, 84 resupinates, 90 Agaricales s. l., 111 polypores of which 26 are poroid Hymenochaetaceae, and 11 of Gasteromycetes. Furthermore, 8 Ascomycetes, 58 Basidiomycetes and 2 Deuteromycotina were determined to genus. Lichens have been excluded. The microfungi of the Park have hardly been explored, and no phycomycetes are recorded, so the number of species included in this checklist is but a mere sample of the rich mycobiota of the Park.Este catálogo de los hongos registrados para el Parque Nacional Iguazú, una de las áreas preservadas mejor conocidas en América del Sur, ha sido confeccionado principalmente sobre la base de las colecciones y publicaciones de Rolf Singer y las propias. Diez especies de Dictyosteliales, 4 de Myxomycetes, 4 de Pezizales, 9 de Hypocreales, 31 de otros Ascomycetes, 3 Deuteromycotina, y 314 de Basidiomycetes han sido anotadas. Este último grupo es de lejos el mejor conocido, e incluye 13 especies de hongos gelatinosos, 6 de hongos clavarioides, 84 de resupinados, 90 de Agaricales s. l., 111 de políporos, de los cuales 26 son Hymenochaetaceae poroides, y 11 de Gasteromycetes. Además, 8 Ascomycetes, 58 Basidiomycetes y 2 Deuteromycotina fueron solo determinados a nivel de género. Los líquenes han sido excluídos. Los microhongos del Parque apenas han sido explorados, y no se han registrado 'ficomicetes', de modo que el número de especies que se presenta aquí son tan sólo un mero muestreo de la micobiota del Parque.

  15. Applied modern biotechnology for cultivation of Ganoderma and development of their products. (United States)

    Zhou, Xuan-Wei; Su, Kai-Qi; Zhang, Yong-Ming


    A white-rot basidiomycete Ganoderma spp. has long been used as a medicinal mushroom in Asia, and it has an array of pharmacological properties for immunomodulatory activity. There have been many reports about the bioactive components and their pharmacological properties. In order to analyze the current status of Ganoderma products, the detailed process of cultivation of Ganoderma spp. and development of their products are restated in this review article. These include the breeding, cultivating, extracting bioactive component, and processing Ganoderma products, etc. This article will expand people's common knowledge on Ganoderma, and provide a beneficial reference for research and industrial production.

  16. Application of Chinese Jun-Cao technique for the production of Brazilian Ganoderma lucidum strains

    Directory of Open Access Journals (Sweden)

    Leonardo do Nascimento Rolim


    Full Text Available Ganoderma lucidum is a medicinal mushroom traditionally used in China against a wide range of diseases such as cancer and also for its prevention. In this work, commercial Chinese strains G. lucidum were compared to wild Brazilian strains aiming to determine the cultivation potential through the use of Jun-Cao. Six formulations were tested and the strains presented good response to the applied method. In general, the mixture between the grass and wood was well suited for the basidiomycetes, contributing to the preparation of substrates that generated better results in Jun Cao.

  17. Recent advances in the molecular genetics of the lignin degrading fungus, phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Covert, S.F.


    During the past several years, molecular genetics research on phanerochaete chrysosporium, a white-rot basidiomycete, has increased dramatically. It is known that families of highly homologous, clustered genes encode the lignin peroxidases. The same appears to be true with the exocellobiohydrolase genes. Functional domains and active sites have been tentatively identified from the deduced amino acid sequences of these genes. Current investigations focus on elucidating the genomic organization of gene families, the mechanism(s) of gene regulation, and the role and interaction of specific gene products in lignocellulose degradation. (author)

  18. Protocol for isolation of Moniliophthora roreri (Cif and Par Evans et al. from cacao fruits cv. `National' in the Ecuadorian Amazonia

    Directory of Open Access Journals (Sweden)

    Karina Carrera-Sánchez


    Full Text Available Moniliophthora roreri is a pathogen of cocoa (Theobroma cacao L. that causes high economic losses in Ecuador. This paper is intended to present a protocol for the isolation of the pathogen from cocoa fruits cv. `National', showing signs and symptoms of disease. The fruits were collected on farms of Napo (Ecuador. By wet chamber, it was able to induce profusely, sporulation on the surface of selected lesions. The isolations were performed from conidia directly located on the surface of fruits with brown powdery appearance. Isolation procedures and suggested of possible applications are presented.   Key words: amazonia, basidiomycetes, fungi, moniliasis, Theobroma cacao L.

  19. Behavioural and chemical studies of discrimination processes in the leaf-cutting ant Acromyrmex laticeps nigrosetosus (Forel, 1908

    Directory of Open Access Journals (Sweden)

    D. J. Souza

    Full Text Available Leaf-cutting ants live in symbiosis with a basidiomycete fungus that is exploited as a source of nutrients for ant larvae. Tests of brood transport revealed that Acromyrmex laticeps nigrosetosus workers did not discriminate a concolonial brood from an alien brood. The same result was observed with tests of fungus transport. Adult workers showed no aggressive behaviour to workers from other alien colonies (non-nestmates. There was no qualitative variation in the chemical profiles of larvae, pupae and adult workers from the different colonies. However, quantitative differences were observed between the different colonies. Hypotheses about the lack of intraspecific aggression in this subspecies of ants are discussed.

  20. Fungal cellulases as an aid for the saccharification of cassava

    Energy Technology Data Exchange (ETDEWEB)

    De Menezes, T J.B.; Arakaki, T; DeLamo, P R; Sales, A M


    Culture broths of cellulolytic fungi were used together with commercial anylases to enhance the saccharification of cassava starch slurry. It was found that the addition of appropriate concentration of the cellulases Trichoderma viride and a soil isolated Basidiomycete, increased both the rate of sugar formation and the degree of solubilization, and decreased the viscosity of the hydrolyzates. Owing to the improvement of the rheological properties of the must, and the additional sugar produced, an increased ethanol yield would be expected from the alcoholic fermentation of this hydrolyzate.

  1. Auriculariopsis albomellea (Agaricales, Schizophyllaceae new for Poland

    Directory of Open Access Journals (Sweden)

    Władysław Wojewoda


    Full Text Available The article deals with the taxonomy, ecology, general distribution and threatened status of Auriculariopsis albomellea Bondartsev Kotl. (Basidiomycetes. In Europe it is known only from Czech Republic, France, Sweden and Ukraine, in Africa from Canary Islands, in North America from Canada and United States. In Poland the fungus was found for the first time in NE part of the country, in a pine forest, on dead twigs of Pinus sylvestris. Habitat and distribution of this saprobic fungus in Africa, Europe and North America are described, list of synonyms and important references are cited, Polish name is proposed.

