WorldWideScience

Sample records for macconkey agar sma

  1. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  2. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  3. A modified MacConkey agar for selective enumeration of necrotoxigenic E. coli O55 and probiotic E. coli Nissle 1917

    Czech Academy of Sciences Publication Activity Database

    Šplíchalová, Alla; Šplíchal, Igor; Sonnenborn, U.; Rada, V.

    2014-01-01

    Roč. 103, SEP 2014 (2014), s. 82-86 ISSN 0167-7012 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : MacConkey agar * E. coil O55 * NTEC Subject RIV: CE - Biochemistry Impact factor: 2.026, year: 2014

  4. Evaluation of Standard and Modified M-FC, MacConkey, and Teepol Media for Membrane Filtration Counting of Fecal Coliforms in Water

    OpenAIRE

    Grabow, W. O. K.; Hilner, C. A.; Coubrough, P.

    1981-01-01

    MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtai...

  5. Evaluation of standard and modified M-FC, MacConkey, and Teepol media for membrane filtration counting of fecal coliforms in water.

    Science.gov (United States)

    Grabow, W O; Hilner, C A; Coubrough, P

    1981-08-01

    MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtainable, easy to prepare and handle, and yielded clearly recognizable fecal coliform colonies. Identification of 1,139 fecal coliform isolates showed that fecal coliform tests cannot be used to enumerate Escherichia coli because the incidence of E. coli among fecal coliforms varied from an average of 51% for river water to 93% for an activated sludge effluent after chlorination. The incidence of Klebsiella pneumoniae among fecal coliforms varied from an average of 4% for the activated sludge effluent after chlorination to 32% for the river water. The advantages of a standard membrane filtration procedure for routine counting of fecal coliforms in water using M-FC agar without rosolic acid as growth medium, in the absence of preincubation or resuscitation steps, are outlined.

  6. Sistem Informasi Akademik pada SMA Hang Tuah Belawan

    OpenAIRE

    Tanjung, Dini Syahroni

    2015-01-01

    Informasi yang disampaikan oleh SMA HANG TUAH BELAWAN selama ini disebarkan melalui brosur dan cara yang seperti itu kurang efektif. Oleh karena itu dibuatlah sistem informasi akademik ini agar penyampaian informasinya lebih efektif dan efisien. 092406181

  7. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  8. Micromechanical analysis of porous SMA

    International Nuclear Information System (INIS)

    Sepe, V; Marfia, S; Sacco, E; Auricchio, F

    2015-01-01

    The present paper deals with computational micromechanical analyses of porous shape memory alloy (SMA). Porous SMAs are considered composite materials made of a dense SMA matrix including voids. A three-dimensional constitutive law is presented for the dense SMA able to reproduce the pseudo-elastic as well as the shape memory effects and, moreover, to account for the different elastic properties of the austenite and martensite phases. Furthermore, a numerical procedure is developed and the overall behavior of the porous SMA is recovered studying a representative volume element. Comparisons between the numerical results, recovered using the proposed modeling, and experimental data available in the literature are presented. The case of closed and open porosity is investigated. Parametric studies have been conducted in order to investigate the influence of the porosity, the shape and orientation of the pores on the overall mechanical response and, mainly, on the energy absorption dissipation capability. (paper)

  9. SMA DOE Student Fellowship Initiative

    Energy Technology Data Exchange (ETDEWEB)

    Steel Manufacturers Association

    2004-12-24

    Steel companies in many areas of the country have found it increasingly difficult to attract talented recent graduates of college and university engineering and applied science programs to the Electric Arc Furnace iron & steel industry. College student involvement in co-operative programs at steel companies can attract needed talent to the industry. Additionally, certain R & D needs identified in the Steel Industry Technology Roadmap are addressed as co-operative program activities. The Steel Manufacturers Association (''SMA'') therefore established a co-operative education program for selected college students who have completed the first or second year of a four or five-year college program, to be recognized as SMA Co-Operative Fellows, in regard to their summer and fall semester projects with SMA's member companies.

  10. Pemodelan Enterprise Architecture Sistem Informasi Akademik SMA PL Don Bosko Semarang Dengan Framework Zachman

    Directory of Open Access Journals (Sweden)

    Maria Alfonsa Chintia Dea Prananingrum

    2017-05-01

    Full Text Available Abstrak SMA PL Don Bosko Semarang belum dapat memanfaatkan teknologi komputer secara optimal karena masih menggunakan cara manual dalam pengelolaan berbagai macam data akademik sehingga memberikan masalah seperti lambatnya dalam pembuatan laporan yang menyulitkan kepala sekolah dalam pengambilan keputusan. Oleh sebab itu, SMA PL Don Bosko Semarang membutuhkan Sistem Informasi Akademik untuk memberikan kemudahan dalam mengelola berbagai macam data akademik secara terintegrasi serta memberikan layanan yang lebih baik kepada siswanya. Sebuah model architecture enterprise Sistem Informasi Akademik dibutuhkan agar meminimalisir kegagalan ketika menerapkan sistem tersebut sekaligus dapat berjalan sesuai kebutuhan di SMA PL Don Bosko Semarang. Metode analisis dalam penelitian ini menggunakan Framework Zachman yang memberikan pondasi dalam membantu menyediakan struktur dasar organisasi sehingga dapat mendukung perancangan dan pengembangan sistem informasi suatu organisasi. Hasil dari penelitian ini berupa blueprint (cetak biru pemodelan Sistem Informasi Akademik. Kata kunci— sistem informasi akademik, architecture enterprise, framework zachman, bluprint

  11. Scaling structure loads for SMA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dong Won; Song, Jeong Guk; Jeon, Sang Ho; Lim, Hak Kyu; Lee, Kwang Nam [KEPCO ENC, Yongin (Korea, Republic of)

    2012-10-15

    When the Seismic Margin Analysis(SMA) is conducted, the new structural load generation with Seismic Margin Earthquake(SME) is the time consuming work. For the convenience, EPRI NP 6041 suggests the scaling of the structure load. The report recommend that the fixed base(rock foundation) structure designed using either constant modal damping or modal damping ratios developed for a single material damping. For these cases, the SME loads can easily and accurately be calculated by scaling the spectral accelerations of the individual modes for the new SME response spectra. EPRI NP 6041 provides two simple methodologies for the scaling structure seismic loads which are the dominant frequency scaling methodology and the mode by mode scaling methodology. Scaling of the existing analysis to develop SME loads is much easier and more efficient than performing a new analysis. This paper is intended to compare the calculating results of two different methodologies.

  12. Scaling structure loads for SMA

    International Nuclear Information System (INIS)

    Lee, Dong Won; Song, Jeong Guk; Jeon, Sang Ho; Lim, Hak Kyu; Lee, Kwang Nam

    2012-01-01

    When the Seismic Margin Analysis(SMA) is conducted, the new structural load generation with Seismic Margin Earthquake(SME) is the time consuming work. For the convenience, EPRI NP 6041 suggests the scaling of the structure load. The report recommend that the fixed base(rock foundation) structure designed using either constant modal damping or modal damping ratios developed for a single material damping. For these cases, the SME loads can easily and accurately be calculated by scaling the spectral accelerations of the individual modes for the new SME response spectra. EPRI NP 6041 provides two simple methodologies for the scaling structure seismic loads which are the dominant frequency scaling methodology and the mode by mode scaling methodology. Scaling of the existing analysis to develop SME loads is much easier and more efficient than performing a new analysis. This paper is intended to compare the calculating results of two different methodologies

  13. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  14. Design of shape memory alloy (SMA) actuators

    CERN Document Server

    Rao, Ashwin; Reddy, J N

    2015-01-01

    This short monograph presents an analysis and design methodology for shape memory alloy (SMA) components such as wires, beams, and springs for different applications. The solid-solid, diffusionless phase transformations in thermally responsive SMA allows them to demonstrate unique characteristics like superelasticity and shape memory effects. The combined sensing and actuating capabilities of such materials allows them to provide a system level response by combining multiple functions in a single material system. In SMA, the combined mechanical and thermal loading effects influence the functionality of such materials. The aim of this book is to make the analysis of these materials accessible to designers by developing a "strength of materials" approach to the analysis and design of such SMA components inspired from their various applications with a review of various factors influencing the design process for such materials.

  15. Nutcracker and SMA syndromes: What is the normal SMA angle in children?

    Energy Technology Data Exchange (ETDEWEB)

    Arthurs, O.J., E-mail: oja20@owenarthurs.co.uk [Department of Radiology, Box 219, Addenbrooke' s Hospital, Cambridge University Teaching Hospitals NHS Foundation Trust, Hills Road, Cambridge, CB2 0QQ (United Kingdom); Mehta, U. [Department of Radiology, Box 219, Addenbrooke' s Hospital, Cambridge University Teaching Hospitals NHS Foundation Trust, Hills Road, Cambridge, CB2 0QQ (United Kingdom); Set, P.A.K., E-mail: p.set@addenbrookes.nhs.uk [Department of Radiology, Box 219, Addenbrooke' s Hospital, Cambridge University Teaching Hospitals NHS Foundation Trust, Hills Road, Cambridge, CB2 0QQ (United Kingdom)

    2012-08-15

    Objective: The nutcracker and superior mesenteric artery (SMA) syndromes are rare conditions where the left renal vein or duodenum may be compressed by an unusually acute angle between the SMA and aorta, although the normal angle in children is unknown. We measured the SMA angle to define the normal range in children. Methods: We retrospectively measured SMA angles, left renal vein (LRV) distance, and duodenal distance (DD) in 205 consecutive pediatric abdominal CT. Total and visceral intra-abdominal fat at the level of the umbilicus were also assessed. Results: Mean SMA angle was 45.6 {+-} 19.6 Degree-Sign (range 10.6-112.9 Degree-Sign ), mean LRV distance was 8.6 {+-} 3.9 mm (range 2.0-28.6 mm) and mean DD was 11.3 {+-} 4.8 mm (range 3.6-35.3 mm). There was a significant but weak correlation between %visceral fat volume (%VF) and SMA angle (R = 0.30; p < 0.001), LRV distance (R = 0.37, p < 0.001) and DD (R = 0.32; p < 0.001). Conclusion: There is a wide range of SMA angle, LRV and DD in normal children, which correlated weakly with visceral fat volume. Using a definition of SMA angle <25 Degree-Sign would diagnose 9.3% of asymptomatic children with nutcracker syndrome, and using a DD definition of <8 mm would diagnose 20% with SMA compression. Our findings suggest exercising caution when attributing these rare syndromes to an absolute SMA angle.

  16. Nutcracker and SMA syndromes: What is the normal SMA angle in children?

    International Nuclear Information System (INIS)

    Arthurs, O.J.; Mehta, U.; Set, P.A.K.

    2012-01-01

    Objective: The nutcracker and superior mesenteric artery (SMA) syndromes are rare conditions where the left renal vein or duodenum may be compressed by an unusually acute angle between the SMA and aorta, although the normal angle in children is unknown. We measured the SMA angle to define the normal range in children. Methods: We retrospectively measured SMA angles, left renal vein (LRV) distance, and duodenal distance (DD) in 205 consecutive pediatric abdominal CT. Total and visceral intra-abdominal fat at the level of the umbilicus were also assessed. Results: Mean SMA angle was 45.6 ± 19.6° (range 10.6–112.9°), mean LRV distance was 8.6 ± 3.9 mm (range 2.0–28.6 mm) and mean DD was 11.3 ± 4.8 mm (range 3.6–35.3 mm). There was a significant but weak correlation between %visceral fat volume (%VF) and SMA angle (R = 0.30; p < 0.001), LRV distance (R = 0.37, p < 0.001) and DD (R = 0.32; p < 0.001). Conclusion: There is a wide range of SMA angle, LRV and DD in normal children, which correlated weakly with visceral fat volume. Using a definition of SMA angle <25° would diagnose 9.3% of asymptomatic children with nutcracker syndrome, and using a DD definition of <8 mm would diagnose 20% with SMA compression. Our findings suggest exercising caution when attributing these rare syndromes to an absolute SMA angle.

  17. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  18. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  19. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  20. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  1. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  2. Characteristics Analysis and Testing of SMA Spring Actuator

    Directory of Open Access Journals (Sweden)

    Jianzuo Ma

    2013-01-01

    Full Text Available The biasing form two-way shape memory alloy (SMA actuator composed of SMA spring and steel spring is analyzed. Based on the force equilibrium equation, the relationship between load capacity of SMA spring and geometric parameters is established. In order to obtain the characteristics of SMA spring actuator, the output force and output displacement of SMA spring under different temperatures are analyzed by the theoretical model and the experimental method. Based on the shape memory effect of SMA, the relationship of the SMA spring actuator's output displacement with the temperature, the stress and strain, the material parameters, and the size parameters is established. The results indicate that the trend of theoretical results is basically consistent with the experimental data. The output displacement of SMA spring actuator is increased with the increasing temperature.

  3. KESULITAN PEMECAHAN MASALAH FISIKA PADA SISWA SMA

    Directory of Open Access Journals (Sweden)

    Rismatul Azizah

    2015-12-01

    Full Text Available Telah dilakukan penelitian untuk mengidentifikasi kesulitan pemecahan masalah fisika pada siswa SMA. Penelitian ini menggunakan metode survey dengan menyebarkan angket. Responden terdiri dari 120 siswa yang berasal dari 3 sekolah yaitu, SMA Negeri 1 Bangil, SMA Negeri 8 Malang, dan SMA YADIKA Bangil. Dilakukan pula wawancara pada beberapa guru dan siswa. Berdasarkan hasil penyebaran angket, diperoleh 26% siswa mengalami kesulitan pada materi Suhu dan Kalor, 25% Optik, 21% Fluida Statik, 17% Elastisitas dan Hukum Hooke, dan 11% Kinematika. Kesulitan tersebut salah satunya disebabkan pembelajaran bagi siswa yang kurang maksimal dalam bentuk hands on activity. Sebanyak 88% siswa mengatakan bahwa pembelajaran fisika yang sering dialami adalah dengan metode ceramah. Siswa mengalami kesulitan belajar fisika dalam menyelesaikan permasalahan pada soal sebesar 32%, kesulitan memahami konsep dan rumus 26%, kesulitan menggunakan persamaan atau rumus dalam soal 18%, kesulitan menganalisis grafik dan gambar 17%, dan kesulitan menyimpulkan materi yang telah dipelajari 7%. Kesulitan tersebut terlihat ketika siswa memecahkan permasalahan pada soal kinematika serta suhu dan kalor. Diperoleh dari hasil angket, bahwa 76% siswa mengalami kesulitan dalam memecahkan permasalahan pada soal dengan alasan lupa atau tidak paham, sebesar 19% siswa kurang memahami solusi pemecahan masalah pada soal, dan hanya sebesar 5% siswa mampu memecahkan permasalahan pada soal.

  4. Submillimeter Array (SMA) Newsletter August 2011

    OpenAIRE

    Blundell, Raymond

    2011-01-01

    Submillimeter Array (SMA) Newsletter August 2011 Blundell, Raymond Submillimeter Array Newsletter | Number 12 | August 2011 CONTENTS 1 From the Director SCIENCE HIGHLIGHTS: 2 Faint Submillimeter Sources behind Massive Lensing Clusters 5 Millimeter Imaging of the β Pictoris Debris Disk: Evidence for a Planetesimal Belt 7 Physical Properties of the Circumnuclear Starburst Ring in the Barred Galaxy NGC1097 TECHNICAL HIGHLIGHTS: 9 ...

  5. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  6. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  7. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  8. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  10. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  11. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  12. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  13. Investigation on low velocity impact resistance of SMA composite material

    Science.gov (United States)

    Hu, Dianyin; Zhang, Long; Wang, Rongqiao; Zhang, Xiaoyong

    2016-04-01

    A method to improve low velocity impact resistance of aeroengine composite casing using shape memory alloy's properties of shape memory(SM) and super-elasticity(SE) is proposed in this study. Firstly, a numerical modeling of SMA reinforced composite laminate under low velocity impact load with impact velocity of 10 m/s is established based on its constitutive model implemented by the VUMAT subroutine of commercial software ABAQUS. Secondly, the responses of SMA composite laminate including stress and deflection distributions were achieved through transient analysis under low velocity impact load. Numerical results show that both peak stress and deflection values of SMA composite laminate are less than that without SMA, which proves that embedding SMA into the composite structure can effectively improve the low velocity impact performance of composite structure. Finally, the influence of SM and SE on low velocity impact resistance is quantitatively investigated. The values of peak stress and deflection of SMA composite based on SM property decrease by 18.28% and 9.43% respectively, compared with those without SMA, instead of 12.87% and 5.19% based on SE. In conclusion, this proposed model described the impact damage of SMA composite structure and turned to be a more beneficial method to enhance the impact resistance by utilizing SM effect.

  14. EVALUASI STRATEGI BERSAING SMA KRISTEN 1 SALATIGA

    Directory of Open Access Journals (Sweden)

    Eclesia Tehupeiory

    2015-06-01

    Full Text Available This study aims to evaluate the competitive strategies of SMA Kristen 1 Salatiga. The type of this study was a qualitative evaluation, through data collection by means of interviews, questionnaires, observation and documentation study. Data obtained and analyzed by an evaluation component based on Rumelt (2000 were consistency, consonance, advantage and feasibility. The results showed that: (1 Consistency evaluation of competitive strategy applied by SMA Kristen 1 Salatiga has shown consistency with the goals, values and policies of the school. (2 Consonance evaluation of competitive strategy has demonstrated suitability with the needs of society, while for competition with other schools, the school programs such as Peduli Kasih program, Sekolah Lima Hari, moving class, SMUQI Radio and multimedia extracurricular namely cinematography and photography are not appropriate. (3 Advantage evaluation of competitive strategy in the school programs such as Peduli Kasih, moving class, and Sekolah Lima Hari do not excel the resources, skills and superior positions. Other programs such as multimedia Extracurricular namely photography and cinematography is not superior to the superior position. Meanwhile, special programs such as the education expo, parenting day, career day and the Field Trip program through Live In and outdoor study do not excel in superior skills. (4 Feasibility evaluation shows that multimedia extracurricular programs have not showed the feasibility of the physical resources which involves computer supporting facilities and Wi-Fi. Suggestion to school in order to maintain the consistency that was owned, suitability to the needs of society as well as pay attention to competition with other schools also enhance the achievement of advantage and checking of IT facilities.

  15. How do SMA-linked mutations of SMN1 lead to structural/functional deficiency of the SMA protein?

    Directory of Open Access Journals (Sweden)

    Wei Li

    Full Text Available Spinal muscular atrophy (SMA is an autosomal recessive neuromuscular disease with dysfunctional α-motor neurons in the anterior horn of the spinal cord. SMA is caused by loss (∼95% of SMA cases or mutation (∼5% of SMA cases of the survival motor neuron 1 gene SMN1. As the product of SMN1, SMN is a component of the SMN complex, and is also involved in the biosynthesis of the small nuclear ribonucleoproteins (snRNPs, which play critical roles in pre-mRNA splicing in the pathogenesis of SMA. To investigate how SMA-linked mutations of SMN1 lead to structural/functional deficiency of SMN, a set of computational analysis of SMN-related structures were conducted and are described in this article. Of extraordinary interest, the structural analysis highlights three SMN residues (Asp44, Glu134 and Gln136 with SMA-linked missense mutations, which cause disruptions of electrostatic interactions for Asp44, Glu134 and Gln136, and result in three functionally deficient SMA-linked SMN mutants, Asp44Val, Glu134Lys and Gln136Glu. From the computational analysis, it is also possible that SMN's Lys45 and Asp36 act as two electrostatic clips at the SMN-Gemin2 complex structure interface.

  16. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  17. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  18. Sistem Informasi Akademik pada SMA Swasta Hang Tuah Belawan

    OpenAIRE

    Syarifuddin, Ruisya

    2015-01-01

    Perancangan Sistem Informasi Akademik pada SMA Swasta Hang Tuah Belawan ini bertujuan untuk mempermudah proses pencarian atau searching data dan informasi untuk seluruh Siswa SMA Swasta Hang Tuah Belawan yang mengalami kesulitan dalam memperoleh data mengenai masalah Akademik tersebut. Faasilitas yang terdapat dalam aplikasi ini berupa penyediaan data dan informasi mengenai beritaberita terbaru, profil agenda kegiatan, dan data-data yang berguna untuk kelangsungan belajar si...

  19. Manajemen kelas dalam pembelajaran matematika di SMA Negeri Yogyakarta

    OpenAIRE

    Nisak Ruwah Ibnatur Husnul; Heri Retnawati

    2017-01-01

    Penelitian ini bertujuan untuk mengetahui manajemen kelas yang berupa perencanaan, pengorganisasian, penggerakan/kepemimpinan dan pengevaluasian dari pembelajaran matematika yang dilakukan oleh guru matematika di SMA Negeri Yogyakarta. Dengan menggunakan penelitian kualitatif jenis studi kasus ini dilakukan di SMA Negeri 5, 8 dan 9 Yogyakarta dengan subjek data adalah kepala sekolah, guru kurikulum, guru matematika dan siswa. Untuk teknik pengumpulan datanya dengan pedoman observasi dan pedom...

  20. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  1. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  2. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  3. The effectiveness of styrene-maleic acid (SMA) copolymers for solubilisation of integral membrane proteins from SMA-accessible and SMA-resistant membranes.

    Science.gov (United States)

    Swainsbury, David J K; Scheidelaar, Stefan; Foster, Nicholas; van Grondelle, Rienk; Killian, J Antoinette; Jones, Michael R

    2017-10-01

    Solubilisation of biological lipid bilayer membranes for analysis of their protein complement has traditionally been carried out using detergents, but there is increasing interest in the use of amphiphilic copolymers such as styrene maleic acid (SMA) for the solubilisation, purification and characterisation of integral membrane proteins in the form of protein/lipid nanodiscs. Here we survey the effectiveness of various commercially-available formulations of the SMA copolymer in solubilising Rhodobacter sphaeroides reaction centres (RCs) from photosynthetic membranes. We find that formulations of SMA with a 2:1 or 3:1 ratio of styrene to maleic acid are almost as effective as detergent in solubilising RCs, with the best solubilisation by short chain variants (membranes was uniformly low, but could be increased through a variety of treatments to increase the lipid:protein ratio. However, proteins isolated from such membranes comprised clusters of complexes in small membrane patches rather than individual proteins. We conclude that short-chain 2:1 and 3:1 formulations of SMA are the most effective in solubilising integral membrane proteins, but that solubilisation efficiencies are strongly influenced by the size of the target protein and the density of packing of proteins in the membrane. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  4. PENERAPAN TEKNOLOGI WEB SEKOLAH BAGI SMP DAN SMA MUHAMMADIYAH KARTASURA

    Directory of Open Access Journals (Sweden)

    Heru Supriyono

    2016-03-01

    Full Text Available Observation and interview with headmasters, teachers and administrative employees results showed that one of main problems faced by SMP Muhammadiyah 1 Kartasura and SMA Muhammadiyah 4 Kartasura is the do not have a representative school website. Based on this observation, after making discussion with headmasters, the community services team proposed an implementation of school website and train one of chosen teacher to manage implemented website. The outcomes of the community service activities are involving a school website for SMP Muhammadiyah 1 Kartasura and SMA Muhammadiyah 4 Kartasura and scientific publication draft. The contribution of each school is including providing information which will be uploaded to the website, providing fee for domain and hosting cost, and providing facilities for administrator training. The duration of this commuity services is three months. The results of the community services is both SMP Muhammadiyah 1 Kartasura dan SMA Muhammadiyah 4 Kartasura are now have representative website for their promotion and administative activities.

  5. Adaptive and energy efficient SMA-based handling systems

    Science.gov (United States)

    Motzki, P.; Kunze, J.; Holz, B.; York, A.; Seelecke, S.

    2015-04-01

    Shape Memory Alloys (SMA's) are known as actuators with very high energy density. This fact allows for the construction of very light weight and energy-efficient systems. In the field of material handling and automated assembly process, the avoidance of big moments of inertia in robots and kinematic units is essential. High inertial forces require bigger and stronger robot actuators and thus higher energy consumption and costs. For material handling in assembly processes, many different individual grippers for various work piece geometries are used. If one robot has to handle different work pieces, the gripper has to be exchanged and the assembly process is interrupted, which results in higher costs. In this paper, the advantages of using high energy density Shape Memory Alloy actuators in applications of material-handling and gripping-technology are explored. In particular, light-weight SMA actuated prototypes of an adaptive end-effector and a vacuum-gripper are constructed via rapid-prototyping and evaluated. The adaptive end-effector can change its configuration according to the work piece geometry and allows the handling of multiple different shaped objects without exchanging gripper tooling. SMA wires are used to move four independent arms, each arm adds one degree of freedom to the kinematic unit. At the tips of these end-effector arms, SMA-activated suction cups can be installed. The suction cup prototypes are developed separately. The flexible membranes of these suction cups are pulled up by SMA wires and thus a vacuum is created between the membrane and the work piece surface. The self-sensing ability of the SMA wires are used in both prototypes for monitoring their actuation.

  6. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  7. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  8. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  9. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  10. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  11. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  13. Pemanfaatan Informasi Olahraga di Media Massa Cetak oleh Guru Pendidikan Jasmani dan Kesehatan dalam Pembelajaran Pendidikan Jasmani dan Kesehatan di SMA 5, SMA 6, SMA 11 Semarang

    Directory of Open Access Journals (Sweden)

    Muhaimin Muhaimin

    2011-01-01

    Full Text Available Utilization of information in mass media print by master of physical education and health in physical education and health in SMA 5, SMA 6, SMA 11 Semarang. The presence of print media is now a community needs. That's because, the print media presents a variety of information including information of actual politics, culture, economy, crime, entertainment, and sports. Basically, sports information in the print media have educational value and can add insight to a reading of new knowledge. The study produced these findings: (1 third physical education and health teacher at school who becomes the object research have made use of sports information in the print media to support the success of teaching and learning process, (2 the type of information they use to support the success of learning teaching is a form of news, articles about health, (3 form of utilization is appropriate to set clipping and through direct delivery of the material in the field while providing practice in the field. This method is considered more effective because all students can immediately practice, (4 sports information in the print media meets the needs of teachers and physical health education in supporting the learning process.

  14. Fabricating Composite-Material Structures Containing SMA Ribbons

    Science.gov (United States)

    Turner, Travis L.; Cano, Roberto J.; Lach, Cynthia L.

    2003-01-01

    An improved method of designing and fabricating laminated composite-material (matrix/fiber) structures containing embedded shape-memory-alloy (SMA) actuators has been devised. Structures made by this method have repeatable, predictable properties, and fabrication processes can readily be automated. Such structures, denoted as shape-memory-alloy hybrid composite (SMAHC) structures, have been investigated for their potential to satisfy requirements to control the shapes or thermoelastic responses of themselves or of other structures into which they might be incorporated, or to control noise and vibrations. Much of the prior work on SMAHC structures has involved the use SMA wires embedded within matrices or within sleeves through parent structures. The disadvantages of using SMA wires as the embedded actuators include (1) complexity of fabrication procedures because of the relatively large numbers of actuators usually needed; (2) sensitivity to actuator/ matrix interface flaws because voids can be of significant size, relative to wires; (3) relatively high rates of breakage of actuators during curing of matrix materials because of sensitivity to stress concentrations at mechanical restraints; and (4) difficulty of achieving desirable overall volume fractions of SMA wires when trying to optimize the integration of the wires by placing them in selected layers only.

  15. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  16. Dynamics study of free volume properties of SMA/SMMA blends by PAL method

    International Nuclear Information System (INIS)

    Jiang, Z.Y.; Jiang, X.Q.; Huang, Y.J.; Lin, J.; Li, S.M.; Li, S.Z.; Hsia, Y.F.

    2006-01-01

    Miscibility of poly(styrene-co-maleic anhydride) (containing 7 wt% maleic anhydride)/poly(styrene-co-methyl methacrylate) (containing 40 wt% styrene) blends were previously studied. It was obtained that SMA70 (containing 70 wt% of SMA in SMA/SMMA blends) is miscible in molecular level but SMA20 is not. In this paper, the two blends selected were used to investigate the temperature dependence of free volume parameters. It showed there are different deviations of free volume parameters in SMA20 and SMA70, and it was interesting that temperature dependence of ortho-positronium lifetime τ 3 of the SMA20 mixture exhibits two breaks in the range temperature from 90 deg. C to 120 deg. C, which revealed that the mixture has two glass transition ranges. Also, ortho-positronium lifetime τ 3 of the SMA20 mixture is nearly constant in the temperature range from 130 deg. C to 160 deg. C. These indicated that SMA20 blend is phase-separated in room temperature and become miscible above 130 deg. C, which may be due to steric hindrance effect of phenyl rings of SMMA and SMA. From the deviation of o-Ps lifetimes of SMA70, the single glass transition temperature of SMA70 blend was shown. Combining the previous study, it was further concluded that PAL method seems to be a powerful method to detect in situ phase behavior of immiscible polymer blends and glass transition of miscible polymer blends

  17. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  18. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  19. FAKTOR-FAKTOR YANG MEMPENGARUHI DERAJAT MIOPIA PADA REMAJA (STUDI DI SMA NEGERI 2 TEMANGGUNG KABUPATEN TEMANGGUNG

    Directory of Open Access Journals (Sweden)

    Anisa Sofiani

    2016-04-01

    Full Text Available Miopia sebagai kelainan refraksi menjadi penyebab terbanyak gangguan penglihatan di dunia hingga diestimasikan separuh dari penduduk dunia menderita miopia pada tahun 2020. Segala golongan usia dapat mengalami miopia, terutama pada remaja. Jawa tengah menduduki peringkat ke 6 untuk masalah miopia, dan remaja yang menderita miopia di kabupaten Temanggung khususnya SMA N 2 Temanggung diperkirakan meningkat tiap tahunnya. Penelitian ini termasuk dalam penelitian explanatory research dengan pendekatan cross sectional. Populasi berjumlah 720 siswa, sampel 92 siswa SMA N 2 Temanggung. Hasil penelitian ini adalah terdapat hubungan antara jarak baca (p=0,042, intensitas gadget (p=0,049, intensitas jalan kaki outdoor (0,004, dan intensitas olahraga outdoor (p=0,017 dengan derajat miopia remaja. Dan tidak ada hubungan dengan jenis kelamin, asupan vitamin A, lama membaca, penerangan, posisi membaca, penggunaan gadget /hari, pekerjaan, pendapatan orang tua, keturunan, intensitas rekreasi dan hobi. Faktor terkuat adalah olahraga outdoor (p=0,005 dan OR=17,468. Anjuran untuk penelitian selanjutnya adalah dalam penghitungan asupan Vitamin A apakah mempengaruhi peningkatan dioptri miopia agar memperhatikan cara pengolahan makanan. Kategori untuk variabel penggunaan gadget juga perlu ditambahkan. Myopia as refractive error will be the most common cause of visual impairment over the world until half of the world's populations are suffer from myopia in 2020. All of age groups can get it, especially in adolescents. Central Java’s ranked is sixth for the problems of myopia, and adolescents who suffer the myopia in Temanggung regency in particular SMA N 2 Temanggung is expected to increase each year. This study was explanatory research with cross sectional approach. The population were 720 students, with 92 samples students of SMA N 2 Temanggung. The Results, there were a relationship between reading distance (p=0.042, the intensity of the gadget (p=0.049, the

  20. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  1. Fatigue crack behavior on a Cu-Zn-Al SMA

    Directory of Open Access Journals (Sweden)

    V. Di Cocco

    2014-10-01

    Full Text Available In recent years, mechanical property of many SMA has improved in order to introduce these alloys in specific field of industry. Main examples of these alloys are the NiTi, Cu-Zn-Al and Cu-Al-Ni which are used in many fields of engineering such as aerospace or mechanical systems. Cu-Zn-Al alloys are characterized by good shape memory properties due to a bcc disordered structure stable at high temperature called β-phase, which is able to change by means of a reversible transition to a B2 structure after appropriate cooling, and reversible transition from B2 secondary to DO3 order, under other types of cooling. In β-Cu-Zn-Al shape memory alloys, the martensitic transformation is not in equilibrium at room temperature. It is therefore often necessary to obtain the martensitic structure, using a thermal treatment at high temperature followed by quenching. The martensitic phases can be either thermally-induced spontaneous transformation, or stressinduced, or cooling, or stressing the β- phase. Direct quenching from high temperatures to the martensite phase is the most effective because of the non-diffusive character of the transformation. The martensite inherits the atomic order from the β-phase. Precipitation of many kinds of intermetallic phases is the main problem of treatment on cu-based shape memory alloy. For instance, a precipitation of α-phase occurs in many low aluminum copper based SMA alloy and presence of α-phase implies a strong degradation of shape recovery. However, Cu-Zn-Al SMA alloys characterized by aluminum contents less than 5% cover a good cold machining and cost is lower than traditional NiTi SMA alloys. In order to improve the SMA performance, it is always necessary to identify the microstructural changing in mechanical and thermal conditions, using X-Ray analyses. In this work a Cu-Zn-Al SMA alloy obtained in laboratory has been microstructurally and metallographically characterized by means of X-Ray diffraction and Light

  2. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  3. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  4. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  5. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  6. Buckling analysis of SMA bonded sandwich structure – using FEM

    Science.gov (United States)

    Katariya, Pankaj V.; Das, Arijit; Panda, Subrata K.

    2018-03-01

    Thermal buckling strength of smart sandwich composite structure (bonded with shape memory alloy; SMA) examined numerically via a higher-order finite element model in association with marching technique. The excess geometrical distortion of the structure under the elevated environment modeled through Green’s strain function whereas the material nonlinearity counted with the help of marching method. The system responses are computed numerically by solving the generalized eigenvalue equations via a customized MATLAB code. The comprehensive behaviour of the current finite element solutions (minimum buckling load parameter) is established by solving the adequate number of numerical examples including the given input parameter. The current numerical model is extended further to check the influence of various structural parameter of the sandwich panel on the buckling temperature including the SMA effect and reported in details.

  7. PENGARUH LINGKUNGAN KERJA, KOMPENSASI KERJA, DAN MOTIVASI KERJA TERHADAP KINERJA GURU EKONOMI/ AKUNTANSI DI SMA NEGERI SE-KABUPATEN WONOSOBO

    Directory of Open Access Journals (Sweden)

    Siti Imroatun

    2016-02-01

    Full Text Available Kinerja guru sangat menentukan keberhasilan proses belajar yang efektif dan efisien. Dengan kinerja yang baik maka tujuan pendidikan dapat tercapai. Penelitian ini dilakukan di SMA Negeri se-Kabupaten wonosobo yang berjumlah sembilan sekolah yang dilatar belakangi bahwa kinerja guru di SMA Negeri se-Kabupaten Wonosobo belum optimal. Hal ini dilihat dari hasil observasi awal yang menunjukkan kurangnya persiapan sebelum mengajar, penggunaan metode pembelajaran yang kurang inovatif, dan pembelajaran berbasis teknologi kurang dapat dimanfaatkan secara optimal. Populasi dalam penelitian ini berjumlah 30 orang guru ekonomi yang tersebar di sembilan SMA Negeri se-Kabupaten Wonosobo. Sampel yang digunakan adalah semua guru ekonomi yang ada di SMA Negeri se-Kabupaten Wonosobo. Variabel yang diteliti dalam penelitian ini adalah lingkungan kerja, kompensasi kerja, dan motivasi kerja sebagai variabel bebas, serta kinerja guru sebagai variabel terikat. Metode pengumpulan data yang digunakan adalah angket atau kuesioner. Analisis data menggunakan analisis statistik deskriptif dan statistik inferensial.Hasil analisis deskriptif masing-masing variabel menunjukkan bahwa lingkungan kerja, kompensasi kerja, motivasi kerja dan kinerja guru termasuk kriteria baik. Lingkungan kerja berpengaruh positif terhadap kinerja guru sebesar 16,65%; kompensasi kerja berpengaruh positif terhadap kinerja guru sebesar 21,25%; dan motivasi kerja berpengaruh positif terhadap kinerja guru sebesar 31,92%.Penelitian ini terdapat pengaruh positif antara lingkungan kerja, kompensasi kerja dan motivasi kerja terhadap kinerja guru, baik secara simultan maupun parsial. Saran yang dapat diberikan adalah agar guru ekonomi terus meningkatkan kompetensi professional dengan menyesuaikan kemampuan peserta didik. Selain itu juga perlu ditingkatkan fasilitas yang mendukung kinerja guru, memberikan kompensasi sesuai dengan beban kerja guru dan selalu memberikan motivasi kepada guru ekonomi. Teacher

  8. Kondisi Stres Akademik Siswa SMA Negeri di Kota Padang

    OpenAIRE

    Taufik Taufik; Ifdil Ifdil

    2014-01-01

    This research conduct base from increasing the National Examination standards from recent years, and overload student’s learning activity in Senior High School (SMA). These conditions as triggers stress students, from a long time, its influence on their learning. Based that, the research is to identify level of student academic stress, and differences base gender, and school location. This research use Cluster Random Sampling. Samples are grouped into 3 (three), that’s school is located in do...

  9. Optimization of SMA layers in composite structures to enhance damping

    Science.gov (United States)

    Haghdoust, P.; Cinquemani, S.; Lecis, N.; Bassani, P.

    2016-04-01

    The performance of lightweight structures can be severely affected by vibration. New design concepts leading to lightweight, slender structural components can increase the vulnerability of the components to failure due to excessive vibration. The intelligent approach to address the problem would be the use of materials which are more capable in dissipating the energy due to their high value of loss factor. Among the different materials available to achieve damping, much attention has been attached to the use of shape memory alloys (SMAs) because of their unique microstructure, leading to good damping capacity. This work describes the design and optimization of a hybrid layered composite structure for the passive suppression of flexural vibrations in slender and light structures. Embedding the SMA layers in composite structure allows to combine different properties: the lightness of the base composite (e.g. fiber glass), the mechanical strength of the insert of metallic material and the relevant damping properties of SMA, in the martensitic phase. In particular, we put our attention on embedding the CuZnAl in the form of thin sheet in a layered composite made by glass fiber reinforced epoxy. By appropriately positioning of the SMA sheets so that they are subjected to the maximum curvature, the damping of the hybrid system can be considerably enhanced. Accordingly analytical method for evaluating the energy dissipation of the thin sheets with different shapes and patterns is developed and is followed by a shape optimization based on genetic algorithm. Eventually different configurations of the hybrid beam structure with different patterns of SMA layer are proposed and compared in the term of damping capacity.

  10. Development of a Simple Structured Artificial Muscle Using SMA Wire

    International Nuclear Information System (INIS)

    Ibuki, Ryuta; Maruyama, Shigenao; Komiya, Atsuki

    2006-01-01

    Artificial heart muscle using SMA wire is developed to assist weaken heartbeat. Simple structure design was adopted for large output force, large displacement and rapid cyclic motion of the actuator. The actuator was designed and fabricated from the viewpoint of heat transfer. Moving performance of the actuator was experimentally measured under 10N of loading condition. Under the maximum efficiency condition, the actuator shows cyclic motion with 1mm of displacement and time period of about 2 seconds in one cycle

  11. PENGEMBANGAN PERANGKAT PEMBELAJARAN KOMPETENSI SULIT MATEMATIKA SMA DI RIAU

    Directory of Open Access Journals (Sweden)

    Ummi Aisyah

    2014-05-01

    Full Text Available Tujuan penelitian ini adalah untuk menghasilkan perangkat pembelajaran kompetensi sulit matematika SMA di Provinsi Riau yang berkualitas baik/layak yaitu valid, praktis, dan efektif. Penelitian ini merupakan penelitian pengembangan yang mengembangkan perangkat pembelajaran kompetensi sulit matematika SMA dengan menggunakan model pengembangan 4-D yang dikembangkan oleh Thiagarajan, Semmel & Semmel yang telah dimodifikasi sehingga hanya memuat tahap pen-definisian, perancangan, dan pengembangan. Penelitian ini menghasilkan perangkat pembelajaran kompetensi sulit matematika SMA yang meliputi silabus, rencana pelaksanaan pembelajaran (RPP, lembar kegiatan siswa (LKS, dan instrumen tes. Hasil validasi menunjukkan bahwa silabus, RPP, LKS yang dikembangkan memiliki kategori sangat valid untuk masing-masing silabus, RPP, LKS, dan test instrument. Hasil uji coba lapangan menunjukkan bahwa perangkat yang dikembangkan praktis dan efektif. Kepraktisan mencapai hasil sangat baik ditinjau dari penilaian guru dan siswa. Keefektifan ditinjau dari ketuntasan belajar siswa dan hasil observasi keterlaksanaan pembelajaran. Secara klasikal ketuntasan belajar mencapai 84,38%. Secara keseluruhan, hasil penelitian menunjukkan bahwa perangkat pembelajaran yang dikembangkan adalah layak untuk digunakan. Kata Kunci: pengembangan, perangkat pembelajaran, kompetensi sulit matematika

  12. Low power consumption mini rotary actuator with SMA wires

    Science.gov (United States)

    Manfredi, Luigi; Huan, Yu; Cuschieri, Alfred

    2017-11-01

    Shape memory alloys (SMAs) are smart materials widely used as actuators for their high power to weight ratio despite their well-known low energy efficiency and limited mechanical bandwidth. For robotic applications, SMAs exhibit limitations due to high power consumption and limited stroke, varying from 4% to 7% of the total length. Hysteresis, during the contraction and extension cycle, requires a complex control algorithm. On the positive side, the small size and low weight are eminently suited for the design of mini actuators for robotic platforms. This paper describes the design and construction of a light weight and low power consuming mini rotary actuator with on-board contact-less position and force sensors. The design is specifically intended to reduce (i) energy consumption, (ii) dimensions of the sensory system, and (iii) provide a simple control without any need for SMA characterisation. The torque produced is controlled by on-board force sensors. Experiments were performed to investigate the energy consumption and performance (step and sinusoidal angle profiles with a frequency varying from 0.5 to 10 Hz and maximal amplitude of {15}\\circ ). We describe a transient capacitor effect related to the SMA wires during the sinusoidal profile when the active SMA wire is powered and the antagonist one switched-off, resulting in a transient current time varying from 300 to 400 ms.

  13. Passive base isolation with superelastic nitinol SMA helical springs

    International Nuclear Information System (INIS)

    Huang, Bin; Zhang, Haiyang; Wang, Han; Song, Gangbing

    2014-01-01

    Seismic isolation of structures such as multi-story buildings, nuclear reactors, bridges, and liquid storage tanks should be designed to preserve structural integrity. By implementing seismic isolation technology, the deformation of superstructures can be dramatically reduced, consequently helping to protect their safety as well. In this paper, an innovative type of passive base isolation system, which is mainly composed of superelastic nitinol SMA helical springs, is developed. In order to verify the effectiveness of the proposed system, a two-story experimental steel frame model is constructed, and two superelastic SMA helical springs are thermo-mechanically built in the laboratory. To describe the nonlinear mechanical properties of the superelastic SMA helical springs under reciprocating load, a phenomenological model is presented in terms of a series of tensile tests. Afterwards, a numerical model of the two-story frame with the suggested isolation system is set up to simulate the response of the isolated frame subjected to an earthquake. Both the experimental and the numerical simulation results indicate that the proposed base isolation system can remarkably suppress structural vibrations and has improved isolation effects when compared with a steel spring isolation system. Due to the capabilities of energy dissipation as well as fully re-centering, it is very applicable to utilize the suggested isolation system in base isolated structures to resist earthquakes. (paper)

  14. SMA bellows as reversible thermal sensors/actuators

    International Nuclear Information System (INIS)

    Damanpack, A R; Bodaghi, M; Liao, W H

    2015-01-01

    In this paper, the feasibility of reversible bellows made of shape memory alloys (SMAs) in sensory and actuated applications to transfer pressure and/or temperature into a linear motion is investigated. An analytical three-dimensional model is developed to simulate key features of SMAs including martensitic transformation, reorientation of martensite variants, the shape memory effect, and pseudo-elasticity. Axisymmetric two-dimensional theory of thermo-inelasticity based on the non-linear Green–Lagrange strain tensor is employed to derive the equilibrium equations. A finite element method along with an iterative incremental elastic-predictor–inelastic-corrector procedure is developed to solve the governing equations with both material and geometrical non-linearities. The feasibility of reversible SMA bellows in transferring pressure and/or temperature into a linear motion is numerically demonstrated. In this respect, the effects of geometric parameters, magnitude of thermo-mechanical loadings and end conditions on the performances of SMA bellows are evaluated and discussed in depth. This study provides pertinent results toward an efficient and reliable design of reversible thermally-driven SMA bellows. (paper)

  15. Pengembangan Program Macromedia Flash 8 untuk Pembelajaran Fisika di SMA

    Directory of Open Access Journals (Sweden)

    Wiji Susilowati

    2007-12-01

    Full Text Available Tujuan penelitian adalah membuat dan mengevaluasi media pembelajaran fisika SMA menggunakan program Macromedia Flash 8. Subjek coba pada penelitian ini berjumlah 40 orang yang terdiri dari 10 siswa untuk uji coba instrumen penelitian, 10 siswa untuk ujicoba kelompok kecdl, dan 20 siswa untuk uji coba lapangan. Pengumpulan data dilakukan dengan mengguna­kan kuesioner dan tes fisika (pre-test dan post-test. Evaluasi terhadap program ditinjau dari aspek pembelajaran dan aspek media. Kritik dan saran digunakan untuk memperbaiki program. Hasil penelitian menunjukkan bahwa program Macromedia Flash 8 untuk pembelajaran fisika di SMA: (1 dirancang sesuai dengan prinsip-prinsip desain pembelajaran, (2 terbukti mampu menaikkan skor rerata tes fisika siswa sebesar 55,42%, (3 memiliki efisiensi waktu yang tinggi, (4 ditinjau dari aspek media Hinilai cukup bagus/menarik (dinilai/dikategorikan sedang oleh siswa, (5 ditinjau dari aspek pembelajaran secara keseluruhan program ini dinilai tinggi/jelas dimengerti oleh siswa, (6 ditinjau dari aspek media dinilai menarik (bagus/kategori tinggi oleh guru fisika, dan (7 ditinjau dari aspek pembelajaran juga dinilai menarik (bagus/kategori tinggi oleh guru fisika. Kata kunci: media pembelajaran fisika diSMA.

  16. KEEFEKTIFAN TEKNIK RELAKSASI UNTUK MENURUNKAN STRES AKADEMIK SISWA SMA

    Directory of Open Access Journals (Sweden)

    Suyono Suyono

    2016-08-01

    Full Text Available Abstract: This study aims at examining the effectiveness of relaxation techniques to release students’stress and tension regarding academic within Senior High School Assádah in Gresik City. This study employed quasi-experiment design using one group pretest-posttest model. The data of this study were obtained through academic stress inventory to attain a depiction of stress level encountered by the subject. The subjects of this study were seven students of Tenth Graders in SMA Assaadah Bungah Gresik who experienced low to average stress regarding exam preparation. The data were, then, analyzed by using Wilcoxon Statistic Analysis. The result of the study indicated that relaxation technique could lower and release the level of students stress in exam preparation. Key Words: relaxation technique, student academic stress   Abstrak: Penelitian ini bertujuan untuk  menguji keefektifan teknik relaksasi untuk menurunkan stres akademik siswa SMA Ass’adah di Kota Gresik dengan menggunakan rancangan kuasi eksperimen dengan model “one group pretest posttest design. Pengumpulan data dengan menggunakan inventori stres akademik tujuannya untuk memperoleh gambaran tingkat stres akademik pada subjek penelitian. Subjek penelitian adalah siswa yang mengalami stres akademik sedang dan rendah  dalam menghadapi ujian berjumlah 7 orang siswa pada kelas X SMA Assaadah Bungah Gresik. Teknik analisis data dengan menggunakanan analisis statistic Wilcoxon. Hasil penelitian menunjukkan adanya penurunan tingkat stres akademik menjelang ujian sesudah subjek mendapatkan layanan dengan teknik  relaksasi. Kata kunci: Teknik relaksasi, stres akademik siswa

  17. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  18. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  19. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  20. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  1. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  2. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  3. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  4. Confinement of NORMAL- AND HIGH-STRENGTH CONCRETE by Shape Memory Alloy (SMA) Spirals

    Science.gov (United States)

    Gholampour, A.; Ozbakkaloglu, T.

    2018-01-01

    This paper presents the results of an experimental study on the axial compressive behaviour of normal- and high-strength concrete (NSC and HSC) confined by shape memory alloy (SMA) spirals. A spiral pitch space of 36 and 20 mm was used for SMA confinement of NSC and HSC columns, respectively. The confining pressure was applied on the concrete cylinders by SMA spirals that were prestrained at 0, 5.5, and 9.5%. The compression test results on the SMA-confined specimens indicate that the prestrain level of SMA significantly affects the axial compressive behaviour of both NSC and HSC. An increase in the level of prestrain leads to an increase in the peak axial stress and corresponding strain of SMA-confined concrete.

  5. PENGARUH MODEL EXPERIENTIAL LEARNING TERHADAP KEMAMPUAN BERPIKIR SISWA SMA

    Directory of Open Access Journals (Sweden)

    Mar’atus Sholihah

    2016-11-01

    Full Text Available The purpose of this study was to determine the effect of Experiential Learning models developed by Kolb's theory of the critical thinking skills of high school students. This study uses a quasi experiment conducted in SMA Assa'adah Gresik. The population of students of class X IS second semester of academic year 2015/2016. Samples are 2 classes that are homogeneous. Methods of data collection using test questions and the ability to think critically using observation sheet. Data were analyzed by comparing the average acquisition value of critical thinking skills with experimental class control class. Average value of the critical thinking skills using model Experiential Learning higher at 80.9 while the control class is 71.2. Based on the average it can be concluded that the learning model of Experiential Learning can improve students' critical thinking skills. This study is expected to provide information on the application and benefits of the model Experiential Learning in teaching geography and make it more meaningful for students. Tujuan dari penelitian ini adalah mengetahui pengaruh model Experiential Learning yang dikembangkan oleh teori Kolb terhadap kemampuan berpikir kritis siswa SMA. Penelitian ini menggunakan metode quasi experimen yang dilakukan di SMA Assa’adah Gresik. Populasi siswa kelas X IS semester genap tahun pelajaran 2015/2016. Sampel yang digunakan sebanyak 2 kelas yang bersifat homogen. Metode pengumpulan data menggunakan soal tes kemampuan berpikir kritis serta menggunakan lembar observasi. Data yang diperoleh kemudian dianalisis dengan membandingkan rata-rata perolehan nilai kemampuan berpikir kritis kelas kontrol dengan kelas eksperimen. Nilai rata rata kemampuan berpikir kritis yang menggunakan model pembelajaran Experiential Learning lebih tinggi, yaitu sebesar 80,9, sedangkan kelas kontrol sebesar 71,2. Berdasarkan nilai rata-rata tersebut dapat disimpulkan bahwa model pembelajaran Experiential Learning dapat

  6. PENGARUH PENDEKATAN KONTEKSTUAL TERHADAP HASIL BELAJAR BIOLOGI SISWA SMA

    Directory of Open Access Journals (Sweden)

    Irwandi -

    2013-05-01

    Full Text Available Abstract: Contextual Teaching and Learning and Biology Learning Achievement among Senior High School Students. This quasi experimental study was designed to explain the effects of inquiry learning of Contextual Teaching and Learning (CTL, learning community of CTL, and entry behavior on Biology learning achievement of senior high school students of Bengkulu. The subjects were randomly selected from year-10 classes of eight schools and assigned to eight experimental classes. The study shows that: (1 the inquiry learning of CTL has no effect on the students’ cognitive learning achievement; (2 the learning community, particularly the extended one, of CTL  contributes to the students’ cognitive learning achievement; and (3 the students’ entry behavior did not affect their cognitive learning achievement when the students learned through inquiry process of CTL. Abstrak: Pengaruh Pendekatan Kontekstual terhadap Hasil Belajar Biologi Siswa SMA. Penelitian ini bertujuan untuk mengetahui: 1 pengaruh pendekatan kontekstual melalui strategi inkuiri terhadap hasil belajar kognitif siswa; 2 pengaruh pendekatan kontekstual melalui masyarakat belajar terhadap hasil belajar kognitif siswa; dan 3 pengaruh kemampuan awal siswa terhadap hasil belajar kognitifnya, pada pembela­jaran kontekstual melalui strategi inkuiri tingkat 1 dan 2. Penelitian dilakukan terhadap siswa-siswa pada pembelajaran biologi di 8 buah kelas X, masing-masing dari salah satu SMAN Bengkulu yang dipilih secara random. Penelitian ini menggunakan rancangan kuasi eksperimen Pretest-posttest Nonequivalent Control Group Design dengan rancangan penelitian faktorial 2 x 2 x 2. Hasil penelitian menunjukkan bahwa 1 pendekatan kontekstual melalui strategi inkuiri, tidak berpengaruh terhadap hasil belajar kognitif siswa di SMA 2 pendekatan kontekstual melalui masyarakat belajar berpengaruh terhadap hasil belajar kognitif siswa di SMA di mana hasil belajar kognitif melalui masyarakat belajar

  7. Evaluasi Kenyamanan Termal Ruang Sekolah SMA Negeri di Kota Padang

    OpenAIRE

    Lusi Susanti; Nike Aulia

    2016-01-01

    This research aims to determine thermal conditions and sensation of thermal comfort in classrooms of high schools in Padang. This study was conducted in 11 State Senior High School (SMA) represented 11 districts in Padang. About 10% of total student body in each schools were participated in this study to vote thermal comfort questioners. To determine thermal comfort level in this study, PMV (Predicted mean Vote) and PPD (Predicted Percentage of dissatisfied) method were used according to stan...

