WorldWideScience

Sample records for macrofungal basidiomycete blackwell

  1. Macrofungal diversity in Colombian Amazon forests varies with regions and regimes of disturbance

    NARCIS (Netherlands)

    Lopez-Quintero, C.A.; Straatsma, G.; Franco-Molano, A.E.; Boekhout, T.

    2012-01-01

    Here we present the results of fungal biodiversity studies from some selected Colombian Amazon forests in relationship to plant biodiversity and successional stages after slash and burn agriculture. Macrofungal diversity was found to differ between forests occurring in two regions (Araracuara vs Ama

  2. Macrofungal Communities in Hyrcanian Forests, North of Iran: Relationships with Season and Forest Types

    Directory of Open Access Journals (Sweden)

    Maryam Karim

    2013-06-01

    Full Text Available The identification of macrofungal genera and species was carried out according to the macroscopic and microscopic characteristics of the specimens, as well as their characteristic responses to some chemical reagents. This study was conducted to identify the forest floor of macrofungal in Parrotia-Carpinetum and planted stands of Cupressus sempervirens and Alnus subcordata in North of Iran (Gorgan, Shast Kalate during 2010-2011. For this purpose, all macrofungal in the area (0.6 ha in separated stands, three plots were collected. Measurements were made from slide preparations stained with cotton blue- lacto- phenol contains 100 ml. Lacctophenol, 2ml 2% aqueous solution of cotton blue, by Olympus light microscope. The results show that 35 species were found which were classified into 21 genera from 16 families. Up to 54% of the species were classified into Parrotia-Carpinetum, 26% Alnus subcordata and 20% Cupressus sempervirens. In wet season 30 species of macrofungal and 13 species in dry season were collected. In spring season 12 species, one species in summer season, 23 species in fall season and 7 species in winter season were found.

  3. Macro-fungal diversity and nutrient content of some edible mushrooms of Nagaland, India

    Directory of Open Access Journals (Sweden)

    RAJESH KUMAR

    2013-05-01

    Full Text Available Kumar R, Tapwal A, Pandey S, Borah RK, Borah DP, Borgohain J. 2013. Macro-fungal diversity and nutrient content of some edible mushrooms of Nagaland, India. Nusantara Bioscience 5: 1-7. The northeast region of India abounds in forest wealth, including variety of flora and fauna. The high humidity during monsoon period provides ideal atmospheric conditions for the growth of diverse group of macrofungal fruit bodies. Nagaland, the northeastern state of India is rich in biodiversity and encompasses large numbers edible and non-edible mushroom species. Young and matured carpophores of 15 wild edible mushroom species were collected from 12 locations in different districts of Nagaland. Out of these four species belongs to family Agaricaceae, two belongs to Tricholomataceae and rest belongs to Boletaceae, Cantherallaceae, Russulaceae, Sarcoscyphaceae, Auriculariaceae, Polyporaceae, Schizophyllaceae, Pleurotaceae and Lyophyllaceae. The selected species were analyzed for proximate analysis of nutritional values. The protein content varies from 22.50-44.93% and carbohydrates were recorded 32.43-52.07% in selected species. The documentation of wild edible mushrooms is very scanty in Northeast India. The key objective of the present study was to generate a database on macrofungal diversity, ecology, ethnomycology, utilization and nutrient status of important wild edible mushroom species of Nagaland, which forms a part of the food culture of the native peoples.

  4. Diversity of macrofungal genus Russula and Amanita in Hirpora Wildlife Sanctuary, Southern Kashmir Himalayas

    Directory of Open Access Journals (Sweden)

    SHAUKET AHMED PALA

    2012-04-01

    Full Text Available Pala SA, Wani AH, Mir RA. 2012. Diversity of macrofungal genus Russula and Amanita in Hirpora Wild Life Sancturary. Biodiversitas 13: 65-71. The Hirpora Wildlife Sanctuary that extends over an area of 114 km2 lies in the Pir Panjal range at a distance of 70 km in south-west of summer capital Srinagar. It is rich in biodiversity including macrofungal diversity. The Sanctuary has been subjected to high ecological and anthropogenic disturbance due to the construction of Mughal road which is major threat for its biodiversity. Since there is hardly any report of documentation of macrofungi from this sanctuary. In this back drop a survey was carried out during the year 2010 and 2011 to explore and invetorise macrofungal diversity of the sanctuary. During the survey a no of macrofungi were documented, among which Amanita and Russula were dominant genus represented by 7 species each. All the 14 species viz. Amanita ceciliae (Berk. & Broome Bas. Amanita flavoconia G.F. Atk., Amanita muscaria var. formosa Pers., Amanita pantherina (Fr. Krombh., Amanita phalloides (Fr. Link., Amanita vaginata (Bull. ex Fr. Vitt., Amanita virosa (Fr. Bertillon, Russula aeruginea Fr., Russula atropurpurea (Krombh. Britz., Russula aurea Pers., Russula cyanoxantha (Schaeff. Fr., Russula delica Fr. Russula emetica (Schaeff. ex Fr. Gray. and Russula nobilis Velen. are ectomycorrhizal in nature and among them Russula aeruginea Fr. is reported first time from the Kashmir.

  5. Forest Biomass, Carbon Stocks, and Macrofungal Dynamics: A Case Study in Costa Rica

    Directory of Open Access Journals (Sweden)

    Carlos Rojas

    2014-01-01

    Full Text Available There are few published studies providing information about macrofungal biology in a context of forest dynamics in tropical areas. For this study, a characterization of above-ground standing tree biomass and carbon stocks was performed for four different forest subtypes within two life zones in Costa Rica. Fungal productivity and reproductive success were estimated and analyzed in the context of the forest systems studied and results showed fungal dynamics to be a complex and challenging topic. In the present study, fungal productivity was higher in forest patches with more tree density but independent from life zones, whereas fungal biomass was higher in premontane areas with ectomycorrhizal dominant trees. Even though some observed patterns could be explained in terms of climatic differences and biotic relationships, the high fungal productivity observed in dry forests was an interesting finding and represents a topic for further studies.

  6. Macrofungal diversity in the Western Ghats, Kerala, India: members of Russulaceae

    Directory of Open Access Journals (Sweden)

    C. Mohanan

    2014-04-01

    Full Text Available A macrofungal biodiversity inventory carried out in different forest ecosystems viz., west coast tropical evergreen forests, west coast tropical semi-evergreen forests, south Indian moist deciduous forests, southern subtropical broadleaved hill forests, southern montane wet temperate forests (shola forests, southern tropical dry deciduous forests, grasslands, Myristica swamp forests, and forest plantations falling in different forest divisions in the Western Ghats, Kerala employing opportunistic as well as fixed-size plot sampling methods from 2006-2011 yielded several rare and hitherto unrecorded macrofungi. In Russulaceae 15 species of macrofungi belonging to the genera Russula and Lactarius were recorded. Of these, 12 species of Russula viz. Russula aciculocystis, R. adusta, R. atropurpurea, R. cinerella, R. congoana, R. delicula, R. hygrophytica, R. luteotacta, R. mariae, R. martinica, R. michiganensis and R. periglypta and white coloured latex exuding Lactarius nebulosus are new records for the Western Ghats. All the Russulaceae members exhibit an ectomycorrhizal association with tree species like Hopea ponga, H. parviflora, Myristica malabarica, Vateria indica, Calophyllum apetalaum, among others.

  7. The macrofungal diversity and community of Atlantic oak (Quercus petraea and Q. robur forests in Ireland

    Directory of Open Access Journals (Sweden)

    Harrington, Thomas J.

    2012-06-01

    Full Text Available The oak species Quercus petraea and Q. Robur are dominant canopy tree species of native deciduous forests in Ireland and coastal regions of Western Europe. These forests are typically plant species-rich, and can also have a rich fungal flora. This survey examined macrofungi found in five native oak sites across Ireland over three years. Overall, 94 macrofungal species belonging to 39 genera were discovered with Mycena, Lactarius, Russula and Cortinarius the most species-rich genera. The species accumulation curve did not show signs of levelling off, indicating that more sampling would reveal more new species. Species richness estimation using the Chao2 estimator indicated that up to 135 species may be present across all of our plots, with individual plots receiving estimates from 19 to 61 species per plot. Sampled-based rarefaction analysis showed no significant differences in macrofungal species richness between our plots. The five most common species were Laccaria amethystina, L. laccata, Stereum hirsutum, Armillaria mellea and Cortinarius flexipes. Comparisons of the results with results from oak forests in similar regions found that the communities in Great Britain were most similar to those found in Ireland. There were some key oak forest distinguishing fungal species from the family Boletaceae lacking from Irish oak forests. It is hypothesised that the historic deforestation of Ireland, caused a reduction of suitable habitats for Irish oak associated macrofungi, leading to the unspecific mycota found in the oak forests of this study. The threats to Atlantic oak forests in Ireland are briefly discussed.Las especies de Quercus petraea y Q. Robur se encuentran en bosques de Irlanda y regiones de influencia atlántica de Europa Occidental. Estos bosques, típicamente ricos en especies de plantas, presentan una abundante micobiota. Este estudio examina la diversidad de macromicetes en cinco bosques naturales de roble en Irlanda durante un

  8. Terrestrial Macrofungal Diversity from the Tropical Dry Evergreen Biome of Southern India and Its Potential Role in Aerobiology

    Science.gov (United States)

    Priyamvada, Hema; Akila, M.; Singh, Raj Kamal; Ravikrishna, R.; Verma, R. S.; Philip, Ligy; Marathe, R. R.; Sahu, L. K.; Sudheer, K. P.; Gunthe, S. S.

    2017-01-01

    Macrofungi have long been investigated for various scientific purposes including their food and medicinal characteristics. Their role in aerobiology as a fraction of the primary biological aerosol particles (PBAPs), however, has been poorly studied. In this study, we present a source of macrofungi with two different but interdependent objectives: (i) to characterize the macrofungi from a tropical dry evergreen biome in southern India using advanced molecular techniques to enrich the database from this region, and (ii) to assess whether identified species of macrofungi are a potential source of atmospheric PBAPs. From the DNA analysis, we report the diversity of the terrestrial macrofungi from a tropical dry evergreen biome robustly supported by the statistical analyses for diversity conclusions. A total of 113 macrofungal species belonging to 54 genera and 23 families were recorded, with Basidiomycota and Ascomycota constituting 96% and 4% of the species, respectively. The highest species richness was found in the family Agaricaceae (25.3%) followed by Polyporaceae (15.3%) and Marasmiaceae (10.8%). The difference in the distribution of commonly observed macrofungal families over this location was compared with other locations in India (Karnataka, Kerala, Maharashtra, and West Bengal) using two statistical tests. The distributions of the terrestrial macrofungi were distinctly different in each ecosystem. We further attempted to demonstrate the potential role of terrestrial macrofungi as a source of PBAPs in ambient air. In our opinion, the findings from this ecosystem of India will enhance our understanding of the distribution, diversity, ecology, and biological prospects of terrestrial macrofungi as well as their potential to contribute to airborne fungal aerosols. PMID:28072853

  9. Randolph Blackwell and the economics of civil rights

    OpenAIRE

    Hickmott, Alec Fazcakerley

    2011-01-01

    The life of Randolph Blackwell (1927-1981) provides a new lens through which to view the evolution of African American politics during the 20th century. Though perhaps most recognizable as a member of Martin Luther King‘s Southern Christian Leadership Conference, Blackwell‘s career as an activist had dimensions far broader than that of non-violent resistance. Most importantly, Blackwell‘s thought and praxis suggests the centrality of an economic and class-rooted analysis that endured far beyo...

  10. The Rao-Blackwellized Particle Filter: A Filter Bank Implementation

    Directory of Open Access Journals (Sweden)

    Karlsson Rickard

    2010-01-01

    Full Text Available For computational efficiency, it is important to utilize model structure in particle filtering. One of the most important cases occurs when there exists a linear Gaussian substructure, which can be efficiently handled by Kalman filters. This is the standard formulation of the Rao-Blackwellized particle filter (RBPF. This contribution suggests an alternative formulation of this well-known result that facilitates reuse of standard filtering components and which is also suitable for object-oriented programming. Our RBPF formulation can be seen as a Kalman filter bank with stochastic branching and pruning.

  11. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  12. Molecular tools for breeding basidiomycetes.

    Science.gov (United States)

    Ramírez, L; Larraya, L M; Pisabarro, A G

    2000-09-01

    The industrial production of edible basidiomycetes is increasing every year as a response to the increasing public demand of them because of their nutritional properties. About a dozen of fungal species can be currently produced for food with sound industrial and economic bases. Notwithstanding, this production is threatened by biotic and abiotic factors that make it necessary to improve the fungal strains currently used in industry. Breeding of edible basidiomycetes, however, has been mainly empirical and slow since the genetic tools useful in the selection of the new genetic material to be introduced in the commercial strains have not been developed for these fungi as it was for other organisms. In this review we will discuss the main genetic factors that should be considered to develop breeding approaches and tools for higher basidiomycetes. These factors are (i) the genetic system controlling fungal mating; (ii) the genomic structure and organisation of these fungi; and (iii) the identification of genes involved in the control of quantitative traits. We will discuss the weight of these factors using the oyster mushroom Pleurotus ostreatus as a model organism for most of the edible fungi cultivated industrially.

  13. Plant-polysaccharide-degrading enzymes from basidiomycetes

    NARCIS (Netherlands)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P; Mäkelä, Miia R; van den Brink, J.

    2014-01-01

    SUMMARY: Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-poly

  14. Improved Rao-Blackwellized Particle Filter by Particle Swarm Optimization

    Directory of Open Access Journals (Sweden)

    Zeng-Shun Zhao

    2013-01-01

    Full Text Available The Rao-Blackwellized particle filter (RBPF algorithm usually has better performance than the traditional particle filter (PF by utilizing conditional dependency relationships between parts of the state variables to estimate. By doing so, RBPF could not only improve the estimation precision but also reduce the overall computational complexity. However, the computational burden is still too high for many real-time applications. To improve the efficiency of RBPF, the particle swarm optimization (PSO is applied to drive all the particles to the regions where their likelihoods are high in the nonlinear area. So only a small number of particles are needed to participate in the required computation. The experimental results demonstrate that this novel algorithm is more efficient than the standard RBPF.

  15. CMB likelihood approximation by a Gaussianized Blackwell-Rao estimator

    CERN Document Server

    Rudjord, Ø; Eriksen, H K; Huey, Greg; Górski, K M; Jewell, J B

    2008-01-01

    We introduce a new CMB temperature likelihood approximation called the Gaussianized Blackwell-Rao (GBR) estimator. This estimator is derived by transforming the observed marginal power spectrum distributions obtained by the CMB Gibbs sampler into standard univariate Gaussians, and then approximate their joint transformed distribution by a multivariate Gaussian. The method is exact for full-sky coverage and uniform noise, and an excellent approximation for sky cuts and scanning patterns relevant for modern satellite experiments such as WMAP and Planck. A single evaluation of this estimator between l=2 and 200 takes ~0.2 CPU milliseconds, while for comparison, a single pixel space likelihood evaluation between l=2 and 30 for a map with ~2500 pixels requires ~20 seconds. We apply this tool to the 5-year WMAP temperature data, and re-estimate the angular temperature power spectrum, $C_{\\ell}$, and likelihood, L(C_l), for l<=200, and derive new cosmological parameters for the standard six-parameter LambdaCDM mo...

  16. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  17. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  18. Cryopreservation of basidiomycete strains using perlite.

    Science.gov (United States)

    Homolka, L; Lisá, L; Eichlerová, I; Nerud, F

    2001-12-01

    A new alternative method using perlite as a particulate solid carrier in the growth medium with a cryoprotectant was successfully tested for cryopreservation of several basidiomycete species from different genera (Armillaria, Pleurotus, Pluteus, Polyporus) which failed to survive or retain their properties in cryopreservation procedures routinely used in our laboratory. Frozen basidiomycete strains were kept in cryovials submerged in liquid nitrogen and were either immediately after the freezing process or after a 6-month storage thawed and checked for viability, purity and changes in growth, morphology and biochemical characteristics. All cultures survived the cryopreservation procedure and no negative effects of cryopreservation by this method have been observed after 6 months of storage in liquid nitrogen.

  19. Cosine directions using Rao-Blackwell Theorem and Hausdorff metric in Quasars

    CERN Document Server

    Bell, Byron E

    2015-01-01

    This analysis will determine the equations of the cosine directions for all flux of the optical spectrum in quasars. Studies on Hausdorff metric will greatly enhance our understanding of quasars distances. This study will complete steps in the classification of quasars by finding the minimum variance of flux by using the RaoBlackwell Theorem. The papers of C. R. Rao and D. Blackwell will be examined to clarify more of the above theorem. Keywords: Theory of Flux, SDSS, Quasars, Redshift (z), Population Perimeters, Regression Analysis

  20. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  1. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    Science + Business Media B.V. 2009 Abstract Decolorization of six synthetic dyes and two raw textile effluents (A and B) by eight basidiomycetous fungi was investigated. Among eight basidiomycetous fungi, fungal isolate RCK-1 decolorized textile effluent A...., & Viraraghavan, T. (2001). Fungal decolorization of dye wastewater: a review. Bioersource Technol, 79, 251–262. Gnanamani,A.,Bhaskar,M.,Ganeshjeevan,R.,Chandrasekar,R., Sekaran, G., Sadulla, S., et al. (2005). Enzymatic and chemical catalysis of Xylidine Ponceau...

  2. Basidiomycete Mating Type Genes and Pheromone Signaling▿

    Science.gov (United States)

    Raudaskoski, Marjatta; Kothe, Erika

    2010-01-01

    The genome sequences of the basidiomycete Agaricomycetes species Coprinopsis cinerea, Laccaria bicolor, Schizophyllum commune, Phanerochaete chrysosporium, and Postia placenta, as well as of Cryptococcus neoformans and Ustilago maydis, are now publicly available. Out of these fungi, C. cinerea, S. commune, and U. maydis, together with the budding yeast Saccharomyces cerevisiae, have been investigated for years genetically and molecularly for signaling in sexual reproduction. The comparison of the structure and organization of mating type genes in fungal genomes reveals an amazing conservation of genes regulating the sexual reproduction throughout the fungal kingdom. In agaricomycetes, two mating type loci, A, coding for homeodomain type transcription factors, and B, encoding a pheromone/receptor system, regulate the four typical mating interactions of tetrapolar species. Evidence for both A and B mating type genes can also be identified in basidiomycetes with bipolar systems, where only two mating interactions are seen. In some of these fungi, the B locus has lost its self/nonself discrimination ability and thus its specificity while retaining the other regulatory functions in development. In silico analyses now also permit the identification of putative components of the pheromone-dependent signaling pathways. Induction of these signaling cascades leads to development of dikaryotic mycelia, fruiting body formation, and meiotic spore production. In pheromone-dependent signaling, the role of heterotrimeric G proteins, components of a mitogen-activated protein kinase (MAPK) cascade, and cyclic AMP-dependent pathways can now be defined. Additionally, the pheromone-dependent signaling through monomeric, small GTPases potentially involved in creating the polarized cytoskeleton for reciprocal nuclear exchange and migration during mating is predicted. PMID:20190072

  3. Memories of Miles – Miles Blackwell and his contribution to South African librarianship

    Directory of Open Access Journals (Sweden)

    A.S.C. Hooper

    2010-01-01

    Full Text Available The contribution of BH Blackwell (BHB, and specifically of Miles Blackwell, to the development of libraries and librarians in South Africa is explored based on available literature sources and personal reminiscences. This article tells how Miles was true to his personal values and how he demonstrated his integrity in the exercise of his office. Miles integrated in his mind the history of the “firm” of BHB and the times that it lived though with his sense of his responsibility to his customers. He was prepared to stand up against enormous political pressure from his peers in Europe and North America, and perhaps his fellow board members in BHB, to make sure that the channels of published information flow remained open to his customers in South Africa. The value of books and information was what he believed in. His service to his customers in South Africa reflected the self-sacrificing service ethic that he understood to be the essence of the family firm of which he had the great privilege of leading. He contributed to the development of the new, post-apartheid South Africa by ensuring that the people who needed the enlightened word to become part of the global society, benefited by what he had done.

  4. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  5. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described.

  6. Gating Techniques for Rao-Blackwellized Monte Carlo Data Association Filter

    Directory of Open Access Journals (Sweden)

    Yazhao Wang

    2014-01-01

    Full Text Available This paper studies the Rao-Blackwellized Monte Carlo data association (RBMCDA filter for multiple target tracking. The elliptical gating strategies are redesigned and incorporated into the framework of the RBMCDA filter. The obvious benefit is the reduction of the time cost because the data association procedure can be carried out with less validated measurements. In addition, the overlapped parts of the neighboring validation regions are divided into several separated subregions according to the possible origins of the validated measurements. In these subregions, the measurement uncertainties can be taken into account more reasonably than those of the simple elliptical gate. This would help to achieve higher tracking ability of the RBMCDA algorithm by a better association prior approximation. Simulation results are provided to show the effectiveness of the proposed gating techniques.

  7. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  8. Evaluation of the flathead catfish population and fishery on Lake Carl Blackwell, Oklahoma, with emphasis on the effects of noodling

    Science.gov (United States)

    Winkelman, Dana L.; Michaletz, Paul H.; Travnichek, Vincent H.

    2011-01-01

    I conducted a 3-year study at Lake Carl Blackwell, Oklahoma to estimate effects of various fishing gears on the flathead catfish Pylodictis olivaris population. Managers were particularly interested in the effect of handfishing or noodling on this population. I used a phone survey to assess angler effort and electrofishing and gill nets to calculate standard population metrics to assess composition of the current population. Survey data indicated that fishing effort and harvest were highest for trotlines and juglines and lowest for noodling. Size distribution of fish harvested by noodlers was not different from sizes that were available in the fishery and was similar to those fish harvested with other gears. Flathead catfish Sampled in Lake Carl Blackwell ranged in size from 38 to 1,220 mm total length, and 77% of the population was less than 508 mm (minimum legal size). Estimated total annual mortality was about 11%. Proportional size distribution (PSD) of flathead catfish for Lake Carl Blackwell indicates that about 70% of legal-sized flathead catfish were over the preferred size of 710 mm. Overall, the Lake Carl Blackwell flathead catfish population appeared healthy. There were a wide range of sizes and ages in the population, and PSD indicated a well-balanced population with many preferred and memorable-sized fish. Due to its rarity, noodling is probably not adversely influencing the population. Additionally, noodling at Lake Carl Blackwell does not appear to be as size-selective as previously thought. 

  9. Recognizing filamentous basidiomycetes as agents of human disease: A review

    NARCIS (Netherlands)

    Chowdhary, A.; Kathuria, S.; Agarwal, K.; Meis, J.F.G.M.

    2014-01-01

    Filamentous basidiomycetes (BM) are common environmental fungi that have recently emerged as important human pathogens, inciting a wide array of clinical manifestations that include allergic and invasive diseases. We reviewed 218 reported global cases of BM fungi. The most common etiologic agent was

  10. Isolation and screening of basidiomycetes with high peroxidative activity.

    NARCIS (Netherlands)

    Jong, de E.; Vries, de F.P.; Field, J.A.; Zwan, van der R.P.; Bont, de J.A.M.

    1992-01-01

    Sixty-seven Poly R-478 decolorizing basidiomycetes were isolated with a selective medium (containing hemp (Cannabis sativa) stem wood, guaiacol and benomyl). Several of the new isolates seemed to be promising manganese peroxidase-containing white-rot fungi. Enzyme assays indicated that either

  11. Cosmological parameter constraints via Gibbs sampling and the Blackwell-Rao estimator

    Science.gov (United States)

    Chu, I.-Wen Mike

    We study the Blackwell-Rao (BR) estimator of the probability distribution of the angular power spectrum, P ( C [cursive l] | d ), generated via Gibbs sampling of the Cosmic Microwave Background (CMB) data. From simulated samples of full-sky no-noise CMB maps, we find the estimator to be very fast and also highly accurate. We also find that the number of samples required for convergence of the BR estimate rises rapidly with increasing [cursive l], at least at low [cursive l]. Our existing sample chains as applied to the Wilkinson Microwave Anistropy Probe (WMAP) data are only long enough to achieve convergence at [cursive l] [Special characters omitted.] 40. In comparison with P ( C [cursive l] | d ) as reported by the WMAP team we find significant differences at these low [cursive l] values. These differences lead to up to ~ 0.5 s shifts in the estimates of parameters in a 7-parameter LCDM model with non-zero d n s /d ln k , the running in the spectral index. Fixing d n s /dln k = 0 makes these shifts much less significant. Unlike existing analytic approximations, the BR estimator can be straightforwardly extended for the case of power spectra from correlated fields, such as temperature and polarization. We discuss challenges to extending the procedure to higher [cursive l] and provide some solutions.

  12. An Example of an Improvable Rao-Blackwell Improvement, Inefficient Maximum Likelihood Estimator, and Unbiased Generalized Bayes Estimator.

    Science.gov (United States)

    Galili, Tal; Meilijson, Isaac

    2016-01-02

    The Rao-Blackwell theorem offers a procedure for converting a crude unbiased estimator of a parameter θ into a "better" one, in fact unique and optimal if the improvement is based on a minimal sufficient statistic that is complete. In contrast, behind every minimal sufficient statistic that is not complete, there is an improvable Rao-Blackwell improvement. This is illustrated via a simple example based on the uniform distribution, in which a rather natural Rao-Blackwell improvement is uniformly improvable. Furthermore, in this example the maximum likelihood estimator is inefficient, and an unbiased generalized Bayes estimator performs exceptionally well. Counterexamples of this sort can be useful didactic tools for explaining the true nature of a methodology and possible consequences when some of the assumptions are violated. [Received December 2014. Revised September 2015.].

  13. An Example of an Improvable Rao–Blackwell Improvement, Inefficient Maximum Likelihood Estimator, and Unbiased Generalized Bayes Estimator

    Science.gov (United States)

    Galili, Tal; Meilijson, Isaac

    2016-01-01

    The Rao–Blackwell theorem offers a procedure for converting a crude unbiased estimator of a parameter θ into a “better” one, in fact unique and optimal if the improvement is based on a minimal sufficient statistic that is complete. In contrast, behind every minimal sufficient statistic that is not complete, there is an improvable Rao–Blackwell improvement. This is illustrated via a simple example based on the uniform distribution, in which a rather natural Rao–Blackwell improvement is uniformly improvable. Furthermore, in this example the maximum likelihood estimator is inefficient, and an unbiased generalized Bayes estimator performs exceptionally well. Counterexamples of this sort can be useful didactic tools for explaining the true nature of a methodology and possible consequences when some of the assumptions are violated. [Received December 2014. Revised September 2015.] PMID:27499547

  14. Genomic analysis of two-component signal transduction proteins in basidiomycetes.

    Science.gov (United States)

    Lavín, José L; Ramírez, Lucía; Ussery, David W; Pisabarro, Antonio G; Oguiza, José A

    2010-01-01

    Two-component system (TCS) proteins are components of complex signal transduction pathways in fungi, and play essential roles in the regulation of several cellular functions and responses. Species of basidiomycetes have a marked variation in their specific physiological traits, morphological complexity and lifestyles. In this study, we have used the available complete genomes of basidiomycetes to carry out a thorough identification and an extensive comparative analysis of the TCS proteins in this fungal phylum. In comparison with ascomycetes, basidiomycetes exhibit an intermediate number of TCS proteins. Several TCS proteins are highly conserved among all the basidiomycetes, and other TCS proteins appear to be specific to particular species of basidiomycetes. Moreover, some species appear to have developed a unique histidine kinase group with unusual domain architecture, the Dual-histidine kinases. The presence of differential sets of TCS proteins between basidiomycete species might reflect their adaptation to diverse environmental niches.

  15. Basidiomycete yeasts in the cortex of ascomycete macrolichens.

    Science.gov (United States)

    Spribille, Toby; Tuovinen, Veera; Resl, Philipp; Vanderpool, Dan; Wolinski, Heimo; Aime, M Catherine; Schneider, Kevin; Stabentheiner, Edith; Toome-Heller, Merje; Thor, Göran; Mayrhofer, Helmut; Johannesson, Hanna; McCutcheon, John P

    2016-07-29

    For over 140 years, lichens have been regarded as a symbiosis between a single fungus, usually an ascomycete, and a photosynthesizing partner. Other fungi have long been known to occur as occasional parasites or endophytes, but the one lichen-one fungus paradigm has seldom been questioned. Here we show that many common lichens are composed of the known ascomycete, the photosynthesizing partner, and, unexpectedly, specific basidiomycete yeasts. These yeasts are embedded in the cortex, and their abundance correlates with previously unexplained variations in phenotype. Basidiomycete lineages maintain close associations with specific lichen species over large geographical distances and have been found on six continents. The structurally important lichen cortex, long treated as a zone of differentiated ascomycete cells, appears to consistently contain two unrelated fungi.

  16. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  17. Antimicrobial activity of submerged cultures of Chilean basidiomycetes.

    Science.gov (United States)

    Aqueveque, Pedro; Anke, Timm; Saéz, Katia; Silva, Mario; Becerra, José

    2010-10-01

    This study is part of a screening program aimed at searching for bioactive metabolites from Chilean basidiomycetes. Submerged cultivation of fungal mycelia in liquid media was evaluated for antimicrobial activity. A total of 148 strains were obtained in vitro. The extracts produced from submerged cultures were evaluated against bacteria and fungi. In the primary antimicrobial assay, approximately 60% of the extracts presented positive biological activity. The highest frequencies of active strains were from the orders Agaricales (31.0%), Polyporales (20.6%), Sterales (18.3%), Boletales (11.4%), and Cortinariales (9.1%). Antifungal activity was more pronounced than antibacterial activity. Twelve extracts that exhibited strong antimicrobial activity showed minimum inhibitory concentration (MIC) values of 50 µL/mL against Bacillus brevis and 25∼50 µL/mL against Penicillium notatum and Paecilomyces variotii. The biological activity of some strains did not vary considerably, regardless of the substrate or collection site whereas, for others, it showed marked variations. Differences in antimicrobial activities observed in the different fungal genera suggested that the ability to produce bioactive compounds is not homogenously distributed among basidiomycetes. The information obtained from this study reveals that Chilean basidiomycetes are able to generate small and/or large variations in the normal pathway of compounds production. Thus, it is necessary to evaluate this biological and chemical wealth, which could be an unsuspected reservoir of new and potentially useful molecules.

  18. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-12-01

    Full Text Available ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP, which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need of eco-efficient solutions for its colored effluents. White rot basidiomycetous fungi comprise the only group of organisms known to completely degrade lignin. Ligninolytic enzymes have potential applications in a large number of fields, including the chemical, fuel, food, agricultural, paper, textile, cosmetic industrial sectors and more. This ligninolytic system of white-rot fungi is also directly involved in the degradation of various xenobiotic compounds apart from textile dyes. Their capacities to remove xenobiotic substances make them a useful tool for bioremediation purposes. This paper reviews involvement of ligninolytic enzymes of white rot basidiomycetes in the degradation of textiles dyes and xenobiotic compounds for their industrial and biotechnological applications.

  19. Genomic Analysis of Two-Component Signal Transduction Proteins in Basidiomycetes

    DEFF Research Database (Denmark)

    Ussery, David; Lavín, JL; Binnewies, Tim Terence;

    2010-01-01

    proteins. Several TCS proteins are highly conserved among all the basidiomycetes, and other TCS proteins appear to be specific to particular species of basidiomycetes. Moreover, some species appear to have developed a unique histidine kinase group with unusual domain architecture, the Dual-histidine...

  20. Particle filters for the magnetoencephalography inverse problem: increasing the efficiency through a semi-analytic approach (Rao-Blackwellization)

    Energy Technology Data Exchange (ETDEWEB)

    Sorrentino, A [Dipartimento di Fisica, Universita di Genova (Italy); Pascarella, A; Campi, C [Dipartimento di Matematica, Universita di Genova (Italy); Piana, M [Dipartimento di Informatica, Universita di Verona (Italy)], E-mail: sorrentino@fisica.unige.it

    2008-07-15

    We consider the problem of dynamically estimating the parameters of point-like neural sources from magnetoencephalography data. Since the problem is non-linear, we apply the sequential Monte Carlo algorithms known as particle filters for solving the Bayesian filtering problem. We suggest that the linear dependence of the data on a subset of the parameters allows the analytic computation of the posterior density for these parameters, i.e. Rao-Blackwellization; this considerably improves the accuracy of the method and its statistical efficiency.

  1. 江西铜钹山大型真菌区系地理成分分析%Geographical Components of Macrofungal Flora in Tongbo Mountain Nature Reserve, Jiangxi Province, China

    Institute of Scientific and Technical Information of China (English)

    张林平; 张扬; 王舒; 栾丰刚; 李冬; 林昌勇

    2013-01-01

    为了解江西铜钹山自然保护区大型真菌区系多样性,对该地区的大型真菌区系地理成分进行了分析.结果表明:该地区共有大型真菌185种,隶属46科92属.其中优势科为Polyporaceae(40种,占21.62%)、Tricholomataceae(15种,占8.11%)、Russulaceae(13种,占7.03%)和Baletaceae(11种,5.95%);优势属为Russula(10种,占5.41%)、Marasmius(9种,占4.86%)、Tremella(6种,3.24%)、Xylaria(6种,3.24%)、Stereum(5种,2.70%)、Microporus(5种,2.70%)、Coprinus(5种,2.70%);属的区系地理成分可分为世界广布成分(69.57%)、泛热带成分(19.57%)、北温带成分(9.78%)、东亚-北美洲成分(2.17%),分析结果表明铜钹山大型真菌的属以广布成分为主,其次为热带成分和北温带成分.%To understand the diversity of macrofungal flora in Tongbo Mountain Nature Reserve of Jiangxi Province,an investigation was conducted on the geographical components of the flora.A total of 185 macrofungal species were identified,belonging to 92 genera of 45 families.The dominant families were Polyporaceae (40 species,21.62 %),Tricholomataceae (15 species,8.11%),Russulaceae (13 species,7.03 %),and Baletaceae (11 species,5.95%),and the dominant genera were Russula (10 species,5.41%),Marasmius (9 species,4.86%),Tremella (6 species,3.24%),Xylaria (6 species,3.24%),Stereum (5 species,2.70%),Microporus (5 species,2.70%),and Coprinus (5 species,2.70%).Geographically,the genera can be grouped into four components,i.e.,Cosmopolitans (69.57%),Pan-tropic elements (19.57%),North Temperate elements (9.78%),Eastern 1Asia-Northern America elements (2.17%).The results suggest that the genera of silvan macrofungi in Tongbo Mountain Nature Reserve of Jiangxi are dominated by cosmopolitan elements,followed by tropical and temperate floristic elements.

  2. DESTRUCTION OF XENOBIOTICS BY CULTURE FILTRATE FROM XYLOTROPHIC BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2015-12-01

    Full Text Available The article deals with the efficiency of pollutants biodegradation by xylotrophic basidiomycetes submerged cultures grown on standard glucose-peptone medium (GPM. The efficiency of pollutants biodegradation was determined by the model compound – dye Methyl Orange. The purpose of the work is screening of 19 species 81 strains xylotrophic basidiomycetes cultures on the indicator of the dye oxidative degradation efficiency and exploring the possibility of induction of this indicator by modifying the culture medium. The biodegradation efficiency was determined by following method. Assigned amount of culture filtrate (experiment or medium (control was added to the 0.001% solution of Methyl Orange in sodium acetate buffer. pH of the reaction mixture was 4.4 units. Samples were incubated at +40°C for 48 hours. Then pH of the reaction mixture was set up at 3.1 units using sodium acetate buffer and the optical density of solutions at a wavelength of 506 nm was measured. The efficiency of biodegradation was calculated by the difference of the optical density of control and experiment as a percentage. The most promising strains – F. velutipes F-1105, P. eryngii P-er, T. hirsuta Th-11 and D. quercina Dq-08 were selected. The composition of the glucose-peptone medium was modified for these strains by the introduction in the medium lignosulfonate, Tween 80, Kirk’s minerals solution and selecting the concentration of these components. According to the study for the purpose of pollutants degradation it is advisable to cultivate F. velutipes F-1105 strain on modified GPM, which further comprises at 1 l: lignosulfonate – 3.5 g; Tween 80 – 1.0 g, Kirk’s minerals solution – 70 ml; P. eryngii P-er strain – 5.0 g, 1.0 g, 70 ml; T. hirsuta Th-11 strain – 5.0 g, 1.0 g, 105 ml; and D. quercina Dq-08 strain – 6.5 g, 1.0 g, 105 ml, respectively. This allowed to increase the model compound degradation efficiency by the culture filtrate of strain F

  3. Stavroula Leka & Robert R. Sinclair, Eds. 2014. Contemporary Occupational Health Psychology. Global perspectives on research and practice (Volumul 3. West Sussex, UK: Wiley-Blackwell, 264 p.

    Directory of Open Access Journals (Sweden)

    PATRICIA ALBULESCU

    2014-05-01

    Full Text Available Stavroula Leka & Robert R. Sinclair, Eds. 2014. Contemporary Occupational Health Psychology. Global perspectives on research and practice (Volumul 3. West Sussex, UK: Wiley-Blackwell, 264 p.

  4. Wood-destroying Basidiomycetes, found on the elder woods in the South Urals (Orenburg Oblast, Russia

    Directory of Open Access Journals (Sweden)

    Maksim A. Safonov

    2014-09-01

    Full Text Available The article shows the results of a study of wood-destroying basidiomycetes on two species of elder trees (Alnus glutinosa, Alnus incan, growing in the South Urals (Orenburg Oblast. The comparative analysis of basidiomycetes on two species of elder trees was conducted. The reasons for structural differences of these complexes are discussed. It is consumed that the reason lies in growth conditions of the trees.

  5. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  6. Basidiomycete cryopreservation on perlite: evaluation of a new method.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2006-06-01

    A new cryopreservation method using perlite as a carrier was evaluated on a large set of mycelial cultures of basidiomycetes. The viability and some other characteristics--growth, macro- and micromorphology, and laccase production--of 442 strains were tested after 48-h and then after 3-year storage in liquid nitrogen using a perlite protocol (PP). All (100%) of them survived successfully both 48-h storage and 3-year storage in liquid nitrogen without noticeable growth and morphological changes. Also laccase production was unchanged. The viability and laccase production of a part (250) of these strains were compared with those of the strains subjected to an original agar plug protocol (OP). Using OP, 144 strains (57.6%) out of 250 survived a 3-year storage in liquid nitrogen. The results indicate that the cryopreservation protocol used significantly influences survival of the strains. Markedly better results were achieved using the PP.

  7. Genetic Linkage Map of the Edible Basidiomycete Pleurotus ostreatus

    Science.gov (United States)

    Larraya, Luis M.; Pérez, Gúmer; Ritter, Enrique; Pisabarro, Antonio G.; Ramírez, Lucía

    2000-01-01

    We have constructed a genetic linkage map of the edible basidiomycete Pleurotus ostreatus (var. Florida). The map is based on the segregation of 178 random amplified polymorphic DNA and 23 restriction fragment length polymorphism markers; four hydrophobin, two laccase, and two manganese peroxidase genes; both mating type loci; one isozyme locus (est1); the rRNA gene sequence; and a repetitive DNA sequence in a population of 80 sibling monokaryons. The map identifies 11 linkage groups corresponding to the chromosomes of P. ostreatus, and it has a total length of 1,000.7 centimorgans (cM) with an average of 35.1 kbp/cM. The map shows a high correlation (0.76) between physical and genetic chromosome sizes. The number of crossovers observed per chromosome per individual cell is 0.89. This map covers nearly the whole genome of P. ostreatus. PMID:11097904

  8. BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ

    2015-12-01

    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  9. Blackwell Companion to Phonology

    NARCIS (Netherlands)

    van Oostendorp, M.; Ewen, C.J.; Hume, B.; Rice, K.

    2011-01-01

    "The Companion to Phonology" will be the major reference work of the field, drawing together nearly 150 contributions from almost all of the globally recognized, leading scholars in an estimated five-volume set. The international editorial team represents a diverse range of approaches and methodolog

  10. TOTAL ANTIOXIDANT ACTIVITY OF SOME BASIDIOMYCETES STRAINS IN GROWTH DYNAMIC

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2016-08-01

    Full Text Available The work is devoted to the study of total antioxidant activity (AOA in the growth dynamics of basidiomycetes strains in their periodic surface cultivation on glucose-peptone medium. Subjects of research are mycelium and culture filtrate (CF from 57 strains, 5 of which are belong to 5 types of Polyporales order, and 52 of which are belong to the 7 types of Agaricales order. In order to study the dynamics of growth used method for determining the weight of absolutely dry biomass accumulation (ADB. Total AOA of mycological material was evaluated by inhibition of lipid peroxidation products accumulation intensity in the model oxidation reaction of Tween-80 by air oxygen. It was found that the most productive in terms of the accumulation of ADB are strains F. velutipes F-610 and P. eryngii P-er. Lowest values of ADB accumulation recorded for strains P. ostreatus P-14 and P-192 and P. citrinopileatus P sіtr. Were selected the most productive strains of Basidiomycetes for the level of total AOA in mycelium and CF. There are strains P. eryngii P-er, P. citrinopileatus P sіtr, P. ostreatus P-035, F. hepatica Fh-08, A. cylindracea 960, P. ostreatus P-081, P-082, P-087, P. citrinopileatus P sіtr. Has not been established the dependence between the growth and the antioxidant activity of the 9- and 12-day fungal cultures. Selected producers of natural antioxidants may be used as biological agents in biotechnology.

  11. Substrate oxidation sites in versatile peroxidase and other basidiomycete peroxidases.

    Science.gov (United States)

    Ruiz-Dueñas, Francisco J; Morales, María; García, Eva; Miki, Yuta; Martínez, María Jesús; Martínez, Angel T

    2009-01-01

    Versatile peroxidase (VP) is defined by its capabilities to oxidize the typical substrates of other basidiomycete peroxidases: (i) Mn(2+), the manganese peroxidase (MnP) substrate (Mn(3+) being able to oxidize phenols and initiate lipid peroxidation reactions); (ii) veratryl alcohol (VA), the typical lignin peroxidase (LiP) substrate; and (iii) simple phenols, which are the substrates of Coprinopsis cinerea peroxidase (CIP). Crystallographic, spectroscopic, directed mutagenesis, and kinetic studies showed that these 'hybrid' properties are due to the coexistence in a single protein of different catalytic sites reminiscent of those present in the other basidiomycete peroxidase families. Crystal structures of wild and recombinant VP, and kinetics of mutated variants, revealed certain differences in its Mn-oxidation site compared with MnP. These result in efficient Mn(2+) oxidation in the presence of only two of the three acidic residues forming its binding site. On the other hand, a solvent-exposed tryptophan is the catalytically-active residue in VA oxidation, initiating an electron transfer pathway to haem (two other putative pathways were discarded by mutagenesis). Formation of a tryptophanyl radical after VP activation by peroxide was detected using electron paramagnetic resonance. This was the first time that a protein radical was directly demonstrated in a ligninolytic peroxidase. In contrast with LiP, the VP catalytic tryptophan is not beta-hydroxylated under hydrogen peroxide excess. It was also shown that the tryptophan environment affected catalysis, its modification introducing some LiP properties in VP. Moreover, some phenols and dyes are oxidized by VP at the edge of the main haem access channel, as found in CIP. Finally, the biotechnological interest of VP is discussed.

  12. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  13. Enhanced biodecolorization of reactive dyes by basidiomycetes under static conditions.

    Science.gov (United States)

    Bibi, Ismat; Bhatti, Haq Nawaz

    2012-04-01

    This study presents the biodecolorization potential of basidiomycete fungi Trametes hirsuta, Pycnoporus sp., and Irpex sp. for different reactive dyes viz. Reactive Red 120, Remazol Brilliant Blue R (RBBR), Reactive Orange G, and Reactive Orange 16 under static and shaking conditions. The screening trials revealed that T. hirsuta exhibited maximum potential (83.75 %) for biodecolorization of RBBR dye under static conditions after the fifth day of incubation. However, the rate of biodecolorization of RBBR dye by Pycnoporus sp. was much slow and reached maximum (81.25 %) after 15 days of incubation under shaking conditions. By process optimization, enhanced decolorization (91.2 %) of RBBR by T. hirsuta was achieved at pH 5.5 within 24 h using a defined salt medium amended with p-coumaric acid under static conditions. pH was found to be an important parameter for the enzymatic system involved in RBBR dye decolorization by T. hirsuta and Pycnoporus sp. Biodecolorization of RBBR dye was determined by a reduction in optical density at the wavelength of maximum absorbance (λ, 578 nm) by UV-vis spectrophotometer. The shift in maximum wavelength toward shorter/longer wavelength in UV-vis scanning spectrum revealed the degradation of RBBR dye into different transformation products.

  14. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  15. Protease activity in cockroach and basidiomycete allergen extracts.

    Science.gov (United States)

    Wongtim, S; Lehrer, S B; Salvaggio, J E; Horner, W E

    1993-01-01

    Inherent proteolytic activity was estimated in cockroach and basidiomycete extracts by quantifying acid soluble peptides that were released by incubating extracts with 1% bovine serum albumin as measured by Lowry (Sigma). Reference proteases released 740 (Proteinase K, 0.1 U), 248 (Trypsin, 1.0 U), and 533 micrograms/ml (Pronase, 0.5 U) of soluble peptides. American whole body cockroach extract (0.1 mg dry weight) released 330 micrograms/ml of soluble peptides, representing 13 trypsin equivalent units (TEU)/mg. Extracts from spores of the mushroom Pleurotus ostreatus released 230 micrograms/ml (0.9 TEU/mg) and Pleurotus cap extract released 112 micrograms/ml (0.5 TEU/mg). Mycelium of Pleurotus and the mushroom Psilocybe cubensis and spores of Psilocybe and the puffball Calvatia cyathiformis showed negligible amounts of proteolytic activity. The protease inhibitor phenylmethylsulfonyl flouride reduced the proteolytic activity of American whole body cockroach extract by 80% (@1 mM) and the inhibitor ethylene diaminetetraacetic acid inhibited the proteolytic activity of Pleurotus spores by 95% (@1 mM). Loss of allergen activity as determined by RAST inhibition and immunoprinting correlated with protease activity. Thus, in the preparation and handling of allergen extracts, one should employ conditions that minimize proteolysis.