  2. Components of the ligninolytic system of Fusarium oxysporum and Trichoderma atroviride

    Energy Technology Data Exchange (ETDEWEB)

    Moenkemann, H.; Hoelker, U.; Hoefer, M. [Universitaet Bonn, Bonn (Germany). Botanisches Institut


    The ligninolytic system in the two deuteromycetous fungi Fusarium oxysporum and Trichoderma atroviride, which are able to solubilize low-rank coal, has been proved to have several components. Analysis of the chromosomal DNA of these fungi revealed distinct bands with probes coding for three ligninase isoenzymes, glyoxal oxidase and arylalcohol dehydrogenase of the basidiomycete Phanerochaete chrysosporium. These data constitute a strong indication for the existence in F. oxysporum and T. atroviride of a ligninolytic system comparable to that in P. chrysosporium that may be involved in the process of coal solubilization. 11 refs., 3 figs.

  3. Nunamycin and Nunapeptin: Two novel cyclic peptides are key components of the antimicrobial activity of the Greenlandic isolate Pseudomonas fluorescens In5

    DEFF Research Database (Denmark)

    Hennessy, Rosanna Catherine; Phippen, Christopher; Nielsen, Kristian F.

    Pseudomonas spp. are a rich source of secondary metabolites including bioactive non-ribosomal peptides (NRPs) and polyketides. NRPs are synthesised in large assembly lines by multi-domain modular enzymes known as NRP-synthetases (NRPS). Nunamycin and nunapeptin are two cyclic NRPs synthesised...... by the Greenlandic isolate P. fluorescens In5. Nunamycin shows antifungal activity against the basidiomycete Rhizoctonia solani whereas the only partially structure elucidated nunapeptin appears most active against the ascomycete Fusarium graminearum and the oomycete Pythium aphanidermatum. Originally isolated from...

  4. The Medicinal Values of Culinary-Medicinal Royal Sun Mushroom (Agaricus blazei Murrill

    Directory of Open Access Journals (Sweden)

    Hang Wang


    Full Text Available Agaricus blazei Murrill (ABM, a mushroom native to Brazil, is a basidiomycete brown fungus, which is popularly known as “Cogumelo do Sol” in Brazil or “Himematsutake” in Japan, and there has been a prominent increase in the use of ABM for therapeutic and medicinal purposes. ABM is useful against a variety of diseases like cancer, tumor, chronic hepatitis, diabetes, atherosclerosis, hypercholesterolemia, and so on. In this review, we demonstrated various pharmacological effects of ABM, so that we can use different effects of ABM against different diseases and provide reference for the study of ABM in the future.



    Zapata, Paula; Rojas, Diego; Fernández, Carlos; Ramírez, David; Restrepo, Gloria; Orjuela, Viviana; Arroyave, Marcela; Gómez, Tatiana; Atehortüa, Lucía


    Grifóla frondosa es un hongo Basidiomycete comestible y medicinal que produce polisacáridos tipo glucanos (β-1,6 y β-1,3) con actividad antitumoral e inmunomoduladora. Para el presente trabajo, el objetivo fue evaluar la incidencia de diferentes fuentes de carbono (FC) en la producción de biomasa y exopolisacári-dos (EPS), bajo condiciones de cultivo sumergido, utilizando un diseño estadístico factorial con dos factores: fuente de carbono (FC(1-7)) y medio (MB y MS). La máxima produ...

  6. Effect of type of fungal culture, type of pellets and pH on the semi-continuous post-treatment of an anaerobically-pretreated weak black liquor from kraft pulp industry

    Energy Technology Data Exchange (ETDEWEB)

    Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.


    It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)

  7. Biology stage of Moniliophthora roreri in Colombia


    Correa Álvarez, Javier; Castro Martínez, Sergio; Coy, Jairo


    La moniliasis es una enfermedad fúngica que ataca el cultivo de cacao, causada por el basidiomycete Moniliophthora roreri -- Está presente en la mayoría de los países latinoamericanos y se adapta a diversidad de ambientes -- En Colombia la enfermedad es devastadora y las estrategias de control tradicional han generado resultados colaterales como el fortalecimiento de la resistencia genética de cepas del hongo en algunas regiones -- En esta revisión, se recopilan los aspectos biológicos y agro...

  8. Estado de la moniliasis del cacao causada por moniliophthora roreri en colombia


    Correa Alvarez, Javier; Castro Martínez, Sergio; Coy, Jairo


    La Moniliasis es una enfermedad fúngica que ataca el cultivo de cacao, causada por el basidiomycete Mo-niliophthora roreri. Está presente en la mayoría de los países latinoamericanos y se adapta a diversidad de ambientes. En Colombia la enfermedad es devastadora y las estrategias de control tradicional han generado resultados colaterales como el fortalecimiento de la resistencia genética de cepas del hongo en algunas regiones. En esta revisión, se recopilan los aspectos biológicos y agronó...

  9. Mineral-microorganism interactions in Acid Mine Drainage environments: preliminary results (United States)

    Carbone, Cristina; Zotti, Mirca; Pozzolini, Marina; Giovine, Marco; Di Piazza, Simone; Mariotti, Mauro; Lucchetti, Gabriella


    Minerals play a key role in controlling the mobility and distribution of metals and metalloids of environmental concern in supergenic environments. These are involved in a variety of processes, spanning the alteration of primary minerals to the formation of secondary authigenic phases and can represent a source or a trap for Potentially Ecotoxic Elements (PTEs). Soil, sediments, and waters heavily polluted with PTEs through AMD processes are a reservoir of a unusual bacteria and fungi well adapted to these toxic environments. Classical studies of biotic weathering have mainly focused on water-mineral interaction and on the ability of microorganism to influence the soil solution chemical composition. In this work, we analyzed two different representative ochreous and greenish-blue AMD colloidal precipitates in order to i) characterize the biota population present in these colloidal minerals and ii) verify the bioaccumulation of PTEs into the fungi and the potential impact of bacteria in the geochemistry of the system. The samples are composed by nanocrystalline goethite which contains high amounts of Fe, Cu, Zn, Pb, and Ni and woodwardite that is characterized by Cu, Zn, Ni, Y, and Ce. These precipitates were examined in order to evaluate the presence of fungal strains and to extract bacteria DNA. The preliminary results of fungi characterization show an interesting and selected mycobiota able to survive under unfavourable environmental conditions. A significant number of fungal strains was isolated in pure culture. Most of them belong to the genus Mucor and Penicillium. It is worth noting the presence of Trametes versicolor, a macrofungal lignicolous species already known for heavy metal biosorption capability from aqueous solution (Gülay et al 2003). The same colloidal precipitates have been processed to extract bacteria DNA, using a specific procedure developed for DNA extraction from sediments. The results gave a good yield of nucleic acids and the positive PCR

  10. Cultivation of shear stress sensitive microorganisms in disposable bag reactor systems. (United States)

    Jonczyk, Patrick; Takenberg, Meike; Hartwig, Steffen; Beutel, Sascha; Berger, Ralf G; Scheper, Thomas