  8. KONTRIBUSI KONSELOR DALAM MEMBENTUK KARAKTER PESERTA DIDIK SMA

    Directory of Open Access Journals (Sweden)

    Agung Slamet Kusmanto

    2015-11-01

    Full Text Available Pengembangan model Pendidikan Holistik Berbasis Karakter, yang memfokuskan pada pembentukan seluruh aspek dimensi manusia, sehingga dapat menjadi manusia yang berkarakter. Kurikulum Holistik Berbasis Karakter ini disusun berdasarkan Kurikulum Berbasis Kompetensi (KBK dan diterapkan dengan menggunakan pendekatan Student Active Learning, Integrated Learning, Developmentally Appropriate Practices, Contextual Learning, Collaborative Learning, dan Multiple Intelligences yang semuanya dapat menciptakan suasana belajar yang efektif dan menyenangkan, serta dapat mengembangkan seluruh aspek dimensi manusia secara holistik. Maka diperlukan peran yang sangat besar dari guru pembimbing (konselor SMA dalam mengembangkan potensi peserta didiknya dalam mengembangkan potensinya dan membentuk karakter individu itu sendiri dan memberikan warna positif dalam suasana pembelajaran.

  9. Design and control of a linearity-enhanced SMA actuator

    International Nuclear Information System (INIS)

    Son, Hyung-Min; Tak, Chul-Gon; Lee, Yun-Jung; Kang, Seok-Won; Nam, Tae-Hyun; Kim, Jae-Il

    2010-01-01

    For the accurate and dexterous operation of mechanical systems, continuous-type actuation, rather than on/off-type actuation, is an indispensable function. However, conventional Ti-Ni alloys present difficulties for continuous positioning control, due to their hysteretic and abruptly changing relationship between strain and temperature. Therefore, this paper proposes a new linearity-enhanced SMA actuator using a temperature-gradient annealed alloy and an inverse hysteresis controller. In comparative experiments, the proposed controller and alloy exhibit superior performance for continuous actuation.

  10. MODEL PENGEMBANGAN PERANGKAT PEMBELAJARAN SEJARAH BERORIENTASI METAKOGNITIF JENJANG SMA

    Directory of Open Access Journals (Sweden)

    Cahyo Budi Utomo

    2015-01-01

    Full Text Available The importance of metacognitive based history learning in the high school level as requested in the “curriculum 2013” is the main background of this research. The research is focused to find the model of development of metacognitive based learning through research and development (R&D type research. The results showed an essential component in achieving successful management of metacognitive based history learning in high school education which the curriculum as a core competency analysis and basic competencies, lesson plan development, and the development of assessment tools. Development model of metacognitive based learning at high school education have main characteristic of the inclusion of explicit metacognitive learning goals and assignments and devices equipped with a rubric and assessment questionnaire. Metacognitive based history learning instructional tools that are developed in senior high school level has been carried out as optimally as possible by involving history teachers in the process of development and testing through focus group discussions and questionnaire.Keywords: Model, Instructional tool, Metacognitive, senior high school levelPentingnya orientasi metakognitif dalam perangkat pembelajaran sejarah jenjang SMA sebagaimana yang dikehendaki dalam implementasi kurikulum 2013 merupakan latar belakang utama penelitian ini. Penelitian difokuskan untuk menemukan model pengembangan perangkat pembelajaran berorientasi metakognitif melalui penelitian berjenis riset dan pengembangan (R&D. Metode penelitian R&D dilaksanakan melalui tiga tahap utama yaitu: tahap studi pendahuluan, tahap pengembangan, dan tahap uji publik. Hasil penelitian menunjukkan komponen esensial dalam mewujudkan keberhasilan penge-lolaan pembelajaran sejarah berorientasi metakognitif pada jenjang pendidikan SMA adalah kurikulum sebagai bahan analisis kompetensi inti dan kompetensi dasar, pengembangan RPP, dan pengembangan perangkat assesmen. Model

  11. MODEL EVALUASI INTERNAL KOMPETENSI GURU BAHASA INGGRIS (MODEL_EIKGBI) SMA

    OpenAIRE

    Sahraini Sahraini; Suwarsih Madya

    2015-01-01

    Studi ini bertujuan untuk: (1) mengembangkan model evaluasi kompetensi guru bahasa Inggris SMA yang dapat digunakan untuk mengidentifikasi kelebihan dan kekurangan guru dalam proses pemelajaran dan (2) mengetahui efektivitas implementasi evaluasi internal kompetensi guru bahasa Inggris SMA. Studi ini menggunakan metode penelitian dan pengembangan yang dikembangkan oleh Borg & Gall (1983, p.775). Subjek penelitian berjumlah 17 guru yang berasal dari 7 SMA di Sulawesi Selatan. Konstruk instrume...

  12. PENGEMBANGAN MODEL PEMBELAJARAN KIMIA UNTUK MENINGKATKAN KETERAMPILAN PROSES DAN KETERAMPILAN BERPIKIR SISWA SMA

    Directory of Open Access Journals (Sweden)

    Siti Darsati

    2015-01-01

    Full Text Available Tujuan penyusunan model pembelajaran kimia ini untuk meningkatkan keterampilan proses dan keterampilan berpikir siswa SMA. Model Pembelajaran Laju Reaksi untuk SMA mengandung 17 konsep, meliputi konsep abstrak, konsep yang berdasarkan prinsip dan konsep yang menyatakan simbol. Keterampilan Berpikir Kritis dan Keterampilan Proses Sains yang dikembangkan lebih banyak pada keterampilan menyimpulkan. Model ini telah di implementasikan pada 2 SMA di Kodya/Kabupaten Bandung. Kata kunci: Model pembelajaran, keterampilan proses, keterampilan berpikir

  13. Tensile and fatigue behavior of polymer composites reinforced with superelastic SMA strands

    Science.gov (United States)

    Daghash, Sherif M.; Ozbulut, Osman E.

    2018-06-01

    This study explores the use of superelastic shape memory alloy (SMA) strands, which consist of seven individual small-diameter wires, in an epoxy matrix and characterizes the tensile and fatigue responses of the developed SMA/epoxy composites. Using a vacuum assisted hand lay-up technique, twelve SMA fiber reinforced polymer (FRP) specimens were fabricated. The developed SMA-FRP composites had a fiber volume ratio of 50%. Tensile response of SMA-FRP specimens were characterized under both monotonic loading and increasing amplitude loading and unloading cycles. The degradation in superelastic properties of the developed SMA-FRP composites during fatigue loading at different strain amplitudes was investigated. The effect of loading rate on the fatigue response of SMA-FRP composites was also explored. In addition, fractured specimens were examined using the scanning electron microscopy (SEM) technique to study the failure mechanisms of the tested specimens. A good interfacial bonding between the SMA strands and epoxy matrix was observed. The developed SMA-FRP composites exhibited good superelastic behavior at different strain amplitudes up to at least 800 cycle after which significant degradation occurred.

  14. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  16. PENGEMBANGAN MODUL LATIHAN FORGIVENESS UNTUK SISWA SMA DI KOTA MALANG

    Directory of Open Access Journals (Sweden)

    Ari Dwi Yudhianto

    2016-12-01

    Full Text Available This research aims to develop a training modules forgiveness based on the appraisement of experts (reviewers and high school student's response to the training modules forgiveness that have been developed. This study adapting the model development of Borg and Gall (1983, while the structure of the writing module refers to the guide preparation of module which prepared by the Director General module PMPTK (2008. The results of this study are drafting a training module forgiveness for senior high school students in Malang. Based appraisement materials experts, media specialists, and linguists classified as good, according to school counselors classified very good and yield response of students classified as good. So, that these modules worthy be used in the awarding of guidance services in schools. Penelitian ini bertujuan untuk mengembangkan modul latihan forgiveness  berdasarkan penilaian para ahli (reviewer dan respon siswa SMA terhadap Modul latihan forgiveness yang telah dikembangkan. Penelitian ini mengadaptasi model pengembangan Borg and gall (1983, sedangkan struktur penulisan modul mengacu pada panduan penyusunan modul yang disusun oleh dirjen PMPTK (2008. Hasil penelitian ini adalah tersusunnya modul latihan forgiveness untuk siswa SMA di Kota Malang yang berdasarkan penilaian ahli materi, ahli media, dan ahli bahasa tergolong baik, menurut konselor sekolah tergolong sangat baik dan hasil respon siswa tergolong baik. sehingga modul ini layak digunakan dalam pemberian layanan bimbingan di sekolah.

  17. Design optimization and uncertainty analysis of SMA morphing structures

    International Nuclear Information System (INIS)

    Oehler, S D; Hartl, D J; Lopez, R; Malak, R J; Lagoudas, D C

    2012-01-01

    The continuing implementation of shape memory alloys (SMAs) as lightweight solid-state actuators in morphing structures has now motivated research into finding optimized designs for use in aerospace control systems. This work proposes methods that use iterative analysis techniques to determine optimized designs for morphing aerostructures and consider the impact of uncertainty in model variables on the solution. A combination of commercially available and custom coded tools is utilized. ModelCenter, a suite of optimization algorithms and simulation process management tools, is coupled with the Abaqus finite element analysis suite and a custom SMA constitutive model to assess morphing structure designs in an automated fashion. The chosen case study involves determining the optimized configuration of a morphing aerostructure assembly that includes SMA flexures. This is accomplished by altering design inputs representing the placement of active components to minimize a specified cost function. An uncertainty analysis is also conducted using design of experiment methods to determine the sensitivity of the solution to a set of uncertainty variables. This second study demonstrates the effective use of Monte Carlo techniques to simulate the variance of model variables representing the inherent uncertainty in component fabrication processes. This paper outlines the modeling tools used to execute each case study, details the procedures for constructing the optimization problem and uncertainty analysis, and highlights the results from both studies. (paper)

  18. REKAYASA PERANGKAT LUNAK MEDIA INFORMASI SMA QURANIAH PALEMBANG

    Directory of Open Access Journals (Sweden)

    Herlinda Kusmiati

    2017-08-01

    Full Text Available Seiring dengan semakin berkembangnya teknologi informasi dan meningkatnya penggunaan internet sebagai media informasi dikalangan masyarakat Indonesia. Hal ini mendorong SMA Quraniah Palembang untuk membenahi media informasi yang ada saat ini untuk meningkatkan jumlah siswa.  Media informasi yang dibuat berbasis website menggantikan Media  informasi saat ini yang masih menggunakan media brosur dan banner, dimana informasi yang diberikan masih sebatas informasi mengenai visi misi, profile, dan syarat pendaftaran siswa baru yang tidak dapat diakses dengan mudah oleh masyarakat. Dengan media informasi berbasis website dapat memberikan kemudahan kepada masyarakat dalam mendapatkan informasi mengenai profil sekolah, persyaratan pendafataran siswa baru. Selain itu, media informasi ini menyediakan informasi mengenai kegiatan-kegiatan yang ada di sekolah, ektrakulikuler siswa, serta fasilitas yang ada di sekolah. Media informasi ini dikelola oleh admin tata usaha, sehingga kesalahan-kesalahan dalam penyampaian informasi akan lebih mudah diperbaiki. Informasi-informasi mengenai SMA Quraniah Palembang dapat diakses kapanpun dan dimanapu, tidak terbatas pada salah satu wilayah saja. Media informasi ini dibuat dengan menggunakan Php & Mysql dan Waterfall sebagai metode pengembangan sistem.

  19. KESANTUNAN TUTURAN DIREKTIF DALAM INTERAKSI PEMBELAJARAN DI SMA

    Directory of Open Access Journals (Sweden)

    Mardiyah Putri Astuti

    2017-03-01

    Full Text Available Politeness speech in learning interactions in the classroom tend to be effected through a directive speech. Assessment of form directive speech made by using a guide to the theory and analysis based on speech act theory directive Bach and Harnish. This study aims to determine the form of politeness directive in an interaction study in SMA 1 Batu. Forms directive speech in learning interactions are marked with (1 directive requests, (2 directive question, (3 directive command, (4 The prohibition directive, (5 directive licensing, and (6 the directive advice. The results of the analysis of the forms of speech directive shows that teachers do politeness predominantly through commands, prohibitions, permissions, and advice, while the shape of the directive utterances made by teachers and students to consider cultural aspects. Kesantunan tuturan dalam interaksi pembelajaran di dalam kelas cenderung dilakukan melalui bentuk tuturan direktif. Pengkajian terhadap bentuk tuturan direktif dilakukan dengan mengggunakan teori dan panduan analisis berdasarkan teori tindak tutur direktif Bach dan Harnish. Penelitian ini bertujuan untuk mengetahui bentuk kesantunan direktif dalam interaksi pembelajaran di SMA 1 Batu. Bentuk tuturan direktif dalam interaksi pembelajaran ditandai dengan (1 direktif permintaan, (2 direktif pertanyaan, (3 direktif perintah, (4 direktif larangan, (5 direktif pemberian izin, dan (6 direktif nasihat. Hasil analisis mengenai bentuk tuturan direktif menunjukkan bahwa guru melakukan kesantunan secara dominan melalui perintah, larangan, izin, dan nasihat, sedangkan bentuk tuturan direktif dilakukan oleh guru dan siswa dengan mempertimbangkan aspek budaya.

  20. A Novel SMA-based Concept for Airfoil Structural Morphing

    Science.gov (United States)

    Barbarino, S.; Pecora, R.; Lecce, L.; Concilio, A.; Ameduri, S.; Calvi, E.

    2009-08-01

    The adaptive structures concept is of great interest in the aerospace field because of the several benefits which can be accomplished in the fields including noise reduction, load alleviation, weight reduction, etc., at a level in which they can be considered as compulsory in the design of future aircraft. Improvements in terms of the aerodynamic efficiency, aeroelastic behavior, stability, and manoeuvrability performance have already been proved through many international studies in the past. In the family of the Smart Materials, Shape Memory Alloys (SMA) seem to be a suitable solution for many static applications. Their high structural integrability in conjunction with actuation capabilities and a favorable performance per weight ratio, allows the development of original architectures. In this study, a morphing wing trailing edge concept is presented; morphing ability was introduced with the aim of replacing a conventional flap device. A compliant rib structure was designed, based on SMA actuators exhibiting structural potential (bearing external aerodynamic loads). Numerical results, achieved through a FE approach, are presented in terms of trailing edge induced displacement and morphed shape.

  1. Shape Memory Alloy (SMA)-Based Launch Lock

    Science.gov (United States)

    Badescu, Mircea; Bao, Xiaoqi; Bar-Cohen, Yoseph

    2014-01-01

    Most NASA missions require the use of a launch lock for securing moving components during the launch or securing the payload before release. A launch lock is a device used to prevent unwanted motion and secure the controlled components. The current launch locks are based on pyrotechnic, electro mechanically or NiTi driven pin pullers and they are mostly one time use mechanisms that are usually bulky and involve a relatively high mass. Generally, the use of piezoelectric actuation provides high precession nanometer accuracy but it relies on friction to generate displacement. During launch, the generated vibrations can release the normal force between the actuator components allowing shaft's free motion which could result in damage to the actuated structures or instruments. This problem is common to other linear actuators that consist of a ball screw mechanism. The authors are exploring the development of a novel launch lock mechanism that is activated by a shape memory alloy (SMA) material ring, a rigid element and an SMA ring holding flexure. The proposed design and analytical model will be described and discussed in this paper.

  2. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  3. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  4. PEMANFAATAN PTERIDOPHYTA KAWASAN HUTAN PACET TAMAN HUTAN RAYA (TAHURA RADEN SOERJO KECAMATAN PACET KABUPATEN MOJOKERTO SEBAGAI SUMBER BELAJAR BIOLOGI SMA

    Directory of Open Access Journals (Sweden)

    Neni Lusiana

    2015-07-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui Pteridophyta apa saja yang terdapat di kawasan Hutan Pacet Taman Hutan Raya Raden Soerjo Kecamatan Pacet Kabupaten Mojokerto dan bagaimana klasifikasinya, serta untuk mengetahui implementasi hasil penelitian Pteridophyta agar dapat digunakan sebagai sumber belajar biologi SMA. Jenis penelitian yang digunakan adalah jenis penelitian deskriptif. Penelitian di laksanakan di dua tempat, pengambilan sampel Pteridophyta dilaksanakan di kawasan hutan Pacet Taman Hutan Raya Raden Soerjo Kecamatan Pacet Kabupaten Mojokerto pada koordinat S 07o44’00” – S 07o42’10” dan E 112o31’30” – E 112o32’30”. Pengambilan sampel tumbuhan paku yang terestrial maupun epifit pada penelitian ini menggunakan metode jelajah (cruise methods. Sedangkan pemanfaatan hasil penelitian Pteridophyta di kawasan ini yaitu berupa modul yang divalidasi dilakukan oleh guru biologi di SMAN 2 Batu. Berdasarkan hasil penelitian ditemukan sebanyak 57 jenis Pteridophyta yang termasuk dalam 3 kelas. Ditemukan 3 jenis dari kelas Lycopodiinae, 1 jenis dari kelas Equisetinae, dan 53 jenis dari kelas Filicinae. Penggunaan Pteridophyta untuk sumber belajar di sekolah dalam bentuk modul dengan pemberian soal-soal dan pemberian tugas proyek membuat herbarium.

  5. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  6. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  7. Artificial heart for humanoid robot using coiled SMA actuators

    Science.gov (United States)

    Potnuru, Akshay; Tadesse, Yonas

    2015-03-01

    Previously, we have presented the design and characterization of artificial heart using cylindrical shape memory alloy (SMA) actuators for humanoids [1]. The robotic heart was primarily designed to pump a blood-like fluid to parts of the robot such as the face to simulate blushing or anger by the use of elastomeric substrates for the transport of fluids. It can also be used for other applications. In this paper, we present an improved design by using high strain coiled SMAs and a novel pumping mechanism that uses sequential actuation to create peristalsis-like motions, and hence pump the fluid. Various placements of actuators will be investigated with respect to the silicone elastomeric body. This new approach provides a better performance in terms of the fluid volume pumped.

  8. Kelompok Sebaya dan Perilaku Makan Menyimpang Remaja SMA di Jakarta

    Directory of Open Access Journals (Sweden)

    Rizky Ibrahim Isra

    2017-02-01

    Full Text Available                                                                          AbstrakTulisan ini membahas hubungan tekanan kelompok sebaya (peer group terhadap gejala perilaku makan menyimpang pada remaja SMA di Jakarta. Banyak studi lain yang mengkaji hal serupa, namun kajian yang membahas permasalahan perilaku makan menyimpang secara sosiologis masih sangat minim. Ketika studi lain hanya memfokuskan pada jenis kelamin perempuan saja, dalam tulisan ini jenis kelamin (laki-laki dan perempuan digunakan sebagai variabel kontrol. Studi sebelumnya yang hanya berfokus pada perempuan memiliki kelemahan karena kelompok sebaya tidak hanya memengaruhi perilaku remaja perempuan, tetapi juga memengaruhi laki-laki. Oleh karena itu, penulis berargumen bahwa kelompok sebaya dapat memengaruhi munculnya gejala perilaku makan menyimpang pada remaja SMA di Jakarta, baik pada laki-laki maupun perempuan. Tulisan ini merupakan hasil studi yang menggunakan metode kuantitatif dengan teknik pengambilan sampel secara acak bertingkat (stratified random sampling sebanyak 235 siswa salah satu SMA negeri di Jakarta. Tulisan ini mengungkapkan bahwa terdapat hubungan antara tekanan kelompok sebaya terhadap gejala perilaku makan menyimpang pada remaja SMA di Jakarta, di mana laki-laki lebih terpengaruh oleh pesan (message dari kelompok sebayanya, sedangkan perempuan lebih kuat terpengaruh oleh interaksi dan likeability.                                                                      AbstractThis article discusses the correlation between peer group pressure and eating disorder behavior symptoms in Jakarta Senior High School students. Many of studies talk about it, but the discussion about eating disorder behavior on sociology was rarely found. In this article, gender was used as a control variable while many of studies only focused on the

  9. CHARACTER EDUCATION IN ISLAMIC BOARDING SCHOOL- BASED SMA AMANAH

    Directory of Open Access Journals (Sweden)

    Nana Herdiana Abdurrahman

    2016-06-01

    Full Text Available This paper aims to describe findings of the study in pesantren-based SMA Amanah covering: 1 the principal policy in developing character education, 2 the methods used in developing character education, 3 students’ characteristics as the result of the character education process, 4 the problems encountered in the implementation of character education and the efforts made in addressing the implementation of character education at the school. This study applied qualitative method using descriptive technique. The data were collected through observation, interviews, and documentation. The findings of study showed that: 1 the principal’s policy in developing character education was carried out by implementing government policies in line with the school’s vision, mission, and programs; 2 the methods used in the process of character education were through role-modelling, assignments and nurturing, habituation, training programs, and  students’ participation in various types of activities, as well as the application of rewards and punishments; 3 the student's characteristics resulted from the character  education process were piousness and devotion as well as being able to apply their knowledge and piety in everyday life; 4 problems encountered in the implementation of character education  were different values and norms students brought from home; imbalance of facilities compared to the number of students; as well as teachers’ readiness to actually implement the new program, which  was character education. Meanwhile the efforts made to overcome those problems were namely developing personal, family, neighborhood or community characters, and making commitment of all related parties/stakeholdres of SMA Amanah.

  10. KONSUMSI SUPLEMEN ATLET REMAJA DI SMA RAGUNAN JAKARTA

    Directory of Open Access Journals (Sweden)

    Muhammad Q Aliyyan Wijaya

    2015-05-01

    Full Text Available ABSTRACTThe objective of this study was to investigate consumption of supplement among Ragunan High School Jakarta athletes. The cross sectional study was done with total subjects were 79 students of Ragunan high school who were willing to join the study and they were at school when the study was conducted. There was 92.4% athletes consumed supplement in last one year. All athletes from light and heavy sport category were found consumed supplement. The most popular supplement were vitamin, mineral, and phytonutrition in tablet form. There was 89.0% athletes consumed supplement everyday. Moreover, the main reason for supplementation was to meet a nutrition requirement. The source of information about food supplement was mostly from coach advisor. More than half of athletes got supplement for free from any sources. There was a significant correlation between category of sport and number of supplement used (p<0.05.Keywords: adolescent, athlete, high school, supplementABSTRAKTujuan penelitian adalah menggambarkan konsumsi suplemen pada atlet remaja di SMA Ragunan Jakarta. Desain penelitian ini menggunakan cross sectional dengan total subjek sebanyak 79 siswa SMA Ragunan yang bersedia mengikuti penelitian dan berada di sekolah saat penelitian dilakukan. Sebanyak 92,4% atlet mengaku mengonsumsi suplemen dalam satu tahun terakhir. Atlet dari kategori olahraga ringan dan berat sekali semuanya mengonsumsi suplemen. Suplemen vitamin, mineral, dan fitonutrisi dalam bentuk tablet merupakan jenis dan bentuk suplemen yang paling banyak dikonsumsi. Sebanyak 89,0% dari atlet mengonsumsi suplemen setiap hari. Alasan utama atlet mengonsumsi suplemen adalah untuk memenuhi kebutuhan gizi. Pelatih merupakan sumber infomasi tentang suplemen yang paling banyak dipilih oleh atlet. Lebih dari 50,0% atlet mendapatkan suplemen dengan cara diberi. Kategori olahraga dan jumlah suplemen yang dikonsumsi menunjukkan hubungan positif signifikan (p<0,05.Kata kunci: atlet, remaja

  11. MODEL PENGASUHAN ANALISIS TRANSAKSIONAL (AT UNTUK MENANGGULANGI PENYIMPANGAN PERILAKU SEKSUAL DI KALANGAN REMAJA KABUPATEN BULELENG (Studi pada Sekolah SMP/SMA yang Memiliki Siswa Terindikasi

    Directory of Open Access Journals (Sweden)

    Gede Sedanayasa

    2015-05-01

    Full Text Available Penelitian tahun pertama ini, bertujuan untuk mengidentifikasi harapan orang tua terhadap remaja dan harapan remaja terhadap orang tua.  Harapan dua pihak ini dijadikan bahan analisis transaksi pengasuhan orang tua dalam keluarga. Subjek penelitian adalah siswa-siswa SMP/SMA dan orang tua yang anak-anaknya terindikasi melakukan perilaku seksual menyimpang pada lima sekolah di Kabupaten Buleleng. Data  dikumpulkan dengan pencatatan dokumen, kuesioner, dan wawancara. Data  dianalisis dengan analisis deskriptif kuantitatif.  Hasil penelitian menunjukkan  bahwa,   remaja dan orang tua sama-sama memiliki harapan yang baik untuk keberlangsungan perkembangan keluarga hanya,  kedua pihak  tidak saling  memahami harapan masing-masing. Pihak remaja misalnya, mengharapkan agar orang tua dapat memenuhi kebutuhan sekolah secara layak dan ikhlas, dapat membimbing perkembangannya termasuk membantu memecahkan masalah belajar, sedangkan orang tua berharap agar remaja berperilaku hormat, tidak melecehkan orang tua, tidak membantah, patuh aturan keluarga dan sekolah, dan  meminta maaf jika keliru. Disarankan kepada ke dua pihak  (remaja dan orang tua untuk saling memahami keadaan masing-masing. Dari pihak remaja, dalam mengharapkan sesuatu tidak memaksakan kehendak, dan sebaliknya orang tua tetap memandang remaja sebagai individu yang berkembang, butuh perhatian dan penghargaan, sehingga memperlakukannya secara manusiawi.

  12. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  13. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  14. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  15. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  16. Monotonic and cyclic bond behavior of confined concrete using NiTiNb SMA wires

    International Nuclear Information System (INIS)

    Choi, Eunsoo; Chung, Young-Soo; Kim, Yeon-Wook; Kim, Joo-Woo

    2011-01-01

    This study conducts bond tests of reinforced concrete confined by shape memory alloy (SMA) wires which provide active and passive confinement of concrete. This study uses NiTiNb SMA which usually shows wide temperature hysteresis; this is a good advantage for the application of shape memory effects. The aims of this study are to investigate the behavior of SMA wire under residual stress and the performance of SMA wire jackets in improving bond behavior through monotonic-loading tests. This study also conducts cyclic bond tests and analyzes cyclic bond behavior. The use of SMA wire jackets transfers the bond failure from splitting to pull-out mode and satisfactorily increases bond strength and ductile behavior. The active confinement provided by the SMA plays a major role in providing external pressure on the concrete because the developed passive confinement is much smaller than the active confinement. For cyclic behavior, slip and circumferential strain are recovered more with larger bond stress. This recovery of slip and circumferential strain are mainly due to the external pressure of the SMA wires since cracked concrete cannot provide any elastic recovery

  17. National education ideology as the orientation of the school culture development policy at SMA N 1 and SMA N 3 Yogyakarta

    Directory of Open Access Journals (Sweden)

    Lusila Andriani Purwastuti

    2017-09-01

    Full Text Available This study aimed at describing the national education ideology as the orientation of the school culture development policy at SMA N 1 and SMAN 3 Yogyakarta. This research employed the qualitative approach through ethnography method. The subjects of the research were the school community. The object was the implementation of Pancasila on the development of the school culture. The data were collected through interviews, observations, and documentation. The data were analyzed using ethnography analysis as suggested by Spradley and they were validated by data triangulation and member checks. The results show that the national education ideology as the orientation of the school culture development is understood: (1 as an open ideology; (2 implemented on the basis value; instrumental values; the value of practices in the school culture; (3 The school culture in SMA N 1 and SMA N 3 is the implementation and contextualization of the values of Pancasila, along with the uniqueness of SMA N 1 with its “Teladan” icon which represents the religious morality and intellectual, as well as at SMA N 3 with its “Padmanaba” icon representing noble behavior. (4  Both schools have developed the school culture, namely: religious morality, social-culture, intellectual, and environment/management/leadership.

  18. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  19. Percutaneous Thrombin Injection to Complete SMA Pseudoaneurysm Exclusion After Failing of Endograft Placement

    International Nuclear Information System (INIS)

    Szopinski, Piotr; Ciostek, Piotr; Pleban, Eliza; Iwanowski, Jaroslaw; Krol, Malgorzata Serafin-; Marianowska, Agnieszka; Noszczyk, Wojciech

    2005-01-01

    Visceral aneurysms are potentially life-threatening vascular lesions. Superior mesenteric artery (SMA) pseudoaneurysms are a rare but well-recognized complication of chronic pancreatitis. Open surgical repair of such an aneurysm, especially in patients after previous surgical treatment, might be dangerous and risky. Stent graft implantation makes SMA pseudoaneurysm exclusion possible and therefore avoids a major abdominal operation. Percutaneous direct thrombin injection is also one of the methods of treating aneurysms in this area. We report a first case of percutaneous ultrasound-guided thrombin injection to complete SMA pseudoaneurysm exclusion after an unsuccessful endograft placement. Six-month follow-up did not demonstrate any signs of aneurysm recurrence

  20. EVALUASI DAN STRATEGI PENGEMBANGAN SMA INDONESISCH NERDERLANDSCHE SCHOOL (INS KAYUTANAM

    Directory of Open Access Journals (Sweden)

    David David

    2016-06-01

    Full Text Available Penelitian ini bertujuan untuk: (1 mengevaluasi SMA INS Kayutanam dan (2 menyusuan strategi pengembangan SMA INS Kayutanam berdasarkan hasil evaluasi tersebut. Pendekatan yang digunakan dalam penelitian ini adalah kuantitatif dan kualitatif. Sumber data dalam penelitian ini adalah 50 siswa kelas X dan XI, satu kepala sekolah, empat wakil kepala sekolah, 30 guru, dua pembina asrama dan dua orang dari pemerintahan. Hasil penelitian dibagi dalam dua kelompok yaitu hasil evaluasi dan strategi pengembangan. Berdasarkan hasil evaluasi ditemukan bahwa ada beberapa komponen yang perlu perbaikan yaitu kurikulum, kompetensi pendidik dan tenaga kependidikan, fasilitas, peran serta masyarakat, dana dan organisasi. Strategi pengembangan terdiri dari: (1 perumusan kurikulum terintegrasi yang memuat tujuan dan sasaran pendidikan yang diprakarsai oleh Sjafei; (2 perumusan metode mengajar yang sesuai dengan tujuan dan sasaran pendidikan yang diprakasai Sjafei; (3 pengelolaan aset produktif dengan pemanfaatan modal sosial; (4 pemanfaatan basis alumni; (5 membangun kerja sama dengan instansi terkait seperti sekolah lain, pemerintah daerah, dan pihak swasta. Kata kunci: evaluasi, strategi pengembangan   THE EVALUATION AND THE STRATEGY FOR DEVELOPING INDONESISCH NEDERLANDSCHE SCHOOL (INS KAYUTANAM SENIOR HIGH SCHOOL Abstract The study was to: (1 evaluate the development of INS Kayutanam Senior High School; and (2 design the strategy to develop INS Kayutanam Senior High School based on the results of the evaluation. The approach used of in the study was quantitative and qualitative. The data source in the study was 50 students from the X grade and the XI grade, one principal, four vice principals, 30 teachers, two dormitory advisors and two government representatives. The results of the study were divided into two groups namely the evaluation results and the development strategies. Based on the results of the study, the researcher found that there were several

  1. Kondisi Stres Akademik Siswa SMA Negeri di Kota Padang

    Directory of Open Access Journals (Sweden)

    Taufik Taufik

    2014-01-01

    Full Text Available This research conduct base from increasing the National Examination standards from recent years, and overload student’s learning activity in Senior High School (SMA. These conditions as triggers stress students, from a long time, its influence on their learning. Based that, the research is to identify level of student academic stress, and differences base gender, and school location. This research use Cluster Random Sampling. Samples are grouped into 3 (three, that’s school is located in downtown, midtown and the Suburbs. Research findings show that there are 15% of student’s stress academic at low levels of, 71,8% experiencing stress academic at medium level, and 13.2% of students experiencing stress academic at high level. There was no significant difference between the academic stress Student SMAN in Padang by location and gender. These research findings can then be an important basic need for guidance and counseling services in order to decrease the level of stress of academic students in Padang city, so that they can learn by making every effort that is optimal.

  2. Mesoscale simulation of elastocaloric cooling in SMA films

    International Nuclear Information System (INIS)

    Wendler, Frank; Ossmer, Hinnerk; Chluba, Christoph; Quandt, Eckhard; Kohl, Manfred

    2017-01-01

    A model for the evolution of the mechanical and thermal properties of shape memory alloy (SMA) films during elastocaloric cycling is developed and compared with experiments. The focus is on Ti-Ni-Cu-Co films of 20 μm thickness showing ultra-low fatigue properties. The films undergo a highly localized pseudoelastic transformation under tensile load cycling featuring strain and temperature band patterns that depend on the loading conditions. The corresponding temperature change is of special interest for film-based elastocaloric cooling applications. Starting from a thermodynamics-based Gibbs free energy model comprising mechanical and chemical contributions, we include a martensite-austenite interface free energy term, for which formulations from a phase-field model are adapted. A 3D continuum mechanics description is modified to treat plane stress conditions appropriate for polycrystalline thin films. The nucleation mechanism of strain bands under dynamic loading is described by introducing a spatial random distribution of the transformation stress barriers reflecting the degree of material inhomogeneity. Heat transfer due to conduction and convection is taken into account. The simulations predict the correlated mechanical and thermal local response of the films including band formation and evolution, tilt angle as well as strain-rate dependence. Macroscopic stress-strain characteristics and thermal evolution curves well represent the experimental results.

  3. PERANGKAT PENGEMBANGAN DIRI UNTUK MENINGKATKAN KOMPETENSI GURU DAN PENGEMBANGAN KEPRIBADIAN SISWA SMA

    Directory of Open Access Journals (Sweden)

    Wenny Hulukati

    2014-06-01

    Abstrak: Perangkat Pengembangan Diri untuk Meningkatkan Kompetensi Guru dan Pengembangan Kepribadian Siswa SMA. Penelitian ini bertujuan mengembangkan perangkat pengembangan diri untuk meningkatkan kompetensi guru dan pengembangan kepribadian siswa SMA. Kegiatan penelitian ini diawali dengan studi pendahuluan yang berkaitan dengan kompentensi guru pembimbing dalam melaksanakan pelayanan bimbingan dan konseling dan kecenderungan kepribadian siswa SMA. Langkah berikutnya adalah mendesain dan mengembangkan draf, dan diakhiri dengan kegiatan uji keefektifan produk. Dari kegiatan penelitian pengembangan ini telah dihasilkan produk pengembangan yang valid dan handal yang meliputi panduan guru, panduan siswa, dan panduan penilaian. Berdasarkan hasil uji keefektifan terhadap produk pengembangan diperoleh informasi bahwa perangkat panduan pengembangan diri efektif diguna­kan untuk meningkatkan kompetensi guru pembimbing dalam melaksanakan pelayanan bimbingan dan konseling dan pengembangan kepribadian siswa SMA.

  4. Persepsi Siswa Terhadap Pembelajaran Guru Pendidikan Jasmani Di SMA Muhammadiyah Kediri

    Directory of Open Access Journals (Sweden)

    Hendra Mashuri

    2017-05-01

    Full Text Available Tujuan yang ingin dicapai dalam penelitian ini adalah untuk memperoleh informasi tentang persepsi siswa terhadap pembelajaran guru pendidikan jasmani di SMA Muhammadiyah Kediri. Rumusan masalah dalam penelitian ini adalah bagaimana persepsi siswa terhadap pembelajaran guru pendidikan jasmani di SMA Muhammadiyah Kediri? Jenis penelitian ini adalah penelitian survei. Populasi yang digunakan adalah seluruh siswa SMA Muhammadiyah Kediri, sampel yang diambil berjumlah 60 siswa yang terdiri dari 20 siswa dari masing-masing kelas. Instrumen yang digunakan adalah angket dan dokumentasi. Teknik analisis data menggunakan persentase. Hasil penelitian menunjukkan bahwa persepsi siswa terhadap proses pembelajaran SMA Muhammadiyah Kediri mendapatkan skor 3115 atau rata-rata jawaban siswa 51,917 dengan persentase sebesar 74% dan masuk dalam kategori “Baik”. Dengan demikian dapat dikatakan bahwa persepsi siswa terhadap pembelajaran guru pendidikan jasmani adalah baik.

  5. Klasifikasi Kecamatan Berdasarkan Nilai Akhir SMA/MA di Kabupaten Aceh Selatan Menggunakan Analisis Diskriminan

    Directory of Open Access Journals (Sweden)

    Fitriana A.R.

    2015-11-01

    Full Text Available Analisis diskriminan merupakan bagian dari analisis peubah ganda. Analisis diskriminan digunakan untuk memodelkan variabel tak bebas yang bersifat kualitatif dengan variabel bebas yang bersifat kuantitatif. Pada penelitian ini, analisis diskriminan lebih dari dua kelompok diterapkan pada data nilai akhir SMA/MA di Kabupaten Aceh Selatan yang bertujuan untuk mendapatkan model untuk pengklasifikasian kecamatan. Pengklasifikasian ini bertujuan untuk melihat perbedaan kualitas siswa SMA/MA yang berada di masing-masing kecamatan Kabupaten Aceh Selatan berdasarkan data nilai akhir. Variabel tak bebas yang digunakan berupa klasifikasi kecamatan berdasarkan rata-rata jumlah nilai akhir SMA/MA yang berada di masing-masing kecamatan yang dibentuk dengan K-Means Cluster. Sedangkan variabel bebas yang digunakan adalah data rata-rata nilai akhir SMA/MA untuk setiap mata pelajaran yang diujiankan pada masing-masing jurusan setiap kecamatan. Model yang didapatkan adalah dua model diskriminan untuk jurusan IPA dan IPS.

  6. Specific methanogenic activity (SMA of industrial sludge from the aerobic and anaerobic biological treatment

    Directory of Open Access Journals (Sweden)

    Danieli Schneiders

    2013-08-01

    Full Text Available In this study, specific methanogenic activity (SMA tests were performed on textile sludge and food industry sludge. The textile sludge from an activated sludge was collected at the entrance of the secondary biologic clarifier and the food sludge was collected in a UASB reactor. Once collected, the sludges were characterized and tested for SMA. It was found that the microrganisms present in the food sludge had SMA of 0.17 gCOD-CH4 gSSV.d-1 and 337.05 mL of methane production, while the microrganisms of the textile sludge presented 0.10 gCOD-CH4 gSSV.d-1 of SMA and 3.04 mL of methane production. Therefore, the food sludge was more suitable to be used as a starting inoculum in UASB.

  7. PENGEMBANGAN KINERJA GURU MELALUI PENELITIAN TINDAKAN KELAS PADA SMA NEGERI DI KOTA PALOPO

    Directory of Open Access Journals (Sweden)

    Hilal Muhammad

    2015-12-01

    Tujuan penelitian ini adalah untuk mengungkap: (1 pelaksanaan pengembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo; dan (2 hambatan da-lam pelaksanaan pengembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo. Jenis penelitian adalah penelitian lapangan yang kajiannya bersifat kualitatif-verifikatif. Pendekatan yang digunakan adalah pendekatan fenomeno-logi. Metode pengumpulan data yang digunakan dalam penelitian ini adalah wawancara, observasi, dan dokumentasi. Hasil penelitian ini menunjukkan dua hal. Pertama, pengembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo belum berjalan optimal dan baru sebatas memenuhi kebutuhan persyarat-an kenaikan pangkat. Potensi guru belum dimanfaatkan melalui pemberdayaan, khususnya penelitian tindakan kelas. Kedua, hambatan dalam pelaksanaan pe-ngembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo adalah keterbatasan waktu, dana, sumber referensi kurang, lingkungan tidak kondusif, dan motivasi kurang. Selain itu, sebagian guru juga masih mengalami kesulitan dalam melakukan dan menyusun laporan hasil PTK.

  8. Optimal design of damping layers in SMA/GFRP laminated hybrid composites

    Science.gov (United States)

    Haghdoust, P.; Cinquemani, S.; Lo Conte, A.; Lecis, N.

    2017-10-01

    This work describes the optimization of the shape profiles for shape memory alloys (SMA) sheets in hybrid layered composite structures, i.e. slender beams or thinner plates, designed for the passive attenuation of flexural vibrations. The paper starts with the description of the material and architecture of the investigated hybrid layered composite. An analytical method, for evaluating the energy dissipation inside a vibrating cantilever beam is developed. The analytical solution is then followed by a shape profile optimization of the inserts, using a genetic algorithm to minimize the SMA material layer usage, while maintaining target level of structural damping. Delamination problem at SMA/glass fiber reinforced polymer interface is discussed. At the end, the proposed methodology has been applied to study the hybridization of a wind turbine layered structure blade with SMA material, in order to increase its passive damping.

  9. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  10. Faktor Penghambat Operasionalisasi Kunjungan Rumah di SMA Negeri se-Kota Semarang

    Directory of Open Access Journals (Sweden)

    Juwita Nasruddin

    2015-09-01

    Full Text Available Penelitian dilaksanakan berdasarkan fenomena di lapangan pada saat penulis melaksanakan Praktik Pengalaman Lapangan (PPL di SMP Negeri 8 Semarang dan observasi awal di SMA Negeri 8 Semarang. Tujuan dari penelitian ini untuk mengetahui apa faktor penghambat operasionalisasi Home Visit di SMA Negeri se-kota Semarang tahun ajaran 2014/2015. Jenis penelitian yang digunakan oleh penulis dalam penelitian ini yaitu jenis penelitian survei. Untuk populasi pada penelitian ini adalah semua guru BK di SMA se-kota Semarang yaitu sejumlah 59 guru BK. Sampel yang digunakan adalah sejumlah populasi yang ada. Sedangkan instrumen yang digunakan dalam penelitian ini merupakan angket. Analisis data yang digunakan dalam penelitian ini adalah deskriptif persentase. Hasil yang ditemukan bahwa faktor penghambat operasionalisasi Home Visit di SMA Negeri se-kota Semarang mengalami hambatan cukup tinggi dengan presentase sebesar 65,03%. Simpulan yang didapatkan adalah Faktor Penghambat Operasionalisasi Kunjungan Rumah (Home visit di SMA Negeri se-kota Semarang adalah kurangnya pemahaman dari guru BK berkaitan dengan Home Visit. Adapun saran yang diberikan kepada guru BK SMA Negeri se-kota Semarang adalah untuk mempelajari hakikat Home Visit dan melaksanakan prosedur operasionalisasi Home Visit dengan baik dan benar dari perencanaan, pelaksanaan, evaluasi, analisis evaluasi, tindak lanjut hingga laporan. The research was conducted based on the phenomenon on the ground when implementing writer Practice Field Experience (PPL in SMPN 8 Semarang and preliminary observations in SMAN 8 Semarang. The purpose of this study to determine what factors inhibiting the operation of the Home Visit at all SMA Negeri in Semarang throughout the academic year 2014/2015. The type research used by the writer in this study is a survey research. The population in this study were all counselors at SMA in Semarang city. There were 59 counselors. The sample used were as many as the population

  11. Numerical and Experimental Investigation on Aerodynamic Characteristics of SMA Actuated Smart Wing Model

    OpenAIRE

    Iyyappan Balaguru; Sathiavelu Sendhilkumar

    2013-01-01

    Due to the advancements in smart actuators, morphing (changing) of aircraft wings has been investigated by increasing number of researchers in recent years. In this research article, the concept of morphing is introduced to the conventional aircraft wing model with the utilization of Shape memory alloys (SMAs). An actuating mechanism is developed and built inside the aircraft wing model along with the SMA actuators which is used to morph its shape. The aircraft wing model with the SMA actuati...

  12. Investigations on Vibration Characteristics of Sma Embedded Horizontal Axis Wind Turbine Blade

    Science.gov (United States)

    Jagadeesh, V.; Yuvaraja, M.; Chandhru, A.; Viswanathan, P.; Senthil kumar, M.

    2018-02-01

    Vibration induced in wind turbine blade is a solemn problem as it reduces the life of the blade and also it can create critical vibration onto the tower, which may cause serious damage to the tower. The aim of this paper is to investigate the vibration characteristics of the prototype horizontal axis wind turbine blade. Shape memory alloys (SMA), with its variable physical properties, provides an alternative actuating mechanism. Heating an SMA causes a change in the elastic modulus of the material and hence SMAs are used as a damping material. A prototype blade with S1223 profile has been manufactured and the natural frequency is found. The natural frequency is found by incorporating the single SMA wire of 0.5mm diameter over the surface of the blade for a length of 240 mm. Similarly, number of SMA wires over the blade is increased up to 3 and the natural frequency is found. Frequency responses showed that the embedment of SMA over the blade’s surface will increase the natural frequency and reduce the amplitude of vibration. This is because of super elastic nature of SMA. In this paper, when SMA wire of 0.5 mm diameter and of length of 720 mm is embedded on the blade, an increase in the natural frequency by 6.3% and reducing the amplitude by 64.8%. Results of the experimental modal and harmonic indicates the effectiveness of SMA as a passive vibration absorber and that it has potential as a modest and high-performance method for controlling vibration of the blade.

  13. Peningkatan Mutu Pendidikan SMA Muhammadiyah 2 Sidoarjo sebagai Sekolah Berkategori The Outstanding School of Muhammadiyah

    OpenAIRE

    Hidayatulloh Hidayatulloh

    2016-01-01

    This article examines about improving the education quality of SMA Muhammadiyah 2 Sidoarjo as the Outstanding School of Muhammadiyah. This article reveals that the quality improvement of SMA Muhammadiyah 2 Sidoarjo was conducted through: the arrangement of school program and self evaluation, the reinforcement of vision, mission and education objective, the reinforcement of leadership and teamwork, the improvement of teachers and educators competence, the improvement learners quality input, th...

  14. Perancangan Sistem Informasi SMA Negeri 1 Babalan Dengan Menggunakan Pemrograman PHP Dan MySQL

    OpenAIRE

    Yulita, Devi

    2014-01-01

    Tulisan ini bertujuan untuk membangun suatu sistem informasi pada SMA Negeri 1 Babalan. Sistem ini dikembangkan dengan menggunakan perangkat lunak PHP, MySQL, Apache, dan Mozilla Firefox juga software pembantu lainnya seperti Adobe Dreamweaver CS5. Tujuan dari sistem informasi ini adalah untuk menyajikan informasi profil sekolah, visi, misi dan tujuan, daftar siswa, daftar guru. Merancang sebuah website untuk membantu siswa dalam memperoleh informasi SMA Negeri 1 Babalan dan website ini dapat...

  15. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  16. Numerical tool for SMA material simulation: application to composite structure design

    International Nuclear Information System (INIS)

    Chemisky, Yves; Tahiri, Vanessa; Duval, Arnaud; Piotrowski, Boris; Ben Zineb, Tarak; Patoor, Etienne

    2009-01-01

    Composite materials based on shape memory alloys (SMA) have received growing attention over these last few years. In this paper, two particular morphologies of composites are studied. The first one is an SMA/elastomer composite in which a snake-like wire NiTi SMA is embedded into an elastomer ribbon. The second one is a commercial Ni 47 Ti 44 Nb 9 which presents elastic–plastic inclusions in an NiTi SMA matrix. In both cases, the design of such composites required the development of an SMA design tool, based on a macroscopic 3D constitutive law for NiTi alloys. Two different strategies are then applied to compute these composite behaviors. For the SMA/elastomer composite, the macroscopic behavior law is implemented in commercial FEM software, and for the Ni 47 Ti 44 Nb 9 a scale transition approach based on the Mori–Tanaka scheme is developed. In both cases, simulations are compared to experimental data

  17. Experimental characterization of self-sensing SMA actuators under controlled convective cooling

    International Nuclear Information System (INIS)

    Lewis, N; York, A; Seelecke, S

    2013-01-01

    Shape memory alloy (SMA) wires are attractive for actuation systems due to their high energy density, light weight and silent operation. In addition, they feature self-sensing capabilities by relating electrical resistance measurements to strain changes. In real world applications SMAs typically operate in non-ambient air and it is imperative to understand an actuator’s behavior under varying convective cooling conditions, especially for smaller diameter wires, where convective effects are amplified. This paper shows that the multi-functionality of SMA actuators can be further extended by related heating power to convective air speed. It investigates the relationship between the normalized excess power needed and corresponding airspeed under controlled, laminar airflow patterns in a small-scale wind tunnel. For each experiment, airflow through the wind tunnel, strain in the SMA wire, and power supplied to the SMA wire were controlled, while the stress and resistance of the wire were measured. The ability to understand and predict an SMA wire’s behavior under various external airflows will aid in the design and understanding of future SMA actuated structures, such as micro-air vehicles, and shows that SMAs can function as self-sensing actuators and airspeed sensors. (paper)

  18. Domain general sequence operations contribute to pre-SMA involvement in visuo-spatial processing

    Directory of Open Access Journals (Sweden)

    E. Charles eLeek

    2016-01-01

    Full Text Available This study used 3T MRI to elucidate the functional role of supplementary motor area (SMA in relation to visuo-spatial processing. A localizer task contrasting sequential number subtraction and repetitive button pressing was used to functionally delineate non-motor sequence processing in pre-SMA, and activity in SMA-proper associated with motor sequencing. Patterns of BOLD responses in these regions were then contrasted to those from two tasks of visuo-spatial processing. In one task participants performed mental rotation in which recognition memory judgments were made to previously memorized 2D novel patterns across image-plane rotations. The other task involved abstract grid navigation in which observers computed a series of imagined location shifts in response to directional (arrow cues around a mental grid. The results showed overlapping activation in pre-SMA for sequential subtraction and both visuo-spatial tasks. These results suggest that visuo-spatial processing is supported by non-motor sequence operations that involve pre-SMA. More broadly, these data further highlight the functional heterogeneity of pre-SMA, and show that its role extends to processes beyond the planning and online control of movement.

