Sterilization of MacConkey agar and CLED medium by gamma-radiation
Energy Technology Data Exchange (ETDEWEB)
Bogokowsky, B; Eisenberg, E; Altmann, G
1983-10-01
MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.
Sterilization of MacConkey agar and CLED medium by. gamma. -radiation
Energy Technology Data Exchange (ETDEWEB)
Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center
1983-10-01
MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.
Czech Academy of Sciences Publication Activity Database
Šplíchalová, Alla; Šplíchal, Igor; Sonnenborn, U.; Rada, V.
2014-01-01
Roč. 103, SEP 2014 (2014), s. 82-86 ISSN 0167-7012 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : MacConkey agar * E. coil O55 * NTEC Subject RIV: CE - Biochemistry Impact factor: 2.026, year: 2014
Grabow, W. O. K.; Hilner, C. A.; Coubrough, P.
1981-01-01
MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtai...
Grabow, W O; Hilner, C A; Coubrough, P
1981-08-01
MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtainable, easy to prepare and handle, and yielded clearly recognizable fecal coliform colonies. Identification of 1,139 fecal coliform isolates showed that fecal coliform tests cannot be used to enumerate Escherichia coli because the incidence of E. coli among fecal coliforms varied from an average of 51% for river water to 93% for an activated sludge effluent after chlorination. The incidence of Klebsiella pneumoniae among fecal coliforms varied from an average of 4% for the activated sludge effluent after chlorination to 32% for the river water. The advantages of a standard membrane filtration procedure for routine counting of fecal coliforms in water using M-FC agar without rosolic acid as growth medium, in the absence of preincubation or resuscitation steps, are outlined.
Sistem Informasi Akademik pada SMA Hang Tuah Belawan
Tanjung, Dini Syahroni
2015-01-01
Informasi yang disampaikan oleh SMA HANG TUAH BELAWAN selama ini disebarkan melalui brosur dan cara yang seperti itu kurang efektif. Oleh karena itu dibuatlah sistem informasi akademik ini agar penyampaian informasinya lebih efektif dan efisien. 092406181
Role of pH in oxidase variability of Aeromonas hydrophila.
Hunt, L K; Overman, T L; Otero, R B
1981-01-01
Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...
Directory of Open Access Journals (Sweden)
Maria Alfonsa Chintia Dea Prananingrum
2017-05-01
Full Text Available Abstrak SMA PL Don Bosko Semarang belum dapat memanfaatkan teknologi komputer secara optimal karena masih menggunakan cara manual dalam pengelolaan berbagai macam data akademik sehingga memberikan masalah seperti lambatnya dalam pembuatan laporan yang menyulitkan kepala sekolah dalam pengambilan keputusan. Oleh sebab itu, SMA PL Don Bosko Semarang membutuhkan Sistem Informasi Akademik untuk memberikan kemudahan dalam mengelola berbagai macam data akademik secara terintegrasi serta memberikan layanan yang lebih baik kepada siswanya. Sebuah model architecture enterprise Sistem Informasi Akademik dibutuhkan agar meminimalisir kegagalan ketika menerapkan sistem tersebut sekaligus dapat berjalan sesuai kebutuhan di SMA PL Don Bosko Semarang. Metode analisis dalam penelitian ini menggunakan Framework Zachman yang memberikan pondasi dalam membantu menyediakan struktur dasar organisasi sehingga dapat mendukung perancangan dan pengembangan sistem informasi suatu organisasi. Hasil dari penelitian ini berupa blueprint (cetak biru pemodelan Sistem Informasi Akademik. Kata kunci— sistem informasi akademik, architecture enterprise, framework zachman, bluprint
Nutcracker and SMA syndromes: What is the normal SMA angle in children?
Energy Technology Data Exchange (ETDEWEB)
Arthurs, O.J., E-mail: oja20@owenarthurs.co.uk [Department of Radiology, Box 219, Addenbrooke' s Hospital, Cambridge University Teaching Hospitals NHS Foundation Trust, Hills Road, Cambridge, CB2 0QQ (United Kingdom); Mehta, U. [Department of Radiology, Box 219, Addenbrooke' s Hospital, Cambridge University Teaching Hospitals NHS Foundation Trust, Hills Road, Cambridge, CB2 0QQ (United Kingdom); Set, P.A.K., E-mail: p.set@addenbrookes.nhs.uk [Department of Radiology, Box 219, Addenbrooke' s Hospital, Cambridge University Teaching Hospitals NHS Foundation Trust, Hills Road, Cambridge, CB2 0QQ (United Kingdom)
2012-08-15
Objective: The nutcracker and superior mesenteric artery (SMA) syndromes are rare conditions where the left renal vein or duodenum may be compressed by an unusually acute angle between the SMA and aorta, although the normal angle in children is unknown. We measured the SMA angle to define the normal range in children. Methods: We retrospectively measured SMA angles, left renal vein (LRV) distance, and duodenal distance (DD) in 205 consecutive pediatric abdominal CT. Total and visceral intra-abdominal fat at the level of the umbilicus were also assessed. Results: Mean SMA angle was 45.6 {+-} 19.6 Degree-Sign (range 10.6-112.9 Degree-Sign ), mean LRV distance was 8.6 {+-} 3.9 mm (range 2.0-28.6 mm) and mean DD was 11.3 {+-} 4.8 mm (range 3.6-35.3 mm). There was a significant but weak correlation between %visceral fat volume (%VF) and SMA angle (R = 0.30; p < 0.001), LRV distance (R = 0.37, p < 0.001) and DD (R = 0.32; p < 0.001). Conclusion: There is a wide range of SMA angle, LRV and DD in normal children, which correlated weakly with visceral fat volume. Using a definition of SMA angle <25 Degree-Sign would diagnose 9.3% of asymptomatic children with nutcracker syndrome, and using a DD definition of <8 mm would diagnose 20% with SMA compression. Our findings suggest exercising caution when attributing these rare syndromes to an absolute SMA angle.
Nutcracker and SMA syndromes: What is the normal SMA angle in children?
International Nuclear Information System (INIS)
Arthurs, O.J.; Mehta, U.; Set, P.A.K.
2012-01-01
Objective: The nutcracker and superior mesenteric artery (SMA) syndromes are rare conditions where the left renal vein or duodenum may be compressed by an unusually acute angle between the SMA and aorta, although the normal angle in children is unknown. We measured the SMA angle to define the normal range in children. Methods: We retrospectively measured SMA angles, left renal vein (LRV) distance, and duodenal distance (DD) in 205 consecutive pediatric abdominal CT. Total and visceral intra-abdominal fat at the level of the umbilicus were also assessed. Results: Mean SMA angle was 45.6 ± 19.6° (range 10.6–112.9°), mean LRV distance was 8.6 ± 3.9 mm (range 2.0–28.6 mm) and mean DD was 11.3 ± 4.8 mm (range 3.6–35.3 mm). There was a significant but weak correlation between %visceral fat volume (%VF) and SMA angle (R = 0.30; p < 0.001), LRV distance (R = 0.37, p < 0.001) and DD (R = 0.32; p < 0.001). Conclusion: There is a wide range of SMA angle, LRV and DD in normal children, which correlated weakly with visceral fat volume. Using a definition of SMA angle <25° would diagnose 9.3% of asymptomatic children with nutcracker syndrome, and using a DD definition of <8 mm would diagnose 20% with SMA compression. Our findings suggest exercising caution when attributing these rare syndromes to an absolute SMA angle.
Incidence of bacteraemia following teeth extraction at the dental ...
African Journals Online (AJOL)
STORAGESEVER
2008-05-16
May 16, 2008 ... genital or acquired heart disease, or those fitted with a valvular prosthesis ... ments published reports on the prevalence, aetiologic agents and risk ... cultured onto plates of blood agar, chocolate agar and MacConkey agar.
DEFF Research Database (Denmark)
Wasyl, Dariusz; Hasman, Henrik; Cavaco, Lina
2012-01-01
The prevalence of Escherichia coli with putative extended-spectrum cephalosporin resistance was assessed in cattle, pigs, broilers, layers, and turkey slaughtered in Poland. The occurrence of random E. coli isolates recovered from MacConkey agar plates with non–wild-type minimal inhibitory...... concentrations for cefotaxime and ceftazidime reached 0.6% in layers, 2.3% in turkey, and 4.7% in broilers, whereas all cattle and pigs isolates fell into the wild-type subpopulation. The use of MacConkey agar supplemented with cefotaxime (2 mg/L) increased the recovery of resistant strains up to 33...
Bacteriology of chronic discharging ears in Port Harcourt, Nigeria ...
African Journals Online (AJOL)
Methods: Ear swabs of discharging ears aseptically collected from 102 patients of various age groups attending Ear, Nose, and Throat out-patient clinic at University of Port Harcourt Teaching Hospital were cultured for bacterial agents using blood agar, chocolate agar and MacConkey agar. Culture plates were incubated ...
Microbial handflora of nursing services workers in a Nigerian ...
African Journals Online (AJOL)
The samples were inoculated onto dried Blood agar, MacConkey agar, Mannitol salt agar and Muellar-Hinton agar plates and incubated aerobically at 37°C for 18-24 hours. Overall, 38% of the cultures yielded growth, while 52% of the nurses yielded growth as against 75% of the ward-maids. The bacterial isolates are ...
Isolation and molecular identification of a Serratia strain from ...
African Journals Online (AJOL)
ONOS
2010-04-05
Apr 5, 2010 ... family Tupaiidae, mainly found in Southern China, India and Southeast Asia. The 17 known species of tree shrews ... for pathogenic coccus cultivation and nutrient agar culture dish and. MacConkey agar for pathogenic rod ...
Joshi, K R; Solanki, A; Prakash, P
1993-01-01
A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.
Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation
Energy Technology Data Exchange (ETDEWEB)
Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at
2016-09-01
Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.
Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation
International Nuclear Information System (INIS)
Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo
2016-01-01
Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.
African Journals Online (AJOL)
DELL
various selective media such as MacConkey agar, mannitol salt agar .... Yemen. Journal of Pharmacy and. Pharmacognosy Research.3(1), 6 – 12. Amira, E. E., Abdel, M. E. S. ... of Natural and Social Sciences.2: 54 – 59. Ferreria, A. C., Morais ...
How do SMA-linked mutations of SMN1 lead to structural/functional deficiency of the SMA protein?
Directory of Open Access Journals (Sweden)
Wei Li
Full Text Available Spinal muscular atrophy (SMA is an autosomal recessive neuromuscular disease with dysfunctional α-motor neurons in the anterior horn of the spinal cord. SMA is caused by loss (∼95% of SMA cases or mutation (∼5% of SMA cases of the survival motor neuron 1 gene SMN1. As the product of SMN1, SMN is a component of the SMN complex, and is also involved in the biosynthesis of the small nuclear ribonucleoproteins (snRNPs, which play critical roles in pre-mRNA splicing in the pathogenesis of SMA. To investigate how SMA-linked mutations of SMN1 lead to structural/functional deficiency of SMN, a set of computational analysis of SMN-related structures were conducted and are described in this article. Of extraordinary interest, the structural analysis highlights three SMN residues (Asp44, Glu134 and Gln136 with SMA-linked missense mutations, which cause disruptions of electrostatic interactions for Asp44, Glu134 and Gln136, and result in three functionally deficient SMA-linked SMN mutants, Asp44Val, Glu134Lys and Gln136Glu. From the computational analysis, it is also possible that SMN's Lys45 and Asp36 act as two electrostatic clips at the SMN-Gemin2 complex structure interface.
Biopreservative activity of lactic acid bacteria on suya produced from ...
African Journals Online (AJOL)
STORAGESEVER
2008-10-20
Oct 20, 2008 ... MRS (pH 5.5) for LAB, potato dextrose agar (PDA) for yeast/mould,. MacConkey agar for coliforms and mannitol salt agar for Staphylo- coccus. The cultures were incubated for 48 h with the exception of yeast and mould (72 h). For FFA determination 5 g of each suya sample was comminuted and the lipid ...
Characteristics Analysis and Testing of SMA Spring Actuator
Directory of Open Access Journals (Sweden)
Jianzuo Ma
2013-01-01
Full Text Available The biasing form two-way shape memory alloy (SMA actuator composed of SMA spring and steel spring is analyzed. Based on the force equilibrium equation, the relationship between load capacity of SMA spring and geometric parameters is established. In order to obtain the characteristics of SMA spring actuator, the output force and output displacement of SMA spring under different temperatures are analyzed by the theoretical model and the experimental method. Based on the shape memory effect of SMA, the relationship of the SMA spring actuator's output displacement with the temperature, the stress and strain, the material parameters, and the size parameters is established. The results indicate that the trend of theoretical results is basically consistent with the experimental data. The output displacement of SMA spring actuator is increased with the increasing temperature.
Mastitis pathogens prevalent in dairy cattle at Magadu farm ...
African Journals Online (AJOL)
This study was carried out to determine the prevalence of mastitis pathogens at the Magadu Dairy Farm, Sokoine University of Agriculture. A total of 19 milk samples were collected and cultured on blood agar and MacConkey agar followed by identification of bacteria colonies and cells using standard laboratory techniques.
Micromechanical analysis of porous SMA
International Nuclear Information System (INIS)
Sepe, V; Marfia, S; Sacco, E; Auricchio, F
2015-01-01
The present paper deals with computational micromechanical analyses of porous shape memory alloy (SMA). Porous SMAs are considered composite materials made of a dense SMA matrix including voids. A three-dimensional constitutive law is presented for the dense SMA able to reproduce the pseudo-elastic as well as the shape memory effects and, moreover, to account for the different elastic properties of the austenite and martensite phases. Furthermore, a numerical procedure is developed and the overall behavior of the porous SMA is recovered studying a representative volume element. Comparisons between the numerical results, recovered using the proposed modeling, and experimental data available in the literature are presented. The case of closed and open porosity is investigated. Parametric studies have been conducted in order to investigate the influence of the porosity, the shape and orientation of the pores on the overall mechanical response and, mainly, on the energy absorption dissipation capability. (paper)
Swainsbury, David J K; Scheidelaar, Stefan; Foster, Nicholas; van Grondelle, Rienk; Killian, J Antoinette; Jones, Michael R
2017-10-01
Solubilisation of biological lipid bilayer membranes for analysis of their protein complement has traditionally been carried out using detergents, but there is increasing interest in the use of amphiphilic copolymers such as styrene maleic acid (SMA) for the solubilisation, purification and characterisation of integral membrane proteins in the form of protein/lipid nanodiscs. Here we survey the effectiveness of various commercially-available formulations of the SMA copolymer in solubilising Rhodobacter sphaeroides reaction centres (RCs) from photosynthetic membranes. We find that formulations of SMA with a 2:1 or 3:1 ratio of styrene to maleic acid are almost as effective as detergent in solubilising RCs, with the best solubilisation by short chain variants (membranes was uniformly low, but could be increased through a variety of treatments to increase the lipid:protein ratio. However, proteins isolated from such membranes comprised clusters of complexes in small membrane patches rather than individual proteins. We conclude that short-chain 2:1 and 3:1 formulations of SMA are the most effective in solubilising integral membrane proteins, but that solubilisation efficiencies are strongly influenced by the size of the target protein and the density of packing of proteins in the membrane. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Evaluation for sterility of four crystalloid solutions used in ...
African Journals Online (AJOL)
Pre and post preservation, a loop-full of each solution was cultured on freshly prepared two general purpose media (Blood and nutrient agar) and one selective medium (MacConkey agar). They were incubated at 37 0C for 48 hours after which they were examined for bacterial growth. Histological studies of the preserved ...
Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent
International Nuclear Information System (INIS)
Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.
2006-01-01
Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)
African Journals Online (AJOL)
2013-06-22
Jun 22, 2013 ... onto blood, MacConkey, and Mannitol salt agar plates and incubated for 18-24 hrs at ... standard 0.5 and spread over the surface of. Mueller-Hinton agar. Antibiotic .... Table 3. Comparison of infection rate in emergency and elective Caesarean Operation in patients at MMSH, Kano. X2 = 8.1 df = 1 p<0.004.
A fatal pulmonary infection by Nocardia brasiliensis.
Wadhwa, V; Rai, S; Kharbanda, P; Kabra, S; Gur, R; Sharma, V K
2006-01-01
The reported case is of primary pulmonary nocardiosis, caused by Nocardia brasiliensis, in a immunocompromised patient, which ended fatally despite appropriate treatment. The partially acid fast filamentous bacterium was predominant on direct examination of the sputum. It was cultured on blood agar, MacConkey agar and by paraffin baiting technique. The bacterium was resistant to cotrimoxazole, the drug of choice for nocardiosis.
SMA DOE Student Fellowship Initiative
Energy Technology Data Exchange (ETDEWEB)
Steel Manufacturers Association
2004-12-24
Steel companies in many areas of the country have found it increasingly difficult to attract talented recent graduates of college and university engineering and applied science programs to the Electric Arc Furnace iron & steel industry. College student involvement in co-operative programs at steel companies can attract needed talent to the industry. Additionally, certain R & D needs identified in the Steel Industry Technology Roadmap are addressed as co-operative program activities. The Steel Manufacturers Association (''SMA'') therefore established a co-operative education program for selected college students who have completed the first or second year of a four or five-year college program, to be recognized as SMA Co-Operative Fellows, in regard to their summer and fall semester projects with SMA's member companies.
Asymptomatic Vaginal Disease In Pregnancy
African Journals Online (AJOL)
1974-04-17
Apr 17, 1974 ... Eight patients (1,4%) had asymptomatic gonorrhoea. Clinical features ... MacConkey's agar (for identification of Escherichia coli,. Proteus and other .... Another interesting observation was the error in the clinical diagnosis of ...
International Nuclear Information System (INIS)
Rehse, Steven J.; Diedrich, Jonathan; Palchaudhuri, Sunil
2007-01-01
Pseudomonas aeruginosa bacteria colonies have been analyzed by laser-induced breakdown spectroscopy using nanosecond laser pulses. LIBS spectra were obtained after transferring the bacteria from a nutrient-rich culture medium to a nutrient-free agar plate for laser ablation. To study the dependence of the LIBS spectrum on growth and environmental conditions, colonies were cultured on three different nutrient media: a trypticase soy agar (TSA) plate, a blood agar plate, and a medium chosen deliberately to induce bacteria membrane changes, a MacConkey agar plate containing bile salts. Nineteen atomic and ionic emission lines in the LIBS spectrum, which was dominated by inorganic elements such as calcium, magnesium and sodium, were used to identify and classify the bacteria. A discriminant function analysis was used to discriminate between the P. aeruginosa bacteria and two strains of E. coli: a non-pathogenic environmental strain and the pathogenic strain enterohemorrhagic E. coli 0157:H7 (EHEC). Nearly identical spectra were obtained from P. aeruginosa grown on the TSA plate and the blood agar plate, while the bacteria grown on the MacConkey plate exhibited easily distinguishable differences from the other two. All P. aeruginosa samples, independent of initial growth conditions, were readily discriminated from the two E. coli strains
Micropipette Deflection Measurements of Agar-Glass Adhesion
Parg, Richard; Shelton, Erin; Dutcher, John
Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.
Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K
2014-01-01
The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.
Design of shape memory alloy (SMA) actuators
Rao, Ashwin; Reddy, J N
2015-01-01
This short monograph presents an analysis and design methodology for shape memory alloy (SMA) components such as wires, beams, and springs for different applications. The solid-solid, diffusionless phase transformations in thermally responsive SMA allows them to demonstrate unique characteristics like superelasticity and shape memory effects. The combined sensing and actuating capabilities of such materials allows them to provide a system level response by combining multiple functions in a single material system. In SMA, the combined mechanical and thermal loading effects influence the functionality of such materials. The aim of this book is to make the analysis of these materials accessible to designers by developing a "strength of materials" approach to the analysis and design of such SMA components inspired from their various applications with a review of various factors influencing the design process for such materials.
A fatal pulmonary infection by Nocardia brasiliensis
Directory of Open Access Journals (Sweden)
Wadhwa V
2006-01-01
Full Text Available The reported case is of primary pulmonary nocardiosis, caused by Nocardia brasiliensis , in a immunocompromised patient, which ended fatally despite appropriate treatment. The partially acid fast filamentous bacterium was predominant on direct examination of the sputum. It was cultured on blood agar, MacConkey agar and by paraffin baiting technique. The bacterium was resistant to cotrimoxazole, the drug of choice for nocardiosis.
Inoculation Expedition of Agar wood
International Nuclear Information System (INIS)
Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria
2015-01-01
Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)
African Journals Online (AJOL)
pond was drained and left empty for two weeks to dry and then lime was added .... using inoculating wire loop and cultured on Blood and MacConkey agar and ... and temperate zones causing Ichthyophthiriasis or 'white spot disease' (Scholz,.
Investigation on low velocity impact resistance of SMA composite material
Hu, Dianyin; Zhang, Long; Wang, Rongqiao; Zhang, Xiaoyong
2016-04-01
A method to improve low velocity impact resistance of aeroengine composite casing using shape memory alloy's properties of shape memory(SM) and super-elasticity(SE) is proposed in this study. Firstly, a numerical modeling of SMA reinforced composite laminate under low velocity impact load with impact velocity of 10 m/s is established based on its constitutive model implemented by the VUMAT subroutine of commercial software ABAQUS. Secondly, the responses of SMA composite laminate including stress and deflection distributions were achieved through transient analysis under low velocity impact load. Numerical results show that both peak stress and deflection values of SMA composite laminate are less than that without SMA, which proves that embedding SMA into the composite structure can effectively improve the low velocity impact performance of composite structure. Finally, the influence of SM and SE on low velocity impact resistance is quantitatively investigated. The values of peak stress and deflection of SMA composite based on SM property decrease by 18.28% and 9.43% respectively, compared with those without SMA, instead of 12.87% and 5.19% based on SE. In conclusion, this proposed model described the impact damage of SMA composite structure and turned to be a more beneficial method to enhance the impact resistance by utilizing SM effect.
Indian Academy of Sciences (India)
Abasaheb Garware College,. Karve Road .... students and teachers goes, that other things are not to be taught. In effect the ... different that I had to say - I don't know. Probably ... MacConkey's agar, they prepared whatever they thought suited.
Directory of Open Access Journals (Sweden)
Lydia Ninan Lestario
2015-02-01
jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna
Tensile and fatigue behavior of polymer composites reinforced with superelastic SMA strands
Daghash, Sherif M.; Ozbulut, Osman E.
2018-06-01
This study explores the use of superelastic shape memory alloy (SMA) strands, which consist of seven individual small-diameter wires, in an epoxy matrix and characterizes the tensile and fatigue responses of the developed SMA/epoxy composites. Using a vacuum assisted hand lay-up technique, twelve SMA fiber reinforced polymer (FRP) specimens were fabricated. The developed SMA-FRP composites had a fiber volume ratio of 50%. Tensile response of SMA-FRP specimens were characterized under both monotonic loading and increasing amplitude loading and unloading cycles. The degradation in superelastic properties of the developed SMA-FRP composites during fatigue loading at different strain amplitudes was investigated. The effect of loading rate on the fatigue response of SMA-FRP composites was also explored. In addition, fractured specimens were examined using the scanning electron microscopy (SEM) technique to study the failure mechanisms of the tested specimens. A good interfacial bonding between the SMA strands and epoxy matrix was observed. The developed SMA-FRP composites exhibited good superelastic behavior at different strain amplitudes up to at least 800 cycle after which significant degradation occurred.
Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton
Directory of Open Access Journals (Sweden)
Margaret Ordoñez Smith de Danies
1993-12-01
Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.
DEFF Research Database (Denmark)
Literak, I.; Dolejska, Monika; Radimersky, T.
2010-01-01
Aims: To determine the presence of antibiotic-resistant faecal Escherichia coli in populations of wild mammals in the Czech Republic and Slovakia. Methods and Results: Rectal swabs or faeces collected during 2006-2008 from wild mammals were spread on MacConkey agar and MacConkey agar containing 2...... mg l-1 of cefotaxime. From plates with positive growth, one isolate was recovered and identified as E. coli. Susceptibility to 12 antibiotics was tested using the disk diffusion method. Resistance genes, class 1 and 2 integrons and gene cassettes were detected in resistant isolates by polymerase...... of resistant isolates was 6%. Class 1 and 2 integrons with various gene cassettes were recorded in resistant isolates. From wild boars, five (2%, n(rectal smears) = 293) multiresistant isolates producing ESBL were recovered: one isolate with bla(CTX-M-1) + bla(TEM-1), three with bla(CTX-M-1) and one with bla...
Microbial status of smoked fish, scombia scombia sold in Owerri, Imo ...
African Journals Online (AJOL)
These were analyzed microbiologically for viable heterotrophic bacteria and fungi count on Nutrient and Potato dextrose agar respectively, using pour plate method and coliform count in MacConkey broth by multiple tube method (MPN). The mean value ... Key words: Bacteria, Yeast, Mould, Smoked fish, Contamination.
Directory of Open Access Journals (Sweden)
Lusila Andriani Purwastuti
2017-09-01
Full Text Available This study aimed at describing the national education ideology as the orientation of the school culture development policy at SMA N 1 and SMAN 3 Yogyakarta. This research employed the qualitative approach through ethnography method. The subjects of the research were the school community. The object was the implementation of Pancasila on the development of the school culture. The data were collected through interviews, observations, and documentation. The data were analyzed using ethnography analysis as suggested by Spradley and they were validated by data triangulation and member checks. The results show that the national education ideology as the orientation of the school culture development is understood: (1 as an open ideology; (2 implemented on the basis value; instrumental values; the value of practices in the school culture; (3 The school culture in SMA N 1 and SMA N 3 is the implementation and contextualization of the values of Pancasila, along with the uniqueness of SMA N 1 with its “Teladan” icon which represents the religious morality and intellectual, as well as at SMA N 3 with its “Padmanaba” icon representing noble behavior. (4 Both schools have developed the school culture, namely: religious morality, social-culture, intellectual, and environment/management/leadership.
Dynamics study of free volume properties of SMA/SMMA blends by PAL method
International Nuclear Information System (INIS)
Jiang, Z.Y.; Jiang, X.Q.; Huang, Y.J.; Lin, J.; Li, S.M.; Li, S.Z.; Hsia, Y.F.
2006-01-01
Miscibility of poly(styrene-co-maleic anhydride) (containing 7 wt% maleic anhydride)/poly(styrene-co-methyl methacrylate) (containing 40 wt% styrene) blends were previously studied. It was obtained that SMA70 (containing 70 wt% of SMA in SMA/SMMA blends) is miscible in molecular level but SMA20 is not. In this paper, the two blends selected were used to investigate the temperature dependence of free volume parameters. It showed there are different deviations of free volume parameters in SMA20 and SMA70, and it was interesting that temperature dependence of ortho-positronium lifetime τ 3 of the SMA20 mixture exhibits two breaks in the range temperature from 90 deg. C to 120 deg. C, which revealed that the mixture has two glass transition ranges. Also, ortho-positronium lifetime τ 3 of the SMA20 mixture is nearly constant in the temperature range from 130 deg. C to 160 deg. C. These indicated that SMA20 blend is phase-separated in room temperature and become miscible above 130 deg. C, which may be due to steric hindrance effect of phenyl rings of SMMA and SMA. From the deviation of o-Ps lifetimes of SMA70, the single glass transition temperature of SMA70 blend was shown. Combining the previous study, it was further concluded that PAL method seems to be a powerful method to detect in situ phase behavior of immiscible polymer blends and glass transition of miscible polymer blends
Adaptive and energy efficient SMA-based handling systems
Motzki, P.; Kunze, J.; Holz, B.; York, A.; Seelecke, S.
2015-04-01
Shape Memory Alloys (SMA's) are known as actuators with very high energy density. This fact allows for the construction of very light weight and energy-efficient systems. In the field of material handling and automated assembly process, the avoidance of big moments of inertia in robots and kinematic units is essential. High inertial forces require bigger and stronger robot actuators and thus higher energy consumption and costs. For material handling in assembly processes, many different individual grippers for various work piece geometries are used. If one robot has to handle different work pieces, the gripper has to be exchanged and the assembly process is interrupted, which results in higher costs. In this paper, the advantages of using high energy density Shape Memory Alloy actuators in applications of material-handling and gripping-technology are explored. In particular, light-weight SMA actuated prototypes of an adaptive end-effector and a vacuum-gripper are constructed via rapid-prototyping and evaluated. The adaptive end-effector can change its configuration according to the work piece geometry and allows the handling of multiple different shaped objects without exchanging gripper tooling. SMA wires are used to move four independent arms, each arm adds one degree of freedom to the kinematic unit. At the tips of these end-effector arms, SMA-activated suction cups can be installed. The suction cup prototypes are developed separately. The flexible membranes of these suction cups are pulled up by SMA wires and thus a vacuum is created between the membrane and the work piece surface. The self-sensing ability of the SMA wires are used in both prototypes for monitoring their actuation.
Energy-dissipating and self-repairing SMA-ECC composite material system
International Nuclear Information System (INIS)
Li, Xiaopeng; Li, Mo; Song, Gangbing
2015-01-01
Structural component ductility and energy dissipation capacity are crucial factors for achieving reinforced concrete structures more resistant to dynamic loading such as earthquakes. Furthermore, limiting post-event residual damage and deformation allows for immediate re-operation or minimal repairs. These desirable characteristics for structural ‘resilience’, however, present significant challenges due to the brittle nature of concrete, its deformation incompatibility with ductile steel, and the plastic yielding of steel reinforcement. Here, we developed a new composite material system that integrates the unique ductile feature of engineered cementitious composites (ECC) with superelastic shape memory alloy (SMA). In contrast to steel reinforced concrete (RC) and SMA reinforced concrete (SMA-RC), the SMA-ECC beams studied in this research exhibited extraordinary energy dissipation capacity, minimal residual deformation, and full self-recovery of damage under cyclic flexural loading. We found that the tensile strain capacity of ECC, tailored up to 5.5% in this study, allows it to work compatibly with superelastic SMA. Furthermore, the distributed microcracking damage mechanism in ECC is critical for sufficient and reliable recovery of damage upon unloading. This research demonstrates the potential of SMA-ECC for improving resilience of concrete structures under extreme hazard events. (paper)
Numerical tool for SMA material simulation: application to composite structure design
International Nuclear Information System (INIS)
Chemisky, Yves; Tahiri, Vanessa; Duval, Arnaud; Piotrowski, Boris; Ben Zineb, Tarak; Patoor, Etienne
2009-01-01
Composite materials based on shape memory alloys (SMA) have received growing attention over these last few years. In this paper, two particular morphologies of composites are studied. The first one is an SMA/elastomer composite in which a snake-like wire NiTi SMA is embedded into an elastomer ribbon. The second one is a commercial Ni 47 Ti 44 Nb 9 which presents elastic–plastic inclusions in an NiTi SMA matrix. In both cases, the design of such composites required the development of an SMA design tool, based on a macroscopic 3D constitutive law for NiTi alloys. Two different strategies are then applied to compute these composite behaviors. For the SMA/elastomer composite, the macroscopic behavior law is implemented in commercial FEM software, and for the Ni 47 Ti 44 Nb 9 a scale transition approach based on the Mori–Tanaka scheme is developed. In both cases, simulations are compared to experimental data
MODEL EVALUASI INTERNAL KOMPETENSI GURU BAHASA INGGRIS (MODEL_EIKGBI) SMA
Sahraini Sahraini; Suwarsih Madya
2015-01-01
Studi ini bertujuan untuk: (1) mengembangkan model evaluasi kompetensi guru bahasa Inggris SMA yang dapat digunakan untuk mengidentifikasi kelebihan dan kekurangan guru dalam proses pemelajaran dan (2) mengetahui efektivitas implementasi evaluasi internal kompetensi guru bahasa Inggris SMA. Studi ini menggunakan metode penelitian dan pengembangan yang dikembangkan oleh Borg & Gall (1983, p.775). Subjek penelitian berjumlah 17 guru yang berasal dari 7 SMA di Sulawesi Selatan. Konstruk instrume...
Brown, B. J.; Leff, L. G.
1996-01-01
Aquatic bacteria grown on MacConkey agar and modified nutrient agar were identified by using API 20E and NFT strips and fatty acid methyl ester (FAME) analysis. Identifications agreed at the species level 35.7% of the time when API 20E strips and FAME analysis were used and in 4.3% of the cases when API NFT strips and FAME analysis were used. These techniques require further development before extended use in ecological studies.
Fabricating Composite-Material Structures Containing SMA Ribbons
Turner, Travis L.; Cano, Roberto J.; Lach, Cynthia L.
2003-01-01
An improved method of designing and fabricating laminated composite-material (matrix/fiber) structures containing embedded shape-memory-alloy (SMA) actuators has been devised. Structures made by this method have repeatable, predictable properties, and fabrication processes can readily be automated. Such structures, denoted as shape-memory-alloy hybrid composite (SMAHC) structures, have been investigated for their potential to satisfy requirements to control the shapes or thermoelastic responses of themselves or of other structures into which they might be incorporated, or to control noise and vibrations. Much of the prior work on SMAHC structures has involved the use SMA wires embedded within matrices or within sleeves through parent structures. The disadvantages of using SMA wires as the embedded actuators include (1) complexity of fabrication procedures because of the relatively large numbers of actuators usually needed; (2) sensitivity to actuator/ matrix interface flaws because voids can be of significant size, relative to wires; (3) relatively high rates of breakage of actuators during curing of matrix materials because of sensitivity to stress concentrations at mechanical restraints; and (4) difficulty of achieving desirable overall volume fractions of SMA wires when trying to optimize the integration of the wires by placing them in selected layers only.
KESULITAN PEMECAHAN MASALAH FISIKA PADA SISWA SMA
Directory of Open Access Journals (Sweden)
Rismatul Azizah
2015-12-01
Full Text Available Telah dilakukan penelitian untuk mengidentifikasi kesulitan pemecahan masalah fisika pada siswa SMA. Penelitian ini menggunakan metode survey dengan menyebarkan angket. Responden terdiri dari 120 siswa yang berasal dari 3 sekolah yaitu, SMA Negeri 1 Bangil, SMA Negeri 8 Malang, dan SMA YADIKA Bangil. Dilakukan pula wawancara pada beberapa guru dan siswa. Berdasarkan hasil penyebaran angket, diperoleh 26% siswa mengalami kesulitan pada materi Suhu dan Kalor, 25% Optik, 21% Fluida Statik, 17% Elastisitas dan Hukum Hooke, dan 11% Kinematika. Kesulitan tersebut salah satunya disebabkan pembelajaran bagi siswa yang kurang maksimal dalam bentuk hands on activity. Sebanyak 88% siswa mengatakan bahwa pembelajaran fisika yang sering dialami adalah dengan metode ceramah. Siswa mengalami kesulitan belajar fisika dalam menyelesaikan permasalahan pada soal sebesar 32%, kesulitan memahami konsep dan rumus 26%, kesulitan menggunakan persamaan atau rumus dalam soal 18%, kesulitan menganalisis grafik dan gambar 17%, dan kesulitan menyimpulkan materi yang telah dipelajari 7%. Kesulitan tersebut terlihat ketika siswa memecahkan permasalahan pada soal kinematika serta suhu dan kalor. Diperoleh dari hasil angket, bahwa 76% siswa mengalami kesulitan dalam memecahkan permasalahan pada soal dengan alasan lupa atau tidak paham, sebesar 19% siswa kurang memahami solusi pemecahan masalah pada soal, dan hanya sebesar 5% siswa mampu memecahkan permasalahan pada soal.
Feasibility study of an active soft catheter actuated by SMA wires
Konh, Bardia; Karimi, Saeed; Miller, Scott
2018-03-01
This study aims to assess the feasibility of using a combination of thin elastomer tubes and SMA wires to develop an active catheter. Cardiac catheters have been widely used in investigational and interventional procedures such as angiography, angioplasty, electro- physiology, and endocardial ablation. The commercial models manually steer inside the patient's body via internally installed pull wires. Active catheters, on the other hand, have the potential to revolutionize surgical procedures because of their computer-controlled and enhanced motion. Shape memory alloys have been used for almost a decade as a trustworthy actuator for biomedical applications. In this work, SMA wires were attached to a small pressurized elastomer tube to realize deflection. The tube was pressurized to maintain a constant stress on the SMA wires. The tip motion via actuation of SMA wires was then measured and reported. The results of this study showed that by adopting an appropriate training process for the SMA wires prior to performing the experiments and adopting an appropriate internal pressure for the elastomer tube, less external loads on SMA wires would be needed for a consistent actuation.
Prevalence of asymptomatic bacteriuria in students of University of ...