    Technical scale (≥5l) cultivations of shear stress sensitive microorganisms are often difficult to perform, as common bioreactors are usually designed to maximize the oxygen input into the culture medium. This is achieved by mechanical stirrers, causing high shear stress. Examples for shear stress sensitive microorganisms, for which no specific cultivation systems exist, are many anaerobic bacteria and fungi, such as basidiomycetes. In this work a disposable bag bioreactor developed for cultivation of mammalian cells was investigated to evaluate its potential to cultivate shear stress sensitive anaerobic Eubacterium ramulus and shear stress sensitive basidiomycetes Flammulina velutipes and Pleurotus sapidus. All cultivations were compared with conventional stainless steel stirred tank reactors (STR) cultivations. Good growth of all investigated microorganisms cultivated in the bag reactor was found. E. ramulus showed growth rates of μ=0.56 h⁻¹ (bag) and μ=0.53 h⁻¹ (STR). Differences concerning morphology, enzymatic activities and growth in fungal cultivations were observed. In the bag reactor growth in form of small, independent pellets was observed while STR cultivations showed intense aggregation. F. velutipes reached higher biomass concentrations (21.2 g l⁻¹ DCW vs. 16.8 g l⁻¹ DCW) and up to 2-fold higher peptidolytic activities in comparison to cell cultivation in stirred tank reactors. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Pretreatment of lignocellulosic material with fungi capable of higher lignin degradation and lower carbohydrate degradation improves substrate acid hydrolysis and the eventual conversion to ethanol

    Energy Technology Data Exchange (ETDEWEB)

    Kuhar, S.; Nair, L.M.; Kuhad, R.C. [Delhi Univ., New Delhi (India). Dept. of Microbiology, Lignocellulose Biotechnology Laboratory


    Lignocellulosic biomass is the most abundant energy resource in the world and is a potential source of carbon substrate for the production of ethanol via fermentation. However, the presence of lignin restricts access to holocellulose. It is necessary to break or remove the lignin in plant residues prior to their hydrolysis. Pretreatment is needed to liberate cellulose and hemicellulose from the lignins. This paper discussed a biological delignification method that avoided the use of toxic and corrosive chemicals. The in situ microbial delignification process used white rot fungi as a basidiomycetes for biological pretreatment. The study examined the capability of 4 basidiomycetes fungi, notably: (1) Phanerochaete chrysosporium; (2) Pycnoporus cinnabarinus; (3) fungal isolate RCK-1; and (4) fungal isolate RCK-3. The fungi were used to delignify wheat straw and improve hydrolysis procedures. Attempts were also made to ferment the acid hydrolysates from fungal-pretreated lignocellulosic materials. Results of the experiment showed that higher yields of ethanol were obtained using selective lignin-degrading fungi as a pretreatment method. 39 refs., 3 tabs., 4 figs.

  12. Carbohydrate-active enzymes from the zygomycete fungus Rhizopus oryzae: a highly specialized approach to carbohydrate degradation depicted at genome level

    Directory of Open Access Journals (Sweden)

    Henrissat Bernard


    Full Text Available Abstract Background Rhizopus oryzae is a zygomycete filamentous fungus, well-known as a saprobe ubiquitous in soil and as a pathogenic/spoilage fungus, causing Rhizopus rot and mucomycoses. Results Carbohydrate Active enzyme (CAZy annotation of the R. oryzae identified, in contrast to other filamentous fungi, a low number of glycoside hydrolases (GHs and a high number of glycosyl transferases (GTs and carbohydrate esterases (CEs. A detailed analysis of CAZy families, supported by growth data, demonstrates highly specialized plant and fungal cell wall degrading abilities distinct from ascomycetes and basidiomycetes. The specific genomic and growth features for degradation of easily digestible plant cell wall mono- and polysaccharides (starch, galactomannan, unbranched pectin, hexose sugars, chitin, chitosan, β-1,3-glucan and fungal cell wall fractions suggest specific adaptations of R. oryzae to its environment. Conclusions CAZy analyses of the genome of the zygomycete fungus R. oryzae and comparison to ascomycetes and basidiomycete species revealed how evolution has shaped its genetic content with respect to carbohydrate degradation, after divergence from the Ascomycota and Basidiomycota.

  13. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Directory of Open Access Journals (Sweden)

    Patricia Valente

    Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T  =  DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T  =  CBS 12527(T  =  ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T  =  ATCC MYA-4603(T  =  MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T  =  NU7M71(T  =  BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T  =  NRRL Y-48076(T  =  ATCC MYA-4760(T  =  BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T  =  DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T  =  NRRL Y-48783(T  =  NCAIM Y.01952(T.

  14. Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1alpha genes. (United States)

    Voigt, K; Wöstemeyer, J


    True fungi (Eumycota) are heterotrophic eukaryotic microorganisms encompassing ascomycetes, basidiomycetes, chytridiomycetes and zygomycetes. The natural systematics of the latter group, Zygomycota, are very poorly understood due to the lack of distinguishing morphological characters. We have determined sequences for the nuclear-encoded genes actin (act) from 82 zygomycetes representing all 54 currently recognized genera from the two zygomycetous orders Mucorales and Mortierellales. We also determined sequences for translation elongation factor EF-1alpha (tef) from 16 zygomycetes (total of 96,837 bp). Phylogenetic analysis in the context of available sequence data (total 2,062 nucleotide positions per species) revealed that current classification schemes for the mucoralean fungi are highly unnatural at the family and, to a large extent, at the genus level. The data clearly indicate a deep, ancient and distinct dichotomy of the orders Mucorales and Mortierellales, which are recognized only in some zygomycete systems. Yet at the same time the data show that two genera - Umbelopsis and Micromucor - previously placed within the Mortierellales on the basis of their weakly developed columella (a morphological structure of the sporangiophore well-developed within all Mucorales) are in fact members of the Mucorales. Phylogenetic analyses of the encoded amino acid sequences in the context of homologues from eukaryotes and archaebacterial outgroups indicate that the Eumycota studied here are a natural group but provide little or no support for the monophyly of either zygomycetes, ascomycetes or basidiomycetes. The data clearly indicate that a complete revision of zygomycete natural systematics is necessary.

  15. Microbial community analysis of field-grown soybeans with different nodulation phenotypes. (United States)

    Ikeda, Seishi; Rallos, Lynn Esther E; Okubo, Takashi; Eda, Shima; Inaba, Shoko; Mitsui, Hisayuki; Minamisawa, Kiwamu


    Microorganisms associated with the stems and roots of nonnodulated (Nod(-)), wild-type nodulated (Nod(+)), and hypernodulated (Nod(++)) soybeans [Glycine max (L.) Merril] were analyzed by ribosomal intergenic transcribed spacer analysis (RISA) and automated RISA (ARISA). RISA of stem samples detected no bands specific to the nodulation phenotype, whereas RISA of root samples revealed differential bands for the nodulation phenotypes. Pseudomonas fluorescens was exclusively associated with Nod(+) soybean roots. Fusarium solani was stably associated with nodulated (Nod(+) and Nod(++)) roots and less abundant in Nod(-) soybeans, whereas the abundance of basidiomycetes was just the opposite. The phylogenetic analyses suggested that these basidiomycetous fungi might represent a root-associated group in the Auriculariales. Principal-component analysis of the ARISA results showed that there was no clear relationship between nodulation phenotype and bacterial community structure in the stem. In contrast, both the bacterial and fungal community structures in the roots were related to nodulation phenotype. The principal-component analysis further suggested that bacterial community structure in roots could be classified into three groups according to the nodulation phenotype (Nod(-), Nod(+), or Nod(++)). The analysis of root samples indicated that the microbial community in Nod(-) soybeans was more similar to that in Nod(++) soybeans than to that in Nod(+) soybeans.