  19. Energy-dissipating and self-repairing SMA-ECC composite material system

    International Nuclear Information System (INIS)

    Li, Xiaopeng; Li, Mo; Song, Gangbing

    2015-01-01

    Structural component ductility and energy dissipation capacity are crucial factors for achieving reinforced concrete structures more resistant to dynamic loading such as earthquakes. Furthermore, limiting post-event residual damage and deformation allows for immediate re-operation or minimal repairs. These desirable characteristics for structural ‘resilience’, however, present significant challenges due to the brittle nature of concrete, its deformation incompatibility with ductile steel, and the plastic yielding of steel reinforcement. Here, we developed a new composite material system that integrates the unique ductile feature of engineered cementitious composites (ECC) with superelastic shape memory alloy (SMA). In contrast to steel reinforced concrete (RC) and SMA reinforced concrete (SMA-RC), the SMA-ECC beams studied in this research exhibited extraordinary energy dissipation capacity, minimal residual deformation, and full self-recovery of damage under cyclic flexural loading. We found that the tensile strain capacity of ECC, tailored up to 5.5% in this study, allows it to work compatibly with superelastic SMA. Furthermore, the distributed microcracking damage mechanism in ECC is critical for sufficient and reliable recovery of damage upon unloading. This research demonstrates the potential of SMA-ECC for improving resilience of concrete structures under extreme hazard events. (paper)

  20. Feasibility study of an active soft catheter actuated by SMA wires

    Science.gov (United States)

    Konh, Bardia; Karimi, Saeed; Miller, Scott

    2018-03-01

    This study aims to assess the feasibility of using a combination of thin elastomer tubes and SMA wires to develop an active catheter. Cardiac catheters have been widely used in investigational and interventional procedures such as angiography, angioplasty, electro- physiology, and endocardial ablation. The commercial models manually steer inside the patient's body via internally installed pull wires. Active catheters, on the other hand, have the potential to revolutionize surgical procedures because of their computer-controlled and enhanced motion. Shape memory alloys have been used for almost a decade as a trustworthy actuator for biomedical applications. In this work, SMA wires were attached to a small pressurized elastomer tube to realize deflection. The tube was pressurized to maintain a constant stress on the SMA wires. The tip motion via actuation of SMA wires was then measured and reported. The results of this study showed that by adopting an appropriate training process for the SMA wires prior to performing the experiments and adopting an appropriate internal pressure for the elastomer tube, less external loads on SMA wires would be needed for a consistent actuation.

  1. SMA Foils for MEMS: From Material Properties to the Engineering of Microdevices

    Science.gov (United States)

    Kohl, Manfred; Ossmer, Hinnerk; Gueltig, Marcel; Megnin, Christof

    2018-03-01

    In the early nineties, microelectromechanical systems (MEMS) technology has been still in its infancy. As silicon (Si) is not a transducer material, it was clear at the very beginning that mechanically active materials had to be introduced to MEMS in order to enable functional microdevices with actuation capability beyond electrostatics. At that time, shape memory alloys (SMAs) have been available in bulk form, mainly as SMA wires and SMA plates. On the macro scale, these materials show highest work densities compared to other actuation principles in the order of 107 J/m3, which stimulated research on the integration of SMA to MEMS. Subsequently, two approaches for producing planar materials have been initiated (1) magnetron sputtering of SMA thin films and (2) the integration of rolled SMA foils, which both turned out to be very successful creating a paradigm change in microactuation technology. The following review covers important milestones of the research and development of SMA foil-based microactuators including materials characterization, design engineering, technology, and demonstrator development as well as first commercial products.

  2. Behavior of NiTiNb SMA wires under recovery stress or prestressing.

    Science.gov (United States)

    Choi, Eunsoo; Nam, Tae-Hyun; Chung, Young-Soo; Kim, Yeon-Wook; Lee, Seung-Yong

    2012-01-05

    The recovery stress of martensitic shape-memory alloy [SMA] wires can be used to confine concrete, and the confining effectiveness of the SMA wires was previously proved through experimental tests. However, the behavior of SMA wires under recovery stress has not been seriously investigated. Thus, this study conducted a series of tests of NiTiNb martensitic SMA wires under recovery stress with varying degrees of prestrain on the wires and compared the behavior under recovery stress with that under prestressing of the wires. The remaining stress was reduced by the procedure of additional strain loading and unloading. More additional strains reduced more remaining stresses. When the SMA wires were heated up to the transformation temperature under prestress, the stress on the wires increased due to the state transformation. Furthermore, the stress decreased with a decreasing temperature of the wires down to room temperature. The stress of the NiTiNb wires was higher than the prestress, and the developed stress seemed to depend on the composition of the SMAs. When an additional strain was subsequently loaded and unloaded on the prestressed SMA wires, the remaining stress decreased. Finally, the remaining stress becomes zero when loading and unloading a specific large strain.

  3. SMA Foils for MEMS: From Material Properties to the Engineering of Microdevices

    Science.gov (United States)

    Kohl, Manfred; Ossmer, Hinnerk; Gueltig, Marcel; Megnin, Christof

    2017-12-01

    In the early nineties, microelectromechanical systems (MEMS) technology has been still in its infancy. As silicon (Si) is not a transducer material, it was clear at the very beginning that mechanically active materials had to be introduced to MEMS in order to enable functional microdevices with actuation capability beyond electrostatics. At that time, shape memory alloys (SMAs) have been available in bulk form, mainly as SMA wires and SMA plates. On the macro scale, these materials show highest work densities compared to other actuation principles in the order of 107 J/m3, which stimulated research on the integration of SMA to MEMS. Subsequently, two approaches for producing planar materials have been initiated (1) magnetron sputtering of SMA thin films and (2) the integration of rolled SMA foils, which both turned out to be very successful creating a paradigm change in microactuation technology. The following review covers important milestones of the research and development of SMA foil-based microactuators including materials characterization, design engineering, technology, and demonstrator development as well as first commercial products.

  4. REKAYASA MEDIA PEMBELAJARAN FISIKA BERBASIS WEBSITE UNTUK SISWA KELAS X SMA NEGERI I GUBUG POKOK BAHASAN GERAK LURUS

    Directory of Open Access Journals (Sweden)

    denny rachmadi

    2016-03-01

    Full Text Available Rendahnya  hasil  belajar  siswa  dalam  pembelajaran sika mendorong keinginan guru untuk memperbaiki model pembelajaran sika agar mendapatkan hasil belajar yang sesuai dengan harapan. Dalam materi sika dibutuh- kan adanya kemampuan siswa untuk berabstraksi dalam memahai konsep sika. Hal ini dapat di atasi dengan adan- ya praktikum sika, itu kalau fasilitas laboratorium sika lengkap. Untuk mengatasi kekurangan sarana laborato- rium sika dapat digunakan media computer untuk me- nampilkan konsep sika yang abstrak menjadi nyata baik dalam bentuk lm atau animasi. Selain itu adanya kegiatan guru dan kelembagaan mengurangi jumlah tatap muka dalam pembelajaran  sika.  Dengan  demikian  dibutuh- kan media pembelajaran sika yang berbasis website agar siswa dapat belajar.  Yang menjadi masalah dalam penelitian ini media pem- belajaran computer yang berbasis website yang bagaimana yang akan diciptakan dan yang dapat dimanfaatkan un- tuk meningkatan hasil belajar sika kelas X SMA Negeri 1 Gubug. Untuk mengetahui layak ataupun tidak layak peng- gunaan media pembelajaran sika menggunakan media komputer berbasis website tersebut perlu adanya uji in- strument. Uji kelayakan instrument dalam penelitian ini menggunakan white box dan black box. Selain itu juga di- lakukan uji respon user dan hasil belajar siswa terhadap pemakaian instrument ini menggunakan angket (kuision- er dengan metode membandingan instrument ini dengan instrument lain yang ada di SMA N I Gubug. Dari hasil uji whitebox dan blackbox tidak ada ma- salah dan program dapat berjalan dengan baik. Dari uji respon user menggunakan angket diperoleh data dan anal- isis data menyatakan bahwa 80% respon user memiliki ke- cenderungan yang tinggi dan l3,3%7 dalam kategori cukup untuk menyukai media pembelajaran sika berbasis web dari pada instrument lain yang hanya 23,33% dalam kat- egori cukup dan 66,67% pada kategori rendah. Selain itu dari uji hasil

  5. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  6. Profil Antisipasi Siswa SMA Dalam Memecahkan Masalah Integral

    Directory of Open Access Journals (Sweden)

    Erfan Yudianto

    2015-06-01

    Full Text Available Penelitian ini dilatarbelakangi oleh sulitnya siswa dalam menyelesaikan masalah integral khusunya luas daerah. Banyak siswa hanya menyelesaikan masalah integral hanya berdasarkan rumus yang sudah disediakan. Siswa jarang mengaitkan konsep-konsep yang saling terkait, dalam hal ini konsep integral subpokokbahasan luas daerah.Tujuan penelitian ini untuk mendeskripsikan Profil antisipasi siswa SMA dalam memecahkan masalah integral. Hasil penelitian ini dapat dimanfaatkan oleh guru untuk membantu siswa mengaitkan konsep-konsep yang belum terkait.  Penelitian ini menggunakan metode tes dan wawancara. Tes berupa  tes kemampuan matematika yang diberikan kepada siswa, sehingga diperoleh siswa berkemampuan tinggi dan wawancara diberikan kepada siswa yang bersangkutan untuk menggali dan melihat jaringan konsep yang dimiliki siswa dalam menyelesaikan masalah integral. Subjek dalam penelitian ini termasuk dalam antisipasi terinternasilsasi dikarenakan siswa secara spontan menerapkan rumus integral tanpa menganalisis soal yang diberikan.This research is motivated by the difficulty of students in solving integral problems especially the area. Many students just completed the integral problems just based on a formula that has been provided. Students rarely associate the concepts are interrelated, in this case the integral concept of the area. The purpose of this study was to describe the profile anticipation of high school students in problem solving integrals. The results could be used by teachers to help students link the concepts are not related. This study uses tests and interviews. The tests such as math skills test given to students, in order to obtain a high ability students and interviews given to the student to explore and see the network concept of the students in problem solving integrals. Subjects in this study are included in anticipation terinternasilsasi because students spontaneously apply the integral formula without analyzing the questions

  7. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  8. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  9. Probabilistic fiber tracking of the language and motor white matter pathways of the supplementary motor area (SMA) in patients with brain tumors.

    Science.gov (United States)

    Jenabi, Mehrnaz; Peck, Kyung K; Young, Robert J; Brennan, Nicole; Holodny, Andrei I

    2014-12-01

    Accurate localization of anatomically and functionally separate SMA tracts is important to improve planning prior to neurosurgery. Using fMRI and probabilistic DTI techniques, we assessed the connectivity between the frontal language area (Broca's area) and the rostral pre-SMA (language SMA) and caudal SMA proper (motor SMA). Twenty brain tumor patients completed motor and language fMRI paradigms and DTI. Peaks of functional activity in the language SMA, motor SMA and Broca's area were used to define seed regions for probabilistic tractography. fMRI and probabilistic tractography identified separate and unique pathways connecting the SMA to Broca's area - the language SMA pathway and the motor SMA pathway. For all subjects, the language SMA pathway had a larger number of voxels (PProbabilistic tractography can identify unique white matter tracts that connect language SMA and motor SMA to Broca's area. The language SMA is more significantly connected to Broca's area than is the motor subdivision of the SMA proper. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  10. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  11. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  12. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  13. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  15. Miskonsepsi Buku Ajar Fisika SMA Kelas X Pada Pokok Bahasan Dinamika Gerak

    Directory of Open Access Journals (Sweden)

    Fachmi Nurdiansyah

    2018-03-01

    Full Text Available Penelitian ini bertujuan untuk memaparkan bentuk-bentuk miskonsepsi pada pokok bahasan dinamika gerak dalam buku ajar fisika SMA kelas X. Adapun buku ajar yang digunakan dalam penelitian ini, yaitu: (1 Fisika untuk SMA/MA Kelas X Semester I karangan RA dan SI yang diterbitkan tahun 2012 oleh penerbit IP, (2 Fisika untuk SMA/MA Kelas X Semester I karangan TPM yang diterbitkan tahun 2013 oleh penerbit VP, dan (3 Fisika Peminatan untuk SMA/MA Kelas X karangan SN dan SZ yang diterbitkan tahun 2013 oleh penerbit YW. Penelitian ini merupakan penelitian kualitatif deskriptif. Objek dalam penelitian ini adalah data berupa aspek penjelasan konsep, penulisan rumus, penulisan simbol, penulisan satuan, dan penyajian gambar pada pokok bahasan dinamika gerak dalam buku ajar fisika SMA. Penelitian dilakukan dengan cara menganalisis data dalam buku ajar fisika SMA yang dibandingkan dengan buku teks fisika universitas. Berdasarkan analisis data yang telah dilakukan, dapat disimpulkan bahwa miskonsepsi pada pokok bahasan dinamika gerak terdapat dalam buku ajar fisika SMA. Buku ajar IP mengalami miskonsepsi pada aspek penjelasan konsep dengan persentase 10%, penulisan rumus dengan persentase 57,14%, penulisan simbol dengan persentase 46,15%, dan penyajian gambar dengan persentase 20%. Buku ajar VP mengalami miskonsepsi pada aspek penjelasan konsep dengan persentase 10%, penulisan rumus dengan persentase 85,71%, penulisan simbol dengan persentase 79,62%, dan penyajian gambar dengan persentase 80%. Buku ajar YW mengalami miskonsepsi pada aspek penjelasan konsep dengan persentase 10%, penulisan rumus dengan persentase 85,71%, penulisan simbol dengan persentase 69,23, dan penyajian gambar dengan persentase 20%. Pada aspek penulisan satuan, tidak terdapat miskonsepsi dalam buku ajar IP, VP, dan YW.

  16. Protective effects of long-term lithium administration in a slowly progressive SMA mouse model.

    Science.gov (United States)

    Biagioni, Francesca; Ferrucci, Michela; Ryskalin, Larisa; Fulceri, Federica; Lazzeri, Gloria; Calierno, Maria Teresa; Busceti, Carla L; Ruffoli, Riccardo; Fornai, Francesco

    2017-12-01

    In the present study we evaluated the long-term effects of lithium administration to a knock-out double transgenic mouse model (Smn-/-; SMN1A2G+/-; SMN2+/+) of Spinal Muscle Atrophy type III (SMA-III). This model is characterized by very low levels of the survival motor neuron protein, slow disease progression and motor neuron loss, which enables to detect disease-modifying effects at delayed time intervals. Lithium administration attenuates the decrease in motor activity and provides full protection from motor neuron loss occurring in SMA-III mice, throughout the disease course. In addition, lithium prevents motor neuron enlargement and motor neuron heterotopy and suppresses the occurrence of radial-like glial fibrillary acidic protein immunostaining in the ventral white matter of SMA-III mice. In SMA-III mice long-term lithium administration determines a dramatic increase of survival motor neuron protein levels in the spinal cord. These data demonstrate that long-term lithium administration during a long-lasting motor neuron disorder attenuates behavioural deficit and neuropathology. Since low level of survival motor neuron protein is bound to disease severity in SMA, the robust increase in protein level produced by lithium provides solid evidence which calls for further investigations considering lithium in the long-term treatment of spinal muscle atrophy.

  17. PEMBELAJARAN THINK-PAIR-SHARE, KETERAMPILAN METAKOGNITIF, DAN HASIL BELAJAR KOGNITIF SISWA SMA

    Directory of Open Access Journals (Sweden)

    Sri Amnah S.

    2012-05-01

    Full Text Available Abstract: Think-Pair-Share Learning, Meta-cognitive Skills and Cognitive Learning Outcomes. The study investigates the effects of meta-cognitive skills based Think-Pair-Share cooperative learning on meta-cognitive skills and cognitive learning outcomes of 11th grade students of Senior High Schools in Pekanbaru. The sample consists of 11th grade students of SMA 9 as an experiment group and 11th grade students SMA 10 as a control group. Based on analyzing the data using ANCOVA, the results show that there is a signifi­cant difference in meta-cognitive skills and cognitive learning outcomes of the students in the experimental and the control groups, and there is no significant difference between students who have high and low academic levels in their meta-cognitive skills and cognitive learning outcomes. Abstrak: Pembelajaran Think-Pair-Share, Keterampilan Metakognitif, dan Hasil Belajar Kognitif Siswa SMA. Penelitian ini bertujuan mengukur pengaruh pembela­jaran koperatif Think-Pair-Share terha­dap keterampilan metakognitif dan hasil belajar kognitif siswa SMA. Sampel dipilih secara acak dari popu­lasi 13 SMA di Pekanbaru. Dengan menggunakan ANAKOVA, hasilnya menunjukkan bahwa terdapat per­bedaan yang nyata keterampilan metakognitif dan hasil belajar kognitif siswa di kelompok eksperimental dan kelompok control, dan tidak ada perbedaan yang nyata antara siswa berkemampuan akademik tinggi dan akademik rendah pada keterampilan metakognitif dan hasil belajar kognitifnya.

  18. An improved tuned mass damper (SMA-TMD) assisted by a shape memory alloy spring

    International Nuclear Information System (INIS)

    Mishra, Sudib K; Gur, Sourav; Chakraborty, Subrata

    2013-01-01

    The tuned mass damper (TMD) is a well acclaimed passive control device for vibration control of structures. However, the requirement of a higher mass ratio restricts its applicability for seismic vibration control of civil engineering structures. Improving the performance of TMDs has been attempted by supplementing them with nonlinear restoring devices. In this regard, the ability of shape memory alloy (SMA) in dissipating energy through a hysteretic phase transformation of its microstructure triggered by cyclic loading is notable. An improved version of TMD assisted by a nonlinear shape memory alloy (SMA) spring, referred as SMA-TMD, is studied here for seismic vibration mitigation. Extensive numerical simulations are conducted based on nonlinear random vibration analysis via stochastic linearization of the nonlinear force–deformation hysteresis of the SMA. A design optimization based on minimizing the root mean square displacement of the main structure is also carried out to postulate the optimal design parameters for the proposed system. The viability of the optimal design is verified with respect to its performance under recorded earthquake motions. Significant improvements of the control efficiency and a reduction of the TMD displacement at a much reduced mass ratio are shown to be achieved in the proposed SMA-TMD over those in the linear TMD. (paper)

  19. EFEKTIVITAS FOCUS GROUP DISCUSSION UNTUK MENGURANGI STRES PADA SISWA SMA YANG AKAN MENGHADAPI UJIAN AKHIR NASIONAL

    Directory of Open Access Journals (Sweden)

    Dina Aprilia

    2016-10-01

    Full Text Available This research is aimed to find the effectivity of Focus Group Discussion (FGD to decrease the feeling stress for senior high school students (SMA who will face the national final examination (UAN. Stress on SMA students is a circumstance which gets negative assessment. It intimidates and pushes the students, in this case is UAN would appear a reaction such as emotional disorder, cognition, physiology and behavior disorder of SMA students. This research concerned 21 SMA students in grade XII, who had high stress level in facing UAN. The subjects were divided into two groups. First group was the experiment group (include 11 students and it was the group who got the FGD treatment. The second group was control group (include 10 students and this group didn’t get the FGD treatment. Collecting data was done by using Stress Scale in facing UAN. It was given (a before FGD (pre-test and (b after FGD (post-test. The hypothesis is examined by using difference examination (t-test by comparing mean pre-test and post-test. The result showed that there was a significant influence to decrease the stress in SMA students who were in experiment group (t = 6,540, p < 0,01 after they got FGD treatment. Experiment group had decreased the stress score to face UAN (Mean=7,476.

  20. Analisis Kelayakan Buku Ajar Al Islam dan Kemuhammadiyahan Berwawasan HAM Untuk SMA/MA/SMK Terbitan Maarif Intitute dan Majelis Dikdasmen Pimpinan Pusat Muhammadiyah (Tinjauan dari Segi Materi dan Metodologi Pembelajaran

    Directory of Open Access Journals (Sweden)

    Rio Estetika

    2016-10-01

    Full Text Available Buku Ajar Al-Islam dan Kemuhammadiyahan berwawasan HAM untuk SMA/MA/SMK merupakan salah satu bentuk upaya pendidikan agama di Muhammadiyah untuk mengembangkan buku teks pengajaran Al Islam dan Kemuhammadiyahan agar dapat lebih dinamis, up to date, kontekstual, dan mengakomodasi aspek-aspek sosio-kultural sebagai bentuk respon terhadap permasalahan kemanusiaan. Penelitian ini merupakan penelitian analisis isi dengan menggunakan dokumen sebagai objeknya. Dari hasil kesimpulan disarankan untuk menggunakan buku ajar tersebut sebagai penunjang buku pokok yang sudah diteritkan Majelis Dikdasemen dalam mengajarkan materi hak asasi manusia. Kemudian, dalam penyusunan buku AIK dapat mengadopsi konsep penyusunan buku AIK berwawasan HAM yang lebih up to date dan bervariasi dalam metode pembelajarannya.

  1. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  2. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  3. Note: A component-level frequency tunable isolator for vibration-sensitive chips using SMA beams

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiaoyong, E-mail: zhangxy@buaa.edu.cn, E-mail: yanxiaojun@buaa.edu.cn; Yan, Xiaojun, E-mail: zhangxy@buaa.edu.cn, E-mail: yanxiaojun@buaa.edu.cn [School of Energy and Power Engineering, Beihang University, Beijing 100191 (China); Collaborative Innovation Center of Advanced Aero-Engine, Beijing 100191 (China); National Key Laboratory of Science and Technology on Aero-Engine Aero-Thermodynamics, Beijing 100191 (China); Beijing Key Laboratory of Aero-Engine Structure and Strength, Beijing 100191 (China); Ding, Xin; Wu, Di; Qi, Junlei; Wang, Ruixin; Lu, Siwei [School of Energy and Power Engineering, Beihang University, Beijing 100191 (China)

    2016-06-15

    This note presents a component-level frequency tunable isolator for vibration-sensitive chips. The isolator employed 8 U-shaped shape memory alloy (SMA) beams to support an isolation island (used for mounting chips). Due to the temperature-induced Young’s modulus variation of SMA, the system stiffness of the isolator can be controlled through heating the SMA beams. In such a way, the natural frequency of the isolator can be tuned. A prototype was fabricated to evaluate the concept. The test results show that the natural frequency of the isolator can be tuned in the range of 64 Hz–97 Hz by applying different heating strategies. Moreover, resonant vibration can be suppressed significantly (the transmissibility decreases about 65% near the resonant frequency) using a real-time tuning method.

  4. PENGEMBANGAN MEDIA PEMBELAJARAN PENDIDIKAN JASMANI OLAHRAGA DAN KESEHATAN BERBASIS KOMPUTER UNTUK SMA

    Directory of Open Access Journals (Sweden)

    Suci Cahyati

    2014-04-01

    Full Text Available Penelitian ini bertujuan untuk menghasilkan produk berupa CD pembelajaran pendidikan jasmani olahraga dan kesehatan berbasis komputer untuk SMA yang valid dan efektif. Penelitian ini menggunakan metode Research and Development (R&D. Media yang dikembangkan memuat materi tentang HIV/AIDS. Pengembangan media pembelajaran ini menggunakan software Adobe Flash Cs3 Professional. Media yang telah dikembangkan melalui dua tahap penelitiannya itu validasi ahli dan uji coba lapangan. Berdasarkan validasi ahli dan uji coba lapangan hasil penelitian menunjukkan produk termasuk kriteria “Sangat baik” dengan rerata skor 4,25. Hasil tes siswa mengalami peningkatan dari rerata skor pretest 5,53 dan rerata skor posttest 7,56. Berdasarkan hasil tes tersebut dapat disimpulkan bahwa media pembelajaran pendidikan jasmani olahraga dan kesehatan efektif digunakan dalam pembelajaran di SMA. Kata kunci: Pengembangan media, penjasorkes, SMA

  5. Development of SMA Actuated Morphing Airfoil for Wind Turbine Load Alleviation

    Science.gov (United States)

    Karakalas, A.; Machairas, T.; Solomou, A.; Riziotis, V.; Saravanos, D.

    Wind turbine rotor upscaling has entered a range of rotor diameters where the blade structure cannot sustain the increased aerodynamic loads without novel load alleviation concepts. Research on load alleviation using morphing blade sections is presented. Antagonistic shape memory alloy (SMA) actuators are implemented to deflect the section trailing edge (TE) to target shapes and target time-series relating TE movement with changes in lift coefficient. Challenges encountered by the complex thermomechanical response of morphing section and the enhancement of SMA transient response to achieve frequencies meaningful for aerodynamic load alleviation are addressed. Using a recently developed finite element for SMA actuators [1], actuator configurations are considered for fast cooling and heating cycles. Numerical results quantify the attained ranges of TE angle movement, the moving time period and the developed stresses. Estimations of the attained variations of lift coefficient vs. time are also presented to assess the performance of the morphing section.

  6. Note: A component-level frequency tunable isolator for vibration-sensitive chips using SMA beams

    International Nuclear Information System (INIS)

    Zhang, Xiaoyong; Yan, Xiaojun; Ding, Xin; Wu, Di; Qi, Junlei; Wang, Ruixin; Lu, Siwei

    2016-01-01

    This note presents a component-level frequency tunable isolator for vibration-sensitive chips. The isolator employed 8 U-shaped shape memory alloy (SMA) beams to support an isolation island (used for mounting chips). Due to the temperature-induced Young’s modulus variation of SMA, the system stiffness of the isolator can be controlled through heating the SMA beams. In such a way, the natural frequency of the isolator can be tuned. A prototype was fabricated to evaluate the concept. The test results show that the natural frequency of the isolator can be tuned in the range of 64 Hz–97 Hz by applying different heating strategies. Moreover, resonant vibration can be suppressed significantly (the transmissibility decreases about 65% near the resonant frequency) using a real-time tuning method.

  7. PENGGUNAAN STRATEGI PEMBELAJARAN INKUIRI UNTUK MENINGKATKAN METAKOGNISI SISWA SMA

    Directory of Open Access Journals (Sweden)

    Maulida Fitriana

    2016-05-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui (1 peningkatkan metakognisi siswa melalui strategi pembelajaran inkuiri materi kelarutan dan hasil kali kelarutan di suatu SMA di Donorojo, (2 perbedaan antara penggunaan strategi pembelajaran inkuiri dan pembelajaran langsung terhadap peningkatan metakognisi siswa. Metode eksperimen dengan desain pretest-posttest group design digunakan dalam penelitian ini. Objek penelitian ini adalah siswa kelas XI IPA. Teknik pengambilan sampel adalah cluster random sampling karena populasi berdistribusi normal dan homogen. Hasil penelitian menunjukkan bahwa rata-rata nilai posttes kelas eksperimen 75,15 dan kelas kontrol 72,42. Berdasarkan hasil analisis N-gain pada kelas eksperimen menunjukkan peningkatan metakognisi sebesar 0,68 antara sebelum dan sesudah penggunaan strategi pembelajaran inkuiri. Sedangkan hasil analisis N-gain pada kelas kontrol menunjukkan peningkatan metakognisi sebesar 0,62 antara sebelum dan sesudah penggunaan strategi pembelajaran langsung. Pada uji hipotesis diperoleh t hitung sebesar 1,65 kurang dari t 1,66 yang berarti rata-rata hasil belajar kognitif kelas eksperimen tidak berbeda dari kelas kontrol. Kesimpulan dari penelitian ini adalah (1 strategi pembelajaran inkuiri dapat meningkatkan metakognisi siswa, (2 tidak ada perbedaan yang signifikan antara penggunaan strategi pembelajaran inkuiri dan pembelajaran langsung terhadap peningkatan metakognisi siswa.The objective of this study is to find out (1 the improvement of the students’ metacognition by using the inquiry learning method on the water-soluble substance and the result of its product in a high school in Donorojo, (2 the significant difference between the use of inquiry learning method and the direct instruction method to the improvement of students' metacognition. This study is an experimental research and the design was pretest-posttest group design. Object of this study is eleventh grade students of science program. The

  8. Constitutive modeling of SMA SMP multifunctional high performance smart adaptive shape memory composite

    International Nuclear Information System (INIS)

    Jarali, Chetan S; Raja, S; Upadhya, A R

    2010-01-01

    Materials design involving the thermomechanical constitutive modeling of shape memory alloy (SMA) and shape memory polymer (SMP) composites is a key topic in the development of smart adaptive shape memory composites (SASMC). In this work, a constitutive model for SASMC is developed. First, a one-dimensional SMA model, which can simulate the pseudoelastic (PE) and shape memory effects (SME) is presented. Subsequently, a one-dimensional SMP model able to reproduce the SME is addressed. Both SMA and SMP models are based on a single internal state variable, namely the martensite fraction and the frozen fraction, which can be expressed as a function of temperature. A consistent form of the analytical solution for the SMP model is obtained using the fourth-order Runge–Kutta method. Finally, the SASMC constitutive model is proposed, following two analytical homogenization approaches. One approach is based on an equivalent inclusion method and the other approach is the rule of mixtures. The SMA and SMP constitutive models are validated independently with experimental results. However, the validation of the composite model is performed using the two homogenization approaches and a close agreement in results is observed. Results regarding the isothermal and thermomechanical stress–strain responses are analyzed as a function of SMA volume fraction. Further, it is concluded that the proposed composite model is able to reproduce consistently the overall composite response by taking into consideration not only the phase transformations, variable modulus and transformation stresses in SMA but also the variable modulus, the evolution of stored strain and thermal strain in the SMP

  9. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  10. Group-SMA Algorithm Based Joint Estimation of Train Parameter and State

    Directory of Open Access Journals (Sweden)

    Wei Zheng

    2015-03-01

    Full Text Available The braking rate and train arresting operation is important in the train braking performance. It is difficult to obtain the states of the train on time because of the measurement noise and a long calculation time. A type of Group Stochastic M-algorithm (GSMA based on Rao-Blackwellization Particle Filter (RBPF algorithm and Stochastic M-algorithm (SMA is proposed in this paper. Compared with RBPF, GSMA based estimation precisions for the train braking rate and the control accelerations were improved by 78% and 62%, respectively. The calculation time of the GSMA was decreased by 70% compared with SMA.

  11. MENINGKATKAN KEMAMPUAN BERPIKIR KREATIF MATEMATIS SISWA SMA MELALUI PEMBELAJARAN OPEN ENDED PADA MATERI SPLDV

    Directory of Open Access Journals (Sweden)

    Firdaus Firdaus

    2016-02-01

    Penelitian ini bertujuan untuk mendeskripsikan kemampuan berpikir kreatif matematis siswa SMA melalui pembelajaran open ended problem materi SPLDV. Jenis penelitian ini, yaitu deskriptif kualitatif. Subjeknya adalah siswa kelas X.2 SMA Negeri 1 Woja Dompu. Tahap pembelajaran dalam penelitian ini adalah (1 Orientasi, (2 pembekalan materi, (3 penyajian dan pengerjaan soal open ended, (4 presentasi, (5 kesimpulan. Kemampuan berpikir kreatif matematis siswa meliputi: (a fluency, kemampuan siswa lancar dalam memberikan jawaban benar, (b flexibility, kemampuan siswa dalam menggunakan berbagai cara penyelesaian masalah, (c novelty, kemampuan siswa dalam memberikan jawaban yang baru dan berbeda dengan siswa lain. Penelitian ini hasilnya, bahwa siswa mempunyai kemampuan berpikir kreatif matematis.

  12. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  13. Crack-closing of cement mortar beams using NiTi cold-drawn SMA short fibers

    Science.gov (United States)

    Choi, Eunsoo; Kim, Dong Joo; Chung, Young-Soo; Kim, Hee Sun; Jung, Chungsung

    2015-01-01

    In this study, crack-closing tests of mortar beams reinforced by shape memory alloy (SMA) short fibers were performed. For this purpose, NiTi SMA fibers with a diameter of 0.965 mm and a length of 30 mm were made from SMA wires of 1.0 mm diameter by cold drawing. Four types of SMA fibers were prepared, namely, straight and dog-bone-shaped fiber and the two types of fibers with paper wrapping in the middle of the fibers. The paper provides an unbonded length of 15 mm. For bending tests, six types of mortar beams with the dimensions of 40 mm × 40 mm × 160 mm (B×H×L) were prepared. The SMA fibers were placed at the bottom center of the beams along with an artificial crack of 10 mm depth and 1 mm thickness. This study investigated the influence of SMA fibers on the flexural strength of the beams from the measured force- deflection curves. After cracking, the beams were heated at the bottom by fire to activate the SMA fibers. Then, the beams recovered the deflection, and the cracks were closed. This study evaluated crack-closing capacity using the degree of crack recovery and deflection-recovery factor. The first factor is estimated from the crack-width before and after crack-closing, and the second one is obtained from the downward deflection due to loading and the upward deflection due to the closing force of the SMA fibers.

  14. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  15. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  16. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  17. Metal muscles and nerves—a self-sensing SMA-actuated hand concept

    Science.gov (United States)

    Simone, F.; Rizzello, G.; Seelecke, S.

    2017-09-01

    Bio-inspired hand-like grippers actuated by Shape Memory Alloy (SMA) wires represent an emerging new technology with potential applications in many different fields, ranging from industrial assembly processes to biomedical systems. The inherently high energy density makes SMAs a natural choice for compact, lightweight, and silent actuator systems capable of producing a high amount of work, such as hand prostheses or robotic systems in industrial human/machine environments. In this work, a concept for a compact and versatile gripping system is developed, in which SMA wires are implemented as antagonistic muscles actuating an artificial hand with three fingers. In order to combine high gripping force with sufficient actuation speed, the muscle implementation pursues a multi-wire concept with several 0.1 mm diameter NiTi wires connected in parallel, in order to increase the surface-to-volume ratio for accelerated cooling. The paper starts with an illustration of the design concept of an individual 3-phalanx-finger, along with kinematic considerations for optimal placement of SMA wires. Three identical fingers are subsequently fabricated via 3D printing and assembled into a hand-like gripper. The maximum displacement of each finger phalanx is measured, and an average phalanxes dynamic responsiveness is evaluated. SMA self-sensing is documented by experiments relating the wires change in resistance to the finger motion. Several finger force measurements are also performed. The versatility of the gripper is finally documented by displaying a variety of achievable grasping configurations.

  18. PENGARUH MODEL PEMBELAJARAN KONSTRUKTIVIS 5E TERHADAP HASIL BELAJAR DI SMA LAKSAMANA MARTADINATA

    Directory of Open Access Journals (Sweden)

    Nazila Ramadhani

    2012-06-01

    sehingga thitung > ttabel. Ini berarti Ha diterima, sehingga dapat disimpulkan ada pengaruh yang signifikan penerapan model pembelajaran konstruktivis 5E terhadap hasil belajar siswa pada materi pokok Medan Magnet di kelas XII semester ganjil SMA Laksamana Martadinata T.P 2011/2012.

  19. PELAKSANAAN PROGRAM BOARDING SCHOOL DALAM PEMBINAAN MORAL SISWA DI SMA TARUNA INDONESIA PALEMBANG

    Directory of Open Access Journals (Sweden)

    Hendriyenti H

    2014-12-01

    Full Text Available AbstractIndonesia nowadays faces some moral issues in teenagers scope or adult scope such as the use of drugs, violence, rascality, abortion, persecution, gambling, prostitution, and so on. Those problems are very danger for the country. Therefore, moral education is very important in this situation. The study was done at SMA Taruna Indonesia Palembang by the tittle: “the Implementation of boarding School Program for Students Moral education at SMA Taruna Indonesia Palembang”.Based on the result of the stuy, it was found that the implementation of boarding school program to educate students’moral at SMA Taruna Indonesia Palembang was applied throug dicipline implementation program and religion education program. Those two programs were applied by preventive and currative treatment. Moreover, there were some factors which support students’ moral education at SMA Taruna Indonesia Palembang such as students motivation, advisors dedication, 24 hours education and guidance, good coordination between advisors, teachers, securities, and other staff, and far location of boarding school from city center. As long as the teenager is an unstable period, there weremany difficulties in educate them. Finally,it is hoped that school stakeholders could improve the school management so that those difficulties could be solved and moral education could be applied.  Keywords: boarding school, morality building

  20. iSmaRT: a toolkit for a comprehensive analysis of small RNA-Seq data.

    Science.gov (United States)

    Panero, Riccardo; Rinaldi, Antonio; Memoli, Domenico; Nassa, Giovanni; Ravo, Maria; Rizzo, Francesca; Tarallo, Roberta; Milanesi, Luciano; Weisz, Alessandro; Giurato, Giorgio

    2017-03-15

    The interest in investigating the biological roles of small non-coding RNAs (sncRNAs) is increasing, due to the pleiotropic effects of these molecules exert in many biological contexts. While several methods and tools are available to study microRNAs (miRNAs), only few focus on novel classes of sncRNAs, in particular PIWI-interacting RNAs (piRNAs). To overcome these limitations, we implemented iSmaRT ( i ntegrative Sm all R NA T ool-kit), an automated pipeline to analyze smallRNA-Seq data. iSmaRT is a collection of bioinformatics tools and own algorithms, interconnected through a Graphical User Interface (GUI). In addition to performing comprehensive analyses on miRNAs, it implements specific computational modules to analyze piRNAs, predicting novel ones and identifying their RNA targets. A smallRNA-Seq dataset generated from brain samples of Huntington's Disease patients was used here to illustrate iSmaRT performances, demonstrating how the pipeline can provide, in a rapid and user friendly way, a comprehensive analysis of different classes of sncRNAs. iSmaRT is freely available on the web at ftp://labmedmolge-1.unisa.it (User: iSmart - Password: password). aweisz@unisa.it or ggiurato@unisa.it. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  1. Recovery and residual stress of SMA wires and applications for concrete structures

    International Nuclear Information System (INIS)

    Choi, Eunsoo; Cho, Sung-Chul; Park, Taehyo; Hu, Jong Wan; Chung, Young-Soo

    2010-01-01

    In general, NiTi shape memory alloys are used for applications in civil structures. NiTi SMAs show good superelasticity and shape memory effect properties. However, for application of the shape memory effect, it is desirable for SMAs to show a wide temperature hysteresis, especially for civil structures which are exposed to severe environmental conditions. NiTiNb SMAs, in general, show a wider temperature hysteresis than NiTi SMAs and are more applicable for civil structures. This study examines the temperature hysteresis of NiTiNb and NiTi SMAs, and their recovery and residual stress are investigated. In addition, the tensile behaviors of SMA wires under residual stress are evaluated. This study explains the possible applications for concrete structures with the shape memory effect and illustrates two experimental results of concrete cylinders and reinforced concrete columns. For both tests, SMA wires of NiTiNb and NiTi are used to confine concrete using residual stress. The SMA wire jackets on the concrete cylinders increase the peak strength and the ductility compared to the plain concrete cylinders. In addition, the SMA wire jackets on reinforced concrete columns increase the ductility greatly without flexural strength degradation

  2. KREATIVITAS GURU BIOLOGI DALAM MEMETAKAN KOMODITAS HAYATI UNGGULAN LOKAL KE DALAM PEMBELAJARAN BIOLOGI SMA

    Directory of Open Access Journals (Sweden)

    Asep Agus Sulaeman

    2015-03-01

    Full Text Available Tujuan penelitian ini adalah untuk mengetahui kreativitas guru Biologi SMA dalam memetakan topik-topik dari berbagai aspek komoditas hayati unggulan lokal melalui penggunaan metode mind map dan mengetahui kemampuan guru dalam memetakan topik-topik komoditas hayati unggulan lokal ke dalam pembelajaran Biologi di SMA. Analisis data kreativitas guru Biologi SMA dilakukan secara deskriptif kuantitatif terhadap mind map dengan menggunakan kriteria sesuai instrumen yang dikembangkan. Adapun analisis data tentang jumlah topik-topik Biologi dan jenis kegiatan pembelajaran berbasis komoditas hayati unggulan lokal dilakukan secara deskriptif kuantatif dan kualitatif. Hasil kajian ini menunjukkan nilai aspek-aspek kreativitas guru Biologi yang tinggi, yaitu kemampuan berpikir asli (91,67, peka terhadap masalah (91,67, kemampuan berpikir lancar (90, kemampuan berpikir luwes (88,33, dan kemampuan berpikir terperinci (86,67. Berdasarkan hasil pemetaan yang dilakukan guru, dapat diidentifikasi 15 topik Biologi SMA yang berkaitan dengan komoditas hayati unggulan lokal di Kabupaten Majalengka. Adapun kegiatan pembelajaran berbasis komoditas hayati unggulan yang diusulkan oleh guru tersebar di masing-masing tingkatan kelas dan semesternya dengan jumlah yang berbeda-beda.

  3. Superelastic SMA U-shaped dampers with self-centering functions

    Science.gov (United States)

    Wang, Bin; Zhu, Songye

    2018-05-01

    As high-performance metallic materials, shape memory alloys (SMAs) have been investigated increasingly by the earthquake engineering community in recent years, because of their remarkable self-centering (SC) and energy-dissipating capabilities. This paper systematically presents an experimental study on a novel superelastic SMA U-shaped damper (SMA-UD) with SC function under cyclic loading. The mechanical properties, including strength, SC ability, and energy-dissipating capability with varying loading amplitudes and strain rates are evaluated. Test results show that excellent and stable flag-shaped hysteresis loops are exhibited in multiple loading cycles. Strain rate has a negligible effect on the cyclic behavior of the SMA-UD within the dynamic frequency range of typical interest in earthquake engineering. Furthermore, a numerical investigation is performed to understand the mechanical behavior of the SMA-UD. The numerical model is calibrated against the experimental results with reasonable accuracy. Then, the stress–strain states with different phase transformations are also discussed.

  4. Stress Relaxation Effects in TiNi SMA During Superelastic Deformation: Experiment and Constitutive Model

    Science.gov (United States)

    Pieczyska, Elżbieta A.; Kowalewski, Zbigniew L.; Dunić, Vladimir Lj.

    2017-12-01

    This paper presents an investigation of thermomechanical effects related to the phenomena of stress relaxation occurring in TiNi SMA subjected to modified program of displacement-controlled tension. The deformation data were taken from testing machine, whereas the temperature changes accompanying the exothermic/endothermic martensite forward/reverse transformation were measured by infrared camera. At the advanced stages of the transformations, the strain was kept constant for a few minutes and the SMA load and temperature were recorded continuously. As a consequence, the stress and temperature changed significantly during the loading stops. A large stress drop, caused by the transformation, was observed during the relaxation stage in both courses of the SMA loading and unloading. Moreover, the non-uniform temperature distribution, reflecting macroscopically inhomogeneous transformation, lapsed while the strain was kept constant, yet restarted at the end of the relaxation stop and developed at the reloading stage. Along with the experimental results, the mechanical and thermal responses induced by the transformation were obtained by 3D coupled thermomechanical numerical analysis, realized in partitioned approach. Latent heat production was correlated with an amount of the martensitic volume fraction. The stress and temperature drops recorded during the experiment were satisfactorily reproduced by the model proposed for the SMA thermomechanical coupling.

  5. PENGEMBANGAN BUKU PEDOMAN GURU PADA PEMBELAJARAN FISIKA SMA MENGGUNAKAN MODEL PROBLEM SOLVING LEVEL INKUIRI

    OpenAIRE

    Susi Fatikhah Setiyawati; Heru Kuswanto

    2015-01-01

    Penelitian ini bertujuan: (1) menghasilkan buku pedoman guru untuk pembelajaran fisika SMA menggunakan model problem solving sesuai level inkuiri yang layak digunakan; (2) mendeskripsikan keberhasilan pembelajaran fisika menggunakan model problem solving (MPS) sesuai dengan level inkuiri sesuai dengan buku pedoman terhadap peningkatan aktivitas peserta didik dan kemampuan berpikir kritis peserta didik. Penelitian ini merupakan penelitian pengembangan, sesuai langkah yang dikembangkan oleh Bor...

  6. Phenotypic and genotypic studies of ALS cases in ALS-SMA families.

    Science.gov (United States)

    Corcia, Philippe; Vourc'h, Patrick; Blasco, Helene; Couratier, Philippe; Dangoumau, Audrey; Bellance, Remi; Desnuelle, Claude; Viader, Fausto; Pautot, Vivien; Millecamps, Stephanie; Bakkouche, Salah; Salachas, FranÇois; Andres, Christian R; Meininger, Vincent; Camu, William

    2018-03-01

    Amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA) are the most frequent motor neuron disorders in adulthood and infancy, respectively. There is a growing literature supporting common pathophysiological patterns between those disorders. One important clinical issue for that is the co-occurrence of both diseases within a family. To collect families in which ALS and SMA patients co-exist and describe the phenotype and the genotype of ALS patients. Nine families with co-occurrence of SMA and ALS have been gathered over the last 15 years. Epidemiological, phenotype and genetic status were collected. Out of the nine families, six corresponded to the criteria of familial ALS (FALS). Clinical data were available for 11 patients out of the 15 ALS cases. Mean age of onset was 58.5 years, site of onset was lower limbs in nine cases (81.8%), median duration was 22 months. Four ALS patients carried a mutation: three mutations in SOD1 gene (G147N in two cases and one with E121G) and one repeat expansion in the C9ORF72 gene. Three patients had abnormal SMN1 copy numbers. While the high proportion of familial history of ALS cases in these ALS-SMA pedigrees could have suggested that these familial clusters of the two most frequent MND rely on a genetic background, we failed to exclude that this occurred by chance.

  7. Full-scale flight tests of aircraft morphing structures using SMA actuators

    Science.gov (United States)

    Mabe, James H.; Calkins, Frederick T.; Ruggeri, Robert T.

    2007-04-01

    In August of 2005 The Boeing Company conducted a full-scale flight test utilizing Shape Memory Alloy (SMA) actuators to morph an engine's fan exhaust to correlate exhaust geometry with jet noise reduction. The test was conducted on a 777-300ER with GE-115B engines. The presence of chevrons, serrated aerodynamic surfaces mounted at the trailing edge of the thrust reverser, have been shown to greatly reduce jet noise by encouraging advantageous mixing of the free, and fan streams. The morphing, or Variable Geometry Chevrons (VGC), utilized compact, light weight, and robust SMA actuators to morph the chevron shape to optimize the noise reduction or meet acoustic test objectives. The VGC system was designed for two modes of operation. The entirely autonomous operation utilized changes in the ambient temperature from take-off to cruise to activate the chevron shape change. It required no internal heaters, wiring, control system, or sensing. By design this provided one tip immersion at the warmer take-off temperatures to reduce community noise and another during the cooler cruise state for more efficient engine operation, i.e. reduced specific fuel consumption. For the flight tests a powered mode was added where internal heaters were used to individually control the VGC temperatures. This enabled us to vary the immersions and test a variety of chevron configurations. The flight test demonstrated the value of SMA actuators to solve a real world aerospace problem, validated that the technology could be safely integrated into the airplane's structure and flight system, and represented a large step forward in the realization of SMA actuators for production applications. In this paper the authors describe the development of the actuator system, the steps required to integrate the morphing structure into the thrust reverser, and the analysis and testing that was required to gain approval for flight. Issues related to material strength, thermal environment, vibration

  8. ANALISIS KESULITAN KOGNITIF DAN MASALAH AFEKTIF SISWA SMA DALAM BELAJAR MATEMATIKA MENGHADAPI UJIAN NASIONAL

    Directory of Open Access Journals (Sweden)

    Azis Azis

    2015-11-01

    Full Text Available Penelitian untuk mendeskripsikan tingkat dan letak kesulitan belajar matematika siswa pada aspek kognitif dan kategorisasi masalah belajar matematika siswa pada aspek afektif dalam menghadapi Ujian Nasional tahun pelajaran 2013/2014 SMA di Kota Baubau. Penelitian ini menggunakan penelitian dengan metode survei. Pengumpulan data yang digunakan adalah teknik pengukuran (tes diagnostik, kuisioner, dan wawancara. Hasil penelitian menunjukkan bahwa tingkat kesulitan belajar matematika yang dialami oleh siswa untuk menyelesaikan soal-soal Ujian Nasional berada pada kategori sedang; letak kesulitan belajar matematika siswa pada aspek kognitif dalam menyelesaikan soal-soal Ujian Nasional dilihat dari segi pengetahuan faktual dengan persentase interval kesulitan sebesar, segi pengetahuan konseptual dengan persentase interval kesulitan sebesar, dan segi pengetahuan prosedural dengan persentase interval kesulitan sebesar; dan kategorisasi masalah belajar matematika siswa pada kategori aspek afektif dalam menghadapi Ujian Nasional tahun pelajaran 2013/2014 SMA di Kota Baubau secara umum berada pada kategori rendah. Kata kunci: kesulitan belajar matematika, kognitif, afektif, ujian nasional SMA   AN ANALYSIS OF DIFFICULTY ON COGNITIVE AND PROBLEM ON AFFECTIVE OF SMA STUDENTS IN MATHEMATICS LEARNING FACING NATIONAL EXAMINATION Abstract This study aims to describe the degree of student’s learning difficulty of mathematics on cognitive and categorization of student’s learning problem on affective aspect in accomplishing mathematic items in facing national final exam of SMA Baubau municipality in 2013/2014 academic year. The research type uses survey method. The technique of data collecting made use of diagnostic test that is National final exam items in 2012/2013 academic year which was modified by the researcher, questionnaires, and interviews. The research result indicates that the degree of students’ learning difficulty of mathematics to accomplish

  9. Design and fabrication of a three-finger prosthetic hand using SMA muscle wires

    Science.gov (United States)

    Simone, Filomena; York, Alexander; Seelecke, Stefan

    2015-03-01

    Bio-inspired hand-like gripper systems based on shape memory alloy (SMA) wire actuation have the potential to enable a number of useful applications in, e.g., the biomedical field or industrial assembly systems. The inherent high energy density makes SMA solutions a natural choice for systems with lightweight, low noise and high force requirements, such as hand prostheses or robotic systems in a human/machine environment. The focus of this research is the development, design and realization of a SMA-actuated prosthetic hand prototype with three fingers. The use of thin wires (100 μm diameter) allows for high cooling rates and therefore fast movement of each finger. Grouping several small wires mechanically in parallel allows for high force actuation. To save space and to allow for a direct transmission of the motion to each finger, the SMA wires are attached directly within each finger, across each phalanx. In this way, the contraction of the wires will allow the movement of the fingers without the use of any additional gears. Within each finger, two different bundles of wires are mounted: protagonist ones that create bending movement and the antagonist ones that enable stretching of each phalanx. The resistance change in the SMA wires is measured during actuation, which allows for monitoring of the wire stroke and potentially the gripping force without the use of additional sensors. The hand is built with modern 3D-printing technologies and its performance while grasping objects of different size and shape is experimentally investigated illustrating the usefulness of the actuator concept.