African Journals Online (AJOL)
Urine samples were collected from 50 males and 50 females. The samples were cultured on CLED and MacConkey agar. Growth ... significant asymptomatic bacteriuria was higher in females 6 (60%) than males 4 (40%). The organisms isolated were S. aureus; S. epidermidis; E. coli; Pseudomonas spp and Proteus spp.
Morphological development of Morchella conica mycelium on different agar media.
Guler, P; Ozkaya, E G
2009-07-01
The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.
Menu Proposal to Use Powdered Agar
土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧
2015-01-01
The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...
Directory of Open Access Journals (Sweden)
Muhaimin Muhaimin
2011-01-01
Full Text Available Utilization of information in mass media print by master of physical education and health in physical education and health in SMA 5, SMA 6, SMA 11 Semarang. The presence of print media is now a community needs. That's because, the print media presents a variety of information including information of actual politics, culture, economy, crime, entertainment, and sports. Basically, sports information in the print media have educational value and can add insight to a reading of new knowledge. The study produced these findings: (1 third physical education and health teacher at school who becomes the object research have made use of sports information in the print media to support the success of teaching and learning process, (2 the type of information they use to support the success of learning teaching is a form of news, articles about health, (3 form of utilization is appropriate to set clipping and through direct delivery of the material in the field while providing practice in the field. This method is considered more effective because all students can immediately practice, (4 sports information in the print media meets the needs of teachers and physical health education in supporting the learning process.
Faktor Penghambat Operasionalisasi Kunjungan Rumah di SMA Negeri se-Kota Semarang
Directory of Open Access Journals (Sweden)
Juwita Nasruddin
2015-09-01
Full Text Available Penelitian dilaksanakan berdasarkan fenomena di lapangan pada saat penulis melaksanakan Praktik Pengalaman Lapangan (PPL di SMP Negeri 8 Semarang dan observasi awal di SMA Negeri 8 Semarang. Tujuan dari penelitian ini untuk mengetahui apa faktor penghambat operasionalisasi Home Visit di SMA Negeri se-kota Semarang tahun ajaran 2014/2015. Jenis penelitian yang digunakan oleh penulis dalam penelitian ini yaitu jenis penelitian survei. Untuk populasi pada penelitian ini adalah semua guru BK di SMA se-kota Semarang yaitu sejumlah 59 guru BK. Sampel yang digunakan adalah sejumlah populasi yang ada. Sedangkan instrumen yang digunakan dalam penelitian ini merupakan angket. Analisis data yang digunakan dalam penelitian ini adalah deskriptif persentase. Hasil yang ditemukan bahwa faktor penghambat operasionalisasi Home Visit di SMA Negeri se-kota Semarang mengalami hambatan cukup tinggi dengan presentase sebesar 65,03%. Simpulan yang didapatkan adalah Faktor Penghambat Operasionalisasi Kunjungan Rumah (Home visit di SMA Negeri se-kota Semarang adalah kurangnya pemahaman dari guru BK berkaitan dengan Home Visit. Adapun saran yang diberikan kepada guru BK SMA Negeri se-kota Semarang adalah untuk mempelajari hakikat Home Visit dan melaksanakan prosedur operasionalisasi Home Visit dengan baik dan benar dari perencanaan, pelaksanaan, evaluasi, analisis evaluasi, tindak lanjut hingga laporan. The research was conducted based on the phenomenon on the ground when implementing writer Practice Field Experience (PPL in SMPN 8 Semarang and preliminary observations in SMAN 8 Semarang. The purpose of this study to determine what factors inhibiting the operation of the Home Visit at all SMA Negeri in Semarang throughout the academic year 2014/2015. The type research used by the writer in this study is a survey research. The population in this study were all counselors at SMA in Semarang city. There were 59 counselors. The sample used were as many as the population
Directory of Open Access Journals (Sweden)
Anisa Sofiani
2016-04-01
Full Text Available Miopia sebagai kelainan refraksi menjadi penyebab terbanyak gangguan penglihatan di dunia hingga diestimasikan separuh dari penduduk dunia menderita miopia pada tahun 2020. Segala golongan usia dapat mengalami miopia, terutama pada remaja. Jawa tengah menduduki peringkat ke 6 untuk masalah miopia, dan remaja yang menderita miopia di kabupaten Temanggung khususnya SMA N 2 Temanggung diperkirakan meningkat tiap tahunnya. Penelitian ini termasuk dalam penelitian explanatory research dengan pendekatan cross sectional. Populasi berjumlah 720 siswa, sampel 92 siswa SMA N 2 Temanggung. Hasil penelitian ini adalah terdapat hubungan antara jarak baca (p=0,042, intensitas gadget (p=0,049, intensitas jalan kaki outdoor (0,004, dan intensitas olahraga outdoor (p=0,017 dengan derajat miopia remaja. Dan tidak ada hubungan dengan jenis kelamin, asupan vitamin A, lama membaca, penerangan, posisi membaca, penggunaan gadget /hari, pekerjaan, pendapatan orang tua, keturunan, intensitas rekreasi dan hobi. Faktor terkuat adalah olahraga outdoor (p=0,005 dan OR=17,468. Anjuran untuk penelitian selanjutnya adalah dalam penghitungan asupan Vitamin A apakah mempengaruhi peningkatan dioptri miopia agar memperhatikan cara pengolahan makanan. Kategori untuk variabel penggunaan gadget juga perlu ditambahkan. Myopia as refractive error will be the most common cause of visual impairment over the world until half of the world's populations are suffer from myopia in 2020. All of age groups can get it, especially in adolescents. Central Java’s ranked is sixth for the problems of myopia, and adolescents who suffer the myopia in Temanggung regency in particular SMA N 2 Temanggung is expected to increase each year. This study was explanatory research with cross sectional approach. The population were 720 students, with 92 samples students of SMA N 2 Temanggung. The Results, there were a relationship between reading distance (p=0.042, the intensity of the gadget (p=0.049, the
Superelastic SMA U-shaped dampers with self-centering functions
Wang, Bin; Zhu, Songye
2018-05-01
As high-performance metallic materials, shape memory alloys (SMAs) have been investigated increasingly by the earthquake engineering community in recent years, because of their remarkable self-centering (SC) and energy-dissipating capabilities. This paper systematically presents an experimental study on a novel superelastic SMA U-shaped damper (SMA-UD) with SC function under cyclic loading. The mechanical properties, including strength, SC ability, and energy-dissipating capability with varying loading amplitudes and strain rates are evaluated. Test results show that excellent and stable flag-shaped hysteresis loops are exhibited in multiple loading cycles. Strain rate has a negligible effect on the cyclic behavior of the SMA-UD within the dynamic frequency range of typical interest in earthquake engineering. Furthermore, a numerical investigation is performed to understand the mechanical behavior of the SMA-UD. The numerical model is calibrated against the experimental results with reasonable accuracy. Then, the stress–strain states with different phase transformations are also discussed.
Agar from some Hawaiian red algae
Energy Technology Data Exchange (ETDEWEB)
Santos, G.A.; Doty, M.S.
1983-08-01
From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).
Confinement of NORMAL- AND HIGH-STRENGTH CONCRETE by Shape Memory Alloy (SMA) Spirals
Gholampour, A.; Ozbakkaloglu, T.
2018-01-01
This paper presents the results of an experimental study on the axial compressive behaviour of normal- and high-strength concrete (NSC and HSC) confined by shape memory alloy (SMA) spirals. A spiral pitch space of 36 and 20 mm was used for SMA confinement of NSC and HSC columns, respectively. The confining pressure was applied on the concrete cylinders by SMA spirals that were prestrained at 0, 5.5, and 9.5%. The compression test results on the SMA-confined specimens indicate that the prestrain level of SMA significantly affects the axial compressive behaviour of both NSC and HSC. An increase in the level of prestrain leads to an increase in the peak axial stress and corresponding strain of SMA-confined concrete.
Experimental characterization of self-sensing SMA actuators under controlled convective cooling
International Nuclear Information System (INIS)
Lewis, N; York, A; Seelecke, S
2013-01-01
Shape memory alloy (SMA) wires are attractive for actuation systems due to their high energy density, light weight and silent operation. In addition, they feature self-sensing capabilities by relating electrical resistance measurements to strain changes. In real world applications SMAs typically operate in non-ambient air and it is imperative to understand an actuator’s behavior under varying convective cooling conditions, especially for smaller diameter wires, where convective effects are amplified. This paper shows that the multi-functionality of SMA actuators can be further extended by related heating power to convective air speed. It investigates the relationship between the normalized excess power needed and corresponding airspeed under controlled, laminar airflow patterns in a small-scale wind tunnel. For each experiment, airflow through the wind tunnel, strain in the SMA wire, and power supplied to the SMA wire were controlled, while the stress and resistance of the wire were measured. The ability to understand and predict an SMA wire’s behavior under various external airflows will aid in the design and understanding of future SMA actuated structures, such as micro-air vehicles, and shows that SMAs can function as self-sensing actuators and airspeed sensors. (paper)
DEFF Research Database (Denmark)
Petersen, Line Hedegård
1997-01-01
-Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...
Molecular, Serological And Microbiological Profiling Evidence Of ...
African Journals Online (AJOL)
All items that the boy had contact with including a laboratory coat, bunch of keys and shoes were swabbed. Finally samples of all the boy's food and drinks were taken. Microbiological, Serological and Polymerase Chain Reaction (PCR) Profiling Assays. l the samples were cultured on Sorbitol - MacConkey (SMAC) agar, ...
SMA Foils for MEMS: From Material Properties to the Engineering of Microdevices
Kohl, Manfred; Ossmer, Hinnerk; Gueltig, Marcel; Megnin, Christof
2018-03-01
In the early nineties, microelectromechanical systems (MEMS) technology has been still in its infancy. As silicon (Si) is not a transducer material, it was clear at the very beginning that mechanically active materials had to be introduced to MEMS in order to enable functional microdevices with actuation capability beyond electrostatics. At that time, shape memory alloys (SMAs) have been available in bulk form, mainly as SMA wires and SMA plates. On the macro scale, these materials show highest work densities compared to other actuation principles in the order of 107 J/m3, which stimulated research on the integration of SMA to MEMS. Subsequently, two approaches for producing planar materials have been initiated (1) magnetron sputtering of SMA thin films and (2) the integration of rolled SMA foils, which both turned out to be very successful creating a paradigm change in microactuation technology. The following review covers important milestones of the research and development of SMA foil-based microactuators including materials characterization, design engineering, technology, and demonstrator development as well as first commercial products.
SMA Foils for MEMS: From Material Properties to the Engineering of Microdevices
Kohl, Manfred; Ossmer, Hinnerk; Gueltig, Marcel; Megnin, Christof
2017-12-01
In the early nineties, microelectromechanical systems (MEMS) technology has been still in its infancy. As silicon (Si) is not a transducer material, it was clear at the very beginning that mechanically active materials had to be introduced to MEMS in order to enable functional microdevices with actuation capability beyond electrostatics. At that time, shape memory alloys (SMAs) have been available in bulk form, mainly as SMA wires and SMA plates. On the macro scale, these materials show highest work densities compared to other actuation principles in the order of 107 J/m3, which stimulated research on the integration of SMA to MEMS. Subsequently, two approaches for producing planar materials have been initiated (1) magnetron sputtering of SMA thin films and (2) the integration of rolled SMA foils, which both turned out to be very successful creating a paradigm change in microactuation technology. The following review covers important milestones of the research and development of SMA foil-based microactuators including materials characterization, design engineering, technology, and demonstrator development as well as first commercial products.
21 CFR 866.4600 - Ouchterlony agar plate.
2010-04-01
...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...
Investigations on Vibration Characteristics of Sma Embedded Horizontal Axis Wind Turbine Blade
Jagadeesh, V.; Yuvaraja, M.; Chandhru, A.; Viswanathan, P.; Senthil kumar, M.
2018-02-01
Vibration induced in wind turbine blade is a solemn problem as it reduces the life of the blade and also it can create critical vibration onto the tower, which may cause serious damage to the tower. The aim of this paper is to investigate the vibration characteristics of the prototype horizontal axis wind turbine blade. Shape memory alloys (SMA), with its variable physical properties, provides an alternative actuating mechanism. Heating an SMA causes a change in the elastic modulus of the material and hence SMAs are used as a damping material. A prototype blade with S1223 profile has been manufactured and the natural frequency is found. The natural frequency is found by incorporating the single SMA wire of 0.5mm diameter over the surface of the blade for a length of 240 mm. Similarly, number of SMA wires over the blade is increased up to 3 and the natural frequency is found. Frequency responses showed that the embedment of SMA over the blade’s surface will increase the natural frequency and reduce the amplitude of vibration. This is because of super elastic nature of SMA. In this paper, when SMA wire of 0.5 mm diameter and of length of 720 mm is embedded on the blade, an increase in the natural frequency by 6.3% and reducing the amplitude by 64.8%. Results of the experimental modal and harmonic indicates the effectiveness of SMA as a passive vibration absorber and that it has potential as a modest and high-performance method for controlling vibration of the blade.
SMA bellows as reversible thermal sensors/actuators
International Nuclear Information System (INIS)
Damanpack, A R; Bodaghi, M; Liao, W H
2015-01-01
In this paper, the feasibility of reversible bellows made of shape memory alloys (SMAs) in sensory and actuated applications to transfer pressure and/or temperature into a linear motion is investigated. An analytical three-dimensional model is developed to simulate key features of SMAs including martensitic transformation, reorientation of martensite variants, the shape memory effect, and pseudo-elasticity. Axisymmetric two-dimensional theory of thermo-inelasticity based on the non-linear Green–Lagrange strain tensor is employed to derive the equilibrium equations. A finite element method along with an iterative incremental elastic-predictor–inelastic-corrector procedure is developed to solve the governing equations with both material and geometrical non-linearities. The feasibility of reversible SMA bellows in transferring pressure and/or temperature into a linear motion is numerically demonstrated. In this respect, the effects of geometric parameters, magnitude of thermo-mechanical loadings and end conditions on the performances of SMA bellows are evaluated and discussed in depth. This study provides pertinent results toward an efficient and reliable design of reversible thermally-driven SMA bellows. (paper)
Identification of Cryptococcus neoformans isolates using Staib agar without creatinine
Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia
2005-01-01
In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...
Agar alternatives for micropropagation of African violet ( Saintpaulia ...
African Journals Online (AJOL)
Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...
Persepsi Siswa Terhadap Pembelajaran Guru Pendidikan Jasmani Di SMA Muhammadiyah Kediri
Directory of Open Access Journals (Sweden)
Hendra Mashuri
2017-05-01
Full Text Available Tujuan yang ingin dicapai dalam penelitian ini adalah untuk memperoleh informasi tentang persepsi siswa terhadap pembelajaran guru pendidikan jasmani di SMA Muhammadiyah Kediri. Rumusan masalah dalam penelitian ini adalah bagaimana persepsi siswa terhadap pembelajaran guru pendidikan jasmani di SMA Muhammadiyah Kediri? Jenis penelitian ini adalah penelitian survei. Populasi yang digunakan adalah seluruh siswa SMA Muhammadiyah Kediri, sampel yang diambil berjumlah 60 siswa yang terdiri dari 20 siswa dari masing-masing kelas. Instrumen yang digunakan adalah angket dan dokumentasi. Teknik analisis data menggunakan persentase. Hasil penelitian menunjukkan bahwa persepsi siswa terhadap proses pembelajaran SMA Muhammadiyah Kediri mendapatkan skor 3115 atau rata-rata jawaban siswa 51,917 dengan persentase sebesar 74% dan masuk dalam kategori “Baik”. Dengan demikian dapat dikatakan bahwa persepsi siswa terhadap pembelajaran guru pendidikan jasmani adalah baik.
Sistem Informasi Akademik pada SMA Swasta Hang Tuah Belawan
Syarifuddin, Ruisya
2015-01-01
Perancangan Sistem Informasi Akademik pada SMA Swasta Hang Tuah Belawan ini bertujuan untuk mempermudah proses pencarian atau searching data dan informasi untuk seluruh Siswa SMA Swasta Hang Tuah Belawan yang mengalami kesulitan dalam memperoleh data mengenai masalah Akademik tersebut. Faasilitas yang terdapat dalam aplikasi ini berupa penyediaan data dan informasi mengenai beritaberita terbaru, profil agenda kegiatan, dan data-data yang berguna untuk kelangsungan belajar si...
Manajemen kelas dalam pembelajaran matematika di SMA Negeri Yogyakarta
Nisak Ruwah Ibnatur Husnul; Heri Retnawati
2017-01-01
Penelitian ini bertujuan untuk mengetahui manajemen kelas yang berupa perencanaan, pengorganisasian, penggerakan/kepemimpinan dan pengevaluasian dari pembelajaran matematika yang dilakukan oleh guru matematika di SMA Negeri Yogyakarta. Dengan menggunakan penelitian kualitatif jenis studi kasus ini dilakukan di SMA Negeri 5, 8 dan 9 Yogyakarta dengan subjek data adalah kepala sekolah, guru kurikulum, guru matematika dan siswa. Untuk teknik pengumpulan datanya dengan pedoman observasi dan pedom...
Optimal design of damping layers in SMA/GFRP laminated hybrid composites
Haghdoust, P.; Cinquemani, S.; Lo Conte, A.; Lecis, N.
2017-10-01
This work describes the optimization of the shape profiles for shape memory alloys (SMA) sheets in hybrid layered composite structures, i.e. slender beams or thinner plates, designed for the passive attenuation of flexural vibrations. The paper starts with the description of the material and architecture of the investigated hybrid layered composite. An analytical method, for evaluating the energy dissipation inside a vibrating cantilever beam is developed. The analytical solution is then followed by a shape profile optimization of the inserts, using a genetic algorithm to minimize the SMA material layer usage, while maintaining target level of structural damping. Delamination problem at SMA/glass fiber reinforced polymer interface is discussed. At the end, the proposed methodology has been applied to study the hybridization of a wind turbine layered structure blade with SMA material, in order to increase its passive damping.
Behavior of NiTiNb SMA wires under recovery stress or prestressing.
Choi, Eunsoo; Nam, Tae-Hyun; Chung, Young-Soo; Kim, Yeon-Wook; Lee, Seung-Yong
2012-01-05
The recovery stress of martensitic shape-memory alloy [SMA] wires can be used to confine concrete, and the confining effectiveness of the SMA wires was previously proved through experimental tests. However, the behavior of SMA wires under recovery stress has not been seriously investigated. Thus, this study conducted a series of tests of NiTiNb martensitic SMA wires under recovery stress with varying degrees of prestrain on the wires and compared the behavior under recovery stress with that under prestressing of the wires. The remaining stress was reduced by the procedure of additional strain loading and unloading. More additional strains reduced more remaining stresses. When the SMA wires were heated up to the transformation temperature under prestress, the stress on the wires increased due to the state transformation. Furthermore, the stress decreased with a decreasing temperature of the wires down to room temperature. The stress of the NiTiNb wires was higher than the prestress, and the developed stress seemed to depend on the composition of the SMAs. When an additional strain was subsequently loaded and unloaded on the prestressed SMA wires, the remaining stress decreased. Finally, the remaining stress becomes zero when loading and unloading a specific large strain.
Potential sources of transmission of hospital acquired infections in ...
African Journals Online (AJOL)
The swabs were cultured on Blood, Chocolate and Mac-Conkey agars and incubated for 24hrs at 35±2ºC afterwhich isolates were identified morphologically and biochemically. Results: A total of 187 (88.8%) bacterial isolates were obtained from the swabs (P<0.0017) made up of 55.5% non-pathogenic isolates, 33.3% ...
Rao, A V; Bekheet, I A
1976-10-01
The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.
Energy Technology Data Exchange (ETDEWEB)
Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)
2010-01-15
Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)
Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.
Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin
2012-10-01
Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.
Directory of Open Access Journals (Sweden)
Wenny Hulukati
2014-06-01
Abstrak: Perangkat Pengembangan Diri untuk Meningkatkan Kompetensi Guru dan Pengembangan Kepribadian Siswa SMA. Penelitian ini bertujuan mengembangkan perangkat pengembangan diri untuk meningkatkan kompetensi guru dan pengembangan kepribadian siswa SMA. Kegiatan penelitian ini diawali dengan studi pendahuluan yang berkaitan dengan kompentensi guru pembimbing dalam melaksanakan pelayanan bimbingan dan konseling dan kecenderungan kepribadian siswa SMA. Langkah berikutnya adalah mendesain dan mengembangkan draf, dan diakhiri dengan kegiatan uji keefektifan produk. Dari kegiatan penelitian pengembangan ini telah dihasilkan produk pengembangan yang valid dan handal yang meliputi panduan guru, panduan siswa, dan panduan penilaian. Berdasarkan hasil uji keefektifan terhadap produk pengembangan diperoleh informasi bahwa perangkat panduan pengembangan diri efektif digunakan untuk meningkatkan kompetensi guru pembimbing dalam melaksanakan pelayanan bimbingan dan konseling dan pengembangan kepribadian siswa SMA.
Monotonic and cyclic bond behavior of confined concrete using NiTiNb SMA wires
International Nuclear Information System (INIS)
Choi, Eunsoo; Chung, Young-Soo; Kim, Yeon-Wook; Kim, Joo-Woo
2011-01-01
This study conducts bond tests of reinforced concrete confined by shape memory alloy (SMA) wires which provide active and passive confinement of concrete. This study uses NiTiNb SMA which usually shows wide temperature hysteresis; this is a good advantage for the application of shape memory effects. The aims of this study are to investigate the behavior of SMA wire under residual stress and the performance of SMA wire jackets in improving bond behavior through monotonic-loading tests. This study also conducts cyclic bond tests and analyzes cyclic bond behavior. The use of SMA wire jackets transfers the bond failure from splitting to pull-out mode and satisfactorily increases bond strength and ductile behavior. The active confinement provided by the SMA plays a major role in providing external pressure on the concrete because the developed passive confinement is much smaller than the active confinement. For cyclic behavior, slip and circumferential strain are recovered more with larger bond stress. This recovery of slip and circumferential strain are mainly due to the external pressure of the SMA wires since cracked concrete cannot provide any elastic recovery
Domain general sequence operations contribute to pre-SMA involvement in visuo-spatial processing
Directory of Open Access Journals (Sweden)
E. Charles eLeek
2016-01-01
Full Text Available This study used 3T MRI to elucidate the functional role of supplementary motor area (SMA in relation to visuo-spatial processing. A localizer task contrasting sequential number subtraction and repetitive button pressing was used to functionally delineate non-motor sequence processing in pre-SMA, and activity in SMA-proper associated with motor sequencing. Patterns of BOLD responses in these regions were then contrasted to those from two tasks of visuo-spatial processing. In one task participants performed mental rotation in which recognition memory judgments were made to previously memorized 2D novel patterns across image-plane rotations. The other task involved abstract grid navigation in which observers computed a series of imagined location shifts in response to directional (arrow cues around a mental grid. The results showed overlapping activation in pre-SMA for sequential subtraction and both visuo-spatial tasks. These results suggest that visuo-spatial processing is supported by non-motor sequence operations that involve pre-SMA. More broadly, these data further highlight the functional heterogeneity of pre-SMA, and show that its role extends to processes beyond the planning and online control of movement.
Directory of Open Access Journals (Sweden)
Rio Estetika
2016-10-01
Full Text Available Buku Ajar Al-Islam dan Kemuhammadiyahan berwawasan HAM untuk SMA/MA/SMK merupakan salah satu bentuk upaya pendidikan agama di Muhammadiyah untuk mengembangkan buku teks pengajaran Al Islam dan Kemuhammadiyahan agar dapat lebih dinamis, up to date, kontekstual, dan mengakomodasi aspek-aspek sosio-kultural sebagai bentuk respon terhadap permasalahan kemanusiaan. Penelitian ini merupakan penelitian analisis isi dengan menggunakan dokumen sebagai objeknya. Dari hasil kesimpulan disarankan untuk menggunakan buku ajar tersebut sebagai penunjang buku pokok yang sudah diteritkan Majelis Dikdasemen dalam mengajarkan materi hak asasi manusia. Kemudian, dalam penyusunan buku AIK dapat mengadopsi konsep penyusunan buku AIK berwawasan HAM yang lebih up to date dan bervariasi dalam metode pembelajarannya.
Miskonsepsi Buku Ajar Fisika SMA Kelas X Pada Pokok Bahasan Dinamika Gerak
Directory of Open Access Journals (Sweden)
Fachmi Nurdiansyah
2018-03-01
Full Text Available Penelitian ini bertujuan untuk memaparkan bentuk-bentuk miskonsepsi pada pokok bahasan dinamika gerak dalam buku ajar fisika SMA kelas X. Adapun buku ajar yang digunakan dalam penelitian ini, yaitu: (1 Fisika untuk SMA/MA Kelas X Semester I karangan RA dan SI yang diterbitkan tahun 2012 oleh penerbit IP, (2 Fisika untuk SMA/MA Kelas X Semester I karangan TPM yang diterbitkan tahun 2013 oleh penerbit VP, dan (3 Fisika Peminatan untuk SMA/MA Kelas X karangan SN dan SZ yang diterbitkan tahun 2013 oleh penerbit YW. Penelitian ini merupakan penelitian kualitatif deskriptif. Objek dalam penelitian ini adalah data berupa aspek penjelasan konsep, penulisan rumus, penulisan simbol, penulisan satuan, dan penyajian gambar pada pokok bahasan dinamika gerak dalam buku ajar fisika SMA. Penelitian dilakukan dengan cara menganalisis data dalam buku ajar fisika SMA yang dibandingkan dengan buku teks fisika universitas. Berdasarkan analisis data yang telah dilakukan, dapat disimpulkan bahwa miskonsepsi pada pokok bahasan dinamika gerak terdapat dalam buku ajar fisika SMA. Buku ajar IP mengalami miskonsepsi pada aspek penjelasan konsep dengan persentase 10%, penulisan rumus dengan persentase 57,14%, penulisan simbol dengan persentase 46,15%, dan penyajian gambar dengan persentase 20%. Buku ajar VP mengalami miskonsepsi pada aspek penjelasan konsep dengan persentase 10%, penulisan rumus dengan persentase 85,71%, penulisan simbol dengan persentase 79,62%, dan penyajian gambar dengan persentase 80%. Buku ajar YW mengalami miskonsepsi pada aspek penjelasan konsep dengan persentase 10%, penulisan rumus dengan persentase 85,71%, penulisan simbol dengan persentase 69,23, dan penyajian gambar dengan persentase 20%. Pada aspek penulisan satuan, tidak terdapat miskonsepsi dalam buku ajar IP, VP, dan YW.
Fatigue crack behavior on a Cu-Zn-Al SMA
Directory of Open Access Journals (Sweden)
V. Di Cocco
2014-10-01
Full Text Available In recent years, mechanical property of many SMA has improved in order to introduce these alloys in specific field of industry. Main examples of these alloys are the NiTi, Cu-Zn-Al and Cu-Al-Ni which are used in many fields of engineering such as aerospace or mechanical systems. Cu-Zn-Al alloys are characterized by good shape memory properties due to a bcc disordered structure stable at high temperature called β-phase, which is able to change by means of a reversible transition to a B2 structure after appropriate cooling, and reversible transition from B2 secondary to DO3 order, under other types of cooling. In β-Cu-Zn-Al shape memory alloys, the martensitic transformation is not in equilibrium at room temperature. It is therefore often necessary to obtain the martensitic structure, using a thermal treatment at high temperature followed by quenching. The martensitic phases can be either thermally-induced spontaneous transformation, or stressinduced, or cooling, or stressing the β- phase. Direct quenching from high temperatures to the martensite phase is the most effective because of the non-diffusive character of the transformation. The martensite inherits the atomic order from the β-phase. Precipitation of many kinds of intermetallic phases is the main problem of treatment on cu-based shape memory alloy. For instance, a precipitation of α-phase occurs in many low aluminum copper based SMA alloy and presence of α-phase implies a strong degradation of shape recovery. However, Cu-Zn-Al SMA alloys characterized by aluminum contents less than 5% cover a good cold machining and cost is lower than traditional NiTi SMA alloys. In order to improve the SMA performance, it is always necessary to identify the microstructural changing in mechanical and thermal conditions, using X-Ray analyses. In this work a Cu-Zn-Al SMA alloy obtained in laboratory has been microstructurally and metallographically characterized by means of X-Ray diffraction and Light
Crack-closing of cement mortar beams using NiTi cold-drawn SMA short fibers
Choi, Eunsoo; Kim, Dong Joo; Chung, Young-Soo; Kim, Hee Sun; Jung, Chungsung
2015-01-01
In this study, crack-closing tests of mortar beams reinforced by shape memory alloy (SMA) short fibers were performed. For this purpose, NiTi SMA fibers with a diameter of 0.965 mm and a length of 30 mm were made from SMA wires of 1.0 mm diameter by cold drawing. Four types of SMA fibers were prepared, namely, straight and dog-bone-shaped fiber and the two types of fibers with paper wrapping in the middle of the fibers. The paper provides an unbonded length of 15 mm. For bending tests, six types of mortar beams with the dimensions of 40 mm × 40 mm × 160 mm (B×H×L) were prepared. The SMA fibers were placed at the bottom center of the beams along with an artificial crack of 10 mm depth and 1 mm thickness. This study investigated the influence of SMA fibers on the flexural strength of the beams from the measured force- deflection curves. After cracking, the beams were heated at the bottom by fire to activate the SMA fibers. Then, the beams recovered the deflection, and the cracks were closed. This study evaluated crack-closing capacity using the degree of crack recovery and deflection-recovery factor. The first factor is estimated from the crack-width before and after crack-closing, and the second one is obtained from the downward deflection due to loading and the upward deflection due to the closing force of the SMA fibers.
Differentiating Agar wood Oil Quality Using Artificial Neural Network
International Nuclear Information System (INIS)
Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib
2013-01-01
Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)
Gari agar as culture media for mycological studies | Okorondu ...
African Journals Online (AJOL)
Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...
Directory of Open Access Journals (Sweden)
Siti Darsati
2015-01-01
Full Text Available Tujuan penyusunan model pembelajaran kimia ini untuk meningkatkan keterampilan proses dan keterampilan berpikir siswa SMA. Model Pembelajaran Laju Reaksi untuk SMA mengandung 17 konsep, meliputi konsep abstrak, konsep yang berdasarkan prinsip dan konsep yang menyatakan simbol. Keterampilan Berpikir Kritis dan Keterampilan Proses Sains yang dikembangkan lebih banyak pada keterampilan menyimpulkan. Model ini telah di implementasikan pada 2 SMA di Kodya/Kabupaten Bandung. Kata kunci: Model pembelajaran, keterampilan proses, keterampilan berpikir
Directory of Open Access Journals (Sweden)
Gede Sedanayasa
2015-05-01
Full Text Available Penelitian tahun pertama ini, bertujuan untuk mengidentifikasi harapan orang tua terhadap remaja dan harapan remaja terhadap orang tua. Harapan dua pihak ini dijadikan bahan analisis transaksi pengasuhan orang tua dalam keluarga. Subjek penelitian adalah siswa-siswa SMP/SMA dan orang tua yang anak-anaknya terindikasi melakukan perilaku seksual menyimpang pada lima sekolah di Kabupaten Buleleng. Data dikumpulkan dengan pencatatan dokumen, kuesioner, dan wawancara. Data dianalisis dengan analisis deskriptif kuantitatif. Hasil penelitian menunjukkan bahwa, remaja dan orang tua sama-sama memiliki harapan yang baik untuk keberlangsungan perkembangan keluarga hanya, kedua pihak tidak saling memahami harapan masing-masing. Pihak remaja misalnya, mengharapkan agar orang tua dapat memenuhi kebutuhan sekolah secara layak dan ikhlas, dapat membimbing perkembangannya termasuk membantu memecahkan masalah belajar, sedangkan orang tua berharap agar remaja berperilaku hormat, tidak melecehkan orang tua, tidak membantah, patuh aturan keluarga dan sekolah, dan meminta maaf jika keliru. Disarankan kepada ke dua pihak (remaja dan orang tua untuk saling memahami keadaan masing-masing. Dari pihak remaja, dalam mengharapkan sesuatu tidak memaksakan kehendak, dan sebaliknya orang tua tetap memandang remaja sebagai individu yang berkembang, butuh perhatian dan penghargaan, sehingga memperlakukannya secara manusiawi.
Thermal characterization of magnetically aligned carbonyl iron/agar composites.
Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J
2014-01-01
Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.
Detection of extracellular proteases from microorganisms on agar plates
Directory of Open Access Journals (Sweden)
Alane Beatriz Vermelho
1996-12-01
Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.
Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar
DEFF Research Database (Denmark)
Høi, L.; Dalsgaard, Inger; Dalsgaard, A.
1998-01-01
An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....
Antibiotic resistance of microbial contaminations isolated from husbandry animals and foodstuffs
Directory of Open Access Journals (Sweden)
Lukáš Hleba
2014-05-01
Full Text Available In this paper the antibiotic resistance of microbial contaminations isolated from husbandry animals and foodstuffs were investigated. Microorganisms isolated from animals and foodstuffs were contaminations of selective media as MacConkey agar for Enterobacteriaceae genera and MRS agar for lactobacilli strains. Microorganisms were isolated and puryfied by agar four ways streak plate method. Identification of isolated microorganisms was done by mass-spectrometry method in MALDI-TOF MS Biotyper. For investigation of antibiotic resistance disc diffusion method by EUCAST was used. In this study Gram-negative and Gram-positive bacteria were identified. The most resistant or multi-resistant bacteria as Pseudomonas aeruginosa, Acinetobacter lwoffi, Lysinibacillus sphaericus, Staphylococcus aureus and Staphylococcus epidermis were determined. Other identified microorganisms were resistant to one antibiotic or not at all.
Jenabi, Mehrnaz; Peck, Kyung K; Young, Robert J; Brennan, Nicole; Holodny, Andrei I
2014-12-01
Accurate localization of anatomically and functionally separate SMA tracts is important to improve planning prior to neurosurgery. Using fMRI and probabilistic DTI techniques, we assessed the connectivity between the frontal language area (Broca's area) and the rostral pre-SMA (language SMA) and caudal SMA proper (motor SMA). Twenty brain tumor patients completed motor and language fMRI paradigms and DTI. Peaks of functional activity in the language SMA, motor SMA and Broca's area were used to define seed regions for probabilistic tractography. fMRI and probabilistic tractography identified separate and unique pathways connecting the SMA to Broca's area - the language SMA pathway and the motor SMA pathway. For all subjects, the language SMA pathway had a larger number of voxels (PProbabilistic tractography can identify unique white matter tracts that connect language SMA and motor SMA to Broca's area. The language SMA is more significantly connected to Broca's area than is the motor subdivision of the SMA proper. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Agar/collagen membrane as skin dressing for wounds
Energy Technology Data Exchange (ETDEWEB)
Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn
2008-12-15
Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.
Agar/collagen membrane as skin dressing for wounds
International Nuclear Information System (INIS)
Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing
2008-01-01
Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.
PENGEMBANGAN PERANGKAT PEMBELAJARAN KOMPETENSI SULIT MATEMATIKA SMA DI RIAU
Directory of Open Access Journals (Sweden)
Ummi Aisyah
2014-05-01
Full Text Available Tujuan penelitian ini adalah untuk menghasilkan perangkat pembelajaran kompetensi sulit matematika SMA di Provinsi Riau yang berkualitas baik/layak yaitu valid, praktis, dan efektif. Penelitian ini merupakan penelitian pengembangan yang mengembangkan perangkat pembelajaran kompetensi sulit matematika SMA dengan menggunakan model pengembangan 4-D yang dikembangkan oleh Thiagarajan, Semmel & Semmel yang telah dimodifikasi sehingga hanya memuat tahap pen-definisian, perancangan, dan pengembangan. Penelitian ini menghasilkan perangkat pembelajaran kompetensi sulit matematika SMA yang meliputi silabus, rencana pelaksanaan pembelajaran (RPP, lembar kegiatan siswa (LKS, dan instrumen tes. Hasil validasi menunjukkan bahwa silabus, RPP, LKS yang dikembangkan memiliki kategori sangat valid untuk masing-masing silabus, RPP, LKS, dan test instrument. Hasil uji coba lapangan menunjukkan bahwa perangkat yang dikembangkan praktis dan efektif. Kepraktisan mencapai hasil sangat baik ditinjau dari penilaian guru dan siswa. Keefektifan ditinjau dari ketuntasan belajar siswa dan hasil observasi keterlaksanaan pembelajaran. Secara klasikal ketuntasan belajar mencapai 84,38%. Secara keseluruhan, hasil penelitian menunjukkan bahwa perangkat pembelajaran yang dikembangkan adalah layak untuk digunakan. Kata Kunci: pengembangan, perangkat pembelajaran, kompetensi sulit matematika
PEMBELAJARAN THINK-PAIR-SHARE, KETERAMPILAN METAKOGNITIF, DAN HASIL BELAJAR KOGNITIF SISWA SMA
Directory of Open Access Journals (Sweden)
Sri Amnah S.