  16. Microbial Community Analysis of Field-Grown Soybeans with Different Nodulation Phenotypes▿ (United States)

    Ikeda, Seishi; Rallos, Lynn Esther E.; Okubo, Takashi; Eda, Shima; Inaba, Shoko; Mitsui, Hisayuki; Minamisawa, Kiwamu


    Microorganisms associated with the stems and roots of nonnodulated (Nod−), wild-type nodulated (Nod+), and hypernodulated (Nod++) soybeans [Glycine max (L.) Merril] were analyzed by ribosomal intergenic transcribed spacer analysis (RISA) and automated RISA (ARISA). RISA of stem samples detected no bands specific to the nodulation phenotype, whereas RISA of root samples revealed differential bands for the nodulation phenotypes. Pseudomonas fluorescens was exclusively associated with Nod+ soybean roots. Fusarium solani was stably associated with nodulated (Nod+ and Nod++) roots and less abundant in Nod− soybeans, whereas the abundance of basidiomycetes was just the opposite. The phylogenetic analyses suggested that these basidiomycetous fungi might represent a root-associated group in the Auriculariales. Principal-component analysis of the ARISA results showed that there was no clear relationship between nodulation phenotype and bacterial community structure in the stem. In contrast, both the bacterial and fungal community structures in the roots were related to nodulation phenotype. The principal-component analysis further suggested that bacterial community structure in roots could be classified into three groups according to the nodulation phenotype (Nod−, Nod+, or Nod++). The analysis of root samples indicated that the microbial community in Nod− soybeans was more similar to that in Nod++ soybeans than to that in Nod+ soybeans. PMID:18658280

  17. Cellobiose dehydrogenase of Chaetomium sp. INBI 2-26(-): structural basis of enhanced activity toward glucose at neutral pH. (United States)

    Vasilchenko, Liliya G; Karapetyan, Karen N; Yershevich, Olga P; Ludwig, Roland; Zamocky, Marcel; Peterbauer, Clemens K; Haltrich, Dietmar; Rabinovich, Mikhail L


    Cellobiose dehydrogenase (CDH) is an extracellular fungal flavocytochrome specifically oxidizing cellooligosaccharides and lactose to corresponding (-lactones by a variety of electron acceptors. In contrast to basidiomycetous CDHs, CDHs of ascomycetes also display certain activity toward glucose. The objective of this study was to establish the structural reasons of such an activity of CDH from mesophilic ascomycete Chaetomium sp. INBI 2-26 (ChCDH). The complete amino acid sequence of ChCDH displayed high levels of similarity with the amino acid sequences of CDHs from the thermophilic fungi Thielavia heterotallica and Myriococcum thermophilum. Peptide mass fingerprinting of purified ChCDH provided evidence for the oxidation of methionine residues in the FAD-domain. Comparative homology modeling of the structure of the ChCDH FAD-domain in complex with the transition state analog based on the structure of the same complex of basidiomycetous CDH (1NAA) as template indicated possible structural reasons for the enhanced activity of ascomycetous CDHs toward glucose at neutral pH, which is a prerequisite for application of CDH in a variety of biocompatible biosensors and biofuel cells. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. New data on agaricoid fungi of the Katunsky State Nature Reserve and rare fungi of the Republic of Altai (Russia

    Directory of Open Access Journals (Sweden)

    Irina A. Gorbunova


    Full Text Available The article presents new data on agaricoid basidiomycetes of the Katunsky State Nature Reserve (Republic of Altai, Russia, including data on rare species. Besides the paper contains characteristics of some rare ascomycetes and basidiomycetes found in the Katunsky Reserve and in the Republic of Altai as well as about species recommended for inclusion in the new edition of the Red Data Book of the Republic of Altai. In total descriptions of 17 species of macromycetes are presented. These are Chroogomphus sibiricus, Cortinarius violaceus, Floccularia luteovirens, Ganoderma lucidum, Grifola frondosa, Lactarius lignyotus, Leucoagaricus nympharum, Leucopholiota lignicola, Gastrosporium simplex, Gyromitra sphaerospora, Laricifomes officinalis, Bovista acuminata, Hydropus atramentosus, Leucopaxillus rhodoleucus, Phallus costatus, Polyozellus multiplex and Polyporus rhizophilus. We present data on species' distribution throughout the Republic of Altai, Russia and the world; some ecological and biological features of species; major threats and their conservation status. Arguments for exclusion of Amanita echinocephala, Hericium coralloides, Cystoderma rugosoreticulatum, Leccinum percandidum, Mutinus caninus from the list of rare species of the region are presented.

  19. Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate. (United States)

    Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji


    Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Secretome-based Manganese(II) Oxidation by Filamentous Ascomycete Fungi (United States)

    Zeiner, C. A.; Purvine, S.; Zink, E.; Paša-Tolić, L.; Chaput, D.; Wu, S.; Santelli, C. M.; Hansel, C. M.


    Manganese (Mn) oxides are among the strongest oxidants in the environment, and Mn(II) oxidation to Mn(III/IV) (hydr)oxides includes both abiotic and microbially-mediated processes. While white-rot Basidiomycete fungi oxidize Mn(II) using laccases and Mn peroxidases in association with lignocellulose degradation, the mechanisms by which filamentous Ascomycete fungi oxidize Mn(II) and a physiological role for Mn(II) oxidation in these organisms remain poorly understood. Through a combination of chemical and in-gel assays, bulk mass spectrometry, and iTRAQ proteomics, we demonstrate enzymatic Mn(II) oxidation in the secretomes of three phylogenetically diverse Ascomycetes that were isolated from Mn-laden sediments. Candidate Mn(II)-oxidizing enzymes were species-specific and included bilirubin oxidase and tyrosinase in Stagonospora sp. SRC1lsM3a, GMC oxidoreductase in Paraconiothyrium sporulosum AP3s5-JAC2a, and FAD-binding oxidoreductases in Pyrenochaeta sp. DS3sAY3a. These findings were supported by full proteomic characterization of the secretomes, which revealed a lack of Mn, lignin, and versatile peroxidases in these Ascomycetes but a substantially higher proportion of LMCOs and GMC oxidoreductases compared to wood-rot Basidiomycetes. We also identified the potential for indirect enzymatic Mn(II) oxidation by hydroxyl radical, as the secretomes were rich in diverse lignocellulose-degrading enzymes that could participate in Fenton chemistry. A link between Mn(II) oxidation and carbon oxidation analogous to white-rot Basidiomycetes remains unknown in these Ascomycetes. Interestingly, growth rates on rich medium were unaffected by the presence of Mn(II), and the production of Mn(II)-oxidizing proteins in the secretome was constitutive and not inducible by Mn(II). Thus, no physiological benefit of Mn(II) oxidation in these Ascomycetes has yet been identified, and Mn(II) oxidation appears to be a side reaction. Future work will explore the lignin-degrading capacity of

  1. The solar iron abundance: not the last word

    NARCIS (Netherlands)

    Kostik, R.I.; Shchukina, N.G.; Rutten, R.J.