  10. Seismic fragility analysis of lap-spliced reinforced concrete columns retrofitted by SMA wire jackets

    International Nuclear Information System (INIS)

    Choi, Eunsoo; Park, Sun-Hee; Chung, Young-Soo; Kim, Hee Sun

    2013-01-01

    The aim of this study is to provide seismic fragility curves of reinforced concrete columns retrofitted by shape memory alloy wire jackets and thus assess the seismic performance of the columns against earthquakes, comparing them with reinforced concrete columns with lap-spliced and continuous reinforcement. For that purpose, this study first developed analytical models of the experimental results of the three types of columns, (1) lap-spliced reinforcement, (2) continuous reinforcement and (3) lap-spliced reinforcement and retrofitted by SMA wire jackets, using the OpenSEES program, which is oriented to nonlinear dynamic analysis. Then, a suite of ten recorded ground motions was used to conduct dynamic analyses of the analytical models with scaling of the peak ground acceleration from 0.1g to 1.0g in steps of 0.1g. From the static experimental tests, the column retrofitted with SMA wire jackets had a larger displacement ductility by a factor of 2.3 times that of the lap-spliced column, which was 6% larger compared with the ductility of the continuous reinforcement column. From the fragility analyses, the SMA wire jacketed column had median values of 0.162g and 0.567g for yield and collapse, respectively. For the yield damage state, the SMA wire jacketed column had a median value similar to the continuous reinforcement column. However, for the complete damage state, the SMA wire jacketed column showed a 1.33 times larger median value than the continuously reinforcement column. (paper)

  11. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  12. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  13. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  14. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  15. An experimental and analytical study on the feasibility of SMA spring driven actuation of an iris mechanism

    International Nuclear Information System (INIS)

    Rajan, Aravindh; Abouseada, Mostafa; Manghaipathy, Pavithra; Ozalp, Nesrin; Majid, Feras Abdul; Salem, Ayman; Srinivasa, Arun

    2016-01-01

    Highlights: • An iris mechanism proposed in response to fluctuations in solar energy. • Iris motion controlled with the use of Nickel–Titanium Shape Memory Alloy springs. • Variation of the force exerted by SMA spring w.r.t. temperature tested experimentally. • An analytical expression that relates the aperture area and crank rotation is given. • SMA springs showed promising actuation mechanism as a replacement to motor. - Abstract: Variation in incoming solar energy adversely affects the temperature inside a solar reactor and lowers its efficiency. Therefore, it is important to develop a mechanism that can maintain semi-constant temperatures inside the reactor from sunrise to sunset. In this paper, we present an iris mechanism that reduces or enlarges its circular opening with the use of Nickel–Titanium Shape Memory Alloy (SMA) springs. SMA springs possess memory of their shapes at certain temperatures. Hence, by controlling the temperature of the spring, it is possible to exert different forces that may then be transferred to the variable aperture mechanism. In this study, variation of the force exerted by an SMA spring with respect to temperature was experimentally tested and the viability of an SMA spring’s use in actuating an iris mechanism aperture was examined. In order to simulate conditions under fluctuating solar radiation, a 7 kW solar simulator was used in experiments at varying power levels. It was observed that SMA springs are promising as a replacement of the actuation mechanism driven by a motor.

  16. Fabrication and characterization of a dual-joint smart inhaler nozzle actuated by embedded SMA wires

    International Nuclear Information System (INIS)

    Furst, Stephen J; Seelecke, Stefan

    2014-01-01

    Shape memory alloy (SMA) wires offer a novel solution for many embedded actuator and sensor applications. Small SMA wires in particular can be heated with a relatively low electric current, cool rapidly, and serve as a sensor thanks to a measurable resistance change. However, the challenges of fabrication with SMA actuator wires as well as their hysteretic nature have prevented them from finding mainstream application. This work focuses on the process used to control the fabrication of an SMA-actuated adaptive nozzle for the previously presented Smart Inhaler application. The elements of nozzle design that facilitate fabrication are summarized and an assembly setup and procedure is presented for controlling the stress and strain in the SMA wires while they are attached to the nozzle structure via temperature-resistant adhesives. Finally, the performance of the nozzle is characterized by measuring the changes in nozzle deflection and SMA wire strain and resistance in response to a controlled Joule heating power input. Results show controlling pre-stress in the wires during assembly can lead to reproducible behavior, an input heating power serves to control nozzle deflection, and a measured resistance can provide a useful sensor of SMA wire strain and nozzle joint deflection. (paper)

  17. Incidence of bacteraemia following teeth extraction at the dental ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... genital or acquired heart disease, or those fitted with a valvular prosthesis ... ments published reports on the prevalence, aetiologic agents and risk ... cultured onto plates of blood agar, chocolate agar and MacConkey agar.

  18. Evaluation of SMN protein, transcript, and copy number in the biomarkers for spinal muscular atrophy (BforSMA clinical study.

    Directory of Open Access Journals (Sweden)

    Thomas O Crawford

    Full Text Available The universal presence of a gene (SMN2 nearly identical to the mutated SMN1 gene responsible for Spinal Muscular Atrophy (SMA has proved an enticing incentive to therapeutics development. Early disappointments from putative SMN-enhancing agent clinical trials have increased interest in improving the assessment of SMN expression in blood as an early "biomarker" of treatment effect.A cross-sectional, single visit, multi-center design assessed SMN transcript and protein in 108 SMA and 22 age and gender-matched healthy control subjects, while motor function was assessed by the Modified Hammersmith Functional Motor Scale (MHFMS. Enrollment selectively targeted a broad range of SMA subjects that would permit maximum power to distinguish the relative influence of SMN2 copy number, SMA type, present motor function, and age.SMN2 copy number and levels of full-length SMN2 transcripts correlated with SMA type, and like SMN protein levels, were lower in SMA subjects compared to controls. No measure of SMN expression correlated strongly with MHFMS. A key finding is that SMN2 copy number, levels of transcript and protein showed no correlation with each other.This is a prospective study that uses the most advanced techniques of SMN transcript and protein measurement in a large selectively-recruited cohort of individuals with SMA. There is a relationship between measures of SMN expression in blood and SMA type, but not a strong correlation to motor function as measured by the MHFMS. Low SMN transcript and protein levels in the SMA subjects relative to controls suggest that these measures of SMN in accessible tissues may be amenable to an "early look" for target engagement in clinical trials of putative SMN-enhancing agents. Full length SMN transcript abundance may provide insight into the molecular mechanism of phenotypic variation as a function of SMN2 copy number.Clinicaltrials.gov NCT00756821.

  19. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  20. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  3. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  4. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  5. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  6. Role of pH in oxidase variability of Aeromonas hydrophila.

    OpenAIRE

    Hunt, L K; Overman, T L; Otero, R B

    1981-01-01

    Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

  7. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  8. PENGARUH LINGKUNGAN KELUARGA, LINGKUNGAN SEKOLAH, DISIPLIN BELAJAR DAN MOTIVASI BELAJAR TERHADAP PRESTASI BELAJAR EKONOMI SISWA SMA KELAS XI IPS SMA PGRI 1 TAMAN PEMALANG

    Directory of Open Access Journals (Sweden)

    Iyut Sustiasih Sudikno

    2014-02-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui pengaruh lingkungan keluarga, lingkungan sekolah dan disiplin belajar terhadap prestasi belajar melalui motivasi belajar siswa kelas XI IPS SMA PGRI 1 Taman Pemalang. Subyek penelitian ini adalah siswa kelas XI IPS SMA PGRI 1 Taman Pemalang. Latar belakang penelitian ini adalah prestasi belajar siswa kelas XI IPS yang kurang optimal. Penelitian ini merupakan penelitian kuantitatif. Variabel bebas yang dikaji dalam penelitian ini adalah Lingkungan Keluarga (X1, Lingkungan Sekolah (X2, Disiplin Belajar (X3. Variabel terikat adalah Prestasi Belajar (Y2 dan Variabel intervening adalah Motivasi Belajar (Y1. Metode pengumpulan data yang digunakan adalah dokumentasi dan angket. Metode analisis data yaitu analisis deskriptif persentase dan analisis uji jalur (path analysis. Hasil analisis regresi linier berganda diperoleh persamaan regresi Y1 = 10,011 + 0,233X1 + 0,391X 2+ 0,522X3 +e1, dan Y2 = 71,062 + 0,227X1 + 0,704Y1 + 0,349X3 + e2. Hasil analisi jalur menunjukkan bahwa pengaruh secara tidak langsung (LK-PB sebesar 22,7%, (LS-PB sebesar 10,5%, (DB-PB sebesar 34,9%, (MB-PB sebesar 70,4% dan pengaruh secara tidak langsung (LK-MB-PB sebesar 16,4%, (LS-MB-PB sebesar 27,5%, (DP-MB-PB sebesar 36,7%. This research aims to determine the effect of on family environment, school environment, learning discipline on students’ achievements through student motivation SMA PGRI 1 Taman Pemalang. The subjects were students of class XI IPS Students of SMA PGRI 1 Taman Pemalang. The background of this research is the student’ achievements XI IPS Stuents of SMA PGRI 1 Taman Pemalang. This research is a quantitative study. The independent variables were examined in this study is family environment (X1, school environment (X2, learning discipline (X3. The dependent variable is the students, achievements (Y2 and the intervening variable is learning motivation (Y1. Data collection methods used are documentation and

  9. PELATIHAN PENULISAN KARYA ILMIAH BIDANG SOSIAL ( HUKUM DI SMA NEGERI 3 DENPASAR

    Directory of Open Access Journals (Sweden)

    I KETUT SUDIARTA

    2012-09-01

    Full Text Available ABSRACT Training of Constructing Scientific Report on Social Major (Law has done on SMA Negeri 3 Denpasar, by the Guiding Team of the Lecturers of Law Faculty of Udayana University through a practice of constructing a report in a class through a workshop. Aproximately, 40% are for meanwhile, 60% are by practice of composing and providing some reference which is related to the constructing of a social-scientific report, and there all are done well so far. This fact was indicated by the responds which were given by the students of SMA Negeri 3 Denpasar, especially for those who join the KIR group.This activity has been done once a week.

  10. A 3D Printed Implantable Device for Voiding the Bladder Using Shape Memory Alloy (SMA) Actuators.

    Science.gov (United States)

    Hassani, Faezeh Arab; Peh, Wendy Yen Xian; Gammad, Gil Gerald Lasam; Mogan, Roshini Priya; Ng, Tze Kiat; Kuo, Tricia Li Chuen; Ng, Lay Guat; Luu, Percy; Yen, Shih-Cheng; Lee, Chengkuo

    2017-11-01

    Underactive bladder or detrusor underactivity (DU) is defined as a reduction of contraction strength or duration of the bladder wall. Despite the serious healthcare implications of DU, there are limited solutions for affected individuals. A flexible 3D printed implantable device driven by shape memory alloys (SMA) actuators is presented here for the first time to physically contract the bladder to restore voluntary control of the bladder for individuals suffering from DU. This approach is used initially in benchtop experiments with a rubber balloon acting as a model for the rat bladder to verify its potential for voiding, and that the operating temperatures are safe for the eventual implantation of the device in a rat. The device is then implanted and tested on an anesthetized rat, and a voiding volume of more than 8% is successfully achieved for the SMA-based device without any surgical intervention or drug injection to relax the external sphincter.

  11. RTC simulations on large branched sewer systems with SmaRTControl.

    Science.gov (United States)

    de Korte, Kees; van Beest, Dick; van der Plaat, Marcel; de Graaf, Erno; Schaart, Niels

    2009-01-01

    In The Netherlands many large branched sewer systems exist. RTC can improve the performance of these systems. The objective of the universal algorithm of SmaRTControl is to improve the performance of the sewer system and the WWTP. The effect of RTC under rain weather flow conditions is simulated using a hydrological model with 19 drainage districts. The system related inefficiency coefficient (SIC) is introduced for assessment of the performance of sewer systems. The performance can be improved by RTC in combination with increased pumping capacities in the drainage districts, but without increasing the flow to the WWTP. Under dry weather flow conditions the flow to the WWTP can be equalized by storage of wastewater in the sewer system. It is concluded that SmaRTControl can improve the performance, that simulations are necessary and that SIC is an excellent parameter for assessment of the performance.

  12. Dynamical analysis and development of a biologically inspired SMA caterpillar robot.

    Science.gov (United States)

    Daily-Diamond, Christopher A; Novelia, Alyssa; O'Reilly, Oliver M

    2017-09-26

    With the goal of robustly designing and fabricating a soft robot based on a caterpillar featuring shape memory alloy (SMA) actuators, analytical and numerical models for a soft robot were created based on the forward crawling motion of the Manduca sexta caterpillar. The analytical model features a rod theory and the mechanics of undulation were analyzed using a motion pattern based on the 'Witch of Agnesi' curve. Complementing these models, experiments on a SMA actuator sample were performed in order to determine its flexural rigidity and curvature as a function of the actuation voltage. A series of these actuators can be modeled as a system of rigid bodies connected by torsional springs. As these bodies are actuated according to the motion pattern based on the individual caterpillar segments, ground contact forces are calculated and analyzed to determine the requirements of successful forward locomotion. The energetics of the analytical and numerical models are then compared and discussed.

  13. Assessing upper limb function in nonambulant SMA patients: development of a new module.

    Science.gov (United States)

    Mazzone, Elena; Bianco, Flaviana; Martinelli, Diego; Glanzman, Allan M; Messina, Sonia; De Sanctis, Roberto; Main, Marion; Eagle, Michelle; Florence, Julaine; Krosschell, Kristin; Vasco, Gessica; Pelliccioni, Marco; Lombardo, Marilena; Pane, Marika; Finkel, Richard; Muntoni, Francesco; Bertini, Enrico; Mercuri, Eugenio

    2011-06-01

    We report the development of a module specifically designed for assessing upper limb function in nonambulant SMA patients, including young children and those with severe contractures. The application of the module to a preschool cohort of 40 children (age 30-48 months) showed that all the items could be completed by 30 months. The module was also used in 45 nonambulant SMA patients (age 30 months to 27 years). Their scores were more variable than in the preschool cohort, ranging from 0 to 18. The magnitude of scores was not related to age (r=-0.19). The upper limb scores had a good correlation with the Hammersmith Functional Motor Scale, r=0.75, but the upper limb function did not always strictly follow the overall gross motor function. These findings suggest that even some of the very weak nonambulant children possess upper limb skills that can be measured. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  15. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  16. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  17. Experiment feedbacks in micromechanics modeling of thermomechanical behaviour of SMA polycrystals

    Czech Academy of Sciences Publication Activity Database

    Šittner, Petr; Novák, Václav

    2004-01-01

    Roč. 51, - (2004), s. 321-326 ISSN 1359-6462 R&D Projects: GA AV ČR IAA1048107; GA ČR GA202/04/2016 Institutional research plan: CEZ:AV0Z1010914 Keywords : shape memory alloys (SMA) * martensitic phase transformation * micromechanical modeling * neutron diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.112, year: 2004

  18. Hubungan Penggunaan Media Sosial Dengan Kemampuan Interaksi Sosial Remaja di SMA Negeri 1 Kota Medan

    OpenAIRE

    Nugraheni, Auliya Tunnisaa

    2016-01-01

    Social media today is considered as an important daily need. The intensity of using it by adolescents is influenced by their need for information, either academic or non-academic information. The inclination of using it as a communication facility can directly effects one of the social interactions aspect among individual. The objective of this research was to find out the correlation of using social media with the capacity of social interaction in adolescents at SMA Negeri 1, Medan, using co...

  19. Hubungan Facebook Addiction Disorder (Fad) dengan Perilaku Asertif Remaja di SMA Kristen 1 Tomohon

    OpenAIRE

    Polii, Gloria Gratia; Bidjuni, Hendro; Wowiling, Ferdinand

    2014-01-01

    : Facebook addiction berarti menghabiskan jumlah waktu yang berlebihan di facebook. Facebook merupakan situs jejaring sosial yang mudah digunakan, dan yang paling penting adalah mempunyai efek mencandu. Secara psikologis, dampak negatif kecanduan facebook dapat dibagi atas: Pribadi yang anti sosial dan Dualisme kepribadian. Tujuan penelitian ini untuk mengetahui hubungan Facebook Addiction Disorder (FAD) dengan Perilaku Asertif Remaja di SMA Kristen 1 Tomohon. Desain penelitian ini dilaksanak...

  20. Sistem Informasi Data Kepegawaian Dan Kesiswaan SMA Negeri 1 P. Brandan

    OpenAIRE

    Ramadhani, Tiara

    2015-01-01

    Tulisan ini bertujuan untuk membangun suatu sistem informasi pada SMA Negeri 1 Babalan P.Brandan. Sistem informasi ini dikembangkan dengan menggunakan perangkat lunak PHP, MySQL, Apache, dan Mozilla Firefox juga software pembantu lainnya seperti Adobe Dreamweaver CS5. Tujuan dari sistem informasi ini adalah untuk menyajikan informasi data kepegawaian, guru, serta kesiswaan kepada user/pengguna dengan baik dan dapat meng-update isi dari informasi yang terdapat pada web tersebut dengan mudah pa...

  1. Hubungan Bermain Video Game Terhadap Kejadian Insomnia Pada Kalangan Remaja Di Sma Negeri 12 Medan

    OpenAIRE

    Pangaribuan, Hotman Parasian

    2015-01-01

    The number of adolescent who played video game was increased now days. This can cause many problems in social relationship, behavioral, and their sleep pattern like insomnia. This cross sectional study aimed to evaluate the relationship between playing video game with insomnia among the adolescent. Our total sample was 100 students in SMA Negeri 12 Medan. The sample was chosen by consequtive sampling. The data was taken by interview using questionnaire. From our result, the major...

  2. Pembanguna Sistem Informasi Manajemen Keluhan Siswa Berbasi Web pada SMA PGRI 6 Malang Menggunakan Metode Waterfall

    OpenAIRE

    Wiwin Kuswinardi, Marissa Renny Leon/

    2014-01-01

    Leon, Marissa Renny. 2014. Development of web based Management Information System of Student Complaints In SMA PGRI 6 Malang Using Waterfall Method. 109Thesis, information systems Study Program, Faculty of Information Technology, kanjuruhan Universitas of Malang. Supervisor: Wiwin Kuswinardi,Kom., M.KomDelivering complaint of students is still less effective Students write complaints on paper, but there are some constraints faced by the homeroom teacher, if the paper of ...

  3. Force-Deformation Response of a SMA-Based Actuator Considering the Electric Current Intensity as Step-Input

    Directory of Open Access Journals (Sweden)

    Ion-Cornel Mituletu

    2015-06-01

    Full Text Available The goal of the paper is to accomplish the response regarding the force-displacement characteristic evolution, of a Shape Memory Alloy (SMA actuator element. This reveals the first research stage in controlling the SMA behavior, providing important information about the heating-cooling time intervals. Step excitation of the SMA is performed by few values of electric current intensity, which produces the heating of SMA element up to 90-95 oC. To meet the testing requirements, an adequate test stand has been set up, consisting of sensors for force, displacement and temperature. The analog values provided by sensors were acquired and afterwards analyzed. The values of temperature, displacement and force were achieved, and their characteristic evolution has been performed. Thus, the time intervals are resulted and some other important aspects have been observed, regarding the delay between parameters and the temperature overshoot

  4. Design and demonstration of a fish robot actuated by a SMA-driven actuation system

    Science.gov (United States)

    Le, Chan H.; Nguyen, Quang S.; Park, Hoon C.

    2010-04-01

    This paper presents a concept of a fish robot actuated by an SMA-based actuator. The bending-type actuator system is composed of a 0.1mm diameter SMA wire and a 0.5mm thick glass/epoxy strip. The SMA wire is installed to the bent composite strip. The actuator can produce about 200gf of blocking force and 3.5mm displacement at the center of the glass/epoxy strip. The bending motion of the actuator is converted into the tail-beat motion of a fish robot through a linkage system. The fish robot is evaluated by measuring the tail-beat angle, swimming speed and thrust produced by the fish robot. The tail-beat angle is about 20° and the maximum swimming speed is about 1.6cm/s. The measured thrust is about 0.4gf when the fish robot is operated at 0.9Hz.

  5. Kajian Fisis Energi Terbarukan Panel Surya Melalui Eksperimen Sederhana untuk Siswa SMA

    Directory of Open Access Journals (Sweden)

    Sunaryo Sunaryo

    2015-12-01

    Full Text Available Abstract Has conducted research on the effects of light intensity on the output voltage, current, and power. Research conducted generate data in the form of quantitative and graphs that show a link between the intensity of light, the output voltage, current, and power. The data obtained were used as sources of learning in senior high school (SMA. The implication is capable of enhancing creativity, motivation and learning outcomes of Physics subject of high school students in future studies. Keywords: light intensity, current, voltage, solar panel Abstrak Telah dilakukan penelitian tentang pengaruh intensitas cahaya terhadap tegangan output, arus, dan daya listrik. Penelitian yang dilakukan menghasilkan data dalam bentuk kuantitatif dan grafik yang menunjukkan adanya kaitan antara intensitas cahaya, tegangan output, arus, dan daya listrik. Data yang diperoleh dijadikan sebagai sumber informasi dalam pembelajaran di Sekolah Menengah Atas (SMA. Implikasinya adalah mampu meningkatkan kreativitas, motivasi, dan hasil belajar Fisika siswa SMA pada penelitian selanjutnya. Kata-kata kunci: intensitas cahaya, arus, tegangan, panel surya

  6. Experimental multiphysical characterization of an SMA driven, camber morphing owl wing section

    Science.gov (United States)

    Stroud, Hannah R.; Leal, Pedro B. C.; Hartl, Darren J.

    2018-03-01

    In the context of aerospace engineering, morphing structures are useful in their ability to change the outer mold line (OML) while improving or maintaining certain aerodynamic performance metrics. Skin-based morphing is of particular interest in that it minimizes installation volume. Shape memory alloys (SMAs) have a high force to volume ratio that makes them a suitable choice for skin-based morphing. Because the thermomechanical properties of SMAs are coupled, strain can be generated via a temperature variation; this phenomenon is used as the actuation method. Therefore, it is necessary to determine the interaction of the system not only with aerodynamic loads, but with thermal loads as well. This paper describes the wind tunnel testing and in situ thermomechanical analysis of an SMA actuated, avian inspired morphing wing. The morphing wing is embedded with two SMA composite actuators and consists of a foam core enveloped in a fiberglass-epoxy composite. As the SMA wire is heated, the actuator contracts, morphing the wing from the original owl OML to a highly cambered, high lift OML. Configuration characteristics are analyzed in situ using simultaneous three dimensional digital image correlation (DIC) and infrared thermography, thereby coupling strain and thermal measurements. This method of testing allows for the nonintrusive, multiphysical data acquisition of each actuator separately and the system as a whole.

  7. Minimizing the Moisture Damage and Drain down of Iraqi SMA Mixtures Using Waste Additives

    Directory of Open Access Journals (Sweden)

    Ali Al-Hadidy

    2013-04-01

    Full Text Available This research deals with the viability of using polyester fiber (PF, crumb rubber tire (CRT and cellulose fiber (CF as stabilizing waste additives in producing Iraqi SMA mixtures that sustain drain down phenomenon and moisture damage sensitivity. Different ratios of these additives (0.1, 0.2, and 0.3% by weight of aggregate and filler were mixed with 40/50 paving asphalt by means of dry process. Unmodified and modified SMA mixtures were subjected to drain down, Marshall, static indirect tensile strength, tensile stiffness modulus, static compressive strength, tensile strength ratio and index of retained strength tests. A set of regression equations between these tests were established. In addition, an optimization table based on these tests, which can be used to select the type or amount of additive for any field applications has been determined and reported. The results indicated that the inclusion of these additives in SMA mixtures can satisfy the performance requirement of high temperature and much rain zone.

  8. TGF-beta Sma/Mab signaling mutations uncouple reproductive aging from somatic aging.

    Directory of Open Access Journals (Sweden)

    Shijing Luo

    2009-12-01

    Full Text Available Female reproductive cessation is one of the earliest age-related declines humans experience, occurring in mid-adulthood. Similarly, Caenorhabditis elegans' reproductive span is short relative to its total life span, with reproduction ceasing about a third into its 15-20 day adulthood. All of the known mutations and treatments that extend C. elegans' reproductive period also regulate longevity, suggesting that reproductive span is normally linked to life span. C. elegans has two canonical TGF-beta signaling pathways. We recently found that the TGF-beta Dauer pathway regulates longevity through the Insulin/IGF-1 Signaling (IIS pathway; here we show that this pathway has a moderate effect on reproductive span. By contrast, TGF-beta Sma/Mab signaling mutants exhibit a substantially extended reproductive period, more than doubling reproductive span in some cases. Sma/Mab mutations extend reproductive span disproportionately to life span and act independently of known regulators of somatic aging, such as Insulin/IGF-1 Signaling and Dietary Restriction. This is the first discovery of a pathway that regulates reproductive span independently of longevity and the first identification of the TGF-beta Sma/Mab pathway as a regulator of reproductive aging. Our results suggest that longevity and reproductive span regulation can be uncoupled, although they appear to normally be linked through regulatory pathways.

  9. SMA-Based System for Environmental Sensors Released from an Unmanned Aerial Vehicle

    Directory of Open Access Journals (Sweden)

    Lorenzo Pellone

    2017-01-01

    Full Text Available In the work at hand, a shape memory alloy (SMA-based system is presented. The system, conceived for releasing environmental sensors from ground or small unmanned aerial vehicles, UAV (often named UAS, unmanned aerial system, is made of a door, integrated into the bottom of the fuselage, a device distributor, operated by a couple of antagonistic SMA springs, and a kinematic chain, to synchronize the deployment operation with the system movement. On the basis of the specifications (weight, available space, energy supply, sensors size, etc., the system design was addressed. After having identified the main system characteristics, a representative mock-up was manufactured, featuring the bottom part of the reference fuselage. Functionality tests were performed to prove the system capability to release the sensors; a detailed characterization was finally carried out, mainly finalized at correlating the kinematic chain displacement with the SMA spring temperature and the supplied electrical power. A comparison between theoretical predictions and experimental outcomes showed good agreement.

  10. A fuzzy PID-controlled SMA actuator for a two-DOF joint

    Directory of Open Access Journals (Sweden)

    Shi Zhenyun

    2014-04-01

    Full Text Available Shape memory alloy (SMA actuator is a potential advanced component for servo-systems of aerospace vehicles and aircraft. This paper presents a joint with two degrees of freedom (DOF and a mobility range close to ±60° when driven by SMA triple wires. The fuzzy proportional-integral-derivative (PID-controlled actuator drive was designed using antagonistic SMA triple wires, and the resistance feedback signal made a closed loop. Experiments showed that, with the driving responding frequency increasing, the overstress became harder to be avoided at the position under the maximum friction force. Furthermore, the hysteresis gap between the heating and cooling paths of the strain-to-resistance curve expanded under this condition. A fuzzy logic control was considered as a solution, and the curves of the wires were then modeled by fitting polynomials so that the measured resistance was used directly to determine the control signal. Accurate control was demonstrated through the step response, and the experimental results showed that under the fuzzy PID-control program, the mean absolute error (MAE of the rotation angle was about 3.147°. In addition, the investigation of the external interference to the system proved the controllable maximum output.

  11. Semantic memory retrieval circuit: role of pre-SMA, caudate, and thalamus.

    Science.gov (United States)

    Hart, John; Maguire, Mandy J; Motes, Michael; Mudar, Raksha Anand; Chiang, Hsueh-Sheng; Womack, Kyle B; Kraut, Michael A

    2013-07-01

    We propose that pre-supplementary motor area (pre-SMA)-thalamic interactions govern processes fundamental to semantic retrieval of an integrated object memory. At the onset of semantic retrieval, pre-SMA initiates electrical interactions between multiple cortical regions associated with semantic memory subsystems encodings as indexed by an increase in theta-band EEG power. This starts between 100-150 ms after stimulus presentation and is sustained throughout the task. We posit that this activity represents initiation of the object memory search, which continues in searching for an object memory. When the correct memory is retrieved, there is a high beta-band EEG power increase, which reflects communication between pre-SMA and thalamus, designates the end of the search process and resultant in object retrieval from multiple semantic memory subsystems. This high beta signal is also detected in cortical regions. This circuit is modulated by the caudate nuclei to facilitate correct and suppress incorrect target memories. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Evaluation of Fatigue Life of CRM-Reinforced SMA and Its Relationship to Dynamic Stiffness

    Directory of Open Access Journals (Sweden)

    Nuha Salim Mashaan

    2014-01-01

    Full Text Available Fatigue cracking is an essential problem of asphalt concrete that contributes to pavement damage. Although stone matrix asphalt (SMA has significantly provided resistance to rutting failure, its resistance to fatigue failure is yet to be fully addressed. The aim of this study is to evaluate the effect of crumb rubber modifier (CRM on stiffness and fatigue properties of SMA mixtures at optimum binder content, using four different modification levels, namely, 6%, 8%, 10%, and 12% CRM by weight of the bitumen. The testing undertaken on the asphalt mix comprises the dynamic stiffness (indirect tensile test, dynamic creep (repeated load creep, and fatigue test (indirect tensile fatigue test at temperature of 25°C. The indirect tensile fatigue test was conducted at three different stress levels (200, 300, and 400 kPa. Experimental results indicate that CRM-reinforced SMA mixtures exhibit significantly higher fatigue life compared to the mixtures without CRM. Further, higher correlation coefficient was obtained between the fatigue life and resilient modulus as compared to permanent strain; thus resilient modulus might be a more reliable indicator in evaluating the fatigue life of asphalt mixture.

  13. Evaluation of fatigue life of CRM-reinforced SMA and its relationship to dynamic stiffness.

    Science.gov (United States)

    Mashaan, Nuha Salim; Karim, Mohamed Rehan; Abdel Aziz, Mahrez; Ibrahim, Mohd Rasdan; Katman, Herda Yati; Koting, Suhana

    2014-01-01

    Fatigue cracking is an essential problem of asphalt concrete that contributes to pavement damage. Although stone matrix asphalt (SMA) has significantly provided resistance to rutting failure, its resistance to fatigue failure is yet to be fully addressed. The aim of this study is to evaluate the effect of crumb rubber modifier (CRM) on stiffness and fatigue properties of SMA mixtures at optimum binder content, using four different modification levels, namely, 6%, 8%, 10%, and 12% CRM by weight of the bitumen. The testing undertaken on the asphalt mix comprises the dynamic stiffness (indirect tensile test), dynamic creep (repeated load creep), and fatigue test (indirect tensile fatigue test) at temperature of 25°C. The indirect tensile fatigue test was conducted at three different stress levels (200, 300, and 400 kPa). Experimental results indicate that CRM-reinforced SMA mixtures exhibit significantly higher fatigue life compared to the mixtures without CRM. Further, higher correlation coefficient was obtained between the fatigue life and resilient modulus as compared to permanent strain; thus resilient modulus might be a more reliable indicator in evaluating the fatigue life of asphalt mixture.

  14. Spliceosome integrity is defective in the motor neuron diseases ALS and SMA

    Science.gov (United States)

    Tsuiji, Hitomi; Iguchi, Yohei; Furuya, Asako; Kataoka, Ayane; Hatsuta, Hiroyuki; Atsuta, Naoki; Tanaka, Fumiaki; Hashizume, Yoshio; Akatsu, Hiroyasu; Murayama, Shigeo; Sobue, Gen; Yamanaka, Koji

    2013-01-01

    Two motor neuron diseases, amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA), are caused by distinct genes involved in RNA metabolism, TDP-43 and FUS/TLS, and SMN, respectively. However, whether there is a shared defective mechanism in RNA metabolism common to these two diseases remains unclear. Here, we show that TDP-43 and FUS/TLS localize in nuclear Gems through an association with SMN, and that all three proteins function in spliceosome maintenance. We also show that in ALS, Gems are lost, U snRNA levels are up-regulated and spliceosomal U snRNPs abnormally and extensively accumulate in motor neuron nuclei, but not in the temporal lobe of FTLD with TDP-43 pathology. This aberrant accumulation of U snRNAs in ALS motor neurons is in direct contrast to SMA motor neurons, which show reduced amounts of U snRNAs, while both have defects in the spliceosome. These findings indicate that a profound loss of spliceosome integrity is a critical mechanism common to neurodegeneration in ALS and SMA, and may explain cell-type specific vulnerability of motor neurons. PMID:23255347

  15. PENGARUH KOMPETENSI SUMBER DAYA MANUSIA TERHADAP KINERJA PEGAWAI DAN GURU PADA SMA SARIBUANA MAKASSAR

    Directory of Open Access Journals (Sweden)

    Novita _

    2017-08-01

    Full Text Available NOVITA. 2017.Essay . The Influence of Human Resource Competency on Employee and Teacher Performance at SMA SARIBUANA Makassar South Sulawesi Province.Guided by Indrayani Nur, S. Pd SE., M.Si. An employee is an individual who works for an employer, by contract or agreement whether in writing or in writing, to carry out a job or occupation in a particular activity by obtaining compensation paid under a specified period. This study aims to analyze the influence of human resource competencies on the performance of employees and teachers in SMA SARIBUANA Makassar. Analyzer used is multiple linear regression. Respondents of this research are employees and teachers of SMA Saribuana Makassar. The results of the analysis show that knowledge, mastery of science of technology and motivation affect the improvement of employee and teacher performance From the ANOVA or F test, the significant number (Sig (0,000 is below 0.05 and the Fcount is 19.614 where the Fcount is greater than the Ftable of 3.35. Thus, Fcount > Ftable then this result indicates that the independent variable (knowledge, mastery of technology science, motivation influence together to the dependent variable (employee and teacher performance.

  16. Free vibration response of a multilayer smart hybrid composite plate with embedded SMA wires

    Directory of Open Access Journals (Sweden)

    K. Malekzadeh

    Full Text Available In this paper, free vibration response of a hybrid composite plate was studied. Effects of some geometrical, physical and material parameters on response of the composite plates embedded with shape memory alloy (SMA wires were investigated, which have not been reported in the literature thus far. Some of these parameters included important factors affecting free vibration response of the smart hybrid composite plates. The SMA wires were embedded within the layers of the composite laminate. First-order shear deformation theory (FSDT was utilized to obtain the governing equations of hybrid composite plates. Transverse shear and rotary inertia effects of the plate were taken into consideration. For simply-supported boundary conditions, systematic closed form solutions were obtained by Navier's technique. It was established that dynamic behavior of the smart hybrid composite plate depended on various parameters such as volume fraction, temperature dependent recovery stress and tensile pre-strain of SMA wires and aspect ratio of the laminated hybrid plate.

  17. Analysis of SMA Hybrid Composite Structures in MSC.Nastran and ABAQUS

    Science.gov (United States)

    Turner, Travis L.; Patel, Hemant D.

    2005-01-01

    A thermoelastic constitutive model for shape memory alloy (SMA) actuators and SMA hybrid composite (SMAHC) structures was recently implemented in the commercial finite element codes MSC.Nastran and ABAQUS. The model may be easily implemented in any code that has the capability for analysis of laminated composite structures with temperature dependent material properties. The model is also relatively easy to use and requires input of only fundamental engineering properties. A brief description of the model is presented, followed by discussion of implementation and usage in the commercial codes. Results are presented from static and dynamic analysis of SMAHC beams of two types; a beam clamped at each end and a cantilever beam. Nonlinear static (post-buckling) and random response analyses are demonstrated for the first specimen. Static deflection (shape) control is demonstrated for the cantilever beam. Approaches for modeling SMAHC material systems with embedded SMA in ribbon and small round wire product forms are demonstrated and compared. The results from the commercial codes are compared to those from a research code as validation of the commercial implementations; excellent correlation is achieved in all cases.

  18. Peningkatan Mutu Pendidikan SMA Muhammadiyah 2 Sidoarjo sebagai Sekolah Berkategori The Outstanding School of Muhammadiyah

    Directory of Open Access Journals (Sweden)

    Hidayatulloh Hidayatulloh

    2016-09-01

    Full Text Available This article examines about improving the education quality of SMA Muhammadiyah 2 Sidoarjo as the Outstanding School of Muhammadiyah. This article reveals that the quality improvement of SMA Muhammadiyah 2 Sidoarjo was conducted through: the arrangement of school program and self evaluation, the reinforcement of vision, mission and education objective, the reinforcement of leadership and teamwork, the improvement of teachers and educators competence, the improvement learners quality input, the development of curriculum and learning, the development of school culture, the development of facilities and infrastructure, the development of community service, the cooperation of education and student exchange, the mobilization of education funding resources, the develop-ment of SIM, monitoring and evaluation, and education quality system. The management quality of SMA Muhammadiyah 2 Sidoarjo was run through input-process-output formula. The process of quality containes the process of quality planning, main process, supporting process, dan quality improvement process. Factors supporting the quality improvement are: Muhammadiyah’s popular name, the doctrine of education quality improvement, the leadership of TORSIE paradigm, the school academicians’ spirit of gaining achievement, the synergy of school academicians, the appropriate facilities, and the supports of all stakeholders.

  19. Implementasi Sistem Informasi Akademik Menggunakan Aplikasi Jibas pada SMA Negeri 9 Padang

    Directory of Open Access Journals (Sweden)

    Ricky Akbar

    2015-10-01

    Full Text Available SMA Negeri 9 Padang is one of the institutions engaged in the field of education, which requires the design of software to manage and run all school activities, one of which is the Academic Information System (SIA. SIA currently in SMA 9 Padang yet well integrated, so it still has many shortcomings in meeting the needs of the school or institution, in particular to deal with academic problems. Therefore, it needs to be implemented Academic Information System that can overcome the various shortcomings earlier. Implementation of this application starts with a preliminary study. Activities, the introduction of the school as a whole with interviews and observations, identify business processes academically at school is running and then make the proposed system as terkomputerisasinya, which is described by using the tools of Business Process Model Notation (BPMN, as well as the depiction of a working model of the system to be applied using use case diagram. The next stage is to study the literature of various books and journals to find the theoretical basis and related research. Then selecting software for SIA School, after the configuration and customization of the software modules, and the latter carry out the implementation and testing. These results indicate that the software SIA Schools that have been selected and applied that JIBAS applications, which can solve the problems on SMA Negeri 9 Padang

  20. Hubungan antara Aktivitas Fisik Terhadap Memori Kerja Murid SMA Don Bosco III Bekasi

    Directory of Open Access Journals (Sweden)

    Michelle Clarissa Junaidi

    2017-03-01

    Full Text Available Latar belakang. Memori kerja merupakan bagian dari memori jangka pendek yang berperan penting dalam membantu proses pembelajaran dan dipengaruhi oleh aktivitas fisik, memori kerja yang rendah akan menimbulkan kesulitan untuk menerima informasi baru serta penurunan prestasi belajar. Tujuan. Mengetahui pengaruh aktivitas fisik terhadap kapasitas memori kerja murid SMA Don Bosco III. Metode. Penelitian metode analitik dengan pendekatan potong lintang pada 113 murid SMA Don Bosco III, Bekasi, pada 18 – 20 Juli 2016. Penelitian dilakukan dengan menggunakan kuesioner demografi, kuesioner skrining gangguan mental dan penyakit kronis, Physical Acitivity Questionnaire of Adolescent (PAQ-A dan Operation Span (O-SPAN. Analisis data dengan univariat dan bivariat menggunakan uji korelasi Spearman. Hasil. Terdapat 113 murid SMA Don Bosco III dengan kisaran usia 14 – 17 tahun, usia terbanyak 15 tahun (47.8%, laki-laki 61,1%, murid kelas X 44.2%. Mayoritas responden memiliki aktivitas fisik “kurang baik” dan rerata memori kerja 6,16. Analisis Spearman menunjukkan terdapat hubungan bermakna (p<0,05 antara aktivitas fisik terhadap memori kerja dengan korelasi positif lemah (r=0,384. Kesimpulan. Terdapat korelasi positif antara aktivitas fisik dan memori kerja, aktivitas fisik yang semakin tinggi cenderung akan meningkatkan memori kerja.

  1. Simulación basada en SMA de sistemas originalmente representados con EDO

    Directory of Open Access Journals (Sweden)

    Ekaitz Zulueta Guerrero

    2011-10-01

    Full Text Available Resumen: En el presente trabajo se expone una metodología para modelar mediante un Sistema Multi-Agente (SMA sistemas biológicos y fisiológicos dinámicos con variables cuantificadas discretas, como el crecimiento y decrecimiento de poblaciones o el modelado epidemiológico de enfermedades. Se muestra un procedimiento para transformar un sistema de Ecuaciones Diferenciales Ordinarias (EDO (que modela un entorno de forma correcta en un SMA equivalente mediante un esquema basado en el método de Monte Carlo. Se utiliza un caso práctico fundamentado en un modelo matemático de Leucemia Mieloide Crónica (LMC para comparar la metodología basada en agentes con el modelado tradicional basado en un sistema de EDO. Se realiza una simulación con cada modelo (SMA y EDO y se compara los resultados obtenidos con ambas metodologías. Palabras clave: Ecuaciones diferenciales, modelo basado en agentes, Monte Carlo

  2. Mechanical behavior and fatigue performance of SMA short fiber reinforced MMC

    Science.gov (United States)

    Al-Matar, Basem Jawad

    The mechanical behavior and performance of Shape Memory Alloy (SMA) short fiber NiTi reinforced Al was experimentally investigated for monotonic and fatigue test Al 6061 NiTi-SiC T6 was superior to unreinforced materials as well as to the reinforced Al T4. Taya three-dimensional model was performed on the monotonic tensile test at room temperature. It showed good agreement with experimental results. In order to utilize the compressive criterion for SMA, the NiTi reinforced Al composite was cooled at -10°C and prestrained at 1.2%. Beyond this limit composite suffered from damage. The net enhancement of SMA effect was around 10 MPa on composite yield stress. Results showed that the elastic constant for the composite did not change with loading and unloading suggesting that the inelastic behavior is plasticity. Further investigation on the inelastic behavior model as damage and/or plasticity by evaluating Poisson's ratio during loading was carried out by Adaptive Image Correlation Technique for Full-Field Strain Measurement. Poisson's ratio increased from around 0.33 to 0.5 demonstrating that it is plasticity that is responsible for the inelastic behavior. Scanning electron microscopy was also used and confirmed model results. The overall damage-behavior was quantified in terms of the post fatigue failure strength for low-cycle fatigue tests. Power law model was best to fit experimental findings.

  3. PROFIL KESULITAN BELAJAR FISIKA POKOK BAHASAN KELISTRIKAN SISWA SMA DI KOTA SEMARANG

    Directory of Open Access Journals (Sweden)

    Ani Rusilowati

    2012-01-01

    Full Text Available Tujuan penelitian ini adalah menentukan profil kesulitan belajar Fisika, khususnya pokok bahasan Kelistrikan yang dialami oleh siswa SMA di kota Semarang. Sampel penelitian adalah siswa SMA kelas X di kota Semarang, diambil secara cluster, dari SMA negeri dan swasta peringkat I, II, dan III, sebanyak 214 siswa. Kesulitan belajar didiagnosis dengan lima pendekatan, yaitu tujuan pembelajaran, pengetahuan prasyarat, profil materi, miskonsepsi, dan pengetahuan terstruktur. Kesulitan belajar Kelistrikan antara lain disebabkan oleh rendahnya penguasaan konsep, lemahnya kemampuan matematis, dan kekurangmampuan mengkonversi satuan. Penyebab kesulitan belajar dalam pengetahuan terstruktur adalah rendahnya kemampuan: verbal, menggunakan skema, membuat strategi pemecahan masalah, dan membuat algoritma. Hasil penelitian menunjukkan bahwa kesulitan belajar Kelistrikan rata-rata terjadi pada sub pokok bahasan: Kuat Arus Listrik, Hukum Ohm, Hambatan Penghantar, Hukum Kirchof II, Energi & Daya Listrik, dan Transformator. Sebagian siswa masih mengalami miskonsepsi terhadap konsep Hukum Ohm dan Hambatan Penghantar. Bagi siswa  sekolah peringkat III mengalami kesulitan belajar di semua aspek dan materi Kelistrikan Kata kunci : profil, kesulitan belajar, kelistrikan

  4. Analysis of Coliform Bacteria in WSPs at ALSCON Using Macconkey ...

    African Journals Online (AJOL)

    Two methods where used for this analysis namely: the membrane Filtration Technique (MFT) and the Multiple Tube Technique (MTT). The MFT was more precise, simple and faster in enumerating coliofrm bacteria per 100ml as compared with the MTT method. The two methods (MTT and MFT) was used to determine the ...

  5. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  6. SMA spring-based artificial muscle actuated by hot and cool water using faucet-like valve

    Science.gov (United States)

    Park, Cheol Hoon; Son, Young Su

    2017-04-01

    An artificial muscle for a human arm-like manipulator with high strain and high power density are under development, and an SMA(Shape memory alloy) spring is a good actuator for this application. In this study, an artificial muscle composed of a silicon tube and a bundle of SMA(Shape memory alloy) springs is evaluated. A bundle of SMA springs consists of five SMA springs which are fabricated by using SMA wires with a diameter of 0.5 mm, and hot and cool water actuates it by heating and cooling SMA springs. A faucet-like valve was also developed to mix hot water and cool water and control the water temperature. The mass of silicon tube and a bundle of SMA springs is only 3.3 g and 2.25 g, respectively, and the total mass of artificial muscle is 5.55 g. It showed good actuating performance for a load with a mass of 2.3 kg and the power density was more than 800 W/kg for continuous valve switching with a cycle of 0.6 s. The faucet-like valve can switch a water output from hot water to cold water within 0.3s, and the artificial muscle is actuated well in response to the valve position and speed. It is also presented that the temperature of the mixed water can be controlled depending on the valve position, and the displacement of the artificial muscle can be controlled well by the mixed water. Based on these results, SMA spring-based artificial muscle actuated by hot and cool water could be applicable to the human arm-like robot manipulators.

  7. Studi Kasus Tentang Siswi yang Memiliki Konsep Diri Negatif pada Kelas X SMA Mujahidin Pontianak Tahun 2017

    OpenAIRE

    Ningsih, Dwi Purwanti

    2017-01-01

    This research entitled case study about student who have negative self concept in class X SMA Mujahidin Pontianak. Common problem in this research is how effort to help student having negatif self concept in class X SMA Mujahidin Pontianak? As for the sub-problems: 1) How are the characteristics of student who have negative self concept?, 2) What psychological factors that cause student to have negative self concept?, 3) What physiological factors that cause student to have a negative self co...

  8. Superior mesenteric artery (SMA) resection during pancreatectomy for malignant disease of the pancreas: a systematic review.

    Science.gov (United States)

    Jegatheeswaran, Santhalingam; Baltatzis, Minas; Jamdar, Saurabh; Siriwardena, Ajith K

    2017-06-01

    Resection of the superior mesenteric artery (SMA) during pancreatectomy is performed infrequently and is undertaken with the aim of removing non-metastatic locally advanced pancreatic tumours. SMA resection reports also encompass resection of other visceral vessels. The consequences of resection of these different arteries are not necessarily equivalent. This is a focused systematic review of the outcome of SMA resection during pancreatectomy for cancer. A computerized search of the English language literature was undertaken for the period 1st January 2000 through 30th April 2016. The keywords "Pancreatic surgery" and "Vascular resections" were used. Thirteen studies reported 70 patients undergoing pancreatectomy with SMA resection from 10,726 undergoing pancreatectomy. Individual patient-level outcome data were available for 25. Median (range) accrual period was 132 (48-372) months. Reported peri-operative morbidity ranged from 39% to 91%. There were 5 peri-operative deaths in the 25 patients with individual-outcome data. Median survival was 11 months (95% Confidence interval 9.5-12.5 months; standard error 0.8 months). SMA resection during pancreatectomy is undertaken infrequently incurring high peri-operative morbidity and mortality. Median survival is 11 (95% CI 9.5-12.5) months. In contemporary practice there is no evidence to support SMA resection during pancreatectomy. Copyright © 2017 International Hepato-Pancreato-Biliary Association Inc. All rights reserved.

  9. Studi Kasus Pengembangan Program Bimbingan dan Konseling di SMA Negeri Kota Surakarta

    Directory of Open Access Journals (Sweden)

    Anna Annisa

    2015-12-01

    Full Text Available Penelitian berdasarkan fenomena program bimbingan dan konseling di sekolah belum berjalan dengan baik terutama pada bagian perencanaan dan pelaksanaan program BK. Tujuan penelitian ini untuk mengetahui pengembangan program di SMA Negeri 7 Surakarta dan SMA N 8 Surakarta mulai dari (1 pelaksanaan asesmen kebutuhan melalui pengumpulan data, (2 interpretasi data asesmen kebutuhan, (3 penetapan prioritas kebutuhan, (4 penetapan tujuan program, (5 penetapan prosedur program, dan (6 perencanaan bagi perbaikan peningkatan penyempurnaan program. Jenis penelitian ini adalah deskriptif kualitatif dengan pendekatan studi kasus. Penelitian ini melibatkan guru BK di SMA Negeri Kota Surakarta. Metode pengumpulan data yang digunakan adalah menggunakan wawancara, observasi dan dokumentasi. Teknik analisis data menggunakan pengumpulan data, reduksi data, penyajian data dan penarikan kesimpulan. Simpulan dari penelitian ini adalah pada SMA N 7 Surakarta pengembangan program fokus pada penggunaan instrumen dalam asesmen, sasaran asesmen, kesesuaian asesmen dengan kebutuhan siswa, layann klasikal dan layanan kelompok. Sedangkan SMA N 8 Surakarta  difokuskan pada penentuan prioritas kebutuhan dan analisis data kebutuhan siswa. This research of program guidance and counselling in schools has not fully well especially at the planning and execution of counseling and guidance program. The purpose to know the development program at senior high school 7 Surakarta and senior high school 8 Surakarta ranging from (1 the implementation of needs assessment through data collection, data interpretation (2 the assessment of needs, (3 the determination of priority needs, (4 The goal setting program, (5 the determination of the procedures of the program, and (6 The planning for improvements to increase refinement program. Type of this research is descriptive qualitative approach to case studies. This research involves guidance and counseling teachers in senior high school of

  10. Faktor Penghambat Proses Layanan Konseling Individual di SMA se-Kota Cilacap

    Directory of Open Access Journals (Sweden)

    Fenti Nurindahsari

    2015-12-01

    Full Text Available Berdasarkan penuturan guru BK di salah satu SMA di kota Cilacap yang pernah menjadi tempat observasi oleh peneliti, ditemukan fenomena terkait dengan layanan konseling individual di sekolah tersebut yang tidak sesuai dengan teori-teori mengenai konseling individual yang ada dalam bimbingan konseling. Contoh yang tidak sesuai dengan teori  ketika proses konseling berakhir guru BK di sekolah tersebut tidak ada upaya tindak lanjut. Tujuan penelitian ini untuk mengetahui faktor penghambat proses layanan konseling individual di SMA sekota Cilacap. Jenis penelitian deskriptif kuantitatif. Populasi dalam penelitian ini adalah konselor yang ada di SMA sekota Cilacap. Teknik sampel untuk konselor yang dipilih praktikan adalah sampling jenuh. Instrumen yang digunakan adalah angket. Validitas menggunakan rumus Product Moment. Uji reliabitilitas menggunakan rumus Alpha. Metode analisis data menggunakan deskriptif persentase. Hasil penelitian menunjukan faktor internal penghambat berasal dari konselor dalam kriteria tinggi (71,74% faktor eksternal penghambat termasuk kriteria tinggi yaitu norma (71,59%, sarpras (71,38% dan lingkungan fisik (72,39%. Dapat disimpulkan hambatan yang ada dalam proses layanan konseling individual di SMA sekota Cilacap berasal dari faktor internal dan eksternal yang memiliki kriteria yang sama yaitu dalam kategori tinggi. Based the narrative counseling teacher in one high school in Cilacap town that  once a place observation, discovered the phenomenon associated with individual counseling services in the school is not in accordance with the theories about the existing individual counseling in counseling. Examples that don’t fit with theory when the counseling process ends counseling teacher the school is’n follow-up effort. The purpose of this study to determine inhibiting factors individual counseling service process In senior high school Cilacap derby. Pupolasi in research is senior high school counselors. Technical

  11. MEDIA FOTO UNTUK MENINGKATKAN KETERAMPILAN MENULIS DESKRIPSI SISWA SMA NEGERI 2 KEBUMEN

    Directory of Open Access Journals (Sweden)

    Rina Tri Indrianingrum

    2015-05-01

    Full Text Available Penelitian ini bertujuan untuk menjelaskan meningkatnya keterampilan menulis deskripsi berbahasa Jawa siswa kelas X SMA N 2 Kebumen dengan menggunakan pendekatan proses dan media foto. Penelitian ini merupakan penelitian tindakan kelas atau classroom action research. Desain yang digunakan dalam penelitian ini adalah desain penelitian tindakan Kemmis dan Taggart. Penelitian ini dilaksanakan dua siklus. Subjek penelitian ini adalah siswa kelas X2 SMA Negeri 2 Kebumen tahun pelajaran 2011/2012 yang berjumlah 32 siswa. Pengumpulan data dilakukan dengan menggunakan observasi, catatan lapangan dan tes. Validitas yang digunakan adalah validitas demo-krasi, validitas proses dan validitas dialogis. Teknik yang digunakan untuk menganalisis data dalam penelitian tindakan ini adalah deskriptif. Hasil penelitian menunjukkan (1 siswa dapat menemukan ide lebih cepat, (2 siswa dapat membuat kerangka karangan, (3 siswa dapat mengembangkan kerang-ka karangan, (4 siswa dapat berpikir sistematis, (5 siswa semakin antusiasnya dalam mengikuti pembelajaran menulis karangan, (6 siswa paham melakukan proses mengarang. _________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ PHOTOGRAPH MEDIA TO IMPROVE THE DESCRIPTION WRITING SKILL OF THE STUDENTS AT SMA NEGERI 2 KEBUMEN   Abstract This research is aimed to describe and to explain the improvement in the description writing skill of the tenth grade students at SMA N 2 Kebumen by using  approach process and photography media. This research is classroom action research or classroom action research. The design used in this research was action research design by Kemmis and Taggart. The subject of the research was X2 class students at SMA Negeri 2 Kebumen in the academic year of 2011/2012, consisted of 32

  12. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  13. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  14. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  16. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  17. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  18. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  19. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  20. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  1. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  2. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  3. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  4. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  5. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  6. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  7. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  8. S&MA Internship to Support Orion and the European Service Module

    Science.gov (United States)

    Hutcheson, Connor

    2016-01-01

    As a University Space Research Association (USRA) intern for NASA Johnson Space Center (JSC) during the summer 2016 work term, I worked on three main projects for the Space Exploration Division (NC) of the Safety and Mission Assurance (S&MA) Directorate. I worked on all three projects concurrently. One of the projects involved facilitating the status and closure of technical actions that were created during European Service Module (ESM) safety reviews by the MPCV Safety & Engineering Review Panel (MSERP). The two main duties included accurately collecting and summarizing qualitative data, and communicating that information to the European Space Agency (ESA) and Airbus (ESA's prime contractor) in a clear, succinct and precise manner. This project also required that I create a report on the challenges and opportunities of international S&MA. With its heavy emphasis on soft skills, this project taught me how to communicate better, by showing me how to present and share information in an easy-to-read and understandable format, and by showing me how to cooperate with and culturally respect international partners on a technical project. The second project involved working with the Orion Thermal Protection System (TPS) Process Failure Modes and Effects Analysis (PFMEA) Working Group to create the first full version of the Orion TPS PFMEA. The Orion TPS PFMEA Working Group met twice a week to analyze the Avcoat block installation process for failure modes, the failure modes effects, and how such failure modes could be controlled. I was in charge of implementing changes that were discussed in meeting, but were not implemented real time. Another major task included creating a significant portion of the content alongside another team member outside the two weekly meetings. This project caused me to become knowledgeable about TPS, heatshields, space-rated manufacturing, and non-destructive evaluation (NDE). The project also helped me to become better at working with a small

  9. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  10. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  11. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  12. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  14. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  15. Candidate proteins, metabolites and transcripts in the Biomarkers for Spinal Muscular Atrophy (BforSMA clinical study.