2012-05-01
Full Text Available Abstract: Think-Pair-Share Learning, Meta-cognitive Skills and Cognitive Learning Outcomes. The study investigates the effects of meta-cognitive skills based Think-Pair-Share cooperative learning on meta-cognitive skills and cognitive learning outcomes of 11th grade students of Senior High Schools in Pekanbaru. The sample consists of 11th grade students of SMA 9 as an experiment group and 11th grade students SMA 10 as a control group. Based on analyzing the data using ANCOVA, the results show that there is a significant difference in meta-cognitive skills and cognitive learning outcomes of the students in the experimental and the control groups, and there is no significant difference between students who have high and low academic levels in their meta-cognitive skills and cognitive learning outcomes. Abstrak: Pembelajaran Think-Pair-Share, Keterampilan Metakognitif, dan Hasil Belajar Kognitif Siswa SMA. Penelitian ini bertujuan mengukur pengaruh pembelajaran koperatif Think-Pair-Share terhadap keterampilan metakognitif dan hasil belajar kognitif siswa SMA. Sampel dipilih secara acak dari populasi 13 SMA di Pekanbaru. Dengan menggunakan ANAKOVA, hasilnya menunjukkan bahwa terdapat perbedaan yang nyata keterampilan metakognitif dan hasil belajar kognitif siswa di kelompok eksperimental dan kelompok control, dan tidak ada perbedaan yang nyata antara siswa berkemampuan akademik tinggi dan akademik rendah pada keterampilan metakognitif dan hasil belajar kognitifnya.
Light transfer in agar immobilized microalgae cell cultures
Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy
2017-09-01
This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.
Full-scale flight tests of aircraft morphing structures using SMA actuators
Mabe, James H.; Calkins, Frederick T.; Ruggeri, Robert T.
2007-04-01
In August of 2005 The Boeing Company conducted a full-scale flight test utilizing Shape Memory Alloy (SMA) actuators to morph an engine's fan exhaust to correlate exhaust geometry with jet noise reduction. The test was conducted on a 777-300ER with GE-115B engines. The presence of chevrons, serrated aerodynamic surfaces mounted at the trailing edge of the thrust reverser, have been shown to greatly reduce jet noise by encouraging advantageous mixing of the free, and fan streams. The morphing, or Variable Geometry Chevrons (VGC), utilized compact, light weight, and robust SMA actuators to morph the chevron shape to optimize the noise reduction or meet acoustic test objectives. The VGC system was designed for two modes of operation. The entirely autonomous operation utilized changes in the ambient temperature from take-off to cruise to activate the chevron shape change. It required no internal heaters, wiring, control system, or sensing. By design this provided one tip immersion at the warmer take-off temperatures to reduce community noise and another during the cooler cruise state for more efficient engine operation, i.e. reduced specific fuel consumption. For the flight tests a powered mode was added where internal heaters were used to individually control the VGC temperatures. This enabled us to vary the immersions and test a variety of chevron configurations. The flight test demonstrated the value of SMA actuators to solve a real world aerospace problem, validated that the technology could be safely integrated into the airplane's structure and flight system, and represented a large step forward in the realization of SMA actuators for production applications. In this paper the authors describe the development of the actuator system, the steps required to integrate the morphing structure into the thrust reverser, and the analysis and testing that was required to gain approval for flight. Issues related to material strength, thermal environment, vibration
SMA spring-based artificial muscle actuated by hot and cool water using faucet-like valve
Park, Cheol Hoon; Son, Young Su
2017-04-01
An artificial muscle for a human arm-like manipulator with high strain and high power density are under development, and an SMA(Shape memory alloy) spring is a good actuator for this application. In this study, an artificial muscle composed of a silicon tube and a bundle of SMA(Shape memory alloy) springs is evaluated. A bundle of SMA springs consists of five SMA springs which are fabricated by using SMA wires with a diameter of 0.5 mm, and hot and cool water actuates it by heating and cooling SMA springs. A faucet-like valve was also developed to mix hot water and cool water and control the water temperature. The mass of silicon tube and a bundle of SMA springs is only 3.3 g and 2.25 g, respectively, and the total mass of artificial muscle is 5.55 g. It showed good actuating performance for a load with a mass of 2.3 kg and the power density was more than 800 W/kg for continuous valve switching with a cycle of 0.6 s. The faucet-like valve can switch a water output from hot water to cold water within 0.3s, and the artificial muscle is actuated well in response to the valve position and speed. It is also presented that the temperature of the mixed water can be controlled depending on the valve position, and the displacement of the artificial muscle can be controlled well by the mixed water. Based on these results, SMA spring-based artificial muscle actuated by hot and cool water could be applicable to the human arm-like robot manipulators.
PENERAPAN TEKNOLOGI WEB SEKOLAH BAGI SMP DAN SMA MUHAMMADIYAH KARTASURA
Directory of Open Access Journals (Sweden)
Heru Supriyono
2016-03-01
Full Text Available Observation and interview with headmasters, teachers and administrative employees results showed that one of main problems faced by SMP Muhammadiyah 1 Kartasura and SMA Muhammadiyah 4 Kartasura is the do not have a representative school website. Based on this observation, after making discussion with headmasters, the community services team proposed an implementation of school website and train one of chosen teacher to manage implemented website. The outcomes of the community service activities are involving a school website for SMP Muhammadiyah 1 Kartasura and SMA Muhammadiyah 4 Kartasura and scientific publication draft. The contribution of each school is including providing information which will be uploaded to the website, providing fee for domain and hosting cost, and providing facilities for administrator training. The duration of this commuity services is three months. The results of the community services is both SMP Muhammadiyah 1 Kartasura dan SMA Muhammadiyah 4 Kartasura are now have representative website for their promotion and administative activities.
PENGEMBANGAN KINERJA GURU MELALUI PENELITIAN TINDAKAN KELAS PADA SMA NEGERI DI KOTA PALOPO
Directory of Open Access Journals (Sweden)
Hilal Muhammad
2015-12-01
Tujuan penelitian ini adalah untuk mengungkap: (1 pelaksanaan pengembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo; dan (2 hambatan da-lam pelaksanaan pengembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo. Jenis penelitian adalah penelitian lapangan yang kajiannya bersifat kualitatif-verifikatif. Pendekatan yang digunakan adalah pendekatan fenomeno-logi. Metode pengumpulan data yang digunakan dalam penelitian ini adalah wawancara, observasi, dan dokumentasi. Hasil penelitian ini menunjukkan dua hal. Pertama, pengembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo belum berjalan optimal dan baru sebatas memenuhi kebutuhan persyarat-an kenaikan pangkat. Potensi guru belum dimanfaatkan melalui pemberdayaan, khususnya penelitian tindakan kelas. Kedua, hambatan dalam pelaksanaan pe-ngembangan kinerja guru melalui PTK pada SMA Negeri di Kota Palopo adalah keterbatasan waktu, dana, sumber referensi kurang, lingkungan tidak kondusif, dan motivasi kurang. Selain itu, sebagian guru juga masih mengalami kesulitan dalam melakukan dan menyusun laporan hasil PTK.
Directory of Open Access Journals (Sweden)
Siti Imroatun
2016-02-01
Full Text Available Kinerja guru sangat menentukan keberhasilan proses belajar yang efektif dan efisien. Dengan kinerja yang baik maka tujuan pendidikan dapat tercapai. Penelitian ini dilakukan di SMA Negeri se-Kabupaten wonosobo yang berjumlah sembilan sekolah yang dilatar belakangi bahwa kinerja guru di SMA Negeri se-Kabupaten Wonosobo belum optimal. Hal ini dilihat dari hasil observasi awal yang menunjukkan kurangnya persiapan sebelum mengajar, penggunaan metode pembelajaran yang kurang inovatif, dan pembelajaran berbasis teknologi kurang dapat dimanfaatkan secara optimal. Populasi dalam penelitian ini berjumlah 30 orang guru ekonomi yang tersebar di sembilan SMA Negeri se-Kabupaten Wonosobo. Sampel yang digunakan adalah semua guru ekonomi yang ada di SMA Negeri se-Kabupaten Wonosobo. Variabel yang diteliti dalam penelitian ini adalah lingkungan kerja, kompensasi kerja, dan motivasi kerja sebagai variabel bebas, serta kinerja guru sebagai variabel terikat. Metode pengumpulan data yang digunakan adalah angket atau kuesioner. Analisis data menggunakan analisis statistik deskriptif dan statistik inferensial.Hasil analisis deskriptif masing-masing variabel menunjukkan bahwa lingkungan kerja, kompensasi kerja, motivasi kerja dan kinerja guru termasuk kriteria baik. Lingkungan kerja berpengaruh positif terhadap kinerja guru sebesar 16,65%; kompensasi kerja berpengaruh positif terhadap kinerja guru sebesar 21,25%; dan motivasi kerja berpengaruh positif terhadap kinerja guru sebesar 31,92%.Penelitian ini terdapat pengaruh positif antara lingkungan kerja, kompensasi kerja dan motivasi kerja terhadap kinerja guru, baik secara simultan maupun parsial. Saran yang dapat diberikan adalah agar guru ekonomi terus meningkatkan kompetensi professional dengan menyesuaikan kemampuan peserta didik. Selain itu juga perlu ditingkatkan fasilitas yang mendukung kinerja guru, memberikan kompensasi sesuai dengan beban kerja guru dan selalu memberikan motivasi kepada guru ekonomi. Teacher
International Nuclear Information System (INIS)
Jarali, Chetan S; Raja, S; Upadhya, A R
2010-01-01
Materials design involving the thermomechanical constitutive modeling of shape memory alloy (SMA) and shape memory polymer (SMP) composites is a key topic in the development of smart adaptive shape memory composites (SASMC). In this work, a constitutive model for SASMC is developed. First, a one-dimensional SMA model, which can simulate the pseudoelastic (PE) and shape memory effects (SME) is presented. Subsequently, a one-dimensional SMP model able to reproduce the SME is addressed. Both SMA and SMP models are based on a single internal state variable, namely the martensite fraction and the frozen fraction, which can be expressed as a function of temperature. A consistent form of the analytical solution for the SMP model is obtained using the fourth-order Runge–Kutta method. Finally, the SASMC constitutive model is proposed, following two analytical homogenization approaches. One approach is based on an equivalent inclusion method and the other approach is the rule of mixtures. The SMA and SMP constitutive models are validated independently with experimental results. However, the validation of the composite model is performed using the two homogenization approaches and a close agreement in results is observed. Results regarding the isothermal and thermomechanical stress–strain responses are analyzed as a function of SMA volume fraction. Further, it is concluded that the proposed composite model is able to reproduce consistently the overall composite response by taking into consideration not only the phase transformations, variable modulus and transformation stresses in SMA but also the variable modulus, the evolution of stored strain and thermal strain in the SMP
Lopes, M; Roll, V F B; Leite, F L; Dai Prá, M A; Xavier, E G; Heres, T; Valente, B S
2013-03-01
Testing different management practices can help to identify conditions that decrease or even eliminate pathogenic bacteria in poultry litter. A trial was conducted to evaluate the effects of daily manual stirring (rotation of the litter with a pitchfork) for the first 14 d of a bird's life (WDR), in 3 types of poultry litter substrates and quicklime treatment (CaO) during layout time between flocks on pathogenic bacteria occurrence (cfu). A total of 216 male Cobb broilers were randomly allotted to 18 pens with new litter (experimental unit). A split-plot design, with 6 treatments allotted to the main plots, was used: 1) wood shavings (WS) + WDR, 2) WS without stirring up to 14 d (WODR), 3) rice hulls (RIH) + WDR, 4) RIH + WODR, 5) mixture of 50% RIH and WS + WDR, and 6) mixture of 50% RIH and WS + WODR. Two treatments were allotted to the subplots: 0 and 300 g of CaO•m(-2) litter. After depopulation, litter samples were collected, and CaO was incorporated into the litter in the designated half of each pen. The cfu from litter samples after 7 d of the quicklime treatment were counted on Chapman agar, brain heart infusion media, and MacConkey agar. The data were analyzed using ANOVA, and the means were compared by least squares means (P litter efficiently reduced the cfu observed on brain heart infusion, Chapman agar, and MacConkey agar media by 57.2, 66.9, and 92.1%, respectively, compared with control (6.4, 17.9, and 46.1%; P litter reduces the cfu, regardless of the substrate and stirring performed.
Fabrication and characterization of a dual-joint smart inhaler nozzle actuated by embedded SMA wires
International Nuclear Information System (INIS)
Furst, Stephen J; Seelecke, Stefan
2014-01-01
Shape memory alloy (SMA) wires offer a novel solution for many embedded actuator and sensor applications. Small SMA wires in particular can be heated with a relatively low electric current, cool rapidly, and serve as a sensor thanks to a measurable resistance change. However, the challenges of fabrication with SMA actuator wires as well as their hysteretic nature have prevented them from finding mainstream application. This work focuses on the process used to control the fabrication of an SMA-actuated adaptive nozzle for the previously presented Smart Inhaler application. The elements of nozzle design that facilitate fabrication are summarized and an assembly setup and procedure is presented for controlling the stress and strain in the SMA wires while they are attached to the nozzle structure via temperature-resistant adhesives. Finally, the performance of the nozzle is characterized by measuring the changes in nozzle deflection and SMA wire strain and resistance in response to a controlled Joule heating power input. Results show controlling pre-stress in the wires during assembly can lead to reproducible behavior, an input heating power serves to control nozzle deflection, and a measured resistance can provide a useful sensor of SMA wire strain and nozzle joint deflection. (paper)
Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João
2011-01-01
Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...
Directory of Open Access Journals (Sweden)
Danieli Schneiders
2013-08-01
Full Text Available In this study, specific methanogenic activity (SMA tests were performed on textile sludge and food industry sludge. The textile sludge from an activated sludge was collected at the entrance of the secondary biologic clarifier and the food sludge was collected in a UASB reactor. Once collected, the sludges were characterized and tested for SMA. It was found that the microrganisms present in the food sludge had SMA of 0.17 gCOD-CH4 gSSV.d-1 and 337.05 mL of methane production, while the microrganisms of the textile sludge presented 0.10 gCOD-CH4 gSSV.d-1 of SMA and 3.04 mL of methane production. Therefore, the food sludge was more suitable to be used as a starting inoculum in UASB.
Methods for identifying lipoxygenase producing microorganisms on agar plates
Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.
2012-01-01
Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching
Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.
Chang, S S; Park, S H; Kang, D H
2013-06-03
The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.
Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen
2015-01-01
Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low
Element distribution of the barley plant grown in an agar slice suspended culture
International Nuclear Information System (INIS)
Makino-Nakanishi, Tomoko; Matsumoto, Satoshi
1991-01-01
An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)
Assessment of Native Agar Gels Extracted from Gracilaria debilis ...
African Journals Online (AJOL)
Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...
International Nuclear Information System (INIS)
Szopinski, Piotr; Ciostek, Piotr; Pleban, Eliza; Iwanowski, Jaroslaw; Krol, Malgorzata Serafin-; Marianowska, Agnieszka; Noszczyk, Wojciech
2005-01-01
Visceral aneurysms are potentially life-threatening vascular lesions. Superior mesenteric artery (SMA) pseudoaneurysms are a rare but well-recognized complication of chronic pancreatitis. Open surgical repair of such an aneurysm, especially in patients after previous surgical treatment, might be dangerous and risky. Stent graft implantation makes SMA pseudoaneurysm exclusion possible and therefore avoids a major abdominal operation. Percutaneous direct thrombin injection is also one of the methods of treating aneurysms in this area. We report a first case of percutaneous ultrasound-guided thrombin injection to complete SMA pseudoaneurysm exclusion after an unsuccessful endograft placement. Six-month follow-up did not demonstrate any signs of aneurysm recurrence
Recovery and residual stress of SMA wires and applications for concrete structures
International Nuclear Information System (INIS)
Choi, Eunsoo; Cho, Sung-Chul; Park, Taehyo; Hu, Jong Wan; Chung, Young-Soo
2010-01-01
In general, NiTi shape memory alloys are used for applications in civil structures. NiTi SMAs show good superelasticity and shape memory effect properties. However, for application of the shape memory effect, it is desirable for SMAs to show a wide temperature hysteresis, especially for civil structures which are exposed to severe environmental conditions. NiTiNb SMAs, in general, show a wider temperature hysteresis than NiTi SMAs and are more applicable for civil structures. This study examines the temperature hysteresis of NiTiNb and NiTi SMAs, and their recovery and residual stress are investigated. In addition, the tensile behaviors of SMA wires under residual stress are evaluated. This study explains the possible applications for concrete structures with the shape memory effect and illustrates two experimental results of concrete cylinders and reinforced concrete columns. For both tests, SMA wires of NiTiNb and NiTi are used to confine concrete using residual stress. The SMA wire jackets on the concrete cylinders increase the peak strength and the ductility compared to the plain concrete cylinders. In addition, the SMA wire jackets on reinforced concrete columns increase the ductility greatly without flexural strength degradation
Submillimeter Array (SMA) Newsletter August 2011
Blundell, Raymond
2011-01-01
Submillimeter Array (SMA) Newsletter August 2011 Blundell, Raymond Submillimeter Array Newsletter | Number 12 | August 2011 CONTENTS 1 From the Director SCIENCE HIGHLIGHTS: 2 Faint Submillimeter Sources behind Massive Lensing Clusters 5 Millimeter Imaging of the β Pictoris Debris Disk: Evidence for a Planetesimal Belt 7 Physical Properties of the Circumnuclear Starburst Ring in the Barred Galaxy NGC1097 TECHNICAL HIGHLIGHTS: 9 ...
Gebala, Barbara; Sandle, Tim
2013-01-01
In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.
Phenotypic and genotypic studies of ALS cases in ALS-SMA families.
Corcia, Philippe; Vourc'h, Patrick; Blasco, Helene; Couratier, Philippe; Dangoumau, Audrey; Bellance, Remi; Desnuelle, Claude; Viader, Fausto; Pautot, Vivien; Millecamps, Stephanie; Bakkouche, Salah; Salachas, FranÇois; Andres, Christian R; Meininger, Vincent; Camu, William
2018-03-01
Amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA) are the most frequent motor neuron disorders in adulthood and infancy, respectively. There is a growing literature supporting common pathophysiological patterns between those disorders. One important clinical issue for that is the co-occurrence of both diseases within a family. To collect families in which ALS and SMA patients co-exist and describe the phenotype and the genotype of ALS patients. Nine families with co-occurrence of SMA and ALS have been gathered over the last 15 years. Epidemiological, phenotype and genetic status were collected. Out of the nine families, six corresponded to the criteria of familial ALS (FALS). Clinical data were available for 11 patients out of the 15 ALS cases. Mean age of onset was 58.5 years, site of onset was lower limbs in nine cases (81.8%), median duration was 22 months. Four ALS patients carried a mutation: three mutations in SOD1 gene (G147N in two cases and one with E121G) and one repeat expansion in the C9ORF72 gene. Three patients had abnormal SMN1 copy numbers. While the high proportion of familial history of ALS cases in these ALS-SMA pedigrees could have suggested that these familial clusters of the two most frequent MND rely on a genetic background, we failed to exclude that this occurred by chance.
Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.
Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young
2014-10-17
This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright
A radiobiological comparison of human tumor soft-agar clonogenic assays.
West, C M; Sutherland, R M
1986-06-15
Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.
Directory of Open Access Journals (Sweden)
Suci Cahyati
2014-04-01
Full Text Available Penelitian ini bertujuan untuk menghasilkan produk berupa CD pembelajaran pendidikan jasmani olahraga dan kesehatan berbasis komputer untuk SMA yang valid dan efektif. Penelitian ini menggunakan metode Research and Development (R&D. Media yang dikembangkan memuat materi tentang HIV/AIDS. Pengembangan media pembelajaran ini menggunakan software Adobe Flash Cs3 Professional. Media yang telah dikembangkan melalui dua tahap penelitiannya itu validasi ahli dan uji coba lapangan. Berdasarkan validasi ahli dan uji coba lapangan hasil penelitian menunjukkan produk termasuk kriteria “Sangat baik” dengan rerata skor 4,25. Hasil tes siswa mengalami peningkatan dari rerata skor pretest 5,53 dan rerata skor posttest 7,56. Berdasarkan hasil tes tersebut dapat disimpulkan bahwa media pembelajaran pendidikan jasmani olahraga dan kesehatan efektif digunakan dalam pembelajaran di SMA. Kata kunci: Pengembangan media, penjasorkes, SMA
Directory of Open Access Journals (Sweden)
Fitriana A.R.
2015-11-01
Full Text Available Analisis diskriminan merupakan bagian dari analisis peubah ganda. Analisis diskriminan digunakan untuk memodelkan variabel tak bebas yang bersifat kualitatif dengan variabel bebas yang bersifat kuantitatif. Pada penelitian ini, analisis diskriminan lebih dari dua kelompok diterapkan pada data nilai akhir SMA/MA di Kabupaten Aceh Selatan yang bertujuan untuk mendapatkan model untuk pengklasifikasian kecamatan. Pengklasifikasian ini bertujuan untuk melihat perbedaan kualitas siswa SMA/MA yang berada di masing-masing kecamatan Kabupaten Aceh Selatan berdasarkan data nilai akhir. Variabel tak bebas yang digunakan berupa klasifikasi kecamatan berdasarkan rata-rata jumlah nilai akhir SMA/MA yang berada di masing-masing kecamatan yang dibentuk dengan K-Means Cluster. Sedangkan variabel bebas yang digunakan adalah data rata-rata nilai akhir SMA/MA untuk setiap mata pelajaran yang diujiankan pada masing-masing jurusan setiap kecamatan. Model yang didapatkan adalah dua model diskriminan untuk jurusan IPA dan IPS.
Assay for adhesion and agar invasion in S. cerevisiae.
Guldal, Cemile G; Broach, James
2006-11-08
Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth
PERFIL ETIOLÓGICO DA MASTITE BOVINA NA BACIA LEITEIRA DE SANTA IZABEL DO OESTE, PARANÁ
Directory of Open Access Journals (Sweden)
Lucianne Leigue dos Santos
2010-12-01
Full Text Available Clinical or sub-clinical mastitis are the main illnesses that affect dairy herds, with impact on the economy, the industry, and with consequence to public health. Considering that the city of Santa Izabel do Oeste is located in the second bigger milk region of Paraná state, and that mastitis cases are epidemiologically classified as ambient or contagious, the purpose of this study was to identify possible etiologic agents of bovine mastitis, by the use of a preliminary, fast and cheap diagnostic method to differentiate these types of illness, to orient treatment and prophylactic measures. Two triplates were employed. Triplate I was composed by blood agar, bile-esculine agar and mannitol-salt agar, while triplate II was composed by MacConkey agar; Baird-Parker agar and sabouraud-dextrose agar with cloranfenicol. Additionally, a tube with sabouraud-dextrose agar with cloranfenicol incubated at room temperature temperature was used for the research of filamentous moulds. It was observed that the great majority of the isolated samples had Staphylococcus coagulase negative, coliforms, Staphylococcus aureus, no-fermenters bacilli gram negative, Coryneforms, Streptococcus spp. and Streptococcus agalactiae.
EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS
Directory of Open Access Journals (Sweden)
A. Villalobos
2007-12-01
Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.
Semantic memory retrieval circuit: role of pre-SMA, caudate, and thalamus.
Hart, John; Maguire, Mandy J; Motes, Michael; Mudar, Raksha Anand; Chiang, Hsueh-Sheng; Womack, Kyle B; Kraut, Michael A
2013-07-01
We propose that pre-supplementary motor area (pre-SMA)-thalamic interactions govern processes fundamental to semantic retrieval of an integrated object memory. At the onset of semantic retrieval, pre-SMA initiates electrical interactions between multiple cortical regions associated with semantic memory subsystems encodings as indexed by an increase in theta-band EEG power. This starts between 100-150 ms after stimulus presentation and is sustained throughout the task. We posit that this activity represents initiation of the object memory search, which continues in searching for an object memory. When the correct memory is retrieved, there is a high beta-band EEG power increase, which reflects communication between pre-SMA and thalamus, designates the end of the search process and resultant in object retrieval from multiple semantic memory subsystems. This high beta signal is also detected in cortical regions. This circuit is modulated by the caudate nuclei to facilitate correct and suppress incorrect target memories. Copyright © 2012 Elsevier Inc. All rights reserved.
Development of SMA Actuated Morphing Airfoil for Wind Turbine Load Alleviation
Karakalas, A.; Machairas, T.; Solomou, A.; Riziotis, V.; Saravanos, D.
Wind turbine rotor upscaling has entered a range of rotor diameters where the blade structure cannot sustain the increased aerodynamic loads without novel load alleviation concepts. Research on load alleviation using morphing blade sections is presented. Antagonistic shape memory alloy (SMA) actuators are implemented to deflect the section trailing edge (TE) to target shapes and target time-series relating TE movement with changes in lift coefficient. Challenges encountered by the complex thermomechanical response of morphing section and the enhancement of SMA transient response to achieve frequencies meaningful for aerodynamic load alleviation are addressed. Using a recently developed finite element for SMA actuators [1], actuator configurations are considered for fast cooling and heating cycles. Numerical results quantify the attained ranges of TE angle movement, the moving time period and the developed stresses. Estimations of the attained variations of lift coefficient vs. time are also presented to assess the performance of the morphing section.
Protective effects of long-term lithium administration in a slowly progressive SMA mouse model.
Biagioni, Francesca; Ferrucci, Michela; Ryskalin, Larisa; Fulceri, Federica; Lazzeri, Gloria; Calierno, Maria Teresa; Busceti, Carla L; Ruffoli, Riccardo; Fornai, Francesco
2017-12-01
In the present study we evaluated the long-term effects of lithium administration to a knock-out double transgenic mouse model (Smn-/-; SMN1A2G+/-; SMN2+/+) of Spinal Muscle Atrophy type III (SMA-III). This model is characterized by very low levels of the survival motor neuron protein, slow disease progression and motor neuron loss, which enables to detect disease-modifying effects at delayed time intervals. Lithium administration attenuates the decrease in motor activity and provides full protection from motor neuron loss occurring in SMA-III mice, throughout the disease course. In addition, lithium prevents motor neuron enlargement and motor neuron heterotopy and suppresses the occurrence of radial-like glial fibrillary acidic protein immunostaining in the ventral white matter of SMA-III mice. In SMA-III mice long-term lithium administration determines a dramatic increase of survival motor neuron protein levels in the spinal cord. These data demonstrate that long-term lithium administration during a long-lasting motor neuron disorder attenuates behavioural deficit and neuropathology. Since low level of survival motor neuron protein is bound to disease severity in SMA, the robust increase in protein level produced by lithium provides solid evidence which calls for further investigations considering lithium in the long-term treatment of spinal muscle atrophy.
An improved tuned mass damper (SMA-TMD) assisted by a shape memory alloy spring
International Nuclear Information System (INIS)
Mishra, Sudib K; Gur, Sourav; Chakraborty, Subrata
2013-01-01
The tuned mass damper (TMD) is a well acclaimed passive control device for vibration control of structures. However, the requirement of a higher mass ratio restricts its applicability for seismic vibration control of civil engineering structures. Improving the performance of TMDs has been attempted by supplementing them with nonlinear restoring devices. In this regard, the ability of shape memory alloy (SMA) in dissipating energy through a hysteretic phase transformation of its microstructure triggered by cyclic loading is notable. An improved version of TMD assisted by a nonlinear shape memory alloy (SMA) spring, referred as SMA-TMD, is studied here for seismic vibration mitigation. Extensive numerical simulations are conducted based on nonlinear random vibration analysis via stochastic linearization of the nonlinear force–deformation hysteresis of the SMA. A design optimization based on minimizing the root mean square displacement of the main structure is also carried out to postulate the optimal design parameters for the proposed system. The viability of the optimal design is verified with respect to its performance under recorded earthquake motions. Significant improvements of the control efficiency and a reduction of the TMD displacement at a much reduced mass ratio are shown to be achieved in the proposed SMA-TMD over those in the linear TMD. (paper)
Hichrom candida agar for identification of Candida species.
Baradkar, V P; Mathur, M; Kumar, S
2010-01-01
Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.
Hichrom candida agar for identification of candida species
Baradkar V; Mathur M; Kumar S
2010-01-01
Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...
Rheological properties of agar and carrageenan from Ghanaian red seaweeds
DEFF Research Database (Denmark)
Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh
2017-01-01
spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...
Metal muscles and nerves—a self-sensing SMA-actuated hand concept
Simone, F.; Rizzello, G.; Seelecke, S.
2017-09-01
Bio-inspired hand-like grippers actuated by Shape Memory Alloy (SMA) wires represent an emerging new technology with potential applications in many different fields, ranging from industrial assembly processes to biomedical systems. The inherently high energy density makes SMAs a natural choice for compact, lightweight, and silent actuator systems capable of producing a high amount of work, such as hand prostheses or robotic systems in industrial human/machine environments. In this work, a concept for a compact and versatile gripping system is developed, in which SMA wires are implemented as antagonistic muscles actuating an artificial hand with three fingers. In order to combine high gripping force with sufficient actuation speed, the muscle implementation pursues a multi-wire concept with several 0.1 mm diameter NiTi wires connected in parallel, in order to increase the surface-to-volume ratio for accelerated cooling. The paper starts with an illustration of the design concept of an individual 3-phalanx-finger, along with kinematic considerations for optimal placement of SMA wires. Three identical fingers are subsequently fabricated via 3D printing and assembled into a hand-like gripper. The maximum displacement of each finger phalanx is measured, and an average phalanxes dynamic responsiveness is evaluated. SMA self-sensing is documented by experiments relating the wires change in resistance to the finger motion. Several finger force measurements are also performed. The versatility of the gripper is finally documented by displaying a variety of achievable grasping configurations.
Optimization of SMA layers in composite structures to enhance damping
Haghdoust, P.; Cinquemani, S.; Lecis, N.; Bassani, P.
2016-04-01
The performance of lightweight structures can be severely affected by vibration. New design concepts leading to lightweight, slender structural components can increase the vulnerability of the components to failure due to excessive vibration. The intelligent approach to address the problem would be the use of materials which are more capable in dissipating the energy due to their high value of loss factor. Among the different materials available to achieve damping, much attention has been attached to the use of shape memory alloys (SMAs) because of their unique microstructure, leading to good damping capacity. This work describes the design and optimization of a hybrid layered composite structure for the passive suppression of flexural vibrations in slender and light structures. Embedding the SMA layers in composite structure allows to combine different properties: the lightness of the base composite (e.g. fiber glass), the mechanical strength of the insert of metallic material and the relevant damping properties of SMA, in the martensitic phase. In particular, we put our attention on embedding the CuZnAl in the form of thin sheet in a layered composite made by glass fiber reinforced epoxy. By appropriately positioning of the SMA sheets so that they are subjected to the maximum curvature, the damping of the hybrid system can be considerably enhanced. Accordingly analytical method for evaluating the energy dissipation of the thin sheets with different shapes and patterns is developed and is followed by a shape optimization based on genetic algorithm. Eventually different configurations of the hybrid beam structure with different patterns of SMA layer are proposed and compared in the term of damping capacity.
Ramos, Ana Carolina; Carvalhaes, Cecília Godoy; Cordeiro-Moura, Jhonatha Rodrigo; Rockstroh, Anna Carolina; Machado, Antonia Maria Oliveira; Gales, Ana Cristina
2016-07-01
In this study, we evaluated the influence of distinct bacterial growth media on detection of carbapenemase hydrolysis by matrix-assisted laser desorption ionization-time of flight mass spectrometry. False-negative results were observed for OXA-25-, OXA-26-, and OXA-72-producing Acinetobacter baumannii isolates grown on MacConkey agar medium. The other culture media showed 100% sensitivity and 100% specificity for detecting carbapenemase. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Pengembangan Program Macromedia Flash 8 untuk Pembelajaran Fisika di SMA
Directory of Open Access Journals (Sweden)
Wiji Susilowati
2007-12-01
Full Text Available Tujuan penelitian adalah membuat dan mengevaluasi media pembelajaran fisika SMA menggunakan program Macromedia Flash 8. Subjek coba pada penelitian ini berjumlah 40 orang yang terdiri dari 10 siswa untuk uji coba instrumen penelitian, 10 siswa untuk ujicoba kelompok kecdl, dan 20 siswa untuk uji coba lapangan. Pengumpulan data dilakukan dengan menggunakan kuesioner dan tes fisika (pre-test dan post-test. Evaluasi terhadap program ditinjau dari aspek pembelajaran dan aspek media. Kritik dan saran digunakan untuk memperbaiki program. Hasil penelitian menunjukkan bahwa program Macromedia Flash 8 untuk pembelajaran fisika di SMA: (1 dirancang sesuai dengan prinsip-prinsip desain pembelajaran, (2 terbukti mampu menaikkan skor rerata tes fisika siswa sebesar 55,42%, (3 memiliki efisiensi waktu yang tinggi, (4 ditinjau dari aspek media Hinilai cukup bagus/menarik (dinilai/dikategorikan sedang oleh siswa, (5 ditinjau dari aspek pembelajaran secara keseluruhan program ini dinilai tinggi/jelas dimengerti oleh siswa, (6 ditinjau dari aspek media dinilai menarik (bagus/kategori tinggi oleh guru fisika, dan (7 ditinjau dari aspek pembelajaran juga dinilai menarik (bagus/kategori tinggi oleh guru fisika. Kata kunci: media pembelajaran fisika diSMA.
Hichrom candida agar for identification of candida species
Directory of Open Access Journals (Sweden)
Baradkar V
2010-01-01
Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.
Desta, Adey F; Dalhammer, Gunnel; Kittuva, Gunatrana R
2010-01-01
Though culture-independent methods have been used in preference to traditional isolation techniques for characterization of microbial community of wastewater treatment plants, it is difficult to widely apply this approach in resource-poor countries. The present study aimed to develop a test to identify the culturable portion of bacterial community in a high-strength wastewater. Wastewater samples were collected from nitrification-denitrification and settling tanks of the treatment plant of Elmo Leather AB tannery located in Borås, Sweden. After cultivating on nutrient agar with the optimal dilution (10⁻²), phenotypic and biochemical identification of the bacteria were done with colony morphology, Gram reaction, growth on MacConkey, phenylethanol media, triple sugar Iron agar slants, catalase and oxidase tests. Biochemical grouping of the isolates was done based on their test results for MacConkey, phenylethanol media, triple sugar Iron agar and oxidase test reaction. From the biochemical groups, isolates were randomly selected for API test and 16SrRNA gene sequencing. The isolates from the denitrification, nitrification tank were identified to be Paracoccus denitrificans (67%), Azoarcus spp (3%) and Spingomonas wittichii (1%). From the settling tank, Paracoccus denitrificans (22%), Corynebacterium freneyi (20%) and Bacillus cereus (1%) were identified. The grouping based on biochemical test results as well as the identification based on sequencing has shown coherence except for discrepancies with the API test. The preliminary implications of the grouping based on culture-based characteristics and its potential application for resource-limited environmental microbial studies is discussed.
Shape Memory Alloy (SMA)-Based Launch Lock
Badescu, Mircea; Bao, Xiaoqi; Bar-Cohen, Yoseph
2014-01-01
Most NASA missions require the use of a launch lock for securing moving components during the launch or securing the payload before release. A launch lock is a device used to prevent unwanted motion and secure the controlled components. The current launch locks are based on pyrotechnic, electro mechanically or NiTi driven pin pullers and they are mostly one time use mechanisms that are usually bulky and involve a relatively high mass. Generally, the use of piezoelectric actuation provides high precession nanometer accuracy but it relies on friction to generate displacement. During launch, the generated vibrations can release the normal force between the actuator components allowing shaft's free motion which could result in damage to the actuated structures or instruments. This problem is common to other linear actuators that consist of a ball screw mechanism. The authors are exploring the development of a novel launch lock mechanism that is activated by a shape memory alloy (SMA) material ring, a rigid element and an SMA ring holding flexure. The proposed design and analytical model will be described and discussed in this paper.