    Determinations of the solar iron abundance have converged to the meteoritic value with the Fe II studies of Holweger et al. (1990), Biémont et al. (1991) and Hannaford et al. (1992) and the Fe i results of Holweger et al. (1991). However, the latter authors pointed out that Blackwell et al. (1984)

  2. 78 FR 70319 - National Register of Historic Places; Notification of Pending Nominations and Related Actions (United States)


    ... Waverly Municipal Hydroelectric Powerhouse, 121 1st St., NE., Waverly, 13000923 Guthrie County Sexton...., Lincolnton, 13000934 New Hanover County Sprunt, James D. and Frances, House, 207 N. Lumina Ave., Wrightsville... Kay County Larkin Hotel, 201 N. Main, Blackwell, 13000940 Marshall County Bounds, James H., Barn...

  3. Chest wall tuberculosis simulating breast carcinoma: Imaging appearance

    International Nuclear Information System (INIS)

    Goyal, M.; Sharma, R.; Sharma, A.; Swahney, S.; Berry, M.; Chumber, S.


    Tuberculosis of the breast is a rare disease. Tubercular abscesses predominantly affecting the soft tissues are also very infrequent. A case of chest wall tuberculosis secondarily involving the breast presenting as a hard, fixed lump simulating mammary carcinoma is presented here. There was no evidence of pleural or pulmonary tuberculosis. Copyright (1998) Blackwell Science Pty Ltd

  4. Big cat scan: magnetic resonance imaging of the tiger

    International Nuclear Information System (INIS)

    Snow, Thomas M.; Gregory, Richard J.W.; Litster, Annette L.; Hanger, Jonathan J.


    In August 2002, we performed MRI scans on a female juvenile Bengal tiger. We present the clinical course, imaging and autopsy findings, and some comparative anatomy of the tiger brain and skull. Magnetic resonance images of a tiger have not previously been published Copyright (2004) Blackwell Publishing Asia Pty Ltd

  5. Mihaly Csikszentmihalyi

    DEFF Research Database (Denmark)

    Knoop, Hans Henrik


    Knoop, H. H. (in press). Mihaly Csikszentmihaly. In B. J. Carducci (Editor-in-Chief) & A. Di Fabio, D. H. Saklofske, & C. Stough (Vol. Eds.), The Wiley-Blackwell encyclopedia of personality and individual differences: Vol. III. Personality processes and individual differences. Hoboken, NJ: John...

  6. Assessing and accounting for time heterogeneity in stochastic actor oriented models

    NARCIS (Netherlands)

    Lospinoso, Joshua A.; Schweinberger, Michael; Snijders, Tom A. B.; Ripley, Ruth M.

    This paper explores time heterogeneity in stochastic actor oriented models (SAOM) proposed by Snijders (Sociological methodology. Blackwell, Boston, pp 361-395, 2001) which are meant to study the evolution of networks. SAOMs model social networks as directed graphs with nodes representing people,

  7. False-positive breast screening due to fat necrosis following mammography

    International Nuclear Information System (INIS)

    Cawson, Jennifer N.; Malara, Frank A.


    Traumatic fat necrosis can result in a spectrum of imaging appearances that range from characteristically benign to those indistinguishable from malignancy. In such cases, biopsy might be required for diagnosis. The present case demonstrates a suspicious mammographic mass lesion appearing following a haematoma caused by a previous screening mammogram Copyright (2004) Blackwell Publishing Asia Pty Ltd

  8. Mesenteric Castleman's disease: ultrasound, computed tomography and angiographic appearance

    International Nuclear Information System (INIS)

    Malara, F.A.; Price, D.; Fabiny


    The localized form of Castleman's disease is rare, and a mesenteric location is particularly unusual. A case of an asymptomatic young woman having the hyaline vascular type is presented and the ultrasound, computed tomography (CT) and angiographic features of the condition are demonstrated. Copyright (1999) Blackwell Science Pty Ltd

  9. Nitrogen uptake by size-fractionated plankton in permanently well-mixed temperate coastal waters

    Digital Repository Service at National Institute of Oceanography (India)

    Wafar, M.V.M.; L'Helguen, S.; Raikar, V.; Maguernd, J.-F.; Le Corre, P.

    ’absorption de l’azote dans un syste`me brasse´ peu profound (Manche occidentale). Oceanol. Acta., 19, 529–537. Malone, T. C. (1980) Algal size. In Morris, I. (ed.), The Physiological Ecology of Phytoplankton. Blackwell, Oxford, UK, 433–463. Platt, T. and Li, W...

  10. Multiple-Vehicle Resource-Constrained Navigation in the Deep Ocean (United States)


    David E. Hardt Chairman, Department Committee on Graduate Students MIT Accepted by...Blackwell, 2007. [84] I.G. Priede, S. Addison, S. Bradley, P.M. Bagley, P. Gray, C. Yau, J.-F. Rolin, J. Blandin, J. Legrand, A. Cremer , U. Witte, O

  11. Observations on Ecology and National Security (United States)


    central business district.8"* To others, human ecology is concerned almost solely with the interaction between the human species and pathogenic ... aphid population," in Animal Populations in Relation to Their Food Resources. Blackwell, Oxford, England (1970). 14. T.R.E. Southwood and

  12. Ectoparasites of Sheep and Goats in North-West Amhara Regional ...

    African Journals Online (AJOL)

    Livestock are managed under extensive system in all of the three districts. Small ruminants in the areas are indigenous breeds. In Metema ..... Urquhart, G.M., Armour, J., Duncan, J.L., Dunn, A.M. and Jennings, F.M., 1996. Veterinary. Parasitology. 2nd Edition, Blackwell Science, London, PP.141-205. Walker, A.R., Bouattour ...

  13. Paradoxical embolism: computed tomography demonstration

    International Nuclear Information System (INIS)

    Kaye, J.; Hayward, M.


    Paradoxical emboli are rare and often presumptively diagnosed. A case of paradoxical embolism, in which both the arterial and venous emboli were documented on CT, is described. While paradoxical emboli are not infrequently diagnosed clinically on a presumptive basis, it is rare to document them with imaging such as CT which, in the present case, confirmed the diagnosis. Copyright (2001) Blackwell Science Pty Ltd

  14. Anesthetic considerations for rapid-onset obesity, hypoventilation, hypothalamic dysfunction, and autonomic dysfunction (ROHHAD) syndrome in children. (United States)

    Chandrakantan, Arvind; Poulton, Thomas J


    Rapid-onset obesity, hypoventilation, hypothalamic dysfunction, and autonomic dysfunction is an increasingly common diagnosis in patients who are being seen at tertiary care children's hospitals. We present two cases of anesthetics from the authors' own experience in addition to a comprehensive review of the disorder and anesthetic implications. © 2012 Blackwell Publishing Ltd.