  16. DESCRIPTION OF THE CULTURE CHARACTERISTICS OF SOME LIGNICOLOUS BASIDIOMYCETES SPECIES GROWN ON THREE SYNTHETIC MEDIA

    Directory of Open Access Journals (Sweden)

    PETRE Cristiana Virginia

    2013-12-01

    Full Text Available A number of 12 species of lignicolous basidiomycetes were cultivated on potato dextrose agar and malt extract agar, incubated at 25 °C and carefully analyzed for a period of 5 weeks. Lignicolous basidiomycetes are fungi that produce potent enzymes and bioactive secondary metabolites which are successfully used in various industries: bioremediation of polluted environments, biodegradation of toxic substances, pharmacology or agriculture. The objective of this study was the description of the main characteristics of in vitro cultures of some lignicolous basidiomycetes species grown on synthetic media. The main characteristics followed were: the growth rate of the colonies, the general features of the mycelium: shape, color, surface aspect, reverse, the presence of fruiting bodies and exudates and the particular odor.

  17. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  18. A case of sinobronchial allergic mycosis; possibility of basidiomycetous fungi as a causative antigen.

    Science.gov (United States)

    Ogawa, Haruhiko; Fujimura, Masaki; Takeuchi, Yasuo; Makimura, Koichi

    2011-01-01

    We herein report a case of sinobronchial allergic mycosis (SAM) caused by basidiomycetous (BM) fungi (probably Phanerochaete velutina). The patient with bronchial asthma that accompanied allergic fungal sinusitis (AFS) fulfilled all 6 criteria for diagnosing SAM. In this case, the BM fungus may act as an allergen, reacting continually in both the upper and lower respiratory tract. The antifungal drug (itraconazole 50 mg/day) seemed to achieve a partial response. Basidiomycetous fungi may attract attention because of the possibility as a causative antigen in this new clinical concept of SAM.

  19. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme ß-gl

  20. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  1. Basidiomycete cultures on perlite survive successfully repeated freezing and thawing in cryovials without subculturing.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2007-06-01

    Mycelial basidiomycete cultures on perlite in cryovials survived successfully three successive cycles of freezing, storage in liquid nitrogen (LN) and thawing without noticeable changes. This indicates that using perlite as a carrier for cryopreservation could in most cases overcome difficulties caused by interrupted supply of LN or electric power during the storage. Cultures on perlite can also be reused for successive inoculations.

  2. Processive endoglucanase active in crystalline cellulose hydrolysis by the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2005-01-01

    Brown rot basidiomycetes have long been thought to lack the processive cellulases that release soluble sugars from crystalline cellulose. On the other hand, these fungi remove all of the cellulose, both crystalline and amorphous, from wood when they degrade it. To resolve this discrepancy, we grew Gloeophyllum trabeum on microcrystalline cellulose (Avicel) and purified...

  3. EFFECT OF NITROGEN NUTRITION SOURCES ON CAROTENOIDS SYNTHESIS FOR SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2014-03-01

    Full Text Available The influence of certain nitrogen compounds - components of glucose-peptone medium (GPM on the accumulation of carotenoids by some strains was investigated by surface cultivating basidiomycetes. The total carotenoid content was set in acetone extracts of mycological material spectrophotometrically and calculated using the Vetshteyn formula. As the nitrogen-containing components used GPM with 9 compounds, such as peptone, DL-valine, L-asparagine, DL-serine, DL-tyrosine, L-proline, L-alanine, urea, NaNO3. The effect on the accumulation of specific compounds both in the mycelium and in the culture fluid of carotenoids by culturing certain strains of Basidiomycetes was identified. Adding to standard glucose-peptone medium peptone at 5 g/l causes an increase of carotenoid accumulation by strain L. sulphureus Ls-08, and in a concentration of 4 g/l by strains of F. hepatica Fh-18 and F. fomentarius Ff-1201. In order to increase the accumulation of carotenoids in the mycelium  we suggested to make a standard glucose-peptone medium with proline or valine for cultivating of L. sulphureus Ls- 08 strain; alanine for F. fomentarius Ff-1201 strain; proline, asparagine and serine - for strain Fh-18 of F. hepatica. The results can be implemented in further optimization of the composition of the nutrient medium for culturing strains of Basidiomycetes wich producing carotenoids. Keywords: nitrogen-containing substances, Basidiomycetes, mycelium, culture filtrate, carotenoids

  4. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  5. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  6. Hongos basidiomycetes: una contribución al conocimiento de 14 generos en norte de santander

    Directory of Open Access Journals (Sweden)

    Nancy Jackeline Sanchez-Sandoval

    2006-07-01

    Full Text Available In this article 14 genera of Basidiomycetes are reported tor Norte de Santander Department. These genera belong to 10 families and 5 orders: Agaricales, Boletales, Schizophyllales, Polyporales and Lycoperdales. The last order belongs to Gasteromycetes. The study was done in Chinócota county, during the years 2003-2004.

  7. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

    Science.gov (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-02-01

    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  8. Antitubercular Lanostane Triterpenes from Cultures of the Basidiomycete Ganoderma sp. BCC 16642.

    Science.gov (United States)

    Isaka, Masahiko; Chinthanom, Panida; Sappan, Malipan; Danwisetkanjana, Kannawat; Boonpratuang, Thitiya; Choeyklin, Rattaket

    2016-01-22

    Sixteen new lanostane triterpenoids (1-16), together with 26 known compounds (17-42), were isolated from cultures of the basidiomycete Ganoderma sp. BCC 16642. Antitubercular activities of these Ganoderma lanostanoids against Mycobacterium tuberculosis H37Ra were evaluated, and structure-activity relationships are proposed.

  9. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389.

    Science.gov (United States)

    Isaka, Masahiko; Palasarn, Somporn; Sappan, Malipan; Supothina, Sumalee; Boonpratuang, Thitiya

    2016-10-01

    Two new hirsutane sesquiterpenes, marasmiellins A (1) and B (2), were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher's method.

  10. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  11. First records of xylophilous Basidiomycetes (Fungi in Mondaí, Santa Catarina (Southern Brazil

    Directory of Open Access Journals (Sweden)

    Clarice Loguercio-Leite

    2008-06-01

    Full Text Available A taxonomic survey of xylophilous Basidiomycetes resulted in the identifi cation of 21 species belonging to the families Boreostereaceae Jülich (1, Ganodermataceae Donk (2, Hymenochaetaceae Imazeki & Toki (6, Meripilaceae Jülich (2, Podoscyphaceae Reid (1, Polyporaceae Fr.: Corda (8 and Schizophyllaceae Quél. (1. All species are new records for Mondaí.

  12. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Science.gov (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

    2017-01-01

    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  13. Fast solubilization of recalcitrant cellulosic biomass by the basidiomycete fungus Laetisaria arvalis involves successive secretion of oxidative and hydrolytic enzymes

    National Research Council Canada - National Science Library

    Navarro, David; Rosso, Marie-Noëlle; Haon, Mireille; Olivé, Caroline; Bonnin, Estelle; Lesage-Meessen, Laurence; Chevret, Didier; Coutinho, Pedro M; Henrissat, Bernard; Berrin, Jean-Guy

    2014-01-01

    .... Filamentous fungi are the predominant natural source of enzymes acting on lignocellulose. We describe the extraordinary cellulose-deconstructing capacity of the basidiomycete Laetisaria arvalis, a soil-inhabiting fungus. The L...

  14. Molecular evolution of the fungi: relationship of the Basidiomycetes, Ascomycetes, and Chytridiomycetes.

    Science.gov (United States)

    Bowman, B H; Taylor, J W; Brownlee, A G; Lee, J; Lu, S D; White, T J

    1992-03-01

    Establishing the phylogeny of fungi and protists often has proved difficult owing to the simple morphologies and convergent characters in these organisms. We used DNA sequences of nuclear small-subunit ribosomal RNA genes to determine phylogenetic relationships among three major classes of organisms considered to be fungi--Basidiomycetes, Ascomycetes and Chytridiomycetes--and to assess the taxonomic position of Neocallimastix, an economically important anaerobic rumen microorganism whose classification is controversial. The Basidiomycetes and Ascomycetes, two classes of nonflagellated fungi, are the most closely related taxa. Chytridiomycetes, though bearing flagella, group with these higher fungi rather than with the protists. Neocallimastix, a eukaryote lacking mitochondria and variously classified as a protist or as a fungus, shows closest molecular affinities with the Chytridiomycete fungi in the order Spizellomycetales.

  15. Cryopreservation of cryosensitive basidiomycete cultures by application and modification of perlite protocol.

    Science.gov (United States)

    Sato, Masanori; Sukenobe, Junji; Nakagiri, Akira

    2012-01-01

    Homolka's perlite protocol (HPP) for cryopreservation of fungal cultures was evaluated in 12 strains (7 species) of cryosensitive basidiomycete cultures maintained in NBRC culture collection by investigating viability, time to recover, and basic morphological study after freezing and storing at -80 degree C for 6 months. The viability of the fungal strains was 60 percent in Phallus hadriani and 100 percent in remaining 11 strains, indicating the efficacy of HPP method for cryopreservation of some cryosensitive basidiomycetes. The HPP method was modified by changing the addition of cryoprotectant (glycerol) from prior precultivation to post precultivation, limiting the cryoprotectant exposure time to 48 hours, and increasing the glycerol concentration from 5 percent to 12 percent. The viability of P. hadriani strain increased from 60 percent to 100 percent with the modified perlite protocol after storage at -80 degree C for 6 months.

  16. Microbial scission of sulfide linkages in vulcanized natural rubber by a white rot basidiomycete, Ceriporiopsis subvermispora.

    Science.gov (United States)

    Sato, Shin; Honda, Yoichi; Kuwahara, Masaaki; Kishimoto, Hiroyuki; Yagi, Noriko; Muraoka, Kiyoshige; Watanabe, Takashi

    2004-01-01

    A white rot basidiomycete, Ceriporiopsis subvermispora, degraded vulcanized natural rubber (NR) sheets on a wood medium. The fungus decreased the total sulfur content of the rubber by 29% in 200 days, accompanied by the cleavage of sulfide bonds between polyisoprene chains. X-ray photoelectron spectroscopy (XPS) demonstrated that C. subvermispora reduced the frequency of S-C bonds by 69% with a concomitant formation of S-O bonds during the culture period. Dipolar decoupling/magic angle spinning (DD/MAS) solid state 13C NMR revealed that the fungus preferentially decomposed monosulfide bonds linked to a cis- and trans-1,4-isoprene backbone but the cleavage of polysulfide bonds was also observed. In contrast, no decrease in weight or devulcanization of rubber was observed in cultures of a white rot fungus, Dichomitus squalens. The oxidative cleavage of sulfide bonds by C. subvermispora demonstrates that ligninolytic basidiomycetes are potential microbes for the biological devulcanization of rubber products.

  17. Draft Genome Sequence of Sporidiobolus salmonicolor CBS 6832, a Red-Pigmented Basidiomycetous Yeast.

    Science.gov (United States)

    Coelho, Marco A; Almeida, João M G C F; Hittinger, Chris Todd; Gonçalves, Paula

    2015-05-21

    We report the genome sequencing and annotation of the basidiomycetous red-pigmented yeast Sporidiobolus salmonicolor strain CBS 6832. The current assembly contains 395 scaffolds, for a total size of about 20.5 Mb and a G+C content of ~61.3%. The genome annotation predicts 5,147 putative protein-coding genes. Copyright © 2015 Coelho et al.

  18. Kinesin-3 in the basidiomycete Ustilago maydis transports organelles along the entire microtubule array.

    Science.gov (United States)

    Steinberg, Gero

    2015-01-01

    The molecular motor kinesin-3 transports early endosomes along microtubules in filamentous fungi. It was reported that kinesin-3 from the ascomycete fungi Aspergillus nidulans and Neurospora crassa use a subset of post-translationally modified and more stable microtubules. Here, I show that kinesin-3 from the basidiomycete Ustilago maydis moves along all hyphal microtubules. This difference is likely due to variation in cell cycle control and associated organization of the microtubule array.

  19. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi

    OpenAIRE

    Machado,Kátia M.G.; Dácio R. Matheus; Bononi,Vera L. R.

    2005-01-01

    Remazol Brilliant Blue R (RBBR) dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%); 96 fungi showed a mycelia growth and decolorization activity stronger than the P. c...

  20. Efficient and simple electro-transformation of intact cells for the basidiomycetous fungus Pseudozyma hubeiensis

    OpenAIRE

    Konishi, Masaaki; Yoshida, Yuta; Ikarashi, Mizuki; Horiuchi, Junichi; 小西, 正朗

    2015-01-01

    Objective: An electroporation procedure for the species was investigated to develop an efficient transformation method for the basidiomycetous fungus Pseudozyma hubeiensis SY62, a strong biosurfactant-producing host. Results: A plasmid, pUXV1emgfp including green fluorescence protein as a reporter gene, was constructed to determine the transformation and expression of foreign genes. Optimal electroporation conditions achieved 44.8 transformants μg−1 plasmid competency (intact cells) without p...

  1. Aromadendrane and cyclofarnesane sesquiterpenoids from cultures of the basidiomycete Inonotus sp. BCC 23706.

    Science.gov (United States)

    Isaka, Masahiko; Yangchum, Arunrat; Supothina, Sumalee; Boonpratuang, Thitiya; Choeyklin, Rattaket; Kongsaeree, Palangpon; Prabpai, Samran

    2015-10-01

    Twelve aromadendrane sesquiterpenoids, inonotins A-L, and a previously unknown cyclofarnesane, i.e., inonofarnesane, together with two known compounds, were isolated from cultures of the wood-rotting basidiomycete Inonotus sp. BCC 23706. Inonotin I is identical to a previously reported compound with an incorrect structure. Structures of the compounds were elucidated by spectroscopic analysis and X-ray crystallography. The absolute configurations of inonotin D and inonofarnesane were determined by application of the modified Mosher's method.

  2. Alliacane sesquiterpenoids from submerged cultures of the basidiomycete Inonotus sp. BCC 22670.

    Science.gov (United States)

    Isaka, Masahiko; Sappan, Malipan; Supothina, Sumalee; Srichomthong, Kitlada; Komwijit, Somjit; Boonpratuang, Thitiya

    2017-02-04

    Nine alliacane sesquiterpenoids, inonoalliacanes A-I, were isolated from culture broth of the basidiomycete Inonotus sp. BCC 22670. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of inonoalliacane F was determined by application of the modified Mosher's method. Inonoalliacane A, the most abundant sesquiterpene constituent, exhibited moderate antibacterial activity against Bacillus cereus, whereas inonoalliacane B showed antiviral activity against herpes simplex virus type 1.

  3. Unexpected diversity of basidiomycetous endophytes in sapwood and leaves of Hevea.

    Science.gov (United States)

    Martin, Rachael; Gazis, Romina; Skaltsas, Demetra; Chaverri, Priscila; Hibbett, David

    2015-01-01

    Research on fungal endophytes has expanded dramatically in recent years, but little is known about the diversity and ecological roles of endophytic basidiomycetes. Here we report the analysis of 310 basidiomycetous endophytes isolated from wild and planted populations of the rubber tree genus, Hevea. Species accumulation curves were nonasymptotic, as in the majority of endophyte surveys, indicating that more sampling is needed to recover the true diversity of the community. One hundred eighteen OTUs were delimited, representing nine orders of Basidiomycota (Agaricales, Atheliales, Auriculariales, Cantharellales, Hymenochaetales, Polyporales, Russulales, Septobasidiales, Tremellales). The diversity of basidiomycetous endophytes found inhabiting wild populations of Hevea was comparable to that present in plantations. However, when samples were segregated by tissue type, sapwood of wild populations was found to contain a higher number of species than sapwood of planted trees. Seventy-five percent of isolates were members of the Polyporales, the majority in the phlebioid clade. Most of the species belong to clades known to cause a white-rot type of wood decay. Two species in the insect-associated genus Septobasidium were isolated. The most frequently isolated genera included Bjerkandera, Ceriporia, Phanerochaete, Phlebia, Rigidoporus, Tinctoporellus, Trametes (Polyporales), Peniophora, Stereum (Russulales) and Coprinellus (Agaricales), all of which have been reported as endophytes from a variety of hosts, across wide geographic locations. Literature records on the geographic distribution and host association of these genera revealed that their distribution and substrate affinity could be extended if the endophytic niche was investigated as part of fungal biodiversity surveys.

  4. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2014-03-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose. Keywords: Basidiomycetes, mycelium, culture filtrate, polyphenols, carotenoids

  5. Du personnel au politique : construction d’une identité militante dans le journal d’Alice Stone Blackwell (1872-1874

    Directory of Open Access Journals (Sweden)

    Claire Sorin

    2008-09-01

    Full Text Available Le militantisme n’est pas seulement affaire de scène publique ; les coulisses, qui sont en interaction permanente avec cette scène, forment un espace crucial où les enjeux se tissent et les acteurs se fabriquent. Alice Stone Blackwell, la fille de la célèbre féministe américaine Lucy Stone, a laissé un certain nombre de journaux mais c’est dans celui qu’elle écrivit adolescente (1872-1874 que l’on voit clairement s’ébaucher et s’incarner la voix militante de l’auteur. L’étude d’un texte « privé » (dont le statut est en fait beaucoup plus complexe ne présente pas seulement l’intérêt d’un regard intime et particulier sur le mouvement féministe américain de la fin du dix-neuvième siècle. Elle permet aussi de comprendre comment l’écriture autorise le sujet à tester et à s’approprier un ensemble de discours sur la nature féminine qui rompent avec l’idéal de domesticité et le culte de la fragilité. Le journal permet à Alice Blackwell de construire son identité de militante et de l’articuler avec d’autres facettes de son existence. Loin d’être simplement le reflet conventionnel d’une pratique bourgeoise essentiellement réservée au sexe féminin, l’écriture du journal chez Blackwell participe d’un acte militant, dont le trait le plus saillant est sans doute de mettre en scène un corps vigoureux et triomphant, apte à investir la sphère publique.El militantismo no sólo es un asunto de la escena pública ; los arcanos, en continua interacción con esa escena, forman un espacio donde se trama lo que está en juego y donde se fabrican los actores. Alice Stone Blackwell, hija de la famosa feminista americana Lucy Stone, ha dejado varios diarios, pero es en él que escribió de joven (1872-1874 donde claramente se esboza y se encarna la voz militante de la autora. El estudiar un texto « privado » no sólo presenta el interés de una mirada intima sobre el movimiento

  6. Clinical significance and molecular characterization of nonsporulating molds isolated from the respiratory tracts of bronchopulmonary mycosis patients with special reference to basidiomycetes.

    Science.gov (United States)

    Singh, Pradeep Kumar; Kathuria, Shallu; Agarwal, Kshitij; Gaur, Shailendra Nath; Meis, Jacques F; Chowdhary, Anuradha

    2013-10-01

    Nonsporulating molds (NSMs), especially basidiomycetes, have predominantly been reported as human pathogens responsible for allergic and invasive disease. Their conventional identification is problematic, as many isolates remain sterile in culture. Thus, inconclusive culture reports might adversely affect treatment decisions. The clinical significance of NSMs in pulmonary mycoses is poorly understood. We sequenced the internal transcribed spacer (ITS) region and D1/D2 domain of the larger subunit (LSU) of 52 NSMs isolated from respiratory specimens. The basidiomycetes were the predominant NSMs, of which Schizophyllum commune was the most common agent in allergic bronchopulmonary mycosis (ABPM), followed by Ceriporia lacerata in invasive fungal disease. Porostereum spadiceum, Phanaerochaete stereoides, Neosartorya fischeri, and Marasmiellus palmivorus were the other molds observed. Application of ITS and LSU region sequencing identified 92% of the isolates. The antifungal susceptibility data revealed that all basidiomycetes tested were susceptible to amphotericin B and resistant to caspofungin, fluconazole, and flucytosine. Except for 3 isolates of S. commune and a solitary isolate of M. palmivorus, all basidiomycetes had low MICs for itraconazole, posaconazole, and voriconazole. Basidiomycetes were isolated from patients with ABPM, invasive pulmonary mycosis/pneumonia, or fungal balls. In addition, the majority of the basidiomycetes were isolated from patients with chronic respiratory disorders who were sensitized to one of the basidiomycetous fungi and demonstrated precipitating antibodies against the incriminating fungi, indicating an indolent tissue reaction. Thus, isolation of basidiomycetes from the lower respiratory tract could be significant, and it is important to monitor these patients in order to prevent subsequent lung damage.

  7. The cell end marker Tea4 regulates morphogenesis and pathogenicity in the basidiomycete fungus Ustilago maydis.

    Science.gov (United States)

    Valinluck, Michael; Woraratanadharm, Tad; Lu, Ching-yu; Quintanilla, Rene H; Banuett, Flora

    2014-05-01

    Positional cues localized to distinct cell domains are critical for the generation of cell polarity and cell morphogenesis. These cues lead to assembly of protein complexes that organize the cytoskeleton resulting in delivery of vesicles to sites of polarized growth. Tea4, an SH3 domain protein, was first identified in fission yeast, and is a critical determinant of the axis of polarized growth, a role conserved among ascomycete fungi. Ustilago maydis is a badiomycete fungus that exhibits a yeast-like form that is nonpathogenic and a filamentous form that is pathogenic on maize and teozintle. We are interested in understanding how positional cues contribute to generation and maintenance of these two forms, and their role in pathogenicity. We identified a homologue of fission yeast tea4 in a genetic screen for mutants with altered colony and cell morphology and present here analysis of Tea4 for the first time in a basidiomycete fungus. We demonstrate that Tea4 is an important positional marker for polarized growth and septum location in both forms. We uncover roles for Tea4 in maintenance of cell and neck width, cell separation, and cell wall deposition in the yeast-like form, and in growth rate, formation of retraction septa, growth reversal, and inhibition of budding in the filamentous form. We show that Tea4::GFP localizes to sites of polarized or potential polarized growth in both forms, as observed in ascomycete fungi. We demonstrate an essential role of Tea4 in pathogencity in the absence of cell fusion. Basidiomycete and ascomycete Tea4 homologues share SH3 and Glc7 domains. Tea4 in basidiomycetes has additional domains, which has led us to hypothesize that Tea4 has novel functions in this group of fungi.

  8. Novel haloperoxidase from the agaric basidiomycete Agrocybe aegerita oxidizes aryl alcohols and aldehydes.

    Science.gov (United States)

    Ullrich, René; Nüske, Jörg; Scheibner, Katrin; Spantzel, Jörg; Hofrichter, Martin

    2004-08-01

    Agrocybe aegerita, a bark mulch- and wood-colonizing basidiomycete, was found to produce a peroxidase (AaP) that oxidizes aryl alcohols, such as veratryl and benzyl alcohols, into the corresponding aldehydes and then into benzoic acids. The enzyme also catalyzed the oxidation of typical peroxidase substrates, such as 2,6-dimethoxyphenol (DMP) or 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS). A. aegerita peroxidase production depended on the concentration of organic nitrogen in the medium, and highest enzyme levels were detected in the presence of soybean meal. Two fractions of the enzyme, AaP I and AaP II, which had identical molecular masses (46 kDa) and isoelectric points of 4.6 to 5.4 and 4.9 to 5.6, respectively (corresponding to six different isoforms), were identified after several steps of purification, including anion- and cation-exchange chromatography. The optimum pH for the oxidation of aryl alcohols was found to be around 7, and the enzyme required relatively high concentrations of H(2)O(2) (2 mM) for optimum activity. The apparent K(m) values for ABTS, DMP, benzyl alcohol, veratryl alcohol, and H(2)O(2) were 37, 298, 1,001, 2,367 and 1,313 microM, respectively. The N-terminal amino acid sequences of the main AaP II spots blotted after two-dimensional gel electrophoresis were almost identical and exhibited almost no homology to the sequences of other peroxidases from basidiomycetes, but they shared the first three amino acids, as well as two additional amino acids, with the heme chloroperoxidase (CPO) from the ascomycete Caldariomyces fumago. This finding is consistent with the fact that AaP halogenates monochlorodimedone, the specific substrate of CPO. The existence of haloperoxidases in basidiomycetous fungi may be of general significance for the natural formation of chlorinated organic compounds in forest soils.

  9. EFFECTS OF MICROELEMENTS ON THE CAROTENOID SYNTHESIS BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    A. K. Velygodska

    2016-08-01

    Full Text Available The effect of microelements on growth and accumulation of carotenoids highly productive strains of basidiomycetes at surface cultivation on glucose-peptone medium was investigated. The objects of research are 3 wood destroying strain. There are Laetiporus sulphureus (Bull. Murrill Ls-08, Fomes fomentarius (L. Fr. Ff-1201 from the order Polyporales and Fistulina hepatica (Schaeff. Sibth Fh-18 from the order Agaricales. Research materials are strains mycelium and culture filtrate (CF. Absolutely dry biomass (ADB mycelium was determined by the gravimetric method, the content of carotenoids was determined by spectrophotometric method in acetone extracts of the Vetshteyn formula. Established individual influence of microelements on the accumulation of biomass and carotenoids of basidiomycetes strains. The possibility of the regulation of these processes by introducing into the glucose-peptone medium of various Fe, Cu, Zn, Ni and Mn sulphate. So, the best to increase the intensity of the growth processes and the accumulation of carotenoids strain of L. sulphureus Ls-08 is an experimental environment which includes Zn sulfate in a concentration of 8 mmol/L. To induce the accumulation of ADB and carotenoids in the mycelium and CF of strain F fomentarius Ff-1201 making in is expedient Mn sulfate in a concentration of 1.6 mmol/L. To improve carotenogenesis of F. hepatica Fh-18 strain expedient entry in GPM Mn sulphate at concentration of 8 mmol/L. These allow to optimize the concentration of microelements in nutrient medium for the cultivation of carotenoids high-producing strains of Basidiomycetes.

  10. Inhibition of growth and sporulation of Penicillium expansum by extracts of selected Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Teresa Florianowicz

    2014-01-01

    Full Text Available A screening of antifungal activity of 33 Basidiomycetes strains was realized with their extracts. The influence of aqueous extracts of fruit-bodies of the testeded fungi after addition of spores or hyphae of Penicillium expansum on growth and sporulation of the fitopathogen in vitro was estimated. The species: Hydnum repandum L.: Fr., Pleurotus ostreatus (Jacq.: Fr. Kummer, Coprinus comatus (Műll Fr. S.F. Gray, Coprinus atramentarius (Bull: Fr. Fr. and Lactarius turpis (Weinm. Fr. reduced the mycelial growth and inhibited sporulation of this pathogen.

  11. Anticancer properties of polysaccharides isolated from fungi of the Basidiomycetes class.

    Science.gov (United States)

    Lemieszek, Marta; Rzeski, Wojciech

    2012-01-01

    Basidiomycete mushrooms represent a valuable source of biologically active compounds with anticancer properties. This feature is primarily attributed to polysaccharides and their derivatives. The anticancer potential of polysaccharides is linked to their origin, composition and chemical structure, solubility and method of isolation. Moreover, their activity can be significantly increased by chemical modifications. Anticancer effects of polysaccharides can be expressed indirectly (immunostimulation) or directly (cell proliferation inhibition and/or apoptosis induction). Among the wide range of polysaccharides with documented anticancer properties, lentinan, polysaccharide-K (PSK) and schizophyllan deserve special attention. These polysaccharides for many years have been successfully applied in cancer treatment and their mechanism of action is the best known.

  12. Prenylhydroquinone-Derived Secondary Metabolites from Cultures of the Basidiomycete Lentinus similis BCC 52578.

    Science.gov (United States)

    Isaka, Masahiko; Palasarn, Somporn; Sappana, Malipan; Srichomthong, Kitlada; Karunarathna, Samantha C; Hyde, Kevin D

    2015-08-01

    Two new prenylhydroquinone-derived compounds, Ientinospirol (1) and 1-(2,5-dihydroxyphenyl)-4-hydroxy-3-methyl-l-butanone (2), were isolated from cultures of the basidiomycete Lentinus similis BCC 52578, together with the known compounds panepoxydone (3), panepoxydione (4), isopanepoxydone (5), 2,2-dimethyl-6-hydroxy-2H-chromene (6), and (3R,4S)-3,4-dihydroxy-2,2-dimethyl-6-methoxychroman (7). Compounds 3 and 4 exhibited cytotoxicity against all cell-lines tested, while the other compounds were inactive.

  13. A comparison of hypoglycemic activity of three species of basidiomycetes rich in vanadium.

    Science.gov (United States)

    Han, Chunchao; Liu, Tongjun

    2009-02-01

    The hypoglycemic activity of fermented mushroom of three fungi of basidiomycetes rich in vanadium was studied in this paper. Alloxan- and adrenalin-induced hyperglycemic mice were used in the study. The blood glucose and the sugar tolerance were determined. After the mice were administered (ig) with Coprinus comatus rich in vanadium, the blood glucose of alloxan-induced hyperglycemic mice decreased (p hypoglycemic effects of Coprinus comatus rich in vanadium on hyperglycemic animals are significant; it may be used as a hypoglycemic food or medicine for hyperglycemic people.

  14. Antifungal activity of some metabolites of higher fungi (Basidiomycetes - an overview

    Directory of Open Access Journals (Sweden)

    Teresa Florianowicz

    2014-01-01

    Full Text Available A series of compounds of different chemical structures showing antifungal activity were isolated from higher fungi (Basidiomycetes fruit bodies. Among the microflora against which the examined metabolites showed effective activity, there are pathogenic organisms for people as well as for animals: Candida albicans, Candida tropicalis, Rhodotorula rubra, Aspergillus fumigatus and pathogens attacking plants: Penicillium chrysogenum, Botrytis cinerea, Alternaria solani, Fusarium culmorum, Trichoderma lignorum and Verticillium dahlae. Searching for fungal metabolites having antifungal activity creates possibilities of using them against a range of fungal pathogens of clinical, agronomic and environmental significance.

  15. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  16. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  17. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  18. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  19. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2014-04-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose.

  20. Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas.

    Science.gov (United States)

    Taylor, D Lee; McCormick, Melissa K

    2008-01-01

    Despite advances owing to molecular approaches, several hurdles still obstruct the identification of fungi forming orchid mycorrhizas. The Tulasnellaceae exhibit accelerated evolution of the nuclear ribosomal operon, causing most standard primers to fail in polymerase chain reaction (PCR) trials. Insufficient sequences are available from well characterized isolates and fruitbodies. Lastly, taxon-specific PCR primers are needed in order to explore the ecology of the fungi outside of the orchid root. Here, progress in overcoming these hurdles is reported. Broad-spectrum basidiomycete internal transcribed spacer (ITS) primers that do not exclude most known Tulasnellaceae are presented. blast searches and empirical PCR tests support their wide utility within the Basidiomycota. Taxon-specific ITS primers are presented targeted to orchid-associated Tulasnella, and a core component of the Thelephora-Tomentella complex. The efficiency and selectivity of these primer sets are again supported by blast searches and empirical tests. Lastly, ITS DNA sequences are presented from several strains of Epulorhiza, Ceratorhiza, Ceratobasidium, Sistotrema, Thanatephorus and Tulasnella that were originally described in the landmark mycorrhizal studies of Currah and Warcup. Detailed phylogenetic analyses reveal some inconsistencies in species concepts in these taxonomically challenging resupinate basidiomycetes, but also help to place several sequences from environmental samples.

  1. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants.

  2. Molecular characterization of a lipoxygenase from the basidiomycete mushroom Pleurotus ostreatus.

    Science.gov (United States)

    Tasaki, Yuji; Toyama, Shungo; Kuribayashi, Takashi; Joh, Toshio

    2013-01-01

    The full-length cDNA of the gene PoLOX1 encoding a lipoxygenase (LOX) and its corresponding genomic DNA were isolated from the basidiomycete mushroom Pleurotus ostreatus strain H1. The deduced amino acid sequence of PoLOX1 showed similarity to a valencene dioxygenase of Pleurotus sapidus, putative LOX-like proteins from ascomycete, basidiomycete, and deuteromycete fungi, and known LOXs from plants, animals, and bacteria. PoLOX1 also contained the LOX iron-binding catalytic domain in the C-terminal region, but not the polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain, which is usually found in the N-terminal region of eukaryotic LOXs. Genomic sequence analysis revealed that PoLOX1 was interrupted by one intron, and that the promoter region included TATA and CAAT boxes. Southern blot analysis indicated that PoLOX1 is a member of a small gene family comprising highly similar genes. Northern blot analysis revealed that it is transcribed more abundantly in the stipes of the fruit bodies than in the caps.

  3. Novel Root-Fungus Symbiosis in Ericaceae: Sheathed Ericoid Mycorrhiza Formed by a Hitherto Undescribed Basidiomycete with Affinities to Trechisporales

    Science.gov (United States)

    Vohník, Martin; Sadowsky, Jesse J.; Kohout, Petr; Lhotáková, Zuzana; Nestby, Rolf; Kolařík, Miroslav

    2012-01-01

    Ericaceae (the heath family) are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM) fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed ‘sheathed ericoid mycorrhiza’, discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity) to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet remain

  4. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  5. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  6. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    Science.gov (United States)

    Baharaeen, S.; Vishniac, H. S.

    1984-01-01

    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  7. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  8. Cytochrome P450 monooxygenases involved in anthracene metabolism by the white-rot basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Chigu, Nomathemba Loice; Hirosue, Sinji; Nakamura, Chie; Teramoto, Hiroshi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-08-01

    Cytochrome P450 monooxygenases (P450s) involved in anthracene metabolism by the white-rot basidiomycete Phanerochaete chrysosporium were identified by comprehensive screening of both catalytic potentials and transcriptomic profiling. Functional screening of P. chrysosporium P450s (PcCYPs) revealed that 14 PcCYP species catalyze stepwise conversion of anthracene to anthraquinone via intermediate formation of anthrone. Moreover, transcriptomic profiling explored using a complementary DNA microarray system demonstrated that 12 PcCYPs are up-regulated in response to exogenous addition of anthracene. Among the up-regulated PcCYPs, five species showed catalytic activity against anthracene. Based upon both catalytic and transcriptional properties, these five species are most likely to play major roles in anthracene metabolic processes in vivo. Thus, the combination of functional screening and a microarray system may provide a novel strategy for obtaining a thorough understanding of the catalytic functions and biological impacts of PcCYPs.

  9. The mitochondrial genome of the wood-degrading basidiomycete Trametes cingulata.

    Science.gov (United States)

    Haridas, Sajeet; Gantt, J Stephen

    2010-07-01

    We present the 91,500 bp mitochondrial genome of the wood-degrading basidiomycete Trametes cingulata and compare it with the mitochondrial genomes of five additional Basidiomycota species. The Trametes mitochondrial genome encodes 15 proteins, 25 tRNAs and the small and large rRNAs. All of the genes, except one tRNA, are found on the same DNA strand. Several additional ORFs have also been identified; however, their sequences have not been conserved across the species we compared and they show no similarity to any known gene, suggesting that they may not correspond to authentic genes. The presence of endonuclease-like sequences in introns suggests a mechanism that explains the diversity of mitochondrial genome sizes that are unrelated to the gene content.

  10. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  11. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  12. A deviation from the bipolar-tetrapolar mating paradigm in an early diverged basidiomycete.

    Directory of Open Access Journals (Sweden)

    Marco A Coelho

    2010-08-01

    Full Text Available In fungi, sexual identity is determined by specialized genomic regions called MAT loci which are the equivalent to sex chromosomes in some animals and plants. Usually, only two sexes or mating types exist, which are determined by two alternate sets of genes (or alleles at the MAT locus (bipolar system. However, in the phylum Basidiomycota, a unique tetrapolar system emerged in which four different mating types are generated per meiosis. This occurs because two functionally distinct molecular recognition systems, each encoded by one MAT region, constrain the selection of sexual partners. Heterozygosity at both MAT regions is a pre-requisite for mating in both bipolar and tetrapolar basidiomycetes. Tetrapolar mating behaviour results from the absence of genetic linkage between the two regions bringing forth up to thousands of mating types. The subphylum Pucciniomycotina, an early diverged lineage of basidiomycetes encompassing important plant pathogens such as the rusts and saprobes like Rhodosporidium and Sporidiobolus, has been so far poorly explored concerning the content and organization of MAT loci. Here we show that the red yeast Sporidiobolus salmonicolor has a mating system unlike any previously described because occasional disruptions of the genetic cohesion of the bipolar MAT locus originate new mating types. We confirmed that mating is normally bipolar and that heterozygosity at both MAT regions is required for mating. However, a laboratory cross showed that meiotic recombination may occur within the bipolar MAT locus, explaining tetrapolar features like increased allele number and evolution rates of some MAT genes. This pseudo-bipolar system deviates from the classical bipolar-tetrapolar paradigm and, to our knowledge, has never been observed before. We propose a model for MAT evolution in the Basidiomycota in which the pseudo-bipolar system may represent a hitherto unforeseen gradual form of transition from an ancestral tetrapolar

  13. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  14. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Science.gov (United States)

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  15. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  16. Structural Variation (SV Markers in the Basidiomycete Volvariella volvacea and Their Application in the Construction of a Genetic Map

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2015-07-01

    Full Text Available Molecular markers and genetic maps are useful tools in genetic studies. Novel molecular markers and their applications have been developed in recent years. With the recent advancements in sequencing technology, the genomic sequences of an increasingly great number of fungi have become available. A novel type of molecular marker was developed to construct the first reported linkage map of the edible and economically important basidiomycete Volvariella volvacea by using 104 structural variation (SV markers that are based on the genomic sequences. Because of the special and simple life cycle in basidiomycete, SV markers can be effectively developed by genomic comparison and tested in single spore isolates (SSIs. This stable, convenient and rapidly developed marker may assist in the construction of genetic maps and facilitate genomic research for other species of fungi.

  17. Versatile applications of the culinary-medicinal mushroom Mycoleptodonoides aitchisonii (Berk.) Maas G. (Higher Basidiomycetes): a review.

    Science.gov (United States)

    Chandrasekaran, Gayathri; Oh, Deuk-Sil; Shin, Hyun-Jae

    2012-01-01

    Higher Basidiomycetes medicinal mushroom Mycoleptodonoides aitchisonii has become attractive as a natural health product because of its antihypertensive effects on human health. Moreover, the food industry is especially interested in the preparation of the nutritional tonic of this mushroom. Various studies on this mushroom have shown that it has antidiabetic, antihypertensive, and antioxidant effects. The aim of this review is to report the present findings from studies on this mushroom and to discuss its future prospects.

  18. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    OpenAIRE

    Fedotov O. V.; Voloshko T.E.

    2013-01-01

    A method for obtaining of enzyme preparations of enzyme preparations (EP) of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfat...

  19. Systematic Identification and Evolutionary Analysis of Catalytically Versatile Cytochrome P450 Monooxygenase Families Enriched in Model Basidiomycete Fungi

    OpenAIRE

    Khajamohiddin Syed; Karabo Shale; Nataraj Sekhar Pagadala; Jack Tuszynski

    2014-01-01

    Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s) in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to id...

  20. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  1. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    OpenAIRE

    Sampaio, José Paulo; Libkind, Diego; Ruffini, Alejandra; Alves, Leonor; van Broock,Maria

    2006-01-01

    Applied and Environmental Microbiology, Vol. 73, No.4 Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with ...

  2. Better One-Eyed than Blind--Challenges and Opportunities of Biomass Measurement During Solid-State Fermentation of Basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Bley, Thomas

    2015-01-01

    Filamentous fungi, especially basidiomycetes, produce a wide range of metabolites, many of which have potential biotechnological and industrial applications. Solid-state fermentation (SSF) is very suitable for the cultivation of basidiomycetes since it mimics the natural habitat of these fungi. Some of the major advantages of SSF are the robustness of the process, the use of low-cost residual materials as substrates, and the reduced usage of water. However, monitoring key variables is difficult, which makes process control a challenge. Specifically, it is very difficult to determine the biomass during SSF process involving basidiomycetes. This is problematic, as the biomass is normally a key variable in mass and energy balance equations. Further, the success of fungal SSF processes is often evaluated, in part, based on the growth of the fungus. Direct determination of the dry weight of biomass is impossible and indirect quantification techniques must be used. Over the years, various determination techniques have been developed for the quantification of fungal biomass in SSF processes. The current review gives an overview of various direct and indirect biomass determination methods, discussing their advantages and disadvantages.

  3. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  4. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  5. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta'Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  6. The temperature dependance of photoinhibition in the tropical basidiomycete lichen Cora pavonia E. Fries.

    Science.gov (United States)

    Coxson, D S

    1987-09-01

    The response of net photosynthesis (NP) and dark respiration to periods of high insolation exposure was examined in the tropical basidiomycete lichen Cora pavonia. Photoinhibition of NP proved quite dependant on temperature. Rates of light saturated NP were severely impaired immediately after pretreatment high light exposure at temperatures of 10, 20 and 40°C, while similar exposure at 30°C resulted in only minimal photoinhibition. Apparent quantum yield proved an even more sensitive indicator of photoinhibition, reduced in all temperature treatments, although inhibition was again greatest at low and high temperatures. Concurrent exposure to reduced O2 tensions during high light exposure mitigated some of the deleterious effects of high light exposure at 10 and 20°C, suggesting an interaction of O2 with the inactivation of photosynthetic function. This represents the first reported instance of light dependant chilling stress in lichens, and may be an important limitation on the distribution of this and other tropical lichen species. This narrow range of temperatures within which thalli of C. pavonia can withstand periods of high insolation exposure coincides with that faced by hydrated thalli during rare periods of high insolation exposure within the cloud/shroud zone on La Soufrière, and points to the necessity of considering periods of atypical or unusual climatic events when interpreting patterns of net photosynthetic response, both in tropical and in north temperate lichen species.

  7. A novel serine protease with caspase- and legumain-like activities from edible basidiomycete Flammulina velutipes.

    Science.gov (United States)

    Iketani, Aya; Nakamura, Mayumi; Suzuki, Yuya; Awai, Koichiro; Shioi, Yuzo

    2013-03-01

    A serine protease with caspase- and legumain-like activities from basidiocarps of the edible basidiomycete Flammulina velutipes was characterized. The protease was purified to near homogeneity by three steps of chromatography using acetyl-Tyr-Val-Ala-Asp-4-methylcoumaryl-7-amide (Ac-YVAD-MCA) as a substrate. The enzyme was termed FvSerP (F. velutipes serine protease). This enzyme activity was completely inhibited by the caspase-specific inhibitor, Ac-YVAD-CHO, as well as moderately inhibited by serine protease inhibitors. Based on the N-terminal sequence, the cDNA of FvSerP was identified. The deduced protease sequence was a peptide composed of 325 amino acids with a molecular mass of 34.5 kDa. The amino acid sequence of FvSerP showed similarity to neither caspases nor to the plant subtilisin-like serine protease with caspase-like activity called saspase. FvSerP shared identity to the functionally unknown genes from class of Agaricomycetes, with similarity to the peptidase S41 domain of a serine protease. It was thus concluded that this enzyme is likely a novel serine protease with caspase- and legumain-like activities belonging to the peptidase S41 family and distributed in the class Agaricomycetes. This enzyme possibly functions in autolysis, a type of programmed cell death that occurs in the later stages of development of basidiocarps with reference to their enzymatic functions.

  8. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment.

  9. Characterization of basidiomycetous yeasts in hypersaline soils of the Urmia Lake National Park, Iran.

    Science.gov (United States)

    Mokhtarnejad, Lachin; Arzanlou, Mahdi; Babai-Ahari, Asadollah; Di Mauro, Simone; Onofri, Andrea; Buzzini, Pietro; Turchetti, Benedetta

    2016-11-01

    Urmia Lake, located in northwest Iran, is an oligotrophic and extremely hypersaline habitat that supports diverse forms of life. Owing to its unique biodiversity and special environmental conditions, Urmia Lake National Park has been designated as one of the biosphere reserves by UNESCO. This study was aimed to characterize basidiomycetous yeasts in hypersaline soils surrounding the Urmia Lake National Park using a polyphasic combination of molecular and physiological data. Soil samples were collected from eight sites in Lake Basin and six islands insides the lake. Yeast strains were identified by sequencing the D1/D2 domains of the 26S rRNA gene. When D1/D2 domain sequencing did not resolve the identity of the species, strain identification was obtained by ITS 1 & 2 sequencing. Twenty-one species belonging to the genera Cystobasidium, Holtermanniella, Naganishia, Rhodotorula, Saitozyma, Solicoccozyma, Tausonia, Vanrija, and Vishniacozyma were identified. Solicoccozyma aeria represented the dominant species. The ability of isolates to grow at 10 and 15 % of NaCl was checked; about two-thirds of the strains grew at 10 %, while about 13 % of the isolates grew in medium with 15 % NaCl. this study is the first study on the culturable yeast diversity in hypersaline soils surrounding an Asian lake.

  10. The ectomycorrhizal basidiomycete Hebeloma cylindrosporum undergoes early waves of transcriptional reprogramming prior to symbiotic structures differentiation.

    Science.gov (United States)

    Doré, Jeanne; Kohler, Annegret; Dubost, Audrey; Hundley, Hope; Singan, Vasanth; Peng, Yi; Kuo, Alan; Grigoriev, Igor V; Martin, Francis; Marmeisse, Roland; Gay, Gilles

    2017-03-01

    To clarify the early molecular interaction between ectomycorrhizal partners, we performed a RNA-Seq study of transcriptome reprogramming of the basidiomycete Hebeloma cylindrosporum before symbiotic structure differentiation with Pinus pinaster. Mycorrhiza transcriptome was studied for comparison. By reference to asymbiotic mycelium, 47 and 46 genes were specifically upregulated over fivefold (p ≤ 0.05) upon rhizosphere colonization and root adhesion respectively. Other 45 were upregulated throughout the symbiotic interaction, from rhizosphere colonization to differentiated mycorrhizas, whereas 274 were specifically upregulated in mycorrhizas. Although exoproteome represents 5.6% of H. cylindrosporum proteome, 38.5% of the genes upregulated upon pre-infectious root colonization encoded extracellular proteins. The proportion decreased to 23.5% in mycorrhizas. At all studied time points, mycorrhiza-induced small secreted proteins (MiSSPs), representing potential effectors, were over-represented among upregulated genes. This was also the case for carbohydrate-active enzymes (CAZymes). Several CAZymes were upregulated at all studied stages of the interaction. Consistent with a role in fungal morphogenesis and symbiotic interface differentiation, CAZymes over-expressed before and upon root attachment targeted fungal and both fungal and plant polysaccharides respectively. Different hydrophobins were upregulated upon early root adhesion, in mycorrhizas or throughout interaction. The functional classification of genes upregulated only in mycorrhizas pointed to intense metabolic activity and nutritional exchanges. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Physiological regulation of laccase and manganese peroxidase production by white-rot Basidiomycetes.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva

    2009-10-12

    This review integrates recent literature and our own data on the physiology of laccase and manganese peroxidase synthesis, focusing on the common characteristics and unique properties of individual fungi as well as on several approaches providing enhanced enzyme secretion. Firstly, the enzyme yield is species-dependent and strain-dependent and selection of new organisms with tremendous synthesis of these enzymes is possible. For example, in screening program the laccase activity of tested basidiomycetes varied from 0.5Uml(-1) to 75Uml(-1). Secondly, the carbon source and lignocellulosic substrate play a crucial role in enzyme production. Thus, laccase activity of Pseudotrametes gibbosa varied from 0.3Uml(-1) (Avicel) to 13.7Uml(-1) (lactose), while the substitution of wheat bran with walnut pericarp increased Cerrena unicolor manganese peroxidase yield from 0.7Uml(-1) to 8.3Uml(-1). Thirdly, aromatic compounds regulate the ligninolytic enzyme synthesis although their effect is very specific depending on fungi physiological peculiarities. 2,4,6-trinitrotoluene (TNT) supplemented to the medium at appropriate concentration significantly accelerated C. unicolor laccase production and 4-fold increased laccase specific activity. Fourthly, co-cultivation of appropriate fungi shows considerable promise as a strategy to highly enhance the enzyme production. For example, pairing of C. unicolor and Phellinus robustus 2-fold increased the total laccase yield.