Low power consumption mini rotary actuator with SMA wires
Manfredi, Luigi; Huan, Yu; Cuschieri, Alfred
2017-11-01
Shape memory alloys (SMAs) are smart materials widely used as actuators for their high power to weight ratio despite their well-known low energy efficiency and limited mechanical bandwidth. For robotic applications, SMAs exhibit limitations due to high power consumption and limited stroke, varying from 4% to 7% of the total length. Hysteresis, during the contraction and extension cycle, requires a complex control algorithm. On the positive side, the small size and low weight are eminently suited for the design of mini actuators for robotic platforms. This paper describes the design and construction of a light weight and low power consuming mini rotary actuator with on-board contact-less position and force sensors. The design is specifically intended to reduce (i) energy consumption, (ii) dimensions of the sensory system, and (iii) provide a simple control without any need for SMA characterisation. The torque produced is controlled by on-board force sensors. Experiments were performed to investigate the energy consumption and performance (step and sinusoidal angle profiles with a frequency varying from 0.5 to 10 Hz and maximal amplitude of {15}\\circ ). We describe a transient capacitor effect related to the SMA wires during the sinusoidal profile when the active SMA wire is powered and the antagonist one switched-off, resulting in a transient current time varying from 300 to 400 ms.
Passive base isolation with superelastic nitinol SMA helical springs
International Nuclear Information System (INIS)
Huang, Bin; Zhang, Haiyang; Wang, Han; Song, Gangbing
2014-01-01
Seismic isolation of structures such as multi-story buildings, nuclear reactors, bridges, and liquid storage tanks should be designed to preserve structural integrity. By implementing seismic isolation technology, the deformation of superstructures can be dramatically reduced, consequently helping to protect their safety as well. In this paper, an innovative type of passive base isolation system, which is mainly composed of superelastic nitinol SMA helical springs, is developed. In order to verify the effectiveness of the proposed system, a two-story experimental steel frame model is constructed, and two superelastic SMA helical springs are thermo-mechanically built in the laboratory. To describe the nonlinear mechanical properties of the superelastic SMA helical springs under reciprocating load, a phenomenological model is presented in terms of a series of tensile tests. Afterwards, a numerical model of the two-story frame with the suggested isolation system is set up to simulate the response of the isolated frame subjected to an earthquake. Both the experimental and the numerical simulation results indicate that the proposed base isolation system can remarkably suppress structural vibrations and has improved isolation effects when compared with a steel spring isolation system. Due to the capabilities of energy dissipation as well as fully re-centering, it is very applicable to utilize the suggested isolation system in base isolated structures to resist earthquakes. (paper)
Design and fabrication of a three-finger prosthetic hand using SMA muscle wires
Simone, Filomena; York, Alexander; Seelecke, Stefan
2015-03-01
Bio-inspired hand-like gripper systems based on shape memory alloy (SMA) wire actuation have the potential to enable a number of useful applications in, e.g., the biomedical field or industrial assembly systems. The inherent high energy density makes SMA solutions a natural choice for systems with lightweight, low noise and high force requirements, such as hand prostheses or robotic systems in a human/machine environment. The focus of this research is the development, design and realization of a SMA-actuated prosthetic hand prototype with three fingers. The use of thin wires (100 μm diameter) allows for high cooling rates and therefore fast movement of each finger. Grouping several small wires mechanically in parallel allows for high force actuation. To save space and to allow for a direct transmission of the motion to each finger, the SMA wires are attached directly within each finger, across each phalanx. In this way, the contraction of the wires will allow the movement of the fingers without the use of any additional gears. Within each finger, two different bundles of wires are mounted: protagonist ones that create bending movement and the antagonist ones that enable stretching of each phalanx. The resistance change in the SMA wires is measured during actuation, which allows for monitoring of the wire stroke and potentially the gripping force without the use of additional sensors. The hand is built with modern 3D-printing technologies and its performance while grasping objects of different size and shape is experimentally investigated illustrating the usefulness of the actuator concept.
International Nuclear Information System (INIS)
Rajan, Aravindh; Abouseada, Mostafa; Manghaipathy, Pavithra; Ozalp, Nesrin; Majid, Feras Abdul; Salem, Ayman; Srinivasa, Arun
2016-01-01
Highlights: • An iris mechanism proposed in response to fluctuations in solar energy. • Iris motion controlled with the use of Nickel–Titanium Shape Memory Alloy springs. • Variation of the force exerted by SMA spring w.r.t. temperature tested experimentally. • An analytical expression that relates the aperture area and crank rotation is given. • SMA springs showed promising actuation mechanism as a replacement to motor. - Abstract: Variation in incoming solar energy adversely affects the temperature inside a solar reactor and lowers its efficiency. Therefore, it is important to develop a mechanism that can maintain semi-constant temperatures inside the reactor from sunrise to sunset. In this paper, we present an iris mechanism that reduces or enlarges its circular opening with the use of Nickel–Titanium Shape Memory Alloy (SMA) springs. SMA springs possess memory of their shapes at certain temperatures. Hence, by controlling the temperature of the spring, it is possible to exert different forces that may then be transferred to the variable aperture mechanism. In this study, variation of the force exerted by an SMA spring with respect to temperature was experimentally tested and the viability of an SMA spring’s use in actuating an iris mechanism aperture was examined. In order to simulate conditions under fluctuating solar radiation, a 7 kW solar simulator was used in experiments at varying power levels. It was observed that SMA springs are promising as a replacement of the actuation mechanism driven by a motor.
Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme
Directory of Open Access Journals (Sweden)
Murdinah murdinah
2008-06-01
Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.
MODEL PENGEMBANGAN PERANGKAT PEMBELAJARAN SEJARAH BERORIENTASI METAKOGNITIF JENJANG SMA
Directory of Open Access Journals (Sweden)
Cahyo Budi Utomo
2015-01-01
Full Text Available The importance of metacognitive based history learning in the high school level as requested in the “curriculum 2013” is the main background of this research. The research is focused to find the model of development of metacognitive based learning through research and development (R&D type research. The results showed an essential component in achieving successful management of metacognitive based history learning in high school education which the curriculum as a core competency analysis and basic competencies, lesson plan development, and the development of assessment tools. Development model of metacognitive based learning at high school education have main characteristic of the inclusion of explicit metacognitive learning goals and assignments and devices equipped with a rubric and assessment questionnaire. Metacognitive based history learning instructional tools that are developed in senior high school level has been carried out as optimally as possible by involving history teachers in the process of development and testing through focus group discussions and questionnaire.Keywords: Model, Instructional tool, Metacognitive, senior high school levelPentingnya orientasi metakognitif dalam perangkat pembelajaran sejarah jenjang SMA sebagaimana yang dikehendaki dalam implementasi kurikulum 2013 merupakan latar belakang utama penelitian ini. Penelitian difokuskan untuk menemukan model pengembangan perangkat pembelajaran berorientasi metakognitif melalui penelitian berjenis riset dan pengembangan (R&D. Metode penelitian R&D dilaksanakan melalui tiga tahap utama yaitu: tahap studi pendahuluan, tahap pengembangan, dan tahap uji publik. Hasil penelitian menunjukkan komponen esensial dalam mewujudkan keberhasilan penge-lolaan pembelajaran sejarah berorientasi metakognitif pada jenjang pendidikan SMA adalah kurikulum sebagai bahan analisis kompetensi inti dan kompetensi dasar, pengembangan RPP, dan pengembangan perangkat assesmen. Model
Directory of Open Access Journals (Sweden)
Asep Agus Sulaeman
2015-03-01
Full Text Available Tujuan penelitian ini adalah untuk mengetahui kreativitas guru Biologi SMA dalam memetakan topik-topik dari berbagai aspek komoditas hayati unggulan lokal melalui penggunaan metode mind map dan mengetahui kemampuan guru dalam memetakan topik-topik komoditas hayati unggulan lokal ke dalam pembelajaran Biologi di SMA. Analisis data kreativitas guru Biologi SMA dilakukan secara deskriptif kuantitatif terhadap mind map dengan menggunakan kriteria sesuai instrumen yang dikembangkan. Adapun analisis data tentang jumlah topik-topik Biologi dan jenis kegiatan pembelajaran berbasis komoditas hayati unggulan lokal dilakukan secara deskriptif kuantatif dan kualitatif. Hasil kajian ini menunjukkan nilai aspek-aspek kreativitas guru Biologi yang tinggi, yaitu kemampuan berpikir asli (91,67, peka terhadap masalah (91,67, kemampuan berpikir lancar (90, kemampuan berpikir luwes (88,33, dan kemampuan berpikir terperinci (86,67. Berdasarkan hasil pemetaan yang dilakukan guru, dapat diidentifikasi 15 topik Biologi SMA yang berkaitan dengan komoditas hayati unggulan lokal di Kabupaten Majalengka. Adapun kegiatan pembelajaran berbasis komoditas hayati unggulan yang diusulkan oleh guru tersebar di masing-masing tingkatan kelas dan semesternya dengan jumlah yang berbeda-beda.
Directory of Open Access Journals (Sweden)
Azis Azis
2015-11-01
Full Text Available Penelitian untuk mendeskripsikan tingkat dan letak kesulitan belajar matematika siswa pada aspek kognitif dan kategorisasi masalah belajar matematika siswa pada aspek afektif dalam menghadapi Ujian Nasional tahun pelajaran 2013/2014 SMA di Kota Baubau. Penelitian ini menggunakan penelitian dengan metode survei. Pengumpulan data yang digunakan adalah teknik pengukuran (tes diagnostik, kuisioner, dan wawancara. Hasil penelitian menunjukkan bahwa tingkat kesulitan belajar matematika yang dialami oleh siswa untuk menyelesaikan soal-soal Ujian Nasional berada pada kategori sedang; letak kesulitan belajar matematika siswa pada aspek kognitif dalam menyelesaikan soal-soal Ujian Nasional dilihat dari segi pengetahuan faktual dengan persentase interval kesulitan sebesar, segi pengetahuan konseptual dengan persentase interval kesulitan sebesar, dan segi pengetahuan prosedural dengan persentase interval kesulitan sebesar; dan kategorisasi masalah belajar matematika siswa pada kategori aspek afektif dalam menghadapi Ujian Nasional tahun pelajaran 2013/2014 SMA di Kota Baubau secara umum berada pada kategori rendah. Kata kunci: kesulitan belajar matematika, kognitif, afektif, ujian nasional SMA AN ANALYSIS OF DIFFICULTY ON COGNITIVE AND PROBLEM ON AFFECTIVE OF SMA STUDENTS IN MATHEMATICS LEARNING FACING NATIONAL EXAMINATION Abstract This study aims to describe the degree of student’s learning difficulty of mathematics on cognitive and categorization of student’s learning problem on affective aspect in accomplishing mathematic items in facing national final exam of SMA Baubau municipality in 2013/2014 academic year. The research type uses survey method. The technique of data collecting made use of diagnostic test that is National final exam items in 2012/2013 academic year which was modified by the researcher, questionnaires, and interviews. The research result indicates that the degree of students’ learning difficulty of mathematics to accomplish
Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli
2013-01-01
Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...
Group-SMA Algorithm Based Joint Estimation of Train Parameter and State
Directory of Open Access Journals (Sweden)
Wei Zheng
2015-03-01
Full Text Available The braking rate and train arresting operation is important in the train braking performance. It is difficult to obtain the states of the train on time because of the measurement noise and a long calculation time. A type of Group Stochastic M-algorithm (GSMA based on Rao-Blackwellization Particle Filter (RBPF algorithm and Stochastic M-algorithm (SMA is proposed in this paper. Compared with RBPF, GSMA based estimation precisions for the train braking rate and the control accelerations were improved by 78% and 62%, respectively. The calculation time of the GSMA was decreased by 70% compared with SMA.
SMA-Based System for Environmental Sensors Released from an Unmanned Aerial Vehicle
Directory of Open Access Journals (Sweden)
Lorenzo Pellone
2017-01-01
Full Text Available In the work at hand, a shape memory alloy (SMA-based system is presented. The system, conceived for releasing environmental sensors from ground or small unmanned aerial vehicles, UAV (often named UAS, unmanned aerial system, is made of a door, integrated into the bottom of the fuselage, a device distributor, operated by a couple of antagonistic SMA springs, and a kinematic chain, to synchronize the deployment operation with the system movement. On the basis of the specifications (weight, available space, energy supply, sensors size, etc., the system design was addressed. After having identified the main system characteristics, a representative mock-up was manufactured, featuring the bottom part of the reference fuselage. Functionality tests were performed to prove the system capability to release the sensors; a detailed characterization was finally carried out, mainly finalized at correlating the kinematic chain displacement with the SMA spring temperature and the supplied electrical power. A comparison between theoretical predictions and experimental outcomes showed good agreement.
Kajian Fisis Energi Terbarukan Panel Surya Melalui Eksperimen Sederhana untuk Siswa SMA
Directory of Open Access Journals (Sweden)
Sunaryo Sunaryo
2015-12-01
Full Text Available Abstract Has conducted research on the effects of light intensity on the output voltage, current, and power. Research conducted generate data in the form of quantitative and graphs that show a link between the intensity of light, the output voltage, current, and power. The data obtained were used as sources of learning in senior high school (SMA. The implication is capable of enhancing creativity, motivation and learning outcomes of Physics subject of high school students in future studies. Keywords: light intensity, current, voltage, solar panel Abstrak Telah dilakukan penelitian tentang pengaruh intensitas cahaya terhadap tegangan output, arus, dan daya listrik. Penelitian yang dilakukan menghasilkan data dalam bentuk kuantitatif dan grafik yang menunjukkan adanya kaitan antara intensitas cahaya, tegangan output, arus, dan daya listrik. Data yang diperoleh dijadikan sebagai sumber informasi dalam pembelajaran di Sekolah Menengah Atas (SMA. Implikasinya adalah mampu meningkatkan kreativitas, motivasi, dan hasil belajar Fisika siswa SMA pada penelitian selanjutnya. Kata-kata kunci: intensitas cahaya, arus, tegangan, panel surya
Simulación basada en SMA de sistemas originalmente representados con EDO
Directory of Open Access Journals (Sweden)
Ekaitz Zulueta Guerrero
2011-10-01
Full Text Available Resumen: En el presente trabajo se expone una metodología para modelar mediante un Sistema Multi-Agente (SMA sistemas biológicos y fisiológicos dinámicos con variables cuantificadas discretas, como el crecimiento y decrecimiento de poblaciones o el modelado epidemiológico de enfermedades. Se muestra un procedimiento para transformar un sistema de Ecuaciones Diferenciales Ordinarias (EDO (que modela un entorno de forma correcta en un SMA equivalente mediante un esquema basado en el método de Monte Carlo. Se utiliza un caso práctico fundamentado en un modelo matemático de Leucemia Mieloide Crónica (LMC para comparar la metodología basada en agentes con el modelado tradicional basado en un sistema de EDO. Se realiza una simulación con cada modelo (SMA y EDO y se compara los resultados obtenidos con ambas metodologías. Palabras clave: Ecuaciones diferenciales, modelo basado en agentes, Monte Carlo
PROFIL KESULITAN BELAJAR FISIKA POKOK BAHASAN KELISTRIKAN SISWA SMA DI KOTA SEMARANG
Directory of Open Access Journals (Sweden)
Ani Rusilowati
2012-01-01
Full Text Available Tujuan penelitian ini adalah menentukan profil kesulitan belajar Fisika, khususnya pokok bahasan Kelistrikan yang dialami oleh siswa SMA di kota Semarang. Sampel penelitian adalah siswa SMA kelas X di kota Semarang, diambil secara cluster, dari SMA negeri dan swasta peringkat I, II, dan III, sebanyak 214 siswa. Kesulitan belajar didiagnosis dengan lima pendekatan, yaitu tujuan pembelajaran, pengetahuan prasyarat, profil materi, miskonsepsi, dan pengetahuan terstruktur. Kesulitan belajar Kelistrikan antara lain disebabkan oleh rendahnya penguasaan konsep, lemahnya kemampuan matematis, dan kekurangmampuan mengkonversi satuan. Penyebab kesulitan belajar dalam pengetahuan terstruktur adalah rendahnya kemampuan: verbal, menggunakan skema, membuat strategi pemecahan masalah, dan membuat algoritma. Hasil penelitian menunjukkan bahwa kesulitan belajar Kelistrikan rata-rata terjadi pada sub pokok bahasan: Kuat Arus Listrik, Hukum Ohm, Hambatan Penghantar, Hukum Kirchof II, Energi & Daya Listrik, dan Transformator. Sebagian siswa masih mengalami miskonsepsi terhadap konsep Hukum Ohm dan Hambatan Penghantar. Bagi siswa sekolah peringkat III mengalami kesulitan belajar di semua aspek dan materi Kelistrikan Kata kunci : profil, kesulitan belajar, kelistrikan
International Nuclear Information System (INIS)
Choi, Eunsoo; Park, Sun-Hee; Chung, Young-Soo; Kim, Hee Sun
2013-01-01
The aim of this study is to provide seismic fragility curves of reinforced concrete columns retrofitted by shape memory alloy wire jackets and thus assess the seismic performance of the columns against earthquakes, comparing them with reinforced concrete columns with lap-spliced and continuous reinforcement. For that purpose, this study first developed analytical models of the experimental results of the three types of columns, (1) lap-spliced reinforcement, (2) continuous reinforcement and (3) lap-spliced reinforcement and retrofitted by SMA wire jackets, using the OpenSEES program, which is oriented to nonlinear dynamic analysis. Then, a suite of ten recorded ground motions was used to conduct dynamic analyses of the analytical models with scaling of the peak ground acceleration from 0.1g to 1.0g in steps of 0.1g. From the static experimental tests, the column retrofitted with SMA wire jackets had a larger displacement ductility by a factor of 2.3 times that of the lap-spliced column, which was 6% larger compared with the ductility of the continuous reinforcement column. From the fragility analyses, the SMA wire jacketed column had median values of 0.162g and 0.567g for yield and collapse, respectively. For the yield damage state, the SMA wire jacketed column had a median value similar to the continuous reinforcement column. However, for the complete damage state, the SMA wire jacketed column showed a 1.33 times larger median value than the continuously reinforcement column. (paper)
Directory of Open Access Journals (Sweden)
Richard S Finkel
Full Text Available Spinal Muscular Atrophy (SMA is a neurodegenerative motor neuron disorder resulting from a homozygous mutation of the survival of motor neuron 1 (SMN1 gene. The gene product, SMN protein, functions in RNA biosynthesis in all tissues. In humans, a nearly identical gene, SMN2, rescues an otherwise lethal phenotype by producing a small amount of full-length SMN protein. SMN2 copy number inversely correlates with disease severity. Identifying other novel biomarkers could inform clinical trial design and identify novel therapeutic targets.To identify novel candidate biomarkers associated with disease severity in SMA using unbiased proteomic, metabolomic and transcriptomic approaches.A cross-sectional single evaluation was performed in 108 children with genetically confirmed SMA, aged 2-12 years, manifesting a broad range of disease severity and selected to distinguish factors associated with SMA type and present functional ability independent of age. Blood and urine specimens from these and 22 age-matched healthy controls were interrogated using proteomic, metabolomic and transcriptomic discovery platforms. Analyte associations were evaluated against a primary measure of disease severity, the Modified Hammersmith Functional Motor Scale (MHFMS and to a number of secondary clinical measures.A total of 200 candidate biomarkers correlate with MHFMS scores: 97 plasma proteins, 59 plasma metabolites (9 amino acids, 10 free fatty acids, 12 lipids and 28 GC/MS metabolites and 44 urine metabolites. No transcripts correlated with MHFMS.In this cross-sectional study, "BforSMA" (Biomarkers for SMA, candidate protein and metabolite markers were identified. No transcript biomarker candidates were identified. Additional mining of this rich dataset may yield important insights into relevant SMA-related pathophysiology and biological network associations. Additional prospective studies are needed to confirm these findings, demonstrate sensitivity to change with
PELAKSANAAN PROGRAM BOARDING SCHOOL DALAM PEMBINAAN MORAL SISWA DI SMA TARUNA INDONESIA PALEMBANG
Directory of Open Access Journals (Sweden)
Hendriyenti H
2014-12-01
Full Text Available AbstractIndonesia nowadays faces some moral issues in teenagers scope or adult scope such as the use of drugs, violence, rascality, abortion, persecution, gambling, prostitution, and so on. Those problems are very danger for the country. Therefore, moral education is very important in this situation. The study was done at SMA Taruna Indonesia Palembang by the tittle: “the Implementation of boarding School Program for Students Moral education at SMA Taruna Indonesia Palembang”.Based on the result of the stuy, it was found that the implementation of boarding school program to educate students’moral at SMA Taruna Indonesia Palembang was applied throug dicipline implementation program and religion education program. Those two programs were applied by preventive and currative treatment. Moreover, there were some factors which support students’ moral education at SMA Taruna Indonesia Palembang such as students motivation, advisors dedication, 24 hours education and guidance, good coordination between advisors, teachers, securities, and other staff, and far location of boarding school from city center. As long as the teenager is an unstable period, there weremany difficulties in educate them. Finally,it is hoped that school stakeholders could improve the school management so that those difficulties could be solved and moral education could be applied. Keywords: boarding school, morality building
Directory of Open Access Journals (Sweden)
Thalyta Marina Benetti
2012-12-01
Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at
KEEFEKTIFAN TEKNIK RELAKSASI UNTUK MENURUNKAN STRES AKADEMIK SISWA SMA
Directory of Open Access Journals (Sweden)
Suyono Suyono
2016-08-01
Full Text Available Abstract: This study aims at examining the effectiveness of relaxation techniques to release students’stress and tension regarding academic within Senior High School Assádah in Gresik City. This study employed quasi-experiment design using one group pretest-posttest model. The data of this study were obtained through academic stress inventory to attain a depiction of stress level encountered by the subject. The subjects of this study were seven students of Tenth Graders in SMA Assaadah Bungah Gresik who experienced low to average stress regarding exam preparation. The data were, then, analyzed by using Wilcoxon Statistic Analysis. The result of the study indicated that relaxation technique could lower and release the level of students stress in exam preparation. Key Words: relaxation technique, student academic stress Abstrak: Penelitian ini bertujuan untuk menguji keefektifan teknik relaksasi untuk menurunkan stres akademik siswa SMA Ass’adah di Kota Gresik dengan menggunakan rancangan kuasi eksperimen dengan model “one group pretest posttest design. Pengumpulan data dengan menggunakan inventori stres akademik tujuannya untuk memperoleh gambaran tingkat stres akademik pada subjek penelitian. Subjek penelitian adalah siswa yang mengalami stres akademik sedang dan rendah dalam menghadapi ujian berjumlah 7 orang siswa pada kelas X SMA Assaadah Bungah Gresik. Teknik analisis data dengan menggunakanan analisis statistic Wilcoxon. Hasil penelitian menunjukkan adanya penurunan tingkat stres akademik menjelang ujian sesudah subjek mendapatkan layanan dengan teknik relaksasi. Kata kunci: Teknik relaksasi, stres akademik siswa
Seasonal variations of agar extracted from different life stages of ...
African Journals Online (AJOL)
Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...
Directory of Open Access Journals (Sweden)
Thomas O Crawford
Full Text Available The universal presence of a gene (SMN2 nearly identical to the mutated SMN1 gene responsible for Spinal Muscular Atrophy (SMA has proved an enticing incentive to therapeutics development. Early disappointments from putative SMN-enhancing agent clinical trials have increased interest in improving the assessment of SMN expression in blood as an early "biomarker" of treatment effect.A cross-sectional, single visit, multi-center design assessed SMN transcript and protein in 108 SMA and 22 age and gender-matched healthy control subjects, while motor function was assessed by the Modified Hammersmith Functional Motor Scale (MHFMS. Enrollment selectively targeted a broad range of SMA subjects that would permit maximum power to distinguish the relative influence of SMN2 copy number, SMA type, present motor function, and age.SMN2 copy number and levels of full-length SMN2 transcripts correlated with SMA type, and like SMN protein levels, were lower in SMA subjects compared to controls. No measure of SMN expression correlated strongly with MHFMS. A key finding is that SMN2 copy number, levels of transcript and protein showed no correlation with each other.This is a prospective study that uses the most advanced techniques of SMN transcript and protein measurement in a large selectively-recruited cohort of individuals with SMA. There is a relationship between measures of SMN expression in blood and SMA type, but not a strong correlation to motor function as measured by the MHFMS. Low SMN transcript and protein levels in the SMA subjects relative to controls suggest that these measures of SMN in accessible tissues may be amenable to an "early look" for target engagement in clinical trials of putative SMN-enhancing agents. Full length SMN transcript abundance may provide insight into the molecular mechanism of phenotypic variation as a function of SMN2 copy number.Clinicaltrials.gov NCT00756821.
Jegatheeswaran, Santhalingam; Baltatzis, Minas; Jamdar, Saurabh; Siriwardena, Ajith K
2017-06-01
Resection of the superior mesenteric artery (SMA) during pancreatectomy is performed infrequently and is undertaken with the aim of removing non-metastatic locally advanced pancreatic tumours. SMA resection reports also encompass resection of other visceral vessels. The consequences of resection of these different arteries are not necessarily equivalent. This is a focused systematic review of the outcome of SMA resection during pancreatectomy for cancer. A computerized search of the English language literature was undertaken for the period 1st January 2000 through 30th April 2016. The keywords "Pancreatic surgery" and "Vascular resections" were used. Thirteen studies reported 70 patients undergoing pancreatectomy with SMA resection from 10,726 undergoing pancreatectomy. Individual patient-level outcome data were available for 25. Median (range) accrual period was 132 (48-372) months. Reported peri-operative morbidity ranged from 39% to 91%. There were 5 peri-operative deaths in the 25 patients with individual-outcome data. Median survival was 11 months (95% Confidence interval 9.5-12.5 months; standard error 0.8 months). SMA resection during pancreatectomy is undertaken infrequently incurring high peri-operative morbidity and mortality. Median survival is 11 (95% CI 9.5-12.5) months. In contemporary practice there is no evidence to support SMA resection during pancreatectomy. Copyright © 2017 International Hepato-Pancreato-Biliary Association Inc. All rights reserved.
Analysis of SMA Hybrid Composite Structures in MSC.Nastran and ABAQUS
Turner, Travis L.; Patel, Hemant D.
2005-01-01
A thermoelastic constitutive model for shape memory alloy (SMA) actuators and SMA hybrid composite (SMAHC) structures was recently implemented in the commercial finite element codes MSC.Nastran and ABAQUS. The model may be easily implemented in any code that has the capability for analysis of laminated composite structures with temperature dependent material properties. The model is also relatively easy to use and requires input of only fundamental engineering properties. A brief description of the model is presented, followed by discussion of implementation and usage in the commercial codes. Results are presented from static and dynamic analysis of SMAHC beams of two types; a beam clamped at each end and a cantilever beam. Nonlinear static (post-buckling) and random response analyses are demonstrated for the first specimen. Static deflection (shape) control is demonstrated for the cantilever beam. Approaches for modeling SMAHC material systems with embedded SMA in ribbon and small round wire product forms are demonstrated and compared. The results from the commercial codes are compared to those from a research code as validation of the commercial implementations; excellent correlation is achieved in all cases.
Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.
Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon
2017-07-01
Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.
Directory of Open Access Journals (Sweden)
Ion-Cornel Mituletu
2015-06-01
Full Text Available The goal of the paper is to accomplish the response regarding the force-displacement characteristic evolution, of a Shape Memory Alloy (SMA actuator element. This reveals the first research stage in controlling the SMA behavior, providing important information about the heating-cooling time intervals. Step excitation of the SMA is performed by few values of electric current intensity, which produces the heating of SMA element up to 90-95 oC. To meet the testing requirements, an adequate test stand has been set up, consisting of sensors for force, displacement and temperature. The analog values provided by sensors were acquired and afterwards analyzed. The values of temperature, displacement and force were achieved, and their characteristic evolution has been performed. Thus, the time intervals are resulted and some other important aspects have been observed, regarding the delay between parameters and the temperature overshoot
Iyyappan Balaguru; Sathiavelu Sendhilkumar
2013-01-01
Due to the advancements in smart actuators, morphing (changing) of aircraft wings has been investigated by increasing number of researchers in recent years. In this research article, the concept of morphing is introduced to the conventional aircraft wing model with the utilization of Shape memory alloys (SMAs). An actuating mechanism is developed and built inside the aircraft wing model along with the SMA actuators which is used to morph its shape. The aircraft wing model with the SMA actuati...
Note: A component-level frequency tunable isolator for vibration-sensitive chips using SMA beams
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xiaoyong, E-mail: zhangxy@buaa.edu.cn, E-mail: yanxiaojun@buaa.edu.cn; Yan, Xiaojun, E-mail: zhangxy@buaa.edu.cn, E-mail: yanxiaojun@buaa.edu.cn [School of Energy and Power Engineering, Beihang University, Beijing 100191 (China); Collaborative Innovation Center of Advanced Aero-Engine, Beijing 100191 (China); National Key Laboratory of Science and Technology on Aero-Engine Aero-Thermodynamics, Beijing 100191 (China); Beijing Key Laboratory of Aero-Engine Structure and Strength, Beijing 100191 (China); Ding, Xin; Wu, Di; Qi, Junlei; Wang, Ruixin; Lu, Siwei [School of Energy and Power Engineering, Beihang University, Beijing 100191 (China)
2016-06-15
This note presents a component-level frequency tunable isolator for vibration-sensitive chips. The isolator employed 8 U-shaped shape memory alloy (SMA) beams to support an isolation island (used for mounting chips). Due to the temperature-induced Young’s modulus variation of SMA, the system stiffness of the isolator can be controlled through heating the SMA beams. In such a way, the natural frequency of the isolator can be tuned. A prototype was fabricated to evaluate the concept. The test results show that the natural frequency of the isolator can be tuned in the range of 64 Hz–97 Hz by applying different heating strategies. Moreover, resonant vibration can be suppressed significantly (the transmissibility decreases about 65% near the resonant frequency) using a real-time tuning method.
Note: A component-level frequency tunable isolator for vibration-sensitive chips using SMA beams
International Nuclear Information System (INIS)
Zhang, Xiaoyong; Yan, Xiaojun; Ding, Xin; Wu, Di; Qi, Junlei; Wang, Ruixin; Lu, Siwei
2016-01-01
This note presents a component-level frequency tunable isolator for vibration-sensitive chips. The isolator employed 8 U-shaped shape memory alloy (SMA) beams to support an isolation island (used for mounting chips). Due to the temperature-induced Young’s modulus variation of SMA, the system stiffness of the isolator can be controlled through heating the SMA beams. In such a way, the natural frequency of the isolator can be tuned. A prototype was fabricated to evaluate the concept. The test results show that the natural frequency of the isolator can be tuned in the range of 64 Hz–97 Hz by applying different heating strategies. Moreover, resonant vibration can be suppressed significantly (the transmissibility decreases about 65% near the resonant frequency) using a real-time tuning method.
Spliceosome integrity is defective in the motor neuron diseases ALS and SMA
Tsuiji, Hitomi; Iguchi, Yohei; Furuya, Asako; Kataoka, Ayane; Hatsuta, Hiroyuki; Atsuta, Naoki; Tanaka, Fumiaki; Hashizume, Yoshio; Akatsu, Hiroyasu; Murayama, Shigeo; Sobue, Gen; Yamanaka, Koji
2013-01-01
Two motor neuron diseases, amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA), are caused by distinct genes involved in RNA metabolism, TDP-43 and FUS/TLS, and SMN, respectively. However, whether there is a shared defective mechanism in RNA metabolism common to these two diseases remains unclear. Here, we show that TDP-43 and FUS/TLS localize in nuclear Gems through an association with SMN, and that all three proteins function in spliceosome maintenance. We also show that in ALS, Gems are lost, U snRNA levels are up-regulated and spliceosomal U snRNPs abnormally and extensively accumulate in motor neuron nuclei, but not in the temporal lobe of FTLD with TDP-43 pathology. This aberrant accumulation of U snRNAs in ALS motor neurons is in direct contrast to SMA motor neurons, which show reduced amounts of U snRNAs, while both have defects in the spliceosome. These findings indicate that a profound loss of spliceosome integrity is a critical mechanism common to neurodegeneration in ALS and SMA, and may explain cell-type specific vulnerability of motor neurons. PMID:23255347
Directory of Open Access Journals (Sweden)
Neni Lusiana
2015-07-01
Full Text Available Penelitian ini bertujuan untuk mengetahui Pteridophyta apa saja yang terdapat di kawasan Hutan Pacet Taman Hutan Raya Raden Soerjo Kecamatan Pacet Kabupaten Mojokerto dan bagaimana klasifikasinya, serta untuk mengetahui implementasi hasil penelitian Pteridophyta agar dapat digunakan sebagai sumber belajar biologi SMA. Jenis penelitian yang digunakan adalah jenis penelitian deskriptif. Penelitian di laksanakan di dua tempat, pengambilan sampel Pteridophyta dilaksanakan di kawasan hutan Pacet Taman Hutan Raya Raden Soerjo Kecamatan Pacet Kabupaten Mojokerto pada koordinat S 07o44’00” – S 07o42’10” dan E 112o31’30” – E 112o32’30”. Pengambilan sampel tumbuhan paku yang terestrial maupun epifit pada penelitian ini menggunakan metode jelajah (cruise methods. Sedangkan pemanfaatan hasil penelitian Pteridophyta di kawasan ini yaitu berupa modul yang divalidasi dilakukan oleh guru biologi di SMAN 2 Batu. Berdasarkan hasil penelitian ditemukan sebanyak 57 jenis Pteridophyta yang termasuk dalam 3 kelas. Ditemukan 3 jenis dari kelas Lycopodiinae, 1 jenis dari kelas Equisetinae, dan 53 jenis dari kelas Filicinae. Penggunaan Pteridophyta untuk sumber belajar di sekolah dalam bentuk modul dengan pemberian soal-soal dan pemberian tugas proyek membuat herbarium.
REKAYASA PERANGKAT LUNAK MEDIA INFORMASI SMA QURANIAH PALEMBANG
Directory of Open Access Journals (Sweden)
Herlinda Kusmiati
2017-08-01
Full Text Available Seiring dengan semakin berkembangnya teknologi informasi dan meningkatnya penggunaan internet sebagai media informasi dikalangan masyarakat Indonesia. Hal ini mendorong SMA Quraniah Palembang untuk membenahi media informasi yang ada saat ini untuk meningkatkan jumlah siswa. Media informasi yang dibuat berbasis website menggantikan Media informasi saat ini yang masih menggunakan media brosur dan banner, dimana informasi yang diberikan masih sebatas informasi mengenai visi misi, profile, dan syarat pendaftaran siswa baru yang tidak dapat diakses dengan mudah oleh masyarakat. Dengan media informasi berbasis website dapat memberikan kemudahan kepada masyarakat dalam mendapatkan informasi mengenai profil sekolah, persyaratan pendafataran siswa baru. Selain itu, media informasi ini menyediakan informasi mengenai kegiatan-kegiatan yang ada di sekolah, ektrakulikuler siswa, serta fasilitas yang ada di sekolah. Media informasi ini dikelola oleh admin tata usaha, sehingga kesalahan-kesalahan dalam penyampaian informasi akan lebih mudah diperbaiki. Informasi-informasi mengenai SMA Quraniah Palembang dapat diakses kapanpun dan dimanapu, tidak terbatas pada salah satu wilayah saja. Media informasi ini dibuat dengan menggunakan Php & Mysql dan Waterfall sebagai metode pengembangan sistem.
Sense of agency is related to gamma band coupling in an inferior parietal-preSMA circuitry
Directory of Open Access Journals (Sweden)
Anina eRitterband-Rosenbaum
2014-07-01
Full Text Available In the present study we tested whether sense of agency (SoA is reflected by changes in coupling between right medio-frontal/supplementary motor area (SMA and inferior parietal cortex (IPC. Twelve healthy adult volunteers participated in the study. They performed a variation of a line-drawing task (Nielsen, 1963;Fourneret and Jeannerod, 1998, in which they moved a cursor on a digital tablet with their right hand without seeing the hand. Visual feedback displayed on a computer monitor was either in correspondence with or deviated from the actual movement. This made participants uncertain as to the agent of the movement and they reported SoA in approximately 50% of trials when the movement was computer-generated. We tested whether IPC-preSMA coupling was associated with SoA, using dynamic causal modelling (DCM for induced responses (Chen et al., 2008;Herz et al., 2012. Nine different DCMs were constructed for the early and late phases of the task, respectively. All models included two regions: a superior medial gyrus (preSMA region and a right supramarginal gyrus (IPC region. Bayesian models selection (Stephan et al., 2009 favoured a model with input to IPC and modulation of the forward connection to SMA in the late task phase, and a model with input to preSMA and modulation of the backward connection was favoured for the early task phase. The analysis shows that IPC source activity in the 50-60Hz range modulated preSMA source activity in the 40-70 Hz range in the presence of SoA compared with no SoA in the late task phase, but the test of the early task phase did not reveal any differences between presence and absence of SoA. We show that SoA is associated with a directionally specific between frequencies coupling from IPC to preSMA in the higher gamma (ɣ band in the late task phase. This suggests that SoA is a retrospective perception, which is highly dependent on interpretation of the outcome of the performed action.