    Directory of Open Access Journals (Sweden)

    Richard S Finkel

    Full Text Available Spinal Muscular Atrophy (SMA is a neurodegenerative motor neuron disorder resulting from a homozygous mutation of the survival of motor neuron 1 (SMN1 gene. The gene product, SMN protein, functions in RNA biosynthesis in all tissues. In humans, a nearly identical gene, SMN2, rescues an otherwise lethal phenotype by producing a small amount of full-length SMN protein. SMN2 copy number inversely correlates with disease severity. Identifying other novel biomarkers could inform clinical trial design and identify novel therapeutic targets.To identify novel candidate biomarkers associated with disease severity in SMA using unbiased proteomic, metabolomic and transcriptomic approaches.A cross-sectional single evaluation was performed in 108 children with genetically confirmed SMA, aged 2-12 years, manifesting a broad range of disease severity and selected to distinguish factors associated with SMA type and present functional ability independent of age. Blood and urine specimens from these and 22 age-matched healthy controls were interrogated using proteomic, metabolomic and transcriptomic discovery platforms. Analyte associations were evaluated against a primary measure of disease severity, the Modified Hammersmith Functional Motor Scale (MHFMS and to a number of secondary clinical measures.A total of 200 candidate biomarkers correlate with MHFMS scores: 97 plasma proteins, 59 plasma metabolites (9 amino acids, 10 free fatty acids, 12 lipids and 28 GC/MS metabolites and 44 urine metabolites. No transcripts correlated with MHFMS.In this cross-sectional study, "BforSMA" (Biomarkers for SMA, candidate protein and metabolite markers were identified. No transcript biomarker candidates were identified. Additional mining of this rich dataset may yield important insights into relevant SMA-related pathophysiology and biological network associations. Additional prospective studies are needed to confirm these findings, demonstrate sensitivity to change with

  16. Cure SMA

    Science.gov (United States)

    ... 2, 2017 New Clinical Trial Data Published in New England Journal of Medicine Two new papers of clinical trial data for spinal muscular atrophy were published today in the November issue of the New England Journal of... READ MORE October 25, 2017 Fall 2017 ...

  17. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  18. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  19. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  20. Profil Problem Emosi/ Perilaku Pada Remaja Pelajar SMP-SMA Di Kota Semarang

    Directory of Open Access Journals (Sweden)

    Annastasia Ediati

    2015-10-01

    Full Text Available The aims of this study is to identify the profile of emotional/behavioral problems on adolescents students of junior and senior high school (SMP-SMA in Semarang, Central Java. The subjects comprised 568 students (grade VII and X; males and females, aged between 13-17 years. Data were collected using the Indonesian translation of the Youth Self Report (YSR. The results of data analysis showed that adolescents in the junior high school/SMP reported emotional/behavioral problems more frequently than the adolescents in the senior high school/SMA (t (566 = 2.08, p = .038, especially in terms of social relations (t (566 = 2.92, p = .004, thought problems (t (566 = 2.47, p = .014, somatic complaints (t(566 = 2.98, p = .002, rule-breaking behavior (t (566 = 6.63, p < .001, and externalizing problems (t(566 = 3,37; p = .001. Gender differences was found in the adolescents’ emotional/behavioral problems. In group of junior high school students (SMP, girls reported more emotional problems than boys (t(335 = -3.55; p < .001, particularly in anxiety/depression (t(335 = -6.51; p < .001; withdrawal (t(335 = -4.26; p < .001, somatic complaints (t(335 = -2.86; p = .004; social problems (t(335 = -3.30; p = .001, attention problems (t(335 = -2.39; p = .017; and internalizing problem (t(335 = -5.76; p < .001. In group of senior high school students (SMA, boys reported more externalizing problems (t(229 = 2.10; p = .037 and rule-breaking behavior (t(229 = 4.44; p < .001 than girls. In contrasts, girls reported more somatic complaints than boys (t(229 = -3.09; p = .001. Adolescents’ emotional/behavioral problems should gained more attention. Preventive as well as curative intervention is needed, particularly intervention that sensitive to gender and age, which also involve significant figures for adolescents (parents, school teachers, and peers.

  1. Experimental study on tunnel lining joints temporarily strengthened by SMA bolts

    International Nuclear Information System (INIS)

    Wu, Bo; Ou, Yunlong

    2014-01-01

    Shield tunnels have been widely used in city metros all over the world. During the long-term period of the metro operation, the joints of shield tunnel’s neighboring segments may degrade due to some environmental factors, leading to the increasing of the joint opening and some resulting adverse consequences. In this paper, a temporary strengthening method by using shape memory alloy (SMA) bolts is proposed and experimentally studied for the joints of neighboring segments, and a revised electric heating method which suits with the strengthening method is presented and experimentally validated for the SMA bolts. The purpose of the proposed temporary strengthening method is to create favorable conditions for the following permanent strengthening. Test results show that: (a) for the joints of shield tunnel’s neighboring segments, the strengthening method can effectively reduce the joint opening, joint deflection, concrete strain in joint’s compression zone, and strain of joint’s steel bolts; (b) the revised electric heating method can be used to heat the SMA rod to a temperature higher than the SMA’s austenite finish temperature quickly, and the average heating rate related to Type 2 inner resistance element is larger than that related to Type 1 inner resistance element; and (c) the reduction percentages of the joint opening increment, joint deflection, concrete strain in joint’s compression zone, and strain of joint’s steel bolts for Specimen I are all larger than those for Specimen II, implying that the less the joint opening is, the more significant the strengthening effect is. (paper)

  2. KEMAMPUAN PROFESIONAL GURU BIOLOGI DALAM MEMAHAMI DAN MERANCANG MODEL PEMBELAJARAN KONSERVASI BIODIVERSITAS DI SMA

    Directory of Open Access Journals (Sweden)

    Suroso Mukti Leksono

    2013-11-01

    Full Text Available Abstrak: Tujuan penelitian ini adalah untuk mengetahui penguasaan konsep konservasi biodiversitas guru biologi dan cara mengajarkannya. Penelitian ini menggunakan metode deskriptif dengan menggunakan angket pada 31 guru SMA/MA di Kota/Kab Serang. Hasil penelitian menunjukkan bahwa 52% guru telah memahami konsep biodiversitas, namun hanya 3% yang memahami konsep konservasi. Model yang digunakan guru dalam mengajarkan konservasi biodiversitas, 58% menggunakan observasi, 45% diskusi, 23% ceramah dan 16% tanya jawab. Untuk tingkat kesukaran, 87% guru beranggapan mudah memahami materi konservasi biodiversitas dan 81% beranggapan mudah mengajarkannya dibandingkan dengan materi IPA lainnya. Guru-guru selama ini hanya 6% saja yang memperoleh pengetahuan tentang konservasi biodiversitas pada saat pelatihan. Oleh sebab itu diperlukan pelatihan-pelatihan melalui Continuing Professional Development (CPD. Kata Kunci: guru profesional, konservasi biodiversitas, continuing professional development (CPD BIOLOGY TEACHERS’ PROFESSIONAL ABILITY IN UNDERSTANDING AND DESIGNING INSTRUCTION ON BIODIVERSITY CONSERVATION IN SMA Abstract: The purpose of this study was to gain the knowledge about biology teachers’ concept mastery on biodiversity conservation as well as how to teach it. This study used descriptive methods with the questionnaires to 31 respondents of SMA/MA in Kota/KabSerang. The research result showed that 52% respondents had mastered the biodiversity concept. However, only 3% of respondents had fully mastered biodiversity conservation. In addition, for the teaching methods 58% respondents used observation, 45% respondents used discussion, 23% respondents used lecturing and 16% respondents used an interactive method. Moreover, for the difficulty level, 87% of respondents argued that it was easy to master the biodiversity conservation materials and 81% said that it was easier to teach the concept than other concepts. Only 6% of the teachers had gained

  3. Pola Pembinaan Kompetensi Kepribadian dan Kompetensi Sosial Guru di SMA Muhammadiyah 1 Ponorogo

    Directory of Open Access Journals (Sweden)

    Bambang Wahrudin

    2017-11-01

    Full Text Available This research is motivated by the importance of personal competence and social competence teacher as the spirit of education. The focus of reasearch is know the program fostering personal competence and social competence teacherin SMA Muhammadiyah 1 Ponorogo . Deep observation and interview used in this research by qualitative aproach. The result shows that personality competence development programs conducted in six (6 forms include: 1 Dhuhr and Asr prayers in congregation, 2 Baitul Arqom for teachers and employees, 3 Course / tahsin read the Koran for teachers and employees, 4 Pray tahajud ahad congregation every morning, and 5 Training Motivation and 6 Counseling, whereas social competence training program conducted by three (3 forms, namely: 1 Piket Sympathetic, 2 MGMPs and 3 Sinergy Building. These patern have made theacher have stong  professionaly and  authority Abstrak Penelitian ini dilatarbelakangi oleh pentingnya kompetensi kepribadian dan kompetensi sosial bagi guru sebagai ruh pendidikan. Penelitian ini bertujuan untuk mengetahui program pembinaan kompetensi kepribadian dan kompetensi sosial guru di SMA Muhammadiyah 1 Ponorogo. Reset mendalam dilakukan secara kualitatif. Hasil penelitian menunjukkaan bahwa Program pembinaan kompetensi kepribadian dan kompetensi sosial sumber daya manusia di SMA Muhammadiyah 1 Ponorogo menggunakan 6 (enam bentuk meliputi: 1. sholat Dhuhur dan Ashar berjamaah, 2. baitul Arqom untuk guru dan karyawan, 3. kursus/tahsin baca al-Qur’an untuk guru dan karyawan, 4. sholat tahajud berjamaah setiap ahad dini hari, dan 5. training motivasi dan 6. konseling, sedangkan program pembinaan kompetensi sosial dilakukan dengan 3 (tiga bentuk, yaitu: 1. paket Simpatik, 2.  MGMP dan 3. sinergy Building. Pola ini telah berhasil menghantarkan guru sebagai guru yang profesional yang kuat dan berwibawa.

  4. Advanced methods for the analysis, design, and optimization of SMA-based aerostructures

    International Nuclear Information System (INIS)

    Hartl, D J; Lagoudas, D C; Calkins, F T

    2011-01-01

    Engineers continue to apply shape memory alloys to aerospace actuation applications due to their high energy density, robust solid-state actuation, and silent and shock-free operation. Past design and development of such actuators relied on experimental trial and error and empirically derived graphical methods. Over the last two decades, however, it has been repeatedly demonstrated that existing SMA constitutive models can capture stabilized SMA transformation behaviors with sufficient accuracy. This work builds upon past successes and suggests a general framework by which predictive tools can be used to assess the responses of many possible design configurations in an automated fashion. By applying methods of design optimization, it is shown that the integrated implementation of appropriate analysis tools can guide engineers and designers to the best design configurations. A general design optimization framework is proposed for the consideration of any SMA component or assembly of such components that applies when the set of design variables includes many members. This is accomplished by relying on commercially available software and utilizing tools already well established in the design optimization community. Such tools are combined with finite element analysis (FEA) packages that consider a multitude of structural effects. The foundation of this work is a three-dimensional thermomechanical constitutive model for SMAs applicable for arbitrarily shaped bodies. A reduced-order implementation also allows computationally efficient analysis of structural components such as wires, rods, beams and shells. The use of multiple optimization schemes, the consideration of assembled components, and the accuracy of the implemented constitutive model in full and reduced-order forms are all demonstrated

  5. Analisis Dampak Negatif Facebook pada Remaja Kelas X IPS SMA Kemala Bhayangkari Kubu Raya

    OpenAIRE

    Malindo, Hari

    2017-01-01

    The negative impact of the use of facebook is a result caused the use of facebook excessively that can give rise to abuse and diversion to brpengaruh directly to the consumer, and often waste time just to tamper with his facebook account, if not used wisely facebook will have a negative impact to pengggunanya it sendiri..Oleh because the researchers wanted to know more profound analysis of the negative impact on teenagers facebook IPS class X SMA Kemala Bhayangkari Kubu Raya.A common problem ...

  6. MODEL EVALUASI INTERNAL KOMPETENSI GURU BAHASA INGGRIS (MODEL_EIKGBI SMA

    Directory of Open Access Journals (Sweden)

    Sahraini Sahraini

    2015-10-01

    Full Text Available Studi ini bertujuan untuk: (1 mengembangkan model evaluasi kompetensi guru bahasa Inggris SMA yang dapat digunakan untuk mengidentifikasi kelebihan dan kekurangan guru dalam proses pemelajaran dan (2 mengetahui efektivitas implementasi evaluasi internal kompetensi guru bahasa Inggris SMA. Studi ini menggunakan metode penelitian dan pengembangan yang dikembangkan oleh Borg & Gall (1983, p.775. Subjek penelitian berjumlah 17 guru yang berasal dari 7 SMA di Sulawesi Selatan. Konstruk instrumen terdiri atas instrumen untuk mengevaluasi kompetensi guru bahasa Inggris dalam merencanakan pemelajaran, instrumen untuk mengevaluasi kompetensi guru dalam melaksanaan proses pemelajaran, dan instrumen untuk mengevaluai kompetensi guru dalam mengevaluasi hasil proses pemelajaran. Hasil penelitian menunjukkan bahwa instrumen yang dikembangkan dapat digunakan untuk mengevaluasi kompetensi guru bahasa Inggris. Untuk mengetahui sejauh mana tingkat efektivitas Model Evaluasi Internal Kompetensi Guru Bahasa Inggris SMA, model ini kemudian dievaluasi oleh teman sejawat guru bahasa Inggris dan guru bahasa Inggris itu sendiri. Mereka menyimpulkan bahwa komponen dari model tersebut adalah komprehensip, praktis, ekonomis, dan telah didukung oleh instrumen yang valid dan reliabel. Kata kunci: evaluasi internal, model evaluasi, kompetensi guru   INTERNAL EVALUATION MODEL OF ENGLISH TEACHERS’ COMPETENCY (IEMET FOR SENIOR HIGH SCHOOL Abstract High School that can be used to identify the teacher’s strengths and weaknesses in learning and teaching processes and (2 find out the implementation effectiveness of the Internal Evaluation Model of English Teachers’ Competency for Senior High School. This study used research & development methods by following the pattern of phases developed by Borg & Gall (1983, p.775.  The subjects of this study were seventeen English teachers from seven Senior High Schools in South Sulawesi. The constructs of instruments consist of the

  7. Hubungan Merokok Dengan Kejadian Insomnia Pada Remaja Di SMA Negeri 1 Remboken Kabupaten Minahasa

    OpenAIRE

    Kairupan, Juwinda Meini Ayu; Rottie, Julia; Malara, Reginus

    2016-01-01

    : Insomnia is difficulty initiating and maintaining sleep so can not meet the need for adequate sleep , both quantity and quality. Smoking is one of the causes of insomnia. Smoking is an act of burning a tabacco which inhaled the smoke from the burning process in a form of cigarette or a pipe. The purpose of this study was to analyze the relationship of smoking with the incidence of insomnia in adolescents at SMA N 1 Remboken Minahasa District. The research method is used observational analy...

  8. PENGARUH PROJECT BASED LEARNING TERHADAP KETERAMPILAN PROSES SAINS SISWA KELAS X SMA NEGERI SIDOARJO

    Directory of Open Access Journals (Sweden)

    Nuril Maghfiroh

    2016-08-01

    Tujuan penelitian ini adalah untuk mengetahui pengaruh pembelajaran Project Based Learning terhadap keterampilan proses sains siswa kelas X SMA Negeri 4 Sidoarjo. Penelitian ini menggunakan metode Quasi Eksperimen dengan rancangan pretest postest non-equivalent control group design. Penentuan sampel mempertimbangkan kemampuan kognitif yang setara antara dua kelas yang menjadi kelompok kontrol dan kelompok eksperimen. Keterampilan proses sains diukur melalui tes tulis yang kemudian dianalisis dengan rubrik penilaian yang sudah disesuaikan untuk setiap aspek keterampilan proses sains. Hasil penelitian menunjukkan bahwa ada pengaruh pembelajaran Project Based Learning terhadap keterampilan proses sains siswa.

  9. Analisis Kemampuan Berpikir Matematis Siswa SMA kota Sorong terhadap Butir Soal dengan Graded Response Model

    Directory of Open Access Journals (Sweden)

    Muhammad Syahrul Kahar

    2017-06-01

    Full Text Available This research aims to know the level of mathematical thinking ability of students by using scored model Graded Response Model (GRM. The subject here is the students of Class XI IPA 1 SMA Negeri 3 Sorong the 2016/2017 academic year, which amounted to 38 students with 22 students are male and 16 female students. This research is a descriptive research experiment. The results of this study indicate that the scored model GRM is effective in analyzing the ability of mathematical thinking of students. The effectiveness is shown an increase in student learning outcomes grade XI IPA 1 SMA Negeri 3 Kota Sorong, where the average grade results visible increase of 56.7 until 78, and the value of the completeness students improved significantly, and student learning outcomes were shown in graded contents relevance criteria students with score 4 there are 18 students (47.37%, while the relevance of the contents with a score of 1 there are 4 students (10.53%. From the criteria of completeness students who achieve complete answers by a score of 4, there are 1 students (2.64%, and the answers are far from finished with a score of 1 there were 7 students (19.52%. Then to organizing criteria, students are working on a very systematic, there are 8 students (21.05%, and organizing with not systematically there are 10 students (26.32%. Penelitian ini bertujuan untuk mengetahui tingkat kemampuan berpikir matematis siswa dengan menggunakan model penyekoran Graded Response Model (GRM. Subjek penelitian disini adalah siswa kelas XI IPA 1 SMA Negeri 3 Kota Sorong tahun ajaran 2016/2017, yang berjumlah 38 siswa dengan 22 siswa laki-laki dan 16 siswa perempuan. Penelitian ini adalah penelitian eksperimen yang bersifat Deskriptif. Hasil penelitian ini menunjukkan bahwa model penyekoran GRM ini efektif dalam menganalisis kemampuan berpikir matematis siswa. Keefektifan tersebut terlihat adanya peningkatan hasil belajar siswa kelas XI IPA 1 SMA Negeri 3 Kota Sorong, dimana

  10. Analisis pengelolaan peralatan praktikum fisika kelas XI SMA Muhammadiyah 1 Yogyakarta menggunakan model countenance stake

    Directory of Open Access Journals (Sweden)

    Hanin Fathan Nurfina Istiqomah

    2016-11-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui ketersediaan dan pengelolaan peralatan praktikum serta mengetahui hasil dari pengelolaan dan penggunaan peralatan praktikum fisika kelas XI di laboratorium fisika SMA Muhammadiyah 1 Yogyakarta. Penelitian ini merupakan penelitian evalusi model countenance stake. Subjek penelitian meliputi penanggungjawab laboratorium fisika, guru, laboran, dan siswa kelas XI MIA SMA Muhammadiyah 1 Yogyakarta. Penelitian dilakukan pada akhir pelaksanaan praktikum pada semester genap tahun pelajaran 2015-2016. Data dikumpulkan dengan wawancara terstruktur, pengamatan (observasi, angket, dokumentasi. Hasil penelitian menunjukkan bahwa ketersediaan peralatan praktikum (masukan [antecedents] yang terdiri dari sarana, prasarana dan alat praktikum tersedia sangat baik dengan persentase sebesar 78,16%. Pengelolaan laboratorium fisika (proses [transaction] yang terdiri dari persiapan pelaksanaan praktikum; kesiapan siswa, guru, laboran; dan pelaksanaan praktikum mendapatkan hasil sangat baik dengan persentase sebesar 81,78%. Hasil yang diperoleh (outcomes dari ketersediaan dan pengelolaan peralatan praktikum di laboratorium fisika termasuk kategori baik (B+ dengan pencapaian Kriteria Ketuntasan Minimal (KKM 100% dari total 233 siswa kelas XI MIA (Matematika dan Ilmu Alam dan beberapa siswa berhasil meraih juara 1 Olimpiade Fisika. This research is aimed to know the availability, management of the laboratory equipment’s and also the result of maintaining and using physics laboratory equipment’s in 11th class of MIA SMA 1 Muhammadiyah Yogyakarta. And this evaluation research used “countenance stake” approach, hence, such as the objects of it is the physics laboratory care taker, teachers, laboratory assistant, and the students. This research was conducted in the last meeting of practicum on last semester 2015-2016 periods. The data was assembled by interview, observation, questionnaire and documentation. The result of this

  11. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  12. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  13. Self-repairing performance of concrete beams strengthened using superelastic SMA wires in combination with adhesives released from hollow fibers

    International Nuclear Information System (INIS)

    Kuang Yachuan; Ou Jinping

    2008-01-01

    By taking advantage of the superelastic effect of shape memory alloy (SMA) and the cohering characteristic of repairing adhesive, a smart self-repairing concrete beam with damage self-repairing performance has been developed. In order to verify the potential self-repairing capacity of smart concrete beams reinforced with SMA wires and brittle fibers containing adhesives, static loading tests were conducted. Experimental results show that the superelastic SMA wires added self-restoration capacity to concrete beams, the deflection of the beams reversed and the crack closed almost completely after unloading. After the release of adhesive from the broken-open fibers into the cracks from the first loading, stress was redistributed to the uncracked section where a new crack was formed, while the sealed crack remained closed during reloading for the smart concrete beams reinforced with SMA wires and brittle fibers containing adhesives. While the original cracks experienced reopening, the load was carried directly by the wires during reloading for concrete beams reinforced with SMA wires

  14. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  15. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  16. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  17. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  18. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  19. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  20. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  1. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  2. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  3. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  4. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  5. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  6. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  7. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  8. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  9. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  10. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  11. Biomechanics of smart wings in a bat robot: morphing wings using SMA actuators

    International Nuclear Information System (INIS)

    Colorado, J; Barrientos, A; Rossi, C; Breuer, K S

    2012-01-01

    This paper presents the design of a bat-like micro aerial vehicle with actuated morphing wings. NiTi shape memory alloys (SMAs) acting as artificial biceps and triceps muscles are used for mimicking the morphing wing mechanism of the bat flight apparatus. Our objective is twofold. Firstly, we have implemented a control architecture that allows an accurate and fast SMA actuation. This control makes use of the electrical resistance measurements of SMAs to adjust morphing wing motions. Secondly, the feasibility of using SMA actuation technology is evaluated for the application at hand. To this purpose, experiments are conducted to analyze the control performance in terms of nominal and overloaded operation modes of the SMAs. This analysis includes: (i) inertial forces regarding the stretchable wing membrane and aerodynamic loads, and (ii) uncertainties due to impact of airflow conditions over the resistance–motion relationship of SMAs. With the proposed control, morphing actuation speed can be increased up to 2.5 Hz, being sufficient to generate lift forces at a cruising speed of 5 m s −1 . (paper)

  12. Fabrication of wrist-like SMA-based actuator by double smart soft composite casting

    Science.gov (United States)

    Rodrigue, Hugo; Wei, Wang; Bhandari, Binayak; Ahn, Sung-Hoon

    2015-12-01

    A new manufacturing method for smart soft composite (SSC) actuators that consists of double casting a SSC actuator to produce an actuator with non-linear shape memory alloy (SMA) wire positioning is proposed. This method is used to manufacture a tube-shaped SSC actuator in which the SMA wires follow the curvature of the tube and is capable of pure-twisting deformations while sustaining a cantilever load. The concept is tested by measuring the maximum twisting angle and a simple control method is proposed to control the twisting angle of the actuator. Then, a soft robotic wrist with a length of 18 cm is built, its load-carrying capability is tested by measuring the cantilever force required for deforming the actuator, and its load-carrying capability during actuation is tested by loading one end with different objects and actuating the actuator. This wrist actuator shows good repeatability, is capable of twisting deformations up to 25° while holding objects weighing 100 g, and can sustain loads above 2 N without undergoing buckling.

  13. Fabrication of wrist-like SMA-based actuator by double smart soft composite casting

    International Nuclear Information System (INIS)

    Rodrigue, Hugo; Wei, Wang; Bhandari, Binayak; Ahn, Sung-Hoon

    2015-01-01

    A new manufacturing method for smart soft composite (SSC) actuators that consists of double casting a SSC actuator to produce an actuator with non-linear shape memory alloy (SMA) wire positioning is proposed. This method is used to manufacture a tube-shaped SSC actuator in which the SMA wires follow the curvature of the tube and is capable of pure-twisting deformations while sustaining a cantilever load. The concept is tested by measuring the maximum twisting angle and a simple control method is proposed to control the twisting angle of the actuator. Then, a soft robotic wrist with a length of 18 cm is built, its load-carrying capability is tested by measuring the cantilever force required for deforming the actuator, and its load-carrying capability during actuation is tested by loading one end with different objects and actuating the actuator. This wrist actuator shows good repeatability, is capable of twisting deformations up to 25° while holding objects weighing 100 g, and can sustain loads above 2 N without undergoing buckling. (paper)

  14. PENGEMBANGAN MODEL PANDUAN PEMBELAJARAN KETERAMPILAN PROSES SAINS BIOLOGI SMA/MA

    Directory of Open Access Journals (Sweden)

    triana asih

    2015-10-01

    Full Text Available Abstract: Science learning in senior high school was designed with the goal of achieving the competencies of graduates that includes aspects of attitudes, skills, and knowledge competency. Skill aspect refers to the Scientific Approach. Skills such as observing the process are observing, trying, processing, serving, and reasoning. All of these skills, leading to the aspects that exist within SPS. Learning needs analysis conducted by researchers at the SMA/ MA class XI IPA that is in the Purbolinggo district of East Lampung SPS shows a lack of provision in the learning process. Supposedly, learning based  on SPS is further enhanced, the researchers created a learning guide model based on SPS. The objectives of the reasearch: 1 produce a learning guide model based on SPS class XI, 2 improve outcomes (process and output (learning cutcomes biology learning class XI. Type of the research is Research and Development (R&D. The research was conducted in SMA N 1 Purbolinggo in class XI Science. Procedures R&D is adapted from Borg and Gall consisting of five steps: 1 literature review and the results of relevant research, 2 Design and carry out preliminary study, 3 the development/conceptualization models, 4 test the model through experimentation, 5 revision of the model. conclusion; 1 learning guide SPS models has been validated by the user and learning experts, instrument validation, model validation, and it is suitable.

  15. PENGARUH SUPERVISI AKADEMIK, KOMPETENSI GURU DAN KEDISIPLINAN TERHADAP KINERJA GURU SMA NEGERI 3 SLAWI KABUPATEN TEGAL

    Directory of Open Access Journals (Sweden)

    Sussono Hadi

    2009-09-01

    Full Text Available This research is aimed at finding out the impact of academic supervision, teacher’s competence, and discipline towards the performance of teachers of SMA Negeri 3 Slawi, Tegal. This research used survey method. The data was collected using questionnaire and observation. There were 52 teachers as respondents. The data analysis used was percentage, multiple linear regression, F test and t test. The finding was : 1 academic supervision, teacher’s competence and discipline of SMA 3 Slawi teachers were very good, 2 academic supervision, teacher’s competence, and discipline together had impact towards teachers’ performance, 3 academic supervision, teacher’s competence, and discipline separately had impact on teachers’ performance, and 4 discipline had the strongest impact towards teachers’ performance. With this result it is suggested that the Diknas (the regential ministry of education intensify the academic supervision, continually developing teacher’s competence, and enforcing discipline on teachers and schools. Key words: academic supervision, competence, discipline, teacher’s performance

  16. A phenomenological SMA model for combined axial–torsional proportional/non-proportional loading conditions

    International Nuclear Information System (INIS)

    Bodaghi, M.; Damanpack, A.R.; Aghdam, M.M.; Shakeri, M.

    2013-01-01

    In this paper, a simple and robust phenomenological model for shape memory alloys (SMAs) is proposed to simulate main features of SMAs under uniaxial as well as biaxial combined axial–torsional proportional/non-proportional loadings. The constitutive model for polycrystalline SMAs is developed within the framework of continuum thermodynamics of irreversible processes. The model nominates the volume fractions of self-accommodated and oriented martensite as scalar internal variables and the preferred direction of oriented martensitic variants as directional internal variable. An algorithm is introduced to develop explicit relationships for the thermo-mechanical behavior of SMAs under uniaxial and biaxial combined axial–torsional proportional/non-proportional loading conditions and also thermal loading. It is shown that the model is able to simulate main aspects of SMAs including self-accommodation, martensitic transformation, orientation and reorientation of martensite, shape memory effect, ferro-elasticity and pseudo-elasticity. A description of the time-discrete counterpart of the proposed SMA model is presented. Experimental results of uniaxial tension and biaxial combined tension–torsion non-proportional tests are simulated and a good qualitative correlation between numerical and experimental responses is achieved. Due to simplicity and accuracy, the model is expected to be used in the future studies dealing with the analysis of SMA devices in which two stress components including one normal and one shear stress are dominant

  17. SMA foil-based elastocaloric cooling: from material behavior to device engineering

    Science.gov (United States)

    Bruederlin, F.; Ossmer, H.; Wendler, F.; Miyazaki, S.; Kohl, M.

    2017-10-01

    The elastocaloric effect associated with the stress-induced first order phase transformation in pseudoelastic shape memory alloy (SMA) films and foils is of special interest for cooling applications on a miniature scale enabling fast heat transfer and high cycling frequencies as well as tunable transformation temperatures. The focus is on TiNi-based materials having the potential to meet the various challenges associated with elastocaloric cooling including large adiabatic temperature change and ultra-low fatigue. The evolution of strain and temperature bands during tensile load cycling is investigated with respect to strain and strain-rate by in situ digital image correlation and infrared thermography with a spatial resolution in the order of 25 µm. Major design issues and challenges in fabrication of SMA film-based elastocaloric cooling devices are discussed including the efficiency of heat transfer as well as force recovery to enhance the coefficient of performance (COP) on the system level. Advanced demonstrators show a temperature span of 13 °C after 30 s, while the COP of the overall device reaches almost 10% of Carnot efficiency.

  18. Biomechanics of smart wings in a bat robot: morphing wings using SMA actuators.

    Science.gov (United States)

    Colorado, J; Barrientos, A; Rossi, C; Bahlman, J W; Breuer, K S

    2012-09-01

    This paper presents the design of a bat-like micro aerial vehicle with actuated morphing wings. NiTi shape memory alloys (SMAs) acting as artificial biceps and triceps muscles are used for mimicking the morphing wing mechanism of the bat flight apparatus. Our objective is twofold. Firstly, we have implemented a control architecture that allows an accurate and fast SMA actuation. This control makes use of the electrical resistance measurements of SMAs to adjust morphing wing motions. Secondly, the feasibility of using SMA actuation technology is evaluated for the application at hand. To this purpose, experiments are conducted to analyze the control performance in terms of nominal and overloaded operation modes of the SMAs. This analysis includes: (i) inertial forces regarding the stretchable wing membrane and aerodynamic loads, and (ii) uncertainties due to impact of airflow conditions over the resistance-motion relationship of SMAs. With the proposed control, morphing actuation speed can be increased up to 2.5 Hz, being sufficient to generate lift forces at a cruising speed of 5 m s(-1).

  19. Design, fabrication, and testing of a SMA hybrid composite jet engine chevron

    Science.gov (United States)

    Turner, Travis L.; Cabell, Randolph H.; Cano, Roberto J.; Fleming, Gary A.

    2006-01-01

    Control of jet noise continues to be an important research topic. Exhaust nozzle chevrons have been shown to reduce jet noise, but parametric effects are not well understood. Additionally, thrust loss due to chevrons at cruise suggests significant benefit from deployable chevrons. The focus of this study is development of an active chevron concept for the primary purpose of parametric studies for jet noise reduction in the laboratory and technology development to leverage for full scale systems. The active chevron concept employed in this work consists of a laminated composite structure with embedded shape memory alloy (SMA) actuators, termed a SMA hybrid composite (SMAHC). The actuators are embedded on one side of the middle surface such that thermal excitation generates a moment and deflects the structure. A brief description of the chevron design is given followed by details of the fabrication approach. Results from bench top tests are presented and correlated with numerical predictions from a model for such structures that was recently implemented in MSC.Nastran and ABAQUS. Excellent performance and agreement with predictions is demonstrated. Results from tests in a representative flow environment are also presented. Excellent performance is again achieved for both open- and closed-loop tests, the latter demonstrating control to a specified immersion into the flow. The actuation authority and immersion performance is shown to be relatively insensitive to nozzle pressure ratio (NPR). Very repeatable immersion control with modest power requirements is demonstrated.

  20. Recent developments on SMA actuators: predicting the actuation fatigue life for variable loading schemes

    Science.gov (United States)

    Wheeler, Robert W.; Lagoudas, Dimitris C.

    2017-04-01

    Shape memory alloys (SMAs), due to their ability to repeatably recover substantial deformations under applied mechanical loading, have the potential to impact the aerospace, automotive, biomedical, and energy industries as weight and volume saving replacements for conventional actuators. While numerous applications of SMA actuators have been flight tested and can be found in industrial applications, these actuators are generally limited to non-critical components, are not widely implemented and frequently one-off designs, and are generally overdesigned due to a lack of understanding of the effect of the loading path on the fatigue life and the lack of an accurate method for predicting actuator lifetimes. In recent years, multiple research efforts have increased our understanding of the actuation fatigue process of SMAs. These advances can be utilized to predict the fatigue lives and failure loads in SMA actuators. Additionally, these prediction methods can be implemented in order to intelligently design actuators in accordance with their fatigue and failure limits. In the following paper, both simple and complex thermomechanical loading paths have been considered. Experimental data was utilized from two material systems: equiatomic Nickel-Titanium and Nickelrich Nickel-Titanium.

  1. FRECUENCIAS NATURALES EN VIGAS ACTIVAMENTE TORSIONADAS USANDO ALAMBRES DE ALEACIÓN CON MEMORIA DE FORMA (SMA | NATURAL FREQUENCIES IN ACTVELY TWISTED BEAMS USING SHAPE MEMORY ALLOY (SMA WIRES

    Directory of Open Access Journals (Sweden)

    Gaetano Starlacci

    2016-08-01

    Full Text Available Changes in the geometry and stiffness of structural members can be obtained using Shape Memory Alloys (SMA wires, previously stretched, and externally attached to the member in a helical pattern. The wire was modeled assuming transformation from a pure martensitic phase to a pure austenitic phase. Natural frequency values before and after the SMA wire activation attached to the beam were calculated using the finite element method and these values were compared with those obtained from a model developed for pre-twisted stress-free cantilever members. The results obtained showed the active torsion influence over the structural element in the values of natural frequencies calculated.

  2. MODEL PERMAINAN AKTIVITAS LUAR KELAS UNTUK MENGEMBANGKAN RANAH KOGNITIF, AFEKTIF, DAN PSIKOMOTORIK SISWA SMA

    Directory of Open Access Journals (Sweden)

    Hendra Setyawan

    2015-10-01

    Full Text Available Penelitian ini bertujuan menghasilkan model-model permainan Aktivitas Luar kelas (ALK yang layak digunakan sebagai materi pembelajaran penjas, serta efektif untuk mengembangkan ranah kognitif, afektif, dan psikomotorik siswa SMA. Penelitian ini dilakukan dengan langkah-langkah sebagai berikut: (1 pengumpulan informasi di lapangan, (2 menganalisis informasi yang telah dikumpulkan, (3 mengembangkan produk awal, (4 validasi ahli dan revisi, (5 uji coba skala kecil dan  revisi, (6 uji coba skala besar dan revisi, dan (7 pembuatan produk final. Uji coba skala kecil dilakukan terhadap siswa kelas X-D dan XI-IPA 4 dari SMA N I Prambanan berjumlah 66 orang. Uji coba skala besar dilakukan terhadap siswa kelas X-G, X-H, XI-IPS 3, dan XI-BHS dari SMA N I Prambanan berjumlah 132 orang. Instrumen pengumpulan data yang digunakan yaitu; (1 pedoman wawancara, (2 skala nilai, (3 pedoman observasi permainan, (4 pedoman observasi keefektifan permainan, (5 pedoman observasi terhadap guru pelaku uji coba, dan (6 rubrik penilaian siswa. Teknik analisis data dengan analisis deskriptif kuantitatif dan kualitatif. Hasil penelitian berupa tujuh model permainan yang layak dan efektif digunakan dalam pembelajaran penjas, hal ini dibuktikan dengan perolehan persentase sebesar 100% dari data hasil kuesioner skala nilai, observasi model permainan, observasi keefektifan permainan, dan observasi guru pelaku uji coba. Model permainan juga efektif untuk mengembangkan ranah kognitif, afektif, dan psikomotorik, yang dibuktikan dengan terjadinya peningkatan persentase nilai rata-rata siswa sebesar 21%. Kata kunci: model, permainan, aktivitas luar kelas, kognitif, afektif, psikomotorik THE OUTDOOR ACTIVITY GAME MODEL TO DEVELOP THE ASPECT OF COGNITIVE, AFFECTIVE, AND PSYCHOMOTOR OF THE SENIOR HIGH SCHOOL STUDENTS Abstract This study aims at producing outdoor activity game models which are proper to be used for physicall education learning and developing cognitive, affective, and

  3. Pengembangan Instrumen Ranah Kognitif pada Pokok Bahasan Fluida Statis SMA/MA

    Directory of Open Access Journals (Sweden)

    Mukarramah Mustari

    2016-04-01

    Full Text Available This study aims to: 1 Develop Instrument Domains Cognitive at Static Fluid material in SMA / MA, 2 determine the validity of the instrument of cognitive tests on the static fluid material, 3 determine the reliability of cognitive principal static fluid discussion, 4 determine the level of difficulty of the cognitive tests on the static fluid material, 5 determine distinguishing cognitive test on static fluid material. The result products include cognitive aspects such instruments multiple choice tests and essay tests. Instrument developed on cognitive aspects in the form of multiple choice tests and a description to the extent of competence Bloom C1 to C6 on the material of Static Fluid. The Design of this study is used the development procedure Reasearch and Depelopment (R & D from Borg and Gall adopted by Sugiono ie; up to the stage seven form consisting of: the potential and problems, data collection, product design, design validation, design revisions, product trials, product revision. The data collecting is obtained from the results of expert validation instrument, the response of teachers, and product trials, and then analyzed by quantitative descriptive. The results of the analysis of the development of the instrument can be concluded that the cognitive instruments on the material of static fluid SMA / MA is excellent to be used by teachers in the assessment of competence of learners. Penelitian Pengembangan Instrumen Ranah Kognitif pada Pokok Bahasan Fluida Statis SMA/MA Ini dilakukan bertujuan;1 mengembangkan Instrumen Ranah Kognitif pada Pokok Bahasan Fluida Statis SMA/MA, 2 mengetahui validitas instrumen tes kognitif pokok bahasan fluida statis, 3 mengetahui reliabilitas kognitif pokok bahasan fluida statis, 4 mengetahui tingkat kesukaran tes kognitif pokok bahasan fluida statis, 5 mengetahui daya pembeda tes kognitif pada pokok bahasan fluida statis. Produk yang dihasilkan meliputi instrumen aspek kognitif berupa

  4. Simulação de bloqueios periféricos guiados por ultra-som: curva de aprendizado dos residentes de anestesiologia do CET-SMA/HSL Simulacro de bloqueos periféricos guiados por ultrasonido: curva de aprendizaje de los residentes de anestesiología del CET-SMA/HSL Simulation of ultrasound-guided peripheral nerve block: learning curve of CET-SMA/HSL anesthesiology residents

    Directory of Open Access Journals (Sweden)

    Marilia Bonifácio Baranauskas

    2008-04-01

    por ultrasonido a través de modelo experimental de gelatina. MÉTODO: Fue desarrollado un modelo experimental con un recipiente lleno de gelatina y aceituna sumergida. Nueve residentes se distribuyeron aleatoriamente en tres grupos (G1, G2, G3 compuestos cada uno, por un R1, un R2 y un R3. Los tres grupos recibieron una explicación teórica. El G1 recibió dos horas de entrenamiento práctico, el G2 una hora y el G3 no fue entrenado. Acto seguido, se les solicitó a los participantes que pusiesen la aguja en el punto medio de la pared de la aceituna, cerca del transductor y reposicionar la aguja entre la aceituna y el fondo del recipiente, simulando la inyección perineural del anestésico. Se evaluaron la velocidad y la eficacia de las tareas, además de las fallas técnicas. RESULTADOS: El G1 presentó un promedio de tiempo para la realización de las tareas de 37,63 segundos, sin fallas técnicas; en el G2 se observó un promedio de 64,40 segundos, ocurriendo dos fallas técnicas y el G3 presentó un promedio de 93,83 segundos, con doce fallas técnicas. CONCLUSIONES: El estudio permite concluir que el mayor tiempo de entrenamiento en un modelo experimental de bloqueos periféricos guiados por ultrasonido mejoró la curva de aprendizaje en el simulacro de la técnica.BACKGROUND AND OBJECTIVES: The use of ultrasound imaging in peripheral nerve block has been increasing. However, there are few reports in the literature on the learning curve of the ultrasound technique. The objective of this report was to evaluate the learning curve of CET-SMA/HSL Anesthesiology residents of ultrasound-guided peripheral block using an experimental agar model. METHODS: An experimental model was developed by filling a bowl with agar and olives. Nine residents were randomly divided in three groups (G1, G2, and G3, each one with a R1, a R2, and a R3. All three groups received theoretical explanation. G1 also had two hours of practical training, G2 had one hour, and G3 had no training

  5. Pengembangan Modul Fisika Pokok Bahasan Hukum Newton bagi Anak Berkebutuhan Khusus (Tunanetra Di Kelas Inklusi SMA/MA Kelas X

    Directory of Open Access Journals (Sweden)

    Fitriany Yudistia R

    2014-04-01

    Full Text Available Siswa tunanetra SMA Muhammadiyah 4 Yogyakarta, MAN Maguwoharjo dan SMAN 1 Sewon belum memiliki sumber belajar mandiri berupa modul Braille khususnya pada materi Hukum Newton. Berdasarkan kenyataan ini maka dibutuhkan sebuah sumber belajar yang didesain khusus bagi siswa tunanetra di kelas Inklusi yakni modul Braille pada pokok bahasan Hukum Newton.Telah dilakukan penelitian yang bertujuan untuk: (1 mengembangkan modul fisika pokok bahasan Hukum Newton untuk siswa tunanetra SMA/MA kelas X sebagai sumber belajar mandiri, (2 mengetahui kualitas modul fisika Braille materi Hukum Newton untuk siswa tunanetra SMA/MA kelas X, (3 mengetahui respon siswa terhadap modul fisika Braille yang telah dikembangkan.Penelitian ini merupakan penelitian R & D dengan model prosedural yang mengadaptasi dari pengembangan perangkat model 4-D, yakni Define, Design, Develop, and Disseminate. Instrumen penelitian berupa angket kualitas modul yaitu menggunakan skala Likert yang dibuat dalam bentuk checklist. Instrumen untuk siswa berupa angket respon siswa yaitu menggunakan skala Guttman yang dibuat dalam bentuk checklist. Modul dinilai kualitasnya oleh 3 ahli materi, 1 ahli media, dan 2 guru fisika SMA/MA. Kelayakan modul berdasarkan respon siswa pada uji coba terbatas sebanyak 2 siswa dan uji coba luas sebanyak 8 siswa.Hasil penelitian berdasarkan penilaian dari ahli materi, ahli media dan guru fisika SMA/MA modul memiliki kategori sangat baik (SB. Persentase keidealan menurut ahli materi adalah 87,88%; persentase keidealan menurut ahli media adalah 90,00% dan persentase keidealan menurut guru Fisika SMA/MA adalah 75,00%. Respon siswa terhadap modul fisika Braille pada uji coba terbatas diperoleh persentase 97,22%; sedangkan pada uji coba luas diperoleh persentase 89,58%. Hasil penelitian ini menunjukkan bahwa modul layak dijadikan sebagai salah satu sumber belajar mandiri bagi siswa tunanetra.

  6. PKCδ as a regulator for TGFβ1-induced α-SMA production in a murine nonalcoholic steatohepatitis model.

    Directory of Open Access Journals (Sweden)

    Su Jin Lee

    Full Text Available The precise mechanism of TGFβ1 signaling in the progression of non-alcoholic steatohepatitis (NASH has remained unclear. In particular, a potential regulatory mechanism by which PKCδ affects profibrogenic gene expression had never been explored. In this study, therefore, the role of PKCδ in TGFβ1 mediated α-SMA expression was investigated using NASH model mice. In preparation of the NASH model, male C57BL6/J mice were fed a methionine-choline-deficient (MCD diet for 3 weeks, after which time they were intraperitoneally injected with lipopolysaccharide (LPS. In addition, Tlr4(Lps-d (CH3/HeJ mice were used to demonstrate the TGFβ1 signaling's dependency on TLR4 induction. Liver histology and hepatic hepatitis markers were investigated, and hepatic gene expression levels were determined by real-time PCR. Acute liver injury by LPS injection specifically elevated not only α-SMA expression but also phospho-PKCδ in this model. In contrast, Tlr4(Lps-d (CH3/HeJ and blockade of TGFβ1 receptor by SB431542 resulted in a significant reduction of PKCδ activation and α-SMA expression. Moreover, the TGFβ1-induced α-SMA production was significantly reduced by a specific PKCδ inhibitor. These findings suggested that PKCδ plays a critical role in TGFβ1-induced α-SMA production in a NASH model. Thus, this was the first demonstration of the involvement of PKCδ in the regulation of α-SMA expression in NASH liver tissues, and the impaired induction of PKCδ phosphorylation by LPS in a steatohepatitis condition. Interestingly, treatment by PKCδ inhibitor caused dramatic reduction of myofibroblast activation, indicating that PKCδ represents a promising target for treating NASH.

  7. Embedded SMA wire actuated biomimetic fin: a module for biomimetic underwater propulsion

    International Nuclear Information System (INIS)

    Wang Zhenlong; Hang Guanrong; Wang Yangwei; Li Jian; Du Wei

    2008-01-01

    An embedded shape memory alloy (SMA) wire actuated biomimetic fin is presented, and based on this module for biomimetic underwater propulsion, a micro robot fish (146 mm in length, 30 g in weight) and a robot squid (242 mm in length, 360 g in weight) were developed. Fish swim by undulating their body and/or fins. Squid and cuttlefish can also swim by undulating their fins. To simplify engineering modeling, the undulating swimming movement is assumed to be the integration of the movements of many flexible bending segments connected in parallel or in series. According to this idea, a biomimetic fin which can bend flexibly was developed. The musculature of a cuttlefish fin was investigated to aid the design of the biomimetic fin. SMA wires act as 'muscle fibers' to drive the biomimetic fin just like the transverse muscles of the cuttlefish fin. During the bending phase, elastic energy is stored in the elastic substrate and skin, and during the return phase, elastic energy is released to power the return movement. Theorem analysis of the bending angle was performed to estimate the bending performance of the biomimetic fin. Experiments were carried out on single-face fins with latex rubber skin and silicone skin (SF-L and SF-S) to compare the bending angle, return time, elastic energy storage and reliability. Silicone was found to be the better skin. A dual-face fin with silicone skin (DF-S) was tested in water to evaluate the actuating performance and to validate the reliability. Thermal analysis of the SMA temperature was performed to aid the control strategy. The micro robot fish and robot squid employ one and ten DF-S, respectively. Swimming experiments with different actuation frequencies were carried out. The speed and steering radius of the micro robot fish reached 112 mm s −1 and 136 mm, respectively, and the speed and rotary speed of the robot squid reached 40 mm s −1 and 22° s −1 , respectively

  8. RELEVANSI KURIKULUM PRODI PENDIDIKAN SOSIOLOGI ANTROPOLOGI DENGAN KEBUTUHAN MENGAJAR GURU SMA

    Directory of Open Access Journals (Sweden)

    Totok Rochana

    2013-04-01

    Full Text Available Materi pembelajaran  Sosiologi dan Antropologi yang diajarkan di SMA senantiasa mengalami perubahan. Sementara  kurikulum Program Studi Pendidikan Sosiologi dan Antropologi FIS UNNES tidak banyak mengalami perubahan. Dalam penelitian ini, penulis membahas bagaimana relevansi antara Kurikulum Prodi Pendidikan Sosiologi dan Antropologi FIS UNNES dengan kebutuhan mengajar bagi guru Sosiologi dan Antropologi SMA Negeri di Jawa Tengah. Penelitian ini menggunakan pendekatan kualitatif dan  bersifat kasus, pengumpulan data menggunakan metode wawancara tertutup dan terbuka, dan analisis data  menggunakan metode deskriptif kualitatif. Berdasarkan hasil penelitian  disimpulkan bahwa kurikulum  Program Studi Pendidikan Sosiologi dan Antropologi FIS UNNES, masih relevan dengan materi pembelajaran Sosiologi dan Antropologi yang diajarakan di SMA. Saran yang diajukan adalah: perlu diselenggarakan penataran-penataran/diklat-diklat peningkatan penguasaan materi pembelajaran Sosiologi dan Antropologi bagi guru-guru Sosiologi dan Antropologi yang bukan berlatar belakang Pendidikan Sosiologi dan Antropologi. Pengangkatan CPNS Guru Sosiologi dan Antropologi perlu diprioritaskan dari lulusan Prodi Pendidikan Sosiologi dan Antropologi. Pengembangan kurikulum Program Studi Pendidikan Sosiologi dan Antropologi tetap mengacu pada relevansinya dengan kebutuhan di lapangan.Sociology and Anthropology instructional materials taught in high school are constantly changing, though the curriculum of Sociology and Anthropology FIS Unnes does not change much. In this study, the author discusses the relevance of the curriculum of Sociology and Anthropology of Education Unnes FIS to the needs of teaching for teachers of Sociology and Anthropology Senior high school in Central Java. The method used in this study is a qualitative approach using descriptive methods. Based on the results of the study it is concluded that the curriculum of Sociology and Anthropology

  9. High-resolution SMA imaging of bright submillimetre sources from the SCUBA-2 Cosmology Legacy Survey

    Science.gov (United States)

    Hill, Ryley; Chapman, Scott C.; Scott, Douglas; Petitpas, Glen; Smail, Ian; Chapin, Edward L.; Gurwell, Mark A.; Perry, Ryan; Blain, Andrew W.; Bremer, Malcolm N.; Chen, Chian-Chou; Dunlop, James S.; Farrah, Duncan; Fazio, Giovanni G.; Geach, James E.; Howson, Paul; Ivison, R. J.; Lacaille, Kevin; Michałowski, Michał J.; Simpson, James M.; Swinbank, A. M.; van der Werf, Paul P.; Wilner, David J.