  12. Production of gamma-lactones by the brown-rot basidiomycete Piptoporus soloniensis.

    Science.gov (United States)

    Okamoto, Kenji; Chimori, Mieko; Iwanaga, Fumi; Hattori, Tsutomu; Yanase, Hideshi

    2002-01-01

    A wild strain of brown-rot basidiomycete Piptoporus soloniensis produced a sweet flavor similar to tropical fruits in liquid cultures. The major and minor compounds were identified to be gamma-decalactone and gamma-octanolactone by gas chromatography-mass spectrometry analysis, respectively. The growth and production of gamma-decalactone by P. soloniensis in broth to which fatty acids had been added were investigated. The addition of 12-hydroxystearic acid and ricinoleic acid to the culture markedly enhanced the production of gamma-decalactone. On the other hand, addition of myristic acid, palmitic acid, stearic acid and oleic acid to the culture resulted in a higher production of gamma-octanolactone. The addition of hexanoic acid, octanoic acid, decanoic acid, lauric acid, linoleic acid and linolenic acid to the culture reduced the growth of P. soloniensis and production of gamma-decalactone and gamma-octanolactone. This strain accumulated oxalic acid in liquid culture and grew sufficiently under strongly acidic conditions.

  13. Injury-induced biosynthesis of methyl-branched polyene pigments in a white-rotting basidiomycete.

    Science.gov (United States)

    Schwenk, Daniel; Nett, Markus; Dahse, Hans-Martin; Horn, Uwe; Blanchette, Robert A; Hoffmeister, Dirk

    2014-12-26

    A stereaceous basidiomycete was investigated with regard to its capacity to produce yellow pigments after physical injury of the mycelium. Two pigments were isolated from mycelial extracts, and their structures were elucidated by ESIMS and one- and two-dimensional NMR methods. The structures were identified as the previously undescribed polyenes (3Z,5E,7E,9E,11E,13Z,15E,17E)-18-methyl-19-oxoicosa-3,5,7,9,11,13,15,17-octaenoic acid (1) and (3E,5Z,7E,9E,11E,13E,15Z,17E,19E)-20-methyl-21-oxodocosa-3,5,7,9,11,13,15,17,19-nonaenoic acid (2). Stable-isotope feeding with [1-(13)C]acetate and l-[methyl-(13)C]methionine demonstrated a polyketide backbone and that the introduction of the sole methyl branch is most likely S-adenosyl-l-methionine-dependent. Dose-dependent inhibition of Drosophila melanogaster larval development was observed with both polyenes in concentrations between 12.5 and 100 μM. GI50 values for 1 and 2 against HUVEC (K-562 cells) were 71.6 and 17.4 μM (15.4 and 1.1 μM), respectively, whereas CC50 values for HeLa cells were virtually identical (44.1 and 45.1 μM).

  14. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively.

  15. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  16. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  17. Sporobolomyces koalae sp. nov., a basidiomycetous yeast isolated from nasal smears of Queensland koalas kept in a Japanese zoological park.

    Science.gov (United States)

    Satoh, Kazuo; Makimura, Koichi

    2008-12-01

    Three strains (JCM 15063(T), JCM 15098 and JCM 15099) of a novel basidiomycetous yeast species belonging to the genus Sporobolomyces were isolated from nasal smears of Queensland koalas kept in a Japanese zoological park. Analyses of sequences of the nuclear rDNA internal transcribed spacer region and the 26S rDNA D1/D2 domain and morphological studies indicated that these strains represent a novel species with a close phylogenetic relationship to Sporobolomyces carnicolor and Sporobolomyces japonicus in the Sporidiobolus lineage, for which the name Sporobolomyces koalae sp. nov. is proposed (type strain JCM 15063(T) =CBS 10914(T) =DSM 19992(T)).

  18. Mushrooms by magic: making connections between signal transduction and fruiting body development in the basidiomycete fungus Schizophyllum commune.

    Science.gov (United States)

    Palmer, Gail E; Horton, J Stephen

    2006-09-01

    The basidiomycete fungus Schizophyllum commune has been utilised as a model system for examining the genetic regulation of sexual reproduction, a process that culminates in the production of mushrooms in this and many other related species. Recent studies have suggested that conserved elements of the cyclic AMP (cAMP) signalling pathway play a role in the control of mushroom development in S. commune. The small G-protein Ras also appears to impinge on the process, either by inputting into the cAMP pathway, or by acting in parallel. The molecular connections between nutrient sensing and mushroom development are now beginning to be examined.

  19. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period.

  20. Trinitrotoluene and mandarin peels selectively affect lignin-modifying enzyme production in white-rot basidiomycetes.

    Science.gov (United States)

    Kachlishvili, Eva; Asatiani, Mikheil; Kobakhidze, Aza; Elisashvili, Vladimir

    2016-01-01

    Five white-rot basidiomycetes (WRB) species have been evaluated for their potential to tolerate and to degrade 0.2 mM 2, 4, 6-trinitrotoluene (TNT) as well as to produce laccase and manganese peroxidase (MnP) in presence of this xenobiotic. The tested fungal strains produced laccase in both glycerol and mandarin peels-containing media, whereas in the glycerol-containing medium only Cerrena unicolor strains and Trametes versicolor BCC 775 secreted MnP. Replacement of glycerol by milled mandarin peels 3- to 45-fold increased laccase activity, promoted C. unicolor strains and T. versicolor MnP secretion and induced this enzyme production by Fomes fomentarius BCC 38 and Funalia trogii BCC 146. Differential response of the WRB strains to the TNT addition was observed. In particular, laccase activity of C. unicolor increased 2- to 3-fold in both media whereas no stimulation of the laccase production was revealed in cultivation of F. fomentarius. TNT practically did not affect the MnP activity. Two strains of C. unicolor followed by T. versicolor producing laccase and MnP almost completely removed 0.2 mM TNT from the synthetic medium. Increase of TNT concentration from 0 to 0.4 mM in the mandarin peels-based medium and from 0 to 0.3 mM in the glycerol-containing medium stimulated C. unicolor BCC 300 laccase production from 92.4 to 240.7 U/ml and from 17.1 to 48.6 U/ml, respectively. This strain has been resistant to the TNT high concentration and has ability to remove 85 % of initial 0.3 mM TNT content during 6 days of the submerged cultivation.

  1. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  2. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry.

  3. A Central Role for Ras1 in Morphogenesis of the Basidiomycete Schizophyllum commune

    Science.gov (United States)

    Knabe, Nicole; Jung, Elke-Martina; Freihorst, Daniela; Hennicke, Florian; Horton, J. Stephen

    2013-01-01

    Fungi have been used as model systems to define general processes in eukaryotes, for example, the one gene-one enzyme hypothesis, as well as to study polar growth or pathogenesis. Here, we show a central role for the regulator protein Ras in a mushroom-forming, filamentous basidiomycete linking growth, pheromone signaling, sexual development, and meiosis to different signal transduction pathways. ras1 and Ras-specific gap1 mutants were generated and used to modify the intracellular activation state of the Ras module. Transformants containing constitutive ras1 alleles (ras1G12V and ras1Q61L), as well as their compatible mating interactions, did show strong phenotypes for growth (associated with Cdc42 signaling) and mating (associated with mitogen-activated protein kinase signaling). Normal fruiting bodies with abnormal spores exhibiting a reduced germination rate were produced by outcrossing of these mutant strains. Homozygous Δgap1 primordia, expected to experience increased Ras signaling, showed overlapping phenotypes with a block in basidium development and meiosis. Investigation of cyclic AMP (cAMP)-dependent protein kinase A indicated that constitutively active ras1, as well as Δgap1 mutant strains, exhibit a strong increase in Tpk activity. Ras1-dependent, cAMP-mediated signal transduction is, in addition to the known signaling pathways, involved in fruiting body formation in Schizophyllum commune. To integrate these analyses of Ras signaling, microarray studies were performed. Mutant strains containing constitutively active Ras1, deletion of RasGap1, or constitutively active Cdc42 were characterized and compared. At the transcriptome level, specific regulation highlighting the phenotypic differences of the mutants is clearly visible. PMID:23606288

  4. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  5. ‘Art is not what you think it is (but we can approach it through the Art Matrix’. Review of: Donald Preziosi and Claire Farago, Art is Not What You Think It Is. Wiley-Blackwell, 2012

    Directory of Open Access Journals (Sweden)

    Ian Verstegen

    2013-12-01

    Full Text Available This review discusses Art is Not What You Think It Is, from the Wiley-Blackwell manifesto series. It focuses not only on the arguments about the presumed ideas about art – the sole maker of objects with unified content – but especially on the ‘art matrix’ that the authors propose to portray the shifting numerical and temporal elements linking makers and objects through forces of creation. The contribution of the authors is contrasted to the relative neglect of semiotics in art history and proposed as a good model to overcome apparent aporias in the field.

  6. Comparative and transcriptional analysis of the predicted secretome in the lignocellulose-degrading basidiomycete fungus Pleurotus ostreatus.

    Science.gov (United States)

    Alfaro, Manuel; Castanera, Raúl; Lavín, José L; Grigoriev, Igor V; Oguiza, José A; Ramírez, Lucía; Pisabarro, Antonio G

    2016-12-01

    Fungi interact with their environment by secreting proteins to obtain nutrients, elicit responses and modify their surroundings. Because the set of proteins secreted by a fungus is related to its lifestyle, it should be possible to use it as a tool to predict fungal lifestyle. To test this hypothesis, we bioinformatically identified 538 and 554 secretable proteins in the monokaryotic strains PC9 and PC15 of the white rot basidiomycete Pleurotus ostreatus. Functional annotation revealed unknown functions (37.2%), glycosyl hydrolases (26.5%) and redox enzymes (11.5%) as the main groups in the two strains. When these results were combined with RNA-seq analyses, we found that the relative importance of each group was different in different strains and culture conditions and the relevance of the unknown function proteins was enhanced. Only a few genes were actively expressed in a given culture condition in expanded multigene families, suggesting that family expansi on could increase adaptive opportunities rather than activity under a specific culture condition. Finally, we used the set of P. ostreatus secreted proteins as a query to search their counterparts in other fungal genomes and found that the secretome profiles cluster the tested basidiomycetes into lifestyle rather than phylogenetic groups. © 2016 The Authors Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  8. Ubc2, an Ortholog of the Yeast Ste50p Adaptor, Possesses a Basidiomycete-Specific Carboxy terminal Extension Essential for Pathogenicity Independent of Pheromone Response.

    Science.gov (United States)

    Proteins involved in the MAP kinase pathway controlling mating, morphogenesis and pathogenicity have been identified previously in the fungus Ustilago maydis. One of these, the Ubc2 adaptor protein, possesses a basidiomycete-specific structure. In addition to containing SAM and RA domains typical of...

  9. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  10. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  11. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  12. Genetic linkage map and expression analysis of genes expressed in the lamellae of the edible basidiomycete Pleurotus ostreatus.

    Science.gov (United States)

    Park, Sang-Kyu; Peñas, María M; Ramírez, Lucía; Pisabarro, Antonio G

    2006-05-01

    Pleurotus ostreatus is an industrially cultivated basidiomycete with nutritional and environmental applications. Its genome contains 35 Mbp organized in 11 chromosomes. There is currently available a genetic linkage map based predominantly on anonymous molecular markers complemented with the mapping of QTLs controlling growth rate and industrial productivity. To increase the saturation of the existing linkage maps, we have identified and mapped 82 genes expressed in the lamellae. Their manual annotation revealed that 34.1% of the lamellae-expressed and 71.5% of the lamellae-specific genes correspond to previously unknown sequences or to hypothetical proteins without a clearly established function. Furthermore, the expression pattern of some genes provides an experimental basis for studying gene regulation during the change from vegetative to reproductive growth. Finally, the identification of various differentially regulated genes involved in protein metabolism suggests the relevance of these processes in fruit body formation and maturation.

  13. Metabolism of pyrene by the basidiomycete crinipellis stipitaria and identification of pyrenequinones and their hydroxylated precursors in strain JK375

    Energy Technology Data Exchange (ETDEWEB)

    Lambert, M.; Kremer, S.; Anke, H.; Sterner, O. (Univ. of Lund (Sweden))

    1994-10-01

    The metabolism of pyrene, a polycyclic aromatic hydrocarbon, by submerged cultures of the basidiomycete Crinipellis stipitaria was studied. After incubation for 68 h at 25[degrees]C in a 20-liter fermentor with complex medium and 20 mg of pyrene per liter, five metabolites were detected. The compounds were isolated by preparative high-performance liquid chromatography on RP18 and DIOL gels. By, UV, infrared, and [sup 1]H nuclear magnetic resonance spectroscopy and mass spectrometry, 1-hydroxypyrene, 1,6-dihydroxypyrene, 1,8-dihydroxypyrene, 1,6-pyrenequinone, and 1,8-pyrenequinone were identified 1,6- and 1,8-dihydroxypyrene were obtained from fungal cultures for the first time. The formation of these metabolites was confirmed by investigations with [4,5,9,10-[sup 14]C]pyrene. 29 refs., 2 figs., 2 tabs.

  14. Rhodotorula subericola sp. nov., an anamorphic basidiomycetous yeast species isolated from bark of Quercus suber (cork oak).

    Science.gov (United States)

    Belloch, C; Villa-Carvajal, M; Alvarez-Rodríguez, M L; Coque, J J R

    2007-07-01

    Two yeasts strains, Y-31(T) and Y-20B, pertaining to a previously unknown yeast species were isolated from bark of cork oak in Spain. Physiological characterization revealed a pattern of assimilation of carbon and nitrogen compounds compatible with members of the genus Rhodotorula. From sequence analysis of the D1/D2 region of the 26S rRNA gene, Rhodotorula cycloclastica and Rhodotorula philyla were related to the unknown species. Phylogenetic reconstruction based on the D1/D2 region of the 26S rRNA gene showed that the novel species clustered in a branch together with R. cycloclastica. The name Rhodotorula subericola sp. nov. is proposed, with isolate Y-31(T) (=CECT 11976(T)=CBS 10442(T)) the type strain of this novel taxon in the Microbotryum lineage, subclass Microbotryomycetidae, class Urediniomycetes of basidiomycetous yeasts.

  15. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  16. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes.

    Science.gov (United States)

    Gomes, Eleni; Aguiar, Ana Paula; Carvalho, Caio César; Bonfá, Maricy Raquel B; da Silva, Roberto; Boscolo, Mauricio

    2009-01-01

    Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF) using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL(-1)) and Lentinus sp produced the highest activities of manganese peroxidase (MnP) and lignin peroxidase (LiP) (7 and 8 U mL(-1), respectively), when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60ºC while the peroxidases presented maximum activity at temperatures of 30 to 55ºC. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.

  17. The Blackwell Handbook of Internet Studies

    DEFF Research Database (Denmark)

    The Handbook of Internet Studies brings together scholars from a variety of fields to explore the profound shift that has occurred in how we communicate and experience our world as we have moved from the industrial era into the age of digital media. Original essays address issues within topics...... such as Internet and Society, Internet and Culture, Foundations, Futures, and Theory....

  18. The Blackwell Handbook of Internet Studies

    DEFF Research Database (Denmark)

    The Handbook of Internet Studies brings together scholars from a variety of fields to explore the profound shift that has occurred in how we communicate and experience our world as we have moved from the industrial era into the age of digital media. Original essays address issues within topics...... such as Internet and Society, Internet and Culture, Foundations, Futures, and Theory....

  19. Stone-Eating Fungi: Mechanisms in Bioweathering and the Potential Role of Laccases in Black Slate Degradation With the Basidiomycete Schizophyllum commune.

    Science.gov (United States)

    Kirtzel, Julia; Siegel, Daniela; Krause, Katrin; Kothe, Erika

    2017-01-01

    Many enzymes, such as laccases, are involved in the saprotrophic lifestyle of fungi and the effects of those may be linked to enhanced bioweathering on stone surfaces. To test this hypothesis, we studied the decomposition of kerogen-enriched lithologies, especially with black slate containing up to 20% of Corg. Indeed, a formation of ditches with attached hyphal material could be observed. To address enzymes involved, proteomics was performed and one group of enzymes, the multicopper oxidase family members of laccases, was specifically investigated. A role in bioweathering of rocks containing high contents of organic carbon in the form of kerogen could be shown using the basidiomycete Schizophyllum commune, a white rot fungus that has been used as a model organism to study the role of filamentous basidiomycete fungi in bioweathering of black slate. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Clinical Significance and Molecular Characterization of Nonsporulating Molds Isolated from the Respiratory Tracts of Bronchopulmonary Mycosis Patients with Special Reference to Basidiomycetes

    OpenAIRE

    Singh, Pradeep Kumar; Kathuria, Shallu; Agarwal, Kshitij; Gaur, Shailendra Nath; Meis, Jacques F.; Chowdhary, Anuradha

    2013-01-01

    Nonsporulating molds (NSMs), especially basidiomycetes, have predominantly been reported as human pathogens responsible for allergic and invasive disease. Their conventional identification is problematic, as many isolates remain sterile in culture. Thus, inconclusive culture reports might adversely affect treatment decisions. The clinical significance of NSMs in pulmonary mycoses is poorly understood. We sequenced the internal transcribed spacer (ITS) region and D1/D2 domain of the larger sub...

  1. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions.

  2. Enrichment of perforate septal pore caps from the basidiomycetous fungus Rhizoctonia solani by combined use of French press, isopycnic centrifugation, and Triton X-100.

    Science.gov (United States)

    van Driel, Kenneth G A; van Peer, Arend F; Wösten, Han A B; Verkleij, Arie J; Boekhout, Teun; Müller, Wally H

    2007-12-01

    Septal pore caps occur in many filamentous basidiomycetes located at both sides of the dolipore septum and are at their base connected to the endoplasmic reticulum. The septal pore cap ultrastructure has been described extensively by the use of electron microscopy, but its composition and function are not yet known. To enable biochemical and functional analyses in the future, we here describe an enrichment method for perforate septal pore caps from Rhizoctonia solani. Our method is based on the combined use of French press and isopycnic centrifugation, using a discontinuous sucrose gradient followed by a treatment with Triton X-100. Enrichment was monitored by the use of scanning electron microscopy and transmission electron microscopy. Using the same isolation method, smaller septal pore caps were isolated from two other basidiomycetes as well. Furthermore, we showed pore-occluding material co-purified with the septal pore caps. This observation supports the hypothesis that septal pore caps play a key role in the plugging process of the septal pores in filamentous basidiomycetes.

  3. Wood and humus decay strategies by white-rot basidiomycetes correlate with two different dye decolorization and enzyme secretion patterns on agar plates.

    Science.gov (United States)

    Barrasa, José M; Blanco, María N; Esteve-Raventós, Fernando; Altés, Alberto; Checa, Julia; Martínez, Angel T; Ruiz-Dueñas, Francisco J

    2014-11-01

    During several forays for ligninolytic fungi in different Spanish native forests, 35 white-rot basidiomycetes growing on dead wood (16 species from 12 genera) and leaf litter (19 species from 10 genera) were selected for their ability to decolorize two recalcitrant aromatic dyes (Reactive Blue 38 and Reactive Black 5) added to malt extract agar medium. In this study, two dye decolorization patterns were observed and correlated with two ecophysiological groups (wood and humus white-rot basidiomycetes) and three taxonomical groups (orders Polyporales, Hymenochaetales and Agaricales). Depending on the above groups, different decolorization zones were observed on the dye-containing plates, being restricted to the colony area or extending to the surrounding medium, which suggested two different decay strategies. These two strategies were related to the ability to secrete peroxidases and laccases inside (white-rot wood Polyporales, Hymenochaetales and Agaricales) and outside (white-rot humus Agaricales) of the fungal colony, as revealed by enzymatic tests performed directly on the agar plates. Similar oxidoreductases production patterns were observed when fungi were grown in the absence of dyes, although the set of enzyme released was different. All these results suggest that the decolorization patterns observed could be related with the existence of two decay strategies developed by white-rot basidiomycetes adapted to wood and leaf litter decay in the field.

  4. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  5. Survey of Macrofungi (including Truffles in Qatar

    Directory of Open Access Journals (Sweden)

    Roda F Al-Thani

    2010-07-01

    Full Text Available Fourteen macrofungal genera belonging to 11 families and 7 orders were identified. These were isolated from different habitats (semi- desert, gardens, park, decayed roots of dead trees and under trees in Qatar. Macrofungi are defined here as ascomycetes and basidiomycetes with large, conspicuous spore-bearing structures that form above or beneath ground. This study indicated that the distribution of macrofungi is dependent on the plant community and the environmental conditions.

  6. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process.

  7. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  8. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-01-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense. PMID:27616058

  9. Cryptococcus nanyangensis sp. nov., a new basidiomycetous yeast isolated from the gut of wood-boring larvae.

    Science.gov (United States)

    Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Li, Ying-Xia

    2012-11-01

    Two strains of a novel basidiomycetous yeast species were isolated from the gut of wood-boring larvae collected in the Baotianman Nature Reserve, the central China. Sequence analysis of the D1/D2 domains of the large subunit (LSU) rRNA gene and internal transcribed spacer (ITS) regions showed that these yeasts belong to the Bulleromyces clade and formed a cluster together with eleven undescribed Cryptococcus species. The novel species differed from its closest known species, Cryptococcus rajasthanensis, by 3.3 % divergence (15 substitutions and 6 gaps over 630 bases) in the D1/D2 domains, and by 13.4 % divergence (41 substitutions and 27 gaps over 508 bases) in the ITS regions. Physiologically, the fermentation of glucose, galactose, sucrose, trehalose, and raffinose in Durham tubes was observed for the strains of this new yeast. Based on the phenotypical and molecular characteristics presented, the two strains are proposed as a new species, Cryptococcus nanyangensis sp. nov., with the type strain KCY-1(T) (=CICC 1976(T) = CBS 12474(T)).

  10. Molecular cloning and heterologous expression in Pichia pastoris of X-prolyl-dipeptidyl aminopeptidase from basidiomycete Ustilago maydis.

    Science.gov (United States)

    Juárez-Montiel, Margarita; Ibarra, J Antonio; Chávez-Camarillo, Griselda; Hernández-Rodríguez, César; Villa-Tanaca, Lourdes

    2014-03-01

    Dipeptidyl aminopeptidases are enzymes involved in the posttranslational control of bioactive peptides. Here we identified the gene dapUm in Ustilago maydis by homology with other fungal dipeptidyl aminopeptidases. Analysis of the dapUm-deduced amino acid sequence indicated that it encodes for membrane-type serine protease with a characteristic prolyl oligopeptidase catalytic motif triad: Ser, Asp, His. In order to overexpress the DapUm, the gene encoding for it was cloned and transformed into Pichia. Using this system, we observed a ∼ 125-kDa recombinant protein with an optimal enzymatic activity at pH 6.0 and at 40 °C for the Ala-Pro-p-nitroanilide substrate and an experimental pH of 6.9. U. maydis DapUm was specifically inhibited by phenylmethylsulfonyl fluoride and Pefabloc, confirming the presence of a serine residue in the active site. To our knowledge, this study is the first report on the cloning and expression of a DPP IV dipeptidyl aminopeptidase from a basidiomycete organism. Moreover, the use of recombinant DapUm will allow us to further study and characterize this enzyme, in addition to testing chemical compounds for pharmaceutical purposes.

  11. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

    2017-02-01

    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  12. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  13. Transcription analysis of pyranose dehydrogenase from the basidiomycete Agaricus bisporus and characterization of the recombinantly expressed enzyme.

    Science.gov (United States)

    Gonaus, Christoph; Kittl, Roman; Sygmund, Christoph; Haltrich, Dietmar; Peterbauer, Clemens

    2016-03-01

    Agaricus bisporus is a litter degrading basidiomycete commonly found in humic-rich environments. It is used as model organism and cultivated in large scale for food industry. Due to its ecological niche it produces a variety of enzymes for detoxification and degradation of humified plant litter. One of these, pyranose dehydrogenase, is thought to play a role in detoxification and lignocellulose degradation. It is a member of the glucose-methanol-choline family of flavin-dependent enzymes and oxidizes a wide range of sugars with concomitant reduction of electron acceptors like quinones. In this work, transcription of pdh in A. bisporus was investigated with real-time PCR revealing influence of the carbon source on pdh expression levels. The gene was isolated and heterologously expressed in Pichia pastoris. Characterization of the recombinant enzyme showed a higher affinity towards disaccharides compared to other tested pyranose dehydrogenases from related Agariceae. Homology modeling and sequence alignments indicated that two loops of high sequence variability at substrate access site could play an important role in modulating these substrate specificities.

  14. Genomics and transcriptomics characterization of genes expressed during postharvest at 4°C by the edible basidiomycete Pleurotus ostreatus.

    Science.gov (United States)

    Ramírez, Lucía; Oguiza, José Antonio; Pérez, Gúmer; Lavín, José Luis; Omarini, Alejandra; Santoyo, Francisco; Alfaro, Manuel; Castanera, Raúl; Parenti, Alejandra; Muguerza, Elaia; Pisabarro, Antonio G

    2011-06-01

    Pleurotus ostreatus is an industrially cultivated basidiomycete with nutritional and environmental applications. Its genome, which was sequenced by the Joint Genome Institute, has become a model for lignin degradation and for fungal genomics and transcriptomics studies. The complete P. ostreatus genome contains 35 Mbp organized in 11 chromosomes, and two different haploid genomes have been individually sequenced. In this work, genomics and transcriptomics approaches were employed in the study of P. ostreatus under different physiological conditions. Specifically, we analyzed a collection of expressed sequence tags (EST) obtained from cut fruit bodies that had been stored at 4°C for 7 days (postharvest conditions). Studies of the 253 expressed clones that had been automatically and manually annotated provided a detailed picture of the life characteristics of the self-sustained fruit bodies. The results suggested a complex metabolism in which autophagy, RNA metabolism, and protein and carbohydrate turnover are increased. Genes involved in environment sensing and morphogenesis were expressed under these conditions. The data improve our understanding of the decay process in postharvest mushrooms and highlight the use of high-throughput techniques to construct models of living organisms subjected to different environmental conditions.

  15. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O.V.

    2013-04-01

    Full Text Available A method for obtaining of enzyme preparations of enzyme preparations (EP of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfate at 40-70% saturation of peroxidases and 80% of saturation - for catalase. These solutions protein fractions was further purified by dialysis and gel filtration on Molselekt granules G-50 and G-75. The enzyme solution was subjected to freeze-drying. The individual characteristics of the enzyme preparations were found. The individual characteristics of the enzyme preparations are the activity of enzymes, the protein content and amino-acid composition of enzyme preparations. It was established that strain F. velutipes F-vv was an active producer of intracellular and strain of A. cylindracea 167 was an active producer of extracellular peroxidase. The strains of P. ostreatus P-01 and P-208 were the active producers of extracellular catalase, and the strainsof F. hepatica Fh-08 were active producers of intracellular catalase. The developed methods for producing of enzymes catalase and peroxidase preparations of extra-and intracellular origin provided new antioxidant enzymes, which have their own properties and application prospects in various sectors of industry and science research.

  16. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  17. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  18. Two-component signal transduction in Agaricus bisporus: a comparative genomic analysis with other basidiomycetes through the web-based tool BASID2CS.

    Science.gov (United States)

    Lavín, José L; García-Yoldi, Alberto; Ramírez, Lucía; Pisabarro, Antonio G; Oguiza, José A

    2013-06-01

    Two-component systems (TCSs) are signal transduction mechanisms present in many eukaryotes, including fungi that play essential roles in the regulation of several cellular functions and responses. In this study, we carry out a genomic analysis of the TCS proteins in two varieties of the white button mushroom Agaricus bisporus. The genomes of both A. bisporus varieties contain eight genes coding for TCS proteins, which include four hybrid Histidine Kinases (HKs), a single histidine-containing phosphotransfer (HPt) protein and three Response Regulators (RRs). Comparison of the TCS proteins among A. bisporus and the sequenced basidiomycetes showed a conserved core complement of five TCS proteins including the Tco1/Nik1 hybrid HK, HPt protein and Ssk1, Skn7 and Rim15-like RRs. In addition, Dual-HKs, unusual hybrid HKs with 2 HK and 2 RR domains, are absent in A. bisporus and are limited to various species of basidiomycetes. Differential expression analysis showed no significant up- or down-regulation of the Agaricus TCS genes in the conditions/tissue analyzed with the exception of the Skn7-like RR gene (Agabi_varbisH97_2|198669) that is significantly up-regulated on compost compared to cultured mycelia. Furthermore, the pipeline web server BASID2CS (http://bioinformatics.unavarra.es:1000/B2CS/BASID2CS.htm) has been specifically designed for the identification, classification and functional annotation of putative TCS proteins from any predicted proteome of basidiomycetes using a combination of several bioinformatic approaches. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Phylogenetic analysis of β-xylanase SRXL1 of Sporisorium reilianum and its relationship with families (GH10 and GH11) of Ascomycetes and Basidiomycetes

    OpenAIRE

    Jorge Álvarez-Cervantes; Gerardo Díaz-Godínez; Yuridia Mercado-Flores; Vijai Kumar Gupta; Miguel Angel Anducho-Reyes

    2016-01-01

    In this paper, the amino acid sequence of the β-xylanase SRXL1 of Sporisorium reilianum, which is a pathogenic fungus of maize was used as a model protein to find its phylogenetic relationship with other xylanases of Ascomycetes and Basidiomycetes and the information obtained allowed to establish a hypothesis of monophyly and of biological role. 84 amino acid sequences of β-xylanase obtained from the GenBank database was used. Groupings analysis of higher-level in the Pfam database allowed to...

  20. The basidiomycete Ustilago maydis has two plasma membrane H⁺-ATPases related to fungi and plants.

    Science.gov (United States)

    Robles-Martínez, Leobarda; Pardo, Juan Pablo; Miranda, Manuel; Mendez, Tavis L; Matus-Ortega, Macario Genaro; Mendoza-Hernández, Guillermo; Guerra-Sánchez, Guadalupe

    2013-10-01

    The fungal and plant plasma membrane H⁺-ATPases play critical roles in the physiology of yeast, plant and protozoa cells. We identified two genes encoding two plasma membrane H⁺-ATPases in the basidiomycete Ustilago maydis, one protein with higher identity to fungal (um02581) and the other to plant (um01205) H⁺-ATPases. Proton pumping activity was 5-fold higher when cells were grown in minimal medium with ethanol compared to cells cultured in rich YPD medium, but total vanadate-sensitive ATPase activity was the same in both conditions. In contrast, the activity in cells cultured in minimal medium with glucose was 2-fold higher than in YPD or ethanol, implicating mechanisms for the regulation of the plasma membrane ATPase activity in U. maydis. Analysis of gene expression of the H⁺-ATPases from cells grown under different conditions, showed that the transcript expression of um01205 (plant-type) was higher than that of um02581 (fungal-type). The translation of the two proteins was confirmed by mass spectrometry analysis. Unlike baker's yeast and plant H⁺-ATPases, where the activity is increased by a short incubation with glucose or sucrose, respectively, U. maydis H⁺-ATPase activity did not change in response to these sugars. Sequence analysis of the two U. maydis H⁺-ATPases revealed the lack of canonical threonine and serine residues which are targets of protein kinases in Saccharomyces cerevisiae and Arabidopsis thaliana plasma membrane H⁺-ATPases, suggesting that phosphorylation of the U. maydis enzymes occurs at different amino acid residues.

  1. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  2. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  3. Biogeography, host specificity, and molecular phylogeny of the basidiomycetous yeast Phaffia rhodozyma and its sexual form, Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-02-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework.

  4. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic characteristics.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    The macro- and micro-morphological features, mycelial extension rate, enzymatic activities and possible genetic changes were studied in 30 selected strains of basidiomycetes after 10-year cryopreservation on perlite in liquid nitrogen (LN). Comparisons with the same strains preserved by serial transfers on nutrient media at 4°C were also conducted. Production of ligninolytic enzymes and hydrogen peroxide was studied by quantitative spectrophotometric methods, whereas semiquantitative API ZYM testing was used to compare the levels of a wide range of hydrolytic enzymes. Our results show that cryopreservation in LN did not cause morphological changes in any isolate. The vitality of all fungi was successfully preserved and none of the physiological features were lost, even though the extension rate and enzyme activity were slightly affected. Moreover, sequence analysis of eight strains did not detect any changes in their genetic features after cryopreservation. These findings suggest that the perlite-based freezing protocol is suitable for long-term preservation of large numbers of basidiomycetes.

  5. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from Ra-226 from <0.3 to 1.0 ± 0.5 Bq kg(-1) F.W., and K-40 from 56.4 ± 3.0 to 759.0 ± 28.3 Bq kg(-1) F.W. The analysis of the results supported that the bioaccumulation of the studied natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied.

  6. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  7. Trichosporon wieringae sp.nov., an anamorphic basidiomycetous yeast from soil, and assimilation of some phenolic compounds, polysaccharides and other non-conventional carbon sources by saprophytic Trichosporon species

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    A morphological and physiological description of an anamorphic basidiomycetous yeast species isolated from soil, named Trichosporon wieringae, is presented. The phylogenetic position within the genus, based on nuclear base sequencing of the D1/D2 region of the large subunit of rDNA and of the ITS re

  8. [Effects of veratryl alcohol and tween 80 on ligninase production and its roles in decolorization of azo dyes by white-rot basidiomycete PM2].

    Science.gov (United States)

    Jia, Rong; Tang, Bi-Kui; Zhang, Xiao-Bin; He, Yue-Mei

    2004-03-01

    Basidiomycete PM2, a lignin-degrading white rot fungus, produces lgnin peroxidase (Lip) and manganese peroxidase (Mnp) in nutrient nitrogen limited liquid cultures. This fungus was selected for its ability to decolorize azo group of dyes. In order to improve production of the peroxidases and rapid dye decolorizing activity by basidiomycete PM2, the addition of veratryl alcohol or Tween 80 to nutrient nitrogen limited liquid cultures were tested. It was found to have a large stimulatory effect on Mnp activities and decolorization rate of azo dyes. A maximum Mnp activities of 254.2 u/L with veratryl alcohol and 192.2 u/L with Tween 80 were achieved respectively. These values were about 3.4-fold and 2.5-fold higher than that obtained in the control cultures (without alcohol or Tween 80), whereas the levels of Lip activity detected were very low (about 12 u/L)in all the cultures. In further experiments using three kinds of azo dyes of congo red, orange G and orange IV, enzyme activities and dye decolorization were investigated in the above-mentioned cultures. The results showed that Mnp activities and decolorization were notably higher than those obtained in the control cultures in the presence of azo dyes. Cultures supplemented with Tween 80 were more adequate for dye decolorization. The rates of the decolorization with Tween 80 of congo red (95.4%), orange G (98.5%) and orange IV (54.4%) after 24 hours of dye incubation were higher than that supplemented with veratryl alcohol. According to the results, Mnp activities secreted by basidiomycete PM2 play an essential role in the process of dye decolorization. Tween 80 was the main factor affecting the decolorization. The analysis of structure of the three kinds of azo dyes indicats that the extent of decolorization is affected by the dye molecular structure. The types and quantity of the substituted groups on the aromatic ring of azo dyes have effect on the percentage of biological decolorization.

  9. Phylogenetic analysis of β-xylanase SRXL1 of Sporisorium reilianum and its relationship with families (GH10 and GH11) of Ascomycetes and Basidiomycetes.

    Science.gov (United States)

    Álvarez-Cervantes, Jorge; Díaz-Godínez, Gerardo; Mercado-Flores, Yuridia; Gupta, Vijai Kumar; Anducho-Reyes, Miguel Angel

    2016-04-04

    In this paper, the amino acid sequence of the β-xylanase SRXL1 of Sporisorium reilianum, which is a pathogenic fungus of maize was used as a model protein to find its phylogenetic relationship with other xylanases of Ascomycetes and Basidiomycetes and the information obtained allowed to establish a hypothesis of monophyly and of biological role. 84 amino acid sequences of β-xylanase obtained from the GenBank database was used. Groupings analysis of higher-level in the Pfam database allowed to determine that the proteins under study were classified into the GH10 and GH11 families, based on the regions of highly conserved amino acids, 233-318 and 180-193 respectively, where glutamate residues are responsible for the catalysis.

  10. Decolorization of mixtures of different reactive textile dyes by the white-rot basidiomycete Phanerochaete sordida and inhibitory effect of polyvinyl alcohol.

    Science.gov (United States)

    Harazono, Koichi; Nakamura, Kazunori

    2005-03-01

    We tried to decolorize mixtures of four reactive textile dyes, including azo and anthraquinone dyes, by a white-rot basidiomycete Phanerochaete sordida. P. sordida decolorized dye mixtures (200 mg l-1 each) by 90% within 48 h in nitrogen-limited glucose-ammonium media. Decolorization of dye mixtures needed Mn2+ and Tween 80 in the media. Manganese peroxidase (MnP) played a major role in dye decolorization by P. sordida. Decolorization of dye mixtures by P. sordida was partially inhibited by polyvinyl alcohol (PVA) that wastewaters from textile industries often contain. This was caused by an inhibitory effect of PVA on the decolorization of Reactive Red 120 (RR120) with MnP reaction system. Second addition of Tween 80 to the reaction mixtures in the presence of PVA improved the decolorization of RR120. These results suggest that PVA could interfere with lipid peroxidation or subsequent attack to the dye.

  11. Fungicides affect the production of extracellular mucilaginous material (ECMM) and the peripheral growth unit (PGU) in two wood-rotting basidiomycetes.

    Science.gov (United States)

    Vesentini, Damiano; Dickinson, David J; Murphy, Richard J

    2006-10-01

    This study shows the effect of two fungicides on the production of extracellular mucilaginous material (ECMM) in two wood-rotting basidiomycetes and identifies a mechanism that might be responsible for the variation observed. Increasing concentrations of the fungicides copper sulphate (CuSO4) and cyproconazole in the growth medium increased the proportion of ECMM in the biomass of Trametes versicolor and Gloeophyllum trabeum. These fungicides also caused a reduction in the length of the peripheral growth unit (PGU) of the mycelia leading to a more highly branched morphology and a larger number of hyphal tips, the sites for active secretion of ECMM, per unit length of mycelium. It is postulated that both in T. versicolor and G. trabeum this change in growth leads to the increases observed in the proportion of ECMM in the total biomass. The implications of these results are discussed with a view to a potential protective role of ECMM against stress and toxic environments.

  12. [Total Peroxidase and Catalase Activity of Luminous Basidiomycetes Armillaria borealis and Neonothopanus nambi in Comparison with the Level of Light Emission].

    Science.gov (United States)

    Mogil'naya, O A; Ronzhin, N O; Medvedeva, S E; Bondar, V S

    2015-01-01

    The peroxidase and catalase activities in the mycelium of luminous basidiomycetes Armillaria borealis and Neonothopanus nambi in normal conditions and under stress were compared. An increase in the luminescence level was observed under stress, as well as an increase in peroxidase and catalase activities. Moreover, the peroxidase activity in extracts of A. borealis mycelium was found to be almost one and a half orders of magnitude higher, and the catalase activity more than two orders of magnitude higher in comparison with the N. nambi mycelium. It can be suggested that the difference between the brightly luminescent and dimly luminescent mycelium of N. nambi is due to the content of H2O2 or other peroxide compounds.

  13. Reduction of organic and inorganic selenium compounds by the edible medicinal basidiomycete Lentinula edodes and the accumulation of elemental selenium nanoparticles in its mycelium.

    Science.gov (United States)

    Vetchinkina, Elena; Loshchinina, Ekaterina; Kursky, Viktor; Nikitina, Valentina

    2013-12-01

    We report for the first time that the medicinal basidiomycete Lentinula edodes can reduce selenium from inorganic sodium selenite (Se(IV)) and the organoselenium compound 1,5-diphenyl-3-selenopentanedione-1,5 (DAPS-25) to the elemental state, forming spherical nanoparticles. Submerged cultivation of the fungus with sodium selenite or with DAPS-25 produced an intense red coloration of L. edodes mycelial hyphae, indicating accumulation of elemental selenium (Se(0)) in a red modification. Several methods, including transmission electron microscopy (TEM), electron energy loss spectroscopy (EELS), and X-ray fluorescence, were used to show that red Se(0) accumulated intracellularly in the fungal hyphae as electron-dense nanoparticles with a diameter of 180.51±16.82 nm. Under designated cultivation conditions, shiitake did not reduce selenium from sodium selenate (Se(VI)).

  14. Characterization of a gene coding for a putative adenosine deaminase-related growth factor by RNA interference in the basidiomycete Flammulina velutipes.

    Science.gov (United States)

    Sekiya, Shuichi; Yamada, Masato; Shibata, Kou; Okuhara, Toru; Yoshida, Masumi; Inatomi, Satoshi; Taguchi, Goro; Shimosaka, Makoto

    2013-04-01

    A full-length cDNA coding for a putative adenosine deaminase (Fv-ada) was isolated from the basidiomycete Flammulina velutipes. Fv-ada encodes a polypeptide consisting of 537 amino acid residues, which has a consensus sequence conserved among adenosine deaminase-related growth factors (ADGF) found in several metazoa, including chordates and insects. Fv-ada transcript was detected at all stages of growth in dikaryotic F. velutipes cells, with a peak at the primordial stage. Heterologous expression of Fv-ada in the yeast Pichia pastoris produced recombinant Fv-ADA that catalyzed the conversion of adenosine to inosine. Dikaryotic mycelia from F. velutipes were transformed with the binary plasmid pFungiway-Fv-ada, which was designed to suppress the expression of Fv-ada through RNA interference. The growth rates of the resulting transformants were retarded in response to the degree of suppression, indicating that Fv-ada plays an important role in the mycelial growth of F. velutipes. These results suggested that ADGF could function as growth factors in fungi, as is seen in other eukaryotes.

  15. Effect of growth substrate, method of fermentation, and nitrogen source on lignocellulose-degrading enzymes production by white-rot basidiomycetes.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Penninckx, Michel

    2008-11-01

    The exploration of seven physiologically different white rot fungi potential to produce cellulase, xylanase, laccase, and manganese peroxidase (MnP) showed that the enzyme yield and their ratio in enzyme preparations significantly depends on the fungus species, lignocellulosic growth substrate, and cultivation method. The fruit residues were appropriate growth substrates for the production of hydrolytic enzymes and laccase. The highest endoglucanase (111 U ml(-1)) and xylanase (135 U ml(-1)) activities were revealed in submerged fermentation (SF) of banana peels by Pycnoporus coccineus. In the same cultivation conditions Cerrena maxima accumulated the highest level of laccase activity (7,620 U l(-1)). The lignified materials (wheat straw and tree leaves) appeared to be appropriate for the MnP secretion by majority basidiomycetes. With few exceptions, SF favored to hydrolases and laccase production by fungi tested whereas SSF was appropriate for the MnP accumulation. Thus, the Coriolopsis polyzona hydrolases activity increased more than threefold, while laccase yield increased 15-fold when tree leaves were undergone to SF instead SSF. The supplementation of nitrogen to the control medium seemed to have a negative effect on all enzyme production in SSF of wheat straw and tree leaves by Pleurotus ostreatus. In SF peptone and ammonium containing salts significantly increased C. polyzona and Trametes versicolor hydrolases and laccase yields. However, in most cases the supplementation of media with additional nitrogen lowered the fungi specific enzyme activities. Especially strong repression of T. versicolor MnP production was revealed.

  16. The alpha-tubulin gene AmTuba1: a marker for rapid mycelial growth in the ectomycorrhizal basidiomycete Amanita muscaria.

    Science.gov (United States)

    Tarkka, Mika T; Schrey, Silvia; Nehls, Uwe

    2006-05-01

    The apical extension of hyphae is of central importance for extensive spread of fungal mycelium in forest soils and for effective ectomycorrhiza development. Since the tubulin cytoskeleton is known to be important for fungal tip growth, we have investigated the expression of an alpha-tubulin gene from the ectomycorrhizal basidiomycete Amanita muscaria (AmTuba1). The phylogenetic analysis of protein sequences revealed the existence of two subgroups of alpha-tubulins in homobasidiomycetes, clearly distinguishable by defined amino acids. AmTuba1 belongs to subgroup1. The AmTuba1 transcript level is related to mycelial growth rate. Growth induction of carbohydrate starved (non-growing) hyphae resulted in an enhanced AmTuba1 expression as soon as hyphal growth started, reaching a maximum at highest mycelial growth rate. Bacterium-induced hyphal elongation also leads to increased AmTuba1 transcript levels. In mature A. muscaria/P. abies ectomycorrhizas, where fungal hyphae are highly branched, and slowly growing, AmTuba1 expression were even lower than in carbohydrate-starved mycelium, indicating a further down-regulation of gene expression in symbiosis. In conclusion, our analyses show that the AmTuba1 gene can be used as a marker for active apical extension in fly agaric, and that alpha-tubulin proteins are promising tools for the classification of fungi.

  17. Effects of Ganoderma lucidum (Higher Basidiomycetes) Extracts on the miRNA Profile and Telomerase Activity of the MCF-7 Breast Cancer Cell Line.