Sense of agency is related to gamma band coupling in an inferior parietal-preSMA circuitry
Ritterband-Rosenbaum, Anina; Nielsen, Jens B.; Christensen, Mark S.
2014-01-01
In the present study we tested whether sense of agency (SoA) is reflected by changes in coupling between right medio-frontal/supplementary motor area (SMA) and inferior parietal cortex (IPC). Twelve healthy adult volunteers participated in the study. They performed a variation of a line-drawing task (Nielsen, 1963; Fourneret and Jeannerod, 1998), in which they moved a cursor on a digital tablet with their right hand without seeing the hand. Visual feedback displayed on a computer monitor was either in correspondence with or deviated from the actual movement. This made participants uncertain as to the agent of the movement and they reported SoA in approximately 50% of trials when the movement was computer-generated. We tested whether IPC-preSMA coupling was associated with SoA, using dynamic causal modeling (DCM) for induced responses (Chen et al., 2008; Herz et al., 2012). Nine different DCMs were constructed for the early and late phases of the task, respectively. All models included two regions: a superior medial gyrus (preSMA) region and a right supramarginal gyrus (IPC) region. Bayesian models selection (Stephan et al., 2009) favored a model with input to IPC and modulation of the forward connection to SMA in the late task phase, and a model with input to preSMA and modulation of the backward connection was favored for the early task phase. The analysis shows that IPC source activity in the 50–60 Hz range modulated preSMA source activity in the 40–70 Hz range in the presence of SoA compared with no SoA in the late task phase, but the test of the early task phase did not reveal any differences between presence and absence of SoA. We show that SoA is associated with a directionally specific between frequencies coupling from IPC to preSMA in the higher gamma (ɣ) band in the late task phase. This suggests that SoA is a retrospective perception, which is highly dependent on interpretation of the outcome of the performed action. PMID:25076883
The effects of tertiary wastewater treatment on the prevalence of antimicrobial resistant bacteria
DEFF Research Database (Denmark)
Guardabassi, L.; Wong, Danilo Lo Fo; Dalsgaard, A.
2002-01-01
and anaerobically digested sludge by bacteriological counts on media selective for coliforms (MacConkey agar) and Acinetobacter spp. (Baumann agar). In addition, the level of antimicrobial susceptibility was determined by the disc-diffusion method in 442 Acinetobacter isolates identified by colony hybridisation......-resistant presumptive coliforms and Acinetobacter spp. in treated sewage and digested sludge were not significantly higher compared with raw sewage. On the contrary at one plant, statistically significant decreases were observed in the prevalence of ampicillin-resistant presumptive Acinetobacter spp. (p = 0.......0188) following sewage treatment, and in the prevalence of either ampicillin-resistant presumptive Acinetobacter spp. (p = 0.0013) or ampicillin- and gentamicin-resistant presumptive coliforms (p = 0.0273 and p = 0.0186) following sludge treatment. The results obtained by bacteriological counts were confirmed...
Buckling analysis of SMA bonded sandwich structure – using FEM
Katariya, Pankaj V.; Das, Arijit; Panda, Subrata K.
2018-03-01
Thermal buckling strength of smart sandwich composite structure (bonded with shape memory alloy; SMA) examined numerically via a higher-order finite element model in association with marching technique. The excess geometrical distortion of the structure under the elevated environment modeled through Green’s strain function whereas the material nonlinearity counted with the help of marching method. The system responses are computed numerically by solving the generalized eigenvalue equations via a customized MATLAB code. The comprehensive behaviour of the current finite element solutions (minimum buckling load parameter) is established by solving the adequate number of numerical examples including the given input parameter. The current numerical model is extended further to check the influence of various structural parameter of the sandwich panel on the buckling temperature including the SMA effect and reported in details.
Pieczyska, Elżbieta A.; Kowalewski, Zbigniew L.; Dunić, Vladimir Lj.
2017-12-01
This paper presents an investigation of thermomechanical effects related to the phenomena of stress relaxation occurring in TiNi SMA subjected to modified program of displacement-controlled tension. The deformation data were taken from testing machine, whereas the temperature changes accompanying the exothermic/endothermic martensite forward/reverse transformation were measured by infrared camera. At the advanced stages of the transformations, the strain was kept constant for a few minutes and the SMA load and temperature were recorded continuously. As a consequence, the stress and temperature changed significantly during the loading stops. A large stress drop, caused by the transformation, was observed during the relaxation stage in both courses of the SMA loading and unloading. Moreover, the non-uniform temperature distribution, reflecting macroscopically inhomogeneous transformation, lapsed while the strain was kept constant, yet restarted at the end of the relaxation stop and developed at the reloading stage. Along with the experimental results, the mechanical and thermal responses induced by the transformation were obtained by 3D coupled thermomechanical numerical analysis, realized in partitioned approach. Latent heat production was correlated with an amount of the martensitic volume fraction. The stress and temperature drops recorded during the experiment were satisfactorily reproduced by the model proposed for the SMA thermomechanical coupling.
Directory of Open Access Journals (Sweden)
Mariasofia Caltagirone
2017-11-01
Full Text Available To evaluate the water compartment antibiotic-resistance contamination rates, 11 wells, five streams, and four treatment plants located in the Oltrepò Pavese area were screened for the presence of third generation cephalosporins resistant Gram-negative bacteria. Enterobacteriaceae were also characterized for the Extended-Spectrum-β-Lactamases (ESBLs, carbapenemases, and mcr-1 genes presence. From December 2014 to November 2015, 246 water samples were filtered, plated on Plate Count Agar, MacConkey Agar, and MacConkey Agar with cefotaxime. Isolates were species identified using AutoSCAN-4-System and ESBLs, carbapenemases, and colistin resistance determinants were characterized by PCR, sequencing, and microarray. Plasmid conjugative transfer experiments, PCR-based Replicon typing, Pulsed-Field Gel Electrophoresis, Multi-Locus-Sequence-Typing, and in-silico plasmid characterization were performed. A total of 132 enterobacteria isolates grew on MacConkey agar with cefotaxime: 82 (62.1% were obtained from streams, 41 (31.1% from treatment plants, and 9 (6.8% from wells. Thirty out of 132 (22.7% isolates, mainly belonging to Escherichia coli (n = 15 species, showed a synergic effect with piperacillin-tazobactam. A single ESBL gene of blaCTX−M-type was identified in 19/30 isolates. In further two E. coli strains, a blaCTX−M−1 gene co-existed with a blaSHV-type ESBL determinant. A blaSHV−12 gene was detected in two isolates of E. coli (n = 1 and Klebsiella oxytoca (n = 1, while any ESBL determinant was ascertained in seven Yersinia enterocolitica strains. A blaDHA-type gene was detected in a cefoxitin resistant Y. enterocolitica from a stream. Interestingly, two Klebsiella pneumoniae strains of ST307 and ST258, collected from a well and a wastewater treatment plant, resulted KPC-2, and KPC-3 producers, respectively. Moreover, we report the first detection of mcr-1.2 ST10 E. coli on a conjugative IncX4 plasmid (33.303 bp in size from a stream of
Caltagirone, Mariasofia; Nucleo, Elisabetta; Spalla, Melissa; Zara, Francesca; Novazzi, Federica; Marchetti, Vittoria M; Piazza, Aurora; Bitar, Ibrahim; De Cicco, Marica; Paolucci, Stefania; Pilla, Giorgio; Migliavacca, Roberta; Pagani, Laura
2017-01-01
To evaluate the water compartment antibiotic-resistance contamination rates, 11 wells, five streams, and four treatment plants located in the Oltrepò Pavese area were screened for the presence of third generation cephalosporins resistant Gram-negative bacteria. Enterobacteriaceae were also characterized for the Extended-Spectrum-β-Lactamases (ESBLs), carbapenemases, and mcr-1 genes presence. From December 2014 to November 2015, 246 water samples were filtered, plated on Plate Count Agar, MacConkey Agar, and MacConkey Agar with cefotaxime. Isolates were species identified using AutoSCAN-4-System and ESBLs, carbapenemases, and colistin resistance determinants were characterized by PCR, sequencing, and microarray. Plasmid conjugative transfer experiments, PCR-based Replicon typing, Pulsed-Field Gel Electrophoresis, Multi-Locus-Sequence-Typing, and in-silico plasmid characterization were performed. A total of 132 enterobacteria isolates grew on MacConkey agar with cefotaxime: 82 (62.1%) were obtained from streams, 41 (31.1%) from treatment plants, and 9 (6.8%) from wells. Thirty out of 132 (22.7%) isolates, mainly belonging to Escherichia coli ( n = 15) species, showed a synergic effect with piperacillin-tazobactam. A single ESBL gene of bla CTX-M -type was identified in 19/30 isolates. In further two E. coli strains, a bla CTX-M-1 gene co-existed with a bla SHV -type ESBL determinant. A bla SHV-12 gene was detected in two isolates of E. coli ( n = 1) and Klebsiella oxytoca ( n = 1), while any ESBL determinant was ascertained in seven Yersinia enterocolitica strains. A bla DHA -type gene was detected in a cefoxitin resistant Y. enterocolitica from a stream. Interestingly, two Klebsiella pneumoniae strains of ST307 and ST258, collected from a well and a wastewater treatment plant, resulted KPC-2, and KPC-3 producers, respectively. Moreover, we report the first detection of mcr-1.2 ST10 E. coli on a conjugative IncX4 plasmid (33.303 bp in size) from a stream of Oltrep
A fuzzy PID-controlled SMA actuator for a two-DOF joint
Directory of Open Access Journals (Sweden)
Shi Zhenyun
2014-04-01
Full Text Available Shape memory alloy (SMA actuator is a potential advanced component for servo-systems of aerospace vehicles and aircraft. This paper presents a joint with two degrees of freedom (DOF and a mobility range close to ±60° when driven by SMA triple wires. The fuzzy proportional-integral-derivative (PID-controlled actuator drive was designed using antagonistic SMA triple wires, and the resistance feedback signal made a closed loop. Experiments showed that, with the driving responding frequency increasing, the overstress became harder to be avoided at the position under the maximum friction force. Furthermore, the hysteresis gap between the heating and cooling paths of the strain-to-resistance curve expanded under this condition. A fuzzy logic control was considered as a solution, and the curves of the wires were then modeled by fitting polynomials so that the measured resistance was used directly to determine the control signal. Accurate control was demonstrated through the step response, and the experimental results showed that under the fuzzy PID-control program, the mean absolute error (MAE of the rotation angle was about 3.147°. In addition, the investigation of the external interference to the system proved the controllable maximum output.
Energy Technology Data Exchange (ETDEWEB)
Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica
2015-07-01
This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)
Perancangan Sistem Informasi SMA Negeri 1 Babalan Dengan Menggunakan Pemrograman PHP Dan MySQL
Yulita, Devi
2014-01-01
Tulisan ini bertujuan untuk membangun suatu sistem informasi pada SMA Negeri 1 Babalan. Sistem ini dikembangkan dengan menggunakan perangkat lunak PHP, MySQL, Apache, dan Mozilla Firefox juga software pembantu lainnya seperti Adobe Dreamweaver CS5. Tujuan dari sistem informasi ini adalah untuk menyajikan informasi profil sekolah, visi, misi dan tujuan, daftar siswa, daftar guru. Merancang sebuah website untuk membantu siswa dalam memperoleh informasi SMA Negeri 1 Babalan dan website ini dapat...
Directory of Open Access Journals (Sweden)
Gaetano Starlacci
2016-08-01
Full Text Available Changes in the geometry and stiffness of structural members can be obtained using Shape Memory Alloys (SMA wires, previously stretched, and externally attached to the member in a helical pattern. The wire was modeled assuming transformation from a pure martensitic phase to a pure austenitic phase. Natural frequency values before and after the SMA wire activation attached to the beam were calculated using the finite element method and these values were compared with those obtained from a model developed for pre-twisted stress-free cantilever members. The results obtained showed the active torsion influence over the structural element in the values of natural frequencies calculated.
International Nuclear Information System (INIS)
Kuang Yachuan; Ou Jinping
2008-01-01
By taking advantage of the superelastic effect of shape memory alloy (SMA) and the cohering characteristic of repairing adhesive, a smart self-repairing concrete beam with damage self-repairing performance has been developed. In order to verify the potential self-repairing capacity of smart concrete beams reinforced with SMA wires and brittle fibers containing adhesives, static loading tests were conducted. Experimental results show that the superelastic SMA wires added self-restoration capacity to concrete beams, the deflection of the beams reversed and the crack closed almost completely after unloading. After the release of adhesive from the broken-open fibers into the cracks from the first loading, stress was redistributed to the uncracked section where a new crack was formed, while the sealed crack remained closed during reloading for the smart concrete beams reinforced with SMA wires and brittle fibers containing adhesives. While the original cracks experienced reopening, the load was carried directly by the wires during reloading for concrete beams reinforced with SMA wires
Photothermal characterization of the gelation process in Gelidium robustum Agar
Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.
2005-06-01
Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.
Directory of Open Access Journals (Sweden)
Dina Aprilia
2016-10-01
Full Text Available This research is aimed to find the effectivity of Focus Group Discussion (FGD to decrease the feeling stress for senior high school students (SMA who will face the national final examination (UAN. Stress on SMA students is a circumstance which gets negative assessment. It intimidates and pushes the students, in this case is UAN would appear a reaction such as emotional disorder, cognition, physiology and behavior disorder of SMA students. This research concerned 21 SMA students in grade XII, who had high stress level in facing UAN. The subjects were divided into two groups. First group was the experiment group (include 11 students and it was the group who got the FGD treatment. The second group was control group (include 10 students and this group didn’t get the FGD treatment. Collecting data was done by using Stress Scale in facing UAN. It was given (a before FGD (pre-test and (b after FGD (post-test. The hypothesis is examined by using difference examination (t-test by comparing mean pre-test and post-test. The result showed that there was a significant influence to decrease the stress in SMA students who were in experiment group (t = 6,540, p < 0,01 after they got FGD treatment. Experiment group had decreased the stress score to face UAN (Mean=7,476.
AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM
Directory of Open Access Journals (Sweden)
SIEW-LING HII
2016-07-01
Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.
Faktor Penghambat Proses Layanan Konseling Individual di SMA se-Kota Cilacap
Directory of Open Access Journals (Sweden)
Fenti Nurindahsari
2015-12-01
Full Text Available Berdasarkan penuturan guru BK di salah satu SMA di kota Cilacap yang pernah menjadi tempat observasi oleh peneliti, ditemukan fenomena terkait dengan layanan konseling individual di sekolah tersebut yang tidak sesuai dengan teori-teori mengenai konseling individual yang ada dalam bimbingan konseling. Contoh yang tidak sesuai dengan teori ketika proses konseling berakhir guru BK di sekolah tersebut tidak ada upaya tindak lanjut. Tujuan penelitian ini untuk mengetahui faktor penghambat proses layanan konseling individual di SMA sekota Cilacap. Jenis penelitian deskriptif kuantitatif. Populasi dalam penelitian ini adalah konselor yang ada di SMA sekota Cilacap. Teknik sampel untuk konselor yang dipilih praktikan adalah sampling jenuh. Instrumen yang digunakan adalah angket. Validitas menggunakan rumus Product Moment. Uji reliabitilitas menggunakan rumus Alpha. Metode analisis data menggunakan deskriptif persentase. Hasil penelitian menunjukan faktor internal penghambat berasal dari konselor dalam kriteria tinggi (71,74% faktor eksternal penghambat termasuk kriteria tinggi yaitu norma (71,59%, sarpras (71,38% dan lingkungan fisik (72,39%. Dapat disimpulkan hambatan yang ada dalam proses layanan konseling individual di SMA sekota Cilacap berasal dari faktor internal dan eksternal yang memiliki kriteria yang sama yaitu dalam kategori tinggi. Based the narrative counseling teacher in one high school in Cilacap town that once a place observation, discovered the phenomenon associated with individual counseling services in the school is not in accordance with the theories about the existing individual counseling in counseling. Examples that don’t fit with theory when the counseling process ends counseling teacher the school is’n follow-up effort. The purpose of this study to determine inhibiting factors individual counseling service process In senior high school Cilacap derby. Pupolasi in research is senior high school counselors. Technical
Directory of Open Access Journals (Sweden)
Iyut Sustiasih Sudikno
2014-02-01
Full Text Available Penelitian ini bertujuan untuk mengetahui pengaruh lingkungan keluarga, lingkungan sekolah dan disiplin belajar terhadap prestasi belajar melalui motivasi belajar siswa kelas XI IPS SMA PGRI 1 Taman Pemalang. Subyek penelitian ini adalah siswa kelas XI IPS SMA PGRI 1 Taman Pemalang. Latar belakang penelitian ini adalah prestasi belajar siswa kelas XI IPS yang kurang optimal. Penelitian ini merupakan penelitian kuantitatif. Variabel bebas yang dikaji dalam penelitian ini adalah Lingkungan Keluarga (X1, Lingkungan Sekolah (X2, Disiplin Belajar (X3. Variabel terikat adalah Prestasi Belajar (Y2 dan Variabel intervening adalah Motivasi Belajar (Y1. Metode pengumpulan data yang digunakan adalah dokumentasi dan angket. Metode analisis data yaitu analisis deskriptif persentase dan analisis uji jalur (path analysis. Hasil analisis regresi linier berganda diperoleh persamaan regresi Y1 = 10,011 + 0,233X1 + 0,391X 2+ 0,522X3 +e1, dan Y2 = 71,062 + 0,227X1 + 0,704Y1 + 0,349X3 + e2. Hasil analisi jalur menunjukkan bahwa pengaruh secara tidak langsung (LK-PB sebesar 22,7%, (LS-PB sebesar 10,5%, (DB-PB sebesar 34,9%, (MB-PB sebesar 70,4% dan pengaruh secara tidak langsung (LK-MB-PB sebesar 16,4%, (LS-MB-PB sebesar 27,5%, (DP-MB-PB sebesar 36,7%. This research aims to determine the effect of on family environment, school environment, learning discipline on students’ achievements through student motivation SMA PGRI 1 Taman Pemalang. The subjects were students of class XI IPS Students of SMA PGRI 1 Taman Pemalang. The background of this research is the student’ achievements XI IPS Stuents of SMA PGRI 1 Taman Pemalang. This research is a quantitative study. The independent variables were examined in this study is family environment (X1, school environment (X2, learning discipline (X3. The dependent variable is the students, achievements (Y2 and the intervening variable is learning motivation (Y1. Data collection methods used are documentation and
Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species
Directory of Open Access Journals (Sweden)
Marol Serhat
2003-10-01
Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.
Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.
Yücesoy, Mine; Marol, Serhat
2003-10-29
The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.
Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development
Directory of Open Access Journals (Sweden)
Wahyu Ramadhan
2017-04-01
Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.
Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms
Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart
2016-01-01
Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.
Studi Kasus Pengembangan Program Bimbingan dan Konseling di SMA Negeri Kota Surakarta
Directory of Open Access Journals (Sweden)
Anna Annisa
2015-12-01
Full Text Available Penelitian berdasarkan fenomena program bimbingan dan konseling di sekolah belum berjalan dengan baik terutama pada bagian perencanaan dan pelaksanaan program BK. Tujuan penelitian ini untuk mengetahui pengembangan program di SMA Negeri 7 Surakarta dan SMA N 8 Surakarta mulai dari (1 pelaksanaan asesmen kebutuhan melalui pengumpulan data, (2 interpretasi data asesmen kebutuhan, (3 penetapan prioritas kebutuhan, (4 penetapan tujuan program, (5 penetapan prosedur program, dan (6 perencanaan bagi perbaikan peningkatan penyempurnaan program. Jenis penelitian ini adalah deskriptif kualitatif dengan pendekatan studi kasus. Penelitian ini melibatkan guru BK di SMA Negeri Kota Surakarta. Metode pengumpulan data yang digunakan adalah menggunakan wawancara, observasi dan dokumentasi. Teknik analisis data menggunakan pengumpulan data, reduksi data, penyajian data dan penarikan kesimpulan. Simpulan dari penelitian ini adalah pada SMA N 7 Surakarta pengembangan program fokus pada penggunaan instrumen dalam asesmen, sasaran asesmen, kesesuaian asesmen dengan kebutuhan siswa, layann klasikal dan layanan kelompok. Sedangkan SMA N 8 Surakarta difokuskan pada penentuan prioritas kebutuhan dan analisis data kebutuhan siswa. This research of program guidance and counselling in schools has not fully well especially at the planning and execution of counseling and guidance program. The purpose to know the development program at senior high school 7 Surakarta and senior high school 8 Surakarta ranging from (1 the implementation of needs assessment through data collection, data interpretation (2 the assessment of needs, (3 the determination of priority needs, (4 The goal setting program, (5 the determination of the procedures of the program, and (6 The planning for improvements to increase refinement program. Type of this research is descriptive qualitative approach to case studies. This research involves guidance and counseling teachers in senior high school of
Design and demonstration of a fish robot actuated by a SMA-driven actuation system
Le, Chan H.; Nguyen, Quang S.; Park, Hoon C.
2010-04-01
This paper presents a concept of a fish robot actuated by an SMA-based actuator. The bending-type actuator system is composed of a 0.1mm diameter SMA wire and a 0.5mm thick glass/epoxy strip. The SMA wire is installed to the bent composite strip. The actuator can produce about 200gf of blocking force and 3.5mm displacement at the center of the glass/epoxy strip. The bending motion of the actuator is converted into the tail-beat motion of a fish robot through a linkage system. The fish robot is evaluated by measuring the tail-beat angle, swimming speed and thrust produced by the fish robot. The tail-beat angle is about 20° and the maximum swimming speed is about 1.6cm/s. The measured thrust is about 0.4gf when the fish robot is operated at 0.9Hz.
Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan
2015-11-01
Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
denny rachmadi
2016-03-01
Full Text Available Rendahnya hasil belajar siswa dalam pembelajaran sika mendorong keinginan guru untuk memperbaiki model pembelajaran sika agar mendapatkan hasil belajar yang sesuai dengan harapan. Dalam materi sika dibutuh- kan adanya kemampuan siswa untuk berabstraksi dalam memahai konsep sika. Hal ini dapat di atasi dengan adan- ya praktikum sika, itu kalau fasilitas laboratorium sika lengkap. Untuk mengatasi kekurangan sarana laborato- rium sika dapat digunakan media computer untuk me- nampilkan konsep sika yang abstrak menjadi nyata baik dalam bentuk lm atau animasi. Selain itu adanya kegiatan guru dan kelembagaan mengurangi jumlah tatap muka dalam pembelajaran sika. Dengan demikian dibutuh- kan media pembelajaran sika yang berbasis website agar siswa dapat belajar. Yang menjadi masalah dalam penelitian ini media pem- belajaran computer yang berbasis website yang bagaimana yang akan diciptakan dan yang dapat dimanfaatkan un- tuk meningkatan hasil belajar sika kelas X SMA Negeri 1 Gubug. Untuk mengetahui layak ataupun tidak layak peng- gunaan media pembelajaran sika menggunakan media komputer berbasis website tersebut perlu adanya uji in- strument. Uji kelayakan instrument dalam penelitian ini menggunakan white box dan black box. Selain itu juga di- lakukan uji respon user dan hasil belajar siswa terhadap pemakaian instrument ini menggunakan angket (kuision- er dengan metode membandingan instrument ini dengan instrument lain yang ada di SMA N I Gubug. Dari hasil uji whitebox dan blackbox tidak ada ma- salah dan program dapat berjalan dengan baik. Dari uji respon user menggunakan angket diperoleh data dan anal- isis data menyatakan bahwa 80% respon user memiliki ke- cenderungan yang tinggi dan l3,3%7 dalam kategori cukup untuk menyukai media pembelajaran sika berbasis web dari pada instrument lain yang hanya 23,33% dalam kat- egori cukup dan 66,67% pada kategori rendah. Selain itu dari uji hasil
The Role Of Staphylococcus Haemolyticus In Men Infertility
AL-Ghizzawi, Ghaed’a. J.; Jomaa, Zahraa K.
2018-05-01
A total of 80 samples of seminal fluid from infertile men who were admitted to clinics and attended laboratories in Omara City during the period from 1 June 2016 to 1 December 2016, samples were subjected to semen analysis as recommended by WHO. The age of patients was from 20 – 59 year. Another 25 semen samples were collected from fertilized men considered as the control group. For this purpose seminal fluid were cultured on MacConkey agar, Blood agar, Chocolate agar. Within the 80 samples recorded S. haemolyticus appeared in 14 cases and the rate of infection was 18%, all strains was diagnosed by Vitek system 2 Double. The highest percent (64%) was recorded in the age group 30 – 39. Primary infertility recorded 94% while 6% was recorded for secondary infertility. Also, different species of bacterial isolates were identified in 32 cases by Vitek system 2 Double. The bacterial infection of the male genital system affected fertility.
Opportunistic microorganisms in patients undergoing antibiotic therapy for pulmonary tuberculosis
Directory of Open Access Journals (Sweden)
Silvia Maria Rodrigues Querido
2011-12-01
Full Text Available Antimicrobial therapy may cause changes in the resident oral microbiota, with the increase of opportunistic pathogens. The aim of this study was to compare the prevalence of Candida, Staphylococcus, Pseudomonas and Enterobacteriaceae in the oral cavity of fifty patients undergoing antibiotic therapy for pulmonary tuberculosis and systemically healthy controls. Oral rinsing and subgingival samples were obtained, plated in Sabouraud dextrose agar with chloramphenicol, mannitol agar and MacConkey agar, and incubated for 48 h at 37ºC. Candida spp. and coagulase-positive staphylococci were identified by phenotypic tests, C. dubliniensis, by multiplex PCR, and coagulase-negative staphylococci, Enterobacteriaceae and Pseudomonas spp., by the API systems. The number of Candida spp. was significantly higher in tuberculosis patients, and C. albicans was the most prevalent specie. No significant differences in the prevalence of other microorganisms were observed. In conclusion, the antimicrobial therapy for pulmonary tuberculosis induced significant increase only in the amounts of Candida spp.
iSmaRT: a toolkit for a comprehensive analysis of small RNA-Seq data.
Panero, Riccardo; Rinaldi, Antonio; Memoli, Domenico; Nassa, Giovanni; Ravo, Maria; Rizzo, Francesca; Tarallo, Roberta; Milanesi, Luciano; Weisz, Alessandro; Giurato, Giorgio
2017-03-15
The interest in investigating the biological roles of small non-coding RNAs (sncRNAs) is increasing, due to the pleiotropic effects of these molecules exert in many biological contexts. While several methods and tools are available to study microRNAs (miRNAs), only few focus on novel classes of sncRNAs, in particular PIWI-interacting RNAs (piRNAs). To overcome these limitations, we implemented iSmaRT ( i ntegrative Sm all R NA T ool-kit), an automated pipeline to analyze smallRNA-Seq data. iSmaRT is a collection of bioinformatics tools and own algorithms, interconnected through a Graphical User Interface (GUI). In addition to performing comprehensive analyses on miRNAs, it implements specific computational modules to analyze piRNAs, predicting novel ones and identifying their RNA targets. A smallRNA-Seq dataset generated from brain samples of Huntington's Disease patients was used here to illustrate iSmaRT performances, demonstrating how the pipeline can provide, in a rapid and user friendly way, a comprehensive analysis of different classes of sncRNAs. iSmaRT is freely available on the web at ftp://labmedmolge-1.unisa.it (User: iSmart - Password: password). aweisz@unisa.it or ggiurato@unisa.it. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Hidayatulloh Hidayatulloh
2016-01-01
This article examines about improving the education quality of SMA Muhammadiyah 2 Sidoarjo as the Outstanding School of Muhammadiyah. This article reveals that the quality improvement of SMA Muhammadiyah 2 Sidoarjo was conducted through: the arrangement of school program and self evaluation, the reinforcement of vision, mission and education objective, the reinforcement of leadership and teamwork, the improvement of teachers and educators competence, the improvement learners quality input, th...
Anderson, Neil W; Buchan, Blake W; Riebe, Katherine M; Parsons, Lauren N; Gnacinski, Stacy; Ledeboer, Nathan A
2012-03-01
Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for the identification of bacteria. Factors that may alter protein profiles, including growth conditions and presence of exogenous substances, could hinder identification. Bacterial isolates identified by conventional methods were grown on various media and identified using the MALDI Biotyper (Bruker Daltonics, Billerica, MA) using a direct smear method and an acid extraction method. Specimens included 23 Pseudomonas isolates grown on blood agar, Pseudocel (CET), and MacConkey agar (MAC); 20 Staphylococcus isolates grown on blood agar, colistin-nalidixic acid agar (CNA), and mannitol salt agar (MSA); and 25 enteric isolates grown on blood agar, xylose lysine deoxycholate agar (XLD), Hektoen enteric agar (HE), salmonella-shigella agar (SS), and MAC. For Pseudomonas spp., the identification rate to genus using the direct method was 83% from blood, 78% from MAC, and 94% from CET. For Staphylococcus isolates, the identification rate to genus using the direct method was 95% from blood, 75% from CNA, and 95% from MSA. For enteric isolates, the identification rate to genus using the direct method was 100% from blood, 100% from MAC, 100% from XLD, 92% from HE, and 87% from SS. Extraction enhanced identification rates. The direct method of MALDI-TOF analysis of bacteria from selective and differential media yields identifications of varied confidence. Notably, Staphylococci spp. from CNA exhibit low identification rates. Extraction enhances identification rates and is recommended for colonies from this medium.
Directory of Open Access Journals (Sweden)
Su Jin Lee
Full Text Available The precise mechanism of TGFβ1 signaling in the progression of non-alcoholic steatohepatitis (NASH has remained unclear. In particular, a potential regulatory mechanism by which PKCδ affects profibrogenic gene expression had never been explored. In this study, therefore, the role of PKCδ in TGFβ1 mediated α-SMA expression was investigated using NASH model mice. In preparation of the NASH model, male C57BL6/J mice were fed a methionine-choline-deficient (MCD diet for 3 weeks, after which time they were intraperitoneally injected with lipopolysaccharide (LPS. In addition, Tlr4(Lps-d (CH3/HeJ mice were used to demonstrate the TGFβ1 signaling's dependency on TLR4 induction. Liver histology and hepatic hepatitis markers were investigated, and hepatic gene expression levels were determined by real-time PCR. Acute liver injury by LPS injection specifically elevated not only α-SMA expression but also phospho-PKCδ in this model. In contrast, Tlr4(Lps-d (CH3/HeJ and blockade of TGFβ1 receptor by SB431542 resulted in a significant reduction of PKCδ activation and α-SMA expression. Moreover, the TGFβ1-induced α-SMA production was significantly reduced by a specific PKCδ inhibitor. These findings suggested that PKCδ plays a critical role in TGFβ1-induced α-SMA production in a NASH model. Thus, this was the first demonstration of the involvement of PKCδ in the regulation of α-SMA expression in NASH liver tissues, and the impaired induction of PKCδ phosphorylation by LPS in a steatohepatitis condition. Interestingly, treatment by PKCδ inhibitor caused dramatic reduction of myofibroblast activation, indicating that PKCδ represents a promising target for treating NASH.
Mechanical behavior and fatigue performance of SMA short fiber reinforced MMC
Al-Matar, Basem Jawad
The mechanical behavior and performance of Shape Memory Alloy (SMA) short fiber NiTi reinforced Al was experimentally investigated for monotonic and fatigue test Al 6061 NiTi-SiC T6 was superior to unreinforced materials as well as to the reinforced Al T4. Taya three-dimensional model was performed on the monotonic tensile test at room temperature. It showed good agreement with experimental results. In order to utilize the compressive criterion for SMA, the NiTi reinforced Al composite was cooled at -10°C and prestrained at 1.2%. Beyond this limit composite suffered from damage. The net enhancement of SMA effect was around 10 MPa on composite yield stress. Results showed that the elastic constant for the composite did not change with loading and unloading suggesting that the inelastic behavior is plasticity. Further investigation on the inelastic behavior model as damage and/or plasticity by evaluating Poisson's ratio during loading was carried out by Adaptive Image Correlation Technique for Full-Field Strain Measurement. Poisson's ratio increased from around 0.33 to 0.5 demonstrating that it is plasticity that is responsible for the inelastic behavior. Scanning electron microscopy was also used and confirmed model results. The overall damage-behavior was quantified in terms of the post fatigue failure strength for low-cycle fatigue tests. Power law model was best to fit experimental findings.
Minimizing the Moisture Damage and Drain down of Iraqi SMA Mixtures Using Waste Additives
Directory of Open Access Journals (Sweden)
Ali Al-Hadidy
2013-04-01
Full Text Available This research deals with the viability of using polyester fiber (PF, crumb rubber tire (CRT and cellulose fiber (CF as stabilizing waste additives in producing Iraqi SMA mixtures that sustain drain down phenomenon and moisture damage sensitivity. Different ratios of these additives (0.1, 0.2, and 0.3% by weight of aggregate and filler were mixed with 40/50 paving asphalt by means of dry process. Unmodified and modified SMA mixtures were subjected to drain down, Marshall, static indirect tensile strength, tensile stiffness modulus, static compressive strength, tensile strength ratio and index of retained strength tests. A set of regression equations between these tests were established. In addition, an optimization table based on these tests, which can be used to select the type or amount of additive for any field applications has been determined and reported. The results indicated that the inclusion of these additives in SMA mixtures can satisfy the performance requirement of high temperature and much rain zone.
Free vibration response of a multilayer smart hybrid composite plate with embedded SMA wires
Directory of Open Access Journals (Sweden)
K. Malekzadeh
Full Text Available In this paper, free vibration response of a hybrid composite plate was studied. Effects of some geometrical, physical and material parameters on response of the composite plates embedded with shape memory alloy (SMA wires were investigated, which have not been reported in the literature thus far. Some of these parameters included important factors affecting free vibration response of the smart hybrid composite plates. The SMA wires were embedded within the layers of the composite laminate. First-order shear deformation theory (FSDT was utilized to obtain the governing equations of hybrid composite plates. Transverse shear and rotary inertia effects of the plate were taken into consideration. For simply-supported boundary conditions, systematic closed form solutions were obtained by Navier's technique. It was established that dynamic behavior of the smart hybrid composite plate depended on various parameters such as volume fraction, temperature dependent recovery stress and tensile pre-strain of SMA wires and aspect ratio of the laminated hybrid plate.
RTC simulations on large branched sewer systems with SmaRTControl.
de Korte, Kees; van Beest, Dick; van der Plaat, Marcel; de Graaf, Erno; Schaart, Niels
2009-01-01
In The Netherlands many large branched sewer systems exist. RTC can improve the performance of these systems. The objective of the universal algorithm of SmaRTControl is to improve the performance of the sewer system and the WWTP. The effect of RTC under rain weather flow conditions is simulated using a hydrological model with 19 drainage districts. The system related inefficiency coefficient (SIC) is introduced for assessment of the performance of sewer systems. The performance can be improved by RTC in combination with increased pumping capacities in the drainage districts, but without increasing the flow to the WWTP. Under dry weather flow conditions the flow to the WWTP can be equalized by storage of wastewater in the sewer system. It is concluded that SmaRTControl can improve the performance, that simulations are necessary and that SIC is an excellent parameter for assessment of the performance.
GENÇ PARTİ'Yİ ANLAMAK (Parti, Lider ve Kitle Üzerine Bir Çalısma)
TÜRK, Hasan Bahadır
2007-01-01
Türk, Hasan Bahadır, Genç Parti’yi Anlamak: Parti, Lider ve Kitle Üzerine BirÇalısma, Doktora Tezi, Danısman: Doç.Dr. Aykut Çelebi, 399 s.ÖZETBu çalısmanın amacı; Genç Parti’nin temel yapısal özelliklerine ısık tutmaktır. Çalısma;Genç Parti’yi lider, kadro, parti tipolojisi, ideoloji ve söylem gibi parçalarındanhareketle analiz etmeye ve kitleyle kurdugu iliskiyi tartısmaya odaklanacaktır. Çalısma,üç ana bölümden olusmaktadır. lk iki bölümde Uzanlar’ın genel yapısı, yükselis veçöküs süreci Ge...