  15. Book review Biogeochemistry of Marine Systems By Pierre William ...

    African Journals Online (AJOL)

    Blackwell Publishing, 9600 Garsington Road, Oxford, OX4 2DQ, UK. CRC Press, Boca Raton, USA Hardback and paperback available, 334 pages, 269 illustrations. Hardback ISBN 1814 27 3279; price £99.50. Paperback ISBN 063 2055 567; price US$64.95. African Journal of Aquatic Science 2005, 30(1): 91 ...

  16. Changing Mindsets: Evaluation Report and Executive Summary (United States)

    Rienzo, Cinzia; Rolfe, Heather; Wilkinson, David


    The Changing Mindsets project sought to improve academic attainment by supporting pupils to develop a growth mindset: the belief that intelligence is not a fixed characteristic and can be increased through effort. Previous research (Good et al., 2003; Blackwell et al., 2007) has suggested that holding this belief enables pupils to work harder and…

  17. Unusual presentation of perirenal lung metastases

    International Nuclear Information System (INIS)

    D'Souza, D.L.; Heinze, S.B.; Dowling, R.J.


    Lung cancer is not commonly known to metastasise to the perirenal space, with only five such cases previously published. We present an unusual case of perirenal lung metastases manifesting as diffuse perinephric stranding which to our knowledge has not been described before Copyright (2006) Blackwell Publishing Asia Pty Ltd


    African Journals Online (AJOL)

    theory. The structural and vibrational properties of dopamine-4-N7GUA and ... There is evidence, however, that DA is involved in the ... spectra to the results of ab initio gauge-invariant atomic orbital (GIAO) [14-17] and continuous- ..... Nicholls, G. Proteins, transmitter & synapses, Blackwell Scientific Publication: Scotland;.

  19. Magnetic resonance imaging anatomy of the anal canal

    International Nuclear Information System (INIS)

    Kashyap, P.; Bates, N.


    The anatomy of the anal canal is complex but well demonstrated by MRI. Understanding the anatomy is a prerequisite for determining the true site and the extent of pathology, especially for surgical workup. In this article, the MRI anatomy of the anal canal has been displayed using highlighted MRI images and line diagrams. Copyright (2004) Blackwell Science Pty Ltd


    African Journals Online (AJOL)


    and endometriosis-related adhesions. Obstet Gynecol. 1998; 92:766-70. 4. Sulaiman H, Gabelle G, Davis MSc C, Mutsaers SE,. Boulos P, Laurent GJ et al. Presence and distribution of sensory nerve fibers in human peritoneal adhesions. Ann. Surg 2001;234,2: 256-61. 5. Olive DL, Blackwell RE, Copperman AB. En-.

  1. Anomalous rare earth element, yttrium and zirconium mobility associated with uranium mineralization

    Czech Academy of Sciences Publication Activity Database

    René, Miloš


    Roč. 20, č. 1 (2008), s. 52-58 ISSN 0954-4879 Institutional research plan: CEZ:AV0Z30460519 Keywords : Moldanubian Zone * uranium * geochemistry Subject RIV: DB - Geology ; Mineralogy Impact factor: 1.899, year: 2008

  2. Vertical vs. Horizontal Integration: Pre-emptive Merging.


    Colangelo, Giuseppe


    Preemption plays a crucial role in arms merger decisions. The author studies whether and under which circumstances preemptive merging occurs in vertically related industries. He finds that vertical mergers often preempt horizontal mergers and are dominant outcomes. Preempting the threat of a detrimental horizontal integration may be the main reason for vertically integrating. Copyright 1995 by Blackwell Publishing Ltd.

  3. Neuroradiologic findings in brown snake envenomation: Computed tomography demonstration

    International Nuclear Information System (INIS)

    Midyett, F.A.


    A case of fatal brown snake (Pseudonaja textilis) envenomation is presented. The CT examinations show rapid development and progression of atypical bilateral intracerebral haematomas (ICH) which produce a fatal outcome despite correction of the underlying coagulopathy. The striking CT appearance suggests coagulopathy and is predictive of increased mortality. Copyright (1998) Blackwell Science Pty Ltd

  4. A Study of Communicating Science and Engineeing (United States)


    and worldwide. Recently, Vogler wrote the screenplay and song lyrics for JESTER TILL, an animated film about the popular European folk character Till...Education and an essay collection published by Blackwell. She is a hospice volunteer and a frequent public speaker. Lewis is married to a chemist and

  5. Focal myositis

    International Nuclear Information System (INIS)

    Galloway, H.R.; Dahlstrom, J.E.; Bennett, G.M.


    Focal myositis is a rare, benign focal inflammation of muscle. The lesion often presents as a mass that may be mistaken for a soft tissue sarcoma. This report describes the MRI and histopathological features of a case and illustrates how the diagnosis may be suspected on the basis of the MR findings. Copyright (2001) Blackwell Science Pty Ltd

  6. International Journal of Arts and Humanities (IJAH) Bahir Dar- Ethiopia

    African Journals Online (AJOL)

    Nneka Umera-Okeke

    Consolidated Book Publishers, 1975. Print. Ngcobo, Lauretta. “Africa Motherhood – Myth and Reality” in Olaniyan Tejumola and. Quayson Ato. (Eds.) African Literature: A Anthology of Critisism and Theory. Oxford: Blackwell Publishing, 2007. Print. Nwahunanya, Chinyere. “Jagua Nana's Children: The Image of the Prostitute ...

  7. Analysis of patient load data for teams competing in the 2003 cricket ...

    African Journals Online (AJOL)

    teams taking part in 10 warm-up matches and 46 matches during the 2003 Cricket World Cup played in South Africa, .... Medical support was provided from the time that the teams arrived in the country, and the medical staff were ..... Melbourne: Blackwell, 1995, 674 - 8. 5. Orchard J, James T, Alcott E, Carter S, Farhart P.

  8. Cardiac metastasis from carcinoid tumour: Magnetic resonance imaging findings

    International Nuclear Information System (INIS)

    Puvaneswary, M.; Thomson, D.; Bellamy, G.R.


    A case of myocardial metastasis from a gastrointestinal carcinoid is presented. The colon was the primary site. The patient did not manifest symptoms of carcinoid syndrome and had no echocardiographic or MRI evidence of carcinoid valvular heart disease. Copyright (2004) Blackwell Science Pty Ltd

  9. A Vision System Model (United States)


    Away" in Mind and Cognition: A Reader. Ed. William G. Lycan. Cambridge MA: Basil Blackwell. Pp. 63-77. (1990c). Descartes , Rene . Rules for the Direction...other case, we accept that we cannot or need not understand the methods of the brain [behaviorism - Watson; Dualism - Descartes ; Intentionalism

  10. Computed tomography and complicated peptic ulcer disease

    International Nuclear Information System (INIS)

    Pun, E.; Firkin, A.