    Science.gov (United States)

    Gonul, Oyku; Aydin, Hikmet Hakan; Kalmis, Erbil; Kayalar, Husniye; Ozkaya, Ali Burak; Atay, Sevcan; Ak, Handan

    2015-01-01

    Ganoderma lucidum is a medicinal higher Basidiomycetes mushroom that exerts anticancer effects through several different mechanisms. This study investigated the effects of G. lucidum on the telomerase activity and microRNA (miRNA) profiles of MCF-7 cells. According to the cytotoxicity results, the G. lucidum ether extract exhibits the highest cytotoxic potency; therefore it was chosen for the subsequent telomerase activity assay and miRNA profiling. The telomerase activity observed in the cells treated with a half-maximal inhibitory concentration of G. lucidum ether extract (100 µg/mL in dimethyl sulfoxide) was 32.2% lower than that of the control cells treated with 1% dimethyl sulfoxide. Among 1066 miRNAs, the most downregulated miRNA was hsa-miR-27a* (4.469-fold), and the most upregulated miRNA was hsa-miR-1285 (10.462-fold). A database search revealed the predicted miRNAs that target the catalytic subunit of the telomerase enzyme telomerase reverse transcriptase, and only miR-3687 (upregulated 2.153-fold) and miR-1207-5p (upregulated 2.895-fold) were changed by at least 2-fold. The miRNA profile changes demonstrated in this study provide a data set regarding their effects on the pathways that regulate telomerase activity in MCF-7 breast cancer cells treated with G. lucidum. These data should aid the development of novel cancer treatment strategies.

  18. Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune.

    Science.gov (United States)

    Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir

    2017-10-01

    Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. My reflections on the Blackwell-Tapia Prize.

    Science.gov (United States)

    Tapia, Richard

    2013-01-01

    The first two sections of this paper entitled The Conference and The History are taken directly from the webpage of the NSF sponsored Mathematical Sciences Institutes [1]. In the third section I share personal views.

  20. The Handbook of Second Language Acquisition. Blackwell Handbooks in Linguistics.

    Science.gov (United States)

    Doughty, Catherine J., Ed.; Long, Michael H., Ed.

    This handbook provides an integrated discussion of key issues in second language acquisition (SLA). The 24 chapters include the following: (1) "The Scope of Inquiry and the Goals of SLA" (Catherine J. Doughty and Michael H. Long); (2) "On the Nature of Interlanguage Representation: Universal Grammar in the Second Language"…

  1. University of Florida potato variety trials spotlight: 'Harley Blackwell'

    Science.gov (United States)

    ‘Harley Blackwell’ is a potato variety that is commonly grown for the potato chip market. It was selected from the progeny of a cross between B0155-24 and B9935-8, and tested under the pedigree B0564-8. It was released and named jointly by the Agricultural Research Service, United States Department ...

  2. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    OpenAIRE

    García Torres Angélica María; Torres Sáe Rodrigo Gonzalo

    2003-01-01

    La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de ést...

  3. A novel colorimetric assay of β-D-glucans in basidiomycete strains by alcian blue dye in a 96-well microtiter plate.

    Science.gov (United States)

    C Semedo, Magda; Karmali, Amin; Fonseca, Luís

    2015-01-01

    Basidiomycete strains synthesize several types of β-d-glucans, which play a major role in the medicinal properties of mushrooms. Therefore, the specific quantification of these β-d-glucans in mushroom strains is of great biochemical importance. Because published assay methods for these β-d-glucans present some disadvantages, a novel colorimetric assay method for β-d-glucan with alcian blue dye was developed. The complex formation was detected by following the decrease in absorbance in the range of 620 nm and by hypsochromic shift from 620 to 606 nm (∼14 nm) in UV-Vis spectrophotometer. Analysis of variance was used for optimization of the slope of the calibration curve by using the assay mixture containing 0.017% (w/v) alcian blue in 2% (v/v) acetic acid at pH 3.0. The high-throughput colorimetric assay method on microtiter plates was used for quantification of β-d-glucans in the range of 0-0.8 μg, with a slope of 44.15 × 10(-2) and a limit of detection of 0.017 μg/well. Recovery experiments were carried out by using a sample of Hericium erinaceus, which exhibited a recovery of 95.8% for β-1,3-d-glucan. The present assay method exhibited a 10-fold higher sensitivity and a 59-fold lower limit of detection compared with the published method with congo red. β-d-glucans of several mushrooms strains were isolated from fruiting bodies and mycelia, and they were quantified by this assay method. This assay method is fast, specific, simple, and it can be used to quantify β-d-glucans from other biological sources. © 2015 American Institute of Chemical Engineers.

  4. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants.

  5. Chemical composition and nutritional and medicinal value of fruit bodies and submerged cultured mycelia of culinary-medicinal higher Basidiomycetes mushrooms.

    Science.gov (United States)

    Cohen, Nachshol; Cohen, Jacob; Asatiani, Mikheil D; Varshney, Vinay K; Yu, Hui-Tzu; Yang, Yi-Chi; Li, Yu-Hsuan; Mau, Jeng-Leun; Wasser, Solomon P

    2014-01-01

    This research gives the results of a proximate analysis (moisture, ash, crude protein, fat, total carbohydrates, and total energy); a bioactive compounds analysis (γ-aminobutyric acid [GABA], ergothioneine, lovastatin, and cordycepin); fatty acid and amino acid analysis; and an analysis of macro- and microelement content of fruit bodies and mycelia of 15 higher Basidiomycetes medicinal mushroom strains belonging to 12 species. The results obtained demonstrate that almost all investigated mushrooms were found to be good sources of proteins and carbohydrates, with content varying in the ranges of 8.6-42.5% and 42.9-83.6%, respectively. Different species exhibited distinct free amino acid profiles. The total amino acid content was highest in Ophiocordyceps sinensis (MB) (23.84 mg/g) and Cordyceps militaris (FB) (23.69 mg/g). The quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, stearic acid, and linoleic acid were the major fatty acids. The micro- and macroelement compositions were studied, and the highest results were (as milligrams per kilogram) 224-7307 for calcium, 1668-38564 for potassium, 1091-11676 for phosphorus, and 5-97 for zinc. Bioactive components were lovastatin, GABA, and ergothioneine, which are commonly found in most mushrooms. C. militaris (FB), Pleurotus ostreatus (FB), and Coprinus comatus (FB) were most abundant and contained a high amount of GABA (756.30 μg/g, 1304.99 μg/g, 1092.45 μg/g, respectively) and ergothioneine (409.88 μg/g, 2443.53 μg/g, 764.35 μg/g, respectively). The highest lovastatin content was observed in Hericium erinaceus (FB) (14.38 μg/g) and Ganoderma lucidum (FB) (11.54 μg/g). In contrast to C. militaris (FB), cordycepin was not detected in O. sinensis (MB). The fruit body biomass of C. militaris cordycepin content reached 1.743 mg/g dry weight. The nutritional values of the mushroom species studied here could potentially be used in well-balanced diets and as sources

  6. Biodegradation of reactive textile dyes by basidiomycetous fungi from brazilian ecosystems Biodegradação de corantes têxteis reativos fungos basidiomicetos do ecossistema brasileiro

    Directory of Open Access Journals (Sweden)

    Kátia M.G. Machado

    2006-12-01

    Full Text Available The potential of Trametes villosa and Pycnoporus sanguineus to decolorize reactive textile dyes used for cotton manufacturing in the State of Minas Gerais, Brazil, was evaluated. Growth and decolorization halos were determined on malt extract agar containing 0.002g L-1 of the dye. T. villosa decolorized all 28 of the tested dyes while P. sanguineus decolorized only 9. The effect of culture conditions (shaking and dye and nitrogen concentration on the degradation of Drimaren Brilliant Blue dye was evaluated during growth of the fungi in liquid synthetic medium. Shaking favored degradation and decolorization was not repressed by nitrogen. In pure culture, T. villosa and P. sanguineus decolorized synthetic effluent consisting of a mixture of 10 dyes. Higher decolorization of the synthetic effluent was observed when a mixed culture of the two fungi was used. This study demonstrated differences between tropical basidiomycete species in terms of their ability to degrade reactive dyes, and reinforces the potential of this group of fungi for the decolorization of textile effluents.O potencial de Trametes villosa e Pycnoporus sanguineus de descolorir corantes têxteis reativos utilizados na manufatura de algodão no estado de Minas Gerais foi avaliado. Halos de crescimento e descoloração foram determinados em agar extrato malte (MEA com 0,002g L-1 do corante. T. villosa descoloriu os 28 corantes testados e P. sanguineus apenas 9. A influência de condições de cultivo (agitação, concentração de corante e concentração de nitrogênio na degradação do corante azul brilhante Drimaren foi avaliada durante crescimento dos fungos em meio líquido sintético. Agitação favoreceu a degradação e não foi observada repressão da descoloração pelo nitrogênio. Em cultura pura, T. villosa e P. sanguineus descoloriram efluente sintético constituído por uma mistura de dez corantes. Maior descoloração do efluente sintético foi observada no cultivo

  7. Cryptococcus ibericus sp. nov., Cryptococcus aciditolerans sp. nov. and Cryptococcus metallitolerans sp. nov., a new ecoclade of anamorphic basidiomycetous yeast species from an extreme environment associated with acid rock drainage in São Domingos pyrite mine, Portugal.

    Science.gov (United States)

    Gadanho, Mário; Sampaio, José Paulo

    2009-09-01

    In this report, we describe three novel asexual basidiomycetous yeast species, Cryptococcus aciditolerans sp. nov. (type strain CBS 10872T=SDY 081T), Cryptococcus ibericus sp. nov. (type strain CBS 10871T=SDY 022T) and Cryptococcus metallitolerans sp. nov. (type strain CBS 10873T=SDY 190T), which were isolated from acid rock drainage collected at the São Domingos mine in southern Portugal. Phylogenetic analysis of molecular sequence data indicated that the novel species belong to the order Filobasidiales of the class Tremellomycetes and form a well-separated clade, next to Cryptococcus gastricus and Cryptococcus gilvescens. Since the novel species also share a peculiar ecology, being able to thrive under extreme environmental conditions characterized by very low pH and high concentrations of heavy metals, we designate this combination of phylogenetic and ecological characteristics as an ecoclade.

  8. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    OpenAIRE

    Machado,Kátia M.G.; Dácio R. Matheus; Bononi,Vera L. R.

    2005-01-01

    Remazol Brilliant Blue R (RBBR) dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%); 96 fungi showed a mycelia growth and decolorization activity stronger than the P. c...

  9. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    Directory of Open Access Journals (Sweden)

    García Torres Angélica María

    2003-06-01

    Full Text Available La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de éstas es de gran importancia para la degradación de diversas sus­tancias recalcitrantes que muestran similitudes estructurales con la lignina como son los PAH's, PCB's, DDT, colo­rantes azoicos, etc. El trabajo de investigación se realizó utilizando reactores a nivel de matraces y teniendo como sustrato siete diferentes desechos agroindustriales de la región de Santander ( de los cuales se desconoce su pro­ducción de enzimas lignolíticas: tuza de mazorca, bagazo de caña, hoja de pina, cacota de cacao, cereza de café, tamo de arroz, salvado de trigo y paja de trigo. El objetivo general fue evaluar la capacidad de los Basidiomycetes: Trametes versicolor, Pleurotus floridae y Phanerochaete chrysosporium de crecer sobre los desechos agroindustriales y producir las enzimas lignolíticas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; mediante la técnica de fermentación sólida. Se encontró que la producción de enzimas lignolíticas en los sustratos mencionados fue sensible a la concentración de azúcares reductores, condiciones de pH, contenidos de humedad y, dependiente del tipo de inductor presente en el medio de cultivo. El sustrato que presentó una mejor producción de Lacasa y Manganeso-peroxidasa fue la paja de trigo. Se observó la producción de Lignina-peroxidasa en cultivos de tuza de mazorca y salvado de trigo. Palabras clave: enzimas inducibles; Lacasa; Mn-peroxidasa; Li-peroxidasa; desechos agroindustriales; represi

  10. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

    Science.gov (United States)

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

    2012-01-01

    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  11. Could basidiomycetes fungi be an alternative for the treatment of fibrous feedstuffs? application of enzymatic complexes and future prospects Fungos basidiomicetos podem ser uma alternativa para o tratamento de alimentos fibrosos? aplicação de complexos enzimáticos e perspectivas futuras

    OpenAIRE

    Miguel António Machado Rodrigues; Rui Manuel Furtado Bezerra; José Albino Gomes Alves Dias; Cristina Vitória de Miranda Guedes; Luis Miguel Mendes Ferreira; Fernando Nunes

    2010-01-01

    This presentation intends to make a brief description of the studies being investigated by our research group in the area valorization of fibrous feed utilizing the white-rot fungi (basidiomycetes fungi) enzyme complexes.Esta apresentação pretende fazer uma breve descrição dos estudos que têm sido investigados pelo nosso grupo de pesquisa na área de valorização de alimentos fibrosos, utilizando o fungo de podridão branca (fungos basidiomicetos) complexos enzimáticos.

  12. Could basidiomycetes fungi be an alternative for the treatment of fibrous feedstuffs? application of enzymatic complexes and future prospects Fungos basidiomicetos podem ser uma alternativa para o tratamento de alimentos fibrosos? aplicação de complexos enzimáticos e perspectivas futuras

    Directory of Open Access Journals (Sweden)

    Miguel António Machado Rodrigues

    2010-07-01

    Full Text Available This presentation intends to make a brief description of the studies being investigated by our research group in the area valorization of fibrous feed utilizing the white-rot fungi (basidiomycetes fungi enzyme complexes.Esta apresentação pretende fazer uma breve descrição dos estudos que têm sido investigados pelo nosso grupo de pesquisa na área de valorização de alimentos fibrosos, utilizando o fungo de podridão branca (fungos basidiomicetos complexos enzimáticos.

  13. Heterologous expression of fungal cytochromes P450 (CYP5136A1 and CYP5136A3) from the white-rot basidiomycete Phanerochaete chrysosporium: Functionalization with cytochrome b5 in Escherichia coli.

    Science.gov (United States)

    Hatakeyama, Mayumi; Kitaoka, Takuya; Ichinose, Hirofumi

    2016-07-01

    Cytochromes P450 from the white-rot basidiomycete Phanerochaete chrysosporium, CYP5136A1 and CYP5136A3, are capable of catalyzing oxygenation reactions of a wide variety of exogenous compounds, implying their significant roles in the metabolism of xenobiotics by the fungus. It is therefore interesting to explore their biochemistry to better understand fungal biology and to enable the use of fungal enzymes in the biotechnology sector. In the present study, we developed heterologous expression systems for CYP5136A1 and CYP5136A3 using the T7 RNA polymerase/promoter system in Escherichia coli. Expression levels of recombinant P450s were dramatically improved by modifications and optimization of their N-terminal amino acid sequences. A CYP5136A1 reaction system was reconstructed in E. coli whole cells by coexpression of CYP5136A1 and a redox partner, NADPH-dependent P450 reductase (CPR). The catalytic activity of CYP5136A1 was significantly increased when cytochrome b5 (Cyt-b5) was further coexpressed with CPR, indicating that Cyt-b5 supports electron transfer reactions from NAD(P)H to CYP5136A1. Notably, P450 reaction occurred in E. coli cells that harbored CYP5136A1 and Cyt-b5 but not CPR, implying that the reducing equivalents required for the P450 catalytic cycle were transferred via a CPR-independent pathway. Such an "alternative" electron transfer system in CYP5136A1 reaction was also demonstrated using purified enzymes in vitro. The fungal P450 reaction system may be associated with sophisticated electron transfer pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  15. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  16. Screening of basidiomycetes for the production of exopolysaccharide and biomass in submerged culture Triagem de basidiomicetos para a produção de exopolissacarídeos e biomassa em cultura líquida

    Directory of Open Access Journals (Sweden)

    Rosana Maziero

    1999-01-01

    Full Text Available Fifty-six strains of Basidiomycetes, including native Brazilian fungi isolated from different ecosystems and edible mushrooms, were screened for production of exopolysaccharides and biomass in submerged culture. Agaricus sp. (CCB 280 and Oudemansiella canarii (Jungh. Hohn (CCB 179 were the highest exopolysaccharide producers (6.01 and 3.54 g dry w./l respectively after 7 days of incubation. The best producer of biomass was Schizophyllum commune Fr.:Fr. (CCB 473 with 16.68 g dry w./l in 14 days of incubation. When the culture filtrate was submitted to freezing prior to polysaccharide precipitation, a gelatinous fraction was formed.Este trabalho diz respeito à produção de exopolissacarídeos e biomassa por basidiomicetos em cultura líquida. O "screening" foi realizado com 56 linhagens incluindo fungos nativos de diferentes ecossistemas do Brasil e de fungos comestíveis. Agaricus sp. (CCB 280 e Oudemansiella canarii (Jungh. Hohn (CCB 179 foram os melhores produtores de exopolissacarídeo (6,01 e 3,54 g peso seco/l respectivamente, em 7 dias de incubação. O melhor produtor de biomassa foi Schizophyllum commune Fr.:Fr. (CCB 473 com 16,68 g peso seco/l em 14 dias de incubação. Quando o filtrado cultural foi submetido à congelamento antes da precipitação do polissacarídeo, formou-se uma fração gelatinosa.

  17. The importance of basidiomycetous fungi cultured from the sputum of chronic idiopathic cough: a study to determine the existence of recognizable clinical patterns to distinguish CIC from non-CIC.

    Science.gov (United States)

    Ogawa, Haruhiko; Fujimura, Masaki; Takeuchi, Yasuo; Makimura, Koichi

    2009-10-01

    Recently we have reported 5 cases of allergic fungal cough (AFC), which is intractable and is characterized by sensitization to one of basidiomycetous fungus. Because AFC shows good clinical response to antifungal drugs, diagnosing AFC in patients with CIC may lead to the consequent management of CIC. Therefore, we determined the incidence of CIC among our hospital patients, and the frequency of BM fungi in sputum samples collected from patients with CIC. Furthermore we evaluated whether or not a recognizable clinical pattern that distinguishes CIC from non-CIC exists. The medical records of 70 patients complaining of chronic cough who were referred to our hospital for diagnosis and treatment were analyzed retrospectively. The primary diagnoses were CIC (27.0%), cough-variant asthma (30.0%), atopic cough (24.3%), sinobronchial syndrome (8.6%), cough-predominant asthma (7.1%), gastro-esophageal reflux (1.4%), and others (1.4%). In CIC patients, the median age, proportion of females, and frequency of acute upper respiratory tract infection did not differ significantly from those in non-CIC patients. CIC patients had a longer median duration of cough (11.0 months vs. 3.5 months). The positive ratio of BM cultured from the sputa of CIC patients (62.5%) was significantly (p=0.0061) higher than that of non-CIC patients (16.7%). The existence of BM fungi in induced sputum may be an important factor for distinguishing the clinical manifestation of CIC from that of non-CIC. The clinical approach from the aspect of fungal allergy may serve as a clue that may aid in the successful management of CIC.

  18. WARDHAUGH, Ronald. 1986. An introduction to sociolinguistics. New York: Basil Blackwell, 388pp. WARDHAUGH, Ronald. 1986. An introduction to sociolinguistics. New York: Basil Blackwell, 388pp.

    Directory of Open Access Journals (Sweden)

    José Luiz Meurer

    2008-04-01

    Full Text Available An introduction to sociolinguistics -- Una introduce° a sociolinguistica -- de Ronald Wardhaugh (RW tem por objetivo oferecer um embasamento geral a alunos em cursos de sociolinguistica ou sociologia da linguagem. Conforme observe o autor, o livro pode ser usado com alunos que estejam estudando sociolinguistica de maneira panorâmica pola primeira vez ou com alunos em cursos sobre tópicos especificos a níveis mais elevados cujos professores queiram que os mesmos se familiarizem com outros tópicos da sociolinguistica não abordados nos cursos. Além disso, essa introdução pode ser usada como um organizador de assuntos diversos que se relacionam dentro de um conjunto significativo de tópicos importantes da sociolinguistica (ver abaixo. Assim, este livro de RW sera útil tanto para principiantes como para interessados que ja tenham acumulado conhecimentos mais ou menos avançados da área.

  19. Análisis de las reacciones de hipersensibilidad tipo I a los basidiomicetes en una población alérgica costarricense, durante 2009 Analysis of the reactions of type I hypersensitivity to the Basidiomycetes in a Costa Rican allergic population during 2009

    Directory of Open Access Journals (Sweden)

    Daniela Jaikel-Víquez

    2012-12-01

    Full Text Available Justificación y objetivos: Costa Rica es un país tropical en donde se ha encontrado una alta concentración de basidiosporas aéreas, las cuales miden alrededor de 4-13µm de diámetro, y son por definición aerobiológicas, capaces de penetrar a tracto respiratorio inferior, irrespetando la barrera nasal. El presente estudio tiene como objetivos encontrar posibles fuentes de contaminación ambiental por basidiomicetes y determinar si en Costa Rica sería necesario analizar, de forma rutinaria, la reactividad por alergenos a basidiomicetes en la población portadora de enfermedad rinobronquial alérgica. Métodos: se determinó el porcentaje de pacientes alérgicos a los extractos de basidiomicetes, tipo carbón Sporisorium cruentum y Ustilago cynodontis y tipo roya Puccinia graminis subsp. graminis. A la vez, se recolectaron panículas de Panicum maximum para evaluar su contaminación por basidiomicetes. Resultados: se encontró que el 59,23% de los pacientes eran alérgicos a hongos y que el tipo de hongo al que más pacientes presentaron alergia fueron los basidiomicetes. El 100% de las panículas recolectadas estaban contaminadas con un hongo del género Ustilago. Conclusión: se recomienda el testeo continuo por basidiomicetes, ya que estos son los hongos a los que la mayoría de los pacientes estudiados presentó alergia.Background and aim: Costa Rica is a tropical country in which a high concentration of aerial basidiospores has been found, which measure between 4-13 µm and are capable of arriving to the lower respiratory system, surpassing the nasal barrier. This study aims to find possible sources of environmental contamination by basidiomycetes and to determine if it is necessary to routinely analyze this allergen in the Costa Rican population that suffer from rhino bronchial allergy. Methods: The percentage of patients allergic to the extracts of basidiomycetes, specifically smuts like Sporisorium cruentum and Ustilago cynodontis

  20. Recovering Sample Diversity in Rao-Blackwellized Particle Filters for Simultaneous Localization and Mapping

    Science.gov (United States)

    2006-06-01

    111 thuat tvypify eac’h alpproa~c are tile extend~ed Kalman ~ filter (EKE) and tile parti(’le filter. 1.4 EKF SLAM Tile Xailinan filter is at) olptinlal...dliversity, or unique filtr samples after resa in pling. noist he miaiiitained. If not. tc lIeMile is proiie to the mnany side effecs of saniple...situations [39]. 2.1.1 Extended Kalman Filter SLAM The EKF rel)rese’nts thie SLAM posterior distribution as a. hig]-dimensiolal lulti- variate Gaussian

  1. Average, sensitive and Blackwell-optimal policies in denumerable Markov decision chains with unbounded rewards

    NARCIS (Netherlands)

    R. Dekker (Rommert); A. Hordijk (Arie)

    1988-01-01

    textabstractIn this paper we consider a (discrete-time) Markov decision chain with a denumerabloe state space and compact action sets and we assume that for all states the rewards and transition probabilities depend continuously on the actions. The first objective of this paper is to develop an anal

  2. Primordium formation in Hydropus subalpinus (Tricholomatales, Basidiomycetes)

    NARCIS (Netherlands)

    Clémençon, H.

    2004-01-01

    Hydropus subalpinus is exocarpic amphiblemate. The pubescence of the stipe is a cauloblema that sometimes forms a spurious partial veil in young primordia. The pileoblema becomes a gelatinised pileipellis with a few more or less erect cells on the pileus and a few layers of periclinal physalohyphae

  3. MILROY, Lesley. Observing and Analysing Natural Language: A Critical Account of Sociolinguistic Method. Oxford: Basil Blackwell, 1987. 230pp. MILROY, Lesley. Observing and Analysing Natural Language: A Critical Account of Sociolinguistic Method. Oxford: Basil Blackwell, 1987. 230pp.

    Directory of Open Access Journals (Sweden)

    Iria Werlang Garcia

    2008-04-01

    Full Text Available Lesley Milroy's Observing and Analysing Natural Language is a recent addition to an ever growing number of publications in the field of Sociolinguistics. It carries the weight of one of the experienced authors in the current days in the specified field and should offer basic information to both newcomers and established investigators in natural language. Lesley Milroy's Observing and Analysing Natural Language is a recent addition to an ever growing number of publications in the field of Sociolinguistics. It carries the weight of one of the experienced authors in the current days in the specified field and should offer basic information to both newcomers and established investigators in natural language.

  4. The Rao-Blackwellized marginal M-SMC filter for Bayesian multi-target tracking and labelling

    NARCIS (Netherlands)

    Aoki, E.H.; Boers, Y.; Svensson, L.; Mandal, Pranab K.; Bagchi, Arunabha

    2012-01-01

    In multi-target tracking (MTT), we are often interested not only in finding the position of the objects, but also allowing individual objects to be uniquely identified with the passage of time, by placing a label on each track. In some situations, however, observability conditions do not allow us to

  5. 77 FR 14010 - Rocky Ridge Wind Project, LLC, Blackwell Wind, LLC, CPV Cimarron Renewable Energy Company, LLC...

    Science.gov (United States)

    2012-03-08

    ... Cimarron Renewable Energy Company, LLC, Minco Wind Interconnection Services, LLC, Shiloh III Lessee, LLC, California Ridge Wind Energy LLC, Perrin Ranch Wind, LLC, Erie Wind, LLC: Notice of Effectiveness of Exempt... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY...

  6. The Rao-Blackwellized marginal M-SMC filter for Bayesian multi-target tracking and labelling

    NARCIS (Netherlands)

    Aoki, E.H.; Boers, Y.; Svensson, L.; Mandal, P.K.; Bagchi, A.

    2012-01-01

    In multi-target tracking (MTT), we are often interested not only in finding the position of the objects, but also allowing individual objects to be uniquely identified with the passage of time, by placing a label on each track. In some situations, however, observability conditions do not allow us to

  7. A Rao-Blackwellized particle filter for joint parameter estimation and biomass tracking in a stochastic predator-prey system.

    Science.gov (United States)

    Martín-Fernández, Laura; Gilioli, Gianni; Lanzarone, Ettore; Miguez, Joaquin; Pasquali, Sara; Ruggeri, Fabrizio; Ruiz, Diego P

    2014-06-01

    Functional response estimation and population tracking in predator-prey systems are critical problems in ecology. In this paper we consider a stochastic predator-prey system with a Lotka-Volterra functional response and propose a particle filtering method for: (a) estimating the behavioral parameter representing the rate of effective search per predator in the functional response and (b) forecasting the population biomass using field data. In particular, the proposed technique combines a sequential Monte Carlo sampling scheme for tracking the time-varying biomass with the analytical integration of the unknown behavioral parameter. In order to assess the performance of the method, we show results for both synthetic and observed data collected in an acarine predator-prey system, namely the pest mite Tetranychus urticae and the predatory mite Phytoseiulus persimilis.

  8. 75 FR 41276 - US Rail Partners, Ltd. and Blackwell Northern Gateway Railroad Company-Continuance in Control...

    Science.gov (United States)

    2010-07-15

    ... modified certificate of public convenience and necessity in STB Finance Docket No. 35383, Eastern Berks Gateway Railroad Company-- ] Modified Rail Certificate, wherein EBGR seeks to lease and operate... Railroad Company (EWGR). BNGR operates approximately 35 miles of rail line between Wellington, Kan.,...

  9. The Rao-Blackwellized marginal M-SMC filter for Bayesian multi-target tracking and labelling

    NARCIS (Netherlands)

    Aoki, E.H.; Boers, Y.; Svensson, L.; Mandal, Pranab K.; Bagchi, Arunabha

    In multi-target tracking (MTT), we are often interested not only in finding the position of the objects, but also allowing individual objects to be uniquely identified with the passage of time, by placing a label on each track. In some situations, however, observability conditions do not allow us to

  10. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  11. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  12. Low carbon/nitrogen ratio increases laccase production from basidiomycetes in solid substrate cultivation Reduzida relação carbono/nitrogênio aumenta a produção de lacase por basidiomicetos em cultivo de semissólido

    Directory of Open Access Journals (Sweden)

    Érica Clarissa D'Agostini

    2011-06-01

    Full Text Available Basidiomycetes are laccase producers used for hydrolysis of lignocellulosic byproducts in fermentative processes and could be used on biofuel production or ruminant feeding. The objective of this study was to evaluate the effect of concentrations of non-protein nitrogen sources on laccase production and mycelial growth of Pleurotus ostreatus, Lentinula edodes and Agaricus blazei. The fungi were grown on soybean hulls to which urea (U, ammonium sulfate (AS or mixture of AS:U (1:1 were added to achieve carbon/nitrogen (C/N ratios of 5, 15, 20 or 30. The average longitudinal mycelial growth was measured and laccase activity was determined by the oxidation of 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid. Higher C/N ratios increased mycelial growth and decreased laccase production. The highest activities were obtained with a C/N ratio of 5. P. ostreatus, L. edodes and A. blazei produced more laccase when AS, AS:U and U, respectively, were added. In addition, C/N ratios lower than 30 induced laccase syntheses, inhibited mycelial growth and were a better condition for pre-hydrolysis of plant residues.Basidiomicetos são produtores de lacases utilizadas na hidrólise de subprodutos lignocelulósicos em processos fermentativos e pode ser utilizado na produção de biocombustíveis ou na alimentação de ruminantes. Avaliou-se o efeito da adição de fontes e concentrações de nitrogênio não-protéico na produção de lacase e no crescimento micelial de Pleurotus ostreatus, Lentinula edodes e Agaricus blazei. Os fungos foram cultivados em cascas de soja com adição de uréia (U, sulfato de amônio (AS ou AS:U (1:1 de forma a manter a relação carbono/ nitrogênio (C/N de 5, 15, 20 ou 30. O crescimento micelial longitudinal médio foi medido, e a atividade da lacase foi determinada pela oxidação do ácido 2,2'-azino-bis-3-etilbenzotiazolina-6-sulfônico. O crescimento micelial foi diretamente proporcional à relação C/N, enquanto a

  13. Preliminary studies of fungi in the Biebrza National Park. Part IV. Macromycetes – new data and the synthesis

    Directory of Open Access Journals (Sweden)

    Anna Kujawa

    2016-01-01

    Full Text Available The paper presents the last part of the results of the short-term inventory of fungi species in the Biebrza National Park and synthesises all the data gathered during two surveys, including the information published by other authors. The main body of research is focused on a survey of macrofungi identified with morphology-based methods. In case of some specimens molecular technics have been applied. In total 346 macrofungal taxa (21 belonging to ascomycetes and 325 to basidiomycetes were found during the survey, including 186 species unobserved during the previous inventory in 2012. As a result of previous and ongoing studies, the current number of macrofungi recorded from the Biebrza National Park reached 508 species. Among them eight taxa are newly reported for Poland (Conocybe velutipes var. nitrophila, Entoloma caeruleum, E. plebejoides, Inocybe rennyi, I. vulpinella, Pholiota pityrodes, Pholiotina utricystidiata, and Tomentella pilosa. The next seven species (Bovista paludosa, Fistulina hepatica, Ganoderma lucidum, Geastrum schmidelii, Inonotus obliquus, Tulostoma kotlabae, and Xerocomus parasiticus are protected by law and 95 species belong to red-listed species. The results of two intensive, but relatively short-term survey clearly indicate the Biebrza National Park as a hot spot of macrofungi and suggest the need to undertake extended and regular inventories also in other Polish national parks.

  14. The genus Lentinus (Basidiomycetes from India - an annotated checklist

    Directory of Open Access Journals (Sweden)

    Sapan Kumar Sharma

    2015-09-01

    Full Text Available An annotated checklist of species of genus Lentinus has been presented in this paper. On scrutiny of the latest authentic literature and mycobank record, out of a total of 41 documented species from India, 20 were found to be valid species while 21 were invalid species which were found to be synonyms. 

  15. Sorption of heavy metals by four basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dey, S. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Rao, P.R.N. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India); Bhattacharyya, B.C. [Biotechnology Programme, Dept. of Chemical Engineering, Indian Inst. of Tech., Kharagpur (India); Bandyopadhyay, M. [Environmental Engineering Lab., Dept. of Civil Engineering, Indian Inst. of Tech., Kharagpur (India)

    1995-04-01

    Biosorptions of Pb{sup 2+}, Cr{sup 6+}, Cd{sup 2+} and Ni{sup 2+} were investigated, with special emphasis on the first one, using live and dead fungal mycelia. Of the four fungi, namely Polyporus ostreiformis, Volvariella volvacea, Pleurotus sajor-caju and Phanerochaete chrysosporium, the last one was found to be most effective in Pb{sup 2+} removal. Total biosorption was effected in 6 days up to the Pb{sup 2+} concentration of 6 mg/l, with a specific uptake of 1.33 mg Pb{sup 2+}/g dry cell mass. The removal of other three metals varied between 28.8-73.3% from a medium containing 4 mg/l of each of the metals. (orig.)

  16. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van

    2007-01-01

    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous (coenocyt

  17. New records of truffle fungi (Basidiomycetes) from Turkey

    Science.gov (United States)

    Aziz Turkoglu; Michael Angelo. Castellano

    2013-01-01

    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  18. Gravitropism of basidiomycetous fungi — On Earth and in microgravity

    Science.gov (United States)

    Kern, V. D.

    1999-01-01

    In order to achieve perfect positioning of their lamellae for spore dispersal, fruiting bodies of higher fungi rely on the omnipresent force gravity. Only accurate negatively gravitropic orientation of the fruiting body cap will guarantee successful reproduction. A spaceflight experiment during the STS-55 Spacelab mission in 1993 confirmed that the factor gravity is employed for spatial orientation. Most likely every hypha in the transition zone between the stipe and the cap region is capable of sensing gravity. Sensing presumably involves slight sedimentation of nuclei which subsequently causes deformation of the net-like arrangement of F-actin filament strands. Hyphal elongation is probably driven by hormone-controlled activation and redistribution of vesicle traffic and vesicle incorporation into the vacuoles and cell walls to subsequently cause increased water uptake and turgor pressure. Stipe bending is achieved by way of differential growth of the flanks of the upper-most stipe region. After reorientation to a horizontal position, elongation of the upper flank hyphae decreases 40% while elongation of the lower flank slightly increases. On the cellular level gravity-stimulated vesicle accumulation was observed in hyphae of the lower flank.

  19. Transgene expression in the basidiomycete root pathogen Armillaria mellea.

    Science.gov (United States)

    Toward development of a genetic transformation system for Armillaria mellea, we used particle bombardment to identify promoters for driving transgene expression. The plasmid tested was pYES-hph-004iGFP, on which the green fluorescence protein gene, gfp, is linked to the Agaricus bisporus gpdII promo...

  20. New taxa of Entoloma (Basidiomycetes, Agaricales) from Estonia and Karelia

    NARCIS (Netherlands)

    Noordeloos, Machiel E.; Liiv, Vello

    1992-01-01

    Nine new species of Entoloma are described from the Islands of Saaremaa and Vormsi, Estonia, viz. E. conocybecystis, E. leochromus, E. mutabilipes, E. ochromicaceum, E. politoflavipes, E. rhynchocystidiatum, E. roseotinctum, E. viiduense, and E. violaceozonatum. Entoloma lactarioides is described as

  1. Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, L.

    1996-05-01

    Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab

  2. Cadinane sesquiterpenoids from the basidiomycete Stereum cf. sanguinolentum BCC 22926.

    Science.gov (United States)

    Bunyapaiboonsri, Taridaporn; Yoiprommarat, Seangaroon; Nopgason, Rujirek; Komwijit, Somjit; Veeranondha, Sukitaya; Puyngain, Pucharapa; Boonpratuang, Thitiya

    2014-09-01

    Stereumins Q-U, together with known stereumins A, B, K, L, and N, as well as ent-strobilols E and G were isolated from the culture of Stereum cf. sanguinolentum BCC 22926. Their structures were elucidated by extensive spectroscopic analyses. The absolute configurations of stereumins A and Q, as well as ent-strobilol E were established by application of the modified Mosher's method. Stereumin T displayed antibacterial activity against Bacilluscereus with a MIC value of 3.97μM.

  3. Studies on the genus Entoloma (Basidiomycetes, Agaricales) in Kerala State, India (Basidiomycetes, Agaricales) in Kerala State, India

    NARCIS (Netherlands)

    Manimohan, P.; Noordeloos, M.E.; Dhanya, A.M.

    2006-01-01

    Fifteen new taxa are described from Kerala State, India, based on collections made by the first author. Three taxa fit subgenus Pouzarella (E. testaceostrigosum, E. violaceovillosum, and E. dysthales var. keralense). Four species are described as having cuboid spores (E. albidoquadratum, E.

  4. Wiley-Blackwell出版的中国期刊统计分析%Statistical Analysis of China's Journals Published by Wiley Blackwell

    Institute of Scientific and Technical Information of China (English)

    何建新

    2011-01-01

    对美国Wiley-Blackwell出版公司近年来在线出版中国学术期刊的情况进行了简要介绍,时目前Wiley-Blackwell在线的10种中国期刊及其6000多篇文献的学科分布、文献年度分布及合作出版机构等方面进行了统计分析.结果表明,Wiley-Blackwell在线出版的中国期刊以生命科学类最多,出版的文献在2009年涨幅较大.

  5. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis.

    Science.gov (United States)

    Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun

    2016-02-06

    The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50-60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0-8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat) were determined by using a 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  6. Effects of Selenium Presence in Mycelia of Ganoderma species (Higher Basidiomycetes) on Their Medicinal Properties.

    Science.gov (United States)

    Milovanović, Ivan; Stajić, Mirjana; Stanojković, Tatjana; Knežević, Aleksandar; Vukojević, Jelena

    2015-01-01

    This study aimed to research the antifungal, antioxidant, and cytotoxic potential of Ganoderma applanatum and Ganoderma lucidum mycelial extracts as well as the possible effect of Se enrichment on these activities. Both Se-enriched and nonenriched extracts of G. applanatum and G. lucidum showed fungi static activity, while a fungicidal effect was not noted. The extracts exhibited significant 1,1-diphenyl-2-picryl-hydrazil radical scavenging capacity, while the effect of Se on this potential was stimulatory in G. applanatum (1.3%-33.9% without Se and 3.1%-67.1% in Se enrichment) and inhibitory in G. lucidum (1.4%-71.6% and 1.3%-48.6% without and with Se, respectively). Only phenols in G. applanatum and phenols and flavonoids in G. lucidum were holders of antioxidant activity. Cytotoxic activity against both HeLa and LS174 cell lines was very low in comparison with cis-diamminedichloroplatinum.

  7. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2,6-dichloroindophenol. While L. shimeji P2Ox is the least thermostable of these three enzymes (melting temperature Tm of 54.9°C; half-life time of activity τ1/2 of 0.12 at 50°C and pH 6.5, P. chrysosporium P2Ox showed remarkable thermostability with Tm of 75.4°C and τ1/2 of 96 h under identical conditions.

  8. Three novel degraded steroids from cultures of the Basidiomycete Antrodiella albocinnamomea.

    Science.gov (United States)

    Chen, Zi-Ming; Yang, Xiao-Yan; Fan, Qiong-Ying; Li, Zheng-Hui; Wei, Kun; Chen, He-Ping; Feng, Tao; Liu, Ji-Kai

    2014-09-01

    Three novel degraded steroids, named albocisterols A-C (1-3), have been isolated from cultures of Antrodiella albocinnamomea. Their structures were defined by comprehensive spectroscopic analysis and single crystal X-ray crystallography. The mixture of compounds 2 and 3 exhibited significant inhibitory activities against protein tyrosine phosphatase 1B (PTP1B).

  9. Isolation of a natural solopathogenic strain of Sporisorium reilianum f.sp. zeae (Ustilaginaceae, Basidiomycetes).

    Science.gov (United States)

    Sabbagh, S K; Naudan, M; Roux, C

    2008-01-01

    Sporisorium reilianum f.sp. zeae (Kühn) Langdon and Fullerton (Basidiomycota, Ustilaginaceae) is the causal agent of head smut of maize and sorghum. The parasitism is initiated by the fusion of two compatible sporidia which give rise to the formation of dikaryotic pathogen hyphae. However, in Ustilaginaceae, some fuzzy diploid strains could also be formed. These strains are solopathogen as they can infect a host in absence of crossing with a compatible haploid sporidia. A solopathogenic strain of S. refilianum was obtained using an original protocol. Sporidia were isolated from germinated teliospores and spread on solid medium to identify stable fuzzy solopathogenic strain. Confocal observations of the solopathogenic strain (SRZS1) after nucleus staining with propidium iodide indicates that they are formed by rounded shape cells which are monokaryotic. A CAPS approach was used to analysis the matb gene of S. reilianum. The presence of two matb loci in SRZS1 showed that this monocaryotic strain is diploid. The pathogenicity of SRZS1 was investigated by maize infection. Our results confirmed that SRZS1 is infectious, induces some typical symptoms in maize but could not sporulate and form sori.

  10. Antibiotics from basidiomycetes. 26. Phlebiakauranol aldehyde an antifungal and cytotoxic metabolite from Punctularia atropurpurascens.

    Science.gov (United States)

    Anke, H; Casser, I; Steglich, W; Pommer, E H

    1987-04-01

    Phlebiakauranol aldehyde and the corresponding alcohol were isolated from cultures of Punctularia atropurpurascens. The aldehyde but not the alcohol exhibited strong antifungal activity against several phytopathogens as well as antibacterial and cytotoxic activities. Two acetylated derivatives prepared from the aldehyde showed only very weak antifungal and antibacterial and moderate cytotoxic activities. We therefore assume, that the aldehyde group together with the high number of hydroxyl groups are responsible for the biological activity of the compound.

  11. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    (Novex, San Diego, Calif.), and pI markers (range, 3.0 to 7.0) provided by the manufacturer were used as standards. A constant voltage of 100 V was applied to the gels for the first hour, 200 V was used for another hour, and 500 V was used for the last 30... the manufacturer’s instructions). Pooled FPLC peak fractions showing MNP, LIP, and laccase activities were subjected to IEF fractionation as described above, and the results obtained were compared to those obtained with the concentrated extracellular fluid. SDS...

  12. Anticonvulsant and neuroprotective effects of oligosaccharides from Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (Higher Basidiomycetes).

    Science.gov (United States)

    Tello, Isaac; Campos-Pena, Victoria; Montiel, Elizur; Rodriguez, Veronica; Aguirre-Moreno, Alma; Leon-Rivera, Ismael; Del Rio-Portilla, Federico; Herrera-Ruiz, Maribel; Villeda-Hernandez, Juana

    2013-01-01

    An oligosaccharide fraction isolated from the mycelium of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (GLOS) was separated by size-exclusion chromatography. The chemical structure of GLOS consists of a disaccharide repeating unit [-4-β-1-Galf(1-6)-O-(β-Glcp)-1-]n (n=3,4). In addition, this study was undertaken to determine the possible anticonvulsant and neuroprotective effects of GLOS (10-80 mg/kg) on kainic acid (KA)-induced seizures. The behavioral alterations and histopathology of hippocampal neurons were studied. Our results show that GLOS inhibited convulsions in rats from KA-induced seizures, reduced the degeneration pattern in the CA3 region of rats, decreased astrocytic reactivity, and reduced the expression of IL-1β and TNF-α induced by KA. These results indicate a potential anticonvulsant and neuroprotective effects of GLOS.

  13. Influence of Mushroom-Basidiomycetes Ganoderma Lucidum on the Cognitive Function of Man

    Directory of Open Access Journals (Sweden)

    Unzira Kapysheva

    2016-12-01

    Full Text Available The use of the fungus G. Lucidum, thanks to the presence in its composition of a large group of polysaccharides that provide energy and strengthens the immune system, terpenes, and amino acids that affect the operation of almost all human body systems, including the brain blood circulation, it has had a positive effect on the cognitive function of the respondents – it improves memory for numbers on the images, heightened attention and response to an external signal, increased mobility and balance the basic nervous processes in the cerebral cortex.

  14. Effect of mushroom-basidiomycetes Ganoderma lucidum on the cognitive function of the brain experimental animals

    Directory of Open Access Journals (Sweden)

    Unzira N. Kapysheva

    2016-08-01

    Full Text Available Long-term use of the fungus Ganoderma lucidum -bazidiomitseta restores and preserves the balance of the nervous processes, reduces anxiety, improves spatial orientation and accelerates the process of securing long-shaped memory in experimental animals. Also receiving Ganoderma improves the general condition of the body, activates the metabolism, but the trend is the manifestation of age-related changes in cognitive functions of the brain persists, although to a lesser degree.

  15. Development of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (Higher Basidiomycetes) polysaccharides injection formulation.

    Science.gov (United States)

    Jiang, Yuji; He, Anle; Liu, Yanhong; Xie, Baogui; Li, Ye; Deng, Youjin; Liu, Xinrui; Liu, Qichao

    2014-01-01

    Biochemical and pharmacological research has demonstrated that Lingzhi or Reishi medicinal mushroom Ganoderma lucidum polysaccharides (GLPS) have significant anticancer, antitumor, and antioxidant activities. To investigate the effect of injecting GLPS into hosts for clinical studies, aqueous polysaccharide extracts from G. lucidum fruit bodies were purified by deproteinization using the Sevage method, anion-exchange chromatography elution (cellulose DEAE-52 chromatography), dialysis, ethanol precipitation, and active carbon and millipore membrane filtration techniques. The purified GLPS were used for injection in mice. Polysaccharide indexes, protein, tannin, heavy metal, arsenic salt, oxalate, potassium ion, resin, pH, ignition residue measurements, evaluation criterion for allergic reactions, and total solids content of the GLPS injection were all performed using the reference methods in the Chinese Pharmacopoeia. Our results showed that polysaccharide was the key component of injection mixtures. The ignition residue and total solids content in the injection mixture were 1.4% and 2.4%, respectively. The other indices were all within the expected safety ranges. Furthermore, studies from mice functional assays showed that the injection mixture improved the antifatigue capacity of mice without any effect on weight loss/gain. In addition, the injection mixture was safe, which was confirmed by allergy testing in guinea pigs. The development of a GLPS injection offers a novel approach for future medicinal mushroom utilization and holds great commercial promise.

  16. Genomic and Biochemical Analysis of N Glycosylation in the Mushroom-Forming Basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Berends, E.; Ohm, R.A.; Jong, de J.F.; Rouwendal, G.J.A.; Wosten, H.A.B.; Lugones, L.G.; Bosch, van den G.B.M.

    2009-01-01

    N-linked glycans of Schizophyllum commune consist of Man(5-9)GlcNAc(2) structures. Lack of further glycan maturation is explained by the absence of genes encoding such functions in this and other homobasidiomycetes. N-linked glycans in vegetative mycelium and fruiting bodies of S. commune are mainly

  17. Wood decay by Chlorociboria aeruginascens (Nyl.) Kanouse (Helotiales, Leotiaceae) and associated basidiomycete fungi

    Science.gov (United States)

    Dana L. Richter; Jessie A. Glaeser

    2015-01-01

    Two isolates of Chlorociboria aeruginascens (Nyl.) Kanouse incubated axenically on aspen wood blocks resulted in 18% and 32% mass loss after 134 wks (2 yrs 8 mo). Aspen wood decayed by C. aeruginascens contained cavities in the S2 layer of the secondary cell wall, similar to Type I soft rot attack, as well as erosion troughs and...