PELATIHAN PENULISAN KARYA ILMIAH BIDANG SOSIAL ( HUKUM DI SMA NEGERI 3 DENPASAR
Directory of Open Access Journals (Sweden)
I KETUT SUDIARTA
2012-09-01
Full Text Available ABSRACT Training of Constructing Scientific Report on Social Major (Law has done on SMA Negeri 3 Denpasar, by the Guiding Team of the Lecturers of Law Faculty of Udayana University through a practice of constructing a report in a class through a workshop. Aproximately, 40% are for meanwhile, 60% are by practice of composing and providing some reference which is related to the constructing of a social-scientific report, and there all are done well so far. This fact was indicated by the responds which were given by the students of SMA Negeri 3 Denpasar, especially for those who join the KIR group.This activity has been done once a week.
A Novel SMA-based Concept for Airfoil Structural Morphing
Barbarino, S.; Pecora, R.; Lecce, L.; Concilio, A.; Ameduri, S.; Calvi, E.
2009-08-01
The adaptive structures concept is of great interest in the aerospace field because of the several benefits which can be accomplished in the fields including noise reduction, load alleviation, weight reduction, etc., at a level in which they can be considered as compulsory in the design of future aircraft. Improvements in terms of the aerodynamic efficiency, aeroelastic behavior, stability, and manoeuvrability performance have already been proved through many international studies in the past. In the family of the Smart Materials, Shape Memory Alloys (SMA) seem to be a suitable solution for many static applications. Their high structural integrability in conjunction with actuation capabilities and a favorable performance per weight ratio, allows the development of original architectures. In this study, a morphing wing trailing edge concept is presented; morphing ability was introduced with the aim of replacing a conventional flap device. A compliant rib structure was designed, based on SMA actuators exhibiting structural potential (bearing external aerodynamic loads). Numerical results, achieved through a FE approach, are presented in terms of trailing edge induced displacement and morphed shape.
S&MA Internship to Support Orion and the European Service Module
Hutcheson, Connor
2016-01-01
As a University Space Research Association (USRA) intern for NASA Johnson Space Center (JSC) during the summer 2016 work term, I worked on three main projects for the Space Exploration Division (NC) of the Safety and Mission Assurance (S&MA) Directorate. I worked on all three projects concurrently. One of the projects involved facilitating the status and closure of technical actions that were created during European Service Module (ESM) safety reviews by the MPCV Safety & Engineering Review Panel (MSERP). The two main duties included accurately collecting and summarizing qualitative data, and communicating that information to the European Space Agency (ESA) and Airbus (ESA's prime contractor) in a clear, succinct and precise manner. This project also required that I create a report on the challenges and opportunities of international S&MA. With its heavy emphasis on soft skills, this project taught me how to communicate better, by showing me how to present and share information in an easy-to-read and understandable format, and by showing me how to cooperate with and culturally respect international partners on a technical project. The second project involved working with the Orion Thermal Protection System (TPS) Process Failure Modes and Effects Analysis (PFMEA) Working Group to create the first full version of the Orion TPS PFMEA. The Orion TPS PFMEA Working Group met twice a week to analyze the Avcoat block installation process for failure modes, the failure modes effects, and how such failure modes could be controlled. I was in charge of implementing changes that were discussed in meeting, but were not implemented real time. Another major task included creating a significant portion of the content alongside another team member outside the two weekly meetings. This project caused me to become knowledgeable about TPS, heatshields, space-rated manufacturing, and non-destructive evaluation (NDE). The project also helped me to become better at working with a small
Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.
Wang, Xiaoling; Wang, Guoqing; Hao, Mudong
2015-01-01
Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.
Hupfeld, K E; Ketcham, C J; Schneider, H D
2017-03-01
The supplementary motor area (SMA) is believed to be highly involved in the planning and execution of both simple and complex motor tasks. This study aimed to examine the role of the SMA in planning the movements required to complete reaction time, balance, and pegboard tasks using anodal transcranial direct current stimulation (tDCS), which passes a weak electrical current between two electrodes, in order to modulate neuronal activity. Twenty healthy adults were counterbalanced to receive either tDCS (experimental condition) or no tDCS (control condition) for 3 days. During administration of tDCS, participants performed a balance task significantly faster than controls. After tDCS, subjects significantly improved their simple and choice reaction time. These results demonstrate that the SMA is highly involved in planning and executing fine and gross motor skill tasks and that tDCS is an effective modality for increasing SMA-related performance on these tasks. The findings may be generalizable and therefore indicate implications for future interventions using tDCS as a therapeutic tool.
Energy Technology Data Exchange (ETDEWEB)
Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)
2010-10-15
Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.
International Nuclear Information System (INIS)
Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio
2010-01-01
Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.
Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)
2010-11-05
Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.
Adler, Amos; Sturlesi, Na'ama; Fallach, Noga; Zilberman-Barzilai, Deniz; Hussein, Omar; Blum, Shlomo E; Klement, Eyal; Schwaber, Mitchell J; Carmeli, Yehuda
2017-07-01
Our objectives were to establish a methodology for surveillance of ciprofloxacin-resistant Enterobacteriaceae and gentamicin-resistant Enterobacteriaceae (CPRE and GNRE, respectively) in cattle and to study the prevalence and risk factors for carriage of these bacteria in a national survey. This was a point prevalence study conducted from July to October 2013 in Israel. Stool samples were collected from 1,226 cows in 123 sections of 40 farms of all production types. The number of CPRE- and GNRE-positive cows was highest in quarantine stations and fattening farms and was lowest in pasture farms (p 25 months) and highest in calves (<4 months) (p < 0.001). In bivariate analysis, other variables that were significant risk factors for CPRE and GNRE carriage included fewer troughs, crowding, lack of manure cleaning, and recent arrival of new calves. Antimicrobial prophylaxis was given almost exclusively to calves and was associated with a higher prevalence of carriers (p < 0.001). Compared to the use of nonselective media (MacConkey agar alone), the use of selective media (MacConkey agar with 10 μg/ml of ciprofloxacin or 5 μg/ml of gentamicin) increased the sensitivity of screening for CPRE and GNRE by 6.6- and 13.5-fold, respectively. CPRE and GNRE were identified in 609 (49.7%) and 840 (68.5%) samples, respectively. This study provides novel data regarding both the epidemiology of CPRE and GNRE carriage in livestock and the microbiological methodology for their surveillance.
Beuchat, L R; Hwang, C A
1996-04-01
Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.
Hubungan antara Aktivitas Fisik Terhadap Memori Kerja Murid SMA Don Bosco III Bekasi
Directory of Open Access Journals (Sweden)
Michelle Clarissa Junaidi
2017-03-01
Full Text Available Latar belakang. Memori kerja merupakan bagian dari memori jangka pendek yang berperan penting dalam membantu proses pembelajaran dan dipengaruhi oleh aktivitas fisik, memori kerja yang rendah akan menimbulkan kesulitan untuk menerima informasi baru serta penurunan prestasi belajar. Tujuan. Mengetahui pengaruh aktivitas fisik terhadap kapasitas memori kerja murid SMA Don Bosco III. Metode. Penelitian metode analitik dengan pendekatan potong lintang pada 113 murid SMA Don Bosco III, Bekasi, pada 18 – 20 Juli 2016. Penelitian dilakukan dengan menggunakan kuesioner demografi, kuesioner skrining gangguan mental dan penyakit kronis, Physical Acitivity Questionnaire of Adolescent (PAQ-A dan Operation Span (O-SPAN. Analisis data dengan univariat dan bivariat menggunakan uji korelasi Spearman. Hasil. Terdapat 113 murid SMA Don Bosco III dengan kisaran usia 14 – 17 tahun, usia terbanyak 15 tahun (47.8%, laki-laki 61,1%, murid kelas X 44.2%. Mayoritas responden memiliki aktivitas fisik “kurang baik” dan rerata memori kerja 6,16. Analisis Spearman menunjukkan terdapat hubungan bermakna (p<0,05 antara aktivitas fisik terhadap memori kerja dengan korelasi positif lemah (r=0,384. Kesimpulan. Terdapat korelasi positif antara aktivitas fisik dan memori kerja, aktivitas fisik yang semakin tinggi cenderung akan meningkatkan memori kerja.
Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate
Directory of Open Access Journals (Sweden)
Xiaoling Wang
2015-01-01
Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.
International Nuclear Information System (INIS)
Sari, Ahmet; Alkan, Cemil; Karaipekli, Ali; Onal, Adem
2008-01-01
Fatty acids such as stearic acid (SA), palmitic acid (PA), myristic acid (MA) and lauric acid (LA) are promising phase change materials (PCMs) for latent heat thermal energy storage (LHTES) applications, but high cost is the major drawback of them, limiting their utility area in thermal energy storage. The use of fatty acids as form stable PCMs will increase their feasibilities in practical applications due to the reduced cost of the LHTES system. In this regard, a series of styrene maleic anhydride copolymer (SMA)/fatty acid composites, SMA/SA, SMA/PA, SMA/MA, and SMA/LA, were prepared as form stable PCMs by encapsulation of fatty acids into the SMA, which acts as a supporting material. The encapsulation ratio of fatty acids was as much as 85 wt.% and no leakage of fatty acid was observed even when the temperature of the form stable PCM was over the melting point of the fatty acid in the composite. The prepared form stable composite PCMs were characterized using optic microscopy (OM), viscosimetry and Fourier transform infrared (FT-IR) spectroscopy methods, and the results showed that the SMA was physically and chemically compatible with the fatty acids. In addition, the thermal characteristics such as melting and freezing temperatures and latent heats of the form stable composite PCMs were measured by using the differential scanning calorimetry (DSC) technique, which indicated they had good thermal properties. On the basis of all the results, it was concluded that form stable SMA/fatty acid composite PCMs had important potential for practical LHTES applications such as under floor space heating of buildings and passive solar space heating of buildings by using wallboard, plasterboard or floors impregnated with a form stable PCM due to their satisfying thermal properties, easy preparation in desired dimensions, direct usability without needing additional encapsulation thereby eliminating the thermal resistance caused by the shell and, thus, reducing the cost of
Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.
1974-01-01
Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006
International Nuclear Information System (INIS)
Faizal, P.K.
2009-01-01
This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)
Directory of Open Access Journals (Sweden)
Charis Amarantini
2012-02-01
Full Text Available Typhoid fever is highly endemic in the South-West Sumba Regency, East Nusa Tenggara. The incidence rate of the diseases is high estimated at 725/100,000. It is an acute systemic infection caused by Salmonella typhi. The clinical symptoms of the disease are extremely diverse, starting from the mild form to severe ones with the most feared complication being perforation within the small intestine. Therefore, it is important to perform isolation, characterization, and grouping of S. typhi strains from the blood culture in order to determined definitely diagnosis and the different phenotypic characteristics in the community. Isolation was done in selective and differential media: BacT/ALERT FA culture media, Selenite Cystine Broth, Chromocult Coliform Agar, MacConkey Agar, andSalmonella Shigella Agar. The typical colony of Salmonella was confirmed on Triple Sugar Iron Agar, Urea agar, and L-Lysinedecarboxylation media. Phenotypic characteristics of all isolates were identified using API 20E and API 50CHE diagnostics. Based on biochemical characteristics the result showed that 18 strains obtained from different geographical origins were diverse. Four strains have similarity value 100% while the remained strains have similarity value 86.3-98.4%. All of the strains were categorized in the species of S. typhi.
Pengembangan Instrumen Ranah Kognitif pada Pokok Bahasan Fluida Statis SMA/MA
Directory of Open Access Journals (Sweden)
Mukarramah Mustari
2016-04-01
Full Text Available This study aims to: 1 Develop Instrument Domains Cognitive at Static Fluid material in SMA / MA, 2 determine the validity of the instrument of cognitive tests on the static fluid material, 3 determine the reliability of cognitive principal static fluid discussion, 4 determine the level of difficulty of the cognitive tests on the static fluid material, 5 determine distinguishing cognitive test on static fluid material. The result products include cognitive aspects such instruments multiple choice tests and essay tests. Instrument developed on cognitive aspects in the form of multiple choice tests and a description to the extent of competence Bloom C1 to C6 on the material of Static Fluid. The Design of this study is used the development procedure Reasearch and Depelopment (R & D from Borg and Gall adopted by Sugiono ie; up to the stage seven form consisting of: the potential and problems, data collection, product design, design validation, design revisions, product trials, product revision. The data collecting is obtained from the results of expert validation instrument, the response of teachers, and product trials, and then analyzed by quantitative descriptive. The results of the analysis of the development of the instrument can be concluded that the cognitive instruments on the material of static fluid SMA / MA is excellent to be used by teachers in the assessment of competence of learners. Penelitian Pengembangan Instrumen Ranah Kognitif pada Pokok Bahasan Fluida Statis SMA/MA Ini dilakukan bertujuan;1 mengembangkan Instrumen Ranah Kognitif pada Pokok Bahasan Fluida Statis SMA/MA, 2 mengetahui validitas instrumen tes kognitif pokok bahasan fluida statis, 3 mengetahui reliabilitas kognitif pokok bahasan fluida statis, 4 mengetahui tingkat kesukaran tes kognitif pokok bahasan fluida statis, 5 mengetahui daya pembeda tes kognitif pada pokok bahasan fluida statis. Produk yang dihasilkan meliputi instrumen aspek kognitif berupa
TGF-beta Sma/Mab signaling mutations uncouple reproductive aging from somatic aging.
Directory of Open Access Journals (Sweden)
Shijing Luo
2009-12-01
Full Text Available Female reproductive cessation is one of the earliest age-related declines humans experience, occurring in mid-adulthood. Similarly, Caenorhabditis elegans' reproductive span is short relative to its total life span, with reproduction ceasing about a third into its 15-20 day adulthood. All of the known mutations and treatments that extend C. elegans' reproductive period also regulate longevity, suggesting that reproductive span is normally linked to life span. C. elegans has two canonical TGF-beta signaling pathways. We recently found that the TGF-beta Dauer pathway regulates longevity through the Insulin/IGF-1 Signaling (IIS pathway; here we show that this pathway has a moderate effect on reproductive span. By contrast, TGF-beta Sma/Mab signaling mutants exhibit a substantially extended reproductive period, more than doubling reproductive span in some cases. Sma/Mab mutations extend reproductive span disproportionately to life span and act independently of known regulators of somatic aging, such as Insulin/IGF-1 Signaling and Dietary Restriction. This is the first discovery of a pathway that regulates reproductive span independently of longevity and the first identification of the TGF-beta Sma/Mab pathway as a regulator of reproductive aging. Our results suggest that longevity and reproductive span regulation can be uncoupled, although they appear to normally be linked through regulatory pathways.
Experimental multiphysical characterization of an SMA driven, camber morphing owl wing section
Stroud, Hannah R.; Leal, Pedro B. C.; Hartl, Darren J.
2018-03-01
In the context of aerospace engineering, morphing structures are useful in their ability to change the outer mold line (OML) while improving or maintaining certain aerodynamic performance metrics. Skin-based morphing is of particular interest in that it minimizes installation volume. Shape memory alloys (SMAs) have a high force to volume ratio that makes them a suitable choice for skin-based morphing. Because the thermomechanical properties of SMAs are coupled, strain can be generated via a temperature variation; this phenomenon is used as the actuation method. Therefore, it is necessary to determine the interaction of the system not only with aerodynamic loads, but with thermal loads as well. This paper describes the wind tunnel testing and in situ thermomechanical analysis of an SMA actuated, avian inspired morphing wing. The morphing wing is embedded with two SMA composite actuators and consists of a foam core enveloped in a fiberglass-epoxy composite. As the SMA wire is heated, the actuator contracts, morphing the wing from the original owl OML to a highly cambered, high lift OML. Configuration characteristics are analyzed in situ using simultaneous three dimensional digital image correlation (DIC) and infrared thermography, thereby coupling strain and thermal measurements. This method of testing allows for the nonintrusive, multiphysical data acquisition of each actuator separately and the system as a whole.
Implementasi Sistem Informasi Akademik Menggunakan Aplikasi Jibas pada SMA Negeri 9 Padang
Directory of Open Access Journals (Sweden)
Ricky Akbar
2015-10-01
Full Text Available SMA Negeri 9 Padang is one of the institutions engaged in the field of education, which requires the design of software to manage and run all school activities, one of which is the Academic Information System (SIA. SIA currently in SMA 9 Padang yet well integrated, so it still has many shortcomings in meeting the needs of the school or institution, in particular to deal with academic problems. Therefore, it needs to be implemented Academic Information System that can overcome the various shortcomings earlier. Implementation of this application starts with a preliminary study. Activities, the introduction of the school as a whole with interviews and observations, identify business processes academically at school is running and then make the proposed system as terkomputerisasinya, which is described by using the tools of Business Process Model Notation (BPMN, as well as the depiction of a working model of the system to be applied using use case diagram. The next stage is to study the literature of various books and journals to find the theoretical basis and related research. Then selecting software for SIA School, after the configuration and customization of the software modules, and the latter carry out the implementation and testing. These results indicate that the software SIA Schools that have been selected and applied that JIBAS applications, which can solve the problems on SMA Negeri 9 Padang
Blood culture bottles are superior to conventional media for vitreous culture.
Thariya, Patsuda; Yospaiboon, Yosanan; Sinawat, Suthasinee; Sanguansak, Thuss; Bhoomibunchoo, Chavakij; Laovirojjanakul, Wipada
2016-08-01
To compare blood culture bottles and conventional media for the vitreous culture in patients with clinically suspected infectious endophthalmitis. Retrospective comparative study at KKU Eye Center, Khon Kaen University. There were 342 patients with clinically suspected infectious endophthalmitis participated in the study. The vitreous specimens were inoculated in both blood culture bottles and on conventional culture media (blood agar, MacConkey agar, chocolate agar, Sabouraud dextrose agar and thioglycolate broth). The number of positive culture yields in both blood culture bottles and conventional media. Positive culture yields in both methods were found in 151 eyes (49.5%). There were 136 of 151 eyes (90.1%) with positive culture in blood culture bottles, whereas 99 of 151 eyes (65.6%) yielded positive cultures in conventional media. These findings were different with a statistical significance (P culture bottles and conventional media improved the yield. Blood culture bottles are superior to conventional media for vitreous culture in clinically suspected infectious endophthalmitis. Vitreous culture using blood culture bottles should be recommended as the primary method for microbiological diagnosis. A combination of both methods further improves the positive culture yield. © 2016 Royal Australian and New Zealand College of Ophthalmologists.
Frequency and Antibiogram of Vancomycin Resistant Enterococcus in a Tertiary Care Hospital
International Nuclear Information System (INIS)
Babar, N.; Usman, J.; Munir, T.; Gill, M. M.; Anjum, R.; Gilani, M.; Latif, M.
2014-01-01
Objective: To determine the frequency of Vancomycin Resistant Enterococcus (VRE) in a tertiary care hospital of Rawalpindi, Pakistan. Study Design: Observational, cross-sectional study. Place and Duration of Study: Department of Microbiology, Army Medical College, Rawalpindi, from May 2011 to May 2012. Methodology: Vancomycin resistant Enterococcus isolated from the clinical specimens including blood, pus, double lumen tip, ascitic fluid, tracheal aspirate, non-directed bronchial lavage (NBL), cerebrospinal fluid (CSF), high vaginal swab (HVS) and catheter tips were cultured on blood agar and MacConkey agar, while the urine samples were grown on cystine lactose electrolyte deficient agar. Later the antimicrobial susceptibility testing of the isolates was carried out using the modified Kirby-Bauer disc diffusion method on Mueller Hinton agar. Results: A total of 190 enterococci were isolated. Of these, 22 (11.57%) were found to be resistant to vancomycin. The antimicrobial sensitivity pattern revealed maximum resistance against ampicillin (86.36%) followed by erythromycin (81.81%) and gentamicin (68.18%) while all the isolates were 100% susceptible to chloramphenicol and linezolid. Conclusion: The frequency of VRE was 11.57% with the highest susceptibility to linezolid and chloramphenicol. (author)
Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments
Energy Technology Data Exchange (ETDEWEB)
McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)
1997-04-01
Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.
MEDIA FOTO UNTUK MENINGKATKAN KETERAMPILAN MENULIS DESKRIPSI SISWA SMA NEGERI 2 KEBUMEN
Directory of Open Access Journals (Sweden)
Rina Tri Indrianingrum
2015-05-01
Full Text Available Penelitian ini bertujuan untuk menjelaskan meningkatnya keterampilan menulis deskripsi berbahasa Jawa siswa kelas X SMA N 2 Kebumen dengan menggunakan pendekatan proses dan media foto. Penelitian ini merupakan penelitian tindakan kelas atau classroom action research. Desain yang digunakan dalam penelitian ini adalah desain penelitian tindakan Kemmis dan Taggart. Penelitian ini dilaksanakan dua siklus. Subjek penelitian ini adalah siswa kelas X2 SMA Negeri 2 Kebumen tahun pelajaran 2011/2012 yang berjumlah 32 siswa. Pengumpulan data dilakukan dengan menggunakan observasi, catatan lapangan dan tes. Validitas yang digunakan adalah validitas demo-krasi, validitas proses dan validitas dialogis. Teknik yang digunakan untuk menganalisis data dalam penelitian tindakan ini adalah deskriptif. Hasil penelitian menunjukkan (1 siswa dapat menemukan ide lebih cepat, (2 siswa dapat membuat kerangka karangan, (3 siswa dapat mengembangkan kerang-ka karangan, (4 siswa dapat berpikir sistematis, (5 siswa semakin antusiasnya dalam mengikuti pembelajaran menulis karangan, (6 siswa paham melakukan proses mengarang. _________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ PHOTOGRAPH MEDIA TO IMPROVE THE DESCRIPTION WRITING SKILL OF THE STUDENTS AT SMA NEGERI 2 KEBUMEN Abstract This research is aimed to describe and to explain the improvement in the description writing skill of the tenth grade students at SMA N 2 Kebumen by using approach process and photography media. This research is classroom action research or classroom action research. The design used in this research was action research design by Kemmis and Taggart. The subject of the research was X2 class students at SMA Negeri 2 Kebumen in the academic year of 2011/2012, consisted of 32
Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji
2018-04-26
The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.
Experimental study on tunnel lining joints temporarily strengthened by SMA bolts
International Nuclear Information System (INIS)
Wu, Bo; Ou, Yunlong
2014-01-01
Shield tunnels have been widely used in city metros all over the world. During the long-term period of the metro operation, the joints of shield tunnel’s neighboring segments may degrade due to some environmental factors, leading to the increasing of the joint opening and some resulting adverse consequences. In this paper, a temporary strengthening method by using shape memory alloy (SMA) bolts is proposed and experimentally studied for the joints of neighboring segments, and a revised electric heating method which suits with the strengthening method is presented and experimentally validated for the SMA bolts. The purpose of the proposed temporary strengthening method is to create favorable conditions for the following permanent strengthening. Test results show that: (a) for the joints of shield tunnel’s neighboring segments, the strengthening method can effectively reduce the joint opening, joint deflection, concrete strain in joint’s compression zone, and strain of joint’s steel bolts; (b) the revised electric heating method can be used to heat the SMA rod to a temperature higher than the SMA’s austenite finish temperature quickly, and the average heating rate related to Type 2 inner resistance element is larger than that related to Type 1 inner resistance element; and (c) the reduction percentages of the joint opening increment, joint deflection, concrete strain in joint’s compression zone, and strain of joint’s steel bolts for Specimen I are all larger than those for Specimen II, implying that the less the joint opening is, the more significant the strengthening effect is. (paper)
PENGARUH PENDEKATAN KONTEKSTUAL TERHADAP HASIL BELAJAR BIOLOGI SISWA SMA
Directory of Open Access Journals (Sweden)
Irwandi -
2013-05-01
Full Text Available Abstract: Contextual Teaching and Learning and Biology Learning Achievement among Senior High School Students. This quasi experimental study was designed to explain the effects of inquiry learning of Contextual Teaching and Learning (CTL, learning community of CTL, and entry behavior on Biology learning achievement of senior high school students of Bengkulu. The subjects were randomly selected from year-10 classes of eight schools and assigned to eight experimental classes. The study shows that: (1 the inquiry learning of CTL has no effect on the students’ cognitive learning achievement; (2 the learning community, particularly the extended one, of CTL contributes to the students’ cognitive learning achievement; and (3 the students’ entry behavior did not affect their cognitive learning achievement when the students learned through inquiry process of CTL. Abstrak: Pengaruh Pendekatan Kontekstual terhadap Hasil Belajar Biologi Siswa SMA. Penelitian ini bertujuan untuk mengetahui: 1 pengaruh pendekatan kontekstual melalui strategi inkuiri terhadap hasil belajar kognitif siswa; 2 pengaruh pendekatan kontekstual melalui masyarakat belajar terhadap hasil belajar kognitif siswa; dan 3 pengaruh kemampuan awal siswa terhadap hasil belajar kognitifnya, pada pembelajaran kontekstual melalui strategi inkuiri tingkat 1 dan 2. Penelitian dilakukan terhadap siswa-siswa pada pembelajaran biologi di 8 buah kelas X, masing-masing dari salah satu SMAN Bengkulu yang dipilih secara random. Penelitian ini menggunakan rancangan kuasi eksperimen Pretest-posttest Nonequivalent Control Group Design dengan rancangan penelitian faktorial 2 x 2 x 2. Hasil penelitian menunjukkan bahwa 1 pendekatan kontekstual melalui strategi inkuiri, tidak berpengaruh terhadap hasil belajar kognitif siswa di SMA 2 pendekatan kontekstual melalui masyarakat belajar berpengaruh terhadap hasil belajar kognitif siswa di SMA di mana hasil belajar kognitif melalui masyarakat belajar
PENGARUH MODEL EXPERIENTIAL LEARNING TERHADAP KEMAMPUAN BERPIKIR SISWA SMA
Directory of Open Access Journals (Sweden)
Mar’atus Sholihah
2016-11-01
Full Text Available The purpose of this study was to determine the effect of Experiential Learning models developed by Kolb's theory of the critical thinking skills of high school students. This study uses a quasi experiment conducted in SMA Assa'adah Gresik. The population of students of class X IS second semester of academic year 2015/2016. Samples are 2 classes that are homogeneous. Methods of data collection using test questions and the ability to think critically using observation sheet. Data were analyzed by comparing the average acquisition value of critical thinking skills with experimental class control class. Average value of the critical thinking skills using model Experiential Learning higher at 80.9 while the control class is 71.2. Based on the average it can be concluded that the learning model of Experiential Learning can improve students' critical thinking skills. This study is expected to provide information on the application and benefits of the model Experiential Learning in teaching geography and make it more meaningful for students. Tujuan dari penelitian ini adalah mengetahui pengaruh model Experiential Learning yang dikembangkan oleh teori Kolb terhadap kemampuan berpikir kritis siswa SMA. Penelitian ini menggunakan metode quasi experimen yang dilakukan di SMA Assa’adah Gresik. Populasi siswa kelas X IS semester genap tahun pelajaran 2015/2016. Sampel yang digunakan sebanyak 2 kelas yang bersifat homogen. Metode pengumpulan data menggunakan soal tes kemampuan berpikir kritis serta menggunakan lembar observasi. Data yang diperoleh kemudian dianalisis dengan membandingkan rata-rata perolehan nilai kemampuan berpikir kritis kelas kontrol dengan kelas eksperimen. Nilai rata rata kemampuan berpikir kritis yang menggunakan model pembelajaran Experiential Learning lebih tinggi, yaitu sebesar 80,9, sedangkan kelas kontrol sebesar 71,2. Berdasarkan nilai rata-rata tersebut dapat disimpulkan bahwa model pembelajaran Experiential Learning dapat
Papadimitriou, Konstantinos; Anastasiou, Rania; Maistrou, Eleni; Plakas, Thomas; Papandreou, Nikos C.; Hamodrakas, Stavros J.; Ferreira, Stéphanie; Supply, Philip; Renault, Pierre; Pot, Bruno; Tsakalidou, Effie
2015-01-01
Background Streptococcus macedonicus is an intriguing streptococcal species whose most frequent source of isolation is fermented foods similarly to Streptococcus thermophilus. However, S. macedonicus is closely related to commensal opportunistic pathogens of the Streptococcus bovis/Streptococcus equinus complex. Methodology/Principal Findings We analyzed the pSMA198 plasmid isolated from the dairy strain Streptococcus macedonicus ACA-DC 198 in order to provide novel clues about the main ecological niche of this bacterium. pSMA198 belongs to the narrow host range pCI305/pWV02 family found primarily in lactococci and to the best of our knowledge it is the first such plasmid to be reported in streptococci. Comparative analysis of the pSMA198 sequence revealed a high degree of similarity with plasmids isolated from Lactococcus lactis strains deriving from milk or its products. Phylogenetic analysis of the pSMA198 Rep showed that the vast majority of closely related proteins derive from lactococcal dairy isolates. Additionally, cloning of the pSMA198 ori in L. lactis revealed a 100% stability of replication over 100 generations. Both pSMA198 and the chromosome of S. macedonicus exhibit a high percentage of potential pseudogenes, indicating that they have co-evolved under the same gene decay processes. We identified chromosomal regions in S. macedonicus that may have originated from pSMA198, also supporting a long co-existence of the two replicons. pSMA198 was also found in divergent biotypes of S. macedonicus and in strains isolated from dispersed geographic locations (e.g. Greece and Switzerland) showing that pSMA198’s acquisition is not a recent event. Conclusions/Significance Here we propose that S. macedonicus acquired plasmid pSMA198 from L. lactis via an ancestral genetic exchange event that took place most probably in milk or dairy products. We provide important evidence that point towards the dairy origin of this species. PMID:25584532
Evaluation of Fatigue Life of CRM-Reinforced SMA and Its Relationship to Dynamic Stiffness
Directory of Open Access Journals (Sweden)
Nuha Salim Mashaan
2014-01-01
Full Text Available Fatigue cracking is an essential problem of asphalt concrete that contributes to pavement damage. Although stone matrix asphalt (SMA has significantly provided resistance to rutting failure, its resistance to fatigue failure is yet to be fully addressed. The aim of this study is to evaluate the effect of crumb rubber modifier (CRM on stiffness and fatigue properties of SMA mixtures at optimum binder content, using four different modification levels, namely, 6%, 8%, 10%, and 12% CRM by weight of the bitumen. The testing undertaken on the asphalt mix comprises the dynamic stiffness (indirect tensile test, dynamic creep (repeated load creep, and fatigue test (indirect tensile fatigue test at temperature of 25°C. The indirect tensile fatigue test was conducted at three different stress levels (200, 300, and 400 kPa. Experimental results indicate that CRM-reinforced SMA mixtures exhibit significantly higher fatigue life compared to the mixtures without CRM. Further, higher correlation coefficient was obtained between the fatigue life and resilient modulus as compared to permanent strain; thus resilient modulus might be a more reliable indicator in evaluating the fatigue life of asphalt mixture.
Evaluation of fatigue life of CRM-reinforced SMA and its relationship to dynamic stiffness.
Mashaan, Nuha Salim; Karim, Mohamed Rehan; Abdel Aziz, Mahrez; Ibrahim, Mohd Rasdan; Katman, Herda Yati; Koting, Suhana
2014-01-01
Fatigue cracking is an essential problem of asphalt concrete that contributes to pavement damage. Although stone matrix asphalt (SMA) has significantly provided resistance to rutting failure, its resistance to fatigue failure is yet to be fully addressed. The aim of this study is to evaluate the effect of crumb rubber modifier (CRM) on stiffness and fatigue properties of SMA mixtures at optimum binder content, using four different modification levels, namely, 6%, 8%, 10%, and 12% CRM by weight of the bitumen. The testing undertaken on the asphalt mix comprises the dynamic stiffness (indirect tensile test), dynamic creep (repeated load creep), and fatigue test (indirect tensile fatigue test) at temperature of 25°C. The indirect tensile fatigue test was conducted at three different stress levels (200, 300, and 400 kPa). Experimental results indicate that CRM-reinforced SMA mixtures exhibit significantly higher fatigue life compared to the mixtures without CRM. Further, higher correlation coefficient was obtained between the fatigue life and resilient modulus as compared to permanent strain; thus resilient modulus might be a more reliable indicator in evaluating the fatigue life of asphalt mixture.
Directory of Open Access Journals (Sweden)
Novita _
2017-08-01
Full Text Available NOVITA. 2017.Essay . The Influence of Human Resource Competency on Employee and Teacher Performance at SMA SARIBUANA Makassar South Sulawesi Province.Guided by Indrayani Nur, S. Pd SE., M.Si. An employee is an individual who works for an employer, by contract or agreement whether in writing or in writing, to carry out a job or occupation in a particular activity by obtaining compensation paid under a specified period. This study aims to analyze the influence of human resource competencies on the performance of employees and teachers in SMA SARIBUANA Makassar. Analyzer used is multiple linear regression. Respondents of this research are employees and teachers of SMA Saribuana Makassar. The results of the analysis show that knowledge, mastery of science of technology and motivation affect the improvement of employee and teacher performance From the ANOVA or F test, the significant number (Sig (0,000 is below 0.05 and the Fcount is 19.614 where the Fcount is greater than the Ftable of 3.35. Thus, Fcount > Ftable then this result indicates that the independent variable (knowledge, mastery of technology science, motivation influence together to the dependent variable (employee and teacher performance.
Xu, Benjamin; Sandrini, Marco; Wang, Wen-Tung; Smith, Jason F; Sarlls, Joelle E; Awosika, Oluwole; Butman, John A; Horwitz, Barry; Cohen, Leonardo G
2016-09-01
Previous work using transcranial magnetic stimulation (TMS) demonstrated that the right presupplementary motor area (preSMA), a node in the fronto-basal-ganglia network, is critical for response inhibition. However, TMS influences interconnected regions, raising the possibility of a link between the preSMA activity and the functional connectivity within the network. To understand this relationship, we applied single-pulse TMS to the right preSMA during functional magnetic resonance imaging when the subjects were at rest to examine changes in neural activity and functional connectivity within the network in relation to the efficiency of response inhibition evaluated with a stop-signal task. The results showed that preSMA-TMS increased activation in the right inferior-frontal cortex (rIFC) and basal ganglia and modulated their task-free functional connectivity. Both the TMS-induced changes in the basal-ganglia activation and the functional connectivity between rIFC and left striatum, and of the overall network correlated with the efficiency of response inhibition and with the white-matter microstructure along the preSMA-rIFC pathway. These results suggest that the task-free functional and structural connectivity between the rIFCop and basal ganglia are critical to the efficiency of response inhibition. Hum Brain Mapp 37:3236-3249, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Firdaus Firdaus
2016-02-01
Penelitian ini bertujuan untuk mendeskripsikan kemampuan berpikir kreatif matematis siswa SMA melalui pembelajaran open ended problem materi SPLDV. Jenis penelitian ini, yaitu deskriptif kualitatif. Subjeknya adalah siswa kelas X.2 SMA Negeri 1 Woja Dompu. Tahap pembelajaran dalam penelitian ini adalah (1 Orientasi, (2 pembekalan materi, (3 penyajian dan pengerjaan soal open ended, (4 presentasi, (5 kesimpulan. Kemampuan berpikir kreatif matematis siswa meliputi: (a fluency, kemampuan siswa lancar dalam memberikan jawaban benar, (b flexibility, kemampuan siswa dalam menggunakan berbagai cara penyelesaian masalah, (c novelty, kemampuan siswa dalam memberikan jawaban yang baru dan berbeda dengan siswa lain. Penelitian ini hasilnya, bahwa siswa mempunyai kemampuan berpikir kreatif matematis.
Ackermann, Bastian
2011-01-01
Spinal muscular atrophy (SMA) is a neurodegenerative disease characterized by the loss of α-motor neurons in the ventral horn of the spinal cord. Depending on the severity, the clinical spectrum of SMA ranges from early infant death to normal adult life with only mild muscle weakness. To date, no cure is available. SMA is caused by the homozygous loss of the survival motor neuron gene 1 (SMN1). Besides SMN1, another nearly identical copy of the gene is present in the human genome, thus called...
Dynamical analysis and development of a biologically inspired SMA caterpillar robot.
Daily-Diamond, Christopher A; Novelia, Alyssa; O'Reilly, Oliver M
2017-09-26
With the goal of robustly designing and fabricating a soft robot based on a caterpillar featuring shape memory alloy (SMA) actuators, analytical and numerical models for a soft robot were created based on the forward crawling motion of the Manduca sexta caterpillar. The analytical model features a rod theory and the mechanics of undulation were analyzed using a motion pattern based on the 'Witch of Agnesi' curve. Complementing these models, experiments on a SMA actuator sample were performed in order to determine its flexural rigidity and curvature as a function of the actuation voltage. A series of these actuators can be modeled as a system of rigid bodies connected by torsional springs. As these bodies are actuated according to the motion pattern based on the individual caterpillar segments, ground contact forces are calculated and analyzed to determine the requirements of successful forward locomotion. The energetics of the analytical and numerical models are then compared and discussed.