    2018-06-01

    We have used the Submillimeter Array (SMA) at 860 μm to observe the brightest sources in the Submillimeter Common User Bolometer Array-2 (SCUBA-2) Cosmology Legacy Survey (S2CLS). The goal of this survey is to exploit the large field of the S2CLS along with the resolution and sensitivity of the SMA to construct a large sample of these rare sources and to study their statistical properties. We have targeted 70 of the brightest single-dish SCUBA-2 850 μm sources down to S850 ≈ 8 mJy, achieving an average synthesized beam of 2.4 arcsec and an average rms of σ860 = 1.5 mJy beam-1 in our primary beam-corrected maps. We searched our SMA maps for 4σ peaks, corresponding to S860 ≳ 6 mJy sources, and detected 62, galaxies, including three pairs. We include in our study 35 archival observations, bringing our sample size to 105 bright single-dish submillimetre sources with interferometric follow-up. We compute the cumulative and differential number counts, finding them to overlap with previous single-dish survey number counts within the uncertainties, although our cumulative number count is systematically lower than the parent S2CLS cumulative number count by 14 ± 6 per cent between 11 and 15 mJy. We estimate the probability that a ≳10 mJy single-dish submillimetre source resolves into two or more galaxies with similar flux densities to be less than 15 per cent. Assuming the remaining 85 per cent of the targets are ultraluminous starburst galaxies between z = 2 and 3, we find a likely volume density of ≳400 M⊙ yr-1 sources to be {˜ } 3^{+0.7}_{-0.6} {× } 10^{-7} Mpc-3. We show that the descendants of these galaxies could be ≳4 × 1011 M⊙ local quiescent galaxies, and that about 10 per cent of their total stellar mass would have formed during these short bursts of star formation.

  10. PENGEMBANGAN BUDAYA SEKOLAH BERPRESTASI: STUDI TENTANG PENANAMAN NILAI DAN ETOS BERPRESTASI DI SMA KARANGTURI

    Directory of Open Access Journals (Sweden)

    Agus Yuliono

    2013-04-01

    Full Text Available Tujuan penelitian ini adalah untuk mendeskripsikan bentuk budaya sekolah berprestasi, proses penanaman nilai dan etos berprestasi kepada peserta didik dan mengetahui implikasi dari pengembangan budaya sekolah berprestasi di SMA Karangturi. Penelitian ini menggunakan pendekatan deskriptif kualitatif. Pengumpulan data menggunakan teknik observasi, wawancara dan dokumentasi. Hasil penelitian menunjukkan bahwa bentuk budaya sekolah berprestasi di SMA Karangturi mencakup empat poin yaitu: keseimbangan antara pembinaan akademik dan nonakademik, penanaman karakter melalui pelajaran, budaya mencintai almamater dan pentingnya nilai kerokhanian. Penanaman nilai dan etos berprestasi pada peserta didik dilakukan melalui kegiatan orientasi sekolah, proses pembelajaran, evaluasi belajar, ekstrakurikuler, penghargaan prestasi, kecintaan terhadap almamater, keteladanan guru, kerjasama dengan orangtua peserta didik dan seragam patriot sebagai media penanaman budaya berprestasi. Implikasi penanaman pengembangan budaya sekolah berprestasi di SMA Karangturi terdapat dalam input (penerimaan siswa baru dan pencarian siswa berpotensi, proses (pengembangan program sekolah serta pengembangan kerjasama dan output (prestasi akademik dan nonakademik serta jumlah alumni yang melanjutkan ke perguruan tinggi. The objective of this study is to describe a model of school achievement culture, the cultivation of values ​​and ethos of achievement to students and know the implications of the development of school culture on students’ achievement in Karangturi high school. This study used a qualitative descriptive approach. Techniques of collecting data were observation, interviews and documentation. This study uses sources and methods triangulation for data validation. The results show that the  school achievement culture in Karangturi high school contains four pillars, namely: a balance between academic and non-academic achievement, building character

  11. Multifractional microablative laser combined with spacially modulated ablative (SMA) technology for facial skin rejuvenation.

    Science.gov (United States)

    Hersant, Barbara; SidAhmed-Mezi, Mounia; Chossat, Adrien; Meningaud, Jean Paul

    2017-01-01

    Due to the increasing demand for aesthetic procedures, especially facial aesthetic surgery, a new laser technology has been developed for facial skin rejuvenation and wrinkle treatment. The aim of this study was to objectively and subjectively assess the clinical efficacy and safety of Erbium:YAG laser combined with Spatially Modulated Ablation (Er:YAG + SMA) on facial skin rejuvenation. Patients with Fitzpatrick skin type's I-IV were prospectively included. Inclusion criteria consisted of having wrinkles and irregular skin texture. All patients underwent two Er:YAG + SMA sessions (1 month apart) to stimulate tissue regeneration. Er:YAG laser emits wavelength at 2,940 nm and when combined with SMA, a resonance effect is produced in the dermis to promote tissue regeneration. Facial skin elasticity and firmness were objectively assessed by Cutometer at baseline and month 6 (M6). Aesthetic improvement was qualitatively assessed using digital photographs. Patient satisfaction with regard to their facial appearance was self-assessed using the validated FACE-Q scale and the patient-perceived age VAS scale at baseline, M1, and M6. Side effects were investigated after each session. Thirty-four patients were included, 50% (18 patients) had Fitzpatrick skin type III and 41% (14 patients) were smokers. Skin elasticity indices were significantly improved: from 0.335 ± 0.015 at baseline to 0.387 ± 0.021 at M6 (P = 0.05*) for R5 (net elasticity). Skin firmness was assessed through R7 (biological elasticity) and R6 (viscoelastic ratio) at baseline and M6: a significant increase from 0.235 ± 0.01 to 0.2709 ± 0.009 (P technology offers an effective and safe treatment alternative for facial skin rejuvenation. It reduces the recovery time compared to conventional lasers such as carbon dioxide laser. Lasers Surg. Med. 49:78-83, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. EVALUASI KINERJA GURU FISIKA, BIOLOGI DAN KIMIA SMA YANG SUDAH LULUS SERTIFIKASI

    Directory of Open Access Journals (Sweden)

    Yusrizal Yusrizal

    2013-01-01

    Full Text Available Penelitian ini bertujuan (1 mengembangkan instrumen evaluasi kinerja guru yang valid dan reliabel, (2 mengevaluasi kinerja guru Fisika, Biologi, dan Kimia SMA yang sudah terser-tifikasi/menerima tunjangan profesi. Populasi penelitian yaitu seluruh guru Fisika, Biologi dan Kimia SMA tersertifikasi/pene-rima tunjangan profesi yang berada di Kota Banda Aceh, Kabupaten Aceh Besar dan Kabupaten Pidie. Validitas konstruk instrumen yang dikembangkan dibuktikan melalui analisis fak-tor, dan reliabilitasnya diestimasi dengan rumus alpha Cron-bach. Analisis tingkat kinerja ditentukan dengan persentase. Hasil penelitian menunjukkan: (1 instrumen yang dikembang-kan terdiri atas 33 butir pernyataan, dan memiliki koefisien reliabilitas konsistensi internal sebesar 0,953; (2 kinerja guru Fisika, Biologi, dan Kimia SMA yang sudah lulus sertifikasi dan sudah menerima tunjangan belum seluruhnya berkinerja tinggi; (3 kinerja guru Kimia relatif lebih baik dari pada kinerja guru Biologi dan guru Fisika. Kata kunci: evaluasi, kinerja guru, validitas, reliabilitas ______________________________________________________________ AN EVALUATION OF THE PERFORMANCE OF CERTIFIED SCIENCE TEACHERS (PHYSICS, CHEMISTRY AND BIOLOGY OF SENIOR HIGH SCHOOLS Abstract This study was aimed at (1 developing a valid and reliable performance evaluation instruments for teachers, and (2 evaluating the level of Physics, Biology and Chemistry teachers of senior high schools who have been certified and received theprofession allowance. The population of this study included all certified Physics, Biology and Chemistry teachers of senior high schools who have received profession allowance in Banda Aceh, Aceh Besar, and Pidie. The construct validity of the instrument developed was assessed through factor analysis, and the reliability was estimated by using Cronbach’s Alpha formula. The level of teachers’performance was analyzed by the percentage. The result of the research shows that (1 the

  13. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  14. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  15. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  16. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  17. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  18. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  19. Achieving dynamic switchable filter based on a transmutable metasurface using SMA

    Directory of Open Access Journals (Sweden)

    Xin Chen

    2017-09-01

    Full Text Available We propose a switchable filter composed of transmutable array using shape memory alloys (SMA. It could exhibit a temperature induced morphology change spontaneously like the biological excitability, acting as a shutter that allows the incident energy to be selectively transmitted or reflected with in excess of 12dB isolation at the certain frequencies for both polarizations. Equivalent circuit models describe the operational principle qualitatively and the switching effect is underpinned by the full-wave analysis. A further physical mechanism is shown by contrasting the distributions of electric field and surface current on the surface at the same frequency for the two working modes. The experimental results consist with the theoretical simulations, indicating that the metasurface could serve as one innovative solution for manipulating the electromagnetic waves and enlighten the next generation of advanced electromagnetic materials with more freedom in the processes of design and manufacturing.

  20. Achieving dynamic switchable filter based on a transmutable metasurface using SMA

    Science.gov (United States)

    Chen, Xin; Gao, Jinsong; Kang, Bonan

    2017-09-01

    We propose a switchable filter composed of transmutable array using shape memory alloys (SMA). It could exhibit a temperature induced morphology change spontaneously like the biological excitability, acting as a shutter that allows the incident energy to be selectively transmitted or reflected with in excess of 12dB isolation at the certain frequencies for both polarizations. Equivalent circuit models describe the operational principle qualitatively and the switching effect is underpinned by the full-wave analysis. A further physical mechanism is shown by contrasting the distributions of electric field and surface current on the surface at the same frequency for the two working modes. The experimental results consist with the theoretical simulations, indicating that the metasurface could serve as one innovative solution for manipulating the electromagnetic waves and enlighten the next generation of advanced electromagnetic materials with more freedom in the processes of design and manufacturing.

  1. Pendekatan Pengajaran Reciprocal Teaching Berpotensi Meningkatkan Ketuntasan Hasil Belajar Biologi Siswa SMA

    Directory of Open Access Journals (Sweden)

    Nur Efendi

    2013-02-01

    Full Text Available Mutu pembelajaran Biologi masih rendah. Rendahnya mutu pembelajaran ini disebabkan oleh faktor pembelajaran yang masih berpusat pada guru (teacher centered tanpa melibatkan siswa untuk berpatisipasi pada proses untuk mendapatkan informasi dari kegiatan pembelajaran tersebut. Pengajaran Resiprok (Reciprocal Teaching merupakan salah satu strategi pendekatan pembelajaran yang dapat diterapkan untuk meningkatkan ketuntasan belajar siswa pada mata pelajaran biologi SMA, sehingga mutu pembelajaran mengalami ketercapaian ketuntasan hasil belajar yang ditetapkan. Tahapan Pengajajaran Resiprok adalah: (1 membaca  dan mencari ide pokok bacaan berdasarkan teks bacaan yang disediakan, (2 membuat pertanyaan, (3 menjawab pertanyaan, (4 merangkum informasi yang penting, (5 memprediksi, (6 mengidentifikasi hal-hal yang tidak jelas dari teks bacaan, (7 mengklarifikasi hal-hal yang tidak jelas tersebut.

  2. KEADILAN ORGANISASIONAL DAN KONSEKUENSINYA TERHADAP ORGANIZATIONAL CITIZENSHIP BEHAVIOR GURU SMA DAN SMK KOTA MADIUN*

    Directory of Open Access Journals (Sweden)

    Veronika Agustini Srimulyani

    2017-11-01

    Full Text Available Keadilan organisasional memiliki potensi untuk menciptakan manfaat besar bagi organisasi dan karyawan, dan salah satu manfaatnya adalah menumbuhkan extra-role behavior (ERB atau organizational citizenship behavior (OCB. Tujuan dari penelitian ini untuk menganalisis konsekuensi keadilan organisasional (keadilan distributif, keadilan prosedural, dan keadilan interaksional pada organizational citizenship behavior guru SMA dan guru SMK di Kota Madiun. OCB dibagi menjadi dua jenis yaitu citizenship behaviors directed toward individuals (OCB-I dan citizenship behaviors directed towards the organisation (OCB-O. Penelitian ini menggunakan pendekatan kuantitatif dengan metode survei. Sampel penelitian ini adalah 409 guru, yang dipilih secara non-acak. Data diperoleh dengan menyebarkan kuesioner. Analisis data menggunakan analisis regresi. Hasil penelitian disimpulkan: keadilan distributif dan keadilan interaksional berpengaruh positif signifikan terhadap OCB-I dan OCB-O; keadilan prosedural tidak berpengaruh signifikan terhadap OCB-I tetapi keadilan prosedural berpengaruh positif signifikan terhadap OCB-O.

  3. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  4. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  5. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  6. PEMBELAJARAN MENULIS TEKS PIDATO DAN BERPIDATO KELAS X DI SMA NEGERI 3 SUKOHARJO

    Directory of Open Access Journals (Sweden)

    Jaka Santosa

    2016-02-01

    Full Text Available This study has four aims, (1 the procedure of learning to write text to speech and speech in the classroom, (2 learning strategies and what the media writes text to speech and speech in the classroom, (3 student activity in learning to write text to speech and speech in the classroom, and (4 learning outcomes writing text to speech and speech. This includes descriptive qualitative research which took place in SMA Negeri 3 Sukoharjo. Data in the form of words and actions. Sources of data obtained from sources, events, and documents. Informant is Indonesian teachers and students. Events are learning activities Indonesian X1 class 2nd semester of academic year 2012/2013. The document in question is a document relating to the teaching of writing. Data collection techniques were interviews, observation, and documentary. Research findings in the field, among others, (1 the learning procedure by submitting a text to speech material on speech. Then compose the theme is developed into a framework and final drafting speeches, (2 application of learning strategies to write text to speech and speech with the approach that has been programmed patterns , the approach of process skills and communicative approach, (3 students activate in learning writing text to speech and speech have been carried out by providing learning facilities and trust management using effective learning infrastructure, (4 learning to write text to speech and speech by using the approach of process skills and communicative approaches undertaken by teachers Indonesian subjects in SMA Negeri 3 Sukoharjo obtain following result, students who earn good grades for writing text to speech 80 % and 88 % speech practice, then students who received grades enough to write the speech 20 % and 3 % speech practice, and students who obtain less value to the writing of the speech is not there, to practice speech while there were 9 % .

  7. PENGGUNAAN BAHAN AJAR DENGAN PENDEKATAN ANDRAGOGI SEBAGAI UPAYA MENINGKATKAN KREATIVITAS DAN HASIL BELAJAR SISWA SMA RSBI

    Directory of Open Access Journals (Sweden)

    M. Umriyah

    2012-01-01

    Full Text Available Andragogi merupakan teori pembelajaran orang dewasa. Konsep pembelajaran orang dewasa merupakan pembelajaran yang berpola non otoriter. Berdasarkan ciri-ciri biologis maupun psikologis sebagian besar siswa SMA telah memasuki usia dewasa, sehingga pendekatan andragogi agaknya lebih sesuai. Penelitian ini merupakan penelitian pengembangan yaitu mengembangkan bahan ajar dengan pendekatan andragogi, bertujuan untuk memperoleh bahan ajar yang dapat meningkatkan kreativitas dan hasil belajar siswa. Subyek penelitian adalah siswa  kelas X-2 SMA Islam Sudirman Ambarawa tahun pelajaran 2010/2011. Pengambilan data dilakukan dengan metode dokumentasi, observasi dan  test hasil belajar.  Hasil penelitian menunjukkan bahwa dengan digunakannya bahan ajar dengan pendekatan andragogi, skor kreativitas  dan hasil test kognitif siswa rata-rata meningkat.Andragogy is adult learning theory. Adult learning concept is learning activity that gets to pattern non authoritarian. Based on biological characteristics and also psychological a large part Senior High School students  have entered adult age, so pedagogy approach (education for children was not suitable anymore for them, it seems that andragogy (education for adult is more suitable. This research is development research which develop learning material in andragogy approach, has an aim to get a learning material that can develop creativity and studying result. The research is executed in X2 class at Sudirman Islamic Senior High School of Ambarawa, academic year 2010 / 2011 which is chosen bases random sampling. Data taking is done by documentation method, observation and learning result test.  Data analysis  indicate   an  improving  of average  value  in creativity and learning result.

  8. HUBUNGAN KETERPAPARAN MEDIA MASSA, PERAN TEMAN SEBAYA TERHADAP TINDAKAN SEKSUAL DI SMA AN-NAAS

    Directory of Open Access Journals (Sweden)

    rika istawati

    2017-06-01

    Full Text Available Masa remaja merupakan masa peralihan antara tahap anak dan dewasa dimana pada masa ini mereka sangat rentan terpapar informasi dari media massa dan teman sebaya terutama seks bebas. Data SKRRI mempunyai teman yang pernah berhubungan seksual pada usia 14-19 tahun dengan persentasi perempuan 37,7% dan laki-laki 30,9% dan Kementerian Komunikasi dan Informasi menyebut 62,1% siswa mengaku penah melakukan hubungan seks. Observasi yang di lakukan oleh peneliti di SMA AN-NAAS Pekanbaru diketahui adanya 2 siswa  yang tertangkap menyimpan dan menonton video porno di handphone dan melalui wawancara peneliti dengan 8 siswi mereka mengatakan adanya 1 siswi yang hamil diluar nikah dan 2 siswi diantaranya mengaku sering datang ketempat yang berisiko terhadap tindakan seksual. Tujuan Penelitian ini untuk mengetahui hubungan keterpaparan media massa dan peran teman sebaya terhadap tindakan seksual. Desain penelitian yang digunakan adalah cross sectional, populasi penelitian adalah seluruh siswa kelas SMA AN-NAAS Pekanbaru yaitu 123 responden. Sampel penelitian 94 orang dengan teknik stratified random sampling. Alat ukur yang digunakan adalah angket, data diolah menggunakan komputer. Analisa data secara univariat dan bivariat dengan uji chi square dengan ketentuan α (0,5. Hasil penelitian didapatkan uji statistik menunjukkan adanya hubungan keterpaparan media massa dengan tindakan seksual dimana nilai p value 0,000 < 0,05, terdapat hubungan yang bermakna antara peran teman sebaya dengan tindakan seksual, dimana p value  0,001 < 0,05. Bagi pihak sekolah diharapkan untuk meningkatkan kegiatan di sekolah seperti ekstrakurikuler dan guru membimbing serta memberi pengawasan yang ketat terhadap siswanya.   

  9. Transcranial direct current stimulation (tDCS) to the supplementary motor area (SMA) influences performance on motor tasks.

    Science.gov (United States)

    Hupfeld, K E; Ketcham, C J; Schneider, H D

    2017-03-01

    The supplementary motor area (SMA) is believed to be highly involved in the planning and execution of both simple and complex motor tasks. This study aimed to examine the role of the SMA in planning the movements required to complete reaction time, balance, and pegboard tasks using anodal transcranial direct current stimulation (tDCS), which passes a weak electrical current between two electrodes, in order to modulate neuronal activity. Twenty healthy adults were counterbalanced to receive either tDCS (experimental condition) or no tDCS (control condition) for 3 days. During administration of tDCS, participants performed a balance task significantly faster than controls. After tDCS, subjects significantly improved their simple and choice reaction time. These results demonstrate that the SMA is highly involved in planning and executing fine and gross motor skill tasks and that tDCS is an effective modality for increasing SMA-related performance on these tasks. The findings may be generalizable and therefore indicate implications for future interventions using tDCS as a therapeutic tool.

  10. Sense of agency is related to gamma band coupling in an inferior parietal-preSMA circuitry

    DEFF Research Database (Denmark)

    Ritterband-Rosenbaum, Anina; Nielsen, Jens Bo; Christensen, Mark Schram

    2014-01-01

    with no SoA in the late task phase, but the test of the early task phase did not reveal any differences between presence and absence of SoA. We show that SoA is associated with a directionally specific between frequencies coupling from IPC to preSMA in the higher gamma (ɣ) band in the late task phase...

  11. Isolation and molecular identification of a Serratia strain from ...

    African Journals Online (AJOL)

    ONOS

    2010-04-05

    Apr 5, 2010 ... family Tupaiidae, mainly found in Southern China, India and Southeast Asia. The 17 known species of tree shrews ... for pathogenic coccus cultivation and nutrient agar culture dish and. MacConkey agar for pathogenic rod ...

  12. Representasi Matematis Siswa SMA dalam Memecahkan Masalah Persamaan Kuadrat Ditinjau dari Perbedaan Gender

    Directory of Open Access Journals (Sweden)

    Moh. Nasrul Fuad

    2016-12-01

    Full Text Available Penelitian ini merupakan penelitian deskriptif kualitatif yang bertujuan untuk mendeskripsikan secara lengkap representasi matematis siswa SMA dalam memecahkan masalah persamaan kuadrat ditinjau dari perbedaan gender. Subjek penelitian terdiri dari dua siswa SMA Negeri 3 Kediri kelas 10 pada tahun pelajaran 2015/2016, yaitu satu siswa laki-laki dan satu siswa perempuan. Tahap penelitian dimulai dengan pemilihan subjek penelitian yang ditentukan berdasarkan gender dan hasil tes kemampuan matematika yang setara. Setelah terpilih subjek kemudian dilanjutkan dengan pemberian tugas pemecahan masalah persamaan kuadrat dan wawancara. Keabsahan data dilakukan dengan menggunakan triangulasi waktu yaitu pemberian tugas pemecahan masalah persamaan kuadrat yang setara pada waktu yang berbeda. Hasil penelitian ini berupa deskripsi matematis dari siswa SMA laki-laki dan perempuan dalam memecahkan masalah persamaan kuadrat untuk setiap tahap pemecahan masalah menurut tahapan Polya. Representasi matematis dari siswa SMA laki-laki yaitu : Pada tahap memahami masalah, dari apa yang diketahui representasi matematis yang dihasilkan siswa berupa kombinasi antara teks tertulis dan simbol. Sedangkan dari apa yang ditanyakan, representasi matematis yang dihasilkan siswa yaitu berupa simbol dan juga teks tertulis. Pada tahap menyusun rencana pemecahan masalah, representasi matematis yang dihasilkan siswa berupa persamaan matematik dan juga kata-kata secara lisan. Pada tahap melaksanakan rencana pemecahan masalah, langkah – langkah pemecahan masalah direpresentasikan oleh siswa kedalam bentuk persamaan matematik dan simbol aljabar. Siswa menginterpretasi hasil penyelesaian masalah dengan menggunakan representasi berupa teks tertulis. Pada tahap memeriksa kembali penyelesaian masalah siswa tidak memiliki representasi.  Sedangkan representasi matematis dari siswa SMA perempuan yaitu : Pada tahap memahami masalah dari apa yang diketahui representasi matematis yang

  13. Sense of agency is related to gamma band coupling in an inferior parietal-preSMA circuitry

    Directory of Open Access Journals (Sweden)

    Anina eRitterband-Rosenbaum

    2014-07-01

    Full Text Available In the present study we tested whether sense of agency (SoA is reflected by changes in coupling between right medio-frontal/supplementary motor area (SMA and inferior parietal cortex (IPC. Twelve healthy adult volunteers participated in the study. They performed a variation of a line-drawing task (Nielsen, 1963;Fourneret and Jeannerod, 1998, in which they moved a cursor on a digital tablet with their right hand without seeing the hand. Visual feedback displayed on a computer monitor was either in correspondence with or deviated from the actual movement. This made participants uncertain as to the agent of the movement and they reported SoA in approximately 50% of trials when the movement was computer-generated. We tested whether IPC-preSMA coupling was associated with SoA, using dynamic causal modelling (DCM for induced responses (Chen et al., 2008;Herz et al., 2012. Nine different DCMs were constructed for the early and late phases of the task, respectively. All models included two regions: a superior medial gyrus (preSMA region and a right supramarginal gyrus (IPC region. Bayesian models selection (Stephan et al., 2009 favoured a model with input to IPC and modulation of the forward connection to SMA in the late task phase, and a model with input to preSMA and modulation of the backward connection was favoured for the early task phase. The analysis shows that IPC source activity in the 50-60Hz range modulated preSMA source activity in the 40-70 Hz range in the presence of SoA compared with no SoA in the late task phase, but the test of the early task phase did not reveal any differences between presence and absence of SoA. We show that SoA is associated with a directionally specific between frequencies coupling from IPC to preSMA in the higher gamma (ɣ band in the late task phase. This suggests that SoA is a retrospective perception, which is highly dependent on interpretation of the outcome of the performed action.

  14. Sense of agency is related to gamma band coupling in an inferior parietal-preSMA circuitry

    Science.gov (United States)

    Ritterband-Rosenbaum, Anina; Nielsen, Jens B.; Christensen, Mark S.

    2014-01-01

    In the present study we tested whether sense of agency (SoA) is reflected by changes in coupling between right medio-frontal/supplementary motor area (SMA) and inferior parietal cortex (IPC). Twelve healthy adult volunteers participated in the study. They performed a variation of a line-drawing task (Nielsen, 1963; Fourneret and Jeannerod, 1998), in which they moved a cursor on a digital tablet with their right hand without seeing the hand. Visual feedback displayed on a computer monitor was either in correspondence with or deviated from the actual movement. This made participants uncertain as to the agent of the movement and they reported SoA in approximately 50% of trials when the movement was computer-generated. We tested whether IPC-preSMA coupling was associated with SoA, using dynamic causal modeling (DCM) for induced responses (Chen et al., 2008; Herz et al., 2012). Nine different DCMs were constructed for the early and late phases of the task, respectively. All models included two regions: a superior medial gyrus (preSMA) region and a right supramarginal gyrus (IPC) region. Bayesian models selection (Stephan et al., 2009) favored a model with input to IPC and modulation of the forward connection to SMA in the late task phase, and a model with input to preSMA and modulation of the backward connection was favored for the early task phase. The analysis shows that IPC source activity in the 50–60 Hz range modulated preSMA source activity in the 40–70 Hz range in the presence of SoA compared with no SoA in the late task phase, but the test of the early task phase did not reveal any differences between presence and absence of SoA. We show that SoA is associated with a directionally specific between frequencies coupling from IPC to preSMA in the higher gamma (ɣ) band in the late task phase. This suggests that SoA is a retrospective perception, which is highly dependent on interpretation of the outcome of the performed action. PMID:25076883

  15. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  17. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  19. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  20. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  1. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  2. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  5. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  6. PENGARUH DARI NEPTUNE KRILL OIL PADA MANAJEMEN DISMINOREA PADA REMAJA PUTRI KELAS X DI SMA NEGERI 1 PRINGSEWU

    Directory of Open Access Journals (Sweden)

    Indri Retno Palupi

    2016-12-01

    Full Text Available Hasil survei Perkumpulan Keluarga Berencana Indonesia (PKBI cabang Bandar Lampung tahun 2014, dismenorhea  menempati urutan pertama keluhan yang sering dialami wanita, sebesar 65,3% selain siklus menstruasi yang tidak teratur. Prevalensi dismenorhea  lebih tinggi pada kelompok usia remaja 10-20 tahun sebesar 71,4%. Tujuan penelitian ini diketahui pengaruh dari neptune krill oil  pada manajemen disminorea pada remaja putri kelas X di SMA Negeri 1 Pringsewu tahun 2016. Jenis penelitian ini adalah kuantitatif dengan menggunakan rancangan desain  eksperimen dengan menggunakan pendekatan one group pre and post test. Populasi dalam penelitian ini adalah seluruh remaja putri kelas X di SMA Negeri 1 Pringsewu yang berjumlah 193 orang, sampel dalam penelitian ini berjumlah 30 orang. Teknik sampling dalam penelitian ini menggunakan teknik accidental. Analisis data yang digunakan dalam penelitian ini univariat dan bivariat dengan uji t-test.Tingkat nyeri dismenorhea  sebelum diberi Neptune krill oil  pada siswi kelas X SMA Negeri 1 Pringsewu memiliki rata-rata tingkatan nyeri yaitu 8,190 (pada skala 1-15, Tingkat nyeri dismenorhea  setelah diberi Neptune krill oil  pada siswi kelas X SMA Negeri 1 Pringsewu memiliki Rata-rata tingkat nyeri yaitu 4,747 (pada skala 1-15. Ada pengaruh pemberian Neptune krill oil  terhadap intensitas nyeri dismenorhea  pada siswi kelas X SMA Negeri 1 Pringsewu Tahun 2016 (p-value=0,000. Diharapkan remaja putri dapat mengetahui bahwa salah satu cara untuk mengurangi nyeri dismenorhea  adalah dengan mengkonsumsi Neptune krill oil. Sehingga remaja putri dapat menerapkannya dirumah saat mengalami dismenorhea.

  7. Social/economic costs and health-related quality of life in patients with spinal muscular atrophy (SMA) in Spain.

    Science.gov (United States)

    López-Bastida, Julio; Peña-Longobardo, Luz María; Aranda-Reneo, Isaac; Tizzano, Eduardo; Sefton, Mark; Oliva-Moreno, Juan

    2017-08-18

    The aim of this study was to determine the economic burden and health-related quality of life (HRQOL) of patients with Spinal Muscular Atrophy (SMA) and their caregivers in Spain. This was a cross-sectional and retrospective study of patients diagnosed with SMA in Spain. We adopted a bottom up, prevalence approach design to study patients with SMA. The patient's caregivers completed an anonymous questionnaire regarding their socio-demographic characteristics, use of healthcare services and non-healthcare services. Costs were estimated from a societal perspective (including healthcare costs and non-healthcare costs), and health-related quality of life (HRQOL) was assessed using the EQ-5D questionnaire. The main caregivers also answered a questionnaire on their characteristics and on their HRQOL. A total of 81 caregivers of patients with different subtypes of SMA completed the questionnaire. Based on the reference unitary prices for 2014, the average annual costs per patient were € 33,721. Direct healthcare costs were € 10,882 (representing around 32.3% of the total cost) and the direct non-healthcare costs were € 22,839 (67.7% of the total cost). The mean EQ-5D social tariff score for patients was 0.16, and the mean score of the EQ-5D visual analogue scale was 54. The mean EQ-5D social tariff score for caregivers was 0.49 and their mean score on the EQ-5D visual analogue scale was 69. The results highlight the burden that SMA has in terms of costs and decreased HRQOL, not only for patients but also for their caregivers. In particular, the substantial social/economic burden is mostly attributable to the high direct non-healthcare costs.

  8. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  9. Gambaran Perilaku Remaja Terhadap Penggunaan Earphone Pada Siswa SMA Negeri Kota Padang

    Directory of Open Access Journals (Sweden)

    Tiara Rahma Zain

    2016-09-01

    Full Text Available AbstrakEarphone adalah alat yang digunakan untukmendengarkan musik dari telepon genggam dan perangkat audio lainnya.Sebuah survey yang dilakukan oleh American Speech Languageand Hearing Association (2006 menemukan bahwa remaja lebih banyak menggunakan perangkat dengar pribadidengan volume keras dan dalam waktu yang lama. Penelitian ini bertujuan untuk mengetahui gambaran perilaku remaja terhadap pengunaan earphone pada siswa SMA Negeri Kota PadangPenelitian ini dilakukan dengan metode deskriptif pada siswa SMAN Negeri Kota Padang yang berjumlah 13.105 orang.Didapatkan sampel berjumlah 427 orang, pengambilan sampel dilakukan dengan teknik Cluster Sampling.Data diambil dengan menggunakan kuesioner.Analisis data menggunakan analisis univarat dengan menggunakan program SPSS (Statistical Product and Service Solution 21.00 for Windows.                Hasil didapatkan proporsi pengguna earphone pada siswa SMA Negeri Kota Padangberjumlah 83,6%. Perilaku siswa dibagi menjadi 3 kategori yaitu pengetahuan, sikap dan tindakan. Hasilnya didapatkan siswa tersebut memiliki pengetahuan dan sikap yang baik terhadap penggunaan earphone dengan persentase 93,4% dan 80,9%. Tindakan siswa ketika menggunakan earphone cukup baik dengan persentasi 66,3%.                Kesimpulan penelitian ini adalah sebagian besar siswa SMA Negeri Kota Padang menggunakan earphone.Siswa tersebut memiliki pengetahuan yang baik mengenai dampak penggunaan earphone dan cara pencegahannya. Siswa juga memiliki sikap yang baik terhadap penggunaan earphone dan bertindak cukup baik ketika menggunakan earphone.Kata Kunci :Earphone, remaja, perilaku AbstractEarphone is a device that used for listening music from their mobile phone and other devices. A survey conducted by American Speech Languageand Hearing Association (2006 found that many teenagers use their personal audio device with maximum volume within a long time. This research aims to describe the teenager

  10. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  11. Analysis of the modifying influence of Plastin 3 (PLS3) on Spinal Muscular Atrophy (SMA) by generation of transgenic mouse models

    OpenAIRE

    Ackermann, Bastian

    2011-01-01

    Spinal muscular atrophy (SMA) is a neurodegenerative disease characterized by the loss of α-motor neurons in the ventral horn of the spinal cord. Depending on the severity, the clinical spectrum of SMA ranges from early infant death to normal adult life with only mild muscle weakness. To date, no cure is available. SMA is caused by the homozygous loss of the survival motor neuron gene 1 (SMN1). Besides SMN1, another nearly identical copy of the gene is present in the human genome, thus called...

  12. KEBIJAKAN KEPALA SEKOLAH TERHADAP PELAYANAN BIMBINGAN KONSELING DI SMA NEGERI SE-KABUPATEN PURBALINGGA

    Directory of Open Access Journals (Sweden)

    Dinka Rizki Apriliana Mahanggi

    2014-06-01

    Full Text Available Tujuan penelitian ini untuk mengetahui bagaimana pelaksanaan kebijakan kepala sekolah terhadap pelayanan BK di SMA Negeri se-Kabupaten Purbalingga. Penelitian ini adalah penelitian kualitatifdengan pendekatan penelitian kebijakan, sumber dataprimer dan sekunder. Subyek penelitian yaitu seluruh kepala SMA Negeri se-Kabupaten Purbalingga. Instrumen yang digunakan adalah observasi, wawancara dan dokumentasi.Hasil penelitian menunjukkan bahwa kebijakan sarpras untuk BK sudah cukup lengkap walaupun belum maksimal karena minimnya anggaran dana. Kebijakan alokasi jam BK, prosentasenya 20% sama sekali tidak ada jam BK, 40% semua kelas ada jam BK, sedangkan 40% lainnya hanya sebagian kelas yang ada. Kebijakan mengenai kualifikasi akademik konselor, 50% dari jumlah seluruh guru BK yang berlatarbelakang pendidikan BK, dan 50% lainnya non BK. Hampir semua guru BK sudah memenuhi kriteria beban kerja guru BK yaitu minimal mengampu 150 siswa.Supervisi BK oleh kepala sekolah masih belum optimal. Anggapan BK sebagai polisi sekolah sudah mulai hilang karena kebijakan kepala sekolah yang menetapkan guru BK tidak boleh menghukum siswa. Simpulan penelitiannya yaitu secara umum kepala sekolah sudah mengetahui peran serta tanggungjawab kepala sekolah terhadap pelayanan BK, tetapi dalam pelaksanaannya kepala sekolah kurang menerapkan pemahamannya serta kurang melihat kebutuhan dari guru BK dan siswa. The purpose of this study is to find out how the application of headmaster’ policytowards guidance and counseling service in state high schools. It used qualitative research with policy research analysis approach, primary and secondary data sources. The subjects of this research are all headmasters of state high schools throughout Purbalingga district. Observation, interview, documentation are the instruments used in this research. Result of this study shows that in providing the infrastructureis generally appropriate. There are 20% of which haven’t any time allocation

  13. Kurikulum Tersembunyi Lingkungan di dalam Materi Energi Terbarukan untuk Fisika SMA

    Directory of Open Access Journals (Sweden)

    Desnita Desnita

    2015-12-01

    Full Text Available Abstract Renewable energy resources education, in essence, is the treatment of various topics and issues related to enewable energy resources and technologies as an environmental hidden curriculum in physics education at Senior High School. Based on the statement, environmental Hidden Curriculum in teaching physics concept, especially renewable energy resource was developed. Used research and development method, with step: need assessment, development theoretic models, validation, trial, and revision. The development result is a curriculum with contain: concept of green energy renewal resource and waste cooking oil as a kind of the resources, producing process, and learning strategies to implementation the curriculum. Implementation as trial this curriculum was conducted at a senior high school in South of Jakarta. Didactic exploration improves the learning process, link or integration in physics concept, when worksheets were used in the physics lab and multimedia system. The worksheet content are picture, video, and text or article about green renewable energy resources. Used project based learning and cooperative learning, using the worksheet was improve not only cognitive aspect of the student, but also their skill and attitude to save environmental. Kata-kata Kunci: environmental hidden curricullum, green renewable energy resources, learning strategies. Abstrak Inti dari pendidikan tentang sumber energi terbarukan adalah ujicoba terhadap sejumlah topik dan isu yang terkait dengan sumber energi terbarukan ramah lingkungan dan teknologinya sebagai sebuah kurikulum tersembunyi dalam pendidikan fisika pada tingkat SMA. Berdasarkan alasan tersebut, telah dikembangkan kurikulum lingkungan yang tersembunyi di dalam mengajar konsep fisika, khususnya sumber energi ramah lingkungan. Hasil pengembangan adalah kurikulum yang berisi konsep sumber energi terbarukan ramah lingkungan dan minyak jelanta sebagai salah satu jenisnya, proses produksi, dan

  14. Pengembangan Lembar Aktivitas Siswa (LAS Matematika Kelas X SMA Dengan Penerapan Variasi Model Pembelajaran Kooperatif

    Directory of Open Access Journals (Sweden)

    Tetty Natalia Sipayung

    2018-03-01

    Full Text Available Abstrak. Tujuan dari penelitian ini adalah untuk mengetahui: (1 validitas Lembar Aktivitas Siswa (LAS matematika kelas X SMA yang dikembangkan dengan penerapan variasi model pembelajaran kooperatif; (2 efektivitas pembelajaran dengan menggunakan Lembar Aktivitas Siswa  matematika dengan menerapkan variasi model pembelajaran kooperatif. Adapun jenis penelitian ini adalah penelitian dan pengembangan (Research and Development yang mengembangkan bahan ajar berupa Lembar Aktivitas Siswa. Hasil dari penelitian ini adalah: (1 Lembar Aktivitas Siswa matematika kelas X SMA yang dikembangkan adalah valid dengan skor rata-rata dari validator adalah 4,56 atau 91,2%. Dikatakan valid artinya layak digunakan atau dipakai dalam pembelajaran matematika; (2 Pembelajaran dengan menggunakan Lembar Aktivitas Siswa matematika dengan menerapkan variasi model pembelajaran kooperatif adalah efektif. Hal tersebut dianalisis berdasarkan observasi aktivitas siswa, kemampuan guru dalam mengelola pembelajaran, dan hasil belajar siswa di kelas eksperimen dan di kelas kontrol. Siswa pada kelas eksperimen dibelajarkan dengan menggunakan Lembar Aktivitas Siswa (LAS dan menerapkan variasi model pembelajaran kooperatif yaitu tipe Student Teams Achievement Division (STAD, Numbered Head Together (NHT, Think Pair Share (TPS, dan Jigsaw pada kelas eksperimen. Sementara siswa pada kelas kontrol dibelajarkan tanpa menggunakan Lembar Aktivitas Siswa (LAS dan menerapkan pembelajaran konvensional. Kata Kunci: Lembar Aktivitas Siswa, Model Pembelajaran Kooperatif    Abstract. The objectives of the research are: (1 The validity of student’s Mathematic worksheet for tenth grade of senior high school using various cooperative leaning models; (2 The learning effectiveness of student’s Mathematic worksheet sheet using various cooperative learning. The method used is research and development that develops students’ Mathematic worksheet as teaching media. The research findings are as

  15. Kebijakan Kepala Sekolah Terhadap Pelayanan Bimbingan Konseling di SMA Negeri Se-Kabupaten Purbalingga

    Directory of Open Access Journals (Sweden)

    Dinka Rizki Apriliana Mahanggi

    2014-06-01

    Full Text Available Tujuan penelitian ini untuk mengetahui bagaimana pelaksanaan kebijakan kepala sekolah terhadap pelayanan BK di SMA Negeri se-Kabupaten Purbalingga. Penelitian ini adalah penelitian kualitatifdengan pendekatan penelitian kebijakan, sumber dataprimer dan sekunder. Subyek penelitian yaitu seluruh kepala SMA Negeri se-Kabupaten Purbalingga. Instrumen yang digunakan adalah observasi, wawancara dan dokumentasi.Hasil penelitian menunjukkan bahwa kebijakan sarpras untuk BK sudah cukup lengkap walaupun belum maksimal karena minimnya anggaran dana. Kebijakan alokasi jam BK, prosentasenya 20% sama sekali tidak ada jam BK, 40% semua kelas ada jam BK, sedangkan 40% lainnya hanya sebagian kelas yang ada. Kebijakan mengenai kualifikasi akademik konselor, 50% dari jumlah seluruh guru BK yang berlatarbelakang pendidikan BK, dan 50% lainnya non BK. Hampir semua guru BK sudah memenuhi kriteria beban kerja guru BK yaitu minimal mengampu 150 siswa.Supervisi BK oleh kepala sekolah masih belum optimal. Anggapan BK sebagai polisi sekolah sudah mulai hilang karena kebijakan kepala sekolah yang menetapkan guru BK tidak boleh menghukum siswa. Simpulan penelitiannya yaitu secara umum kepala sekolah sudah mengetahui peran serta tanggungjawab kepala sekolah terhadap pelayanan BK, tetapi dalam pelaksanaannya kepala sekolah kurang menerapkan pemahamannya serta kurang melihat kebutuhan dari guru BK dan siswa. The purpose of this study is to find out how the application of headmaster’ policytowards guidance and counseling service in state high schools. It used qualitative research with policy research analysis approach, primary and secondary data sources. The subjects of this research are all headmasters of state high schools throughout Purbalingga district. Observation, interview, documentation are the instruments used in this research. Result of this study shows that in providing the infrastructureis generally appropriate. There are 20% of which haven’t any time allocation

  16. Faktor – Faktor Penyebab Prokrastinasi Akademik pada Siswa Kelas XI SMA Negeri Kabupaten Temanggung

    Directory of Open Access Journals (Sweden)

    Ujang Candra

    2014-10-01

    Full Text Available Prokrastinasi akademik adalah jenis penundaan yang dilakukan pada jenis tugas formal yang berhubungan dengan tugas akademik. Salah satunya yang sering menjadi prokrastinator adalah siswa. Jika prokrastinasi ini tidak segera dibenahi, akan merugikan siswa itu sendiri. Perkembangan siswa dalam meraih prestasi akademik menjadi terganggu. Tujuan dari penelitian ini adalah untuk mengetahui faktor-faktor penyebab prokrastinasi akademik pada siswa kelas XI SMA Negeri Kabupaten Temanggung. Angket diberikan kepada 221 siswa SMA Negeri Kabupaten Temanggung, serta 6 orang responden untuk diwawancara. Analisis data menggunakan analisis kuantitatif yang mencakup deskriptif presentase, dan analisis kulitatif hasil wawancara. Hasil penelitian menemukan bahwa faktor internal penyebab prokrastinasi akademik dilihat dari kondisi fisik (69%, kondisi psikologis (73%. Kemudian faktor eksternal penyebab prokrastinasi akademik dilihat dari kondisi keluarga (75%, lingkungan sekolah (67%, lingkungan masyarakat (66%. Simpulan penelitian ini bahwa faktor internal utama penyebab prokrastinasi akademik pada siswa adalah kondisi fisik dan faktor eksternal yang paling utama penyebab prokrastinasi akademik pada siswa adalah lingkungan sekolah. Bagi konselor sekolah, dapat memberikan layanan prnguasaan konten mengenai manajemen waktu sebagai upaya mencegah munculnya perilaku prokrastinasi akademik. Academic procrastination is the kind of delay that made the tasks associated with the assignment of formal academic. One of them is that often a student prokrastinator. If procrastination is not immediately addressed, it would be detrimental to the students themselves. The development of students academic achievement become impaired. The purpose of this study is to determine the internal factors and external factors that cause students academic procrastination.. Questionnaire given to 221 students of High School in Temanggung, and 6 respondents to be interviewed. Data analysis using

  17. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  18. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  19. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  20. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  2. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  3. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  4. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  5. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  6. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  7. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  8. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  9. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  10. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  11. Efektifitas Layanan Bimbingan dan Konseling Untuk Mengatasi Masalah Menyontek dan Pengaruhnya terhadap Prestasi Belajar Siswa SMA Negeri 11 Ambon

    Directory of Open Access Journals (Sweden)

    Purwatib

    2018-01-01

    Full Text Available The problem of cheating for learners is not something new in the world of school. When school programs begin to enter the stage of assessment, then there are also various behavior patterns of learners to prepare themselves to face a test or test. In fact, in schools such as SMA Negeri 11 Ambon there are some students of class X IPS do cheat behavior at the time of replication take place. The research was conducted in SMA Negeri 11 Ambon, the result of the research showed that there were differences of learners behavior, before and after the students got guidance and counseling service. Of the 40 respondents who originally cheated, after being given guidance almost all declared no and have abandoned the attitude of cheating.

  12. SMA and CARMA observations of young brown dwarfs in ρ Ophiuchi and Taurus

    Directory of Open Access Journals (Sweden)

    Lee C.-F.

    2011-07-01

    Full Text Available Molecular outflows provide vital information about the earliest stages in the birth of stars, studying the molecular outflow properties is therefore crucial for understanding how stars form. Brown dwarfs with masses between that of stars and planets are not massive enough to maintain stable hydrogen-burning fusion reactions during most of their lifetime. Their origins are subject to much debate in recent literature because their masses are far below the typical mass where core collapse is expected to occur. Based on Submillimeter Array (SMA and Combined Array for Research in Millimeter-wave Astronomy (CARMA observations, we present the first detections of bipolar molecular outflows from young brown dwarfs in ρ Ophiuchi and Taurus. Our results demonstrate that the bipolar molecular outflow operates down to brown dwarf masses, occurring in brown dwarfs as a scaled-down version of the universal process seen in young low-mass stars. This demonstrates that brown dwarfs and low-mass stars likely share the same formation mechanism.

  13. Penggunaan Media Sosial Sesuai Nilai Luhur Budaya di Kalangan Siswa SMA

    Directory of Open Access Journals (Sweden)

    Roswita Oktavianti

    2017-12-01

    Full Text Available The youth as a generation of social media users holds great control over the dissemination of information in groups and families. Social media like Facebook, Twitter, Instagram, Path, becomes a medium of expression and self-existence, and the spread of news and information. In this case, social media becomes a means of spreading the noble values of the culture that is acculturated in one's self and their surrounding environment. However, the younger generation is less aware of the role of social media as a means of spreading the noble values of culture. Information and news in social media are accepted immediately without verifying the truth. Social media is more dominantly used as a means of self-expression, without a positive contribution to other social media users, or, in this case, followers. Therefore, the younger generation needs to be briefed on the use of social media as well as the importance of using social media as a medium that communicates the noble values of culture. The briefing was conducted at SMA Santo Kristoforus 1, West Jakarta. By using survey method to know the effectiveness of the briefing, the younger generation' understanding of the use of social media before and after the briefing. The outcome of this activity, all students are able to show which information that should or should not be disseminated, able to recognize or identify false news (hoaxes, false news information, and the steps taken when receiving the false news.

  14. Using the adaptive SMA composite cylinder concept to reduce radial dilation in composite pressure vessels

    Science.gov (United States)

    Paine, Jeffrey S.; Rogers, Craig A.

    1995-05-01

    Composite materials are widely used in the design of pressurized gas and fluid vessels for applications ranging from underground gasoline storage tanks to rocket motors for the space shuttle. In the design of a high pressure composite vessel (Pi > 12 Ksi), thick-wall (R/h short term dilation and long term creep are not problematic for applications requiring only the containment of the pressurized fluid. In applications where metallic liners are required, however, substantial dilation and creep causes plastic yielding which leads to reduced fatigue life. To applications such as a hydraulic accumulator, where a piston is employed to fit and seal the fluid in the composite cylinder, the dilation and creep may allow leakage and pressure loss around the piston. A concept called the adaptive composite cylinder is experimentally presented. Shape memory alloy wire in epoxy resin is wrapped around or within polymer matrix composite cylinders to reduce radial dilation of the cylinder. Experimental results are presented that demonstrate the ability of the SMA wire layers to reduce radial dilation. Results from experimental testing of the recovery stress fatigue response of nitinol shape memory alloy wires is also presented.