  18. Biotransformation of tryptophan by liquid medium culture of Psilocybe coprophila (Basidiomycetes).

    Science.gov (United States)

    Alarcón, Julio; Foncea, Leyla; Aguila, Sergio; Alderete, Joel B

    2006-01-01

    Chemical reactions performed by fungi have been used as a modern tool in chemistry. In this work, we show the tryptophan biotransformation with Psilocybe coprophila on liquid culture medium. The results prove once more the versatility of fungi in performing a wide range of industrially attractive chemical reactions.

  19. Differential regulation of genes encoding manganese peroxidase (MnP) in the basidiomycete Ceriporiopsis subvermispora.

    Science.gov (United States)

    Manubens, Augusto; Avila, Marcela; Canessa, Paulo; Vicuña, Rafael

    2003-09-01

    We previously identified and characterized three mnp genes coding for manganese peroxidase (MnP) in the white rot fungus Ceriporiopsis subvermispora. In this work, we assessed transcript levels of mnp genes in liquid cultures of this fungus grown under various conditions. In the absence of Mn(2+), mnp1 and mnp2 mRNA were detected by Northern hybridization, irrespective of the lack of extracellular MnP activity. Addition of Mn(2+) to the cultures led to a marked increase in both transcripts, the highest titers being observed at 10 micro M Mn(2+). mnp1 mRNA was not detected at Mn(2+ )concentrations above 80 micro M, whereas mnp2 mRNA was still observed at 320 micro M Mn(2+). Differential regulation of these genes was confirmed by the addition of Cu(2+), Zn(2+), Ag(+) and Cd(2+). These metal ions dramatically elevated both transcripts and also allowed the detection of the mnp3 transcript. In most cases, the increase in mRNA levels was partially abolished by the simultaneous presence of Mn(2+), although the latter was strictly required to detect extracellular MnP activity. However, the lignin-related compound syringic acid specifically increased the mnp1 transcript, although only in the absence of Mn(2+). These results indicate that there is no clear correlation between mnp mRNA levels and MnP activity. In addition, they strongly suggest that Mn(2+) plays a post-transcriptional role which is essential for the presence of active MnP in the extracellular fluid.

  20. Effect of manganese on the secretion of manganese-peroxidase by the basidiomycete Ceriporiopsis subvermispora.

    Science.gov (United States)

    Mancilla, Rodrigo A; Canessa, Paulo; Manubens, Augusto; Vicuña, Rafael

    2010-07-01

    The ligninolytic machinery of the widely used model fungus Ceriporiopsis subvermispora includes the enzymes manganese-peroxidase (MnP) and laccase (Lcs). In this work the effect of Mn(II) on the secretion of MnP was studied. Cultures grown in the absence of Mn(II) showed high levels of mnp transcripts. However, almost no MnP enzyme was detected in the extracellular medium, either by enzymatic activity assays or Western blot hybridizations. In the corresponding mycelia, immuno-electron microscopy experiments showed high levels of MnP enzyme within intracellular compartments. These results suggest that in addition to its well-known effect on transcription regulation of mnp genes, manganese influences secretion of MnP to the extracellular medium. Experiments carried out in the presence of cycloheximide confirmed that the metal is required to secrete MnP already synthesized and retained within the cell.

  1. [Polymorphism of endocellular isoenzymes Schizophyllum commune Fr. (Basidiomycetes) in territory of Donetsk area].

    Science.gov (United States)

    Boĭko, S M

    2011-01-01

    Results of research of endocellular isoenzyme polymorphism of Schizophyllum commune Fr. cultures growing on the territory of Donetsk region are presented. Description of AMY, ADH, GPDH, GDH, SDH, EST electrophoretic spectrum has been carried out. The enzyme systems ADH, GPDH and GDH were monomorphic. The greatest variety of endocellular isoforms was shown for EST. Well defined six zones were detected and for three of them the polymorphism was peculiar.

  2. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium.

    OpenAIRE

    Boominathan, K; Dass, S B; Randall, T A; Kelley, R.L.; Reddy, C A

    1990-01-01

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study we isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity (14C-labeled synthetic lignin----14CO2) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical...

  3. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes.

    Science.gov (United States)

    Tomsovský, M; Popelárová, P; Baldrian, P

    2009-01-01

    The wood-decomposing fungal species Antrodia macra, A. pulvinascens, Ceriporiopsis aneirina, C. resinascens and Dichomitus albidofuscus were determined for production of laccase (LAC), Mn peroxidase (MnP), lignin peroxidase (LiP), endo-l,4-P-beta-glucanase, endo-l,4-beta-xylanase, cellobiohydrolase, 1,4-beta-glucosidase and 1,4-beta-xylosidase. The results confirmed the brown-rot mode of Antrodia spp. which did not produce the activity of LAC and MnP. The remaining species performed detectable activity of both enzymes while no strain produced LiP. Significant inhibition of LAC production by high nitrogen was found in all white-rot species while only MnP of D. albidofuscus was regulated in the same way. The endoglucanase and endoxylanase activities of white-rotting species were inhibited by glucose in the medium while those of Antrodia spp. were not influenced by glucose concentration. The regulation of enzyme activity and bio-mass production can vary even within a single fungal genus.

  4. Royal sun medicinal mushroom, Agaricus brasiliensis Ka21 (higher Basidiomycetes), as a functional food in humans.

    Science.gov (United States)

    Yamanaka, Daisuke; Liu, Ying; Motoi, Masuro; Ohno, Naohito

    2013-01-01

    The Royal Sun medicinal mushroom, Agaricus brasiliensis, is used as a natural health product. In Japan, however, the quality control of some of these mushroom products has been viewed as a safety problem. Focusing on the quality control of A. brasiliensis KA21, we have performed several safety studies. To date, we have established evidence that this mushroom can be used safely as an immunostimulant and to mediate biochemical parameters associated with obesity or diabetes. Furthermore, to improve the manufacturing process of this mushroom, we have studied the relationship between its pharmaceutical actions and the conditions of its cultivation and thermal management. The purpose of this review is to report the findings of basic and clinical studies of the fruit body of A. brasiliensis KA21.

  5. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  6. The community structure of macroscopic basidiomycetes (Fungi) in Brazilian mangroves influenced by temporal and spatial variations.

    Science.gov (United States)

    Nogueira-Melo, Georgea Santos; Santos, Paulo Jorge Parreira; Gibertoni, Tatiana Baptista

    2014-12-01

    Mangroves are transitional ecosystems between terrestrial and marine environments, and are dis- tinguished by a high abundance of animals, plants, and fungi. Although macrofungi occur in different types of habitat, including mangroves, little is known about their community structure and dynamic. Therefore the aim of this study was to analyze the diversity of macrofungi in a number of Brazilian mangroves, and the relation- ship between such diversity, precipitation and area of collection. A total of 32 field trips were undertaken from 2009 to 2010, and macrofungi were studied in four 250 x 40 m transects: Timbó and Santa Cruz Channel on the Northern coast, and Maracaipe and Ariquindá on the Southern coast. All basidiomata found along the transects were placed in paper bags, air-dried and identified using existing literature. It was found that Northern areas predominantly featured Avicennia schaueriana mangroves, while Rhizophora mangle dominated in Southern transects. A total of 275 specimens were collected, and 33 species, 28 genera, 14 families and six orders were represented. Overall abundance and species richness did not vary significantly among areas, but varied according to time, being higher during the rainy season. Subtle differences in composition were observed over time and between areas, probably due to variations in plant species occurrence. Further studies with collections during months of greater precipitation in transects dominated by different mangrove species of the same ecosystem are suggested to assess the overall diversity of mycobiota in these ecosystems.

  7. Chloride channel-dependent copper acquisition of laccase in the basidiomycetous fungus Cryptococcus neoformans

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH.This study reports that copper homeostasis was impaired in the clc-a mutant.This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry.CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C.neoformans.

  8. Differentially regulated, vegetative-mycelium-specific hydrophobins of the edible basidiomycete Pleurotus ostreatus.

    Science.gov (United States)

    Peñas, María M; Rust, Brian; Larraya, Luis M; Ramírez, Lucía; Pisabarro, Antonio G

    2002-08-01

    Three different hydrophobins (Vmh1, Vmh2, and Vmh3) were isolated from monokaryotic and dikaryotic vegetative cultures of the edible fungus Pleurotus ostreatus. Their corresponding genes have a number of introns different from those of other P. ostreatus hydrophobins previously described. Two genes (vmh1 and vmh2) were expressed only at the vegetative stage, whereas vmh3 expression was also found in the fruit bodies. Furthermore, the expression of the three hydrophobins varied significantly with culture time and nutritional conditions. The three genes were mapped in the genomic linkage map of P. ostreatus, and evidence is presented for the allelic nature of vmh2 and POH3 and for the different locations of the genes coding for the glycosylated hydrophobins Vmh3 and POH2. The glycosylated nature of Vmh3 and its expression during vegetative growth and in fruit bodies suggest that it should play a role in development similar to that proposed for SC3 in Schizophyllum commune.

  9. Relationship between Monokaryotic Growth Rate and Mating Type in the Edible Basidiomycete Pleurotus ostreatus

    Science.gov (United States)

    Larraya, Luis M.; Pérez, Gúmer; Iribarren, Iñaki; Blanco, Juan A.; Alfonso, Mikel; Pisabarro, Antonio G.; Ramírez, Lucía

    2001-01-01

    The edible fungus Pleurotus ostreatus (oyster mushroom) is an industrially produced heterothallic homobasidiomycete whose mating is controlled by a bifactorial tetrapolar genetic system. Two mating loci (matA and matB) control different steps of hyphal fusion, nuclear migration, and nuclear sorting during the onset and progress of the dikaryotic growth. Previous studies have shown that the segregation of the alleles present at the matB locus differs from that expected for a single locus because (i) new nonparental B alleles appeared in the progeny and (ii) there was a distortion in the segregation of the genomic regions close to this mating locus. In this study, we pursued these observations by using a genetic approach based on the identification of molecular markers linked to the matB locus that allowed us to dissect it into two genetically linked subunits (matBα and matBβ) and to correlate the presence of specific matBα and matA alleles with differences in monokaryotic growth rate. The availability of these molecular markers and the mating type dependence of growth rate in monokaryons can be helpful for marker-assisted selection of fast-growing monokaryons to be used in the construction of dikaryons able to colonize the substrate faster than the competitors responsible for reductions in the industrial yield of this fungus. PMID:11472908

  10. Genome-wide gene expression patterns in dikaryon of the basidiomycete fungus Pleurotus ostreatus.

    Science.gov (United States)

    Liu, Tianxiang; Li, Huiru; Ding, Yatong; Qi, Yuancheng; Gao, Yuqian; Song, Andong; Shen, Jinwen; Qiu, Liyou

    Dikarya is a subkingdom of fungi that includes Ascomycota and Basidiomycota. The gene expression patterns of dikaryon are poorly understood. In this study, we bred a dikaryon DK13×3 by mating monokaryons MK13 and MK3, which were from the basidiospores of Pleurotus ostreatus TD300. Using RNA-Seq, we obtained the transcriptomes of the three strains. We found that the total transcript numbers in the transcriptomes of the three strains were all more than ten thousand, and the expression profile in DK13×3 was more similar to MK13 than MK3. However, the genes involved in macromolecule utilization, cellular material synthesis, stress-resistance and signal transduction were much more up-regulated in the dikaryon than its constituent monokaryons. All possible modes of differential gene expression, when compared to constituent monokaryons, including the presence/absence variation, and additivity/nonadditivity gene expression in the dikaryon may contribute to heterosis. By sequencing the urease gene poure sequences and mRNA sequences, we identified the monoallelic expression of the poure gene in the dikaryon, and its transcript was from the parental monokaryon MK13. Furthermore, we discovered RNA editing in the poure gene mRNA of the three strains. These results suggest that the gene expression patterns in dikaryons should be similar to that of diploids during vegetative growth. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  11. Antioxidant Properties of the Edible Basidiomycete Armillaria mellea in Submerged Cultures

    Directory of Open Access Journals (Sweden)

    Ming-Yeou Lung

    2011-09-01

    Full Text Available Antioxidant components, ascorbic acid, total flavonoids and total phenols are produced effectively by Armillaria mellea submerged cultures. Dried mycelia and mycelia-free broths obtained by A. mellea submerged cultures are extracted with methanol and hot water and investigated for antioxidant properties. Methanolic extracts from dried mycelia (MEM and mycelia-free broth (MEB and hot water extracts from dried mycelia (HWEM by A. mellea submerged cultures show good antioxidant properties as evidenced by low EC50 values (< 10 mg/mL. Total flavonoid is mainly found in hot water extracts; however, total phenol is rich in methanol and hot water extracts from mycelia. Ascorbic acid and total phenol contents are well correlated with the reducing power and the scavenging effect on superoxide anions. Total flavonoid content is dependent on the antioxidant activity and the chelating effect on ferrous ions. Total antioxidant component contents are closely related to the antioxidant activity and the scavenging superoxide anion ability. Results confirm that extracts with good antioxidant properties from fermenting products by A. mellea are potential good substitutes for synthetic antioxidants and can be applied to antioxidant-related functional food and pharmaceutical industries.

  12. Transcriptome and Functional Analysis of Mating in the Basidiomycete Schizophyllum commune

    Science.gov (United States)

    Erdmann, Susann; Freihorst, Daniela; Raudaskoski, Marjatta; Schmidt-Heck, Wolfgang; Jung, Elke-Martina; Senftleben, Dominik

    2012-01-01

    In this study, we undertook a functional characterization and transcriptome analysis that enabled a comprehensive study of the mating type loci of the mushroom Schizophyllum commune. Induced expression of both the bar2 receptor and the bap2(2) pheromone gene within 6 to 12 h after mates' contact was demonstrated by quantitative real-time PCR. Similar temporal expression patterns were confirmed for the allelic bbr1 receptor and bbp1 pheromone-encoding genes by Northern hybridization. Interestingly, the fusion of clamp connections to the subterminal cell was delayed in mating interactions in which one of the compatible partners expressed the bar2 receptor with a truncated C terminus. This developmental delay allowed the visualization of a green fluorescent protein (Gfp)-labeled truncated receptor at the cell periphery, consistent with a localization in the plasma membrane of unfused pseudoclamps. This finding does not support hypotheses envisioning a receptor localization to the nuclear membrane facilitating recognition between the two different nuclei present in each dikaryotic cell. Rather, Gfp fluorescence observed in such pseudoclamps indicated a role of receptor-pheromone interaction in clamp fusion. Transcriptome changes associated with mating interactions were analyzed in order to identify a role for pheromone-receptor interactions. We detected a total of 89 genes that were transcriptionally regulated in a mating type locus A-dependent manner, employing a cutoff of 5-fold changes in transcript abundance. Upregulation in cell cycle-related genes and downregulation of genes involved in metabolism were seen with this set of experiments. In contrast, mating type locus B-dependent transcriptome changes were observed in 208 genes, with a specific impact on genes related to cell wall and membrane metabolism, stress response, and the redox status of the cell. PMID:22210832

  13. Basidiomycetes capability to degrade endosulfan and chlorpyrifos in a complex matrix

    OpenAIRE

    Niell, Silvina; Heinzen, Horacio; Cesio, Verónica; Rivero, Anisleidy; Pareja, Lucía; Cerdeiras, M. Pía

    2012-01-01

    Los hongos de la podredumbre blanca y marrón de la madera han demostrado presentar una alta capacidad para degradar compuestos xenobióticos. Estas propiedades están determinadas por la batería de enzimas extracelulares que pueden transformar los compuestos a CO2 y H2O. Compuestos como el endosulfán y el clorpirifós han sido considerados en Uruguay de importancia dado su uso indiscriminado en los cultivos agrícolas como la soja, cereales, frutas, entre otros. Estos compuestos son considerados ...

  14. Ethanol production from high cellulose concentration by the basidiomycete fungus Flammulina velutipes.

    Science.gov (United States)

    Maehara, Tomoko; Ichinose, Hitomi; Furukawa, Takanori; Ogasawara, Wataru; Takabatake, Koji; Kaneko, Satoshi

    2013-03-01

    Ethanol production by Flammulina velutipes from high substrate concentrations was evaluated. F. velutipes produces approximately 40-60 g l(-1) ethanol from 15% (w/v) D-glucose, D-fructose, D-mannose, sucrose, maltose, and cellobiose, with the highest conversion rate of 83% observed using cellobiose as a carbon source. We also attempted to assess direct ethanol fermentation from sugarcane bagasse cellulose (SCBC) by F. velutipes. The hydrolysis rate of 15% (w/v) SCBC with commercial cellulase was approximately 20%. In contrast, F. velutipes was able to produce a significant amount of ethanol from 15% SCBC with the production of β-glucosidase, cellobohydrolase, and cellulase, although the addition of a small amount of commercial cellulase to the culture was required for the conversion. When 9 mg g(-1) biomass of commercial cellulase was added to cultures, 0.36 g of ethanol was produced from 1 g of cellulose, corresponding to an ethanol conversion rate of 69.6%. These results indicate that F. velutipes would be useful for consolidated bioprocessing of lignocellulosic biomass to bioethanol.

  15. Amaurocine: Anti-Trichomonas vaginalis protein produced by the basidiomycete Amauroderma camerarium.

    Science.gov (United States)

    Duarte, Mariana; Seixas, Adriana; Peres de Carvalho, Maira; Tasca, Tiana; Macedo, Alexandre José

    2016-02-01

    Trichomonas vaginalis is the causative agent of trichomoniasis, the most common nonviral STD worldwide. This infection can lead to severe health conditions, especially when women are affected. Metronidazole and tinidazole are the only choices of treatment. In this sense, natural bioactive compounds against T. vaginalis are an interesting approach in the search for more efficient therapies. Herein, amaurocine, a 12 kDa protein, produced by the mushroom Amauroderma camerarium was purified and tested against T. vaginalis, including two fresh clinical isolates. Amaurocine presented MIC values at 2.6 μM against the ATCC isolate 30236, and 5.2 μM against the fresh clinical isolates, TV-LACH1 and TV-LACM2. Furthermore, besides increasing human neutrophils nitric oxide release, amaurocine presented a low toxicity toward those cells, suggesting it exerts a proinflammatory character.

  16. Espécies raras de Phallales (Agaricomycetidae, Basidiomycetes) no Nordeste do Brasil

    OpenAIRE

    Leite,Anileide Gomes; Silva,Bianca Denise Barbosa; Araújo,Ricardo Souza; Baseia,Iuri Goulart

    2007-01-01

    Seis espécies interessantes de Phallales são registradas para a Mata Atlântica: Aseroë floriformis Baseia & Calonge, Geastrum setiferum Baseia, Ileodictyon cibarium Tulasne ex Raoul, Laternea triscapa Turpin, Phallus pygmaeus Baseia e Staheliomyces cinctus E. Fischer. Adicionalmente, são fornecidas chave de identificação e comentários sobre a taxonomia e ecologia dessas espécies.

  17. Xylobolus subpileatus, a specialized basidiomycete functionally linked to old canopy gaps

    DEFF Research Database (Denmark)

    Taudiere, A.; Bellanger, J. M.; Moreau, P. A.

    2017-01-01

    treefall. In contrast, the abundance and the richness of saprobic and ectomycorrhizal fruitbodies decrease as canopy gaps age. Our results emphasize the high ecological specialization of X. subpileatus. They also highlight the imperative need to conserve the last patches of old-growth Mediterranean forests...

  18. 一种新的杀线虫担子菌%A New Nematicidal Basidiomycetes

    Institute of Scientific and Technical Information of China (English)

    李国红; 张克勤

    2001-01-01

    YLl4是一种首次发现具杀线虫活性的担子菌,12 h内对松材线虫(Bursaphelenchus xylophilus)的致病率达90%以上,是一株有应用前景的线虫生防菌.本试验观察了该菌对线虫的致病过程,证明其杀线虫机制是产生杀线虫毒素.经液体发酵,活性组分存在于发酵液中,不需线虫诱导能稳定生成,为水溶性,对热不敏感.

  19. Lignin peroxidase-negative mutant of the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Boominathan, K.; Dass, S.B.; Randall, T.A.; Kelley, R.L.; Reddy, C.A. (Michigan State Univ., East Lansing (USA))

    1990-01-01

    Phanerochaete chrysosporium produces two classes of extracellular heme proteins, designated lignin peroxidases and manganese peroxidases, that play a key role in lignin degradation. In this study the authors isolated and characterized a lignin peroxidase-negative mutant (lip mutant) that showed 16% of the ligninolytic activity ({sup 14}C-labeled synthetic lignin {yields}{sup 14}CO{sub 2}) exhibited by the wild type. The lip mutant did not produce detectable levels of lignin peroxidase, whereas the wild type, under identical conditions, produced 96 U of lignin peroxidase per liter. Both the wild type and the mutant produced comparable levels of manganese peroxidase and glucose oxidases, a key H{sub 2}O{sub 2}-generating secondary metabolic enzyme in P. chrysosporium. Fast protein liquid chromatographic analysis of the concentrated extracellular fluid of the lip mutant confirmed that it produced only heme proteins with manganese peroxidase activities were produced by the wild type. The lip mutant appears to be a regulatory mutant that is defective in the production of all the lignin peroxidases.

  20. Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition

    Science.gov (United States)

    Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

    2007-01-01

    The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

  1. Women as Members of Groups. Second Grade Social Studies: Elizabeth Cady Stanton, Elizabeth Blackwell, M.D., Annie Wauneka, Rosa Parks, Dolores Huerta, [and] Shirley Cachola, M.D.

    Science.gov (United States)

    National Women's History Project, Santa Rosa, CA.

    Part of the National Women's History Project funded to promote the study of women in history, this unit will help second grade students learn about women's contributions to U.S. society. Equity cannot be achieved until equality is expected and until the contributions of all women are understood and accepted as a simple matter of fact. The unit…

  2. Air Pollution Prevention and Control: Bioreactors and Bioenergy. By Christian Kennes, Maria C. Veiga, Wiley-Blackwell, 2013; 570 Pages. Price US $195.00, ISBN 978-1-119-94331-0

    Directory of Open Access Journals (Sweden)

    Shu-Kun Lin

    2013-05-01

    Full Text Available In recent years, air pollution has become a major worldwide concern. Air pollutants can affect metabolic activity, impede healthy development, and exhibit carcinogenic and toxic properties in humans. Over the past two decades, the use of microbes to remove pollutants from contaminated air streams has become a widely accepted and efficient alternative to the classical physical and chemical treatment technologies. Air Pollution Prevention and Control: Bioreactors and Bioenergy focusses on these biotechnological alternatives looking at both the optimization of bioreactors and the development of cleaner biofuels.

  3. Simultaneous localization and mapping implementation based on the improved Rao-Blackwellized particle filter%基于改进Rao-Blackwellized粒子滤波器的同时定位与地图构建

    Institute of Scientific and Technical Information of China (English)

    罗元; 傅有力; 程铁凤

    2015-01-01

    解决同时定位与地图构建(SLAM)问题是实现机器人自主导航的核心.目前,Rao-Blackwellized粒子滤波器(RBPF)是解决机器人同时定位与地图构建的有效方法.该方法在计算提议分布时,通常只考虑移动机器人的里程计信息,因此存在需要大量的采样粒子造成的计算量和复杂度增大的问题.本文提出一种改进算法,在计算提议分布时将机器人里程计信息和激光传感器采集的距离信息进行融合,有效地减少了所需粒子的数量并降低了滤波器预测阶段机器人位姿的不确定性.本文在机器人操作系统(robot operating system,ROS)平台上,使用配有URG激光器的Pioneer3-DX机器人进行了实验.结果表明,采用本文方法能够实时在线地创建高精度的栅格地图,为机器人在未知环境中的SLAM和导航提供了新途径.

  4. Evidence Informed Nursing with Older People Debbie Tolson Evidence Informed Nursing with Older People JO Booth Irene Schofield Wiley-Blackwell £26.99 264pp 9781444331134 1444331132 [Formula: see text].

    Science.gov (United States)

    2012-03-30

    THE EDITORS preface this text with a definition of gerontological nursing, stating that it 'contributes to and often leads the interdisciplinary and multiagency care of older people... a relationship-centred approach that promotes healthy ageing and the achievement of wellbeing in the older person and their family carers, enabling them to adapt to the older person's health and life changes and to face ongoing life challenges'. This vision threads through each chapter, by providing guidance and advice on quality, evidence-based nursing care for older people and their families in all settings.

  5. Contemporary Art: 1989 to the Present. Edited by Alexander Dumbadze and Suzanne Hudson. Wiley-Blackwell, Chichester, West Sussex, UK, 2013; 512 Pages. Price £22.99, €27.60, ISBN 978-1-4443-3866-9

    Directory of Open Access Journals (Sweden)

    Shu-Kun Lin

    2013-02-01

    Full Text Available An engaging account of today’s contemporary art world that features original articles by leading international art historians, critics, curators, and artists, introducing varied perspectives on the most important debates and discussions happening around the world.

  6. Contemporary Art: 1989 to the Present. Edited by Alexander Dumbadze and Suzanne Hudson. Wiley-Blackwell, Chichester, West Sussex, UK, 2013; 512 Pages. Price £22.99, €27.60, ISBN 978-1-4443-3866-9

    OpenAIRE

    Shu-Kun Lin

    2013-01-01

    An engaging account of today’s contemporary art world that features original articles by leading international art historians, critics, curators, and artists, introducing varied perspectives on the most important debates and discussions happening around the world.

  7. Inhibitory activity of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes) on transformed cells by human papillomavirus.

    Science.gov (United States)

    Hernández-Márquez, Eva; Lagunas-Martínez, Alfredo; Bermudez-Morales, Victor H; Burgete-García, Ana I; León-Rivera, Ismael; Montiel-Arcos, Elizur; García-Villa, Enrique; Gariglio, Patricio; Madrid-Marina V, Vicente; Ondarza-Vidaurreta, Raul N

    2014-01-01

    In this study, we investigated the effects of the aqueous extracts of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum, obtained from three localities (China; and Morelos and Michoacan, Mexico) on cervical cells transformed by human papillomavirus (HeLa and SiHa) and C-33A cancer cells. The cells were plated in DMEM medium supplemented, and were incubated in the presence of different concentrations of G. lucidum for 24 h. Cell proliferation was determined by MTT colorimetric assay and viability by trypan blue assay. Inhibitory dose was determined (IC50) of the three different extracts of G. lucidum in the culture cell lines mentioned above. The apoptosis process was confirmed by nuclear DNA fragmentation and the cell cycle was determined by flow cytometry. The results showed that aqueous extracts G. lucidum obtained from three localities produced inhibition in the proliferation of VPH transformed cells; they also induced apoptosis and cell cycle arrest in HeLa, SiHa, and C-33A cancer cells. Therefore, it was found that aqueous extracts G. lucidum obtained from three different locations produced inhibitory effect on cancer cells and may have a potential therapeutic use for the prevention and treatment of this disease.

  8. Molecular Characterization and In Vitro Antifungal Susceptibility Profile of Schizophyllum commune, an Emerging Basidiomycete in Bronchopulmonary Mycoses

    OpenAIRE

    Chowdhary, Anuradha; Kathuria, Shallu; Singh, Pradeep Kumar; Agarwal, Kshitij; Gaur, Shailendra N.; Roy, Pradip; Randhawa, Harbans S.; Meis, Jacques F.

    2013-01-01

    Schizophyllum commune (n = 30) showed lowest geometric mean MICs of isavuconazole (0.19 μg/ml), itraconazole (0.2 μg/ml), voriconazole (0.24 μg/ml), and amphotericin B (0.29 μg/ml) and high geometric mean MICs of fluconazole (19.39 μg/ml) and flucytosine (17.28 μg/ml). Five cases (of 8) of allergic bronchopulmonary mycosis that were treated with itraconazole had no recrudescence after 6 to 24 months of follow-up. One case each of invasive pulmonary mycosis and fungal ball were treated success...

  9. Molecular characterization and in vitro antifungal susceptibility profile of Schizophyllum commune, an emerging basidiomycete in bronchopulmonary mycoses.

    Science.gov (United States)

    Chowdhary, Anuradha; Kathuria, Shallu; Singh, Pradeep Kumar; Agarwal, Kshitij; Gaur, Shailendra N; Roy, Pradip; Randhawa, Harbans S; Meis, Jacques F

    2013-06-01

    Schizophyllum commune (n = 30) showed lowest geometric mean MICs of isavuconazole (0.19 μg/ml), itraconazole (0.2 μg/ml), voriconazole (0.24 μg/ml), and amphotericin B (0.29 μg/ml) and high geometric mean MICs of fluconazole (19.39 μg/ml) and flucytosine (17.28 μg/ml). Five cases (of 8) of allergic bronchopulmonary mycosis that were treated with itraconazole had no recrudescence after 6 to 24 months of follow-up. One case each of invasive pulmonary mycosis and fungal ball were treated successfully with voriconazole and itraconazole.

  10. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  11. Haematopoiesis radioprotection in Balb/c mice by an aqueous mycelium extract from the Basidiomycete Pleurotus ostreatus mushroom.

    Science.gov (United States)

    Llauradó, G; Morris, H J; Tamayo, V; Lebeque, Y; Beltrán, Y; Marcos, J; Moukha, S; Creppy, E E; Bermúdez, R C

    2015-01-01

    The study examined the radioprotective activity of an aqueous extract from Pleurotus ostreatus mycelium administered to Balb/c mice. Male mice were whole-body irradiated on day 0 ((60)Co, at 0.43 Gy/min) and divided into two groups. The extract was administered intraperitoneally to one group (100 mg/kg) on days - 10 to - 6 and - 2 to +1 with respect to the irradiation. The irradiated-control group was injected with saline solution; non-irradiated mice were used as negative controls. The radioprotective effect was evident by increases in bone marrow cellularity (5.1 × 10(6)/femur vs. 1.1 × 10(6)/femur in saline-control mice, p < 0.05), leucocyte counts (10.5 × 10(9)/L vs. 4.5 × 10(9)/L, p < 0.05), and spleen cellularity (11.2 × 10(7)/spleen vs. 6.2 × 10(7)/spleen, p < 0.05). The extract stimulated macrophage phagocytic activity as judged by a faster rate of carbon clearance in terms of absorbance ratios (1.62 vs. 2.01, p < 0.05). Therefore, this extract may be a candidate therapeutic agent with radioprotective activity for haematopoiesis damage, particularly to cells involved in immune function.

  12. Mycelial growth rate and macro- and micromorphological characteristics of medicinal species of genus Ganoderma (higher Basidiomycetes) from Iran.

    Science.gov (United States)

    Keypour, Somayeh; Riahi, Hossein; Safaie, Naser; Borhani, Ali

    2014-01-01

    Mycelial growth rate is a distinguishing quality that demonstrates continuous variation in different isolates collected from various hosts and locations. The objectives of this research were (1) to reinvestigate the previous identification of Iranian species, and (2) to recognize the best native isolate(s) for cultivation of different Ganoderma species. Of 78 samples collected from different hosts and sites, only 43 mycelia could be purified and examined for further study. Growth rate (GR; Δd/Δt) and growth coefficient (GC; dgh/t) were analyzed by growing isolate culture on 2% malt-extract agar medium (pH 5.5) incubated at 25°C. Macro- and micromorphological studies on mycelia and fruiting bodies such as basidiospore and cutis microcharacters as well as fruiting body quality were used for precise identification. Results revealed that samples belonged to 4 species: G. lucidum, G. applanatum, G. resinaceum, and G. australe. Among all samples, the isolate morphologically identified as G. applanatum showed the best GR (12 mm/day) and good GC (128 mm/day), followed by the 2 other isolates identified as G. resinaceum (GRs and GCs of 11 and 55 mm/day and 10.9 and 43.6 mm/day, respectively).

  13. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review).

    Science.gov (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves

    2015-01-01

    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  14. Protective Effects of Black Hoof Medicinal Mushroom from Korea, Phellinus linteus (Higher Basidiomycetes), on Osteoporosis In Vitro and In Vivo.

    Science.gov (United States)

    Kim, In-Ho; Chung, Min-Yu; Shin, Ji Young; Han, Daeseok

    2016-01-01

    The protective effect of Phellinus linteus (ethanol extract) against osteoporosis was investigated using the Saos-2 human osteoblast-like cell line and osteoclasts. A nontoxic concentration of Ph. linteus (10-2 to 10-8 mg mL-1) increased alkaline phosphatase (ALP) (EC 3.1.3.1) activity to a larger extent than soy did. Ph. linteus also attenuated the number and the activity of tartrate-resistant acid phosphatase-positive multinucleated osteoclasts. These results indicate that Ph. linteus likely regulated both osteoblasts and osteoclasts, contributing to the protection against osteoporosis. The protective effect of Ph. linteus was examined in ovariectomized (OVX) rats. Histological analysis indicates that Ph. linteus improved trabecular bone mass and reduced osteoclast frequency without affecting lipid droplet accumulation in the femur of OVX rats. A Ph. linteus supplementation for 12 weeks also significantly increased serum ALP activity and reduced urinary deoxypyridinoline level in OVX rats. Ultimately, we found that 12-week Ph. linteus supplementation increased the bone accumulation of minerals, including calcium, magnesium, and phosphorus. Collectively, Ph. linteus protected against osteoporosis by balancing the number of osteoblasts and osteoclasts, which was particularly associated with increased ALP activity in vitro and in vivo and mineral accumulation in bone.

  15. Did the iceman know better? Screening of the medicinal properties of the birch polypore medicinal mushroom, piptoporus betulinus (higher basidiomycetes)

    NARCIS (Netherlands)

    Vunduk, Jovana; Klaus, Anita; Kozarski, Maja; Petrović, Predrag; Žižak, Željko; Nikšić, Miomir; Griensven, Van L.J.L.D.

    2015-01-01

    The birch polypore Piptoporus betulinus was among two mushrooms that were found in the Iceman’s bag. Recent studies indicated that P. betulinus was probably used as a religious and medicinal item. In order to examine the medicinal potential of P. betulinus, hot water (HW), partially purified

  16. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy

    2012-12-01

    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  17. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p < 0.01). A positive correlation existed between the phenolic content and antioxidant activity. Our results indicated that fruiting bodies of G. lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application.

  18. Probing Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes): a bitter mushroom with amazing health benefits.

    Science.gov (United States)

    Batra, Priya; Sharma, Anil Kumar; Khajuria, Robinka

    2013-01-01

    Ganoderma lucidum (Lingzhi or Reishi) is known as a bitter mushroom with remarkable health benefits. The active constituents found in mushrooms include polysaccharides, dietary fibers, oligosaccharides, triterpenoids, peptides and proteins, alcohols and phenols, mineral elements (such as zinc, copper, iodine, selenium, and iron), vitamins, and amino acids. The bioactive components found in the G. lucidum mushroom have numerous health properties to treat diseased conditions such as hepatopathy, chronic hepatitis, nephritis, hypertension, hyperlipemia, arthritis, neurasthenia, insomnia, bronchitis, asthma, gastric ulcers, atherosclerosis, leukopenia, diabetes, anorexia, and cancer. In spite of the voluminous literature available, G. lucidum is used mostly as an immune enhancer and a health supplement, not therapeutically. This review discusses the therapeutic potential of G. luidum to attract the scientific community to consider its therapeutic application where it can be worth pursuing.

  19. Antimicrobial effect of the Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes) and its main compounds.

    Science.gov (United States)

    Vazirian, Mahdi; Faramarzi, Mohammad Ali; Ebrahimi, Seyed Esmaeil Sadat; Esfahani, Hamid Reza Monsef; Samadi, Nasrin; Hosseini, Seyed Aboulfazl; Asghari, Ali; Manayi, Azadeh; Mousazadeh, Ali; Asef, Mohammad Reza; Habibi, Emran; Amanzadeh, Yaghoub

    2014-01-01

    Mushrooms are considered one of the richest sources of natural antibiotics, and various species of them inhibit the growth of a wide diversity of microorganisms. Ganoderma lucidum, a well-known medicinal mushroom. has many pharmacological and biological activities including an antimicrobial effect, although few studies have investigated the antibacterial and antifungal effects of its purified compounds. The chemical structure of the purified compounds from the hexane fraction was elucidated as ergosta-7,22-dien-3β-yl acetate, ergosta-5,7,22-trien-3β-yl acetate (isopyrocalciferol acetate), ergosta-7,22-dien-3-one, ergosta-7,22-dien-3β-ol, and ergosta-5,7,22-trien-3β-ol (ergostrol). In addition, the structure of ganodermadiol was demonstrated after purification from the chloroform fraction. The fractions inhibited Gram-positive bacteria and yeast, with minimum inhibitory concentration values of 6.25 mg/mL, but were ineffective against Gram-negative bacteria in the tested concentrations. The results were comparable for isolated compounds, whereas the mixture of ergosta-7,22-dien-3β-yl acetate and isopyrocalciferol acetate was weakly effective against Escherichia coli (minimum inhibitory concentration, 10 mg/mL). It could be assumed that the antimicrobial effect of crude fractions is the consequence of mixing triterpenoid and steroid compounds.

  20. Chemical Composition and Medicinal Value of the New Ganoderma tsugae var. jannieae CBS-120304 Medicinal Higher Basidiomycete Mushroom.

    Science.gov (United States)

    Chan, Jannie Siew Lee; Asatiani, Mikheil D; Sharvit, Lital E; Trabelcy, Beny; Barseghyan, Gayane S; Wasser, Solomon P

    2015-01-01

    In this research, the chemical composition and anticancer and antioxidant activity of the new medicinal mushroom Ganoderma tsugae var. jannieae CBS-120304 were evaluated. The chemical composition assay includes amounts of total carbohydrates and proteins, amino acids, fatty acids, micro- and macroelements, and vitamins. The investigated medicinal mushroom seemed to be a rich source of nutritional components. Mycelium accumulated more than 2-fold more total protein compared with the fruiting body and reached 37% and 16% of dry weight, respectively. Carbohydrate content in the fruiting body seemed to be conspicuously higher than in the mycelium (50% of dry weight) and reached 80% of dry weight. Quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, and linoleic acid were the major fatty acids. Toxic elements, such as silver, arsenic, cadmium, and mercury, were found only in trace amounts in mycelium and were not detected in the fruiting body. Furthermore, the 1,1-diphenyl-2-picrylhydrazyl free radical scavenging assay was used to evaluate antioxidant activity. The highest radical scavenging activity was 9.0 mg/mL (65.9%) by ethanol extract. In addition, mycelial extracts were tested to inhibit MCF7 breast cancer cells. Ganoderma tsugae var. jannieae ethyl acetate extract (GTEAE) extract showed high potential by inhibiting reporter activity by more than 70%. Results demonstrated that GTEAE had a strong effect on inhibitory protein κΒα level in the higher concentration used (200 gg/mL), which could be compared with the effect of parthenolide. Furthermore, GTEAE demonstrated strong inhibition of IκΒα phosphorylation.

  1. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  2. Evidence for strong inter- and intracontinental phylogeographic structure in Amanita muscaria, a wind-dispersed ectomycorrhizal basidiomycete

    Science.gov (United States)

    Jozsef Geml; Rodham E. Tulloss; Gary A. Laursen; Nina A. Sazanova; D.L. Taylor

    2008-01-01

    Agrowing number of molecular studies show that many fungi have phylogeographic structures and that their distinct lineages are usually limited to different continents. As a conservative test of the extent to which wind-dispersed mycorrhizal fungi may exhibit phylogeographic structure, we chose to study Amanita muscaria, a host-generalist,...

  3. Multidimensional NMR analysis reveals truncated lignin structures in wood decayed by the brown rot basidiomycete Postia placenta

    Science.gov (United States)

    Daniel J. Yelle; Dongsheng Wei; John Ralph; Kenneth E. Hammel

    2011-01-01

    Lignocellulose biodegradation, an essential step in terrestrial carbon cycling, generally involves removal of the recalcitrant lignin barrier that otherwise prevents infiltration by microbial polysaccharide hydrolases. However, fungi that cause brown rot of wood, a major route for biomass recycling in coniferous forests, utilize wood polysaccharides efficiently while...

  4. 吉林省担子菌补记(八)%Notes on Basidiomycetes of Jilin Province (Ⅷ)

    Institute of Scientific and Technical Information of China (English)

    图力古尔

    2007-01-01

    报道了6个吉林省新记录担子菌,即辅毛鬼伞[Coprinus radians (Desm.:Fr.)Fr.]、金黄拟蜡伞[Hygrophoropsis aurantiaca (Wulf.:Fr.) Maire]、黄柄小菇[Mycena epipterygia(Scop.:Fr.)S.F.Gray]、黏柄小菇[Mycena rorida(Scop.:Fr.)Quél.]、长齿白齿耳菌[Mycoleptodonoides aitchisonii(Berk.) Mass.]和大刷革[Xylobolus princeps (Jungh.) Boidin].其中,黏柄小菇同时为中国新记录种,其他5种首次在我国东北地区发现,拟蜡伞属和白齿耳菌属为吉林省新记录属.标本保存于吉林农业大学菌物标本馆(HMJAU).

  5. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  6. Antigenotoxic potential of aqueous extracts from the chanterelle mushroom, Cantharellus cibarius (higher Basidiomycetes), on human mononuclear cell cultures.

    Science.gov (United States)

    Mendez-Espinoza, Claudia; Garcia-Nieto, Edelmira; Esquivel, Adriana Montoya; Gonzalez, Monica Montiel; Bautista, Efrain Velasco; Ezquerro, Carmen Calderon; Santacruz, Libertad Juarez

    2013-01-01

    Cantharellus cibarius is one of the most important wild, edible, and ectomycorrhizal mushrooms growing at La Malinche National Park, Tlaxcala, Mexico; therefore, the assessment of its biological properties is of great interest to know its potential as an alternative treatment to chemopreventive strategies when it is consumed as part of a diet. Comet assay was used to evaluate the antigenotoxic properties of several concentrations of aqueous extracts (0.0125, 0.025, 0.05, 0.1, and 0.2% w/v) prepared at room temperature (22 ± 2°C). As a test system we used human mononuclear cells exposed to methyl methanesulphonate (MMS) in vitro according to 3 different protocols: previous, simultaneous, and posterior. Previous (0.0125%) and simultaneous (0.1%) treatments resulted in the highest inhibitory efficiency. In the former, the cells assessed showed a tail length of 94.9 ± 64 µm; in the latter, the tails measured 106.2 ± 40 µm. Resulting percentages of reduction in damage were 236% and 196.1%, respectively. We did not obtain a dose-dependent response. The mean tail length for each protocol (previous, 133.1 ± 80 µm; simultaneous, 127.8 ± 57 µm; posterior, 146.3 ± 74 µm) was statistically significant with regard to the positive control (MMS).

  7. 吉林省担子菌补记(六)%Notes on Basidiomycetes of Jilin Province (Ⅵ)

    Institute of Scientific and Technical Information of China (English)

    王建瑞; 图力古尔

    2004-01-01

    报道了6个吉林省新记录担子菌,即青绿湿伞[Hygrocybe psittacina(Schaeff.:Fr.)Wünsche],梭柄金钱菌[Collybia fusipes(Bull.:Fr.)Quél.],黄褐盔孢菌[Galerina helvoliceps(Berk.et Curt.)Sing.],内鬼笔(Endophallus yunnanensis Zang et Petersen),粉托鬼笔[Phallus hadriani(Vent.)Pers.]和蓖齿地星(Geastrum pectinatum Pers.).其中,内鬼笔属为吉林省新记录属,青绿湿伞、梭柄金钱菌、内鬼笔和篦齿地星为首次在我国东北地区发现.标本存放在吉林农业大学标本馆(HMJAU)内.

  8. 蓝黄红菇的化学成分%The Constituents of the Basidiomycetes Russula cyanoxantha

    Institute of Scientific and Technical Information of China (English)

    高锦明; 董泽军; 刘吉开

    2000-01-01

    从野生真菌蓝黄红菇Russula cyanoxantha Schaeff. Fr.子实体中分得6个化合物,经光谱法分别鉴定为4个麦角甾醇:5α,8α-epidioxy-(22E,24R)-ergosta-6,22-dien-3β-ol 1,5α,8α-epidioxy-(24S)-ergosta-6-en-3β-ol 2,(24S)-ergosta-7-ene-3β,5α,6β-triol 3,(22E,24R)-ergosta-7,22-dien-3β,5α,6β-triol 4 (cerevisterol)以及D -阿洛醇 (D-allitol)和硬脂酸 (stearic acid ).其中化合物1 、2为麦角甾醇过氧化物.3和D -阿洛醇为首次发现存在于高等真菌中.

  9. A HOMOLOGOUS GENE-REPORTER SYSTEM FOR THE BASIDIOMYCETE SCHIZOPHYLLUM-COMMUNE BASED ON INTERNALLY DELETED HOMOLOGOUS GENES

    NARCIS (Netherlands)

    SCHUREN, FHJ; HARMSEN, MC; WESSELS, JGH

    Problems encountered in our attempts to achieve expression of heterologous genes, driven by ascomycetous regulatory sequences, in homobasidiomycetes led us to develop a gene-reporter system based on the expression of homologous genes in Schizophyllum commune. Internal deletions were made in the

  10. Complex Enzyme-Assisted Extraction, Purification, and Antioxidant Activity of Polysaccharides from the Button Mushroom, Agaricus bisporus (Higher Basidiomycetes).

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Zhou, Xinghai

    2015-01-01

    Agaricus bisporus polysaccharides (ABP) were extracted by complex enzyme-assisted extraction methodology. The following were optimal conditions for the extraction of crude ABP: complex enzyme amount, 2.2%; temperature, 62°C; time, 3 h; and pH, 4. Under these conditions, the experimental yield of crude ABP was 6.87%. The crude ABP was purified by diethylaminoethyl-cellulose 52 chromatography and Sephadex G-100 chromatography, and one fraction-namely, ABP-1-was produced. The ABP-1 contained 93.67% carbohydrate, 1.46% protein, and 0.62% uronic acid. The constituent monosaccharides were predominantly glucose, galactose, mannose, and xylose. The antioxidant activities of ABP-1 were investigated by measuring its scavenging ability on 2,2-diphenyl-1-picrylhydrazyl and hydroxyl radicals, its ferric-reducing activity power, and the reducing power assay. At a concentration of 1.2 mg/mL, ABP-1 seemed to possess good free radical scavenging activity, with a scavenging value of about 56%. The results indicate that ABP-1 has good antioxidant activity.