Wang, He; Li, Ying; Fan, Xin; Chiueh, Tzong-Shi; Xu, Ying-Chun; Hsueh, Po-Ren
2017-11-11
The aim of this study was to investigate the performance of the Bruker Biotyper matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and Vitek MS systems for identification of genetically-confirmed blood isolates of Candida tropicalis that had been grown on several types of culture media commonly used for primary fungal isolation. Isolates included 105 from the National China Hospital Invasive Fungal Surveillance Net program (CHIF-NET) and 120 from National Taiwan University Hospital (NTUH). Culture media tested for CHIF-NET isolates included trypticase soy agar supplemented with 5% sheep blood (BAP), Sabouraud dextrose agar (SDA-C), CHROMagar, China blue agar (CBA), chocolate agar supplemented with vancomycin (CAP-VA), and MacConkey agar (MAC). Culture media used for NTUH isolates included BAP, SDA, CHROMagar, eosin methylene blue (EMB), inhibitory mold agar (IMA), Mycosel agar, and cornmeal agar (CMA). The Bruker Biotyper correctly identified all CHIF-NET isolates to the species level on all six agar media tested and correctly identified the majority of NTUH isolates with the exception of isolates grown on SDA (85.8%) and CMA (52.5%). The Vitek MS system correctly identified all CHIF-NET isolates to the species level with the exception of isolates grown on CHROMagar (84.8%), and correctly identified the majority of NTUH isolates with the exception of isolates grown on SDA (51.7%), Mycosel agar (57.5%), and CMA (9.2%) for NTUH isolates. Clinical microbiologists should be aware that different culture media can affect the performance of the Bruker Biotyper MALDI-TOF MS and Vitek MS systems in identifying C. tropicalis. Copyright © 2017. Published by Elsevier B.V.
Use of electron beam on aflatoxins degradation in coconut agar
International Nuclear Information System (INIS)
Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito
2009-01-01
The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)
MODEL EVALUASI INTERNAL KOMPETENSI GURU BAHASA INGGRIS (MODEL_EIKGBI SMA
Directory of Open Access Journals (Sweden)
Sahraini Sahraini
2015-10-01
Full Text Available Studi ini bertujuan untuk: (1 mengembangkan model evaluasi kompetensi guru bahasa Inggris SMA yang dapat digunakan untuk mengidentifikasi kelebihan dan kekurangan guru dalam proses pemelajaran dan (2 mengetahui efektivitas implementasi evaluasi internal kompetensi guru bahasa Inggris SMA. Studi ini menggunakan metode penelitian dan pengembangan yang dikembangkan oleh Borg & Gall (1983, p.775. Subjek penelitian berjumlah 17 guru yang berasal dari 7 SMA di Sulawesi Selatan. Konstruk instrumen terdiri atas instrumen untuk mengevaluasi kompetensi guru bahasa Inggris dalam merencanakan pemelajaran, instrumen untuk mengevaluasi kompetensi guru dalam melaksanaan proses pemelajaran, dan instrumen untuk mengevaluai kompetensi guru dalam mengevaluasi hasil proses pemelajaran. Hasil penelitian menunjukkan bahwa instrumen yang dikembangkan dapat digunakan untuk mengevaluasi kompetensi guru bahasa Inggris. Untuk mengetahui sejauh mana tingkat efektivitas Model Evaluasi Internal Kompetensi Guru Bahasa Inggris SMA, model ini kemudian dievaluasi oleh teman sejawat guru bahasa Inggris dan guru bahasa Inggris itu sendiri. Mereka menyimpulkan bahwa komponen dari model tersebut adalah komprehensip, praktis, ekonomis, dan telah didukung oleh instrumen yang valid dan reliabel. Kata kunci: evaluasi internal, model evaluasi, kompetensi guru INTERNAL EVALUATION MODEL OF ENGLISH TEACHERS’ COMPETENCY (IEMET FOR SENIOR HIGH SCHOOL Abstract High School that can be used to identify the teacher’s strengths and weaknesses in learning and teaching processes and (2 find out the implementation effectiveness of the Internal Evaluation Model of English Teachers’ Competency for Senior High School. This study used research & development methods by following the pattern of phases developed by Borg & Gall (1983, p.775. The subjects of this study were seventeen English teachers from seven Senior High Schools in South Sulawesi. The constructs of instruments consist of the
Energy Technology Data Exchange (ETDEWEB)
Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)
2017-06-01
In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.
Directory of Open Access Journals (Sweden)
Fitriany Yudistia R
2014-04-01
Full Text Available Siswa tunanetra SMA Muhammadiyah 4 Yogyakarta, MAN Maguwoharjo dan SMAN 1 Sewon belum memiliki sumber belajar mandiri berupa modul Braille khususnya pada materi Hukum Newton. Berdasarkan kenyataan ini maka dibutuhkan sebuah sumber belajar yang didesain khusus bagi siswa tunanetra di kelas Inklusi yakni modul Braille pada pokok bahasan Hukum Newton.Telah dilakukan penelitian yang bertujuan untuk: (1 mengembangkan modul fisika pokok bahasan Hukum Newton untuk siswa tunanetra SMA/MA kelas X sebagai sumber belajar mandiri, (2 mengetahui kualitas modul fisika Braille materi Hukum Newton untuk siswa tunanetra SMA/MA kelas X, (3 mengetahui respon siswa terhadap modul fisika Braille yang telah dikembangkan.Penelitian ini merupakan penelitian R & D dengan model prosedural yang mengadaptasi dari pengembangan perangkat model 4-D, yakni Define, Design, Develop, and Disseminate. Instrumen penelitian berupa angket kualitas modul yaitu menggunakan skala Likert yang dibuat dalam bentuk checklist. Instrumen untuk siswa berupa angket respon siswa yaitu menggunakan skala Guttman yang dibuat dalam bentuk checklist. Modul dinilai kualitasnya oleh 3 ahli materi, 1 ahli media, dan 2 guru fisika SMA/MA. Kelayakan modul berdasarkan respon siswa pada uji coba terbatas sebanyak 2 siswa dan uji coba luas sebanyak 8 siswa.Hasil penelitian berdasarkan penilaian dari ahli materi, ahli media dan guru fisika SMA/MA modul memiliki kategori sangat baik (SB. Persentase keidealan menurut ahli materi adalah 87,88%; persentase keidealan menurut ahli media adalah 90,00% dan persentase keidealan menurut guru Fisika SMA/MA adalah 75,00%. Respon siswa terhadap modul fisika Braille pada uji coba terbatas diperoleh persentase 97,22%; sedangkan pada uji coba luas diperoleh persentase 89,58%. Hasil penelitian ini menunjukkan bahwa modul layak dijadikan sebagai salah satu sumber belajar mandiri bagi siswa tunanetra.
Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.
Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max
2016-07-01
Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.
Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.
Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F
2012-12-01
Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.
Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7
Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.
2012-01-01
Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.
Tsuboyama, Shoko; Kodama, Yutaka
2014-01-01
The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.
Directory of Open Access Journals (Sweden)
Indri Retno Palupi
2016-12-01
Full Text Available Hasil survei Perkumpulan Keluarga Berencana Indonesia (PKBI cabang Bandar Lampung tahun 2014, dismenorhea menempati urutan pertama keluhan yang sering dialami wanita, sebesar 65,3% selain siklus menstruasi yang tidak teratur. Prevalensi dismenorhea lebih tinggi pada kelompok usia remaja 10-20 tahun sebesar 71,4%. Tujuan penelitian ini diketahui pengaruh dari neptune krill oil pada manajemen disminorea pada remaja putri kelas X di SMA Negeri 1 Pringsewu tahun 2016. Jenis penelitian ini adalah kuantitatif dengan menggunakan rancangan desain eksperimen dengan menggunakan pendekatan one group pre and post test. Populasi dalam penelitian ini adalah seluruh remaja putri kelas X di SMA Negeri 1 Pringsewu yang berjumlah 193 orang, sampel dalam penelitian ini berjumlah 30 orang. Teknik sampling dalam penelitian ini menggunakan teknik accidental. Analisis data yang digunakan dalam penelitian ini univariat dan bivariat dengan uji t-test.Tingkat nyeri dismenorhea sebelum diberi Neptune krill oil pada siswi kelas X SMA Negeri 1 Pringsewu memiliki rata-rata tingkatan nyeri yaitu 8,190 (pada skala 1-15, Tingkat nyeri dismenorhea setelah diberi Neptune krill oil pada siswi kelas X SMA Negeri 1 Pringsewu memiliki Rata-rata tingkat nyeri yaitu 4,747 (pada skala 1-15. Ada pengaruh pemberian Neptune krill oil terhadap intensitas nyeri dismenorhea pada siswi kelas X SMA Negeri 1 Pringsewu Tahun 2016 (p-value=0,000. Diharapkan remaja putri dapat mengetahui bahwa salah satu cara untuk mengurangi nyeri dismenorhea adalah dengan mengkonsumsi Neptune krill oil. Sehingga remaja putri dapat menerapkannya dirumah saat mengalami dismenorhea.
Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.
Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran
2017-08-01
We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.
Sousa, Ana M M; Gonçalves, Maria P
2015-11-05
Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.
KESANTUNAN TUTURAN DIREKTIF DALAM INTERAKSI PEMBELAJARAN DI SMA
Directory of Open Access Journals (Sweden)
Mardiyah Putri Astuti
2017-03-01
Full Text Available Politeness speech in learning interactions in the classroom tend to be effected through a directive speech. Assessment of form directive speech made by using a guide to the theory and analysis based on speech act theory directive Bach and Harnish. This study aims to determine the form of politeness directive in an interaction study in SMA 1 Batu. Forms directive speech in learning interactions are marked with (1 directive requests, (2 directive question, (3 directive command, (4 The prohibition directive, (5 directive licensing, and (6 the directive advice. The results of the analysis of the forms of speech directive shows that teachers do politeness predominantly through commands, prohibitions, permissions, and advice, while the shape of the directive utterances made by teachers and students to consider cultural aspects. Kesantunan tuturan dalam interaksi pembelajaran di dalam kelas cenderung dilakukan melalui bentuk tuturan direktif. Pengkajian terhadap bentuk tuturan direktif dilakukan dengan mengggunakan teori dan panduan analisis berdasarkan teori tindak tutur direktif Bach dan Harnish. Penelitian ini bertujuan untuk mengetahui bentuk kesantunan direktif dalam interaksi pembelajaran di SMA 1 Batu. Bentuk tuturan direktif dalam interaksi pembelajaran ditandai dengan (1 direktif permintaan, (2 direktif pertanyaan, (3 direktif perintah, (4 direktif larangan, (5 direktif pemberian izin, dan (6 direktif nasihat. Hasil analisis mengenai bentuk tuturan direktif menunjukkan bahwa guru melakukan kesantunan secara dominan melalui perintah, larangan, izin, dan nasihat, sedangkan bentuk tuturan direktif dilakukan oleh guru dan siswa dengan mempertimbangkan aspek budaya.
Scaling structure loads for SMA
Energy Technology Data Exchange (ETDEWEB)
Lee, Dong Won; Song, Jeong Guk; Jeon, Sang Ho; Lim, Hak Kyu; Lee, Kwang Nam [KEPCO ENC, Yongin (Korea, Republic of)
2012-10-15
When the Seismic Margin Analysis(SMA) is conducted, the new structural load generation with Seismic Margin Earthquake(SME) is the time consuming work. For the convenience, EPRI NP 6041 suggests the scaling of the structure load. The report recommend that the fixed base(rock foundation) structure designed using either constant modal damping or modal damping ratios developed for a single material damping. For these cases, the SME loads can easily and accurately be calculated by scaling the spectral accelerations of the individual modes for the new SME response spectra. EPRI NP 6041 provides two simple methodologies for the scaling structure seismic loads which are the dominant frequency scaling methodology and the mode by mode scaling methodology. Scaling of the existing analysis to develop SME loads is much easier and more efficient than performing a new analysis. This paper is intended to compare the calculating results of two different methodologies.
Scaling structure loads for SMA
International Nuclear Information System (INIS)
Lee, Dong Won; Song, Jeong Guk; Jeon, Sang Ho; Lim, Hak Kyu; Lee, Kwang Nam
2012-01-01
When the Seismic Margin Analysis(SMA) is conducted, the new structural load generation with Seismic Margin Earthquake(SME) is the time consuming work. For the convenience, EPRI NP 6041 suggests the scaling of the structure load. The report recommend that the fixed base(rock foundation) structure designed using either constant modal damping or modal damping ratios developed for a single material damping. For these cases, the SME loads can easily and accurately be calculated by scaling the spectral accelerations of the individual modes for the new SME response spectra. EPRI NP 6041 provides two simple methodologies for the scaling structure seismic loads which are the dominant frequency scaling methodology and the mode by mode scaling methodology. Scaling of the existing analysis to develop SME loads is much easier and more efficient than performing a new analysis. This paper is intended to compare the calculating results of two different methodologies
Quantitative SIMS Imaging of Agar-Based Microbial Communities.
Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V
2018-05-01
After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.
Diwadkar, Vaibhav A.; Asemi, Avisa; Burgess, Ashley; Chowdury, Asadur; Bressler, Steven L.
2017-01-01
The dorsal Anterior Cingulate Cortex (dACC) and the Supplementary Motor Area (SMA) are known to interact during motor coordination behavior. We previously discovered that the directional influences underlying this interaction in a visuo-motor coordination task are asymmetric, with the dACC→SMA influence being significantly greater than that in the reverse direction. To assess the specificity of this effect, here we undertook an analysis of the interaction between dACC and SMA in two distinct contexts. In addition to the motor coordination task, we also assessed these effects during a (n-back) working memory task. We applied directed functional connectivity analysis to these two task paradigms, and also to the rest condition of each paradigm, in which rest blocks were interspersed with task blocks. We report here that the previously known asymmetric interaction between dACC and SMA, with dACC→SMA dominating, was significantly larger in the motor coordination task than the memory task. Moreover the asymmetry between dACC and SMA was reversed during the rest condition of the motor coordination task, but not of the working memory task. In sum, the dACC→SMA influence was significantly greater in the motor task than the memory task condition, and the SMA→dACC influence was significantly greater in the motor rest than the memory rest condition. We interpret these results as suggesting that the potentiation of motor sub-networks during the motor rest condition supports the motor control of SMA by dACC during the active motor task condition. PMID:28278267
Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.
Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena
2015-05-01
Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®
Sturød, Kjersti; Dahle, Ulf R; Berg, Einar Sverre; Steinbakk, Martin; Wester, Astrid L
2014-09-04
The aim of this study was to compare the ability of four commercially available media for screening extended-spectrum beta-lactamase (ESBL) to detect and identify ESBL-producing Salmonella and Shigella in fecal samples. A total of 71 Salmonella- and 21 Shigella-isolates producing ESBL(A) and/or AmpC, were received at Norwegian Institute of Public Health between 2005 and 2012. The 92 isolates were mixed with fecal specimens and tested on four ESBL screening media; ChromID ESBL (BioMèrieux), Brilliance ESBL (Oxoid), BLSE agar (AES Chemunex) and CHROMagar ESBL (CHROMagar). The BLSE agar is a biplate consisting of two different agars. Brilliance and CHROMagar are supposed to suppress growth of AmpC-producing bacteria while ChromID and BLSE agar are intended to detect both ESBL(A) and AmpC. The total sensitivity (ESBL(A)+AmpC) with 95% confidence intervals after 24 hours of incubation were as follows: ChromID: 95% (90.4-99.6), Brilliance: 93% (87.6-98.4), BLSE agar (Drigalski): 99% (96.9-100), BLSE agar (MacConkey): 99% (96.9-100) and CHROMagar: 85% (77.5-92.5). The BLSE agar identified Salmonella and Shigella isolates as lactose-negative. The other agars based on chromogenic technology displayed Salmonella and Shigella flexneri isolates with colorless colonies (as expected). Shigella sonnei produced pink colonies, similar to the morphology described for E. coli. All four agar media were reliable in screening fecal samples for ESBL(A)-producing Salmonella and Shigella. However, only ChromID and BLSE agar gave reliable detection of AmpC-producing isolates. Identification of different bacterial species based on colony colour alone was not accurate for any of the four agars.
Advanced methods for the analysis, design, and optimization of SMA-based aerostructures
International Nuclear Information System (INIS)
Hartl, D J; Lagoudas, D C; Calkins, F T
2011-01-01
Engineers continue to apply shape memory alloys to aerospace actuation applications due to their high energy density, robust solid-state actuation, and silent and shock-free operation. Past design and development of such actuators relied on experimental trial and error and empirically derived graphical methods. Over the last two decades, however, it has been repeatedly demonstrated that existing SMA constitutive models can capture stabilized SMA transformation behaviors with sufficient accuracy. This work builds upon past successes and suggests a general framework by which predictive tools can be used to assess the responses of many possible design configurations in an automated fashion. By applying methods of design optimization, it is shown that the integrated implementation of appropriate analysis tools can guide engineers and designers to the best design configurations. A general design optimization framework is proposed for the consideration of any SMA component or assembly of such components that applies when the set of design variables includes many members. This is accomplished by relying on commercially available software and utilizing tools already well established in the design optimization community. Such tools are combined with finite element analysis (FEA) packages that consider a multitude of structural effects. The foundation of this work is a three-dimensional thermomechanical constitutive model for SMAs applicable for arbitrarily shaped bodies. A reduced-order implementation also allows computationally efficient analysis of structural components such as wires, rods, beams and shells. The use of multiple optimization schemes, the consideration of assembled components, and the accuracy of the implemented constitutive model in full and reduced-order forms are all demonstrated
How selective are agar cultures for malignant transformation?
Klein, J.C.
1981-01-01
In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized
Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films
Directory of Open Access Journals (Sweden)
Esam A. El-Hefian
2011-01-01
Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.
Ningsih, Dwi Purwanti
2017-01-01
This research entitled case study about student who have negative self concept in class X SMA Mujahidin Pontianak. Common problem in this research is how effort to help student having negatif self concept in class X SMA Mujahidin Pontianak? As for the sub-problems: 1) How are the characteristics of student who have negative self concept?, 2) What psychological factors that cause student to have negative self concept?, 3) What physiological factors that cause student to have a negative self co...
Directory of Open Access Journals (Sweden)
Hidayatulloh Hidayatulloh
2016-09-01
Full Text Available This article examines about improving the education quality of SMA Muhammadiyah 2 Sidoarjo as the Outstanding School of Muhammadiyah. This article reveals that the quality improvement of SMA Muhammadiyah 2 Sidoarjo was conducted through: the arrangement of school program and self evaluation, the reinforcement of vision, mission and education objective, the reinforcement of leadership and teamwork, the improvement of teachers and educators competence, the improvement learners quality input, the development of curriculum and learning, the development of school culture, the development of facilities and infrastructure, the development of community service, the cooperation of education and student exchange, the mobilization of education funding resources, the develop-ment of SIM, monitoring and evaluation, and education quality system. The management quality of SMA Muhammadiyah 2 Sidoarjo was run through input-process-output formula. The process of quality containes the process of quality planning, main process, supporting process, dan quality improvement process. Factors supporting the quality improvement are: Muhammadiyah’s popular name, the doctrine of education quality improvement, the leadership of TORSIE paradigm, the school academicians’ spirit of gaining achievement, the synergy of school academicians, the appropriate facilities, and the supports of all stakeholders.
Effect of gamma irradiation on the sensitivities of escherichia coli at deep frozen conditions
International Nuclear Information System (INIS)
Takigami, Machiko; Ito, Hitoshi
1996-01-01
Phosphate buffer suspensions of three strains of Escherichia coli were irradiated with gamma-rays at room temperature and deep frozen conditions. They were inoculated on MacConkey agar plates to see the comparative sensitivities to the irradiation. Compared to the irradiation at room temperature, the sensitivities of the strains decreased by irradiation at deep frozen conditions. Addition of glycerol to the E. coli suspensions decreased the sensitivities of E. coli to gamma-rays not only at room temperature but also at deep frozen conditions. These phenomena were elucidated by the decrease of production and mobility of OH radicals at deep frozen conditions. (author)
Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media
Matsuura, Shu; Miyazima, Sasuke
Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.
Kondisi Stres Akademik Siswa SMA Negeri di Kota Padang
Taufik Taufik; Ifdil Ifdil
2014-01-01
This research conduct base from increasing the National Examination standards from recent years, and overload student’s learning activity in Senior High School (SMA). These conditions as triggers stress students, from a long time, its influence on their learning. Based that, the research is to identify level of student academic stress, and differences base gender, and school location. This research use Cluster Random Sampling. Samples are grouped into 3 (three), that’s school is located in do...
SMA foil-based elastocaloric cooling: from material behavior to device engineering
Bruederlin, F.; Ossmer, H.; Wendler, F.; Miyazaki, S.; Kohl, M.
2017-10-01
The elastocaloric effect associated with the stress-induced first order phase transformation in pseudoelastic shape memory alloy (SMA) films and foils is of special interest for cooling applications on a miniature scale enabling fast heat transfer and high cycling frequencies as well as tunable transformation temperatures. The focus is on TiNi-based materials having the potential to meet the various challenges associated with elastocaloric cooling including large adiabatic temperature change and ultra-low fatigue. The evolution of strain and temperature bands during tensile load cycling is investigated with respect to strain and strain-rate by in situ digital image correlation and infrared thermography with a spatial resolution in the order of 25 µm. Major design issues and challenges in fabrication of SMA film-based elastocaloric cooling devices are discussed including the efficiency of heat transfer as well as force recovery to enhance the coefficient of performance (COP) on the system level. Advanced demonstrators show a temperature span of 13 °C after 30 s, while the COP of the overall device reaches almost 10% of Carnot efficiency.
Tremblay, Pascale; Gracco, Vincent L
2009-05-01
An emerging theoretical perspective, largely based on neuroimaging studies, suggests that the pre-SMA is involved in planning cognitive aspects of motor behavior and language, such as linguistic and non-linguistic response selection. Neuroimaging studies, however, cannot indicate whether a brain region is equally important to all tasks in which it is activated. In the present study, we tested the hypothesis that the pre-SMA is an important component of response selection, using an interference technique. High frequency repetitive TMS (10 Hz) was used to interfere with the functioning of the pre-SMA during tasks requiring selection of words and oral gestures under different selection modes (forced, volitional) and attention levels (high attention, low attention). Results show that TMS applied to the pre-SMA interferes selectively with the volitional selection condition, resulting in longer RTs. The low- and high-attention forced selection conditions were unaffected by TMS, demonstrating that the pre-SMA is sensitive to selection mode but not attentional demands. TMS similarly affected the volitional selection of words and oral gestures, reflecting the response-independent nature of the pre-SMA contribution to response selection. The implications of these results are discussed.
Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf
Directory of Open Access Journals (Sweden)
Ricardo J. Licea Moreno
2001-04-01
Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture
Design optimization and uncertainty analysis of SMA morphing structures
International Nuclear Information System (INIS)
Oehler, S D; Hartl, D J; Lopez, R; Malak, R J; Lagoudas, D C
2012-01-01
The continuing implementation of shape memory alloys (SMAs) as lightweight solid-state actuators in morphing structures has now motivated research into finding optimized designs for use in aerospace control systems. This work proposes methods that use iterative analysis techniques to determine optimized designs for morphing aerostructures and consider the impact of uncertainty in model variables on the solution. A combination of commercially available and custom coded tools is utilized. ModelCenter, a suite of optimization algorithms and simulation process management tools, is coupled with the Abaqus finite element analysis suite and a custom SMA constitutive model to assess morphing structure designs in an automated fashion. The chosen case study involves determining the optimized configuration of a morphing aerostructure assembly that includes SMA flexures. This is accomplished by altering design inputs representing the placement of active components to minimize a specified cost function. An uncertainty analysis is also conducted using design of experiment methods to determine the sensitivity of the solution to a set of uncertainty variables. This second study demonstrates the effective use of Monte Carlo techniques to simulate the variance of model variables representing the inherent uncertainty in component fabrication processes. This paper outlines the modeling tools used to execute each case study, details the procedures for constructing the optimization problem and uncertainty analysis, and highlights the results from both studies. (paper)
NMR spectroscopy study of agar-based polymers electrolytes
Energy Technology Data Exchange (ETDEWEB)
Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica
2012-07-01
Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)
Experiment feedbacks in micromechanics modeling of thermomechanical behaviour of SMA polycrystals
Czech Academy of Sciences Publication Activity Database
Šittner, Petr; Novák, Václav
2004-01-01
Roč. 51, - (2004), s. 321-326 ISSN 1359-6462 R&D Projects: GA AV ČR IAA1048107; GA ČR GA202/04/2016 Institutional research plan: CEZ:AV0Z1010914 Keywords : shape memory alloys (SMA) * martensitic phase transformation * micromechanical modeling * neutron diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.112, year: 2004
EVALUASI STRATEGI BERSAING SMA KRISTEN 1 SALATIGA
Directory of Open Access Journals (Sweden)
Eclesia Tehupeiory
2015-06-01
Full Text Available This study aims to evaluate the competitive strategies of SMA Kristen 1 Salatiga. The type of this study was a qualitative evaluation, through data collection by means of interviews, questionnaires, observation and documentation study. Data obtained and analyzed by an evaluation component based on Rumelt (2000 were consistency, consonance, advantage and feasibility. The results showed that: (1 Consistency evaluation of competitive strategy applied by SMA Kristen 1 Salatiga has shown consistency with the goals, values and policies of the school. (2 Consonance evaluation of competitive strategy has demonstrated suitability with the needs of society, while for competition with other schools, the school programs such as Peduli Kasih program, Sekolah Lima Hari, moving class, SMUQI Radio and multimedia extracurricular namely cinematography and photography are not appropriate. (3 Advantage evaluation of competitive strategy in the school programs such as Peduli Kasih, moving class, and Sekolah Lima Hari do not excel the resources, skills and superior positions. Other programs such as multimedia Extracurricular namely photography and cinematography is not superior to the superior position. Meanwhile, special programs such as the education expo, parenting day, career day and the Field Trip program through Live In and outdoor study do not excel in superior skills. (4 Feasibility evaluation shows that multimedia extracurricular programs have not showed the feasibility of the physical resources which involves computer supporting facilities and Wi-Fi. Suggestion to school in order to maintain the consistency that was owned, suitability to the needs of society as well as pay attention to competition with other schools also enhance the achievement of advantage and checking of IT facilities.
Hussain, Shahzad; Khattak, Zainab; Mahmood, Sidra; Malik, Farnaz; Riaz, Humayun; Raza, Syed Atif; Khan, Samiullah
2016-09-01
The microbial and chemical analysis of illicit drug samples from different areas of Pakistan i.e. Quetta, Karachi, Lahore and Islamabad was conducted in a cross-sectional study at National Institute of Health, Islamabad. The drug samples were confiscated by Anti Narcotics Force (ANF), Pakistan. Microbial analysis was done by estimating bioburden which revealed the presence of gram negative and positive bacteria's, fungus, Streptococcus, Staphylococcus species. Trypton soya agar was used for total aerobic count, MacConkey agar for gram-negative bacteria, Sabouraud dextrose agar for fungus and Vogel-Johnson agar for Streptococcus and Staphylococcus species. Colour tests were applied to identify the drug samples. Qualitative and quantitative analysis of suspected samples of Heroin, morphine, cocaine and acetic anhydride was made by employing different chromatographic techniques i.e. Thin-layer chromatography (TLC) and High-performance liquid chromatography (HPLC). The samples were found to be adulterated with paracetamol, diazepam and Dextromethorphen. Acetic anhydride was adulterated with hydrochloric acid (HCl). There is lack of information providing structured advice on responses to the consequences of illicit drug adulteration. Robust and rehearsed interventions and communication strategies would provide a basis for response for a wide variety of organisations. Research into the usefulness of media warnings about adulteration of illicit drugs is required.
The Slime Production by Yeasts Isolated from Subclinical Mastitic Cows
Directory of Open Access Journals (Sweden)
Süheyla Türkyılmaz
2010-01-01
Full Text Available The aim of this study was to isolate yeasts from subclinical mastitic cows and to investigate the slime production by the isolated yeasts. The material used in this study included 339 milk samples from 152 dairy cattle with subclinical mastitis. Milk was plated onto blood agar, MacConkey agar and Sabouraud dextrose agar. Forty-one samples (12.1% of total milk samples were found positive for the yeast by API 20 C AUX identification system. The isolated yeasts were classified into four genera of Candida, Trichosporon, Cryptococcus and Saccharomyces. The Candida species were following: C. krusei, C. kefyr, C. guilliermondii, C. famata, C. rugosa and C. utulis. Other yeasts were identified as Trichosporon mucoides, T. asahii, Cryptococcus laurentii, C. neoformans and Saccharomyces cerevisiae. Slime production was tested on Congo red brain heart infusion agar and evaluated according to Congo red phenomenon. Fifteen (36.6% strains were slime factor positive: seven were C. krusei, four C. kefyr, one C. guilliermondii, one C. famata, one T. asahii, and one C. laurentii. The results of the present study indicate that yeast mastitis is significant for causing economic losses and slime production is mostly found in non-albicans Candida species. Therefore, non-albicans Candida species should be examined for slime production.
Design and control of a linearity-enhanced SMA actuator
International Nuclear Information System (INIS)
Son, Hyung-Min; Tak, Chul-Gon; Lee, Yun-Jung; Kang, Seok-Won; Nam, Tae-Hyun; Kim, Jae-Il
2010-01-01
For the accurate and dexterous operation of mechanical systems, continuous-type actuation, rather than on/off-type actuation, is an indispensable function. However, conventional Ti-Ni alloys present difficulties for continuous positioning control, due to their hysteretic and abruptly changing relationship between strain and temperature. Therefore, this paper proposes a new linearity-enhanced SMA actuator using a temperature-gradient annealed alloy and an inverse hysteresis controller. In comparative experiments, the proposed controller and alloy exhibit superior performance for continuous actuation.
Kanmani, Paulraj; Rhim, Jong-Whan
2014-02-15
The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.
López-Bastida, Julio; Peña-Longobardo, Luz María; Aranda-Reneo, Isaac; Tizzano, Eduardo; Sefton, Mark; Oliva-Moreno, Juan
2017-08-18
The aim of this study was to determine the economic burden and health-related quality of life (HRQOL) of patients with Spinal Muscular Atrophy (SMA) and their caregivers in Spain. This was a cross-sectional and retrospective study of patients diagnosed with SMA in Spain. We adopted a bottom up, prevalence approach design to study patients with SMA. The patient's caregivers completed an anonymous questionnaire regarding their socio-demographic characteristics, use of healthcare services and non-healthcare services. Costs were estimated from a societal perspective (including healthcare costs and non-healthcare costs), and health-related quality of life (HRQOL) was assessed using the EQ-5D questionnaire. The main caregivers also answered a questionnaire on their characteristics and on their HRQOL. A total of 81 caregivers of patients with different subtypes of SMA completed the questionnaire. Based on the reference unitary prices for 2014, the average annual costs per patient were € 33,721. Direct healthcare costs were € 10,882 (representing around 32.3% of the total cost) and the direct non-healthcare costs were € 22,839 (67.7% of the total cost). The mean EQ-5D social tariff score for patients was 0.16, and the mean score of the EQ-5D visual analogue scale was 54. The mean EQ-5D social tariff score for caregivers was 0.49 and their mean score on the EQ-5D visual analogue scale was 69. The results highlight the burden that SMA has in terms of costs and decreased HRQOL, not only for patients but also for their caregivers. In particular, the substantial social/economic burden is mostly attributable to the high direct non-healthcare costs.
Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.
Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W
2012-01-01
A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.
PENGARUH MODEL PEMBELAJARAN KONSTRUKTIVIS 5E TERHADAP HASIL BELAJAR DI SMA LAKSAMANA MARTADINATA
Directory of Open Access Journals (Sweden)
Nazila Ramadhani
2012-06-01
sehingga thitung > ttabel. Ini berarti Ha diterima, sehingga dapat disimpulkan ada pengaruh yang signifikan penerapan model pembelajaran konstruktivis 5E terhadap hasil belajar siswa pada materi pokok Medan Magnet di kelas XII semester ganjil SMA Laksamana Martadinata T.P 2011/2012.
Directory of Open Access Journals (Sweden)
John T Kissel
Full Text Available BACKGROUND: Multiple lines of evidence have suggested that valproic acid (VPA might benefit patients with spinal muscular atrophy (SMA. The SMA CARNIVAL TRIAL was a two part prospective trial to evaluate oral VPA and L-carnitine in SMA children. Part 1 targeted non-ambulatory children ages 2-8 in a 12 month cross over design. We report here Part 2, a twelve month prospective, open-label trial of VPA and L-carnitine in ambulatory SMA children. METHODS: This study involved 33 genetically proven type 3 SMA subjects ages 3-17 years. Subjects underwent two baseline assessments over 4-6 weeks and then were placed on VPA and L-carnitine for 12 months. Assessments were performed at baseline, 3, 6 and 12 months. Primary outcomes included safety, adverse events and the change at 6 and 12 months in motor function assessed using the Modified Hammersmith Functional Motor Scale Extend (MHFMS-Extend, timed motor tests and fine motor modules. Secondary outcomes included changes in ulnar compound muscle action potential amplitudes (CMAP, handheld dynamometry, pulmonary function, and Pediatric Quality of Life Inventory scores. RESULTS: Twenty-eight subjects completed the study. VPA and carnitine were generally well tolerated. Although adverse events occurred in 85% of subjects, they were usually mild and transient. Weight gain of 20% above body weight occurred in 17% of subjects. There was no significant change in any primary outcome at six or 12 months. Some pulmonary function measures showed improvement at one year as expected with normal growth. CMAP significantly improved suggesting a modest biologic effect not clinically meaningful. CONCLUSIONS: This study, coupled with the CARNIVAL Part 1 study, indicate that VPA is not effective in improving strength or function in SMA children. The outcomes used in this study are feasible and reliable, and can be employed in future trials in SMA. TRIAL REGSITRATION: Clinicaltrials.gov NCT00227266.
Directory of Open Access Journals (Sweden)
Christian James
2015-01-01
Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.
Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.
Directory of Open Access Journals (Sweden)
V. O. Antonyuk
2014-08-01
Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric
Vahjen, W; Cuisiniere, T; Zentek, J
2017-10-13
To investigate the inhibitory effect of indigenous enterobacteria on pathogenic Escherichia coli, a challenge trial with postweaning pigs was conducted. A pathogenic E. coli strain was administered to all animals and their health was closely monitored thereafter. Faecal samples were taken from three healthy and three diarrhoeic animals. Samples were cultivated on MacConkey agar and isolates were subcultured. A soft agar overlay assay was used to determine the inhibitory activity of the isolates. A total of 1,173 enterobacterial isolates were screened for their ability to inhibit the E. coli challenge strain. Colony forming units of enterobacteria on MacConkey agar were not different between healthy and diarrhoeic animals in the original samples. Furthermore, numbers of isolates per animal were also not significantly different between healthy (482 isolates) and diarrhoeic animals (691 isolates). A total of 43 isolates (3.7%) with inhibitory activity against the pathogenic E. coli challenge strain were detected. All inhibitory isolates were identified as E. coli via MALDI-TOF. The isolates belonged to the phylotypes A, C and E. Many isolates (67.4%) were commensal E. coli without relevant porcine pathogenic factors, but toxin- and fimbrial genes (stx2e, fae, estIb, elt1a, fas, fan) were detected in 14 inhibitory isolates. Healthy animals showed significantly (P=0.003) more inhibitory isolates (36 of 482 isolates; 7.5%) than diseased animals (7 of 691 isolates; 1.0%). There were no significant correlations regarding phylotype or pathogenic factors between healthy and diseased animals. This study has shown that a small proportion of indigenous E. coli is able to inhibit in vitro growth of a pathogenic E. coli strain in pigs. Furthermore, healthy animals possess significantly more inhibitory E. coli strains than diarrhoeic animals. The inhibition of pathogenic E. coli by specific indigenous E. coli strains may be an underlying principle for the containment of pathogenic
Directory of Open Access Journals (Sweden)
Helio Langoni
2000-03-01
Full Text Available A ação da enrofloxacina pela administração via intramamária e sistêmica na mastite bovina subclínica por Staphylococcus aureus foi avaliada. Como tratamento local, infundiram-se, após as ordenhas da manhã e da tarde, 250mg do produto, diluídos em água estéril, a um volume final de 10ml, durante três dias. O tratamento sistêmico constituiu na aplicação de 5mg/kg do produto, pela via intramuscular, uma vez ao dia, durante o mesmo período. A estimativa de cura deu-se através da realização do California Mastitis Test (CMT e do cultivo bacteriano em agar sangue e MacConkey, três semanas após o término do tratamento. Dos 184 quartos acometidos por Staphylococcus aureus, a droga mostrou-se eficiente em 72,0% e 75,0%, pelas vias intramamária e sistêmica, respectivamente. A análise dos resultados mostrou não haver diferença estatística significante, com pThe activity of Enrofloxacina on bovine subclinical mastitis after systemic and intramammary administration was evaluated. As local treatment, 250mg of the product diluted in sterile distilled water to a final volume of 10ml, was infused into the teat during three days. The systemic treatment was performed with 5mg/kg of product administred intramuscularly, once a day, during the same period. The recovery was estimated three weeks after the treatment had finished through California Mastitis Test (CMT and milk culture on blood agar and MacConkey agar. The drug was effective in 72.0% and 75.0% of 184 quarters with Staphylococcus aureus after intramammary and systemic treatments, respectively. Statystical analysis showed no significant differences (p<0.50 between both forms of treatment.