  15. FAKTOR DETERMINAN KEMAMPUAN PERENCANAAN KARIER SISWA SMA NEGERI SE-KABUPATEN TEGAL

    Directory of Open Access Journals (Sweden)

    Lu'luatun Miskiya

    2014-06-01

    Full Text Available Tujuan penelitian ini untuk mengetahui faktor determinan kemampuan perencanaan karier siswa. Jenis penelitian adalah penelitian survey. Populasi penelitian ini yaitu siswa kelas XI SMA Negeri se-Kabupaten Tegal. Teknik sampling yang digunakan Cluster Sampling Proporsional. Metode pengumpulan data menggunakan angket tertutup. Analisis datanya menggunakan deskriptif persentase. Hasil penelitian menunjukkan faktor keluarga menjadi faktor determinan terhadap kemampuan perencanaan karier siswa dengan perolehan persentase sebesar 80% yang berada dalam kategori tinggi. Sedangkan faktor belajar menjadi faktor yang kurang determinan terhadap kemampuan perencanaan karier siswa dengan perolehan persentase sebesar 67% yang berada dalam kategori sedang. Simpulan dari penelitian ini, faktor keluarga menjadi faktor determinan terhadap kemampuan perencanaan karier siswa. The purpose of the study was to find out the determinant  factor of students career planning ability. This research was using survey research with XI grades students of State Senior High Schools in Tegal regency as the population. Proportionate cluster sampling technique was used  in this study. Method for collecting data was used close questionnaire. The data analysis used descriptive percentages.The results showed family factor become the determinant factor of students career planning ability with the percentage of 80 % which is in the high category while learning factor become less determinant factor of the ability of students career planning with a percentage of 67%  in the medium category . It can concluded that family factor become  determinant factor in the ability of students career planning.

  16. PENGARUH PENGGUNAAN PEMBELAJARAN KOOPERATIF TIPE STAD BERBANTUAN WINGEOM TERHADAP KEMAMPUAN PEMECAHAN MASALAH GEOMETRI SISWA SMA

    Directory of Open Access Journals (Sweden)

    Ikhsanudin Ikhsanudin

    2014-06-01

    Full Text Available This research is a quasi-experimental with pre-test and post-test non-equivalent group design. The population in this research is all of the students on class X in SMA Negeri 1 Marga Tiga and the sampling technique is total sampling. Data are collected by documentation and test. Data are analyzed with descriptive statistics to compare the mean scores of N-Gain  obtained by each student.  The results of the analysis shows that (1 the student’s geometry problem solving ability with cooperative learning STAD is higher than the conventional learning, (2 the student’s geometry problem solving ability with wingeom software in cooperative learning STAD is higher than the conventional learning, (3 the student’s geometry problem solving ability with wingeom software in cooperative learning STAD is higher than without using wingeom software. This research shows that the cooperative learning STAD by using the wingeom software has a significant effect on the high school students’ geometry problem-solving ability. The finding of this research shows that the students are still having difficulties in solving the problems, especially when the students have to look back whether the finishing is right or not.

  17. PENGEMBANGAN PERANGKAT PEMBELAJARAN BIOLOGI BERORIENTASI PENGEMBANGAN KECERDASAN MAJEMUK SISWA PADA KONSEP SEL KELAS XI SMA

    Directory of Open Access Journals (Sweden)

    Vidya Chaerunnisa

    2017-01-01

    Full Text Available This study aimed to determine the feasibility of the development of student’s multiple intelligence-oriented learning instrument on the cells concept in grade XI senior high school. Research and Development (R & D method was conducted in this research. This research was developed four components in the cell concept learning instrument that included syllabus, lesson plan, student’s worksheet, and assessment instrument. From the four components were obtained an average score of 93.76% with a decent category. The time limited test was conducted in July-August 2016, at SMAN 4 Kota Serang and SMA Prisma Sanjaya Kota Serang. Based on students' responses as a user, it was obtained the value of 79.78% with a fair category. Based on the results of expert test and limited test scale, the learning instrument development of multiple intelligences learning-oriented can be applied for the learning process in the cell concept for grade XI in senior high school.

  18. Design and numerical analysis of an SMA mesh-based self-folding sheet

    International Nuclear Information System (INIS)

    Peraza-Hernandez, Edwin A; Hartl, Darren J; Malak Jr, Richard J

    2013-01-01

    Origami engineering, which is the practice of creating useful three-dimensional structures through folding and fold-like operations applied to initially two-dimensional entities, has the potential to impact several areas of design and manufacturing. In some instances, however, it may be impractical to apply external manipulations to produce the desired folds (e.g., as in remote applications such as space systems). In such cases, self-folding capabilities are valuable. A self-folding material or material system is one that can perform folding operations without manipulations from external forces. This work considers a concept for a self-folding material system. The system extends the ‘programmable matter’ concept and consists of an active, self-morphing sheet composed of two meshes of thermally actuated shape memory alloy (SMA) wire separated by a compliant passive layer. The geometric and power input parameters of the self-folding sheet are optimized to achieve the tightest local fold possible subject to stress and temperature constraints. The sheet folding performance considering folds at different angles relative to the orientation of the wire mesh is also analyzed. The optimization results show that a relatively low elastomer thickness is preferable to generate the tightest fold possible. The results also show that the self-folding sheet does not require large power inputs to achieve an optimal folding performance. It was shown that the self-folding sheet is capable of creating similar quality folds at different orientations. (paper)

  19. PENDIDIKAN KARAKTER POLA MUHAMMADIYAH (Studi Kasus SMA Muhammadiyah 1 dan MA Muallimin Yogyakarta

    Directory of Open Access Journals (Sweden)

    Kuswono Kuswono

    2013-09-01

    Full Text Available This research aims to find out the sources of character education at Islamic schools, character- building values application and actualization. This research was conducted in SMA Mubammadiyah I Yogyakarta and MA Muallimin Muhammadiyah Yogyakarta.The result of research showed that teacher's perception on character education relied on Islamic precepts to create akhakul karimah-human beings. The sources of character education included Quran and as=Sunnah/Hadist as well as Ijtihad. The character value implantation was carried out through learning in the classroom, precedents from figures, teachers and peers, well-behaving familiarization in the presence of rule and order, personality report, and extracurricular activities in knowledge, skill, sport, art, and organization fields. The form of character-building values actualization emphasized more on the Islamic activities such as collectively shalat, reading and reciting Quran, social service, participating actively in IPM, hizbul wathan, and tapak suci organizational activities. In addition, there were kader inti/an, mubalig jumat, mubalig hijarah, fasting, Friday sermon, becoming the orator in pengajian, and flag ceremony. Such these activities reflected on religious, cooperative, leadership, loving-to-homeland, social care, environmental care, and creative values.Keywords: Education, Character, Muhammadiyah.

  20. Inovasi Pembelajaran Pendidikan Agama Islam melalui E-Learning di SMA Budaya Bandar Lampung

    Directory of Open Access Journals (Sweden)

    Nur Asiah

    2016-07-01

    Full Text Available Learning is the totality of learning activity that begins with planning and ending with the evaluation and follow-up. Developments in science followed by the development of internet information technology and leading edge technology. With the innovation of education, the learning process can be developed and improved the quality of the quality of information technology, better known as e-learning. E-learning is a new learning model in the educational use of information technology in teaching and learning. Problems faced by the schools and teachers is the ability to apply e-learning, self-learning culture is lacking, teachers who have not been able to use and develop learning e-learning and Internet network system that can not be accessed. Data collection techniques used in this study was the observation, interview and documentation. Implementation of e-learning often contentious among high schools Cultural Bandar Lampung. In the process of learning in e-learning, an innovation and interaction between learners with learning resources, between teachers and learners. Innovation PAI learning via e-learning can be divided into two namely, a e-learning is used entirely for learning PAI in SMA Culture Bandar Lampung, b Learning e-learning at the School of Culture serve as a complement to conventional learning.

  1. Upaya Guru Bimbingan dan Konseling dalam Mencegah Perilaku Bullying di SMA Negeri Se Kota Padang

    Directory of Open Access Journals (Sweden)

    Riri Yunika

    2013-09-01

    Full Text Available Bullying is a behavior consciously done by someone to abuse and hurt others. Ideally, the guidance and counseling teachers (BK teachersare demanded to give attentions in preventing bullying behavior. However, in fact, the BK teachers have not plan special programs yet to prevent the bullying behavior among students in school. This research aims to describe the understanding of BK teachers about the concept of bullying behavior. Then, it aims to describe the treatment of the BK given by the teachers to the students. Finally, it aims to describe the cooperation among the BK teachers within the school. This research is kind of descriptive research. The population of this research is all of the BK teachers of SMA Negeri (State school for secondary education in Padang. Sample is taken by using area sampling and simple random sampling techniques. Generally, the result implicates that the BK teachers have done preventing efforts toward bullying behavior among students in the school. Thus, the teachers should increase the understanding in reference to bullying behavior among students to prevent the behavior in school.

  2. ANALISIS SOAL JENJANG KOGNITIF TAKSONOMI BLOOM REVISI PADA BUKU SEKOLAH ELEKTRONIK (BSE BIOLOGI SMA

    Directory of Open Access Journals (Sweden)

    Aa Juhanda

    2016-11-01

    Penelitian ini bertujuan untuk menganalisis kemunculan soal jenjang kognitif Bloom Revisi pada Buku Sekolah Elektronik (BSE Biologi SMA. Subjek penelitian adalah 1.650 soal yang terdapat pada BSE Edisi 2009. Instrumen yang digunakan adalah lembar analisis dokumen yang di dalamnya memuat informasi seperti kode soal, soal, dan jenis tingkatan kognitif taksonomi Bloom Revisi. Analisis data dilakukan secara kuantitatif dan kualitatif. Hasil penelitian menunjukkan bahwa rerata persentase kemunculan cukup tinggi diperoleh pada soal yang mengembangkan keterampilan berpikir tingkat rendah (Lower-Order Thinking Skills yaitu soal C1 (mengingat sebesar 46,60% dan C2 (memahami sebesar 47,99%, meskipun untuk C3 (menerapkan persentasenya masih rendah (0,28%. Rerata persentase kemunculan soal yang mengembangkan keterampilan tingkat tinggi (Higher-Order Thinking Skills mulai dari soal C4 (menganalisis sampai dengan C6 (mencipta memiliki rerata persentase yang rendah. Oleh karena itu, kemunculan soal jenjang kognitif Bloom Revisi pada BSE khususnya yang mengembangkan Higher-Order Thinking Skills masih perlu untuk ditingkatkan.

  3. Rancang Bangun Sistem Informasi Akademik Berbasis Web ( studi kasus: SMA Swasta Harapan I Medan

    Directory of Open Access Journals (Sweden)

    Haida Dafitri, Marina Elsera

    2017-10-01

    Full Text Available Submission of academic information to students, parents / guardians conducted at private high school SMA Harapan I Medan are still very ineffective and efficient both in terms of delivery time and in terms of finance. This is because the academic delivery is still manual in oral, written or via phone or SMS one by one. The impact of the process is the slow process of delivering academic information and the amount of expenditure in the delivery of information. To overcome these problems, then the academic community wants to improve the delivery of academic information systems using computerized technology. The purpose of the change is by building a School of Academic Information System (SISFO Web-based SCRUM model. The system is built to produce academic information such as value and achievement of students in web-based schools that can be utilized by the academic staff to make it easier in conveying academic information to students, parents / guardians. This system includes and through several aspects of functionality, reliability, efficiency, and usability. And the scrum model used in the design of this system has a framework for building, developing and managing an ever-changing product. Keywords: Information , Academic, Scrum Model, Web

  4. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  5. Rancang Bangun Aplikasi Pembayaran Sekolah Menggunakan Java Dan MySQL Berbasis Client Server Di SMA Yos Sudarso Cilacap

    OpenAIRE

    Usada, Elisa; Isnawati, Anggun Fitrian; Fatimah, Dewi

    2010-01-01

    SMA Yos Sudarso merupakan salah satu sekolah yang sudah memanfaatkan komputer  untuk menyelesaikan berbagai macam tugas, tetapi pemanfaatannya masih belum maksimal karena ada bagian administrasi yang masih menggunakan metode manual, yaitu pada administrasi pembayaran. Penelitian ini  berusaha membuat sebuah aplikasi client server berteknologi JAVA dan MySQL untuk mengelola data pembayaran sekolah meliputi pembayaran SPP, pembayaran uang gedung serta pembayaran ujian. Metode waterfal...

  6. Pose de la première pierre du bâtiment SMA18 du Cern

    CERN Multimedia

    CERN Press Office. Geneva

    1999-01-01

    On 30 April 1999, Jean Pépin, Sénateur for the Department of the Ain and President of the Conseil Général, and Professor Luciano Maiani the Director-General of CERN will lay the foundation stone of Building SMA18, financed by the Department of the Ain in the framework of France's special contribution to CERN's Large Hadron Collider (LHC) project.

  7. PERAN GURU BIMBINGAN DAN KONSELING DALAM MENINGKATKAN KESUKSESAN BELAJAR SISWA DI SMA NEGERI 1 DEPOK SLEMAN YOGYAKARTA

    Directory of Open Access Journals (Sweden)

    Mahdi Mahdi

    2017-05-01

    Full Text Available This study was to determine the role of guidance and counseling teachers in improving student learning success at SMA Negeri 1 Depok Sleman, Yogyakarta. The method used in this research is descriptive qualitative manifold generate descriptive data to describe the behavior of the subject under study. Then the presence of investigators in this study serves as primary research tool. Sources of data in this study are primary data obtained through observation and interview respondents. And secondary data documentation Master's programs of guidance and counseling. Data collection techniques in this study using the method of observation, interviews, and documentation. Selanjtnya data analysis in this study using qualitative data analysis. The results showed that the models of guidance and counseling program in SMA Negeri 1 Depok form their Intensification Program for class XII, intensification program contains material National Examinations and Pathways to college, learning programs in addition to class 10 and 11 to face the Final Exams Semester in order to satisfy student achievement, educational exhibits, and extracurricular programs in SMA Negeri 1 Depok. Then the data findings in the form of involvement or role of teacher guidance and counseling in improving students' success in school is through a program of classical guidance, counseling and personal counseling, tutoring and social counseling, guidance and counseling to learn, and guidance and career counseling.

  8. NRC Information No. 89-43: Permanent deformation of torque switch helical springs in Limitorque SMA-type motor operators

    International Nuclear Information System (INIS)

    Rossi, C.E.

    1992-01-01

    Problems with the helical springs were discovered during a series of dynamic tests that were conducted with a motor-operated wedge-gate valve from the decommissioned Shippingport Atomic Power Station (Shippingport). The valve was installed in a portion of the piping system that had been modified to simulate the stiffness of a typical US piping system. The valve was 30 years old and had its original Limitorque SMA-type motor operator. One of the main objectives of these tests was to determine the operating capability of the valve when subjected to simultaneous internal hydraulic and seismic loadings. This was typically accomplished by operating the valve to achieve maximum hydraulic loading during maximum seismic loading. During testing, an operability problem with the valve motor operator occurred. The design of the SMA-type motor operator is such that the torque switch helical spring is in its most compressed condition when the valve is closed. Thus, a normally closed valve is more likely to experience permanent deformation of the helical torque spring. A review of the Shippingport records indicated that both of these valves had been used as normally closed valves at Shippingport. Thus, normally closed, safety-related valves with Limitorque SMA-type motor operators may not accomplish their intended safety-related function because the original torque switch setting may result in lower output torque caused by the permanent deformation of their torque switch helical springs

  9. UPAYA MENGEMBANGKAN LEARNING COMMUNITY SISWA KELAS X SMA MELALUI PENERAPAN MODEL PEMBELAJARAN KOOPERATIF TIPE STAD BERBASIS CTL PADA PEMBELAJARAN FISIKA

    Directory of Open Access Journals (Sweden)

    Wahyudi -

    2012-04-01

    Full Text Available Penelitian ini bertujuan untuk mendeskripsikan penerapan model pembelajaran kooperatif tipe STAD berbasis CTL pada pembelajaran fisika dalam mengembangkan learning community dan meningkatkan hasil belajar siswa serta mengetahui dampak penerapannya terhadap learning community dan hasil belajar siswa kelas X-7 SMA N 1 Tahunan Jepara. Hasil penelitian menunjukkan meningkatnya hasil belajar serta berkembangnya learning community siswa kelas X-7 SMA N 1 Tahunan Jepara setelah penerapan model pembelajaran kooperatif tipe STAD berbasis CTL pada pokok bahasan listrik dinamis.This research is describe the implementation of cooperative learning model STAD CTL-based for Physics learning subject to develop learning community, improve students learning and also find out the outcome of its implementation  to the learning community and learning result of SMA N 1 Tahunan Jepara Students class of X-7. The research result shows that there is an improvement of students’ learning result and also a development of learning community of N 1 Tahunan Jepara Students class of X-7 after implementing cooperative learning model STAD CTL-based for Dynamic Electricity topic.

  10. Development of a self-stressing NiTiNb shape memory alloy (SMA)/fiber reinforced polymer (FRP) patch

    International Nuclear Information System (INIS)

    El-Tahan, M; Dawood, M; Song, G

    2015-01-01

    The objective of this research is to develop a self-stressing patch using a combination of shape memory alloys (SMAs) and fiber reinforced polymer (FRP) composites. Prestressed carbon FRP patches are emerging as a promising alternative to traditional methods to repair cracked steel structures and civil infrastructure. However, prestressing these patches typically requires heavy and complex fixtures, which is impractical in many applications. This paper presents a new approach in which the prestressing force is applied by restraining the shape memory effect of NiTiNb SMA wires. The wires are subsequently embedded in an FRP overlay patch. This method overcomes the practical challenges associated with conventional prestressing. This paper presents the conceptual development of the self-stressing patch with the support of experimental observations. The bond between the SMA wires and the FRP is evaluated using pull-out tests. The paper concludes with an experimental study that evaluates the patch response during activation subsequent monotonic tensile loading. The results demonstrate that the self-stressing patch with NiTiNb SMA is capable of generating a significant prestressing force with minimal tool and labor requirements. (paper)

  11. PENGARUH MODEL PEMBELAJARAN DAN KESADARAN METAKOGNITIF TERHADAP HASIL BELAJAR PESERTA DIDIK SMA DALAM MATERI POKOK ASAM BASA

    Directory of Open Access Journals (Sweden)

    Wiwiek Tamsyani

    2016-06-01

    Full Text Available Penelitian ini bertujuan untuk mengkaji hasil belajar penyebaran dengan model pembelajaran penemuan dan inkuiri terbimbing menggunakan rancangan quasi eksperimen dengan desain faktorial 2 × 2. Penelitian dilaksanakan di SMA Negeri 2 Takalar. Sampel penelitian dipilih dengan random sampling teknik acak kelas yang terdiri atas 2 kelas. Kelas XI IPA 1 (34 peserta didik sebagai kelas eksperimen 1 dibelajarkan dengan model pembelajaran penemuan dan kelas XI IPA 2 (33 peserta didik sebagai kelas eksperimen 2 dibelajarkan dengan model pembelajaran inkuiri terbimbing. Instrumen penelitian menggunakan yaitu, angket Inventori Kesadaran Meta kognitif dan tes hasil belajar. Penggunaan program SPSS versi 20.0 menunjukkan bahwa 5 soal essay valid dengan reliabilitas sebesar instrumen sebesar 0.699. Data penelitian dianalisis pada taraf signifikan α = 0.05 dengan uji anova dua jalur. Hasil penelitian menunjukkan bahwa (1 Rata-rata nilai hasil belajar peserta didik yang menggunakan model pembelajaran penemuan, hasilnya lebih tinggi dibandingkan dengan model pembelajaran inkuiri terbimbing. (2 Rata-rata nilai hasil belajar peserta didik dengan kesadaran metakognitif tinggi, hasil belajar peserta didik lebih tinggi dibandingkan dengan rata-rata nilai hasil belajar dengan kesadaran metakognitif rendah. (3 Terjadi interaksi antara model pembelajaran dan kesadaran metakognitif dalam mempengaruhi hasil belajar SMA Negeri 2 Takalar. Jadi, ada pengaruh antara model pembelajaran dan kesadaran metakognitif terhadap hasil belajar peserta didik SMA Negeri 2 Takalar dalam materi pokok asam basa.

  12. Nonlinear Analysis for the Crack Control of SMA Smart Concrete Beam Based on a Bidirectional B-Spline QR Method

    Directory of Open Access Journals (Sweden)

    Yan Li

    2018-01-01

    Full Text Available A bidirectional B-spline QR method (BB-sQRM for the study on the crack control of the reinforced concrete (RC beam embedded with shape memory alloy (SMA wires is presented. In the proposed method, the discretization is performed with a set of spline nodes in two directions of the plane model, and structural displacement fields are constructed by the linear combination of the products of cubic B-spline interpolation functions. To derive the elastoplastic stiffness equation of the RC beam, an explicit form is utilized to express the elastoplastic constitutive law of concrete materials. The proposed model is compared with the ANSYS model in several numerical examples. The results not only show that the solutions given by the BB-sQRM are very close to those given by the finite element method (FEM but also prove the high efficiency and low computational cost of the BB-sQRM. Meanwhile, the five parameters, such as depth-span ratio, thickness of concrete cover, reinforcement ratio, prestrain, and eccentricity of SMA wires, are investigated to learn their effects on the crack control. The results show that depth-span ratio of RC beams and prestrain and eccentricity of SMA wires have a significant influence on the control performance of beam cracks.

  13. Membrane protein extraction and purification using styrene-maleic acid (SMA) copolymer: effect of variations in polymer structure.

    Science.gov (United States)

    Morrison, Kerrie A; Akram, Aneel; Mathews, Ashlyn; Khan, Zoeya A; Patel, Jaimin H; Zhou, Chumin; Hardy, David J; Moore-Kelly, Charles; Patel, Roshani; Odiba, Victor; Knowles, Tim J; Javed, Masood-Ul-Hassan; Chmel, Nikola P; Dafforn, Timothy R; Rothnie, Alice J

    2016-12-01

    The use of styrene-maleic acid (SMA) copolymers to extract and purify transmembrane proteins, while retaining their native bilayer environment, overcomes many of the disadvantages associated with conventional detergent-based procedures. This approach has huge potential for the future of membrane protein structural and functional studies. In this investigation, we have systematically tested a range of commercially available SMA polymers, varying in both the ratio of styrene and maleic acid and in total size, for the ability to extract, purify and stabilise transmembrane proteins. Three different membrane proteins (BmrA, LeuT and ZipA), which vary in size and shape, were used. Our results show that several polymers, can be used to extract membrane proteins, comparably to conventional detergents. A styrene:maleic acid ratio of either 2:1 or 3:1, combined with a relatively small average molecular mass (7.5-10 kDa), is optimal for membrane extraction, and this appears to be independent of the protein size, shape or expression system. A subset of polymers were taken forward for purification, functional and stability tests. Following a one-step affinity purification, SMA 2000 was found to be the best choice for yield, purity and function. However, the other polymers offer subtle differences in size and sensitivity to divalent cations that may be useful for a variety of downstream applications. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  14. GENÇ PARTİ'Yİ ANLAMAK (Parti, Lider ve Kitle Üzerine Bir Çalısma)

    OpenAIRE

    TÜRK, Hasan Bahadır

    2007-01-01

    Türk, Hasan Bahadır, Genç Parti’yi Anlamak: Parti, Lider ve Kitle Üzerine BirÇalısma, Doktora Tezi, Danısman: Doç.Dr. Aykut Çelebi, 399 s.ÖZETBu çalısmanın amacı; Genç Parti’nin temel yapısal özelliklerine ısık tutmaktır. Çalısma;Genç Parti’yi lider, kadro, parti tipolojisi, ideoloji ve söylem gibi parçalarındanhareketle analiz etmeye ve kitleyle kurdugu iliskiyi tartısmaya odaklanacaktır. Çalısma,üç ana bölümden olusmaktadır. lk iki bölümde Uzanlar’ın genel yapısı, yükselis veçöküs süreci Ge...

  15. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  16. The Development of Learning Model Based on Problem Solving to Construct High-Order Thinking Skill on the Learning Mathematics of 11th Grade in SMA/MA

    Science.gov (United States)

    Syahputra, Edi; Surya, Edy

    2017-01-01

    This paper is a summary study of team Postgraduate on 11th grade. The objective of this study is to develop a learning model based on problem solving which can construct high-order thinking on the learning mathematics in SMA/MA. The subject of dissemination consists of Students of 11th grade in SMA/MA in 3 kabupaten/kota in North Sumatera, namely:…

  17. Preparation, characterization and thermal properties of styrene maleic anhydride copolymer (SMA)/fatty acid composites as form stable phase change materials

    International Nuclear Information System (INIS)

    Sari, Ahmet; Alkan, Cemil; Karaipekli, Ali; Onal, Adem

    2008-01-01

    Fatty acids such as stearic acid (SA), palmitic acid (PA), myristic acid (MA) and lauric acid (LA) are promising phase change materials (PCMs) for latent heat thermal energy storage (LHTES) applications, but high cost is the major drawback of them, limiting their utility area in thermal energy storage. The use of fatty acids as form stable PCMs will increase their feasibilities in practical applications due to the reduced cost of the LHTES system. In this regard, a series of styrene maleic anhydride copolymer (SMA)/fatty acid composites, SMA/SA, SMA/PA, SMA/MA, and SMA/LA, were prepared as form stable PCMs by encapsulation of fatty acids into the SMA, which acts as a supporting material. The encapsulation ratio of fatty acids was as much as 85 wt.% and no leakage of fatty acid was observed even when the temperature of the form stable PCM was over the melting point of the fatty acid in the composite. The prepared form stable composite PCMs were characterized using optic microscopy (OM), viscosimetry and Fourier transform infrared (FT-IR) spectroscopy methods, and the results showed that the SMA was physically and chemically compatible with the fatty acids. In addition, the thermal characteristics such as melting and freezing temperatures and latent heats of the form stable composite PCMs were measured by using the differential scanning calorimetry (DSC) technique, which indicated they had good thermal properties. On the basis of all the results, it was concluded that form stable SMA/fatty acid composite PCMs had important potential for practical LHTES applications such as under floor space heating of buildings and passive solar space heating of buildings by using wallboard, plasterboard or floors impregnated with a form stable PCM due to their satisfying thermal properties, easy preparation in desired dimensions, direct usability without needing additional encapsulation thereby eliminating the thermal resistance caused by the shell and, thus, reducing the cost of

  18. Pengaruh Penerapan Model Pembelajaran Berbasis Masalah Terhadap Kemampuan Menulis Teks Eksposisi Oleh Siswa Kelas X SMA Negeri 1 Babalan Tahun Pembelajaran 2013/2014

    OpenAIRE

    ulfa, warni atul

    2013-01-01

    Penelitian ini bertujuan untuk mengetahui pengaruh penerapan Model Pembelajaran Berbasis Masalah terhadap kemampuan menulis teks eksposisi oleh siswa kelas X SMA Negeri 1 Babalan tahun pembelajaran 2013/2014. Populasi penelitian ini adalah seluruh siswa kelas X SMA Negeri 1 Babalan, yang berjumlah 200 orang dan yang menjadi sampel penelitian sebanyak 40 orang. Pengambilan sampel dilakukan dengan cara menentukan satu kelas yang dijadikan wakil populasi dengan menggunakan teknik Random Sampling...

  19. Potentiation of motor sub-networks for motor control but not working memory: Interaction of dACC and SMA revealed by resting-state directed functional connectivity

    Science.gov (United States)

    Diwadkar, Vaibhav A.; Asemi, Avisa; Burgess, Ashley; Chowdury, Asadur; Bressler, Steven L.

    2017-01-01

    The dorsal Anterior Cingulate Cortex (dACC) and the Supplementary Motor Area (SMA) are known to interact during motor coordination behavior. We previously discovered that the directional influences underlying this interaction in a visuo-motor coordination task are asymmetric, with the dACC→SMA influence being significantly greater than that in the reverse direction. To assess the specificity of this effect, here we undertook an analysis of the interaction between dACC and SMA in two distinct contexts. In addition to the motor coordination task, we also assessed these effects during a (n-back) working memory task. We applied directed functional connectivity analysis to these two task paradigms, and also to the rest condition of each paradigm, in which rest blocks were interspersed with task blocks. We report here that the previously known asymmetric interaction between dACC and SMA, with dACC→SMA dominating, was significantly larger in the motor coordination task than the memory task. Moreover the asymmetry between dACC and SMA was reversed during the rest condition of the motor coordination task, but not of the working memory task. In sum, the dACC→SMA influence was significantly greater in the motor task than the memory task condition, and the SMA→dACC influence was significantly greater in the motor rest than the memory rest condition. We interpret these results as suggesting that the potentiation of motor sub-networks during the motor rest condition supports the motor control of SMA by dACC during the active motor task condition. PMID:28278267

  20. Contribution of the pre-SMA to the production of words and non-speech oral motor gestures, as revealed by repetitive transcranial magnetic stimulation (rTMS).

    Science.gov (United States)

    Tremblay, Pascale; Gracco, Vincent L

    2009-05-01

    An emerging theoretical perspective, largely based on neuroimaging studies, suggests that the pre-SMA is involved in planning cognitive aspects of motor behavior and language, such as linguistic and non-linguistic response selection. Neuroimaging studies, however, cannot indicate whether a brain region is equally important to all tasks in which it is activated. In the present study, we tested the hypothesis that the pre-SMA is an important component of response selection, using an interference technique. High frequency repetitive TMS (10 Hz) was used to interfere with the functioning of the pre-SMA during tasks requiring selection of words and oral gestures under different selection modes (forced, volitional) and attention levels (high attention, low attention). Results show that TMS applied to the pre-SMA interferes selectively with the volitional selection condition, resulting in longer RTs. The low- and high-attention forced selection conditions were unaffected by TMS, demonstrating that the pre-SMA is sensitive to selection mode but not attentional demands. TMS similarly affected the volitional selection of words and oral gestures, reflecting the response-independent nature of the pre-SMA contribution to response selection. The implications of these results are discussed.

  1. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  2. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  3. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

  4. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Effects of immersion disinfection of agar-alginate combined impressions on the surface properties of stone casts.

    Science.gov (United States)

    Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki

    2016-01-01

    This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.

  6. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    Science.gov (United States)

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  8. Evaluatie van de membraanfiltratiemethode op mCP-agar voor bepaling van sporen van Clostridium perfringens in water

    NARCIS (Netherlands)

    Schets FM; Medema GJ; LWL

    1995-01-01

    Current Dutch and European drinking water standards include criteria for spores of sulphite reducing clostridia. This has some inherent disadvantages. The reproducibility of the enumeration method for spores of sulphite reducing clostridia (SSRC) in Sulphite Cycloserine Agar (SCA) is poor. Some

  9. A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

    Science.gov (United States)

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

    2014-09-01

    A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Pengembangan Buku Pengayaan “Kajian Fisis Peristiwa Angin Puting Beliung” untuk Siswa SMA

    Directory of Open Access Journals (Sweden)

    Desnita Desnita

    2016-12-01

      dilakukan yaitu survei di delapan SMA, dua toko buku terkenal di Jakarta, toko buku online, dan Pusat Kurikulum dan Perbukuan (Puskurbuk. Hasil survei menunjukkan sajian buku pengayaan terkait angin puting beliung yang ada lebih fokus pada bencana sehingga kurang ilmiah dan kurang mendalam karena hanya sebatas dalam satu subbab. Mengacu pada hasil survei dan standar kualitas buku pengayaan, ditulis buku pengayaan pengetahuan yang membahas besaran fisis aliran gas terutama gradien tekanan, peristiwa dan konsep fisis terjadinya angin puting beliung, hingga mitigasi bencana. Berdasarkan hasil uji keterbacaan kepada siswa SMA diperoleh rerata skor komponen materi 92,5%, penyajian 88,5%, bahasa 84,17%, dan grafika 85,62%. Skor 87,5% menyatakan materi pada buku mudah dipahami dan 82,5% menyatakan penyajian materi dapat memotivasi untuk menggali informasi lebih lanjut. Dari hasil uji keterbacaan, buku ini memperoleh interpretasi keseluruhan sangat baik. Berdasarkan hasil uji kelayakan diperoleh rata-rata skor 81,05, menunjukkan buku pengayaan pengetahuan “Kajian Fisis Peristiwa Angin Puting Beliung” layak dengan predikat baik. Kata-kata kunci: buku pengayaan pengetahuan, angin puting beliung, tekanan, aliran gas

  11. PENGEMBANGAN PERANGKAT PEMBELAJARAN BIOLOGI BERBASIS METAKOGNITIF UNTUK MELATIHKAN KETERAMPILAN BERPIKIR REFLEKTIF SISWA SMA

    Directory of Open Access Journals (Sweden)

    Mochammad Yasir

    2015-09-01

    Full Text Available The aim of this research was to develop and implement biology learning materials based on metacognitive strategy. The learning material was developed by using 4-D model, including the Definition, Design, Develop phase, whereas the Disseminate phase was not conducted because this research is classified as the development research. This research was conducted in one of the senior high schools in East Java. Validating, observing, and giving questionnaire were implemented to collect various information during implementation of the learning materials. The findings from this research showed that the learning materials are valid, practical, and effective in empowering students both in terms of attention and learning outcomes. There were several obstacles occurred during the implementation of the learning materials, i.e. students were confused of new task and learning strategy and were not accostumed in correcting and acknowledged their own mistakes. Alternative solutions were given by providing guidance and information to students about learning using metacognitive strategy, so that students were expected to follow the learning with ease, as well as to train their reflective thinking skill and using an analogy which easier to understand. ABSTRAK Penelitian ini bertujuan untuk menghasilkan dan mengimplementasikan perangkat pembelajaran Biologi berbasis metakognitif. Pengembangan perangkat pembelajaran menggunakan model 4-D, meliputi tahap pendefinisian (Definition, perancangan (Design, dan pengembangan (Develop, sedangkan tahap penyebaran (Disseminate tidak dilakukan karena penelitian ini tergolong penelitian pengembangan. Penelitian dilakukan di salah satu Sekolah Menengah Atas (SMA Negeri di Jawa Timur. Observasi, angket, dan tes digunakan untuk mengumpulkan variasi informasi selama implementasi perangkat pembelajaran. Hasil penelitian menunjukkan perangkat pembelajaran ini valid, praktis, dan efektif untuk melatihkan keterampilan berpikir reflektif

  12. PENGEMBANGAN MODEL PEMBELAJARAN SEJARAH BERBASIS SITUS SEJARAH LOKAL DI SMA NEGERI KABUPATEN TEMANGGUNG

    Directory of Open Access Journals (Sweden)

    Iin Purnamasari

    2011-10-01

    kunci: belajar sejarah, situs sejarah, SMA  

  13. MODEL PENULISAN BUKU AJAR BIOLOGI SMA BERWAWASAN EKOLOGI DAN LOKAL UNTUK MENINGKATKAN KEPEDULIAN SISWA TERHADAP LINGKUNGAN

    Directory of Open Access Journals (Sweden)

    Achyani Achyani

    2010-05-01

    Full Text Available A study using Research and Development design was conducted to produce a model of Biology hand book writing which is ecology and local oriented as an effort to increase students’ care toward environment. The background of this research is the reality which is  still going on untill now that the awareness and care of the school graduatee toward the environement safety is still low. Besides, hard science instructional at school could not affect or intervene the graduatee’s characteristics, for instance in keeping the environment awareness. Meanwhile, there are many concepts of environment which had been taught through hard science especially biology, so in the researcher’s point of view, biology subject has strategic role to prevent or mitigate the environment disaster caused by human activities. The model was validated at beach  ecosystem. The analysis of the research result includes three aspects, namely: 1 text comprehension, 2 environment care attitude, and 3 handbook readibility. Based on the result of beach ecosystem data analysis, it was found that (1 there was a significant difference between experimental class and control class in the beach ecosystem which is shown by tcalculation > ttable (7.429 > 2.00; (2 there was strong correlation between students’ comprehension and attitude which is shown by coeficient correlation (r 0.634. While the text readability test (Cloze test shown  the readability of beach ecosystem text is 57,57% (moderate. Therefore, it can be concluded that all of the texts in the developed book are fit and proper for SMA students of grade X.   Kata kunci:  Penulisan buku ajar, orientasi ekologi dan lokal, kepedulian terhadap  lingkungan.

  14. A 1.3 mm SMA survey of 29 variable young stellar objects

    Science.gov (United States)

    Liu, Hauyu Baobab; Dunham, Michael M.; Pascucci, Ilaria; Bourke, Tyler L.; Hirano, Naomi; Longmore, Steven; Andrews, Sean; Carrasco-González, Carlos; Forbrich, Jan; Galván-Madrid, Roberto; Girart, Josep M.; Green, Joel D.; Juárez, Carmen; Kóspál, Ágnes; Manara, Carlo F.; Palau, Aina; Takami, Michihiro; Testi, Leonardo; Vorobyov, Eduard I.

    2018-04-01

    Context. Young stellar objects (YSOs) may undergo periods of active accretion (outbursts), during which the protostellar accretion rate is temporarily enhanced by a few orders of magnitude. Whether or not these accretion outburst YSOs possess similar dust and gas reservoirs to each other, and whether or not their dust and gas reservoirs are similar as quiescent YSOs, are issues yet to be clarified. Aims: The aim of this work is to characterize the millimeter thermal dust emission properties of a statistically significant sample of long and short duration accretion outburst YSOs (i.e., FUors and EXors) and the spectroscopically identified candidates of accretion outbursting YSOs (i.e., FUor-like objects). Methods: We have carried out extensive Submillimeter Array (SMA) observations mostly at 225 GHz (1.33 mm) and 272 GHz (1.10 mm), from 2008 to 2017. We covered accretion outburst YSOs located at database of 29 objects. We obtained 21 detections at >3σ significance. Detected sources except for the two cases of V883 Ori and NGC 2071 MM3 were observed with 1″ angular resolution. Overall our observed targets show a systematically higher millimeter luminosity distribution than those of the M* > 0.3 M⊙ Class II YSOs in the nearby (≲400 pc) low-mass star-forming molecular clouds (e.g., Taurus, Lupus, Upp Scorpio, and Chameleon I). In addition, at 1 mm our observed confirmed binaries or triple-system sources are systematically fainter than the rest of the sources even though their 1 mm fluxes are broadly distributed. We may have detected 30-60% millimeter flux variability from V2494 Cyg and V2495 Cyg, from the observations separated by approximately one year.

  15. Hubungan Antara Keterampilan Berpikir Rasional Siswa SMA dengan Hasil Belajar dalam Pembelajaran Kooperatif Menggunakan Constructive Feedback

    Directory of Open Access Journals (Sweden)

    Rahmi Zulva

    2016-04-01

    Full Text Available The aim of the study is to examine the connection between rational thinking skills of high school students with the results of cognitive learning in cooperative learning process by providing constructive feedback. In this study used a quasi experimental method to the design of the randomized pretest-posttest control group design. Before doing it, the treatment given is initial tests, and after treatment is given a final test. During the learning process observation occurs. The results showed that the relationship between rational thinking skills of students' cognitive learning outcomes of students after learning at the end of the experimental class there is a significant relationship, with a big increase learning outcomes for 0.551 of great value rational thinking skills. While in the control group there were no correlations. Tujuan dari penelitian ini untuk mengetahui besarnya hubungan antara keterampilan berpikir rasional siswa SMA dengan hasil belajar ranah kognitif dalam proses pembelajaran kooperatif dengan pemberian constructive feedback. Pada penelitian ini digunakan metode quasi eksperimen dengan desain the randomized pretest-posttest control group design. Sebelum melakukan traetment diberi tes awal dan setelah dilakukan treatment diberi tes akhir. Selama proses pembelajran berlangsung dilakukan observasi proses pembelajaran. Hasil penelitian menunjukkan bahwa hubungan antara keterampilan berpikir rasional siswa terhadap hasil belajar ranah kognitif siswa setelah akhir pembelajaran pada kelas eksperimen terdapat hubungan yang signifikan, dengan besarnya peningkatan hasil belajar sebesar 0,551 dari besar nilai keterampilan berpikir rasional . Sedangkan pada kelas kontrol tidak terdapat hubungan. Kata kunci: constructive feedback, hasil belajar ranah kognitif, keterampilan berpikir rasional

  16. Faktor-Faktor Hambatan Profesionalisasi Guru BK di SMA Negeri se- Kota Purwokerto

    Directory of Open Access Journals (Sweden)

    Cahya Dewi Rizkiwati

    2014-10-01

    Full Text Available Tujuan penelitian ini yaitu untuk mendeskripsikan tentang faktor-faktor hambatan yang terjadi dalam profesionalisasi guru BK. Jenis penelitian ini merupakan penelitian survey. Penelitian ini dilaksanakan di SMA Negeri se-Kota Purwokerto. Penelitian ini adalah penelitian populasi atau sensus karena populasi guru BK berjumlah 25 orang. Metode yang digunakan dalam penelitian ini adalah  inventori dalam bentuk daftar cek masalah. Instrumen tersebut telah diuji validitasnya menggunakan rumus point biserial, sedangkan reliabilitas instrumen digunakan rumus KR-20. Data yang telah diperoleh dianalisis dengan menggunakan teknik deskriptif prosentase. Hasil dari penelitian ini menunjukkan hambatan yang berasal dari faktor internal mendapat prosentase lebih tinggi daripada faktor eksternal. Faktor internal yang paling mempengaruhi profesionalisasi guru BK antara lain latar belakang pendidikan, pengalaman kerja, motivasi kerja, kompetensi guru BK. Sedangkan faktor eksternal yang paling mempengaruhi profesionalisasi guru BK adalah sarana dan prasarana. The purpose of this research is to describe problems  occur in the professionalization of guidance and counseling teachers. The type of the research is survey research . This research was conducted in all of Senior High School in Purwokerto. Population research or census were used as sampling method, since  the population of guidance and counseling teachers were 25 people. Data collection technique was  using inventory with list of issues. The instrument validity has been tested using point biserial formula, whilst its reliability was tested using KR-20 formula. The data was analyzed using descriptive percentage techniques. The results of this research indicate that internal factors get higher percentage than external factors. Internal factors that have the most influence in the professionalization of guidance and counseling teachers include educational background, working experience , motivation, teacher

  17. PENGEMBANGAN MODEL PEMBELAJARAN MEMBACA KRITIS TEKS ARGUMENTASI UNTUK SISWA KELAS X SMA/SMK

    Directory of Open Access Journals (Sweden)

    Anri Nofitria

    2017-10-01

    Full Text Available This development research can produce a Critical Reading model for argumentation text learning in class X SMA/SMK. The Critical Reading Model has nine stages, reading skimming; Make inquiries; Facts and opinions; Happy alignment; Main idea development framework; Tap refill content; Prevention of spelling errors, inaccurate choice of words, ineffectiveness of sentences, and inaccuracy of paragraph development; Conclude; And verification This development research uses the Dick and Carey procedures. The validation of the products carried out on three aspects, namely (a the feasibility of the concept of the model, (b the feasibility of the model steps, and (c the feasibility of the model on the level of understanding. Meanwhile, field testing was conducted to determine the feasibility and response of learners to the application of the model. Based on validation and field test results, it can be concluded that Critical Reading Model is suitable to be applied in learning to read critical argument text. Penelitian pengembangan ini dilaksanakan untuk menghasilkan model Membaca Kritis dalam pembelajaran teks argumentasi. Model Membaca Kritis memiliki sembilan tahap, yaitu (1 membaca skimming; (2 membuat pertanyaan; (3 mengidentifikasi fakta dan opini; (4 mengidentifikasi keselarasan; (5 mengidentifikasi pengembangan ide pokok; (6 mengidentifikasi ketepatan hubungan isi; (7 mengidentifikasi kesalahan ejaan, ketidaktepatan pilihan kata, dan ketidakefektifan kalimat, dan ketidaktepatan pengembangan paragraf; (8 menyimpulkan; (9 memverifikasi. Penelitian pengembangan ini menggunakan model Dick and Carey. Validasi produk yang dilakukan meliputi tiga aspek, yakni (a kelayakan konsep model, (b kelayakan langkah-langkah model, dan (c kelayakan model terhadap tingkat pemahaman. Sementara itu, uji coba produk dilakukan terhadap sembilan tahap model pembelajaran. Berdasarkan hasil validasi dan uji produk dapat disimpulkan bahwa model Membaca Kritis layak diterapkan

  18. PENGEMBANGAN PERANGKAT PEMBELAJARAN MATEMATIKA BERBASIS KONSTRUKTIVISME UNTUK MELATIH KEMAMPUANBERPIKIR KRITIS SISWA SMA KELAS X

    Directory of Open Access Journals (Sweden)

    Rini Herlina Rusiyanti

    2014-02-01

    Full Text Available Teaching learning process in math hasn’t been requiring student to construct their knowledge and to exercise their critical thinking. So need to develop constructivism instruction materials for exercise student’s ability in critical thinking. This research aim to: (1 Produce the valid and practice constructivism instruction materials to exercise student’s ability in critical learning, (2 Know effectiveness it to exercise student’s ability in critical learning. Instruction materials were developed in this research are plan learning, student worksheet and test of student’s ability in critical thinking. Development research methods are used by this research. The methods consist of analysis, design, evaluation and revision. Collecting data use Observation and test. Observation is used to know the student’s activity in teaching learning process and to know the teacher’s ability in learning constructivism approach management. Test is used to know the result of student’s ability in critical thinking after teaching learning process. Subjects in this research are students from the first semester in class X.7 at SMA Negeri 10, Palembang . The total subjects are 40 students. The conclusions are: 1. Instruction materials process development is for quadrate equivalence only that begins from analysis design, and than evaluation until revision. 2. Instruction materials prototype is develope, fulfill in valid and practice criteria also have effect potential. 3. Some aspects of student’s activity in learning process do not effective; because restructure (57.92 % and review (55.00 % just in enough category. The result learning test to evaluate student’s ability in critical thinking is 24.38. It means the student’s ability in critical thinking is good category. The final conclusion is constructivism instruction materials can practice to exercise student’s ability in critical thinking for math learning. Key words: critical thinking ability

  19. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0–64.0 μg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  20. Hypertonic sabouraud dextrose agar as a substrate for differentiation of Candida dubliniensis.

    Science.gov (United States)

    Akgül, Oncü; Cerikçioğlu, Nilgün

    2009-06-01

    In this study, we aimed to detect the proportion of Candida dubliniensis among yeast strains previously identified as C. albicans by using several phenotypic methods and PCR.For this purpose, we screened 300 strains by using phenotypic tests suggested for the identification of C. dubliniensis in the literature, but we detected high proportion of false-positive reactions. Only two strains (0.6%) were detected as true C. dubliniensis by PCR and API ID 32C methods. Moreover, these two strains gave the expected results with all the phenotypic tests, including modified salt tolerance test for C. dubliniensis.In conclusion, none of the phenotypic methods, except for the modified salt tolerance test, revealed 100% successful results in discrimination of C. albicans and C. dubliniensis species. However, in the tobacco agar test, the rate of false positivity was as low as 0.6%. We suggest that in the case of absence of PCR and other automatized identification systems, these two phenotypic tests can be used in routine laboratories to obtain a presumptive result.

  1. Internal properties assessment in agar wood trees using ultrasonic velocity measurement

    International Nuclear Information System (INIS)

    Mohd Noorul Ikhsan Mohamed; Mohamad Pauzi Ismail; Mat Rasol Awang; Mohd Fajri Osman; Fakhruzi, M.; Hashim, M.M.

    2010-01-01

    This paper presents the application of ultrasonic velocity in agar wood trees (Aquilaria crassna) with the purpose of evaluating the relationship of the ultrasonic velocity to the variations of internal properties of trees. In this study, three circular cross-sectional discs from the freshly cut tree were selected as samples. First sample with a big hole (decay) in the middle, second sample with internal resinous and the last one is the sample with no defects. The through transmission ultrasonic testing method was carried out using Tico ultrasonic pulse velocity tester which is from Switzerland. Two-dimensional image of internal properties evaluation by an ultrasonic investigation was obtained using Matlab. The results showed that the ultrasonic wave cannot pass through the internal decay or resinous so that the wave went round it and thus ultrasonic wave velocity significantly decreased by increasing the hole or resinous. The difference in color of the image generated by Matlab software based on variation of ultrasonic velocity between the internal decay area and its surrounding area was obvious. Therefore, the properties of internal properties of the three could be detected by ultrasonic line imaging technique. (author)

  2. Functional properties of edible agar-based and starch-based films for food quality preservation.

    Science.gov (United States)

    Phan, The D; Debeaufort, F; Luu, D; Voilley, A

    2005-02-23

    Edible films made of agar (AG), cassava starch (CAS), normal rice starch (NRS), and waxy (glutinous) rice starch (WRS) were elaborated and tested for a potential use as edible packaging or coating. Their water vapor permeabilities (WVP) were comparable with those of most of the polysaccharide-based films and with some protein-based films. Depending on the environmental moisture pressure, the WVP of the films varies and remains constant when the relative humidity (RH) is >84%. Equilibrium sorption isotherms of these films have been measured; the Guggenheim-Anderson-de Boer (GAB) model was used to describe the sorption isotherm and contributed to a better knowledge of hydration properties. Surface hydrophobicity and wettability of these films were also investigated using the sessile drop contact angle method. The results obtained suggested the migration of the lipid fraction toward evaporation surface during film drying. Among these polysaccharide-based films, AG-based film and CAS-based film displayed more interesting mechanical properties: they are transparent, clear, homogeneous, flexible, and easily handled. NRS- and WRS-based films were relatively brittle and have a low tension resistance. Microstructure of film cross section was observed by environmental scanning electron microscopy to better understand the effect of the structure on the functional properties. The results suggest that AG-based film and CAS-based films, which show better functional properties, are promising systems to be used as food packaging or coating instead of NRS- and WRS-based films.

  3. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  4. Acidity Tunable Ionic Liquids as Catalysts for Conversion of Agar into Mixed Sugars

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Churl; Kim, Hoon Sik [Kyung Hee Univ., Seoul (Korea, Republic of); Ryu, Hyun Jin; Kim, Sang Hyoun; Yoon, Jeong Jun; Kim, Yong Jin [Korea Institute of Industrial Technology, Cheonan (Korea, Republic of)

    2010-02-15

    To summarize, various factors affecting yields of Gal, AG, and 5-HMF formation during saccharification were investigated using agar as a substrate in the presence of several bisulfate-based acidic ionic liquids as catalysts. The result was compared with employing sulfuric acid from the viewpoint of sugar yields and 5-HMF formation. [Bmim][HSO{sub 4}], [Hmim][HSO{sub 4}], [Morph] [HSO{sub 4}], [Bu{sub 4}N][HSO{sub 4}], [Bu{sub 4}P][HSO{sub 4}], [Chol][HSO{sub 4}] showed moderate to high yields of Gal and AG with a remarkable decrease in 5-HMF formation compared with sulfuric acid. Among them, [Chol][HSO{sub 4}] ionic liquid was found to exhibit the highest yield of sugars with an acceptable concentration of 5-HMF that does not inhibit the fermentation process. Generally, there are five major bottom lines for a bioethanol process to be economically viable: the feedstock must be plentiful, inexpensive, in high energy conversion rate, in low demand for food industry, and finally, has to be cultivated in sustainable systems.

  5. Unraveling the nuclear and chloroplast genomes of an agar producing red macroalga, Gracilaria changii (Rhodophyta, Gracilariales).

    Science.gov (United States)

    Ho, Chai-Ling; Lee, Wei-Kang; Lim, Ee-Leen

    2018-03-01

    Agar and agarose have wide applications in food and pharmaceutical industries. Knowledge on the genome of red seaweeds that produce them is still lacking. To fill the gap in genome analyses of these red algae, we have sequenced the nuclear and organellar genomes of an agarophyte, Gracilaria changii. The partial nuclear genome sequence of G. changii has a total length of 35.8Mb with 10,912 predicted protein coding sequences. Only 39.4% predicted proteins were found to have significant matches to protein sequences in SwissProt. The chloroplast genome of G. changii is 183,855bp with a total of 201 open reading frames (ORFs), 29 tRNAs and 3 rRNAs predicted. Five genes: ssrA, leuC and leuD CP76_p173 (orf139) and pbsA were absent in the chloroplast genome of G. changii. The genome information is valuable in accelerating functional studies of individual genes and resolving evolutionary relationship of red seaweeds. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Comparison of three techniques for production goat lentivirus antigen used in the agar gel immunodifusion test

    Directory of Open Access Journals (Sweden)

    Raymundo Rizaldo Pinheiro

    2005-12-01

    Full Text Available The Caprine Arthritis Encephalitis (CAE is a disease who cause considerable economic losses, including loss in the milk production and reduction of the useful life of the animal. In the diagnosis of this disease the agar gel immunodifusion test (AGID is used worldwide as the selection test. The objective of thid work was to test three different concentrations of bovine fetal serum (BFS in the production of the antigen (Ag for the diagnosis of the CAE virus (CAEV, to verify amongst the three methods the most efficient concentration and which the antigen concentration of the antigen produced is appropriate for the test. The method of the AMICON and the concentration of the Ag for dialysis was indicated, however the system AMICON, despite the implantation costs, promoted minor loss of antigen, little time expense in the processing and greater simplicity. With relation to the amount of BFS placed after the viral inoculation it was verified that 5% of BFS the amount that presented better resulted. The antigen concentration 100 times was more indicated, therefore it allowed the diagnosis of the CAEV for two proteins (gp 135 and p28. The concentration of the Ag for precipitation/ultracentrifugation, used for imunoenzimatic tests, did not present resulted satisfactory used in the AGID.