    Peptic ulcer disease (PUD) can present with many complications including inflammation, ulceration and perforation. Improvements in CT have enabled better imaging of the gastroduodenal area. Three cases of complicated PUD detected on CT are presented with a brief review of the current literature. Copyright (2004) Blackwell Science Pty Ltd

  11. Isolated optic nerve pseudotumour

    International Nuclear Information System (INIS)

    Patankar, T.; Prasad, S.; Krishnan, A.; Laxminarayan, R.


    Isolated optic nerve involvement by the idiopathic inflammatory process is a rare finding and very few reports are available. Here a case of an isolated optic nerve inflammatory pseudotumour presenting with gradually progressive unilateral loss of vision is described. It showed dramatic response to a trial of steroids and its differential diagnoses are discussed. Copyright (1999) Blackwell Science Pty Ltd

  12. Bilateral subacromial bursitis with macroscopic rice bodies: Ultrasound, CT and MR appearance

    International Nuclear Information System (INIS)

    Law, T.C.; Chong, S.F.; Lu, P.P.; Mak, K.H.


    The radiological findings of ultrasound, CT and MR of a case of bilateral subacromial bursitis with macroscopic rice bodies is described. MRI is the investigation of choice and the intravenous gadolinium-enhanced usefulness was noted. The previous literature is also reviewed. Copyright (1998) Blackwell Science Pty Ltd

  13. Bilateral subacromial bursitis with macroscopic rice bodies: Ultrasound, CT and MR appearance

    Energy Technology Data Exchange (ETDEWEB)

    Law, T.C.; Chong, S.F.; Lu, P.P. [Kwong Wah Hospital (Hong Kong). Department of Radiology; Mak, K.H. [Kwong Wah Hospital (Hong Kong). Department of Orthopaedics and Traumatology


    The radiological findings of ultrasound, CT and MR of a case of bilateral subacromial bursitis with macroscopic rice bodies is described. MRI is the investigation of choice and the intravenous gadolinium-enhanced usefulness was noted. The previous literature is also reviewed. Copyright (1998) Blackwell Science Pty Ltd 5 refs., 1 tab., 4 figs.

  14. Identification of ectopic ovotestis in a dog with XX ovotesticular, SRY-negative, disorder of sexual development. (United States)

    Diel de Amorim, M; Lerer, A; Durzi, T; Foster, R A; Gartley, C J


    A 1-year-old, previously spayed phenotypic female Poodle/Soft-coated Wheaten Terrier (Whoodle) cross was presented for a suspected ovarian remnant. Serum luteinizing hormone (LH) concentration was below the detection limit (XX karyotype, thus confirming the diagnosis of ectopic ovotestis in a XX ovotesticular, SRY-negative, disorder of sexual development in a dog. © 2018 Blackwell Verlag GmbH.

  15. Cross-cultural examination of the five-factor model of drinking motives in Spanish and Canadian undergraduates

    NARCIS (Netherlands)

    Mezquita, L.; Stewart, S.H.; Kuntsche, E.N.; Grant, V.V.


    This study aims to test the cross-cultural suitability of Modified Drinking Motives Questionnaire-Revised (M DMQ-R) (Grant, Stewart, O'Connor, Blackwell, & Conrod, 2007). The sample included 571 Spanish and 571 Canadian undergraduates between the ages of 18 and 22 (65.8% women). The confirmatory

  16. Vector Antenna and Maximum Likelihood Imaging for Radio Astronomy (United States)


    398, 1994. [21] A. Nehorai, K. C. Ho, and B. T. G. Tan , “Minimum- 14 noise-variance beamformer with an electromagnetic vector sensor,” IEEE...G. Eslinger, A. Nicholas , and C. Pong, “The MicroMAS CubeSat Mission,” AGU Fall Meet. Abstr., vol. -1, p. 2162, Dec. 2012. [39] W. Blackwell, G

  17. Women's Rights Movements in the Nineteenth Century: Conflict and Progress (United States)

    Gilbert, Janet


    Historical review of the function of social conflict in the nineteenth century women's rights movements. Considers whether suffrage and a move toward equality could have been accomplished without major philosophical differences. Differences between the Stanton and Anthony suffrage group and the Stone and Blackwell suffrage group are discussed.…

  18. 78 FR 9682 - Combined Notice of Filings #2 (United States)


    ... Wholesale Generator Status of Niagara Wind Power, LLC. Filed Date: 1/31/13. Accession Number: 20130131-5139... Facility, LLC, Blackwell Wind, LLC, Butler Ridge Wind Energy Center, LLC, Cimarron Wind Energy, LLC....P., Florida Power & Light Co., FPL Energy Burleigh County Wind, LLC, FPL Energy Cabazon Wind, LLC...

  19. Concepts and methods in neuromodulation and functional electrical stimulation: an introduction. (United States)

    Holsheimer, J


    This article introduces two clinical fields in which stimulation is applied to the nervous system: neuromodulation and functional electrical stimulation. The concepts underlying these fields and their main clinical applications, as well as the methods and techniques used in each field, are described. Concepts and techniques common in one field that might be beneficial to the other are discussed. 1998 Blackwell Science, Inc.

  20. Tuberous sclerosis: Ultrasound, CT and MRI features of two cases with multiple organ involvement

    International Nuclear Information System (INIS)

    Arslan, A.; Ciftci, E.; Cetin, A.; Selcuk, H.; Demirci, A.


    The cases of two patients with tuberous sclerosis with multiple sites of involvement are presented. Both patients had characteristic cerebral lesions of tuberous sclerosis associated with bilateral renal angiomyolipomas and hepatic hamartomas. Additionally there were diffuse pulmonary cystic changes in one patient and cardiac rhabdomyoma in the other. Copyright (1998) Blackwell Science Pty Ltd

  1. Mobile Technologies in Schools: The Student Voice (United States)

    Hodge, Emma-Leigh; Robertson, Neville; Sargisson, Rebecca J.


    Intermediate and high school students spend a large amount of time using mobile devices (Lauricella, Cingel, Blackwell, Wartella, & Conway, 2014), and such devices are increasingly being integrated into our school system. We conducted a series of student-led focus groups, with this early adolescent cohort, in order to better understand their…

  2. Modeling Theory of Mind and Cognitive Appraisal with Decision-Theoretic Agents (United States)


    the bully believing himself as powerful). The conditions may also be more complicated combinations of these basic triggers (e.g., a conjunction of...Press, 1995. [49] A. Whiten , editor. Natural Theories of Mind. Basil Blackwell, Oxford, UK, 1991. 30

  3. Identification of a divergent genotype of equine arteritis virus from South American donkeys. (United States)

    Rivas, J; Neira, V; Mena, J; Brito, B; Garcia, A; Gutierrez, C; Sandoval, D; Ortega, R


    A novel equine arteritis virus (EAV) was isolated and sequenced from feral donkeys in Chile. Phylogenetic analysis indicates that the new virus and South African asinine strains diverged at least 100 years from equine EAV strains. The results indicate that asinine strains belonged to a different EAV genotype. © 2017 Blackwell Verlag GmbH.