  11. Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Higher Basidiomycetes), Growth in Grain-Based Diet Improves Broiler Chicken Production.

    Science.gov (United States)

    Santos, Mateus P; Marcante, Rafael C; Santana, Thiago T; Tanaka, Henrique S; Funari, Pascoal; Alberton, Luiz R; Faria, Eliete V; Valle, Juliana S; Colauto, Nelson B; Linde, Giani A

    2015-01-01

    Many alternative compounds have been tested to improve poultry performance but few of them have previously used mycelial-colonized substrate to partially replace standard diet in broiler chickens. The objective of this study was to evaluate broiler chicken production, health, and meat sensory characteristics, with partial replacement of the standard diet by Pleurotus ostreatus-colonized substrate. One hundred fifty 1-day-old male Cobb chicks were given standard diet partially replaced by 0, 5, 10, 100, or 200 g·kg⁻¹ of P. ostreatus-colonized substrate and randomly distributed into five treatments. Each treatment had three replicates, with 10 birds per replicate, totaling 30 birds. The replacement of the standard diet by 10 g·kg⁻¹ of colonized substrate increased (P≤0.05) chicken body mass up to 57% at 21 days, and up to 28% at 42 days. In general, partial replacement of standard diet by colonized substrate increased hematocrits and typical lymphocytes, and reduced low density lipoproteins. Also, it reduced chicken production period up to 21% and there is no meat taste alteration. The use of P. ostreatus-colonized substrate in chicken feeding is an alternative method to improve broiler chicken production.

  12. Evidence for strong inter- and intracontinental phylogeographic structure in Amanita muscaria, a wind-dispersed ectomycorrhizal basidiomycete.

    Science.gov (United States)

    Geml, József; Tulloss, Rodham E; Laursen, Gary A; Sazanova, Nina A; Taylor, D L

    2008-08-01

    A growing number of molecular studies show that many fungi have phylogeographic structures and that their distinct lineages are usually limited to different continents. As a conservative test of the extent to which wind-dispersed mycorrhizal fungi may exhibit phylogeographic structure, we chose to study Amanita muscaria, a host-generalist, widespread, wind-dispersed fungus. In this paper, we document the existence of several distinct phylogenetic species within A. muscaria, based on multilocus DNA sequence data. According to our findings, A. muscaria has strong intercontinental genetic disjunctions, and, more surprisingly, has strong intracontinental phylogeographic structure, particularly within North America, often corresponding to certain habitats and/or biogeographic provinces. Our results indicate that the view of A. muscaria as a common, widespread, easily identifiable, ecologically plastic fungus with a wide niche does not correctly represent the ecological and biological realities. On the contrary, the strong associations between phylogenetic species and different habitats support the developing picture of ecoregional endemisms and relatively narrow to very narrow niches for some lineages.

  13. Antioxidant potential and antioxidant compounds of extracts from the medicinal sulphur polypore, Laetiporus sulphureus (Higher Basidiomycetes) in submerged cultures.

    Science.gov (United States)

    Lung, Ming-Yeou; Huang, Wei Zhong

    2013-01-01

    Fermented products, dried mycelia broth, and mycelia-free broth of Laetiporus sulphureus submerged cultures were extracted with ethanol and hot water under optimal culture conditions and investigated for their antioxidant properties. Ethanolic extracts from dried mycelia broth (EEM) and mycelia-free broth (EEB) and hot water extracts from dried mycelia (HWEM) show extraordinary antioxidant properties for all EC50 values below 10 mg/mL except for EEM, as measured by the scavenging effects on DPPH radicals and chelating effects on ferrous ions. Ascorbic acid is rich in EEB and α-tocopherol, and total flavonoids are abundant in EEM. Total phenols are mainly found in EEB and HWEM. There is a high correlation between total phenol content and EC50 values. The correlation coefficient (R2) of the reducing power is 0.994; the R2 of the scavenging effect on DPPH radicals is 0.992; the R2 of the chelating effects on ferrous ions is 0.949; and the R2 of the scavenging effect on superoxide anions is 0.995. These results suggest that extracts of L. sulphureus fermented products are of considerable application potential in antioxidant-related pharmaceutical industries.

  14. Regioselective oxygenation of fatty acids, fatty alcohols and other aliphatic compounds by a basidiomycete heme-thiolate peroxidase.

    Science.gov (United States)

    Gutiérrez, Ana; Babot, Esteban D; Ullrich, René; Hofrichter, Martin; Martínez, Angel T; del Río, José C

    2011-10-01

    Reaction of fatty acids, fatty alcohols, alkanes, sterols, sterol esters and triglycerides with the so-called aromatic peroxygenase from Agrocybe aegerita was investigated using GC-MS. Regioselective hydroxylation of C(12)-C(20) saturated/unsaturated fatty acids was observed at the ω-1 and ω-2 positions (except myristoleic acid only forming the ω-2 derivative). Minor hydroxylation at ω and ω-3 to ω-5 positions was also observed. Further oxidized products were detected, including keto, dihydroxylated, keto-hydroxy and dicarboxylic fatty acids. Fatty alcohols also yielded hydroxy or keto derivatives of the corresponding fatty acid. Finally, alkanes gave, in addition to alcohols at positions 2 or 3, dihydroxylated derivatives at both sides of the molecule; and sterols showed side-chain hydroxylation. No derivatives were found for fatty acids esterified with sterols or forming triglycerides, but methyl esters were ω-1 or ω-2 hydroxylated. Reactions using H(2)(18)O(2) established that peroxide is the source of the oxygen introduced in aliphatic hydroxylations. These studies also indicated that oxidation of alcohols to carbonyl and carboxyl groups is produced by successive hydroxylations combined with one dehydration step. We conclude that the A. aegerita peroxygenase not only oxidizes aromatic compounds but also catalyzes the stepwise oxidation of aliphatic compounds by hydrogen peroxide, with different hydroxylated intermediates.

  15. Molecular Characterization and In Vitro Antifungal Susceptibility Profile of Schizophyllum commune, an Emerging Basidiomycete in Bronchopulmonary Mycoses

    Science.gov (United States)

    Kathuria, Shallu; Singh, Pradeep Kumar; Agarwal, Kshitij; Gaur, Shailendra N.; Roy, Pradip; Randhawa, Harbans S.

    2013-01-01

    Schizophyllum commune (n = 30) showed lowest geometric mean MICs of isavuconazole (0.19 μg/ml), itraconazole (0.2 μg/ml), voriconazole (0.24 μg/ml), and amphotericin B (0.29 μg/ml) and high geometric mean MICs of fluconazole (19.39 μg/ml) and flucytosine (17.28 μg/ml). Five cases (of 8) of allergic bronchopulmonary mycosis that were treated with itraconazole had no recrudescence after 6 to 24 months of follow-up. One case each of invasive pulmonary mycosis and fungal ball were treated successfully with voriconazole and itraconazole. PMID:23507274

  16. Chemical Constituents of the Basidiomycetes Marasmius maximus Hongo%大皮伞化学成分研究

    Institute of Scientific and Technical Information of China (English)

    牛芸

    2013-01-01

    大皮伞(Marasmius maximus Hongo)是食用菌类,在我国各地均有分布,对其主要化学成分进行研究具有重要的意义.通过运用多种分离与分析方法(CC、TLC、prep.TLC、MPLC、HPLC等)以及波谱学技术(1D NMR、2D NMR、MS、HR-MS、UV/Vis等)并借助必要的化学手段对其发酵液进行化学成分的研究,共分离得到5个化合物.分别为:麦角甾-4,6,8 (14)22-四烯-3-酮、(22E,24R)-麦角甾-7,22-二烯-3β,5α,6β-三醇、邻苯二甲酸二异丁酯、三亚麻油酸甘油酯、5-Hydroxymethl-1-2-呋喃甲醛.

  17. Notes on Basidiomycetes of Jilin Province (Ⅳ)%吉林省担子菌补记(四)

    Institute of Scientific and Technical Information of China (English)

    图力古尔; 李玉

    2003-01-01

    报道了吉林省新分布担子菌6种,即刺孢蜡蘑Laccaria tortilis (Bolt.) S.F.Gray,大型皮伞Marasmius maximus Hongo,粗毛原迷孔菌Protodaedalea hispida Imazeki,巢孔菌 Poronidulus conchifer (Schw.) Murr.中华散尾菌Lysurus sinensis Lioyd和袋形地星Geastrum saccatum (Fr.) Fisch..其中,原迷孔菌属和巢孔菌属为吉林省新记录属.

  18. Anxiolytic Effects of Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) on Ischemia-Induced Anxiety in Rats.

    Science.gov (United States)

    Zhang, Chunjing; Gao, Xiulan; Sun, Yan; Sun, Xiaojie; Wu, Yanmin; Liu, Ying; Yu, Haitao; Cui, Guangcheng

    2015-01-01

    We investigated the anxiolytic effects Agaricus brasiliensis extract (AbSE) on ischemia-induced anxiety using the plus-maze test and the social interaction test. The animals were treated orally with AbSE (4, 8, and 10 mg/kg/d, respectively) for 30 d, followed by middle cerebral artery occlusion-induced cerebral ischemia. Levels of noradrenaline, dopamine, and serotonin in the cerebral cortex of rats, as well as oxidative stress and plasma corticosterone levels were analyzed, respectively. The rota-rod test was carried out to exclude any false positive results in experimental procedures related to anxiety disorders, and the catalepsy test was carried out to investigate whether AbSE induces catalepsy. Our results demonstrate that oral administration of AbSE presented anxiolytic-like effects in the elevated plus-maze test and the social interaction test. Furthermore, AbSE did not induce extrapyramidal symptoms in the catalepsy test. The mechanism underlying the anxiolytic effect of AbSE might be increased brain monoamine levels and plasma corticosterone levels and decreased oxidative stress in cerebral ischemia/reperfusion rats.

  19. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  20. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    .8-2.0 μm, with a distinct sympodial rachis of up to 70 μm long on which blastoconidia are formed, much like a bunch of grapes. Conidia 2.5-3.5 x 1.6-2.5 μm, one-celled, ellipsoidal to clavate-ellipsoidal, with a rather broad base, pale brownish; conidia...

  1. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  2. Enhancement of Shelf Life of Button Mushroom, Agaricus bisporus (Higher Basidiomycetes) by Fumigant Application of Lippia alba Essential Oil.

    Science.gov (United States)

    Vishwakarma, Pratima; Pandey, Abhay K; Mishra, Priyanka; Singh, Pooja; Tripathi, N N

    2015-01-01

    Eleven essential oils isolated from higher plant species were assessed against the four isolates of Verticillium fungicola found on fruiting bodies of Agaricus bisporus. Eucalyptus citriodora and Lippia alba oils were more efficacious and completely inhibited the mycelial growth of fungal isolates. L. alba oil was fungistatic and fungicidal at 10- and 20-µL concentrations against all of the isolates, respectively, and was more potent than E. citriodora oil as well as some prevalent synthetic fungicides such as benomyl, ethylene dibromide, and phosphine. Eighty microliters of L. alba oil protected 500 g of fruiting bodies of A. bisporus for up to 7 d from infection of the fungus under in vivo conditions. The findings strengthen the possibility of L. alba oil as a plant-based protectant to enhance the shelf life of A. bisporus fruiting bodies.

  3. Book Review of: FRANCESCO BERTO. There's Something about Godel. Malden, Mass., and Oxford: Wiley-Blackwell, 2009. ISBN 978-1-4051-9766-3 (hbk); 978-1-4051-9767-0 (pbk). Pp. xx + 233. English translation of Tutti pazzi per Godel! (Rome: Gius, Laterza & Figli, 2008)

    OpenAIRE

    McGee, Vann

    2011-01-01

    There's Something about Godel is a bargain: two books in one. The first half is a gentle but rigorous introduction to the incompleteness theorems for the mathematically uninitiated. The second is a survey of the philosophical, psychological, and sociological consequences people have attempted to derive from the theorems, some of them quite fantastical.

  4. Cryptococcus agrionensis sp. nov., a basidiomycetous yeast of the acidic rock drainage ecoclade, isolated from an acidic aquatic environment of volcanic origin.

    Science.gov (United States)

    Russo, Gabriel; Libkind, Diego; Ulloa, Ricardo J; de García, Virginia; Sampaio, Jose P; van Broock, María R

    2010-04-01

    Seventy-one strains were isolated from the River Agrio-Lake Caviahue acidic aquatic environment in Argentina. Strains were isolated mainly from the most acidic section of the river (pH 1.8-2.7). According to the mini/microsatellite-primed PCR technique and physiological data, these strains are representatives of a single novel species of the genus Cryptococcus. Analysis of the D1/D2 region of the large-subunit rRNA gene showed that the strains belong to the order Filobasidiales of the subphylum Agaricomycotina. The novel isolates formed a phylogenetic group with Cryptococcus ibericus, Cryptococcus aciditolerans and Cryptococcus metallitolerans, the most closely related species. This group, which is phylogenetically related to the Gastricus clade, is considered to be an ecoclade due to its peculiar ecology and physiology. The name Cryptococcus agrionensis sp. nov. is proposed to accommodate these isolates, with strain CRUB 1317(T) (=CBS 10799(T)=JCM 15321(T)) as the type strain.

  5. Characterization of interspecific hybrid dikaryons of the oyster mushrooms, Pleurotus florida PAU-5 and P. sajor-caju PAU-3 (higher Basidiomycetes) from India.

    Science.gov (United States)

    Jaswal, Ravinder Kumar; Sodhi, Harpreet Singh; Sharma, Shivani

    2014-01-01

    Five Pleurotus hybrid dikaryons, developed through cross-breeding of P. florida PAU-5 (PF-5) and P. sajor-caju PAU-3 (PSC-3) were characterized with respect to textural properties, color, and enzymatic and genetic variability. Texture profile revealed significant differences in springiness, resilience, cohesiveness, and chewiness between all hybrids compared to the parents. Among the hybrid cultures, maximum whiteness was reported in hybrid 37, whereas hybrid 8 had minimum whiteness. Three hybrids (16, 37, 42) showed an increased linear growth rate in relation to PF-5, whereas no hybrid showed a higher growth rate than PSC-3. Maximum endoglucanase and xylanase activity was observed in hybrid 46, whereas minimum activity occurred in hybrid 42. Laccase and protease activity was higher in hybrid 37 and 46, respectively. Four hybrids (16, 37, 42, 46) showed increased peroxidase activity in relation to PF-5, whereas hybrid 46 showed activity higher than the parent PSC-3. Comparison of isozyme patterns confirmed the hybrid nature of hybrid 16. The large variation in the intensity of bands could be a result of recombination. Sodium dodecyl sulfate polyacrylamide gel electrophoresis of extracellular enzymes revealed 60.3- and 43-KDa bands in all the hybrids. An additional 25-KDa band was reported in hybrids 37, 42, and 46 and the parent PF-5, indicating their close relatedness. Parental strains showed higher divergence in small-subunit ribosomal DNA region compared with the internal transcribed spacer region, indicating their significance in varietal discrimination. Hybrid 46 had a small-subunit ribosomal DNA region more similar to that of PSC-3 compared with PF-5, whereas the internal transcribed spacer region of hybrids 42 and 46 revealed close resemblance to that of PF-5 and PSC-3, respectively.

  6. Medicinal and antimicrobial role of the oyster culinary-medicinal mushroom Pleurotus ostreatus (higher Basidiomycetes) cultivated on banana agrowastes in India.

    Science.gov (United States)

    Kunjadia, Prashant D; Nagee, Anju; Pandya, Parth Y; Mukhopadhyaya, Pratap N; Sanghvi, Gaurav V; Dave, Gaurav S

    2014-01-01

    Oyster mushrooms, species of the genus Pleurotus, are recognized for producing secondary metabolites with important medicinal properties. Investigations were carried out to evaluate the antioxidative and antimicrobial properties of the edible mushroom Pleurotus ostreatus (MTCC142) extracts cultivated on banana agrowastes. Ethanolic extracts showed antimicrobial activities against gram-positive and gram-negative bacteria, and their in vitro antifungal activities against all fungi tested revealed a promising role. Qualitative phytochemical analysis of Pleurotus grown on yeast dextrose broth and banana agrowaste confirmed the presence of steroids, cardiac glycosides, terpenoids, and alkaloids, whereas ethanolic extract after 40 days exhibited a phenol concentration of 521.67 µg/mL in banana waste compared to 155 µg/mL in yeast dextrose broth. The minimum inhibitory concentration of ethanolic extracts ranged from 19.74 to 56.84 mg/mL and 35.53 to 102.31 mg/mL in solid-state and submerged grown mycelium extracts, respectively, after 40 days. Moreover, banana agrowaste could be a significant economic source for the production of the oyster mushroom P. ostreatus. The nutritive, medicinal, and antimicrobial properties of P. ostreatus can be used to develop a new nutraceutical formulation; it can also be used as an additive to routine and fast food.

  7. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  8. Novel urease-negative basidiomycetous yeast, Trichosporon heliocopridis sp. nov., associated with dung beetles (Heliocopris bucephalus Fabricius) in the north of Thailand.

    Science.gov (United States)

    Kunthiphun, Sineenath; Endoh, Rikiya; Takashima, Masako; Ohkuma, Moriya; Tanasupawat, Somboon; Akaracharanya, Ancharida

    2015-12-16

    Ninety six yeastisolates associated with dung beetles (Heliocopris bucephalus Fabricius) were examined based on culture-dependent method. A comparison of the colony morphology and PCR fingerprints obtained by (GTG)5microsatellite-primed PCR indicated that 84 of these isolates belonged to one group. Five strains (DD1-1,DD2-33, DD4-11, DD5-15 and DD6-1) were selected as the representatives of this main group, whereeach of the five selectedstrains had been derivedfrom a different dung beetle collected innorthern Thailand. A comparison of the D1/D2 domain sequence of the large subunit rRNA gene (LSU D1/D2) and the internal transcribed spacer (ITS) sequencesrevealed that these five strains were the same and wererelated to the genus Trichosporon. Phylogenetic analysis based on the LSU D1/D2 plusITSsequences placed this group within the Trichosporonbrassicae clade, but it was clearly separated from any known species. In addition, physiological tests showed that this group had the unusual property of the inability to hydrolyze urea, which was distinctly different from the related taxon. Therefore, Trichosporon heliocopridis sp. nov. (ex-type strainDD1-1T = TISTR 5946T = JCM 30786T = CBS 14168T) is proposed as a novel yeast species. The MycoBank number is MB812098.

  9. Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

    Science.gov (United States)

    Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

    2012-01-01

    Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

  10. Effect of cost-effective substrates on growth cycle and yield of lingzhi or reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes) from Northwestern Himalaya (India).

    Science.gov (United States)

    Mehta, Sheetal; Jandaik, Savita; Gupta, Dharmesh

    2014-01-01

    To find a cost-effective alternative substrate, the medicinal mushroom Ganoderma lucidum was grown on sawdusts of sheesham, mango, and poplar. Optimum spawn level was determined by spawning in substrates at various levels (1, 2, 3, and 4%). To determine the effect of supplementation, substrates were supplemented with wheat bran, rice bran and corn flour at different concentrations (10, 20, and 30%). Duration of growth cycle, mushroom yield, and biological efficiency data were recorded. Among substrates, mango sawdust was superior, with 1.5-fold higher yields than poplar sawdust, which was the least suitable. However with respect to fructification, mango sawdust produced the first primordia earlier (21±1 days) compared with the other investigated substrates. 3% spawn level was found to be optimal irrespective of the substrate. Yield and biological efficiency (BE) were maximally enhanced by supplementation with wheat bran, whereas rice bran was the least suitable supplement among those tested. Growth cycle shortened and mushroom yield increased to a maximum at the 20% level of supplements. Mango sawdust in combination with 20% wheat bran, if spawned at the 3% level, resulted in a high yield (BE = 58.57%).

  11. Bioinformatic Identification of Potential MicroRNAs and Their Targets in the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes).

    Science.gov (United States)

    Mu, Da-Shuai; Li, Chenyang; Shi, Liang; Zhang, Xuchen; Ren, Ang; Zhao, Ming-Wen

    2015-01-01

    MicroRNAs (miRNAs) are a class of small, endogenous, noncoding RNA molecules that negatively regulate gene expression at the transcriptional or the post-transcriptional level. Although a large number of miRNAs have been identified in many species, especially model plants and animals, miRNAs in fungi remain largely unknown. In this study, based on a database of expressed sequence tags in Ganoderma lucidum, 89 potential miRNAs were identified using computational methods. Real-time polymerase chain reaction analysis of miRNA-like samples prepared from G. lucidum at different development stages revealed that miRNA-like RNAs were differentially expressed in different stages. Furthermore, a total of 28 potential targets were found based on near-perfect or perfect complementarity between the randomly selected 9 miRNA-like RNAs and the target sequences, and potential targets for G. lucidum miRNA-like RNAs were predicted. Finally, we studied the expression pattern of 4 target genes in 3 different development stages of G. lucidum to further understand the mechanism of interaction between miRNA-like RNAs and their target genes. Our analysis paves the way toward identifying fungal miRNA-like RNAs that might be involved in various physiological and cellular differentiation processes.

  12. Methanolic soluble fractions of lingzhi or reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes) extract inhibit neuraminidase activity in Newcastle disease virus (LaSota).

    Science.gov (United States)

    Shamaki, Bala U; Sandabe, Umar K; Ogbe, Adamu O; Abdulrahman, Fanna I; El-Yuguda, Abdul-Dahiru

    2014-01-01

    The antineuraminidase activity of different organic soluble fractions of Ganoderma lucidum extract was investigated using inhibition of hemagglutination and elution of chicken erythrocytes by Newcastle disease virus (NDV). Fractions of methanol, ethylacetate, and normal butanol (n-butanol) of the G. lucidum were tested against neuraminidase producing NDV as antigen. Different dilutions of the organic soluble fractions inhibited elution of 1% red blood cells by neuraminidase of NDV While the methanolic and n-butanol extracts inhibited neuraminidase activity even at a dilution of 1:16 and that of ethylacetate fraction inhibited even at 1:32 respectively. This finding indicates that G. lucidum has some antineuraminidase activity against NDV and may be exploited in the management of NDV infection.

  13. Development of an expression plasmid and its use in genetic manipulation of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Yu, Xuya; Ji, Sen-Lin; He, Yi-Long; Ren, Meng-Fei; Xu, Jun-Wei

    2014-01-01

    We report the construction of a plasmid, pJW-EXP, designed for the expression of homologous and heterologous genes in Ganoderma lucidum. pJW-EXP was generated from the plasmid pMD19-T by inserting the G. lucidum glyceraldehyde-3-phosphate dehydrogenase gene promoter, the G. lucidum iron-sulfur protein subunit of succinate dehydrogenase gene terminator and the homologous carboxin-resistance gene as selection marker. This expression plasmid can be efficiently transformed into Ganoderma through polyethylene glycol-mediated protoplast transformation. Southern blot analysis showed that most of the integrated DNA appeared as multiple copies in the genome. The applicability of the constructed plasmid was tested by expression of the truncated G. lucidum 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene that encodes the catalytic domain of HMGR. Overexpression of the truncated HMGR gene, which is a key gene in the biosynthetic pathway of the antitumor compounds, ganoderic acids, increased the transcription of the HMGR gene and enhanced ganoderic acid accumulation. pJW-EXP can serve as a useful tool in the genetic improvement and metabolic engineering of Ganoderma.

  14. Enhanced Production of Polysaccharide Through the Overexpression of Homologous Uridine Diphosphate Glucose Pyrophosphorylase Gene in a Submerged Culture of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes).

    Science.gov (United States)

    Ji, Sen-Lin; Liu, Rui; Ren, Meng-Fei; Li, Huan-Jun; Xu, Jun-Wei

    2015-01-01

    This study aimed to improve polysaccharide production by engineering the biosynthetic pathway in Ganoderma lucidum through the overexpression of the homologous UDP glucose pyrophosphorylase (UGP) gene. The effects of UGP gene overexpression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production, and transcription levels of 3 genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), UGP, and α-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in G. lucidum overexpressing the UGP gene were 24.32 mg/100 mg dry weight and 1.66 g/L, respectively, which were higher by 42% and 36% than those of the wild-type strain. The transcription levels of PGM, UGP, and GLS were up-regulated by 1.6, 2.6, and 2.4-fold, respectively, in the engineered strain, suggesting that increased polysaccharide biosynthesis may result from a higher expression of those genes.

  15. Production of biomass and polysaccharides of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), by submerged cultivation.

    Science.gov (United States)

    Habijanic, Jozica; Berovic, Marin; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2013-01-01

    Submerged batch and repeated fed-batch cultivation techniques were used for mycelia cultivation and polysaccharide production of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum. Although most publications use various Asiatic G. lucidum strains, the growth of the strain Ga.l 4 (Biotechnical Faculty Strain Collection, Ljubljana, Slovenia), originally isolated from the Slovenian forest, is much faster. The results between the batch and repeated fed-batch cultivation are compared with the polysaccharide production in batch cultivation. From the aspect of biomass production, the best results were obtained in repeated fed-batch after 44 days, where 12.4 g/L of dry fungal biomass was obtained.

  16. Naturally occurring medicinal mushroom-derived antimicrobials: a case-study using Lingzhi or Reishi Ganoderma lucidum (W. Curt.:Fr.) P. Karst. (higher Basidiomycetes).

    Science.gov (United States)

    Karwa, Alka S; Rai, Mahendra K

    2012-01-01

    Antibacterial activity of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum, collected from Central India was evaluated against four bacterial pathogens. Ethyl alcohol and water extracts of fruit body powder were tested using the disc diffusion method against Staphylococcus aureus, Klebsiella pneumoniae, Bacillus cereus, and Pseudomonas aeruginosa. It was noted that the aqueous extract inhibited growth of pathogenic bacteria. The combined effect of fruit body extract with synthetic antibiotic discs was found to increase the activity significantly more than the antibiotics alone. The present study is an attempt to assess antibacterial activity of extracts of G. lucidum singly and in combination. The combination of G. lucidum with commercial antibiotics proves that it enhances antibacterial activity.

  17. Modulatory effect of crude aqueous extract of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes), on hematological and antioxidant indices in Plasmodium berghei-infected mice.

    Science.gov (United States)

    Oluba, Olarewaju M; Adebisi, Kayode E; Eidangbe, George O; Odutuga, Adewale A; Onyeneke, E Chukwu

    2014-01-01

    Hematological and antioxidant effects of the aqueous extract of fruiting bodies of Ganoderma lucidum were evaluated in Plasmodium berghei-infected mice. Extract was administered at doses of 100, 250, and 500 mg/kg body weight by an intragastric tube once daily for 14 d starting from the fourth day after parasite inoculation. At the end of treatment period, mice in each group were sacrificed and blood was collected for hematological and biochemical analyses. A significant (P<0.05) decrease was observed in serum malondialdehyde content with a corresponding significant (P<0.05) increase in superoxide dismutase, glutathione peroxidase, glutathione S-transferase, and glucose 6-phosphate dehydrogenase activities in the extract-treated groups compared to the infected but untreated group. The results obtained suggest that crude aqueous extract of G. lucidum fruiting bodies possesses potent antioxidant activity that protects hemoglobin against Plasmodium-induced oxidative damage. These findings seem to justify the use of the plant in traditional African and Chinese medicine as an anti-inflammatory and antimicrobial agent.

  18. In Vitro Assessment of Extracts of the Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Against Different Plant Pathogenic Fungi.

    Science.gov (United States)

    Baig, Mirza Nabeel; Shahid, Ahmad Ali; Ali, Muhammad

    2015-01-01

    Five isolates of the lingzhi or reishi medicinal mushroom Ganoderma lucidum (GL-1, GL-2, GL-3, GL-4, GL-5) were collected from different locations within and surrounding Lahore, Pakistan, to study the antifungal potential of their bioactive compounds. After studying morphology, different concentrations of the extracts were prepared in methanol and water using a Soxhlet extractor. Different cultures of fungal pathogens were acquired from the First Fungal Culture Bank of Pakistan, University of the Punjab, Lahore. The antimicrobial potential of 5 G. lucidum samples against 5 fungal pathogens (Fusarium oxysporum, Aspergillus niger, A. flavus, Penicillium sp., and Alternaria alternata) was observed. The lowest biomass reduction (7%) was observed in 1% and 2% concentrations of a methanolic extract and 6% in the case of a water extract. Major inhibition was observed using higher concentrations of the methanolic extract (3% and 4%). These extracts significantly suppressed fungal biomass up to 38% and 56% in A. niger, 47% in A. flavus, 58% in ,i>Penicillium sp., 46% in A. alternaria, and 45% in F. oxysporum compared with the control. It was concluded from these studies that methanolic extracts of G. lucidum showed better activity against all plant fungal pathogens when compared with the water extracts.

  19. Hepatoprotective effects of aqueous extract from Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher basidiomycetes) on α-amanitin-induced liver injury in mice.

    Science.gov (United States)

    Wu, Xin; Zeng, Jun; Hu, Jinsong; Liao, Qiong; Zhou, Rong; Zhang, Ping; Chen, Zuohong

    2013-01-01

    The Lingzhi or Reishi mushroom Ganoderma lucidum is a well-known traditional medicinal mushroom that has been shown to have obvious hepatoprotective effects. The aim of this study was to evaluate the hepatoprotective effects of G. lucidum aqueous extracts (GLEs) on liver injury induced by α-amanitin (α-AMA) in mice and to analyze the possible hepatoprotective mechanisms related to radical scavenging activity. Mice were treated with α-AMA prepared from Amanita exitialis and then administrated with GLE after the α-AMA injection. The hepatoprotective activity of the GLE was compared with the reference drug silibinin (SIL). α-AMA induced a significant elevation in serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities and provoked a significant reduction of superoxide dismutase (SOD) and catalase (CAT) activities and a significant increment of malondialdehyde (MDA) content in liver homogenate. Treatment with GLE or SIL significantly decreased serum ALT and AST levels, significantly increased SOD and CAT activities, and decreased MDA content in liver compared with the α-AMA control group. The histopathological examination of liver sections was consistent with that of biochemical parameters. The results demonstrated that GLE induces hepatoprotective effects on acute liver injury induced by α-AMA; these protective effects may be related in part to the antioxidant properties of GLE.

  20. Teratogenic and toxic effects of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt.:Fr.) P. Karst. (higher Basidiomycetes), on zebrafish embryo as model.

    Science.gov (United States)

    Dulay, Rich Milton R; Kalaw, Sofronio P; Reyes, Renato G; Alfonso, Noel F; Eguchi, Fumio

    2012-01-01

    This paper highlights the teratogenic and toxic effects of Ganoderma lucidum (Lingzhi or Reishi mushroom) extract on zebrafish embryos. Hatchability, malformations, and lethality rate of zebrafish embryos were assessed to provide valuable information regarding the potential teratogenic activity of G. lucidum. Hatching was completed 48 h post treatment application (hpta) at 1% or lower concentrations of extract and embryo water. The hatching rate of embryos treated with 5% or higher concentrations was significantly lower (p> 0.05) than the control. Tail malformation was the most marked morphological abnormality in embryos at 72 hpta, which was obviously caused by 1% extract (55.56% tail malformation) and was observed in all embryos exposed to 5% of extract. Growth retardation was evident in embryos exposed to 5%, 10%, and 20%. However, lethal effect of extract of G. lucidum was dependent on dose and time of exposure. Mortality rates of embryos treated with 5% (44.44%) or higher concentrations of the extract was significantly higher (p > 0.05) than that of the control embryos at 72 hpta. These results suggest that G. lucidum extract has lethal and sub-lethal effects on zebrafish embryos.

  1. Production of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), biomass and polysaccharides by solid state cultivation.

    Science.gov (United States)

    Berovic, Marin; Habijanic, Jozica; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2012-01-01

    Solid state cultivation of Ganoderma lucidum biomass, strain BFWS Gal 4, originally isolated from the Slovenian forest, was studied in a horizontal stirred tank reactor. Periodic mixing of N = 80 rpm, 2 min/day was used. Production of fungal polysaccharides and fungal biomass on solid substrate based on beech sawdust, olive oil, and mineral salts was studied. Optimal moisture of the solid matrix was in the range of 80% to 74%. When the moisture content dropped below 57%, the growth of the mycelium and polysaccharide production stopped, but it revived when wet air was applied in further processing. Final concentration of biomass was 0.68 mg/g of solid substrate, while proportions of extracellular and intracellular polysaccharides were 4.5 mg/g and 1.05 mg/g, respectively.

  2. Comparative growth characteristics and yield attributes of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (Higher Basidiomycetes) on different substrates in India.

    Science.gov (United States)

    Jandaik, Savita; Singh, Rajender; Sharma, Mamta

    2013-01-01

    The present study investigated the effects of four forestry byproducts (sawdust of oak, mango, khair, and tuni) and three agricultural residues (paddy straw, wheat straw, and soybean waste) along with four supplements (wheat bran, rice bran, corn flour, and gram powder) on growth characteristics (spawn run and primordial formation) and yield of Ganoderma lucidum. There were significant differences (P=0.05) in yield regardless of substrates and supplements used in experimentation. Among substrates, agriculture residues supported better yield and biological efficiency of G. lucidum compared to forestry byproducts irrespective of the supplements. The highest yield (82.5 g) and biological efficiency (27.5%) were recorded from paddy straw supplemented with wheat bran, which invariably resulted in significantly higher yield compared to the unsupplemented check(s) or other supplements used in this study.

  3. Isolation, purification, and immunological activities of a low-molecular-weight polysaccharide from the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Zhu, Lina; Luo, Xi; Tang, Qingjiu; Liu, Yanfang; Zhou, Shuai; Yang, Yan; Zhang, Jingsong

    2013-01-01

    To obtain a low-molecular-weight polysaccharide with immuno-enhancing activity, hot water extract of Ganoderma lucidum fruit bodies was separated by membrane ultrafiltration, anion exchange, and gel filtration chromatography, and the immunological activities of fractions were assessed on the basis of nitric oxide production by RAW 264.7 macrophages. A novel polysaccharide (TB3-2-2) was successfully isolated and purified. TB3-2-2 is a homogeneous polysaccharide, with a relative molecular weight of 5.11 × 103 Da, identified by high-performance liquid chromatography and was composed of galactose and glucose in a molar ratio of 2:3 determined by high-performance anion exchange chromatography. TB3-2-2 had a carbohydrate content of 99%, as measured using the phenol-sulfuric acid method. Proliferation of mouse spleen lymphocytes and the expression level of interleukin-6 was significantly increased by TB3-2-2. Results indicate that the low-molecular-weight polysaccharide with immunological activity in G. lucidum is worthy of further research and development.

  4. Evaluation of the antigenotoxic effects of the royal sun mushroom, agaricus brasiliensis (Higher basidiomycetes) in human lymphocytes treated with thymol in the comet assay

    NARCIS (Netherlands)

    Radaković, Milena; Stevanović, Jevrosima; Soković, Marina; Radović, Dejan; Griensven, Van Leo J.L.D.; Stanimirović, Zoran

    2015-01-01

    The aim of this investigation was to evaluate the possible protective activity of Agaricus brasiliensis (=A. blazei sensu Murrill) ethanol extract against thymol-induced DNA damage in human lymphocytes. Before we studied the possible interaction of thymol and A. brasiliensis extract, each compone

  5. Antiviral activity of Basidiomycete mycelia against influenza type A(serotype H1N1) and herpes simplex virus type 2 in cell culture

    Institute of Scientific and Technical Information of China (English)

    Tetiana; Krupodorova; Svetlana; Rybalko; Victor; Barshteyn

    2014-01-01

    In this study, we investigated the in vitro antiviral activity of the mycelia of higher mushrooms against influenza virus type A(serotype H1N1) and herpes simplex virus type 2(HSV-2), strain BH. All 10 investigated mushroom species inhibited the reproduction of influenza virus strain A/FM/1/47(H1N1) in MDCK cells reducing the infectious titer by 2.0–6.0 lg ID50. Four species, Pleurotus ostreatus, Fomes fomentarius, Auriporia aurea, and Trametes versicolor, were also determined to be effective against HSV-2 strain BH in RK-13 cells, with similar levels of inhibition as for influenza. For some of the investigated mushroom species—Pleurotus eryngii, Lyophyllum shimeji, and Flammulina velutipes—this is the first report of an anti-influenza effect. This study also reports the first data on the medicinal properties of A. aurea, including anti-influenza and antiherpetic activities. T. versicolor 353 mycelium was found to have a high therapeutic index(324.67), and may be a promising material for the pharmaceutical industry as an anti-influenza and antiherpetic agent with low toxicity. Mycelia with antiviral activity were obtained in our investigation by bioconversion of agricultural wastes(amaranth flour after CO2 extraction), which would reduce the cost of the final product and solve some ecological problems.

  6. Acción degradativa de hongos Basidiomycetes sobre residuos agroindustriales de cultivos de café y plátano

    OpenAIRE

    Rodríguez Núñez, Rafael

    2015-01-01

    Tesis (Magister en Microbiología y Biotecnología Industrial). Universidad Católica de Manizales.Instituto de Investigación en Microbiología y Biotecnología Agroindustrial, 2015 En Colombia, la caficultura y la producción de plátano corresponden a renglones agro industriales importantes, que generan grandes cantidades de residuos lignocelulosicos en su proceso de beneficio y de corte, durante la cosecha, respectivamente. En esta investigación, se llevó a cabo la producción deinoculantes y/...

  7. Developmental toxicity assessment of medicinal mushroom Antrodia cinnamomea T.T. Chang et W.N. Chou (higher Basidiomycetes) submerged culture mycelium in rats.

    Science.gov (United States)

    Chen, Tai-I; Chen, Chiao-Wen; Lin, Ting-Wei; Wang, Di-Sheng; Chen, Chin-Chu

    2011-01-01

    Antrodia cinnamomea is a Taiwanese medicinal mushroom with high antioxidant and polysaccharide content. The objective of this study is to investigate developmental toxicity of A. cinnamomea in pregnant Sprague-Dawley rats. Animals were daily gavaged with A. cinnamomea mycelium at dosage levels of 0 (reverse osmosis water), 50, 150, and 500 mg/kg from gestation day (GD) 6 to 15. All dams were sacrificed on GD 20 and were subjected to cesarean section. Fetuses were examined for external, visceral, and skeletal abnormalities. All copulated females survived until the end of the study. No significant differences were recorded in body weight change, food consumption, and maternal gestational parameters. Only two fetal malformations were noted in 970 fetuses from the treatment groups. Some variations, such as enlarged fontanel, split sternebrae, absent sacral, absent caudal vertebral centra, absent thoracic centra, absent 13th-14th ribs, and fused ribs, were found during the skeletal examination, but no treatment-induced abnormalities occurred. No dose dependency was observed in any of the developmental variations. Overall observation of foetal malformations from rats given A. cinnamomea mycelium during pregnancy demonstrates that this material is not teratogenic at doses up to 500 mg/kg. It is concluded that A. cinnamomea BCRC 35398 mycelium has no teratogenic effects in female rats and is safe to be used as a functional food ingredient.

  8. Investigation of antiproliferative effect of ether and ethanol extracts of birch polypore medicinal mushroom, Piptoporus betulinus (Bull.:Fr.) P. Karst. (higher Basidiomycetes) in vitro grown mycelium.

    Science.gov (United States)

    Cyranka, Małgorzata; Graz, Marcin; Kaczor, Jozef; Kandefer-Szerszeń, Martyna; Walczak, Katarzyna; Kapka-Skrzypczak, Lucyna; Rzeski, Wojciech

    2011-01-01

    This paper describes the study conducted to evaluate the antiproliferative activity of ether and ethanol extracts isolated from Piptoporus betulinus against cancer-derived cells. The fungal material used for extract preparation and further experiments was obtained from in vitro grown strains of P. betulinus. To the best of the authors’ knowledge, this is the first study evaluating antiproliferative potential of in vitro cultured birch polypore fungus. The effect of ether and ethanol extracts on cell proliferation, viability, and adhesion was assessed on colorectal adenocarcinoma cancer cell line LS180, whereas the cytotoxicity effect was investigated in normal colon epithelium-derived cell line CCD 841 CoTr. Studied extracts highly decreased the viability of cancer cells, slightly inhibiting proliferation and tumor cell adhesion in a time- and dose-dependent manner. Cytotoxicity of extracts against cells of normal colon epithelium origin was observed only at the highest studied concentration. The obtained results may seem interesting in comparison with previous studies on water extracts from natural grown P. betulinus. Future research on mycelial extract activity, as well as the content analysis, is needed.

  9. Antiviral activity of Basidiomycete mycelia against influenza type A (serotype H1N1) and herpes simplex virus type 2 in cell culture.

    Science.gov (United States)

    Krupodorova, Tetiana; Rybalko, Svetlana; Barshteyn, Victor

    2014-10-01

    In this study, we investigated the in vitro antiviral activity of the mycelia of higher mushrooms against influenza virus type A (serotype H1N1) and herpes simplex virus type 2 (HSV-2), strain BH. All 10 investigated mushroom species inhibited the reproduction of influenza virus strain A/FM/1/47 (H1N1) in MDCK cells reducing the infectious titer by 2.0-6.0 lg ID50. Four species, Pleurotus ostreatus, Fomes fomentarius, Auriporia aurea, and Trametes versicolor, were also determined to be effective against HSV-2 strain BH in RK-13 cells, with similar levels of inhibition as for influenza. For some of the investigated mushroom species-Pleurotus eryngii, Lyophyllum shimeji, and Flammulina velutipes-this is the first report of an anti-influenza effect. This study also reports the first data on the medicinal properties of A. aurea, including anti-influenza and antiherpetic activities. T. versicolor 353 mycelium was found to have a high therapeutic index (324.67), and may be a promising material for the pharmaceutical industry as an anti-influenza and antiherpetic agent with low toxicity. Mycelia with antiviral activity were obtained in our investigation by bioconversion of agricultural wastes (amaranth flour after CO2 extraction), which would reduce the cost of the final product and solve some ecological problems.

  10. Structural elucidation of novel bioactive compound (2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone from basidiomycetous fungus Lentinus squarrosulus

    Directory of Open Access Journals (Sweden)

    Usha N.

    2016-02-01

    Full Text Available While screening for bioactive compounds from macrofungi of Western Ghats of Karnataka, Lentinus squarrosulus a member of polyporaceae was collected and mycelium of the fungus was obtained on potato dextrose agar medium and cultured in a liquid medium (containing 2% glucose, 1% peptone and 2% yeast extract for 20 days on a rotary shaker for the production of secondary metabolites. The cell free culture fluid (100ml was subjected to solvent extraction with dichloromethane (100ml and the extract was evaluated for antimicrobial activity by agar diffusion method and cytotoxic activity of the extract was also determined by MTT and SRB assay on MCF7 cell line. The results revealed that the dichloromethane extract was inhibitory against Escherichia coli, Enterobacter aerogenes, Staphylococcus aureus and Bacillus subtilus and also fungi such as Aspergillus niger, Fusarium solani and Trichoderma harzianum. The extract showed 13-27% cell inhibition at 63-1000 µg/ml concentration by MTT and SRB assays on MCF7 cell line. The structural elucidation of the compound by spectroscopic NMR (1H and C13, IR and mass spectrometric analysis confirmed the presence of 2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone responsible for antimicrobial and cytotoxic activity.

  11. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  12. Acción degradativa de hongos Basidiomycetes sobre residuos agroindustriales de cultivos de café y plátano

    OpenAIRE

    Rodríguez Núñez, Rafael

    2015-01-01

    Tesis (Magister en Microbiología y Biotecnología Industrial). Universidad Católica de Manizales.Instituto de Investigación en Microbiología y Biotecnología Agroindustrial, 2015 En Colombia, la caficultura y la producción de plátano corresponden a renglones agro industriales importantes, que generan grandes cantidades de residuos lignocelulosicos en su proceso de beneficio y de corte, durante la cosecha, respectivamente. En esta investigación, se llevó a cabo la producción deinoculantes y/...

  13. Biochemical and milk-clotting properties and mapping of catalytic subsites of an extracellular aspartic peptidase from basidiomycete fungus Phanerochaete chrysosporium.

    Science.gov (United States)

    da Silva, Ronivaldo Rodrigues; de Oliveira, Lilian Caroline Gonçalves; Juliano, Maria Aparecida; Juliano, Luiz; de Oliveira, Arthur H C; Rosa, Jose C; Cabral, Hamilton

    2017-06-15

    For a long time, proteolytic enzymes have been employed as key tools of industrial processes, especially in the dairy industry. In the present work, we used Phanerochaete chrysosporium for biochemical characterization and analysis of catalytic specificity of an aspartic peptidase. Our results revealed an aspartic peptidase with molecular mass ∼38kDa, maximal activity at pH 4.5 and 50°C, and stability above 80% in the pH range of 3-8 and temperature up to 55°C for 1h. In a milk-clotting assay, this peptidase showed maximal milk clotting activity at 60-65°C and maintenance of enzymatic activity above 80% in the presence of 20mM CaCl2. In a specificity assay, we observed stronger restriction of catalysis at the S1 subsite, with a preference for lysine, arginine, leucine, tyrosine, and phenylalanine residues. The restricted proteolysis and milk-clotting potential are attractive properties for the use in cheese production. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Antioxidant and antiedema properties of solid-state cultured honey mushroom, Armillaria mellea (higher Basidiomycetes), extracts and their polysaccharide and polyphenol contents.

    Science.gov (United States)

    Lai, Min-Nan; Ng, Lean Teik

    2013-01-01

    Culinary-medicinal honey mushroom or Mi-Huan-Ku, Armillaria mellea (AM), is a popular ingredient in the traditional Chinese medicine for treating diseases of geriatric patients. This study aimed to examine the effect of cultured substrates on the mycelial growth of AM and evaluate its antioxidant and antiedema activities as well as its total polysaccharide and polyphenol contents. Results showed that AM grew best on the maize medium and worst on the potato medium. AM ethanol extract (AM-EtOH) showed stronger DPPH radical scavenging activity than AM aqueous extract (AM-H₂O). However, they were weak in metal chelation and reducing power. AM-EtOH but not AM-H₂O at 200 mg/kg showed antiedema activity in rats. The total β-glucan content of AM-H₂O and AM-EtOH was 21.95% and 3.50%, respectively. AM-EtOH showed higher phenol but lower flavonoid content than AM-H₂O. These results indicate that maize is a good source of substrate for mass production of AM mycelia, and its potency of DPPH radical scavenging and antiedema activities was contributed mainly by the phenolic compounds, not the level of polysaccharide content.

  15. Yield performance of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt.:Fr.) P. Karst. (higher Basidiomycetes), using different waste materials as substrates.