  7. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2 μg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125 μg/mL for both antimicrobials. The MIC90 were 4 μg/mL and 2 μg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from São Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  8. Theoretical and experimental NMR studies on muscimol from fly agaric mushroom (Amanita muscaria)

    Science.gov (United States)

    Kupka, Teobald; Wieczorek, Piotr P.

    2016-01-01

    In this article we report results of combined theoretical and experimental NMR studies on muscimol, the bioactive alkaloid from fly agaric mushroom (Amanita muscaria). The assignment of 1H and 13C NMR spectra of muscimol in DMSO-d6 was supported by additional two-dimensional heteronuclear correlated spectra (2D NMR) and gauge independent atomic orbital (GIAO) NMR calculations using density functional theory (DFT). The effect of solvent in theoretical calculations was included via polarized continuum model (PCM) and the hybrid three-parameter B3LYP density functional in combination with 6-311++G(3df,2pd) basis set enabled calculation of reliable structures of non-ionized (neutral) molecule and its NH and zwitterionic forms in the gas phase, chloroform, DMSO and water. GIAO NMR calculations, using equilibrium and rovibrationally averaged geometry, at B3LYP/6-31G* and B3LYP/aug-cc-pVTZ-J levels of theory provided muscimol nuclear magnetic shieldings. The theoretical proton and carbon chemical shifts were critically compared with experimental NMR spectra measured in DMSO. Our results provide useful information on its structure in solution. We believe that such data could improve the understanding of basic features of muscimol at atomistic level and provide another tool in studies related to GABA analogs.

  9. [Variations in hyperbilirrubinemia in low birth weight newborns under phototherapy and continous or discontinous agar oral administration (author's transl)].

    Science.gov (United States)

    Colomer, J; Moya, M; Marco, V; De Paredes, C; Escrivá, F; Vila, R

    1975-06-01

    Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.

  10. Acquisition through Horizontal Gene Transfer of Plasmid pSMA198 by Streptococcus macedonicus ACA-DC 198 Points towards the Dairy Origin of the Species

    Science.gov (United States)

    Papadimitriou, Konstantinos; Anastasiou, Rania; Maistrou, Eleni; Plakas, Thomas; Papandreou, Nikos C.; Hamodrakas, Stavros J.; Ferreira, Stéphanie; Supply, Philip; Renault, Pierre; Pot, Bruno; Tsakalidou, Effie

    2015-01-01

    Background Streptococcus macedonicus is an intriguing streptococcal species whose most frequent source of isolation is fermented foods similarly to Streptococcus thermophilus. However, S. macedonicus is closely related to commensal opportunistic pathogens of the Streptococcus bovis/Streptococcus equinus complex. Methodology/Principal Findings We analyzed the pSMA198 plasmid isolated from the dairy strain Streptococcus macedonicus ACA-DC 198 in order to provide novel clues about the main ecological niche of this bacterium. pSMA198 belongs to the narrow host range pCI305/pWV02 family found primarily in lactococci and to the best of our knowledge it is the first such plasmid to be reported in streptococci. Comparative analysis of the pSMA198 sequence revealed a high degree of similarity with plasmids isolated from Lactococcus lactis strains deriving from milk or its products. Phylogenetic analysis of the pSMA198 Rep showed that the vast majority of closely related proteins derive from lactococcal dairy isolates. Additionally, cloning of the pSMA198 ori in L. lactis revealed a 100% stability of replication over 100 generations. Both pSMA198 and the chromosome of S. macedonicus exhibit a high percentage of potential pseudogenes, indicating that they have co-evolved under the same gene decay processes. We identified chromosomal regions in S. macedonicus that may have originated from pSMA198, also supporting a long co-existence of the two replicons. pSMA198 was also found in divergent biotypes of S. macedonicus and in strains isolated from dispersed geographic locations (e.g. Greece and Switzerland) showing that pSMA198’s acquisition is not a recent event. Conclusions/Significance Here we propose that S. macedonicus acquired plasmid pSMA198 from L. lactis via an ancestral genetic exchange event that took place most probably in milk or dairy products. We provide important evidence that point towards the dairy origin of this species. PMID:25584532

  11. SMA CARNIVAL TRIAL PART II: a prospective, single-armed trial of L-carnitine and valproic acid in ambulatory children with spinal muscular atrophy.

    Directory of Open Access Journals (Sweden)

    John T Kissel

    Full Text Available BACKGROUND: Multiple lines of evidence have suggested that valproic acid (VPA might benefit patients with spinal muscular atrophy (SMA. The SMA CARNIVAL TRIAL was a two part prospective trial to evaluate oral VPA and L-carnitine in SMA children. Part 1 targeted non-ambulatory children ages 2-8 in a 12 month cross over design. We report here Part 2, a twelve month prospective, open-label trial of VPA and L-carnitine in ambulatory SMA children. METHODS: This study involved 33 genetically proven type 3 SMA subjects ages 3-17 years. Subjects underwent two baseline assessments over 4-6 weeks and then were placed on VPA and L-carnitine for 12 months. Assessments were performed at baseline, 3, 6 and 12 months. Primary outcomes included safety, adverse events and the change at 6 and 12 months in motor function assessed using the Modified Hammersmith Functional Motor Scale Extend (MHFMS-Extend, timed motor tests and fine motor modules. Secondary outcomes included changes in ulnar compound muscle action potential amplitudes (CMAP, handheld dynamometry, pulmonary function, and Pediatric Quality of Life Inventory scores. RESULTS: Twenty-eight subjects completed the study. VPA and carnitine were generally well tolerated. Although adverse events occurred in 85% of subjects, they were usually mild and transient. Weight gain of 20% above body weight occurred in 17% of subjects. There was no significant change in any primary outcome at six or 12 months. Some pulmonary function measures showed improvement at one year as expected with normal growth. CMAP significantly improved suggesting a modest biologic effect not clinically meaningful. CONCLUSIONS: This study, coupled with the CARNIVAL Part 1 study, indicate that VPA is not effective in improving strength or function in SMA children. The outcomes used in this study are feasible and reliable, and can be employed in future trials in SMA. TRIAL REGSITRATION: Clinicaltrials.gov NCT00227266.

  12. The complete genome of Zunongwangia profunda SM-A87 reveals its adaptation to the deep-sea environment and ecological role in sedimentary organic nitrogen degradation

    Directory of Open Access Journals (Sweden)

    Zhou Bai-Cheng

    2010-04-01

    Full Text Available Abstract Background Zunongwangia profunda SM-A87, which was isolated from deep-sea sediment, is an aerobic, gram-negative bacterium that represents a new genus of Flavobacteriaceae. This is the first sequenced genome of a deep-sea bacterium from the phylum Bacteroidetes. Results The Z. profunda SM-A87 genome has a single 5 128 187-bp circular chromosome with no extrachromosomal elements and harbors 4 653 predicted protein-coding genes. SM-A87 produces a large amount of capsular polysaccharides and possesses two polysaccharide biosynthesis gene clusters. It has a total of 130 peptidases, 61 of which have signal peptides. In addition to extracellular peptidases, SM-A87 also has various extracellular enzymes for carbohydrate, lipid and DNA degradation. These extracellular enzymes suggest that the bacterium is able to hydrolyze organic materials in the sediment, especially carbohydrates and proteinaceous organic nitrogen. There are two clustered regularly interspaced short palindromic repeats in the genome, but their spacers do not match any sequences in the public sequence databases. SM-A87 is a moderate halophile. Our protein isoelectric point analysis indicates that extracellular proteins have lower predicted isoelectric points than intracellular proteins. SM-A87 accumulates organic osmolytes in the cell, so its extracelluar proteins are more halophilic than its intracellular proteins. Conclusion Here, we present the first complete genome of a deep-sea sedimentary bacterium from the phylum Bacteroidetes. The genome analysis shows that SM-A87 has some common features of deep-sea bacteria, as well as an important capacity to hydrolyze sedimentary organic nitrogen.

  13. Analysis of High Quality Agar wood Oil Chemical Compounds By Means Of SPME/ GC-MS and Z-Score Technique

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-γ-eudesmol, aromadendrene, β-agar ofuran, α-agar ofuran and γ-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)

  14. Equivalency testing of TTC Tergitol 7 agar (ISO 9308-1:2000) with five culture media for the detection of E. coli in water samples in Greece.

    Science.gov (United States)

    Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G

    2010-01-01

    In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.

  15. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  16. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  17. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    Science.gov (United States)

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  18. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  19. Preparation and application of agar/alginate/collagen ternary blend functional food packaging films.

    Science.gov (United States)

    Wang, Long-Feng; Rhim, Jong-Whan

    2015-09-01

    Ternary blend agar/alginate/collagen (A/A/C) hydrogel films with silver nanoparticles (AgNPs) and grapefruit seed extract (GSE) were prepared. Their performance properties, transparency, tensile strength (TS), water vapor permeability (WVP), water contact angle (CA), water swelling ratio (SR), water solubility (WS), and antimicrobial activity were determined. The A/A/C film was highly transparent, and both AgNPs and GSE incorporated blend films (A/A/C(AgNPs) and A/A/C(GSE)) exhibited UV-screening effect, especially, the A/A/C(GSE) film had high UV-screening effect without sacrificing the transmittance. In addition, the A/A/C blend films formed efficient hydrogel film with the water holding capacity of 23.6 times of their weight. Both A/A/C(AgNPs) and A/A/C(GSE) composite films exhibited strong antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli) food-borne pathogenic bacteria. The test results of fresh potatoes packaging revealed that all the A/A/C ternary blend films prevented forming of condensed water on the packaged film surface, both A/A/C(AgNPs) and A/A/C(GSE) composite films prevented greening of potatoes during storage. The results indicate that the ternary blend hydrogel films incorporated with AgNPs or GSE can be used not only as antifogging packaging films for highly respiring fresh agriculture produce, but also as an active food packaging system utilizing their strong antimicrobial activity. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Evaluation of semisolid agar method for antifungal susceptibility test of T. rubrum

    Directory of Open Access Journals (Sweden)

    Sultana Razia

    2016-08-01

    Full Text Available Background: With increasing fungal disease many newer antifungal drugs are available with different spectrum of activ­ity. Antifungal susceptibility test will help clinicians for selection of effective drug and thereby treatment of patient. Objective: The study was undertaken to perform a simple screening drug susceptibility test of T. rnbrum by Semi Solid Agar Antifungal Susceptibility (SAAS Method: Perfonnance of susceptibility method was assessed by comparing the MICs of three commonly prescribed antifungal agents namely- tluconazole (FCZ, itraconazole (ITZ and terbinafine (TER to the CLSI (Clinical and Laboratory Standard Institute recommended M-38, a broth microdilution method. Results: In SAAS method, among twenty nine T. rubrum, twenty five (86.2% were susceptible (MIC range 0.5-64 µg/ml to Fluconazole (FCZ and four (13.7% were resistant (MIC value >64 µg/ml. In broth microdilution method, among twenty nine T. rubrum, twenty six (89.6% were susceptible (MIC range 0.3-64 µg/ml to FCZ and three (10.3% were resistant (MIC value >64 µg/ml. In case of both ITZ and TER, all were susceptible (MIC range 0.3-64 µg/ml to both methods. The SAAS method demonstrated the susceptibility pattern of T. rubrum against FCZ, ITZ and TER usually within 72 to 96 hours after organism isolation and results were concordance with the results of CLSI broth microdilution method. Conclusion: Though it is a newer method with proper standardization of the test method, SAAS method is simple and easily applicable screening method for susceptibility testing of antifungal agents against dermatophytes in any microbiology laboratories.

  1. Perbedaan Cara Penyebaran Suspensi terhadap Jumlah Bakteri pada Media Eosin Methylene Blue Agar

    Directory of Open Access Journals (Sweden)

    Ahmad Nuzuludin Kadri

    2015-06-01

    Full Text Available Dalam rangka pengawasan mutu secara biologis dilakukan pengujian laboratorium untuk mengisolasi dan melakukan jumlah penghitungan jumlah bakteri patogen (enumerasi. Tujuan dari penelitian ini adalah untuk mengetahui perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok, mikropipet dan ose terhadap jumlah bakteri yang terhitung pada media Eosin Methylene Blue Agar. Sampel diambil dari air susu kambing yang kemudian dihitung jumlah bakteri-nya dengan tiga kelompok perlakuan yaitu menggunakan batang gelas bengkok, mikropipet dan ose. Data hasil penelitian dianalisis menggunakan sidik ragam, bila hasilnya berbeda nyata maka dilanjutkan dengan uji Duncan. Jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok, mikropipet dan ose per ml berturut-turut mengandung 9.722.222 cfu, 68.944.444 cfu dan 116.444.444 cfu. Dengan sidik ragam, perlakuan cara penyebaran dengan menggunakan mikropipet dan ose berbeda sangat nyata (P<0,01 terhadap jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok. Setelah di uji dengan uji Duncan, rata-rata jumlah bakteri yang terhitung dengan menggunakan mikropipet dan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan batang gelas bengkok, sedangkan rata-rata jumlah bakteri yang terhitung menggunakan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan mikropipet. Kesimpulan dari penelitian ini adalah terdapat perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok,mikropipet dan ose terhadap jumlah bakteri pada media EMBA. Penyebaran bakteri menggunakan ose lebih banyak (P<0,01 dibandingkan mikropipet dan batang gelas bengkok. Sedangkan penyebaran bakteri menggunakan mikropipet lebih banyak (P<0,01 dibandingkan dengan gelas bengkok.

  2. Halococcus agarilyticus sp. nov., an agar-degrading haloarchaeon isolated from commercial salt.

    Science.gov (United States)

    Minegishi, Hiroaki; Echigo, Akinobu; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Usami, Ron

    2015-05-01

    Two agar-degrading halophilic archaeal strains, 62 E(T) and 197 A, were isolated from commercial salt samples. Cells were non-motile cocci, approximately 1.2-2.0 µm in diameter and stained Gram-negative. Colonies were pink-pigmented. Strain 62 E(T) was able to grow with 24-30% (w/v) NaCl (optimum, 27%), at pH 6.5-8.5 (optimum, pH 7.5) and at 22-47 °C (optimum, 42 °C). The 16S rRNA gene sequences of strains 62 E(T) and 197 A were identical, and the level of DNA-DNA relatedness between them was 90 and 90% (reciprocally). The closest relative was Halococcus saccharolyticus JCM 8878(T) with 99.7% similarity in 16S rRNA orthologous gene sequences, followed by Halococcus salifodinae JCM 9578(T) (99.6%), while similarities with other species of the genus Halococcus were equal to or lower than 95.1%. The rpoB' gene tree strongly supported that the two strains were members of the genus Halococcus . Mean DNA-DNA relatedness between strain 62 E(T) and H. saccharolyticus JCM 8878(T) and H. salifodinae JCM 9578(T) was 46 and 44%, respectively. The major polar lipids were archaeol derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, derived from both C20C20 and C20C25 archaeol, and sulfated diglycosyl archaeol-1. Several unidentified glycolipids were present. Based on the phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halococcus , for which the name Halococcus agarilyticus sp. nov. is proposed. The type strain is 62 E(T) ( = JCM 19592(T) =KCTC 4143(T)). © 2015 IUMS.

  3. Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

    1969-07-15

    In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

  4. PENGARUH PEMBELAJARAN GEOGRAFI BERBASIS MASALAH DENGAN BLENDED LEARNING TERHADAP KEMAMPUAN BERPIKIR KRITIS SISWA SMA

    Directory of Open Access Journals (Sweden)

    Cindya Alfi

    2016-04-01

    pembelajaran tatap muka dan pembelajaran jarak jauh. Hal ini memberi keuntungan bagi siswa untuk mengulang ataupun bertanya tentang materi yang belum jelas sehingga memudahkan siswa untuk merencanakan, dan melaksanakan pembelajaran berbasis masalah. Penelitian ini bertujuan untuk mengetahui pengaruh penerapan pembelajaran Geografi berbasis masalah dengan blended learning terhadap kemampuan berpikir kritis siswa kelas XI IPS SMA Negeri 4 Malang. Hasil penelitian menunjukkan terdapat perbedaan yang signifikan antara nilai rata-rata kelas eksperimen dan kelas kontrol. Hasil uji hipotesis menunjukkan bahwa bahwa penerapan model pembelajaran Problem Based Learning berpengaruh terhadap kemampuan berpikir kritis siswa.

  5. KEEFEKTIFAN STRATEGI MODELING PARTISIPAN DALAM BANTUAN TEMAN SEBAYA (PEER HELPING UNTUK MENINGKATKAN KOMUNIKASI INTERPERSONAL SISWA SMA

    Directory of Open Access Journals (Sweden)

    Zeti Novitasari

    2017-03-01

    Full Text Available Interpersonal communication is one of important skills that should be owned by a student to reach success in the future. Thus, it is needed a proper strategy to improve students interpersonal communication.this study aims at knowing the effectivity 0f participant modelling strategy and covert modelling implemented in peer helping to improve interpersonal communication of senior high students. This study uses pretest and posttest control group design. Participant modeling strategy as experimental group and covert modeling as control group. Every experimental group and control group consist of six students who have low interpersonal communication. The instruments used are interpersonal communication scale, instruction of peer helping by using participant modelling strategy and covert modeling, reflexion sheet, and observation sheet. This study uses two kinds analysis, namely non parametric statistic test, two-independent sample Test-Mann-Whitney U and Wilcoxon test, an analysis to know the changing of each group. The result of study shows participant modeling strategy could improve students interpersonal communication. Komunikasi interpersonal merupakan salah satu ketrampilan yang sangat penting dimiliki oleh seorang pelajar untuk mencapai keberhasilan dalam aktivitas masa depan. Hal tersebut menyebabkan perlu strategi yang tepat untuk meningkatkan komunikasi interpersonal siswa. Tujuan penelitian ini adalah untuk mengetahui keefektifan strategi modeling partisipan dan covert modeling yang diimplementasi dalam bantuan teman sebaya untuk meningkatkan komunikasi interpersonal siswa SMA. Penelitian ini menggunakan rancangan adalah pretest and posttest control group design. Strategi modeling partisipan sebagai kelompok eksperimen dan covert modeling sebagai kelompok control. Setiap kelompok eksperimen dan control terdiri dari enam siswa yang terjaring memiliki komunikasi interpersonal rendah. Instrument yang digunakan adalah skala komunikasi

  6. Penerapan Teknik Analogi dalam Layanan Informasi untuk Meningkatkan Keterampilan Analitik Siswa SMA

    Directory of Open Access Journals (Sweden)

    Izaac Resley

    2017-07-01

    Full Text Available Students' analytic thinking skills through counseling services are essential. This ability is needed to solve the problems they face. Accordingly, an eclective model or method of counseling used to improve analytical skills is necessary. Technique analogies in information services can be used to improve students' analytic skills. The purpose of this research is to improve the information service process by practicing students' analytic skills. The research design uses PTK where the lecturer collaborates in research at the school where the BK teacher feels the problem in the information service he provides and then collaborates with the lecturer to solve it. The subjects of the study were students of class XI IPS1 SMA Negeri 5 Ambon as many as 35 people. The study was conducted in 2 cycles. Each cycle takes 4 meetings beyond the time used for pretest at the beginning of the first cycle, and 2 times the postes of analytic skill at once at the end of cycle I and again at the end of cycle II. This study uses a learning scenario as a guide for action implementation. The instruments used are service process observation sheets and inventory of analytic skills. The research produces qualitative and quantitative data analyzed by descriptive statistics and interpreted qualitatively. Research data is analyzed with three steps, namely: data reduction, data presentation, and decision making. The results show that the use of analogy techniques can be used in information services to improve students' analytic skills. Improved analytic thinking skills can be seen from the presence of students with low analytic skills in pre-cycle I tests increased in number on post cyclical I tests, and increased again at the post test cycle II. Such improvements occur also in students with analytic thinking skills are increasing in number to students with high analytic thinking skills when heading the cycle I test, and Cycle II postes. Based on the research findings, it is

  7. PENGEMBANGAN MEDIA PEMBELAJARAN KIMIA BERBASIS ANDROID UNTUK MENINGKATKAN MOTIVASI BELAJAR DAN PRESTASI KOGNITIF PESERTA DIDIK SMA

    Directory of Open Access Journals (Sweden)

    Isma Ramadhani Lubis

    2015-10-01

    Full Text Available Penelitian ini bertujuan untuk mengembangkan media pembelajaran kimia berbasis android dan mengetahui karakteristik, kualitas dan efektifitas dari media pembelajaran berbasis android. Jenis penelitian ini merupakan penelitian dan pengembangan. Penilaian produk dilakukan oleh ahli media, ahli materi, pendidik kimia, peer reviewers dan uji coba peserta didik. Data penelitian dikumpulkan melalui angket penilaian media, angket motivasi dan tes, kemudian dianalisis dengan Manova. Hasil dari penelitian ini adalah: (1 media pembelajaran kimia berbasis android memiliki karakteristik, yaitu visualisasi menarik, praktis dan fleksibel serta evaluasi soal yang variatif, (2 media pembelajaran kimia berbasis android dinilai layak digunakan dalam pembelajaran, ditinjau dari aspek materi, aspek media dan hasil uji coba peserta didik, serta (3 terdapat peningkatan yang signifikan antara motivasi belajar dan prestasi kognitif peserta didik yang mengikuti pembelajaran menggunakan media pembelajaran kimia berbasis android dengan pembelajaran konvensional. Hasil penelitian ini menunjukkan bahwa media pembelajaran kimia berbasis android layak dan efektif digunakan dalam pembelajaran kimia. Kata Kunci: pengembangan, media pembelajaran kimia berbasis android, motivasi, prestasi kognitif.   DEVELOPING ANDROID-BASED CHEMISTRY INSTRUCTIONAL MEDIA TO IMPROVE THE LEARNING MOTIVATION AND COGNITIVE ACHIEVEMENT OF SMA STUDENTS Abstract The aims of this study are: to develop android-based chemistry instructional media and to reveal the characteristic, the quality, and the effectiveness of android-based chemistry instructional media. This research was research and development. The product assessment was conducted by a media expert, a material expert, chemistry teachers peer reviewers and students. The data collecting technique was done by using media evaluation questionnaires, motivation questionnaire and test, then it was analysed by Manova. The results of the study show that

  8. PENGEMBANGAN BUKU PEDOMAN GURU PADA PEMBELAJARAN FISIKA SMA MENGGUNAKAN MODEL PROBLEM SOLVING LEVEL INKUIRI

    Directory of Open Access Journals (Sweden)

    Susi Fatikhah Setiyawati

    2015-10-01

    Full Text Available Penelitian ini bertujuan: (1 menghasilkan buku pedoman guru untuk pembelajaran fisika SMA menggunakan model problem solving sesuai level inkuiri yang layak digunakan; (2 mendeskripsikan keberhasilan pembelajaran fisika menggunakan model problem solving (MPS sesuai dengan level inkuiri sesuai dengan buku pedoman terhadap peningkatan aktivitas peserta didik dan kemampuan berpikir kritis peserta didik. Penelitian ini merupakan penelitian pengembangan, sesuai langkah yang dikembangkan oleh Borg & Gall. Subjek coba menggunakan delapan kelas. Pengumpulan data menggunakan angket respon peserta didik, lembar observasi keterlaksanaan proses pembelajaran, lembar observasi aktivitas belajar dan tes kemampuan berfikir kritis peserta didik. Teknik analisis data menggunakan uji multivariat (Manova. Hasil penelitian menunjukkan bahwa produk yang dikembangkan ditinjau dari aspek materi, petunjuk umum buku, RPP & LKPD, dan perangkat penilaiam pembelajaran menurut ahli materi dan ahli media berkategori baik dan terdapat perbedaan peningkatan kemampuan berfikir kritis dan aktivitas belajar peserta didik yang signifikan antara keenam level inkuiri yang diujicobakan. Kata Kunci: model problem solving, level inkuiri, kemampuan berfikir kritis, aktivitas belajar   DEVELOPING A HANDBOOK FOR TEACHER IN TEACHERS HIGH SCHOOL LEVEL PHYSICS USE THE MODEL OF PROBLEM SOLVING LEVEL OF INQUIRY Abstract This study aims to: (1 to produce a handbook for teachers high school level physics use a model of problem solving with level of inquiry fit for use; (2 to determine the successful learning of physics using a model of problem solving in accordance with the level of inquiry to increase learning activities of learners and critical thinking abilities of learners. This research is the development, which refers to measures developed by Borg & Gall. The subject try consists of eight classes. Data collection using the questionnaire responses of learners, observation sheets learning

  9. UV durable colour pigment doped SmA liquid crystal composites for outdoor trans-reflective bi-stable displays

    Science.gov (United States)

    Xu, H.; Davey, A. B.; Crossland, W. A.; Chu, D. P.

    2012-10-01

    High brightness trans-reflective bi-stable displays based on smectic A (SmA) liquid crystals (LCs) can have nearly perfect transparency in the clear state and very high reflection in the scattered state. Because the LC material in use is stable under UV radiation, this kind of displays can stand for strong day-light and therefore be ideal for outdoor applications from e-books to public signage and advertisement. However, the colour application has been limited because the traditional colourants in use are conventional dyes which are lack of UV stability and that their colours are easily photo bleached. Here we present a colour SmA display demonstrator using pigments as colourant. Mixing pigments with SmA LCs and maintain the desirable optical switching performance is not straightforward. We show here how it can be done, including how to obtain fine sized pigment nano-particles, the effects of particle size and size distribution on the display performance. Our optimized pigments/SmA compositions can be driven by a low frequency waveform (~101Hz) to a scattered state to exhibit colour while by a high frequency waveform (~103Hz) to a cleared state showing no colour. Finally, we will present its excellent UV life-time (at least <7.2 years) in comparison with that of dye composition (~2.4 years). The complex interaction of pigment nano-particles with LC molecules and the resulting effects on the LC electro-optical performances are still to be fully understood. We hope this work will not only demonstrate a new and practical approach for outdoor reflective colour displays but also provide a new material system for fundamental liquid crystal colloid research work.

  10. SU-F-J-10: Sliding Mode Control of a SMA Actuated Active Flexible Needle for Medical Procedures

    International Nuclear Information System (INIS)

    Podder, T

    2016-01-01

    Purpose: In medical interventional procedures such as brachytherapy, ablative therapies and biopsy precise steering and accurate placement of needles are very important for anatomical obstacle avoidance and accurate targeting. This study presents the efficacy of a sliding mode controller for Shape Memory Alloy (SMA) actuated flexible needle for medical procedures. Methods: Second order system dynamics of the SMA actuated active flexible needle was used for deriving the sliding mode control equations. Both proportional-integral-derivative (PID) and adaptive PID sliding mode control (APIDSMC) algorithms were developed and implemented. The flexible needle was attached at the end of a 6 DOF robotic system. Through LabView programming environment, the control commands were generated using the PID and APIDSMC algorithms. Experiments with artificial tissue mimicking phantom were performed to evaluate the performance of the controller. The actual needle tip position was obtained using an electromagnetic (EM) tracking sensor (Aurora, NDI, waterloo, Canada) at a sampling period of 1ms. During experiment, external disturbances were created applying force and thermal shock to investigate the robustness of the controllers. Results: The root mean square error (RMSE) values for APIDSMC and PID controllers were 0.75 mm and 0.92 mm, respectively, for sinusoidal reference input. In the presence of external disturbances, the APIDSMC controller showed much smoother and less overshooting response compared to that of the PID controller. Conclusion: Performance of the APIDSMC was superior to the PID controller. The APIDSMC was proved to be more effective controller in compensating the SMA uncertainties and external disturbances with clinically acceptable thresholds.

  11. SU-F-J-10: Sliding Mode Control of a SMA Actuated Active Flexible Needle for Medical Procedures

    Energy Technology Data Exchange (ETDEWEB)

    Podder, T [University Hospitals Case Medical Center, Cleveland, OH (United States)

    2016-06-15

    Purpose: In medical interventional procedures such as brachytherapy, ablative therapies and biopsy precise steering and accurate placement of needles are very important for anatomical obstacle avoidance and accurate targeting. This study presents the efficacy of a sliding mode controller for Shape Memory Alloy (SMA) actuated flexible needle for medical procedures. Methods: Second order system dynamics of the SMA actuated active flexible needle was used for deriving the sliding mode control equations. Both proportional-integral-derivative (PID) and adaptive PID sliding mode control (APIDSMC) algorithms were developed and implemented. The flexible needle was attached at the end of a 6 DOF robotic system. Through LabView programming environment, the control commands were generated using the PID and APIDSMC algorithms. Experiments with artificial tissue mimicking phantom were performed to evaluate the performance of the controller. The actual needle tip position was obtained using an electromagnetic (EM) tracking sensor (Aurora, NDI, waterloo, Canada) at a sampling period of 1ms. During experiment, external disturbances were created applying force and thermal shock to investigate the robustness of the controllers. Results: The root mean square error (RMSE) values for APIDSMC and PID controllers were 0.75 mm and 0.92 mm, respectively, for sinusoidal reference input. In the presence of external disturbances, the APIDSMC controller showed much smoother and less overshooting response compared to that of the PID controller. Conclusion: Performance of the APIDSMC was superior to the PID controller. The APIDSMC was proved to be more effective controller in compensating the SMA uncertainties and external disturbances with clinically acceptable thresholds.

  12. Teka-teki Unsur Kimia sebagai Media Pembelajaran Kimia Interaktif bagi siswa SMA Kelas X Berbasis Android

    Directory of Open Access Journals (Sweden)

    Isvandiari Fitri Utami

    2016-01-01

    Full Text Available Unsur kimia yang terdiri dari banyak unsur sering membuat siswa malas dengan mata pelajaran kimia khususnya dalam hal menghafal sistem periodik unsur kimia. Terkait dengan masalah ini, salah satu solusi yang ditawarkan adalah melalui media pembelajaran. Salah satu cara untuk membantu siswa melalui media pembelajaran dapat dilakukan dengan memanfaaatkan teknologi smartphone yang telah banyak dimiliki. Melihat banyaknya siswa yang telah menggunakan smartphone setiap harinya memungkinkan untuk memadukan kedua hal tersebut, sehingga siswa tidak hanya menggunakan smartphone sebagai sarana komunikasi, sosial media dan bermain game, tetapi dapat dialihkan menjadi sebuah inovasi positif dalam hal edukasi untuk menunjang sistem belajar yang interaktif. Tujuan dari penelitian ini adalah membuat aplikasi teka-teki unsur kimia sebagai media pembelajaran kimia interaktif bagi siswa SMA kelas X berbasis android. Salah satu manfaat dari penelitian ini adalah hasil penelitian dapat dijadikan rujukan bagi perkembangan dunia teknologi dan berguna juga untuk menjadi referensi bagi mahasiswa yang melakukan pengembangan produk teknologi khususnya mengenai media pembelajaran berbasis android. Dalam melakukan penelitian ini, aplikasi dibangun dengan menggunakan metode pengembangan multimedia development life cycle, data dan informasi mengenai unsur- unsur kimia dalam sistem periodik unsur diperoleh dari buku materi kimia SMA kelas X berdasarkan kurikulum 2006, beberapa jurnal, dan dari pengajar kimia untuk materi SMA kelas X secara langsung. Pada tahapan implementasi, program dibuat dengan drag and drop serta menggunakan bahasa pemrograman Javascript. Pengujian yang dilakukan pada aplikasi adalah dengan menggunakan metode whitebox. Berdasarkan hasil pengujian yang dilakukan pada aplikasi teka-teki unsur kimia sebagai media pembelajaran kimia interaktif berbasis aplikasi android, aplikasi sudah mampu berjalan cukup maksimal. Hasil pengujian mampu menampilkan

  13. SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

    Science.gov (United States)

    Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

    2017-12-18

    Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first

  14. PENGEMBANGAN MODEL COMPUTER-BASED E-LEARNING UNTUK MENINGKATKAN KEMAMPUAN HIGH ORDER MATHEMATICAL THINKING SISWA SMA

    OpenAIRE

    Jarnawi Afgani Dahlan; Yaya Sukjaya Kusumah; Mr Heri Sutarno

    2011-01-01

    The focus of this research is on the development of mathematics teaching and learning activity which is based on the application of computer software. The aim of research is as follows : 1) to identify some mathematics topics which feasible to be presented by computer-based e-learning, 2) design, develop, and implement computer-based e-learning on mathematics, and 3) analyze the impact of computer-based e-learning in the enhancement of SMA students’ high order mathematical thinking. All activ...

  15. PreSMA stimulation changes task-free functional connectivity in the fronto-basal-ganglia that correlates with response inhibition efficiency.

    Science.gov (United States)

    Xu, Benjamin; Sandrini, Marco; Wang, Wen-Tung; Smith, Jason F; Sarlls, Joelle E; Awosika, Oluwole; Butman, John A; Horwitz, Barry; Cohen, Leonardo G

    2016-09-01

    Previous work using transcranial magnetic stimulation (TMS) demonstrated that the right presupplementary motor area (preSMA), a node in the fronto-basal-ganglia network, is critical for response inhibition. However, TMS influences interconnected regions, raising the possibility of a link between the preSMA activity and the functional connectivity within the network. To understand this relationship, we applied single-pulse TMS to the right preSMA during functional magnetic resonance imaging when the subjects were at rest to examine changes in neural activity and functional connectivity within the network in relation to the efficiency of response inhibition evaluated with a stop-signal task. The results showed that preSMA-TMS increased activation in the right inferior-frontal cortex (rIFC) and basal ganglia and modulated their task-free functional connectivity. Both the TMS-induced changes in the basal-ganglia activation and the functional connectivity between rIFC and left striatum, and of the overall network correlated with the efficiency of response inhibition and with the white-matter microstructure along the preSMA-rIFC pathway. These results suggest that the task-free functional and structural connectivity between the rIFCop and basal ganglia are critical to the efficiency of response inhibition. Hum Brain Mapp 37:3236-3249, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Effect of EDTA on Pb(II) Uptake and Translocation by Tumbleweed (Salsola Kali): Agar and Hydroponics Studies

    Energy Technology Data Exchange (ETDEWEB)

    de la Rosa, Guadalupe; Gardea-Torresdey, Jorge L.; Peralta-Videa, Jose R.; Aldrich, Mary

    2004-03-31

    Environmental accumulation of Pb represents a worldwide health hazard. While conventional cleanup techniques are generally expensive and soil disturbing, phytoremediation represents an inexpensive friendly option for the removal of contaminants from soil and water. In this research, tumbleweed (Salsola kali) plants exposed for 15 days to Pb(NO3)2 at 80 and 125 ppm in hydroponics and agar media, demonstrated a high capacity to uptake lead. The results showed that the plants cultivated in agar accumulated 25563, 5534 and 2185 mg Pb kg-1 DW in roots, stems and leaves, respectively. Moreover, Pb concentrations found in hydroponically grown tumbleweed plants tissues were 30744, 1511 and 1421 mg kg-1 DW in roots, stems and leaves, respectively. It was observed that EDTA enhanced Pb translocation. No Pb phytotoxic effects were observed during the experimental time period. Cellular structural features were also observed using TEM.

  17. Microbial handflora of nursing services workers in a Nigerian ...

    African Journals Online (AJOL)

    The samples were inoculated onto dried Blood agar, MacConkey agar, Mannitol salt agar and Muellar-Hinton agar plates and incubated aerobically at 37°C for 18-24 hours. Overall, 38% of the cultures yielded growth, while 52% of the nurses yielded growth as against 75% of the ward-maids. The bacterial isolates are ...

  18. Variation in Microbial Identification System Accuracy for Yeast Identification Depending on Commercial Source of Sabouraud Dextrose Agar

    OpenAIRE

    Kellogg, James A.; Bankert, David A.; Chaturvedi, Vishnu

    1999-01-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc.) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system’s accuracy.

  19. Variation in Microbial Identification System accuracy for yeast identification depending on commercial source of Sabouraud dextrose agar.

    Science.gov (United States)

    Kellogg, J A; Bankert, D A; Chaturvedi, V

    1999-06-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc. ) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system's accuracy.

  20. Performance of Chromogenic Candida agar and CHROMagar Candida in recovery and presumptive identification of monofungal and polyfungal vaginal isolates.

    Science.gov (United States)

    Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan

    2010-02-01

    Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.

  1. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  2. Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface

    Science.gov (United States)

    Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan

    2016-01-01

    The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.

  3. Irradiation of silver and agar/silver nanoparticles with argon, oxygen glow discharge plasma, and mercury lamp.

    Science.gov (United States)

    Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R

    2014-01-01

    The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.

  4. Isolation of nontuberculous mycobacteria from soil using Middlebrook 7H10 agar with increased malachite green concentration.

    Science.gov (United States)

    Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican

    2017-12-01

    Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.

  5. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    Science.gov (United States)

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  6. Evaluation of Permanent Deformation of CRM-Reinforced SMA and Its Correlation with Dynamic Stiffness and Dynamic Creep

    Directory of Open Access Journals (Sweden)

    Nuha Salim Mashaan

    2013-01-01

    Full Text Available Today, rapid economic and industrial growth generates increasing amounts of waste materials such as waste tyre rubber. Attempts to inspire a green technology which is more environmentally friendly that can produce economic value are a major consideration in the utilization of waste materials. The aim of this study is to evaluate the effect of waste tyre rubber (crumb rubber modifier (CRM, in stone mastic asphalt (SMA 20 performance. The virgin bitumen (80/100 penetration grade was used, modified with crumb rubber at four different modification levels, namely, 6%, 12%, 16%, and 20% by weight of the bitumen. The testing undertaken on the asphalt mix comprises the indirect tensile (dynamic stiffness, dynamic creep, and wheel tracking tests. By the experimentation, the appropriate amount of CRM was found to be 16% by weight of bitumen. The results show that the addition of CRM into the mixture has an obvious significant effect on the performance properties of SMA which could improve the mixture's resistance against permanent deformation. Further, higher correlation coefficient was obtained between the rut depth and permanent strain as compared to resilient modulus; thus dynamic creep test might be a more reliable test in evaluating the rut resistance of asphalt mixture.

  7. HUBUNGAN PENGETAHUAN REMAJA TENTANG KESEHATAN REPRODUKSIDENGAN SIKAP TERHADAP SEKS BEBAS DI SMA NEGERI 1 SEDAYU BANTUL YOGYAKARTA

    Directory of Open Access Journals (Sweden)

    Umi Latifah

    2015-08-01

    Full Text Available Background:Adolescence isa periodof transition fromchildhood toadulthood.Adolescence tendtowantto learnnew thingssotheyappear towant to be doublebehavior, one of which is illicit sex. Based onpreliminary studiesconducted inSMAN1Sedayuobtained informationsome students donot understandthe impact of freesex.Theyalso lackknowledgeabout reproductive health. Objectives:Thepurposeof thisstudi todeterminetherelationshipbetween the level of knowledgeaboutadolescent reproductivehealthattitudes towardsex inSMA N 1SedayuBantul Yogyakarta.Methods : The method in this research is descriptive analytic with cross sectional approach.Sampleswere takenwithquotasampling technique in which168 students aged16-18years inSMAN1Sedayu.The research instrument was a questionnaireand the results wereanalyzedby Kendall Taucorrelation formula. Results : The level of knowledge about adolescent reproductive health inSMAN1SedayuBantulmostlywellas78students(46.4%.Attitudes towardsex inSMA 1SedayuBantul Yogyakarta Sedayumostlypositiveasmanyas133 students(79.2%. Theresultsof thecorrelation test of Kendall Tauobtained p-valueof 0,000<(0,05.Conclusion : There is a significant relationship between the level of knowledge about adolescentreproductivehealthattitudes toward sex inSMAN1SedayuBantul, Yogyakarta.

  8. Epithelial Markers aSMA, Krt14, and Krt19 Unveil Elements of Murine Lacrimal Gland Morphogenesis and Maturation.

    Science.gov (United States)

    Kuony, Alison; Michon, Frederic

    2017-01-01

    As an element of the lacrimal apparatus, the lacrimal gland (LG) produces the aqueous part of the tear film, which protects the eye surface. Therefore, a defective LG can lead to serious eyesight impairment. Up to now, little is known about LG morphogenesis and subsequent maturation. In this study, we delineated elements of the cellular and molecular events involved in LG formation by using three epithelial markers, namely aSMA, Krt14, and Krt19. While aSMA marked a restricted epithelial population of the terminal end buds (TEBs) in the forming LG, Krt14 was found in the whole embryonic LG epithelial basal cell layer. Interestingly, Krt19 specifically labeled the presumptive ductal domain and subsequently, the luminal cell layer. By combining these markers, the Fucci reporter mouse strain and genetic fate mapping of the Krt14 + population, we demonstrated that LG epithelium expansion is fuelled by a patterned cell proliferation, and to a lesser extent by epithelial reorganization and possible mesenchymal-to-epithelial transition. We pointed out that this epithelial reorganization, which is associated with apoptosis, regulated the lumen formation. Finally, we showed that the inhibition of Notch signaling prevented the ductal identity from setting, and led to a LG covered by ectopic TEBs. Taken together our results bring a deeper understanding on LG morphogenesis, epithelial domain identity, and organ expansion.

  9. Evaluation of permanent deformation of CRM-reinforced SMA and its correlation with dynamic stiffness and dynamic creep.

    Science.gov (United States)

    Mashaan, Nuha Salim; Karim, Mohamed Rehan

    2013-01-01

    Today, rapid economic and industrial growth generates increasing amounts of waste materials such as waste tyre rubber. Attempts to inspire a green technology which is more environmentally friendly that can produce economic value are a major consideration in the utilization of waste materials. The aim of this study is to evaluate the effect of waste tyre rubber (crumb rubber modifier (CRM)), in stone mastic asphalt (SMA 20) performance. The virgin bitumen (80/100) penetration grade was used, modified with crumb rubber at four different modification levels, namely, 6%, 12%, 16%, and 20% by weight of the bitumen. The testing undertaken on the asphalt mix comprises the indirect tensile (dynamic stiffness), dynamic creep, and wheel tracking tests. By the experimentation, the appropriate amount of CRM was found to be 16% by weight of bitumen. The results show that the addition of CRM into the mixture has an obvious significant effect on the performance properties of SMA which could improve the mixture's resistance against permanent deformation. Further, higher correlation coefficient was obtained between the rut depth and permanent strain as compared to resilient modulus; thus dynamic creep test might be a more reliable test in evaluating the rut resistance of asphalt mixture.

  10. PENGARUH PENERAPAN BELAJAR MANDIRI PADA MATERI EKOSISTEM TERHADAP KETERAMPILAN BERPIKIR KRITIS DAN KEMAMPUAN MEMECAHKAN MASALAH SISWA SMA DI KOTA METRO

    Directory of Open Access Journals (Sweden)

    Anak Agung Oka

    2010-11-01

    Full Text Available The objective of this research was to know the effect of  alone learning to the critical thinking skill and problem solving ability in SMA Teladan 1 Metro. This research applied quasy experimental with non-equvalent control group design. The population of this research is allow students of class X SMA Teladan 1 Metro on academic year 2009/2010. The samples of this research were class XA as experimental (alone learning and class XB as control (conventional. The instrument of this research namely critical thinking and problem solving test. This research data are quantitative data consisted by score capacity critical thinking and problem solving ability to river ecosystem, collected on 15 january until 12 Juni 2010. Data were analysed by bilinear covariant statistical analysis (Ancova, continued with LSD test. The result of this research indicated that there were an effect of alone learning strategy toward the critical thinking skill and problem solving ability. Student with alone learning strategy having critical thinking higher 80,111% than conventional learning. Beside, student with alone learning strategy having 11,124% higher than convensional learning. Based on this research, the researcher suggest to the teacher that this strategy can implemented in biology learning.   Kata Kunci: Belajar Mandiri, Keterampilan Berpikir Kritis, Kemampuan Memecahkan Masalah.

  11. Soft and smart modular structures actuated by shape memory alloy (SMA) wires as tentacles of soft robots

    Science.gov (United States)

    Jin, Hu; Dong, Erbao; Xu, Min; Liu, Chunshan; Alici, Gursel; Jie, Yang

    2016-08-01

    This paper introduces the design and fabrication of a multi-layered smart modular structure (SMS) that has been inspired by the muscular organs and modularity in soft animals. The SMS is capable of planar reciprocal motion of bending in heating process and recovering in cooling process when SMA wires carry out phase transformation. An adaptive regulation heating strategy is applied to avoid overheating and achieve bending range control of the SMS based on the resistance feedback of the SMA wires which as actuator of the SMS. The SMS can modular assemble soft robots with multiple morphologies such as lateral robots, bilateral robots and actinomorphic robots. A five-armed actinomorphic soft robot is conducted to crawling in terrestrial ground (max speed: 140 mm s-1, 0.7 body s-1), swimming in underwater environment (max speed: 67 mm s-1, 2.5 height s-1) and griping fragile objects (max object weight: 0.91 kg, 15 times the weight of itself). Those demonstrate that the performance of the SMS is good enough to be modular units to establish soft robots which possess a high speed of response, good adaptability and a safe interaction with their environments.

  12. PERAN GURU PENJASORKES DALAM MENGATASI KENAKALAN SISWA (STUDI KASUS DI SMA NEGERI SE-KABUPATEN KENDAL TAHUN 2013

    Directory of Open Access Journals (Sweden)

    Irkham Kharisma

    2015-06-01

    Full Text Available The purpose of this study to determine, describe, and analyze the role of teachers in addressing student misbehavior penjasorkes Public High School students in Kendal. This study used qualitative methods, the location of the research conducted in SMA se-Kendal. Research subjects in this study were penjasorkes teacher, principal, BK teachers and students. Data collected by using observation, interviews and documentation. The validity of using triangulation source. Data analysis using descriptive analysis model according to Miles and Huberman. Based on the results of research conducted and has been linked with the theory Suparwoto, et al. It can be concluded that the role of teachers penjasorkes (1 in terms of preventive prevent student misbehavior is good. (2 is good in terms of repression. (3 in terms of curative and rehabilitation are good. The conclusions that can be drawn from this research is the teacher's role in addressing delinquency penjasorkes students in SMA se-Kendal has been running both in terms of preventive, repressive and curative or rehabilitation.

  13. PENINGKATAN KEMAMPUAN BERPIKIR KRITIS DAN KETERAMPILAN PROSES SAINS SISWA SMA MELALUI IMPLEMENTASI PROBLEM BASED LEARNING DIPADU THINK PAIR SHARE

    Directory of Open Access Journals (Sweden)

    Abu Husen

    2017-06-01

    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  14. ANALISIS KELAYAKAN ISI BUKU TEKS MATA PELAJARAN EKONOMI SMA KELAS X BERDASARKAN KURIKULUM TINGKAT SATAUAN PENDIDIKAN ( KTSP DI KABUPATEN SEMARANG

    Directory of Open Access Journals (Sweden)

    Koeri Ulinuha

    2016-02-01

    Full Text Available Tujuan penelitian ini adalah untuk mengetahui apakah buku teks ekonomi SMA kelas X yang digunakan di Kabupaten Semarang sudah memenuhi standar kelayakan isi buku teks ekonomi menurut BSNP. Dan manfaat penelitian ini dapat memilih dan mempertimbankan dalam memilih buku teks pelajaran untuk refrensi belajar baik pihak siswa, guru dan pihak sekolahPenelitian ini dilakuakan terhadap isi buku teks pelajaran yang dianalisis secara kualitatif. Sehingga penelitian ini disebut penelitian deskriptif kualitatif. Teknik penelitian yang di gunakan adalah adalah teknik triangulasi. Analisis buku teks ekonomi untuk SMA kelas X melibatkan 5 orang penilai, yaitu 5 guru ekonomi. Dari 5 SMAN yang mengunakan buku teks pelajaran ekonomi dengan pengarang Alam S. dan penerbit Esis. Teknik pengumpulan data dengan lembar penilaian buku teks ekonomi dari BSNP dan menggunakan teknik wawancara terhadap dua guru ekonomi untuk memperkuat hasil dari penilaian dari buku teks ekonomi kelas X.Data yang diperoleh dalam penelitian ini berupa hasil penilaian yang berupa skor penilian dan hasil wawancara. Berdasarkan hasil analisis dapat disimpulkan bahwa buku ekonomi SMA Kelas X karangan Alam S. yang digunakan di Kabupaten Semarang sudah memenuhi standar kelayakan isi menurut BSNP. Buku teks ekonomi untuk SMA Kelas X karangan Alam S. dapat digunakan sebagai sumber belajar dalam pembelajaran ekonomi di SMA kelas X. Selain itu, perlu diadakan penelitian lebih lanjut untuk menganalisis buku teks ekonomi lain yang digunakan di Kabupaten Semarang.. The purpose of this research was to know whether textbooks high school economics class X used in Semarang Regancy already meet the standards of eligibility of the contents of the textbook economics according to BSNP. Analysis of economic text books for high school classes X involves 5 persons appraisers, i.e. 5 economics teacher. From 5 SMAN using textbook economics lessons with author and Publisher Alam S. Esis.. Data collection techniques

  15. Research on Candida dubliniensis in a Brazilian yeast collection obtained from cardiac transplant, tuberculosis, and HIV-positive patients, and evaluation of phenotypic tests using agar screening methods.

    Science.gov (United States)

    Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso

    2011-09-01

    The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 °C; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 °C. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation

    DEFF Research Database (Denmark)

    Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf

    2002-01-01

    trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...

  17. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  18. Enumerating actinomycetes in compost bioaerosols at source—Use of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 °C and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  19. High internal phase agar hydrogel dispersions in cocoa butter and chocolate as a route towards reducing fat content.

    Science.gov (United States)

    Skelhon, Thomas S; Olsson, Patrik K A; Morgan, Adam R; Bon, Stefan A F

    2013-09-01

    Reducing the fat content of chocolate formulations is a major challenge for the confectionery industry. We report the suspension of aqueous microgel agar particles of up to 80% v/v within sunflower oil, cocoa butter, and ultimately chocolate. The optimised emulsification process involves a shear-cooling step. We demonstrate the versatility of our method when applied to white, milk, and dark chocolate formulations, whilst preserving the desired polymorph V of the cocoa butter matrix. In addition, we show that this technology can be used as a strategy to disperse alcoholic beverages into chocolate confectionery.

  20. A Direct Quantitative Agar-Plate Based Assay for Analysis of Pseudomonas protegens PF-5 Degradation of Polyurethane Films (Postprint)

    Science.gov (United States)

    2014-10-02

    was dissolved in methanol ; Irogran (1 g) was dissolved in 25 mL THF; and AS-P108 was prepared by adding 0.3 g of catalyst to 10 g of resin and then... Selected results are in Supple- mental Information. 3. Results 3.1. General growth characteristics of Pf-5 on M9/citrate agar plates Dilutions of P...minimal. An IR map with the color scale corresponding to the in- tensity of the 1735 cm1 carbonyl absorbance from the urethane and ester components is