  4. A new non-parametric stationarity test of time series in the time domain

    KAUST Repository

    Jin, Lei; Wang, Suojin; Wang, Haiyan


    © 2015 The Royal Statistical Society and Blackwell Publishing Ltd. We propose a new double-order selection test for checking second-order stationarity of a time series. To develop the test, a sequence of systematic samples is defined via Walsh

  5. Planned Merger of 2 Big Journal Publishers Worries Academic Librarians (United States)

    Glenn, David


    Last week the venerable publisher John Wiley & Sons made a surprise announcement that it would purchase Blackwell Publishing Ltd. for about $1.13-billion, an acquisition likely to have broad consequences for the world of academic journals and libraries. Assuming that the deal is completed, Wiley's scientific, technical, and medical division will…

  6. MO Aziken, *OO Kalu *Department of Obstetrics and Gynaecolog

    African Journals Online (AJOL)


    management of infertility.1,3,4,5 The IVF was performed ... success rate (human reproduction itself being a ... especially needed in a resource-limited setting. .... and Gynaecology 7th edition. Ed. Edmonds K. Blackwell Publishing. 461-478. 6.

  7. An Appraisal of the Management of Ectopic Pregnancy in a Nigerian ...

    African Journals Online (AJOL)


    Dec 31, 2011 ... Analysis was carried out using Epi‑info 2008 version 3.5.1. Results: ... Keywords: Appraisal, Ectopic pregnancy, Management .... and beta human chorionic gonadotrophin (hCG) assay. .... 7th ed. Oxford, London: Blackwell Science; 2007. p. 106‑16. 5. ... tubal.

  8. et de blé dur (Triticum durum

    African Journals Online (AJOL)


    31 mai 2017 ... Study of the genetic diversity of some varieties of bread wheat (Triticum aestivum L.) and durum wheat. (Triticum durum Desf.) ...... Crop adaptation to climate change,1e éd. Oxford, Wiley-Blackwell, 595 p. Zeven AC,1998. Landraces: a review of definitions and classifications. Euphytica 104(2) : 127-139.


    This is a chapter for a book titled “Livestock Epigenetics” edited by Dr. Hasan Khatib and published by Wiley-Blackwell. This chapter is focused on the research development in our laboratory in the area of interaction of nutrients and genomic phonotype in bovine cells. Briefly, the Research on nutri...

  10. 78 FR 9904 - Combined Notice of Filings #1 (United States)


    ..., FPL Energy New Mexico Wind, LLC, FPL Energy North Dakota Wind, LLC, FPL Energy North Dakota Wind II..., LLC, Bayswater Peaking Facility, LLC, Blackwell Wind, LLC, Butler Ridge Wind Energy Center, LLC, Cimarron Wind Energy, LLC, Crystal Lake Wind, LLC, Crystal Lake Wind II, LLC, Crystal Lake Wind III, LLC...

  11. Perioperative considerations in a newly described subtype of congenital long QT syndrome. (United States)

    Joseph-Reynolds, Ann; Auden, Steve; Sobczyzk, Walter


    An infant with a newly-described subtype of congenital long QT syndrome is presented, along with her perioperative management on three separate occasions. During each anaesthetic characteristic arrhythmias occurred. The available literature and rational approaches to these high risk patients are reviewed. 1997 Blackwell Science Ltd.

  12. 76 FR 330 - Takes of Marine Mammals Incidental to Specified Activities; Taking Marine Mammals Incidental to... (United States)


    ... divided into several subspecies. The one most likely to occur in the proposed project area is the Arctic..., Blackwell et al. (2004) conducted a study to measure impacts of pipe-driving sounds on ringed seals at... such species or stock and its habitat, paying particular attention to rookeries, mating grounds, and...

  13. Faith healing in paediatrics: what do we know about its relevance to clinical practice? (United States)

    Baverstock, A; Finlay, F


    There is widespread use of complementary or alternative medicine among adults and children. Families may use faith healing alongside conventional medicine or as an alternative. In their clinical practice, professionals should be aware of this and need to consider asking patients and their families about complementary or alternative medicine use, including faith healing. © 2011 Blackwell Publishing Ltd.

  14. Philosophy of Education Today (United States)

    Chambliss, J. J.


    In this review essay J.J. Chambliss assesses the current state of the field of philosophy of education through analysis of four recent edited compilations: Randall Curren's "A Companion to Philosophy of Education"; Nigel Blake, Paul Smeyers, Richard Smith, and Paul Standish's "The Blackwell Guide to Philosophy of Education"; Wilfred Carr's "The…

  15. On the Limitation of Warranty Duration.


    Emons, Winand


    This paper analyzes the frequently-observed phenomenon that firms offer product warranties that are of much shorter duration than the life expectancy of these products. It is shown that competitive equilibria may entail limitation of warranty duration if firms face adverse selection problems with respect to different consumers. Copyright 1989 by Blackwell Publishing Ltd.

  16. Limnological Investigations: Lake Koocanusa, Montana. Part 4. Factors Controlling Primary Productivity. (United States)


    meant that the reservoir’s phytoplankton comunity spent much of its time below it during reservoir filling. The phytoplanktonic 52 light environment...Handbook No. 12. Oxford: Blackwell Scientific Publications. Vollenweider, R. A. (1975) Input-output models, with special reference to the phosphorus

  17. Real Heroes. (United States)

    Denenberg, Dennis


    Presents stories taken from the book, "50 American Heroes Every Kid Should Meet," explaining that children need to learn about the value of real-life human accomplishments (versus those of athletes, television personalities, and rock stars). The heroes include Elizabeth Blackwell, first American woman doctor; George C. Marshall,…

  18. 78 FR 52784 - National Register of Historic Places; Notification of Pending Nominations and Related Actions (United States)


    ... St. & Martin Luther King Dr., South Bend, 13000727 KANSAS Grant County Lower Cimarron Spring... by University Blvd., Lee Dr., Thorn Run, Fern Hollow & Old Thorn Run Rds. (Moon Township), Coraopolis...), Blackwell, 13000746 TENNESSEE Macon County Red Boiling Springs Bank, 100 Main St., Red Boiling Springs...

  19. Complications of occipital bone pneumatization

    International Nuclear Information System (INIS)

    Moss, Mary; Roche, Jim; Biggs, Michael; Forer, Martin; Fagan, Paul; Davis, Martin


    Four cases of occipital bone pneumatization and subsequent complications are described, which include a pathological fracture of C 1 and the occipital bone, spontaneous subcutaneous emphysema and pneumatocele formation. Reviews of the published literature and possible aetiological factors have been discussed Copyright (2004) Blackwell Publishing Asia Pty Ltd

  20. Interactivity Communication and Trust: Further Studies of Leadership in the Electronic Age (United States)


    behavior of other interlocutors. A CIS affords contingency if it permits an ABA sequence where A represents an initial utterance, query, or behavior...Ed.), (1988). Trust: Making and breaking cooperative relations. Oxford, UK: Basil Blackwell. Gersick, C.J.G. & Hackman, J.R. (1990). Habitual