    Science.gov (United States)

    Azizi, Majid; Tavana, Maryam; Farsi, Mohammad; Oroojalian, Fatemeh

    2012-01-01

    In this research the effect of sawdust, malt extract, and wheat bran on yield, biological efficiency (BE), and mycelia growth of Ganoderma lucidum was investigated. Three kinds of sawdust (beech, poplar, and hornbeam) as basal medium were mixed with two levels of wheat bran (5% and 10% w/w) and malt extract (2.5% and 5% w/w) as medium supplement for production of G. lucidum in factorial experiments on the basis of completely randomized design with three replications. The results showed that various kinds of sawdust affect fruiting body yield, BE, and mycelia growth rate significantly. The highest fruiting body yield and BE (102.58 g/kg and 12.89%, respectively) were found using hornbeam sawdust. The beech sawdust promotes the mycelia growth rate more than other sawdust. Analysis of variance showed that there is a significant interaction between the sawdust type and wheat bran, sawdust type and malt extract, and wheat bran and malt extract as far as yield and BE of G. lucidum was concerned. A final comparison of the different formulae indicated that the best combinations for high yield (142.44 g/kg) and BE (18.68%) were obtained in a combination of poplar sawdust with 5% malt extract and 10% wheat bran. The highest mycelia growth rate (10.6 mm/day) was obtained in a combination of beech sawdust with 2.5% malt extract and 10% wheat bran.

  16. The genome of the white-rot fungus Pycnoporus cinnabarinus: a basidiomycete model with a versatile arsenal for lignocellulosic biomass breakdown

    NARCIS (Netherlands)

    Levasseur, Anthony; Lomascolo, Anne; Chabrol, Olivier; Ruiz-Dueñas, Francisco J; Boukhris-Uzan, Eva; Piumi, François; Kües, Ursula; Ram, Arthur F J; Murat, Claude; Haon, Mireille; Benoit, Isabelle; Arfi, Yonathan; Chevret, Didier; Drula, Elodie; Kwon, Min Jin; Gouret, Philippe; Lesage-Meessen, Laurence; Lombard, Vincent; Mariette, Jérôme; Noirot, Céline; Park, Joohae; Patyshakuliyeva, Aleksandrina; Sigoillot, Jean Claude; Wiebenga, A.; Wösten, Han A B; Martin, Francis; Coutinho, Pedro M; de Vries, Ronald P; Martínez, Angel T; Klopp, Christophe; Pontarotti, Pierre; Henrissat, Bernard; Record, Eric; van den Brink, J.

    2014-01-01

    BACKGROUND: Saprophytic filamentous fungi are ubiquitous micro-organisms that play an essential role in photosynthetic carbon recycling. The wood-decayer Pycnoporus cinnabarinus is a model fungus for the study of plant cell wall decomposition and is used for a number of applications in green and whi

  17. Effect of Selenium-Enriched Agaricus bisporus (Higher Basidiomycetes) Extracts, Obtained by Pressurized Water Extraction, on the Expression of Cholesterol Homeostasis Related Genes by Low-Density Array.

    Science.gov (United States)

    Gil-Ramírez, Alicia; Soler-Rivas, Cristina; Rodriguez-Casado, Arantxa; Ruiz-Rodríguez, Alejandro; Reglero, Guillermo; Marín, Francisco Ramón

    2015-01-01

    Culinary-medicinal mushrooms are able to lower blood cholesterol levels in animal models by different mechanisms. They might impair the endogenous cholesterol synthesis and exogenous cholesterol absorption during digestion. Mushroom extracts, obtained using pressurized water extractions (PWE) from Agaricus bisporus basidiomes, supplemented or not supplemented with selenium, were applied to HepG2 cell cultures to study the expression of 19 genes related to cholesterol homeostasis by low-density arrays (LDA). Only the PWE fractions obtained at 25°C showed 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) inhibitory activity. Besides the enzymatic inhibition, PWE extracts may downregulate some of the key genes involved in the cholesterol homeostasis, such as the squalene synthase gene (FDFT1), since its mRNA expression falls by one third of its initial value. In summary, A. bisporus extracts may also modulate biological cholesterol levels by molecular mechanisms further than the enzymatic way previously reported.

  18. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  19. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P ostreatus extracts compared with controls. Humoral immune investigation revealed higher immunoglobulin (total Ig, IgG, and IgM) titers against sheep red blood cells in treated groups compared with controls. However, nonsignificant (P > 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  20. Determination of Lovastatin, β-glucan, Total Polyphenols, and Antioxidant Activity in Raw and Processed Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lam, Yu Shan; Okello, Edward J

    2015-01-01

    The objective of this study was to quantify a number of bioactive compounds and antioxidant activity of the oyster mushroom, Pleurotus. Ostreatus, and characterize the effects of processing, such as blanching, on these outcomes. Dry matter content was 8%. Lovastatin was not detected in this study. β-glucan content of 23.9% and total polyphenol content of 487.12 mg gallic acid equivalent/100 g of dry matter were obtained in raw P. ostreatus. Antioxidant activities as evaluated by 1,1-diphenyl-2-picrylhydrazyl, Trolox equivalent antioxidant capacity, and ferric reducing antioxidant power assays in raw P. ostreatus were 14.46, 16.51, and 11.21 µmol/g, respectively. Blanching did not significantly affect β-glucan content but caused significant decrease in dry matter content, polyphenol content, and antioxidant activities. Mushroom rolls produced from blanched mushrooms and blanching water contained significantly higher amounts of β-glucan, total polyphenol content, and FRAP antioxidant activity compared to blanched mushrooms. In conclusion, P. ostreatus is a good source for β-glucan, dietary polyphenols, and antioxidants. Although the blanching process could affect these properties, re-addition of the blanching water during the production process of mushroom rolls could potentially recover these properties and is therefore recommended.

  1. Pleurotus opuntiae (Durieu et Lév.) Sacc. (higher Basidiomycetes) and other species related to Agave and Opuntia plants in Mexico-taxonomy, distribution, and applications.

    Science.gov (United States)

    Camacho, Marcelo; Guzmán, Gastón; Guzmán-Dávalos, Laura

    2012-01-01

    Pleurotus opuntiae is an important mushroom from xerophytic temperate regions of Mexico, as parasite or saprobe on Agave and Opuntia. Discussions on the taxonomic relationships of P opuntiae with P djamor, P. agaves, P. levis, and P. yuccae are presented, of which P. agaves is a synonym of P. opuntiae, and P. yuccae is a synonym of P. djamor. This latter and P levis are close species of P. opuntiae. The traditional uses of P opuntiae and P. djamor as food and remedy for several health problems, and also to get a traditional alcoholic drink from the Agave, are also considered.

  2. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of th

  3. Systematics of the anamorphic basidiomycetous yeast genus Trichosporon Behrend with the description of the five novel species: Trichosporon vadense, T. smithiae, T. dehoogii, T. scarabaeorum and T. gamsii

    NARCIS (Netherlands)

    Middelhoven, W.J.; Scorzetti, G.; Fell, J.W.

    2004-01-01

    Phylogenetic trees of the anamorphic basichomycetous yeast genus Trichosporon Behrend, based on molecular sequence analysis of the internal transcribed spacer region and the D1/D2 region of the large subunit of ribosomal (26S) DNA, are presented. This study includes three novel species from soils, T

  4. Trichosporon porosum comb. nov., an anarmorphoc basidiomycetous yeast inhabiting soil, related to the loubieri/laibachii group of species that assimilate hemicelluloses and phenolic compounds

    NARCIS (Netherlands)

    Middelhoven, W.J.; Scorzetti, G.; Fell, J.W.

    2001-01-01

    Several isolates representing the genus Trichosporon were collected over a 6-year period from soils in The Netherlands. Based on classical growth tests with carbon and nitrogen compounds these were identical. Three of these (CBS 8396, CBS 8397 and CBS 8522) were subjected to molecular analysis of th

  5. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologically resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds.

    Science.gov (United States)

    Middelhoven, Wouter J

    2005-02-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of the D1D2 region of the large subunit (26S) and of the ITS region of ribosomal DNA showed relationship to the Bulleromyces clade of the genus Cryptococcus (order Tremellales) with some Tremella spp. as the closest relatives. A traditional morphological and physiological description of the strain is given. Data on the assimilation of some C2 compounds and polysaccharides are provided and compared with those of other type strains of novel species of the C. laurentii complex.

  6. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    OpenAIRE

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of the D1D2 region of the large subunit (26S) and of the ITS region of ribosomal DNA showed relationship to the Bulleromyces clade of the genus Cryptococcus (order Tremellales) with some Tremella spp. a...

  7. The genome of the white-rot fungus Pycnoporus cinnabarinus: a basidiomycete model with a versatile arsenal for lignocellulosic biomass breakdown

    NARCIS (Netherlands)

    Levasseur, Anthony; Lomascolo, Anne; Chabrol, Olivier; Ruiz-Dueñas, Francisco J; Boukhris-Uzan, Eva; Piumi, François; Kües, Ursula; Ram, Arthur F J; Murat, Claude; Haon, Mireille; Benoit, Isabelle; Arfi, Yonathan; Chevret, Didier; Drula, Elodie; Kwon, Min Jin; Gouret, Philippe; Lesage-Meessen, Laurence; Lombard, Vincent; Mariette, Jérôme; Noirot, Céline; Park, Joohae; Patyshakuliyeva, Aleksandrina; Sigoillot, Jean Claude; Wiebenga, A.; Wösten, Han A B; Martin, Francis; Coutinho, Pedro M; de Vries, Ronald P; Martínez, Angel T; Klopp, Christophe; Pontarotti, Pierre; Henrissat, Bernard; Record, Eric; van den Brink, J.

    2014-01-01

    BACKGROUND: Saprophytic filamentous fungi are ubiquitous micro-organisms that play an essential role in photosynthetic carbon recycling. The wood-decayer Pycnoporus cinnabarinus is a model fungus for the study of plant cell wall decomposition and is used for a number of applications in green and whi

  8. The genome of the white-rot fungus Pycnoporus cinnabarinus : a basidiomycete model with a versatile arsenal for lignocellulosic biomass breakdown

    NARCIS (Netherlands)

    Levasseur, Anthony; Lomascolo, Anne; Chabrol, Olivier; Ruiz-Dueñas, Francisco J; Boukhris-Uzan, Eva; Piumi, François; Kües, Ursula; Ram, Arthur F J; Murat, Claude; Haon, Mireille; Benoit, Isabelle|info:eu-repo/dai/nl/314410023; Arfi, Yonathan; Chevret, Didier; Drula, Elodie; Kwon, Min Jin; Gouret, Philippe; Lesage-Meessen, Laurence; Lombard, Vincent; Mariette, Jérôme; Noirot, Céline; Park, Joohae; Patyshakuliyeva, Aleksandrina; Sigoillot, Jean Claude; Wiebenga, Ad|info:eu-repo/dai/nl/314110763; Wösten, Han A B; Martin, Francis; Coutinho, Pedro M; de Vries, Ronald P|info:eu-repo/dai/nl/186324960; Martínez, Angel T; Klopp, Christophe; Pontarotti, Pierre; Henrissat, Bernard; Record, Eric; Wosten, Han|info:eu-repo/dai/nl/120693186

    2014-01-01

    BACKGROUND: Saprophytic filamentous fungi are ubiquitous micro-organisms that play an essential role in photosynthetic carbon recycling. The wood-decayer Pycnoporus cinnabarinus is a model fungus for the study of plant cell wall decomposition and is used for a number of applications in green and whi

  9. Comparative analysis of the secretomes of Schizophyllum commune and other wood-decay basidiomycetes during solid-state fermentation reveals its unique lignocellulose-degrading enzyme system.

    Science.gov (United States)

    Zhu, Ning; Liu, Jiawen; Yang, Jinshui; Lin, Yujian; Yang, Yi; Ji, Lei; Li, Meng; Yuan, Hongli

    2016-01-01

    The genome of Schizophyllum commune encodes a diverse repertoire of degradative enzymes for plant cell wall breakdown. Recent comparative genomics study suggests that this wood decayer likely has a mode of biodegradation distinct from the well-established white-rot/brown-rot models. However, much about the extracellular enzyme system secreted by S. commune during lignocellulose deconstruction remains unknown and the underlying mechanism is poorly understood. In this study, extracellular proteins of S. commune colonizing Jerusalem artichoke stalk were analyzed and compared with those of two white-rot fungi Phanerochaete chrysosporium and Ceriporiopsis subvermispora and a brown-rot fungus Gloeophyllum trabeum. Under solid-state fermentation (SSF) conditions, S. commune displayed considerably higher levels of hydrolytic enzyme activities in comparison with those of P. chrysosporium, C. subvermispora and G. trabeum. During biodegradation process, this fungus modified the lignin polymer in a way which was consistent with a hydroxyl radical attack, similar to that of G. trabeum. The crude enzyme cocktail derived from S. commune demonstrated superior performance over a commercial enzyme preparation from Trichoderma longibrachiatum in the hydrolysis of pretreated lignocellulosic biomass at low enzyme loadings. Secretomic analysis revealed that compared with three other fungi, this species produced a higher diversity of carbohydrate-degrading enzymes, especially hemicellulases and pectinases acting on polysaccharide backbones and side chains, and a larger set of enzymes potentially supporting the generation of hydroxyl radicals. In addition, multiple non-hydrolytic proteins implicated in enhancing polysaccharide accessibility were identified in the S. commune secretome, including lytic polysaccharide monooxygenases (LPMOs) and expansin-like proteins. Plant lignocellulose degradation by S. commune involves a hydroxyl radical-mediated mechanism for lignocellulose modification in parallel with the synergistic system of various polysaccharide-degrading enzymes. Furthermore, the complex enzyme system of S. commune holds significant potential for application in biomass saccharification. These discoveries will help unveil the diversity of natural lignocellulose-degrading mechanisms, and advance the design of more efficient enzyme mixtures for the deconstruction of lignocellulosic feedstocks.

  10. Effect of Introns and AT-Rich Sequences on Expression of the Bacterial Hygromycin B Resistance Gene in the Basidiomycete Schizophyllum commune

    Science.gov (United States)

    Scholtmeijer, Karin; Wösten, Han A. B.; Springer, Jan; Wessels, Joseph G. H.

    2001-01-01

    Previously, it was shown that introns are required for efficient mRNA accumulation in Schizophyllum commune and that the presence of AT-rich sequences in the coding region of genes can result in truncation of transcripts in this homobasidiomycete. Here we show that intron-dependent mRNA accumulation and truncation of transcripts are two independent events that both affect expression of the bacterial hygromycin B resistance gene in S. commune. PMID:11133486

  11. The genome of the white-rot fungus Pycnoporus cinnabarinus : a basidiomycete model with a versatile arsenal for lignocellulosic biomass breakdown

    NARCIS (Netherlands)

    Levasseur, Anthony; Lomascolo, Anne; Chabrol, Olivier; Ruiz-Dueñas, Francisco J; Boukhris-Uzan, Eva; Piumi, François; Kües, Ursula; Ram, Arthur F J; Murat, Claude; Haon, Mireille; Benoit, Isabelle; Arfi, Yonathan; Chevret, Didier; Drula, Elodie; Kwon, Min Jin; Gouret, Philippe; Lesage-Meessen, Laurence; Lombard, Vincent; Mariette, Jérôme; Noirot, Céline; Park, Joohae; Patyshakuliyeva, Aleksandrina; Sigoillot, Jean Claude; Wiebenga, Ad; Wösten, Han A B; Martin, Francis; Coutinho, Pedro M; de Vries, Ronald P; Martínez, Angel T; Klopp, Christophe; Pontarotti, Pierre; Henrissat, Bernard; Record, Eric; Wosten, Han

    2014-01-01

    BACKGROUND: Saprophytic filamentous fungi are ubiquitous micro-organisms that play an essential role in photosynthetic carbon recycling. The wood-decayer Pycnoporus cinnabarinus is a model fungus for the study of plant cell wall decomposition and is used for a number of applications in green and whi

  12. A New Hydroxyl Acetylenic Fatty Acid from the Basidiomycete Craterellus aureus(Cantharellaceae)%金黄喇叭菌中一个新的炔酸化合物

    Institute of Scientific and Technical Information of China (English)

    蒋孟圆; 王飞; 董泽军; 张漪; 朱华结; 刘吉开

    2008-01-01

    从担子菌金黄喇叭菌(CratereUus aureus)子实体中分离到3个炔酸类化合物,其中-个为新化合物,其化学结构通过波谱学方法和量子化学计算鉴定为(8E,10R,14Z)-10-羟基-8,14-十八碳二烯-12-炔酸(1).%A new hydroxyl acetylenic acid, named(8E,10R,14Z)-10-hydroxy-8,14-octadecadien-12-ynoic acid(1),together with two known compounds(2,3),were isolated from the ethanol extract of the fruiting bodies of Craterellus au-res. Their structures were established by spectroscopic methods(1D-and 2D-NMR experiments). The absolute configura-tion of 1 was determined to be R by computational calculation of optical rotation.

  13. EFFECT OF DIFFERENT CULTURE CONDITIONS AND INDUCERS ON PRODUCTION OF LACCASE BY A BASIDIOMYCETE FUNGAL ISOLATE PLEUROTUS OSTREATUS HP-1 UNDER SOLID STATE FERMENTATION

    Directory of Open Access Journals (Sweden)

    Hardik Patel

    2009-02-01

    Full Text Available The production of laccase by an indigenous strain of Pleurotus ostreatus HP-1 was studied on solid state fermentation. Culture parameters such as type and concentration of substrate, inoculum size, moisture content, pH, surfactant presence, temperature, and nitrogen source were optimized by conventional “one factor at a time” methodology. A maximum laccase yield of 3952 U g-1 of dry substrate optimized was obtained with wheat straw as substrate with five agar plugs as the inoculum, 60% moisture content, pH 5.0, surfactant concentration 0.015 gl-1, and nitrogen source (combination of L-asparagine and NH4NO3 at 10 mM concentration each at incubation temperature 28oC. Enhancement in laccase activity was achieved with the use of various aromatic inducers and copper sulphate. Highest laccase activity of 14189 U g-1 of dry substrate was achieved using 0.28 mM copper sulphate under optimized conditions. Thus, the indigenous isolate seems to be a potential producer of laccase using SSF and can be exploited for further biotechnological applications. The process also promises economic utilization and value addition of agro-residues.

  14. Macrofungi diversity in cork-oak and holm-oak Woodlands in Alentejo (Southern Portugal)

    OpenAIRE

    Santos-Silva,Celeste; Louro, Rogério

    2011-01-01

    With the purpose of contributing to a better knowledge of the Portuguese mycota, a compilation study of the macrofungal diversity of cork-oak and holm-oak woodlands (montado/dehesas) of Alentejo, Southern Portugal was made. This work is based on a series of macrofungi surveys, carried out by the authors, between 2005 and 2011, in six representative sites. Taxonomy and nomenclature follows Kirk et al. (2001) and Kirk (2004-2011). Current species distribution was consulted in: online intern...

  15. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  16. 国际学术期刊数据库使用现状的中美比较——以中山大学与加州大学的Wiley-Blackwell期刊库为例%Empirical Research on the Use of International Academic Journal Database Between China and America——Taking Sun Yat-sen University and University of California's Wiley-Blackwell Journal Database as Example

    Institute of Scientific and Technical Information of China (English)

    汤罡辉; 王元

    2011-01-01

    为了解国际学术期刊库在使用过程中的中关差别,选择中山大学与美国加州大学所使用的Wiley-Black-well期刊库为研究对象,分别比较了访问次数、全文次数、核心需求刊物分布与稳定性、高影响因子刊物使用量、各学科主题刊物使用量、投入费用合理性等方面的使用情况.通过实证比较,可为出版商、图书馆、读者提供参考作用.

  17. Optimization of the Yield of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes), Cultivated on a Sunflower Seed Hull Substrate Produced in Argentina: Effect of Olive Oil and Copper.

    Science.gov (United States)

    Bidegain, Maximiliano A; Cubitto, Maria Amelia; Curvetto, Nestor Raul

    2015-01-01

    Sunflower seed hulls were used as the main component of a solid substrate for the cultivation of the lingzhi or reishi medicinal mushroom Ganoderma lucidum. This study evaluated the effects of supplementing the substrate with olive oil and copper (II) on the mushroom production (MP) parameters and fruiting body total triterpenoid content. The addition of 1.5% olive oil increased total MP by 21.7% (dry basis) in 3 flushes. Copper (60 ppm) increased the daily productivity of the first flush (MP per day) by both reducing the time needed to harvest the crop and increasing the MP. However, the MP at the second and third flushes was reduced. When both supplements were combined, the MP at the first flush was 43% higher than with control treatment. No significant change in mushroom total triterpenoid content was observed by the addition of supplements to the substrate. An increase of 145-155% in the mushroom copper content was obtained by the addition of 60 ppm copper to the substrate. It is thus recommended to use substrate formulations containing both olive oil and copper (II) and harvest just the first flush.

  18. Simple and Reproducible Two-Stage Agitation Speed Control Strategy for Enhanced Triterpene Production by Lingzhi or Reishi Medicinal Mushrooms, Ganoderma lucidum ACCC G0119 (Higher Basidiomycetes) Based on Submerged Liquid Fermentation.

    Science.gov (United States)

    Feng, Jie; Feng, Na; Yang, Yan; Liu, Fang; Zhang, Jingsong; Jia, Wei; Lin, Chi-Chung

    2015-01-01

    Triterpenes are important anticancer agents produced by batch submerged liquid fermentation, with the medicinal mushroom Ganoderma lucidum ACCC G0119, which was investigated under various dissolved oxygen levels by varying agitation speeds. Three kinetic parameters were analyzed: specific mycelial growth rate (μsmg), specific glucose consumption rate (qsgc), and specific triterpene production rate (qstp). High concentration, yield, and productivity of triterpenes were achieved by developing a simple and reproducible two-stage agitation speed control strategy. At the first 40 h, agitation speed was controlled at 150 rpm to obtain the quickest peak qstp for triterpene production, subsequently agitation speed was controlled at 100 rpm to maintain high qstp for high triterpene accumulation. The maximum concentration of triterpenes reached 0.086 g/l with the yield of 6.072 g/kg and the productivity of 6.532 × 10-4 g/(l·h), which were 39.61%, 36.48%, and 49.22%, respectively, better than the best results controlled by fixed agitation speeds. Conceivably, such a triterpene fermentation production strategy would be useful for industrial large-scale production of triterpenes with G. lucidum.

  19. Inhibition of quorum sensing in the opportunistic pathogenic bacterium Chromobacterium violaceum by an extract from fruiting bodies of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt.:Fr.) P. Karst. (higher Basidiomycetes).

    Science.gov (United States)

    Zhu, Hu; Liu, Wei; Tian, Baozhen; Liu, Huijun; Ning, Shoujiao

    2011-01-01

    Extracts of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum, inhibited quorum sensing in Chromobacterium violaceum CV026. G. lucidum fruiting bodies were milled and extracted with ethyl acetate. The crude extract was dissolved in an appropriate concentration of methanol, sterilized by filtration through a 0.22-μm membrane filter, and added to Ch. Violaceum CV026 cultures, which were used as an indicator to monitor quorum sensing inhibition. Inhibitory activity was measured by quantifying violacein production using a microplate reader. Methanol-soluble compounds extracted from G. lucidum significantly inhibited quorum sensing-controlled behavior in Ch. Violaceum in a concentration-dependent manner. The results suggest that compounds in G. lucidum might be useful to control and handle detrimental infections caused by human, animal, and plant pathogens. Further studies are in progress in our lab to isolate the specific compounds from G. lucidum extract, evaluate them as quorum sensing inhibitors, and analyze their mechanism of action.

  20. Determination of the antioxidant activity and polyphenol contents of wild Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. Fr.) P. Karst. (higher Basidiomycetes) from central Himalayan hills of India.

    Science.gov (United States)

    Mohsin, Mohammed; Negi, P; Ahmed, Z

    2011-01-01

    The antioxidant potential of wild strain of Lingzhi or Reishi medicinal mushroom Ganoderma lucidum from Central Himalayan Hills (2000 m MSL) was evaluated, and compared with its in vitro cultured mycelia grown on malt extract broth in the laboratory. Antioxidant activities of both wild and cultivated G. lucidum in terms of IC₅₀ (mg/ mL) were determined against different in vitro radical systems such as DPPH (1, 1-diphenyl-2-picrylhydrazyl), ABTS [2,2'-azinobis (3-ethylenebenzothiazoline-6-sulphonic acid)] and hydroxyl radicals, in addition to ferric reducing antioxidant power assay. Polyphenol contents were also determined, in order to assess their effects on the antioxidant activity of extracts. All the extracts showed significant antioxidant activity, and maximum scavenging was observed in the case of methanolic extracts of wild G. lucidum with minimum IC50 values 0.953 ± 0.040, 0.690 ± 0.014 and 3.295 ± 0.027 mg/mL, respectively, for DPPH, ABTS, and hydroxyl radicals. The efficacy of wild G. lucidum as a rich source of natural antioxidant was established for nutraceutical development.

  1. Evaluation of Anticonvulsant, Antidepressant-, and Anxiolytic-like Effects of an Aqueous Extract from Cultured Mycelia of the Lingzhi or Reishi Medicinal Mushroom Ganoderma lucidum (Higher Basidiomycetes) in Mice.

    Science.gov (United States)

    Socala, Katarzyna; Nieoczym, Dorota; Grzywnowicz, Krzysztof; Stefaniuk, Dawid; Wlaz, Piotr

    2015-01-01

    Ganoderma lucidum is a well-known medicinal mushroom with a long history of use. This study was designed to assess the anticonvulsant potential of an aqueous extract from cultured G. lucidum mycelium in 3 acute seizure models: timed intravenous pentylenetetrazole infusion, maximal electroshock seizure threshold, and 6-Hz-induced psychomotor seizure tests in mice. Moreover, antidepressant-like and anxiolytic-like effects of G. lucidum were evaluated using the forced swim test and the elevated plus maze test in mice, respectively. No changes in seizure thresholds in the intravenous pentylenetetrazole and maximal electroshock seizure threshold tests after acute treatment with G. lucidum extract (200-600 mg/kg) was observed. However, the studied extract (100-400 mg/kg) significantly increased the threshold for psychomotor seizures in the 6-Hz seizure test. In the forced swim test, G. lucidum (100-400 mg/kg) significantly reduced the duration of immobility. No anxiolytic-like or sedative effects were reported in mice pretreated with the extract (400-600 mg/kg). G. lucidum extract (50-2400 mg/kg) did not produce toxic effects in the chimney test (motor coordination) or grip-strength test (neuromuscular strength). Further studies are required to explain the neuropharmacological effects of G. lucidum and to identify its active ingredients that may affect seizure threshold, mood, or anxiety.

  2. The cloning, characterization, and functional analysis of a gene encoding an isopentenyl diphosphate isomerase involved in triterpene biosynthesis in the Lingzhi or reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Wu, Feng-Li; Shi, Liang; Yao, Jian; Ren, Ang; Zhou, Chao; Mu, Da-Shuai; Zhao, Ming-Wen

    2013-01-01

    An isopentenyl diphosphate isomerase (IDI) gene, GlIDI, was isolated from Ganoderma lucidum, which produces triterpenes through the mevalonate pathway. The open reading frame of GlIDI encodes a 252 amino acid polypeptide with a theoretical molecular mass of 28.71 kDa and a theoretical isoelectric point of 5.36. GlIDI is highly homologous to other fungal IDIs and contains conserved active residues and nudix motifs shared by the IDI protein family. The color complementation assay indicated that GlIDI can accelerate the accumulation of β-carotene and confirmed that the cloned complementary DNA encoded a functional GlIDI protein. Gene expression analysis showed that the GlIDI transcription level was relatively low in the mycelia and reached a relatively high level in the mushroom primordia. In addition, its expression level could be up-regulated by 254 µM methyl jasmonate. Our results suggest that this enzyme may play an important role in triterpene biosynthesis.

  3. Preliminary results of determination of chemical changes on Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt.:Fr.)P. Karst. (higher Basidiomycetes) carried by Shenzhou I spaceship with FTIR and 2D-IR correlation spectroscopy.

    Science.gov (United States)

    Choong, Yew Keong; Chen, Xiangdong; Jamal, Jamia Azdina; Wang, Qiuying; Lan, Jin

    2012-01-01

    Spaceflight represents a complex environmental condition. Space mutagenesis breeding has achieved marked results over the years. The objective of this study is to determine the chemical changes in medicinal mushroom Ganoderma lucidum cultivated after spaceflight in 1999. Fourier transform infrared (FTIR) and two-dimensional infrared (2DIR) correlation spectroscopy were used in analysis. The sample Sx and its control Cx showed the least dissimilarities in one-dimensional FTIR spectra, but absorbance of Sx is twice as high as Cx. Sx presented a clear peak at 1648 cm in 2nd derivative spectra, which could not be detected in the Cx. The 2DIR spectra showed the intensity of Sx in the range 1800-1400 cm-1 for protein is higher than the control. The sample Sx produced some carbohydrate peaks in the area of 889 cm-1 compared with the Cx. The spaceflight set up an extreme condition and caused changes of chemical properties in G. lucidum strain.

  4. Production of biomass, polysaccharides, and ganoderic acid using non-conventional carbon sources under submerged culture of the Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt.:Fr.)P. Karst. (higher Basidiomycetes).

    Science.gov (United States)

    Zapata, Paola; Rojas, Diego; Atehortúa, Lucía

    2012-01-01

    The effect of different non-conventional carbon sources was studied in the submerged culture of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum, for simultaneous production of mycelial biomass, bioactive ganoderic acid, and polysaccharides, in less time, using non-conventional carbon sources to minimize the high costs of current culture media. The optimal medium composition was defined as (g/L): 50 of barley flour, 0.2 of KH2PO4, 0.1 of MgSO4ⁱ7H2O, and 1 NH4Cl. Cultivated under this complex culture medium, the mycelial biomass production was 23.49 ± 0.37 g/L; the extracellular polysaccharides production was 2.72 ± 0.11 g/L; the intracellular polysaccharides production was 2.22 ± 0.06 g/L; the ganoderic acids production was 299.67 ± 11.63 mg/L. One liter of culture medium developed in this project was priced at USD $ 0.11 if barley flour is used as carbon source or $ 0.13 with oat flour in order to get a good amount of products of interest.

  5. Antimalarial and hepatoprotective effects of crude ethanolic extract of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt.:Fr.)P.Karst. (higher Basidiomycetes), in Plasmodium berghei-infected mice.

    Science.gov (United States)

    Oluba, Olarewaju M; Olusola, Augustine O; Fagbohunka, Bamidele S; Onyeneke, E

    2012-01-01

    This study was aimed at investigating the in vivo antimalarial activity (using some biochemical indices) of crude aqueous extracts of the fruiting bodies of Ganoderma lucidum, a mushroom with well-established medicinal properties. A rodent malaria parasite, Plasmodium berghei (1 × 107), was inoculated intraperitoneally into Swiss albino mice. The test groups were administered G. lucidum extract and chloroquine (CQ, as standard drug), while the control groups were administered the same amount of distilled water by an intragastric tube once daily. The antimalarial activity of the extract was investigated from the suppressive, curative, and prophylactic effects of the extract on parasite growth. Serum aminotransferases (AST and ALT), alkaline phosphatase (ALP), and gamma glutamine transpeptidase (γ-GT) levels monitored following the 4-day suppressive test were significantly reduced, with a corresponding significant increase in the livers of mice treated with the extract compared with infected untreated mice. The results obtained from this study provide scientific justification in an animal model of malaria that an ethanolic extract of G. lucidum possesses potent antimalarial activity and also could help ameliorate the attendant Plasmodium-induced liver damage due to malarial infection.

  6. Production of Ginkgo leaf-shaped basidiocarps of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes), containing high levels of α- and β-D-glucan and ganoderic acid A.

    Science.gov (United States)

    Yajima, Yuka; Miyazaki, Minoru; Okita, Noriyasu; Hoshino, Tamotsu

    2013-01-01

    Ganoderic acid A and α- and β-D-glucan content were compared among morphologically different basidiocarps of the medicinal mushroom Ganoderma lucidum. Ginkgo leaf-shaped basidiocarps gradually hardened from the base to the pileus and accumulated a higher amount of bioactive components than normal (kidney-shaped) and antler/deer horn-shaped basidiocarps. In the normal G. lucidum stipe, the outer context contained the highest amount of α- and β-D-glucan (approximately 55%) and the highest amount of ganoderic acid A (approximately 0.3%). Ginkgo leaf-shaped G. lucidum had a large area of outer layer and stout outer context, which contributed to their high α- and β-D-glucan and ganoderic acid A content.

  7. Lion's Mane, Hericium erinaceus and Tiger Milk, Lignosus rhinocerotis (Higher Basidiomycetes) Medicinal Mushrooms Stimulate Neurite Outgrowth in Dissociated Cells of Brain, Spinal Cord, and Retina: An In Vitro Study.

    Science.gov (United States)

    Samberkar, Snehlata; Gandhi, Sivasangkary; Naidu, Murali; Wong, Kah-Hui; Raman, Jegadeesh; Sabaratnam, Vikineswary

    2015-01-01

    Neurodegenerative disease is defined as a deterioration of the nervous system in the intellectual and cognitive capabilities. Statistics show that more than 80-90 million individuals age 65 and above in 2050 may be affected by neurodegenerative conditions like Alzheimer's and Parkinson's disease. Studies have shown that out of 2000 different types of edible and/or medicinal mushrooms, only a few countable mushrooms have been selected until now for neurohealth activity. Hericium erinaceus is one of the well-established medicinal mushrooms for neuronal health. It has been documented for its regenerative capability in peripheral nerve. Another mushroom used as traditional medicine is Lignosus rhinocerotis, which has been used for various illnesses. It has been documented for its neurite outgrowth potential in PC12 cells. Based on the regenerative capabilities of both the mushrooms, priority was given to select them for our study. The aim of this study was to investigate the potential of H. erinaceus and L. rhinocerotis to stimulate neurite outgrowth in dissociated cells of brain, spinal cord, and retina from chick embryo when compared to brain derived neurotrophic factor (BDNF). Neurite outgrowth activity was confirmed by the immu-nofluorescence method in all tissue samples. Treatment with different concentrations of extracts resulted in neuronal differentiation and neuronal elongation. H. erinaceus extract at 50 µg/mL triggered neurite outgrowth at 20.47%, 22.47%, and 21.70% in brain, spinal cord, and retinal cells. L. rhinocerotis sclerotium extract at 50 µg/mL induced maximum neurite outgrowth of 20.77% and 24.73% in brain and spinal cord, whereas 20.77% of neurite outgrowth was observed in retinal cells at 25 µg/mL, respectively.

  8. The influence of the hot water extract from shiitake medicinal mushroom, Lentinus edodes (higher Basidiomycetes) on the food intake, life span, and age-related locomotor activity of Drosophila melanogaster.

    Science.gov (United States)

    Matjuskova, Natalya; Azena, Elena; Serstnova, Ksenija; Muiznieks, Indrikis

    2014-01-01

    Shiitake medicinal mushroom, Lentinus edodes, is among the most widely cultivated edible mushrooms in the world and is a well-studied source of nutrients and biologically active compounds. We have studied the influence of the dietary supplement of the polysaccharides containing a hot water extract of the mushroom L. edodes on the fruit fly Drosophila melanogaster in terms of food intake, body weight, life span, and age-related locomotor activity. L. edodes extract, when added to the D. melanogaster feeding substrate at a 0.003-0.030% concentration (calculated for the dry weight of the polysaccharide fraction) did not influence food intake or body weight of the flies. It increased the life span and locomotor activities of male flies but was associated with early mortality and decreased locomotor activity of female flies. We conclude that the observed anti-aging effects of L. edodes extracts in the male D. melanogaster are not the result of dietary restriction. We propose that D. melanogaster is a suitable model organism for researching the molecular basis of the anti-aging effect of the shiitake mushroom extracts and sex linkage of these effects.

  9. Study of the combined effect of temperature, pH and water activity on the radial growth rate of the white-rot basidiomycete Physisporinus vitreus by using a hyphal growth model

    CERN Document Server

    Fuhr, M J; Schubert, M; Schwarze, F W M R; Herrmann, H J

    2011-01-01

    The present work investigates environmental effects on the growth of fungal colonies of P. vitreus by using a lattice-free discrete modelling approach called FGM (Fuhr et al. (2010), arXiv:1101.1747), in which hyphae and nutrients are considered as discrete structures. A discrete modelling approach allows studying the underlying mechanistic rule concerning the basic architecture and dynamic of fungal networks on the scale of a single colony. By comparing simulations of the FGM with laboratory experiments of growing fungal colonies on malt extract agar we show that combined effect of temperature, pH and water activity on the radial growth rate of a fungal colony on a macroscopic scale may be explained by a power law for the growth costs of hyphal expansion on a microscopic scale. The information about the response of the fungal mycelium on a microscopic scale to environmental conditions is essential to simulate its behavior in complex structure substrates such as wood, where the impact of the fungus to the woo...

  10. Influence of olive oil press cakes on Shiitake culinary-medicinal mushroom, lentinus edodes (Berk.) singer (higher basidiomycetes) fruiting bodies production and effect of their crude polysaccharides on CCRF-CEM cell proliferation.

    Science.gov (United States)

    Gregori, Andrej; Kretschmer, Nadine; Wagner, Susanne; Boechzelt, Herbert; Klinar, Dusan; Bauer, Rudolf; Pohleven, Franc

    2012-01-01

    Lentinus edodes (Berk.) Singer fruiting bodies were cultivated on substrates composed of beech sawdust, wheat bran, and calcium sulfate hemihydrate (gypsum), containing different proportions of olive oil press cakes (OOPC). We determined the influence of OOPC on fruiting bodies production and proliferation of CCRF-CEM leukemia cells. A negative influence of OOPC on mycelia growth and maturation was noticed. When growth medium contained 80% OOPC, fruiting bodies ceased forming. To investigate the cytotoxicity on CCRF-CEM cells in vitro, cells were treated with crude polysaccharides extracted from L. edodes fruiting bodies. Also in this case a negative correlation between OOPC content and cytotoxicity was found.

  11. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    OpenAIRE

    Marcos José Correia; José Antônio de Sousa Pereira Junior; Jefferson Cunha dos Santos; Maria Auxiliadora de Queiroz Cavalcanti

    1998-01-01

    A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR) in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved t...

  12. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  13. Enhancement of antioxidant properties and increase of content of vitamin D2 and non-volatile components in fresh button mushroom, Agaricus bisporus (higher Basidiomycetes) by γ-irradiation.

    Science.gov (United States)

    Tsai, Shu-Yao; Mau, Jeng-Leun; Huang, Shih-Jeng

    2014-01-01

    Agaricus bisporus is a popular culinary-medicinal mushroom in Taiwan, and γ-irradiation could extend its shelf life. Our objective was to study the content of vitamin D2 and the taste components and antioxidant properties of ethanolic extracts from A. bisporus with various doses of γ-irradiation. After irradiation, the vitamin D2 content of 5-10 kGy irradiated mushrooms was in the range of 5.22-7.90 µg/g, higher than that of the unirradiated control (2.24 µg/g). For all treatments, the total content of soluble sugars and polyols ranged from 113 to 142 mg/g, and the monosodium glutamate-like components ranged from 6.57 to 13.50 mg/g, among which the 2.5 kGy irradiated sample has the highest content of flavor 5'-nucleotide. About antioxidant properties, 10 kGy irradiated samples exhibited lower EC50 values than did other samples. EC50 values were less than 5 mg/mL for ethanolic extracts. Total phenols were the major antioxidant components and the total content was 13.24-22.78 mg gallic acid equivalents/g. Based on the results obtained, γ-irradiation could be used to improve the vitamin D2 content and intensity of umami taste in fresh mushrooms. In addition, γ-irradiation not only maintained the antioxidant properties of mushrooms but also enhanced the antioxidant properties to some extent.

  14. Laccase production by the aquatic ascomycete Phoma sp. UHH 5-1-03 and the white rot basidiomycete Pleurotus ostreatus DSM 1833 during submerged cultivation on banana peels and enzyme applicability for the removal of endocrine-disrupting chemicals.

    Science.gov (United States)

    Libardi, Nelson; Gern, Regina Maria Miranda; Furlan, Sandra Aparecida; Schlosser, Dietmar

    2012-07-01

    This work aimed to study the production of laccase from Pleurotus ostreatus DSM 1833 and Phoma sp. UHH 5-1-03 using banana peels as alternative carbon source, the subsequent partial purification and characterization of the enzyme, as well the applicability to degrade endocrine disruptors. The laccase stability with pH and temperature, the optimum pH, the K (m) and V(max) parameters, and the molar mass were determined. Tests were conducted for assessing the ability of degradation of the endocrine disruptors t-nonylphenol, bisphenol A, and 17α-ethinylestradiol. Laccase production of 752 and 1,117 U L⁻¹ was obtained for Phoma sp. and P. ostreatus, respectively. Phoma sp. laccase showed higher stability with temperature and pH. The laccase from both species showed higher affinity by syringaldazine. The culture broth with banana peels induced the production of two isoforms of P. ostreatus (58.7 and 21 kDa) and one of Phoma sp. laccase (72 kDa). In the first day of incubation, the concentrations of bisphenol A and 17α-ethinylestradiol were reduced to values close to zero and after 3 days the concentration of t-nonylphenol was reduced in 90% by the P. ostreatus laccase, but there was no reduction in its concentration by the Phoma sp. laccase.

  15. Screening and fermentation conditions of β-glucanase producing strain from basidiomycetes by multiple mutagensis%β-葡聚糖酶担子菌种复合诱变选育及发酵条件研究

    Institute of Scientific and Technical Information of China (English)

    李蕤; 张洁; 蔡敬民; 吴克; 阚劲松

    2011-01-01

    用平板透明圈法对高温平菇(Pleurotus ostreatus)、金针菇(Flammulina velutipes)、香菇(Lentinus edodes)等担子菌菌种进行筛选.选取高温平菇作为诱变出发菌株进行复合诱变处理并进行初筛.选取透明圈半径与菌落半径比值较大的菌株接种至发酵培养基进行复筛.最终筛选出一株产β-葡聚糖酶能力较强的高温平菇突变菌株P32,并进行产酶条件的优化.结果表明:最佳碳源比为麸皮∶β-葡聚糖∶麦秸粉=9∶1∶1,氮源为4 g/L (NH4)2CO3,起始pH值5.0,培养温度32℃.该菌株在优化条件下产β-葡聚糖酶的能力最强,酶活力达到60.08 IU/mL.%Pleurotus ostreatus, Flam mulina velutipes and Lentinus edodes and so on , were screened by transparent zonesm ethod . Pleurotus ostreatus as initial strain was treated by multiple mutagensis and then the mutants with the bigger ratio of transparent zones radius to colony radius were chosen for further screening . At last, the Pleurotus ostreatus P32 producing high β-glucanase activity was obtained . The results showed that the optinum carbon sources were bran , β-gjucan and barley straw powder in the ratio of 9:1:1 ; the optinum nitrogen source was 4g/L (N H4 )2 CO3; the optinum initial pH and temperature were pH 5 .0 and 32℃ , respectively . Under the optimized conditions, the β-glucanase ability of Pleurotus ostreatus P32 reached as high as 60 .08 IU /m L .

  16. DNA-based identification of Lentinula edodes strains with species ...

    African Journals Online (AJOL)

    phe

    2016-02-17

    Feb 17, 2016 ... spore bearing Basidiomycetes possessing separate hyphae. Specific ... nutritionally important fungal reference strains, Oyster (Pleurotus ostreatus), Maitake (Grifola .... into Petri plates under a sterilized laminar hood.

  17. Bioactive Triterpenes from the Fungus Piptoporus betulinus

    National Research Council Canada - National Science Library

    Zeyad Alresly; Ulrike Lindequist; Michael Lalk; Andrea Porzel; Norbert Arnold; Ludger AWessjohann

    2016-01-01

      Phytochemical investigation of the ethyl acetate extract of the fruiting bodies from the basidiomycete Piptoporus betulinus led to the isolation of a new bioactive lanostane triterpene identified...

  18. Uusi raamatuid : a companion to the history of the book

    Index Scriptorium Estoniae

    2010-01-01

    Tutvustus: A companion to the history of the book / edited by Simon Eliot and Jonathan Rose. - Malden, MA : Blackwell Pub., 2007. - xvi, 599 lk. : ill. - (Blackwell companions to literature and culture ; 48)

  19. Organizational Behaviour in Construction

    DEFF Research Database (Denmark)

    Kreiner, Kristian

    2013-01-01

    Review of: Organizational Behaviour in Construction / Anthony Walker (Wiley-Blackwell,2011 336 pp)......Review of: Organizational Behaviour in Construction / Anthony Walker (Wiley-Blackwell,2011 336 pp)...

  20. Uusi raamatuid : a companion to the history of the book

    Index Scriptorium Estoniae

    2010-01-01

    Tutvustus: A companion to the history of the book / edited by Simon Eliot and Jonathan Rose. - Malden, MA : Blackwell Pub., 2007. - xvi, 599 lk. : ill. - (Blackwell companions to literature and culture ; 48)

  1. A new representative of star-shaped fungi: Astraeus sirindhorniae sp. nov. from Thailand.

    Directory of Open Access Journals (Sweden)

    Cherdchai Phosri

    Full Text Available Phu Khieo Wildlife Sanctuary (PKWS is a major hotspot of biological diversity in Thailand but its fungal diversity has not been thouroughly explored. A two-year macrofungal study of this remote locality has resulted in the recognition of a new species of a star-shaped gasteroid fungus in the genus Astraeus. This fungus has been identified based on a morphological approach and the molecular study of five loci (LSU nrDNA, 5.8S nrDNA, RPB1, RPB2 and EF1-a. Multigene phylogenetic analysis of this new species places it basal relative to other Astraeus, providing additional evidence for the SE Asian origin of the genus. The fungus is named in honour of Her Majesty Princess Sirindhorn on the occasion the 84th birthday of her father, who have both been supportive of natural heritage studies in Thailand.

  2. Metabolite proving fungal cleavage of the aromatic core part of a fluoroquinolone antibiotic

    National Research Council Canada - National Science Library

    Wetzstein, Heinz-Georg; Schneider, Josef; Karl, Wolfgang

    2012-01-01

    Liquid cultures of the basidiomycetous fungus Gloeophyllum striatum were employed to study the biodegradation of pradofloxacin, a new veterinary fluoroquinolone antibiotic carrying a CN group at position C-8...

  3. Effect of cultivation conditions on growth and antifungal activity of ...

    African Journals Online (AJOL)

    Administrator

    Growth and production of antifungal agent by Mycena leptocephala was investigated in ... plus glucose were used as carbon source and yeast extract was used as nitrogen source. .... basidiomycetes from wood – A review Int. Biodeterio. Bull.

  4. Medicinal mushrooms

    NARCIS (Netherlands)

    Gargano, Maria Letizia; Griensven, van Leo J.L.D.; Isikhuemhen, Omoanghe S.; Lindequist, Ulrike; Venturella, Giuseppe; Wasser, Solomon P.; Zervakis, Georgios I.

    2017-01-01

    Higher Basidiomycetes and Ascomycetes mushrooms possess various immunological and anticancer properties. They also offer important health benefits and exhibit a broad spectrum of pharmacological activities including antibacterial, antifungal, antiviral, cytotoxic, immunomodulating,

  5. Effects of gamma radiation on enzymatic production of lignolytic ...

    African Journals Online (AJOL)

    ajl Mike

    2015-02-18

    Feb 18, 2015 ... of gamma radiation increased the production of enzymes by filamentous fungi compared to tests ... Many microorganisms have been investigated in relation ..... basidiomycetes isolated from compost: role of laccases and.

  6. Further observations on Sporotrichum and some similar fungi

    NARCIS (Netherlands)

    Arx, von J.A.

    1973-01-01

    Sporotrichum azureum Wright & v. Arx, isolated from wood in Argentina, is described and illustrated. The relationship of the genus Sporotrichum with Ptychogaster is discussed, both may represent conidial states of basidiomycetes ( Tyromyces, Oligoporus).

  7. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  8. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  9. Role of manganese and veratryl alcohol in the ligninolytic system of bjerkandera sp. strain BOS55.

    NARCIS (Netherlands)

    Mester, T.

    1998-01-01

    IntroductionLignin is a three dimensional hydrophobic plant polymer derived from the random coupling of phenylpropanoid precursors. The chemical and physical characteristics of lignin require a nonspecific, extracellular oxidative process for biodegradation. White rot basidiomycetes

  10. The higher fungi of Amchitka and Adak Islands, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Fruiting body collections of higher fungi, basidiomycetes and ascomycetes, were made during a twelve day field study on two of Alaska's Aleutian Islands, Amchitka...

  11. Some endophytes of Juncus trifidus from Tatra Mts. in Poland

    Directory of Open Access Journals (Sweden)

    Andrzej Chlebicki

    2013-12-01

    Full Text Available This is a first part of work devoted highland rush endophytes: Penicillium expansum, Cladosporium oxysporum, Arthrinium state of Apiospora montagnei and Aureobasidium pullulans. The basidiomycete strain, possibly Lagarobasidium detriticum was also isolated.

  12. Calnexin overexpression increases manganese peroxidase production in Aspergillus niger

    NARCIS (Netherlands)

    Conesa, A.; Jeenes, D.; Archer, D.B.; Hondel, C.A.M.J.J. van den; Punt, P.J.

    2002-01-01

    Heme-containing peroxidases from white rot basidiomycetes, in contrast to most proteins of fungal origin, are poorly produced in industrial filamentous fungal strains. Factors limiting peroxidase production are believed to operate at the posttranslational level. In particular, insufficient

  13. Calnexin overexpression increases manganese peroxidase production in Aspergillus niger

    NARCIS (Netherlands)

    Conesa, A.; Jeenes, D.; Archer, D.B.; Hondel, C.A.M.J.J. van den; Punt, P.J.

    2002-01-01

    Heme-containing peroxidases from white rot basidiomycetes, in contrast to most proteins of fungal origin, are poorly produced in industrial filamentous fungal strains. Factors limiting peroxidase production are believed to operate at the posttranslational level. In particular, insufficient availabil

  14. Cultivation of Agaricus bisporus on some compost formulas and ...

    African Journals Online (AJOL)

    SERVER

    2007-10-04

    Oct 4, 2007 ... the basidiomycete fungus Agaricus bisporus are pro- duced in large ... selective and pathogen free substrate (Randle and. Hayes, 1972 ..... Development of mushroom cultivation techniques in Eastern Black Sea Region of.

  15. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    NARCIS (Netherlands)

    Fernandez-Fueyo, E.; Ruiz-Duenas, F.J.; Ferreira, P.; Floudas, D.; Hibbett, D.S.; Canessa, P.; Larrondo, L.F.; James, T.Y.; Seelenfreund, D.; Lobos, S.; Polanco, R.; Tello, M.; Honda, Y.; Watanabe, T.; Ryu, J.S.; Kubicek, C.P.; Schmoll, M.; Gaskell, J.; Hammel, K.E.; St John, F.J.; Vanden Wymelenberg, A.; Sabat, G.; Splinter BonDurant, S.; Syed, K.; Yadav, J.S.; Doddapaneni, H.; Subramanian, V.; Lavin, J.L.; Oguiza, J.A.; Perez, G.; Pisabarro, A.G.; Ramirez, L.; Santoyo, F.; Master, E.; Coutinho, P.M.; Henrissat, B.; Lombard, V.; Magnuson, J.K.; Kues, U.; Hori, C.; Igarashi, K.; Samejima, M.; Held, B.W.; Barry, K.W.; LaButti, K.M.; Lapidus, A.; Lindquist, E.A.; Lucas, S.M.; Riley, R.; Salamov, A.A.; Hoffmeister, D.; Schwenk, D.; Hadar, Y.; Yarden, O.; de Vries, R.P.; Wiebenga, A.; Stenlid, J.; Eastwood, D.; Grigoriev, I.V.; Berka, R.M.; Blanchette, R.A.; Kersten, P.; Martinez, A.T.; Vicuna, R.; Cullen, D.

    2012-01-01

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do

  16. Optimized protein extraction methods for proteomic analysis of Rhizoctonia solani

    Science.gov (United States)

    Rhizoctonia solani (Teleomorph: Thanatephorus cucumeris) is a basidiomycetous fungus which includes important plant pathogens, saprophytes and mycorrhizae. R. solani displays several hyphal anastomosis groups (AGs) with distinct host plant specializations. In order to facilitate studies on its biol...

  17. Molecular characterization of Cryptococcus gattii genotype AFLP6/VGII isolated from woody debris of divi-divi (Caesalpinia coriaria), Bonaire, Dutch Caribbean

    NARCIS (Netherlands)

    Hagen, F.; Chowdhary, A.; Prakash, A.; Yntema, J.B.; Meis, J.F.G.M.

    2014-01-01

    BACKGROUND: The basidiomycetous yeast Cryptococcus gattii is an emerging and primary pathogen. There is a lack of information about its environmental spread outside outbreak regions in Mediterranean Europe, North and South America. Environmental sampling for C. gattii and molecular characterization

  18. The role of natural chlorinated hydroquinone metabolites in ligninolytic fungi

    NARCIS (Netherlands)

    Teunissen, P.J.M.

    1999-01-01

    Ligninolytic Basidiomycetes have been reported to produce a wide variety of chloroaromatic compounds as secondary metabolites, which are structurally similar to environmental pollutants. Among these are chlorinated hydroquinone metabolites (CHM), such as 2-chloro-1,4-dimethoxybenzene

  19. Basidiomycosis: a review of the literature Basidiomicoses: revisão da literatura

    OpenAIRE

    Carlos da Silva Lacaz; Elisabeth Maria Heins-Vaccari; Natalina Takashi de Melo; Giovanna Letícia Hernandez-Arriagada

    1996-01-01

    The basidiomycosis, fungal infections provoked by basidiomycetes or agaric fungi have been recorded at growing frequencies in the medical literature, especially after the advent of AIDS in 1991. The basidiospores of these fungi, scattered in the atmosphere and transported by winds or air currents, reach the maxillary sinuses through the nasal route, most of the times causing signs and symptoms of chronic sinusitis. Basidiomycetes have also been isolated from sputum, especially Schizophyllum c...

  20. Deterioration of Eucalyptus spp. wood by xylophagous fungi

    Directory of Open Access Journals (Sweden)

    Luciana Ferreira da Silva

    2014-09-01

    Full Text Available This research aimed to test the deteriorating ability of fungi isolated from Eucalyptus spp. wood and perform chemical analysis of wood deteriorated, to verify which components of wood suffered major changes in the light of the attack. The experiment was conducted in the Laboratório de Biodeterioração da Madeira, Departamento de Ciências Florestais e da Madeira, Centro de Ciências Agrárias, Universidade Federal do Espírito Santo in the municipality of Jerônimo Monteiro, ES, Brazil. A total of 12 fungi were used, and nine of these came from pure cultures isolated from fragments of stumps of eucalypt woods deteriorated, collected in three distinct locations, and three with recognized capacity of deterioration that were used as the standard of comparison. The Basidiomycetous fungi 1 and 2 showed high capacity of deterioration of Eucalyptus spp. The heartwood of eucalypt showed a greater natural resistance than the sapwood, but the fungi were able to degrade both them. In general, there were, an increase in the content of extractives in wood damaged (heartwood and sapwood, for Basidiomycetous 1 and Basidiomycetous 2. The heartwood of Eucalyptus grandis there was a decrease in extractives content for both Basidiomycetes. To the holocelulose (cellulose and hemicelluloses, there were small differences between the healthy and damaged wood (mean variations around 1 %. The Fungi, Basidiomycetous 2 caused a greater degradation of lignin as compared to the Basidiomycetous 1.

  1. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Assimilation of Unusual Carbon Compounds

    Science.gov (United States)

    Middelhoven, Wouter J.

    Yeast taxa traditionally are distinguished by growth tests on several sugars and organic acids. During the last decades it became apparent that many yeast species assimilate a much greater variety of naturally occurring carbon compounds as sole source of carbon and energy. These abilities are indicative of a greater role of yeasts in the carbon cycle than previously assumed. Especially in acidic soils and other habitats, yeasts may play a role in the degradation of carbon compounds. Such compounds include purines like uric acid and adenine, aliphatic amines, diamines and hydroxyamines, phenolics and other benzene compounds and polysaccharides. Assimilation of purines and amines is a feature of many ascomycetes and basidiomycetes. However, benzene compounds are degraded by only a few ascomycetous yeasts (e.g. the Stephanoascus/ Blastobotrys clade and black yeastlike fungi) but by many basidiomycetes, e.g. Filobasidiales, Trichosporonales, red yeasts producing ballistoconidia and related species, but not by Tremellales. Assimilation of polysaccharides is wide-spread among basidiomycetes

  3. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O’Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  4. Patterns of Early Christian Thinking and Writing of History

    DEFF Research Database (Denmark)

    Becker, Eve-Marie

    2016-01-01

    reprint of article, published in: "Thinking, Recording, and Writing History in the Ancient World", ed. by K. A. Raaflaub, Wiley-Blackwell 2014, pages: 276-296.......reprint of article, published in: "Thinking, Recording, and Writing History in the Ancient World", ed. by K. A. Raaflaub, Wiley-Blackwell 2014, pages: 276-296....

  5. A preliminary checklist of macrofungi of Guatemala, with notes on edibility and traditional knowledge

    Directory of Open Access Journals (Sweden)

    Flores Arzú R

    2012-01-01

    Full Text Available Despite its biological wealth, current knowledge on the macromycetes inhabiting Guatemala is scant, in part because of the prolonged civil war that has prevented exploration of many ecological niches. We provide a preliminary literature–based checklist of the macrofungi occuring in the various ecological regions of Guatemala, supplemented with original observations reported here for the first time. Three hundred and fifty species, 163 genera, and 20 orders in the Ascomycota and Basidiomycota have been reported from Guatemala. Many of the entries pertain to ectomycorrhizal fungal species that live in symbiosis with the several Pinus and Quercus species that form the extensive pine and mixed forests of the highlands (up to 3600 m a.s.l.. As part of an ongoing study of the ethnomycology of the Maya populations in the Guatemalan highlands, we also report on the traditional knowledge about macrofungi and their uses among native people. These preliminary data confirm the impression that Guatemala hosts a macrofungal diversity that is by no means smaller than that recorded in better studied neighboring Mesoamerican areas, such as Mexico and Costa Rica.

  6. Phylogenetic position and physiology of Cerinosterus cyanescens

    NARCIS (Netherlands)

    Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.

    2000-01-01

    Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

  7. Evolutionary history of the sequestrate genus Rossbeevera (Boletaceae) reveals a new genus Turmalinea and highlights the utility of ITS minisatellite-like insertions for molecular identification

    NARCIS (Netherlands)

    Orihara, T.; Lebel, T.; Ge, Z.-W.; Smith, M.E.; Maekawa, N.

    2016-01-01

    The sequestrate (truffle-like) basidiomycete genera Rossbeevera, Chamonixia, and Octaviania are closely related to the epigeous mushroom genera Leccinum and Leccinellum. In order to elucidate the properties and placement of several undescribed sequestrate taxa in the group and to reveal the evolutio

  8. Puccinia coronata f. sp. avenae: a threat to global oat production

    Science.gov (United States)

    Puccinia coronata f. sp. avenae causes crown rust disease in cultivated and wild oat. The significant yield losses inflicted by this pathogen makes crown rust the most devastating disease in the oat industry. P. coronata f. sp. avenae is a basidiomycete fungus with an obligate biotrophic lifestyle a...

  9. Environ: E00815 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00815 Maitake Medicinal herb 1,3-beta-D-Glucan [CPD:C00965], Protein [CPD:C00017],...-beta-D-Glucan [CPD:C00965] Medicinal herbs [BR:br08322] Fungi Basidiomycetes E00815 Maitake ...

  10. Identification and Characterization of Small Noncoding RNAs in Genome Sequences of the Edible Fungus Pleurotus ostreatus

    Science.gov (United States)

    Zhao, Mengran; Hsiang, Tom; Feng, Xiaoxing

    2016-01-01

    Noncoding RNAs (ncRNAs) have been identified in many fungi. However, no genome-scale identification of ncRNAs has been inventoried for basidiomycetes. In this research, we detected 254 small noncoding RNAs (sncRNAs) in a genome assembly of an isolate (CCEF00389) of Pleurotus ostreatus, which is a widely cultivated edible basidiomycetous fungus worldwide. The identified sncRNAs include snRNAs, snoRNAs, tRNAs, and miRNAs. SnRNA U1 was not found in CCEF00389 genome assembly and some other basidiomycetous genomes by BLASTn. This implies that if snRNA U1 of basidiomycetes exists, it has a sequence that varies significantly from other organisms. By analyzing the distribution of sncRNA loci, we found that snRNAs and most tRNAs (88.6%) were located in pseudo-UTR regions, while miRNAs are commonly found in introns. To analyze the evolutionary conservation of the sncRNAs in P. ostreatus, we aligned all 254 sncRNAs to the genome assemblies of some other Agaricomycotina fungi. The results suggest that most sncRNAs (77.56%) were highly conserved in P. ostreatus, and 20% were conserved in Agaricomycotina fungi. These findings indicate that most sncRNAs of P. ostreatus were not conserved across Agaricomycotina fungi. PMID:27703969

  11. 秀珍菇高产优质栽培技术%High Yield and High Quality Planting Technology of Pleurotus geesteranus

    Institute of Scientific and Technical Information of China (English)

    李宇伟; 连瑞丽; 王新民; 王志强

    2009-01-01

    @@ 秀珍菇(Pleurotus geesteranus Singer.),又名袖珍菇、环柄侧耳、黄白侧耳、环柄斗菇、姬平菇和小平菇,隶属担子菌纲(Basidiomycetes)、伞菌目(Agaricals)、侧耳科(Pleurotaceae.)、侧耳属(Pleurotus) [1-2].

  12. Trichlorinated phenols from Hypholoma elongatum.

    NARCIS (Netherlands)

    Swarts, H.J.; Verhagen, F.J.M.; Field, J.A.; Wijnberg, J.B.P.A.

    1998-01-01

    Three trichlorinated phenols, 2,4,6-trichloro-3-methoxyphenol, 3,5,6-trichloro-2,4-dimethoxyphenol and 3,4,6-trichloro-2,5-dimethoxyphenol, were detected as novel metabolites in the ethyl acetate extract from the culture medium of the Basidiomycete, Hypholoma elongatum (strain WIJS94-28).

  13. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

    2010-01-01

    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass amounts—3.8

  14. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  15. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    NARCIS (Netherlands)

    Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.

    2007-01-01

    Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species divide

  16. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    NARCIS (Netherlands)

    Aanen, D.K.; Ros, V.I.D.; Licht, H.H.D.; Mitchel, J.; de Beer, Z.W.; Slippers, B.; Rouland-LeFevre, C.; Boomsma, J.J.

    2007-01-01

    Background: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species divid

  17. Levels of specificity of Xylaria species associated with fungus-growing termites: a phylogenetic approach

    NARCIS (Netherlands)

    Visser, A.A.; Ros, V.I.D.; Beer, de Z.W.; Debets, A.J.M.; Hartog, E.; Kuyper, T.W.; Laessoe, T.; Slippers, B.; Aanen, D.K.

    2009-01-01

    Fungus-growing termites live in obligate mutualistic symbiosis with species of the basidiomycete genus Termitomyces, which are cultivated on a substrate of dead plant material. When the termite colony dies, or when nest material is incubated without termites in the laboratory, fruiting bodies of the

  18. Novel Phialophora species from leaf-cutting ants (tribe Attini)

    NARCIS (Netherlands)

    Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.

    2014-01-01

    Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

  19. Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879

    NARCIS (Netherlands)

    Triana, Sergio; González, Andrés; Ohm, Robin A|info:eu-repo/dai/nl/304837628; Wosten, Han|info:eu-repo/dai/nl/120693186; de Cock, Hans|info:eu-repo/dai/nl/087737116; Restrepo, Silvia; Celis, Adriana

    2015-01-01

    Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia

  20. Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879.

    Science.gov (United States)

    Triana, Sergio; González, Andrés; Ohm, Robin A; Wösten, Han A B; de Cock, Hans; Restrepo, Silvia; Celis, Adriana

    2015-10-15

    Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. Copyright © 2015 Triana et al.

  1. Bibliography

    NARCIS (Netherlands)

    NN,

    1961-01-01

    Agnihothrudu, V.: A new genus of the helicosporous Basidiomycetes (from North-East India) (Fungi) (Trans. Brit. Myc. Soc. 44, 1961, 51-54, 1 fig.). Ahmad, S.: Further contributions to the Fungi of West Pakistan 1 (Biologia 6, 1960, 117-136, 17 fig.).

  2. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Science.gov (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  3. Long-term maintenance of fungal cultures on perlite in cryovials - an alternative for agar slants.

    Science.gov (United States)

    Homolka, L; Lisá, L

    2008-01-01

    Cultures of 33 basidiomycete strains out of 35 tested were viable with unchanged characteristics after four years of maintenance on perlite in cryovials. These cultures can be a good substitute for agar cultures in long-term maintenance of fungi. For comparison, the storage under oil was evaluated but it turned out to be unsuitable for the majority of our cultures.

  4. Improving ruminal degradability of oil palm fronds using white rot fungi

    NARCIS (Netherlands)

    Rahman, M.M.; Lourenco, M.; Hassim, H.A.; Baars, J.J.P.; Sonnenberg, A.S.M.; Cone, J.W.; Boever, de J.L.; Fievez, V.

    2011-01-01

    The use of oil palm fronds (OPF) in livestock production is limited as up to 0.20 of their dry biomass is lignin. White rot fungi (WRF) are very effective basidiomycetes for biological pre-treatment as they degrade lignin extensively. Ten WRF were screened for their potential to increase OPF digesti

  5. Fungal Systematics and Evolution: FUSE 2

    NARCIS (Netherlands)

    Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.

    2016-01-01

    The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature Ze

  6. Temporal Alterations in the Secretome of the Selective Ligninolytic Fungus Ceriporipsis subvermispora during growth on Aspen Wood Reveal this Organism's Strategy for Degrading Lighnocellulose

    Science.gov (United States)

    Chiaki Hori; Jill Gaskell; Kiyohiko Igarashi; Phil Kersten; Michael Mozuch; Masahiro Samejima; Dan Cullen

    2014-01-01

    The white-rot basidiomycetes efficiently degrade all wood cell wall polymers. Generally, these fungi simultaneously degrade cellulose and lignin, but certain organisms, such as Ceriporiopsis subvermispora, selectively remove lignin in advance of cellulose degradation. However, relatively little is known about themechanismof selective ligninolysis. To...

  7. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    DEFF Research Database (Denmark)

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter

    2010-01-01

    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

  8. INSOLUBLE HYDROPHOBIN COMPLEXES IN THE WALLS OF SCHIZOPHYLLUM-COMMUNE AND OTHER FILAMENTOUS FUNGI

    NARCIS (Netherlands)

    DEVRIES, OMH; FEKKES, MP; WOSTEN, HAB; WESSELS, JGH

    Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted

  9. Draft Genome Sequence of Ustilago trichophora RK089, a Promising Malic Acid Producer

    Science.gov (United States)

    Zambanini, Thiemo; Buescher, Joerg M.; Meurer, Guido; Blank, Lars M.

    2016-01-01

    The basidiomycetous smut fungus Ustilago trichophora RK089 produces malate from glycerol. De novo genome sequencing revealed a 20.7-Mbp genome (301 gap-closed contigs, 246 scaffolds). A comparison to the genome of Ustilago maydis 521 revealed all essential genes for malate production from glycerol contributing to metabolic engineering for improving malate production. PMID:27469969

  10. Genome and secretome analysis of the hemibiotrophic fungal pathogen, Moniliophthora roreri, which causes frosty pod rot disease of cacao: mechanisms of the biotrophic and necrotrophic phases

    Science.gov (United States)

    Background: Moniliophthora roreri is the causal agent of Frosty pod rot (FPR) disease of Theobroma cacao, the source of chocolate and is one of the most destructive diseases of cacao in the Americas. This Basidiomycete only infects cacao pods and has an extended biotrophic phase lasting up to sixty ...

  11. Draft Genome Sequence of Grammothele lineata SDL-CO-2015-1, a Jute Endophyte with a Potential for Paclitaxel Biosynthesis.

    Science.gov (United States)

    Das, Avizit; Ahmed, Oly; Baten, A K M Abdul; Bushra, Samira; Islam, M Tariqul; Ferdous, Ahlan Sabah; Islam, Mohammad Riazul; Khan, Haseena

    2017-08-17

    Grammothele lineata strain SDL-CO-2015-1, a basidiomycete fungus, was identified as an endophyte from a jute species, Corchorus olitorius var. 2015, and found to produce paclitaxel, a diterpenic polyoxygenated pseudoalkaloid with antitumor activity. Here, we report the draft genome sequence (42.8 Mb with 9,395 genes) of this strain. Copyright © 2017 Das et al.

  12. Conservative ecological and evolutionary patterns in liverwort–fungal symbioses

    Science.gov (United States)

    Bidartondo, Martin I.; Duckett, Jeffrey G.

    2010-01-01

    Liverworts, the most ancient group of land plants, form a range of intimate associations with fungi that may be analogous to the mycorrhizas of vascular plants. Most thalloid liverworts contain arbuscular mycorrhizal glomeromycete fungi similar to most vascular plants. In contrast, a range of leafy liverwort genera and one simple thalloid liverwort family (the Aneuraceae) have switched to basidiomycete fungi. These liverwort switches away from glomeromycete fungi may be expected to parallel switches undergone by vascular plants that target diverse lineages of basidiomycete fungi to form ectomycorrhizas. To test this hypothesis, we used a cultivation-independent approach to examine the basidiomycete fungi associated with liverworts in varied worldwide locations by generating fungal DNA sequence data from over 200 field collections of over 30 species. Here we show that eight leafy liverwort genera predominantly and consistently associate with members of the Sebacina vermifera species complex and that Aneuraceae thalloid liverworts associate nearly exclusively with Tulasnella species. Furthermore, within sites where multiple liverwort species co-occur, they almost never share the same fungi. Our analyses reveal a strikingly conservative ecological and evolutionary pattern of liverwort symbioses with basidiomycete fungi that is unlike that of vascular plant mycorrhizas. PMID:19812075

  13. Check list of European Hymenomycetous Heterobasidiae

    NARCIS (Netherlands)

    Donk, M.A.

    1966-01-01

    With this check list an attempt is made to account for the recorded European species of those Basidiomycetes that Patouillard called the “Hétérobasidies”, excluding, however, the Uredinales and Ustilaginales. Therefore, it covers the Septobasidiales, Tremellales (comprising the Auriculariineae and T

  14. First report of frosty pod rot caused by Moniliophthora roreri on cacao in Bolivia

    Science.gov (United States)

    Frosty pod rot (FPR) is a devastating cacao disease caused by the basidiomycete Moniliophthora roreri (Aime and Phillips-Mora, 2005). The disease is confined to 13 countries in Central and South America and constitutes a permanent threat for cacao cultivation worldwide. In July 2012, FPR was detect...

  15. Levels of specificity of Xylaria species associated with fungus-growing termites: a phylogenetic approach

    DEFF Research Database (Denmark)

    Visser, Andre; Ros, V I D; De Beer, Z. W.

    2009-01-01

    Fungus-growing termites live in obligate mutualistic symbiosis with species of the basidiomycete genus Termitomyces, which are cultivated on a substrate of dead plant material. When the termite colony dies, or when nest material is incubated without termites in the laboratory, fruiting bodies of ...

  16. THE SC7/SC14 GENE FAMILY OF SCHIZOPHYLLUM-COMMUNE CODES FOR EXTRACELLULAR PROTEINS SPECIFICALLY EXPRESSED DURING FRUIT-BODY FORMATION

    NARCIS (Netherlands)

    SCHUREN, FHJ; ASGEIRSDOTTIR, SA; KOTHE, EM; SCHEER, JMJ; WESSELS, JGH

    The Sc7 and Sc14 genes are specifically expressed in the dikaryon of the basidiomycete fungus Schizophyllum commune during fruiting. These genes are closely linked (within 6 kb) and highly similar in gene structure and nucleotide sequence (70% identical nucleotides in their coding regions). The

  17. Bibliography

    NARCIS (Netherlands)

    NN,

    1961-01-01

    Agnihothrudu, V.: A new genus of the helicosporous Basidiomycetes (from North-East India) (Fungi) (Trans. Brit. Myc. Soc. 44, 1961, 51-54, 1 fig.). Ahmad, S.: Further contributions to the Fungi of West Pakistan 1 (Biologia 6, 1960, 117-136, 17 fig.).

  18. Habitat preference and the evolution of sympatric intersterility groups in the Heterbasidion annosum species complex

    Science.gov (United States)

    M. Garbelotto; W.J. Otrosina; F.W. Cobb; T.D. Bruns

    1998-01-01

    Populations of the basidiomycete Heterobasidion annosum display varying degrees, of intersterility and differential host specialization. At least three intersterility groups have been formally described, each characterized by a range of "preferred" hosts. It has been hypothesized that processes of host-pathogen compatibility may have been...

  19. Insights into the mechanism of copper-tolerance in Fibroporia radiculosa: The biosynthesis of oxalate

    Science.gov (United States)

    Katie Jenkins; Carol A. Clausen; Frederick Green; Susan V. Diehl

    2015-01-01

    Copper is currently used as the key component in wood preservatives despite the known tolerance of many brown-rot Basidiomycetes. Copper-tolerant fungi, like Fibroporia radiculosa, produce and accumulate high levels of oxalate when exposed to copper. To gain insight into the mechanism of oxalate production, four F. radiculosa...

  20. Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

    NARCIS (Netherlands)

    Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko

    2015-01-01

    The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

  1. Identification and Characterization of Small Noncoding RNAs in Genome Sequences of the Edible Fungus Pleurotus ostreatus.

    Science.gov (United States)

    Qu, Jibin; Zhao, Mengran; Hsiang, Tom; Feng, Xiaoxing; Zhang, Jinxia; Huang, Chenyang

    2016-01-01

    Noncoding RNAs (ncRNAs) have been identified in many fungi. However, no genome-scale identification of ncRNAs has been inventoried for basidiomycetes. In this research, we detected 254 small noncoding RNAs (sncRNAs) in a genome assembly of an isolate (CCEF00389) of Pleurotus ostreatus, which is a widely cultivated edible basidiomycetous fungus worldwide. The identified sncRNAs include snRNAs, snoRNAs, tRNAs, and miRNAs. SnRNA U1 was not found in CCEF00389 genome assembly and some other basidiomycetous genomes by BLASTn. This implies that if snRNA U1 of basidiomycetes exists, it has a sequence that varies significantly from other organisms. By analyzing the distribution of sncRNA loci, we found that snRNAs and most tRNAs (88.6%) were located in pseudo-UTR regions, while miRNAs are commonly found in introns. To analyze the evolutionary conservation of the sncRNAs in P. ostreatus, we aligned all 254 sncRNAs to the genome assemblies of some other Agaricomycotina fungi. The results suggest that most sncRNAs (77.56%) were highly conserved in P. ostreatus, and 20% were conserved in Agaricomycotina fungi. These findings indicate that most sncRNAs of P. ostreatus were not conserved across Agaricomycotina fungi.

  2. Identification of three differentially expressed hydrophobins in Pleurotus ostreatus (oyster mushroom)

    NARCIS (Netherlands)

    Asgeirsdottir, S.A; de Vries, O.M H; Wessels, J.G H

    1998-01-01

    Three proteins with characteristic features of class I hydrophobins, designated POH1, POH2 and POH3, were isolated from the basidiomycete Pleurotus ostreatus. Based on N-terminal sequence analyses, their cDNAs were isolated using RT-PCR; the cDNAs and corresponding genes were sequenced and their

  3. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Science.gov (United States)

    Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen

    2012-01-01

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...

  4. A potential role for an extracellular methanol oxidase secreted by Moniliophthora perniciosa in Witches' broom disease in cacao

    Science.gov (United States)

    The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...

  5. Selection of Variovorax paradoxus-like bacteria in the mycosphere and the role of fungal-released compounds

    NARCIS (Netherlands)

    Boersma, F.G.H.; Otten, Renee; Warmink, J.A.; Nazir, R.; van Elsas, J.D.

    2010-01-01

    At two occasions (2004 and 2006), a similar cluster of culturable bacteria was found to be selected in the mycosphere of the basidiomycetous fungus Laccaria proximo (Agaricales, Tricholomataceae) in the field. The bacteria, identified as related to Variovorax paradoxus, comprised 7.3-9% of the total

  6. Selection of Variovorax paradoxus-like bacteria in the mycosphere and the role of fungal-released compounds

    NARCIS (Netherlands)

    Boersma, F.G.H.; Otten, Renee; Warmink, J.A.; Nazir, R.; van Elsas, J.D.

    2010-01-01

    At two occasions (2004 and 2006), a similar cluster of culturable bacteria was found to be selected in the mycosphere of the basidiomycetous fungus Laccaria proximo (Agaricales, Tricholomataceae) in the field. The bacteria, identified as related to Variovorax paradoxus, comprised 7.3-9% of the total

  7. Transformation of the cultivated mushroom Agaricus bisporus (Lange) using T-DNA from Agrobacterium tumefaciens.

    NARCIS (Netherlands)

    Mikosch, T.S.P.; Lavrijssen, B.; Griensven, van L.J.L.D.

    2001-01-01

    Agrobacterium tumefaciens is known to transfer parts of its tumour-inducing plasmid, the T-DNA, to plants, yeasts and filamentous fungi. We have used this system to transform germinating basidiospores and vegetative mycelium of a commercial strain of the cultivated basidiomycete Agaricus bisporus. A

  8. Improving ruminal degradability of oil palm fronds using white rot fungi

    NARCIS (Netherlands)

    Rahman, M.M.; Lourenco, M.; Hassim, H.A.; Baars, J.J.P.; Sonnenberg, A.S.M.; Cone, J.W.; Boever, de J.L.; Fievez, V.

    2011-01-01

    The use of oil palm fronds (OPF) in livestock production is limited as up to 0.20 of their dry biomass is lignin. White rot fungi (WRF) are very effective basidiomycetes for biological pre-treatment as they degrade lignin extensively. Ten WRF were screened for their potential to increase OPF digesti

  9. First report of otitis externa caused by Schizophyllum commune and review of the literature.

    Science.gov (United States)

    Matos, Tadeja; Tomazin, Rok; Battelino, Saba

    2016-05-01

    Basidiomycete Schizophyllum commune is a widely distributed cellulolytic fungus that is a well-known pathogen. It can cause a wide range of different infections, and here we describe the first case of otitis externa and a molecularly based identification process.

  10. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  11. Identification and Characterization of Small Noncoding RNAs in Genome Sequences of the Edible Fungus Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Jibin Qu

    2016-01-01

    Full Text Available Noncoding RNAs (ncRNAs have been identified in many fungi. However, no genome-scale identification of ncRNAs has been inventoried for basidiomycetes. In this research, we detected 254 small noncoding RNAs (sncRNAs in a genome assembly of an isolate (CCEF00389 of Pleurotus ostreatus, which is a widely cultivated edible basidiomycetous fungus worldwide. The identified sncRNAs include snRNAs, snoRNAs, tRNAs, and miRNAs. SnRNA U1 was not found in CCEF00389 genome assembly and some other basidiomycetous genomes by BLASTn. This implies that if snRNA U1 of basidiomycetes exists, it has a sequence that varies significantly from other organisms. By analyzing the distribution of sncRNA loci, we found that snRNAs and most tRNAs (88.6% were located in pseudo-UTR regions, while miRNAs are commonly found in introns. To analyze the evolutionary conservation of the sncRNAs in P. ostreatus, we aligned all 254 sncRNAs to the genome assemblies of some other Agaricomycotina fungi. The results suggest that most sncRNAs (77.56% were highly conserved in P. ostreatus, and 20% were conserved in Agaricomycotina fungi. These findings indicate that most sncRNAs of P. ostreatus were not conserved across Agaricomycotina fungi.

  12. Identification of three differentially expressed hydrophobins in Pleurotus ostreatus (oyster mushroom)

    NARCIS (Netherlands)

    Asgeirsdottir, S.A; de Vries, O.M H; Wessels, J.G H

    1998-01-01

    Three proteins with characteristic features of class I hydrophobins, designated POH1, POH2 and POH3, were isolated from the basidiomycete Pleurotus ostreatus. Based on N-terminal sequence analyses, their cDNAs were isolated using RT-PCR; the cDNAs and corresponding genes were sequenced and their reg

  13. Data on the macromycetes flora of the North-Eastern Ploand

    Directory of Open Access Journals (Sweden)

    Longin Olesiński

    2014-08-01

    Full Text Available The list of 352 macromycetes (Asco- and Basidiomycetes collected in the North-Eastern Poland is given. It is the first part of mycofloristic investigation in this region conducted in the years 1964-1997 by latter author, and 1981-1982, by former autor.;

  14. INSOLUBLE HYDROPHOBIN COMPLEXES IN THE WALLS OF SCHIZOPHYLLUM-COMMUNE AND OTHER FILAMENTOUS FUNGI

    NARCIS (Netherlands)

    DEVRIES, OMH; FEKKES, MP; WOSTEN, HAB; WESSELS, JGH

    1993-01-01

    Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted wi

  15. Moniliophthora roreri Genome and Transcriptome

    Science.gov (United States)

    Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...

  16. Biologically Active Substances from Higher Fungi

    Institute of Scientific and Technical Information of China (English)

    Liu Jikai

    2007-01-01

    As a part of our search for naturally occurring bioactive metabolites of mushrooms, we have investigated the chemical constituents of more than 100 Basidiomycetes and Ascomycetes fungi, and isolated over 300 including 150 new terpenoids,phenolics and nitrogen-containing compounds. The isolation, structural elucidation and biologically activity of the natural products from the higher fungi are briefly discussed.

  17. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The deduce

  18. Global warming and mycoflora in the Baltic Region

    Directory of Open Access Journals (Sweden)

    Hanns Kreisel

    2013-12-01

    Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.

  19. Extremophilic fungi in arctic ice: a relationship between adaptation to low temperature and water activity

    DEFF Research Database (Denmark)

    Gunde-Cimerman, N.; Sonjak, S.; Zalar, P.

    2003-01-01

    , media, ranging from 1000 to 3000 l(-1) in seawater, 6000 to 7000 l(-1) in melted sea ice and up to 13,000 l(-1) in melted glacier ice. The dominant taxa were ascomycetous and basidiomycetous yeasts, melanized fungi, mainly represented by the genera Cladosporium and Aureobasidium plus different species...

  20. Mating type-correlated molecular markers and demonstration of heterokaryosis in the phytopathogenic fungus Thanatephorus cucumeris (Rhizoctonia solani) AG 1-IC by AFLP DNA fingerprinting analysis

    NARCIS (Netherlands)

    Julian, M.C.; Acero, J.; Salazar, O.; Keijer, J.; Rubio, O.

    1999-01-01

    The destructive soil-borne plant pathogenic basidiomycetous fungus Thanatephorus cucumeris (Frank) Donk [anamorph: Rhizoctonia solani Kühn] is not a homogeneous species, but is composed of at least twelve anastomosis groups (AG), which seem to be genetically isolated. The genetics of several T. cucu

  1. Lignin-degrading enzyme from the hymenomycete Phanerochaete chrysosporium Burds

    Energy Technology Data Exchange (ETDEWEB)

    Tien, M.; Kirk, T.K.

    1983-08-12

    The extracellular fluid of ligninolytic cultures of the wood-decomposing basidiomycete Phanerochaete chrysosporium Burds contains an enzyme that degrades lignin substructure model compounds as well as spruce and birch lignins. It has a molecular size of 42,000 daltons and requires hydrogen peroxide for activity. (Refs. 24).

  2. The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.

    2013-01-01

    Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median eff

  3. Cross-Cultural Food Consumption Behavior of Consumers in Fiji

    National Research Council Canada - National Science Library

    Karishma Kavita Devi; Gurmeet Singh; Rafia Naz; Kim-Shyan Fam

    2015-01-01

    .... Consumer culture theory (CCT) and the Engel-Blackwell-Kollat model have been used as a preliminary point of exploration, and the quantitative approach was employed, involving a total of 225 respondents...

  4. Planning for shallow high resolution seismic surveys

    CSIR Research Space (South Africa)

    Fourie, CJS

    2008-11-01

    Full Text Available to Geophysical Exploration: Second Edition, Blackwell Scientific Publications, 1991. [12] T W B Kibble:Classical Mechanics: Third Edition, Longman Scientific & Technical Press, London, 1985. [13] Sears, Zemansky and Young: University Physics: (Seventh...

  5. IJAAAR 2012 COMPLETE ARTICLES

    African Journals Online (AJOL)

    2011

    Eggs: A Consumer Preference Approach. Jibir, *M., Garba S. and ... The identified attributes were also matched to consumer quality expectations. Quality attributes ..... Consumer behaviour for egg in Japan ... Blackwell UK 196 p. Mako, A. A ...

  6. As below, so above: A perspective on African Theology

    African Journals Online (AJOL)

    p1243322

    sinful acts include immoral behaviour, breaking covenant, ritual mistakes, breaking of taboos ..... fate; put more crudely, Christianity had to produce consumers for its product. Michel Foucault (in .... postmodernity, 55-78. Oxford: Blackwell.

  7. A Curious Case of Caveats and Causes

    DEFF Research Database (Denmark)

    Blyth, Mark

    2014-01-01

    Review symposium contribution. Banking Across Boundaries: Placing Finance in Capitalism / Brett Christophers. Wiley-Blackwell, Chichester, Sussex, 2013, 302 pages. Participants: Jamie Peck; Fred Block; Mark Blyth; Ewald Engelen; Brett Christophers....

  8. 75 FR 7265 - Notice of Agreement Filed

    Science.gov (United States)

    2010-02-18

    .... Moller-Maersk A/S; APL Co. Pte Ltd.; Compania Chilena de Navigacion Interoceanica, S.A.; Compania Sud... Shipping Line. Filing Party: Wayne R. Rohde, Esq.; Sher & Blackwell LLP; 1850 M Street, NW.; Suite...

  9. Post -Episiotomy Morbidity amongst Parturients at the University of ...

    African Journals Online (AJOL)

    Alasia Datonye

    Post operative pain was the commonest complication and dyspareumia ... There is need to have a review of the pain management of patients with .... There is also need to improve the quality of care of ... Intervention, Oxford Blackwell Science.

  10. Assessing the Goodness of Fit of Phylogenetic Comparative Methods: A Meta-Analysis and Simulation Study: e67001

    National Research Council Canada - National Science Library

    Dwueng-Chwuan Jhwueng

    2013-01-01

    ...? Data I conducted a meta-analysis of 122 phylogenetic data sets found by searching all papers in JEB, Blackwell Synergy and JSTOR published in 2002-2005 for the purpose of assessing the fit of PCMs...

  11. Short communication Parentage verification of South African Angora ...

    African Journals Online (AJOL)

    ***

    South African Journal of Animal Science 2011, 41 (no. 3) ... A large number of microsatellite markers are available for most farm animal species and parentage panels have been commercialized ..... Reproduction in Farm Animals. Blackwell ...

  12. Mental Rotation, Pictured Rotation, and Tandem Rotation in Depth

    Science.gov (United States)

    1997-01-01

    explain. For what is hidden, for example, is of no interest to us." ( Wittgenstein , 1953, p. 50, para. 126.) 6. General discussion "The blessed...1980. Wittgenstein : Understanding and meaning. Oxford: Basil Blackwell. Bauer, B. and P. Jolicoeur, 1996. Stimulus dimensionality effects in mental...P.M.S., 1990. Wittgenstein : Meaning and mind. Oxford: Basil Blackwell. Hall, D.L. and A. Friedman, 1994. Shape discriminations of three-dimensional

  13. Modeling Conflict between China and the United States

    Science.gov (United States)

    2012-12-01

    Moore , “China Views Globalization: Toward a New Great Power Politics,” The Washington Quarterly, vol. 27, Issue 3 (2004). These articles predicate...Baldwin, Paradoxes of Power, Basil Blackwell, New York, 1989 and Karl Deutsche, The Analysis of International Relations (Prentice Hall, Englewood NJ...Baldwin David. Paradoxes of Power. Basil Blackwell, New York, 1989 Barnes, Julian. “Navy SEALs Rescue Hostages in Somalia,” Wall Street

  14. End user programming with personally meaningful objects

    CSIR Research Space (South Africa)

    Smith, Andrew Cyrus

    2016-09-01

    Full Text Available . MIT Artificial Intelligence Lab. Perlman, R. (1976). Using computer technology to provide a creative learning environment for preschool children. (No. 24 (Logo Memo), MIT Artificial Intelligence Lab Memo 360). MIT Artificial Intelligence Lab... Publishing Group. Blackwell, A. F., & Hague, R. (2001). AutoHAN: An architecture for programming the home. Human-centric computing languages and environments, 2001. Proceedings IEEE symposia on (pp. 150–157). IEEE. Blackwell, A. F., & Hague, R. (2001...

  15. 鸡油菌属的研究概况与展望%Research Status and Prospect of the Genus Cantharellus Adans.ex Fr.(Cantharellaceae,Basidiomycota)

    Institute of Scientific and Technical Information of China (English)

    田霄飞; 刘培贵; 邵士成

    2009-01-01

    鸡油菌属Cantharellus Adans.ex Fr.在担子菌中是一个具有独立演化路线的类群,隶属于担子菌门,同担子菌纲,鸡油菌目,鸡油菌科.该属全球分布广泛,目前有65种,中国曾记载9种.本文回顾了该属的研究历史,结合自己的研究成果,着重对本属各分类单元的划分和命名,相近种的区分,鸡油菌C.cibarius Fr.和管形鸡油菌C.tubaeformis Fr.:Fr.复合群以及生态保护和仿生栽培等方面研究中存在的疑问和纷争进行了论述.最后,作者对我国鸡油菌属的生物多样性研究和资源的持续利用提出了针对性的建议.%Cantharellus Adans. ex Fr., a member of the Cantharellaceae, Cantharellales, Homobasidio-mycetes, Basidiomycota, is a widely distributed macro-fungal genus with an independent evolutionary lineage. It currently includes 65 species, of which 9 were recorded in China. In this article, research history of the genus was briefly reviewed and some controversial conclusions, especially the demarcation and naming of some taxa, discrimination among similar species, problems on C. cibarius Fr. and C. tubaeformis Fr.: Fr. complex, as well as their ecological conservation and bionic cultivation, are discussed based on the authors' findings. Proposals for further research on biodiversities and sustainable utilizations were put forward at last.

  16. Hydrophobins in ectomycorrhizas: heterologous transcription of the Pisolithus HydPt-1 gene in yeast and Hebeloma cylindrosporum

    Directory of Open Access Journals (Sweden)

    D Tagu

    2009-12-01

    Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.

  17. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.

    2013-01-01

    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta......Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former...... are attacked by specialized fungi (Escovopsis) and diverse generalist microbes. Ants deploy biochemical defenses from bacteria and metapleural glands (MGs) and express different behaviors to control contaminants. We studied four Trachymyrmex species that differed in relative abundance of actinomycetes...

  18. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.

    Science.gov (United States)

    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi

    2016-10-01

    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune.

  19. A novel expansin protein from the white-rot fungus Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Omar Eduardo Tovar-Herrera

    Full Text Available A novel expansin protein (ScExlx1 was found, cloned and expressed from the Basidiomycete fungus Schizophylum commune. This protein showed the canonical features of plant expansins. ScExlx1 showed the ability to form "bubbles" in cotton fibers, reduce the size of avicel particles and enhance reducing sugar liberation from cotton fibers pretreated with the protein and then treated with cellulases. ScExlx1 was able to bind cellulose, birchwood xylan and chitin and this property was not affected by different sodium chloride concentrations. A novel property of ScExlx1 is its capacity to enhance reducing sugars (N-acetyl glucosamine liberation from pretreated chitin and further added with chitinase, which has not been reported for any expansin or expansin-like protein. To the best of our knowledge, this is the first report of a bona fide fungal expansin found in a basidiomycete and we could express the bioactive protein in Pichia pastoris.

  20. Screening for ligninolytic enzymes from autochthonous fungi and applications for decolorization of Remazole Marine Blue

    Science.gov (United States)

    Erden, Emre; Ucar, M. Cigdem; Gezer, Tekin; Pazarlioglu, Nurdan Kasikara

    2009-01-01

    This study presents new and alternative fungal strains for the production of ligninolytic enzymes which have great potential to use in industrial and biotechnological processes. Thirty autochthonous fungal strains were harvested from Bornova-Izmir in Turkiye. In the fresh fruitbody extracts laccase, manganese peroxidase and lignin peroxidase activities, which are the principal enzymes responsible for ligninocellulose degradation by Basidiomycetes, were screened. Spores of some of the basidiomycetes species such as Cortinarius sp., Trametes versicolor, Pleurotus ostreatus, Abortiporus biennis, Lyophyllum subglobisporium, Ramaria stricta, Ganoderma carnosum, Lactarius delicious ve Lepista nuda were isolated and investigated optimum cultivation conditions in submerged fermentation for high yields of ligninolytic enzyme production. In addition, isolated fungal strains were monitored on agar plates whether having the capability of decolorization of a textile dye Remazol Marine Blue. PMID:24031371