Zhou, C T; Zhang, S L; Ding, R Y; Hua, L; Zhong, W J
2000-06-01
To observe dynamically that Erigeron Breviscapus (Vant) Hand-Mazz (HEr) affects the expression of alpha-smooth muscle actin (alpha-SMA). To discuss the probable mechanism of obstructing leukoplakia carcinogenesis of this medicine. 120 golden hamsters were randomly divided into model group (48), HEr group (48) and control group (6). HEr was applied to obstruct the evolution of carcinogenesis of golden hamster cheek pouch. Immunohistochemistry was used to detect the expression level of alpha-SMA with cheek pouch specimen that besmears DMBA in 4-9 weeks. Results were compared with model group. Vessel density dyed with alpha-SMA continuously of HEr group was 65.76 significantly higher than that of model group 42.12 (P<0.001). High classification cases in HEr group were much more than model group when cases were divided into five groups as follow: 100%, 50%, 20%, 10%, 3% (P<0.01). HEr can raise the expression level of alpha-SMA exactly during the evolution of leukoplakia carcinogenesis of golden hamster, which shows that this medicine obstructs carcinogenesis by keeping the normal physiological function of vascular myoepithelial cell and integrity of vascular basement membrane.
Directory of Open Access Journals (Sweden)
Zhou Bai-Cheng
2010-04-01
Full Text Available Abstract Background Zunongwangia profunda SM-A87, which was isolated from deep-sea sediment, is an aerobic, gram-negative bacterium that represents a new genus of Flavobacteriaceae. This is the first sequenced genome of a deep-sea bacterium from the phylum Bacteroidetes. Results The Z. profunda SM-A87 genome has a single 5 128 187-bp circular chromosome with no extrachromosomal elements and harbors 4 653 predicted protein-coding genes. SM-A87 produces a large amount of capsular polysaccharides and possesses two polysaccharide biosynthesis gene clusters. It has a total of 130 peptidases, 61 of which have signal peptides. In addition to extracellular peptidases, SM-A87 also has various extracellular enzymes for carbohydrate, lipid and DNA degradation. These extracellular enzymes suggest that the bacterium is able to hydrolyze organic materials in the sediment, especially carbohydrates and proteinaceous organic nitrogen. There are two clustered regularly interspaced short palindromic repeats in the genome, but their spacers do not match any sequences in the public sequence databases. SM-A87 is a moderate halophile. Our protein isoelectric point analysis indicates that extracellular proteins have lower predicted isoelectric points than intracellular proteins. SM-A87 accumulates organic osmolytes in the cell, so its extracelluar proteins are more halophilic than its intracellular proteins. Conclusion Here, we present the first complete genome of a deep-sea sedimentary bacterium from the phylum Bacteroidetes. The genome analysis shows that SM-A87 has some common features of deep-sea bacteria, as well as an important capacity to hydrolyze sedimentary organic nitrogen.
The routine use of modified Borelli's lactritmel agar (MBLA).
Kaminski, G W
1985-07-01
The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.
Calibration of Ge(Li) semiconductor detector by method using agar volume source
International Nuclear Information System (INIS)
Yanase, Nobuyuki; Kasai, Atsushi
1979-12-01
The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)
International Nuclear Information System (INIS)
Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib
2013-01-01
Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-γ-eudesmol, aromadendrene, β-agar ofuran, α-agar ofuran and γ-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)
Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B
1985-07-01
Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.
Profil Problem Emosi/ Perilaku Pada Remaja Pelajar SMP-SMA Di Kota Semarang
Directory of Open Access Journals (Sweden)
Annastasia Ediati
2015-10-01
Full Text Available The aims of this study is to identify the profile of emotional/behavioral problems on adolescents students of junior and senior high school (SMP-SMA in Semarang, Central Java. The subjects comprised 568 students (grade VII and X; males and females, aged between 13-17 years. Data were collected using the Indonesian translation of the Youth Self Report (YSR. The results of data analysis showed that adolescents in the junior high school/SMP reported emotional/behavioral problems more frequently than the adolescents in the senior high school/SMA (t (566 = 2.08, p = .038, especially in terms of social relations (t (566 = 2.92, p = .004, thought problems (t (566 = 2.47, p = .014, somatic complaints (t(566 = 2.98, p = .002, rule-breaking behavior (t (566 = 6.63, p < .001, and externalizing problems (t(566 = 3,37; p = .001. Gender differences was found in the adolescents’ emotional/behavioral problems. In group of junior high school students (SMP, girls reported more emotional problems than boys (t(335 = -3.55; p < .001, particularly in anxiety/depression (t(335 = -6.51; p < .001; withdrawal (t(335 = -4.26; p < .001, somatic complaints (t(335 = -2.86; p = .004; social problems (t(335 = -3.30; p = .001, attention problems (t(335 = -2.39; p = .017; and internalizing problem (t(335 = -5.76; p < .001. In group of senior high school students (SMA, boys reported more externalizing problems (t(229 = 2.10; p = .037 and rule-breaking behavior (t(229 = 4.44; p < .001 than girls. In contrasts, girls reported more somatic complaints than boys (t(229 = -3.09; p = .001. Adolescents’ emotional/behavioral problems should gained more attention. Preventive as well as curative intervention is needed, particularly intervention that sensitive to gender and age, which also involve significant figures for adolescents (parents, school teachers, and peers.
Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.
Wang, Xueyan; Duan, Delin; Fu, Xiaoting
2016-12-01
Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.
KONTRIBUSI KONSELOR DALAM MEMBENTUK KARAKTER PESERTA DIDIK SMA
Directory of Open Access Journals (Sweden)
Agung Slamet Kusmanto
2015-11-01
Full Text Available Pengembangan model Pendidikan Holistik Berbasis Karakter, yang memfokuskan pada pembentukan seluruh aspek dimensi manusia, sehingga dapat menjadi manusia yang berkarakter. Kurikulum Holistik Berbasis Karakter ini disusun berdasarkan Kurikulum Berbasis Kompetensi (KBK dan diterapkan dengan menggunakan pendekatan Student Active Learning, Integrated Learning, Developmentally Appropriate Practices, Contextual Learning, Collaborative Learning, dan Multiple Intelligences yang semuanya dapat menciptakan suasana belajar yang efektif dan menyenangkan, serta dapat mengembangkan seluruh aspek dimensi manusia secara holistik. Maka diperlukan peran yang sangat besar dari guru pembimbing (konselor SMA dalam mengembangkan potensi peserta didiknya dalam mengembangkan potensinya dan membentuk karakter individu itu sendiri dan memberikan warna positif dalam suasana pembelajaran.
Suitability of various plant derived gelling agents as agar substitute ...
African Journals Online (AJOL)
USER
2012-06-05
Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.
Assessing upper limb function in nonambulant SMA patients: development of a new module.
Mazzone, Elena; Bianco, Flaviana; Martinelli, Diego; Glanzman, Allan M; Messina, Sonia; De Sanctis, Roberto; Main, Marion; Eagle, Michelle; Florence, Julaine; Krosschell, Kristin; Vasco, Gessica; Pelliccioni, Marco; Lombardo, Marilena; Pane, Marika; Finkel, Richard; Muntoni, Francesco; Bertini, Enrico; Mercuri, Eugenio
2011-06-01
We report the development of a module specifically designed for assessing upper limb function in nonambulant SMA patients, including young children and those with severe contractures. The application of the module to a preschool cohort of 40 children (age 30-48 months) showed that all the items could be completed by 30 months. The module was also used in 45 nonambulant SMA patients (age 30 months to 27 years). Their scores were more variable than in the preschool cohort, ranging from 0 to 18. The magnitude of scores was not related to age (r=-0.19). The upper limb scores had a good correlation with the Hammersmith Functional Motor Scale, r=0.75, but the upper limb function did not always strictly follow the overall gross motor function. These findings suggest that even some of the very weak nonambulant children possess upper limb skills that can be measured. Copyright © 2011 Elsevier B.V. All rights reserved.
Radiation effects on agar, alginates and carrageenan to be used as food additives
International Nuclear Information System (INIS)
Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del
2000-01-01
Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)
Radiation effects on agar, alginates and carrageenan to be used as food additives
Energy Technology Data Exchange (ETDEWEB)
Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del
2000-03-01
Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)
Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki
2016-01-01
This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.
Immediate differentiation of salmonella-resembling colonies on brilliant green agar
DEFF Research Database (Denmark)
Jensen, Annette Nygaard; Hoorfar, Jeffrey
2000-01-01
A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...
Growth of strontium oxalate crystals in agar–agar gel
Indian Academy of Sciences (India)
Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.
Directory of Open Access Journals (Sweden)
Lukáš Hleba
2015-05-01
Full Text Available In this study we monitored antibiotic resistance in Enterobacteriaceae strains isolated from different animals gastrointestinal tracts (GIT. We isolated Enterobacteriaceae from chicken, ducks, lambs, pigs, sheeps, cows and rabbits collected from slovakian farms. Enterobacteriaceae strains were cultivated on MacConkey agar at 35° ± 2°C at 24 hours. Pure cultures of Enterobacteriaceae strains were obtained by four-way streak method on Chromogenic coliform agar. Identification of purified Enterobacteriaceae strains were done by Enterotest 24 and MALDI TOF MS. For susceptibility testing disk diffusion method was used according by EUCAST. We determined the most resistance in Enterobacteriaceae strains against streptomycin, tetracycline, ampicillin, piperecillin, levofloxacine, chloramphenicol and smaller level of resistance against amikacin, ceftriaxone and ofloxacine. Equally we detected resistance to more antibiotics in one strain. The most resistance was Salmonella enterica ser. Typhimurium. Also E. coli was resistance against four antibiotics and Raoultella ornithinolytica too. Antibiotic resistance was found in other isolated strains too.
Directory of Open Access Journals (Sweden)
V Tak
2013-01-01
Full Text Available A 23-year-old male patient who was a follow-up case of neurosurgery presented to our emergency department with a history of high-grade fever and clinical features of meningitis for 1 week. The cerebrospinal fluid (CSF was sent to our laboratory for culture. The culture demonstrated growth of 1-2 mm in diameter light yellow coloured colonies of Gram-negative bacilli on chocolate and blood agar. There was no growth on MacConkey agar. The bacterium was multidrug resistant. Based upon the growth characteristics, bio-chemical reactions, drug susceptibility pattern and identification by Vitek 2 system the isolate was identified as Elizabethkingia meningoseptica. Patient was treated with injection piperacillin-tazobactam, injection vancomycin and cotrimoxazole tablets for 21 days along with intrathecal injection of tigecycline and finally, patient improved clinically and the CSF cultures became sterile. The presence in hospital environment along with multidrug resistance makes E. meningoseptica a successful emerging nosocomial pathogen.
Directory of Open Access Journals (Sweden)
N Karabulut
2014-01-01
Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.
PENGEMBANGAN MODUL LATIHAN FORGIVENESS UNTUK SISWA SMA DI KOTA MALANG
Directory of Open Access Journals (Sweden)
Ari Dwi Yudhianto
2016-12-01
Full Text Available This research aims to develop a training modules forgiveness based on the appraisement of experts (reviewers and high school student's response to the training modules forgiveness that have been developed. This study adapting the model development of Borg and Gall (1983, while the structure of the writing module refers to the guide preparation of module which prepared by the Director General module PMPTK (2008. The results of this study are drafting a training module forgiveness for senior high school students in Malang. Based appraisement materials experts, media specialists, and linguists classified as good, according to school counselors classified very good and yield response of students classified as good. So, that these modules worthy be used in the awarding of guidance services in schools. Penelitian ini bertujuan untuk mengembangkan modul latihan forgiveness berdasarkan penilaian para ahli (reviewer dan respon siswa SMA terhadap Modul latihan forgiveness yang telah dikembangkan. Penelitian ini mengadaptasi model pengembangan Borg and gall (1983, sedangkan struktur penulisan modul mengacu pada panduan penyusunan modul yang disusun oleh dirjen PMPTK (2008. Hasil penelitian ini adalah tersusunnya modul latihan forgiveness untuk siswa SMA di Kota Malang yang berdasarkan penilaian ahli materi, ahli media, dan ahli bahasa tergolong baik, menurut konselor sekolah tergolong sangat baik dan hasil respon siswa tergolong baik. sehingga modul ini layak digunakan dalam pemberian layanan bimbingan di sekolah.
Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates
Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.
2014-03-01
This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.
Pola Pembinaan Kompetensi Kepribadian dan Kompetensi Sosial Guru di SMA Muhammadiyah 1 Ponorogo
Directory of Open Access Journals (Sweden)
Bambang Wahrudin
2017-11-01
Full Text Available This research is motivated by the importance of personal competence and social competence teacher as the spirit of education. The focus of reasearch is know the program fostering personal competence and social competence teacherin SMA Muhammadiyah 1 Ponorogo . Deep observation and interview used in this research by qualitative aproach. The result shows that personality competence development programs conducted in six (6 forms include: 1 Dhuhr and Asr prayers in congregation, 2 Baitul Arqom for teachers and employees, 3 Course / tahsin read the Koran for teachers and employees, 4 Pray tahajud ahad congregation every morning, and 5 Training Motivation and 6 Counseling, whereas social competence training program conducted by three (3 forms, namely: 1 Piket Sympathetic, 2 MGMPs and 3 Sinergy Building. These patern have made theacher have stong professionaly and authority Abstrak Penelitian ini dilatarbelakangi oleh pentingnya kompetensi kepribadian dan kompetensi sosial bagi guru sebagai ruh pendidikan. Penelitian ini bertujuan untuk mengetahui program pembinaan kompetensi kepribadian dan kompetensi sosial guru di SMA Muhammadiyah 1 Ponorogo. Reset mendalam dilakukan secara kualitatif. Hasil penelitian menunjukkaan bahwa Program pembinaan kompetensi kepribadian dan kompetensi sosial sumber daya manusia di SMA Muhammadiyah 1 Ponorogo menggunakan 6 (enam bentuk meliputi: 1. sholat Dhuhur dan Ashar berjamaah, 2. baitul Arqom untuk guru dan karyawan, 3. kursus/tahsin baca al-Qur’an untuk guru dan karyawan, 4. sholat tahajud berjamaah setiap ahad dini hari, dan 5. training motivasi dan 6. konseling, sedangkan program pembinaan kompetensi sosial dilakukan dengan 3 (tiga bentuk, yaitu: 1. paket Simpatik, 2. MGMP dan 3. sinergy Building. Pola ini telah berhasil menghantarkan guru sebagai guru yang profesional yang kuat dan berwibawa.
Energy Technology Data Exchange (ETDEWEB)
Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)
2002-07-01
Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.
Carriage and fecal counts of cefotaxime M-producing Escherichia coli in pigs
DEFF Research Database (Denmark)
Hansen, Katrine Hartung; Damborg, Peter Panduro; Andreasen, Margit
2013-01-01
, and finishers). Cefotaxime (CTX)-resistant coliforms in feces were counted on MacConkey agar containing 2 µg/ml CTX and characterized for the presence of ESBL-encoding genes by PCR and sequencing. CTX-M-positive pigs were detected in all age groups at farms A (bla(CTX-M-9) group, compatible with bla(CTX-M-14......% just before weaning, 29% during weaning, and 12% during finishing. The observed reduction in numbers of CTX-M-positive pigs was accompanied by a significant reduction in mean fecal counts of CTX-resistant coliforms from ~10(7) CFU/g in piglets to ~10(3) CFU/g in finishers (P
Evaluasi Kenyamanan Termal Ruang Sekolah SMA Negeri di Kota Padang
Lusi Susanti; Nike Aulia
2016-01-01
This research aims to determine thermal conditions and sensation of thermal comfort in classrooms of high schools in Padang. This study was conducted in 11 State Senior High School (SMA) represented 11 districts in Padang. About 10% of total student body in each schools were participated in this study to vote thermal comfort questioners. To determine thermal comfort level in this study, PMV (Predicted mean Vote) and PPD (Predicted Percentage of dissatisfied) method were used according to stan...
Development of a Simple Structured Artificial Muscle Using SMA Wire
International Nuclear Information System (INIS)
Ibuki, Ryuta; Maruyama, Shigenao; Komiya, Atsuki
2006-01-01
Artificial heart muscle using SMA wire is developed to assist weaken heartbeat. Simple structure design was adopted for large output force, large displacement and rapid cyclic motion of the actuator. The actuator was designed and fabricated from the viewpoint of heat transfer. Moving performance of the actuator was experimentally measured under 10N of loading condition. Under the maximum efficiency condition, the actuator shows cyclic motion with 1mm of displacement and time period of about 2 seconds in one cycle
Development of a self-stressing NiTiNb shape memory alloy (SMA)/fiber reinforced polymer (FRP) patch
International Nuclear Information System (INIS)
El-Tahan, M; Dawood, M; Song, G
2015-01-01
The objective of this research is to develop a self-stressing patch using a combination of shape memory alloys (SMAs) and fiber reinforced polymer (FRP) composites. Prestressed carbon FRP patches are emerging as a promising alternative to traditional methods to repair cracked steel structures and civil infrastructure. However, prestressing these patches typically requires heavy and complex fixtures, which is impractical in many applications. This paper presents a new approach in which the prestressing force is applied by restraining the shape memory effect of NiTiNb SMA wires. The wires are subsequently embedded in an FRP overlay patch. This method overcomes the practical challenges associated with conventional prestressing. This paper presents the conceptual development of the self-stressing patch with the support of experimental observations. The bond between the SMA wires and the FRP is evaluated using pull-out tests. The paper concludes with an experimental study that evaluates the patch response during activation subsequent monotonic tensile loading. The results demonstrate that the self-stressing patch with NiTiNb SMA is capable of generating a significant prestressing force with minimal tool and labor requirements. (paper)
International Nuclear Information System (INIS)
Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi
2012-01-01
Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.
Samaranayake, L P; MacFarlane, T W; Williamson, M I
1987-01-01
The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...
CHARACTER EDUCATION IN ISLAMIC BOARDING SCHOOL- BASED SMA AMANAH
Directory of Open Access Journals (Sweden)
Nana Herdiana Abdurrahman
2016-06-01
Full Text Available This paper aims to describe findings of the study in pesantren-based SMA Amanah covering: 1 the principal policy in developing character education, 2 the methods used in developing character education, 3 students’ characteristics as the result of the character education process, 4 the problems encountered in the implementation of character education and the efforts made in addressing the implementation of character education at the school. This study applied qualitative method using descriptive technique. The data were collected through observation, interviews, and documentation. The findings of study showed that: 1 the principal’s policy in developing character education was carried out by implementing government policies in line with the school’s vision, mission, and programs; 2 the methods used in the process of character education were through role-modelling, assignments and nurturing, habituation, training programs, and students’ participation in various types of activities, as well as the application of rewards and punishments; 3 the student's characteristics resulted from the character education process were piousness and devotion as well as being able to apply their knowledge and piety in everyday life; 4 problems encountered in the implementation of character education were different values and norms students brought from home; imbalance of facilities compared to the number of students; as well as teachers’ readiness to actually implement the new program, which was character education. Meanwhile the efforts made to overcome those problems were namely developing personal, family, neighborhood or community characters, and making commitment of all related parties/stakeholdres of SMA Amanah.
KONSUMSI SUPLEMEN ATLET REMAJA DI SMA RAGUNAN JAKARTA
Directory of Open Access Journals (Sweden)
Muhammad Q Aliyyan Wijaya
2015-05-01
Full Text Available ABSTRACTThe objective of this study was to investigate consumption of supplement among Ragunan High School Jakarta athletes. The cross sectional study was done with total subjects were 79 students of Ragunan high school who were willing to join the study and they were at school when the study was conducted. There was 92.4% athletes consumed supplement in last one year. All athletes from light and heavy sport category were found consumed supplement. The most popular supplement were vitamin, mineral, and phytonutrition in tablet form. There was 89.0% athletes consumed supplement everyday. Moreover, the main reason for supplementation was to meet a nutrition requirement. The source of information about food supplement was mostly from coach advisor. More than half of athletes got supplement for free from any sources. There was a significant correlation between category of sport and number of supplement used (p<0.05.Keywords: adolescent, athlete, high school, supplementABSTRAKTujuan penelitian adalah menggambarkan konsumsi suplemen pada atlet remaja di SMA Ragunan Jakarta. Desain penelitian ini menggunakan cross sectional dengan total subjek sebanyak 79 siswa SMA Ragunan yang bersedia mengikuti penelitian dan berada di sekolah saat penelitian dilakukan. Sebanyak 92,4% atlet mengaku mengonsumsi suplemen dalam satu tahun terakhir. Atlet dari kategori olahraga ringan dan berat sekali semuanya mengonsumsi suplemen. Suplemen vitamin, mineral, dan fitonutrisi dalam bentuk tablet merupakan jenis dan bentuk suplemen yang paling banyak dikonsumsi. Sebanyak 89,0% dari atlet mengonsumsi suplemen setiap hari. Alasan utama atlet mengonsumsi suplemen adalah untuk memenuhi kebutuhan gizi. Pelatih merupakan sumber infomasi tentang suplemen yang paling banyak dipilih oleh atlet. Lebih dari 50,0% atlet mendapatkan suplemen dengan cara diberi. Kategori olahraga dan jumlah suplemen yang dikonsumsi menunjukkan hubungan positif signifikan (p<0,05.Kata kunci: atlet, remaja
Kelompok Sebaya dan Perilaku Makan Menyimpang Remaja SMA di Jakarta
Directory of Open Access Journals (Sweden)
Rizky Ibrahim Isra
2017-02-01
Full Text Available AbstrakTulisan ini membahas hubungan tekanan kelompok sebaya (peer group terhadap gejala perilaku makan menyimpang pada remaja SMA di Jakarta. Banyak studi lain yang mengkaji hal serupa, namun kajian yang membahas permasalahan perilaku makan menyimpang secara sosiologis masih sangat minim. Ketika studi lain hanya memfokuskan pada jenis kelamin perempuan saja, dalam tulisan ini jenis kelamin (laki-laki dan perempuan digunakan sebagai variabel kontrol. Studi sebelumnya yang hanya berfokus pada perempuan memiliki kelemahan karena kelompok sebaya tidak hanya memengaruhi perilaku remaja perempuan, tetapi juga memengaruhi laki-laki. Oleh karena itu, penulis berargumen bahwa kelompok sebaya dapat memengaruhi munculnya gejala perilaku makan menyimpang pada remaja SMA di Jakarta, baik pada laki-laki maupun perempuan. Tulisan ini merupakan hasil studi yang menggunakan metode kuantitatif dengan teknik pengambilan sampel secara acak bertingkat (stratified random sampling sebanyak 235 siswa salah satu SMA negeri di Jakarta. Tulisan ini mengungkapkan bahwa terdapat hubungan antara tekanan kelompok sebaya terhadap gejala perilaku makan menyimpang pada remaja SMA di Jakarta, di mana laki-laki lebih terpengaruh oleh pesan (message dari kelompok sebayanya, sedangkan perempuan lebih kuat terpengaruh oleh interaksi dan likeability. AbstractThis article discusses the correlation between peer group pressure and eating disorder behavior symptoms in Jakarta Senior High School students. Many of studies talk about it, but the discussion about eating disorder behavior on sociology was rarely found. In this article, gender was used as a control variable while many of studies only focused on the
Comparison of the Cellient(™) automated cell block system and agar cell block method.
Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D
2014-12-01
To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.
Sistem Informasi Data Kepegawaian Dan Kesiswaan SMA Negeri 1 P. Brandan
Ramadhani, Tiara
2015-01-01
Tulisan ini bertujuan untuk membangun suatu sistem informasi pada SMA Negeri 1 Babalan P.Brandan. Sistem informasi ini dikembangkan dengan menggunakan perangkat lunak PHP, MySQL, Apache, dan Mozilla Firefox juga software pembantu lainnya seperti Adobe Dreamweaver CS5. Tujuan dari sistem informasi ini adalah untuk menyajikan informasi data kepegawaian, guru, serta kesiswaan kepada user/pengguna dengan baik dan dapat meng-update isi dari informasi yang terdapat pada web tersebut dengan mudah pa...
Surgical site infections due to rapidly growing mycobacteria in puducherry, India.
Kannaiyan, Kavitha; Ragunathan, Latha; Sakthivel, Sulochana; Sasidar, A R; Muralidaran; Venkatachalam, G K
2015-03-01
Rapidly growing Mycobacteria are increasingly recognized, nowadays as an important pathogen that can cause wide range of clinical syndromes in humans. We herein describe unrelated cases of surgical site infection caused by Rapidly growing Mycobacteria (RGM), seen during a period of 12 months. Nineteen patients underwent operations by different surgical teams located in diverse sections of Tamil Nadu, Pondicherry, Karnataka, India. All patients presented with painful, draining subcutaneous nodules at the infection sites. Purulent material specimens were sent to the microbiology laboratory. Gram stain and Ziehl-Neelsen staining methods were used for direct examination. Culture media included blood agar, chocolate agar, MacConkey agar, Sabourauds agar and Lowenstein-Jensen medium for Mycobacteria. Isolated microorganisms were identified and further tested for antimicrobial susceptibility by standard microbiologic procedures. Mycobacterium fortuitum and M.chelonae were isolated from the purulent drainage obtained from wounds by routine microbiological techniques from all the specimens. All isolates analyzed for antimicrobial susceptibility pattern were sensitive to clarithromycin, linezolid and amikacin but were variable to ciprofloxacin, rifampicin and tobramycin. Our case series highlights that a high level of clinical suspicion should be maintained for patients presenting with protracted soft tissue lesions with a history of trauma or surgery as these infections not only cause physical but also emotional distress that affects both the patients and the surgeon.
Biomechanics of smart wings in a bat robot: morphing wings using SMA actuators
International Nuclear Information System (INIS)
Colorado, J; Barrientos, A; Rossi, C; Breuer, K S
2012-01-01
This paper presents the design of a bat-like micro aerial vehicle with actuated morphing wings. NiTi shape memory alloys (SMAs) acting as artificial biceps and triceps muscles are used for mimicking the morphing wing mechanism of the bat flight apparatus. Our objective is twofold. Firstly, we have implemented a control architecture that allows an accurate and fast SMA actuation. This control makes use of the electrical resistance measurements of SMAs to adjust morphing wing motions. Secondly, the feasibility of using SMA actuation technology is evaluated for the application at hand. To this purpose, experiments are conducted to analyze the control performance in terms of nominal and overloaded operation modes of the SMAs. This analysis includes: (i) inertial forces regarding the stretchable wing membrane and aerodynamic loads, and (ii) uncertainties due to impact of airflow conditions over the resistance–motion relationship of SMAs. With the proposed control, morphing actuation speed can be increased up to 2.5 Hz, being sufficient to generate lift forces at a cruising speed of 5 m s −1 . (paper)
Fabrication of wrist-like SMA-based actuator by double smart soft composite casting
Rodrigue, Hugo; Wei, Wang; Bhandari, Binayak; Ahn, Sung-Hoon
2015-12-01
A new manufacturing method for smart soft composite (SSC) actuators that consists of double casting a SSC actuator to produce an actuator with non-linear shape memory alloy (SMA) wire positioning is proposed. This method is used to manufacture a tube-shaped SSC actuator in which the SMA wires follow the curvature of the tube and is capable of pure-twisting deformations while sustaining a cantilever load. The concept is tested by measuring the maximum twisting angle and a simple control method is proposed to control the twisting angle of the actuator. Then, a soft robotic wrist with a length of 18 cm is built, its load-carrying capability is tested by measuring the cantilever force required for deforming the actuator, and its load-carrying capability during actuation is tested by loading one end with different objects and actuating the actuator. This wrist actuator shows good repeatability, is capable of twisting deformations up to 25° while holding objects weighing 100 g, and can sustain loads above 2 N without undergoing buckling.
Fabrication of wrist-like SMA-based actuator by double smart soft composite casting
International Nuclear Information System (INIS)
Rodrigue, Hugo; Wei, Wang; Bhandari, Binayak; Ahn, Sung-Hoon
2015-01-01
A new manufacturing method for smart soft composite (SSC) actuators that consists of double casting a SSC actuator to produce an actuator with non-linear shape memory alloy (SMA) wire positioning is proposed. This method is used to manufacture a tube-shaped SSC actuator in which the SMA wires follow the curvature of the tube and is capable of pure-twisting deformations while sustaining a cantilever load. The concept is tested by measuring the maximum twisting angle and a simple control method is proposed to control the twisting angle of the actuator. Then, a soft robotic wrist with a length of 18 cm is built, its load-carrying capability is tested by measuring the cantilever force required for deforming the actuator, and its load-carrying capability during actuation is tested by loading one end with different objects and actuating the actuator. This wrist actuator shows good repeatability, is capable of twisting deformations up to 25° while holding objects weighing 100 g, and can sustain loads above 2 N without undergoing buckling. (paper)
Biomechanics of smart wings in a bat robot: morphing wings using SMA actuators.
Colorado, J; Barrientos, A; Rossi, C; Bahlman, J W; Breuer, K S
2012-09-01
This paper presents the design of a bat-like micro aerial vehicle with actuated morphing wings. NiTi shape memory alloys (SMAs) acting as artificial biceps and triceps muscles are used for mimicking the morphing wing mechanism of the bat flight apparatus. Our objective is twofold. Firstly, we have implemented a control architecture that allows an accurate and fast SMA actuation. This control makes use of the electrical resistance measurements of SMAs to adjust morphing wing motions. Secondly, the feasibility of using SMA actuation technology is evaluated for the application at hand. To this purpose, experiments are conducted to analyze the control performance in terms of nominal and overloaded operation modes of the SMAs. This analysis includes: (i) inertial forces regarding the stretchable wing membrane and aerodynamic loads, and (ii) uncertainties due to impact of airflow conditions over the resistance-motion relationship of SMAs. With the proposed control, morphing actuation speed can be increased up to 2.5 Hz, being sufficient to generate lift forces at a cruising speed of 5 m s(-1).
PENGEMBANGAN MODEL PANDUAN PEMBELAJARAN KETERAMPILAN PROSES SAINS BIOLOGI SMA/MA
Directory of Open Access Journals (Sweden)
triana asih
2015-10-01
Full Text Available Abstract: Science learning in senior high school was designed with the goal of achieving the competencies of graduates that includes aspects of attitudes, skills, and knowledge competency. Skill aspect refers to the Scientific Approach. Skills such as observing the process are observing, trying, processing, serving, and reasoning. All of these skills, leading to the aspects that exist within SPS. Learning needs analysis conducted by researchers at the SMA/ MA class XI IPA that is in the Purbolinggo district of East Lampung SPS shows a lack of provision in the learning process. Supposedly, learning based on SPS is further enhanced, the researchers created a learning guide model based on SPS. The objectives of the reasearch: 1 produce a learning guide model based on SPS class XI, 2 improve outcomes (process and output (learning cutcomes biology learning class XI. Type of the research is Research and Development (R&D. The research was conducted in SMA N 1 Purbolinggo in class XI Science. Procedures R&D is adapted from Borg and Gall consisting of five steps: 1 literature review and the results of relevant research, 2 Design and carry out preliminary study, 3 the development/conceptualization models, 4 test the model through experimentation, 5 revision of the model. conclusion; 1 learning guide SPS models has been validated by the user and learning experts, instrument validation, model validation, and it is suitable.
Directory of Open Access Journals (Sweden)
Mochamad Yusuf
2017-12-01
Full Text Available This article discusses the influence of the ISO 9001:2008 quality management system and compensation for teacher performance in SMA Darul Ulum 2 Unggulan BPPT Jombang. The purpose of this research is: to know the influence of SMM 9001:2008 implementation to the teacher performance; to know the influence of the compensation for teacher performance; to find out the influence of the SMM ISO 9001:2008 implementation and the compensation simultaneously on the teacher performance. This is a correlational research with an expost facto approach. The population of this study are all teachers in SMA Darul Ulum 2 Unggulan BPPT Jombang that amounted to 92 people. The methods of data collection in this study using questionnaires. Based on the research conducted, it was concluded that the implementation of ISO 9001:2008 quality management system and the the compensation either apart or together are very closely related to the teacher performance in Darul Ulum 2 SMA Unggulan BPPT Jombang.
Directory of Open Access Journals (Sweden)
Leyla Sadat Bouryabaf
2017-10-01
Full Text Available Background: Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods: The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results: The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion: We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.
Embedded SMA wire actuated biomimetic fin: a module for biomimetic underwater propulsion
International Nuclear Information System (INIS)
Wang Zhenlong; Hang Guanrong; Wang Yangwei; Li Jian; Du Wei
2008-01-01
An embedded shape memory alloy (SMA) wire actuated biomimetic fin is presented, and based on this module for biomimetic underwater propulsion, a micro robot fish (146 mm in length, 30 g in weight) and a robot squid (242 mm in length, 360 g in weight) were developed. Fish swim by undulating their body and/or fins. Squid and cuttlefish can also swim by undulating their fins. To simplify engineering modeling, the undulating swimming movement is assumed to be the integration of the movements of many flexible bending segments connected in parallel or in series. According to this idea, a biomimetic fin which can bend flexibly was developed. The musculature of a cuttlefish fin was investigated to aid the design of the biomimetic fin. SMA wires act as 'muscle fibers' to drive the biomimetic fin just like the transverse muscles of the cuttlefish fin. During the bending phase, elastic energy is stored in the elastic substrate and skin, and during the return phase, elastic energy is released to power the return movement. Theorem analysis of the bending angle was performed to estimate the bending performance of the biomimetic fin. Experiments were carried out on single-face fins with latex rubber skin and silicone skin (SF-L and SF-S) to compare the bending angle, return time, elastic energy storage and reliability. Silicone was found to be the better skin. A dual-face fin with silicone skin (DF-S) was tested in water to evaluate the actuating performance and to validate the reliability. Thermal analysis of the SMA temperature was performed to aid the control strategy. The micro robot fish and robot squid employ one and ten DF-S, respectively. Swimming experiments with different actuation frequencies were carried out. The speed and steering radius of the micro robot fish reached 112 mm s −1 and 136 mm, respectively, and the speed and rotary speed of the robot squid reached 40 mm s −1 and 22° s −1 , respectively
EVALUASI KINERJA GURU FISIKA, BIOLOGI DAN KIMIA SMA YANG SUDAH LULUS SERTIFIKASI
Directory of Open Access Journals (Sweden)
Yusrizal Yusrizal
2013-01-01
Full Text Available Penelitian ini bertujuan (1 mengembangkan instrumen evaluasi kinerja guru yang valid dan reliabel, (2 mengevaluasi kinerja guru Fisika, Biologi, dan Kimia SMA yang sudah terser-tifikasi/menerima tunjangan profesi. Populasi penelitian yaitu seluruh guru Fisika, Biologi dan Kimia SMA tersertifikasi/pene-rima tunjangan profesi yang berada di Kota Banda Aceh, Kabupaten Aceh Besar dan Kabupaten Pidie. Validitas konstruk instrumen yang dikembangkan dibuktikan melalui analisis fak-tor, dan reliabilitasnya diestimasi dengan rumus alpha Cron-bach. Analisis tingkat kinerja ditentukan dengan persentase. Hasil penelitian menunjukkan: (1 instrumen yang dikembang-kan terdiri atas 33 butir pernyataan, dan memiliki koefisien reliabilitas konsistensi internal sebesar 0,953; (2 kinerja guru Fisika, Biologi, dan Kimia SMA yang sudah lulus sertifikasi dan sudah menerima tunjangan belum seluruhnya berkinerja tinggi; (3 kinerja guru Kimia relatif lebih baik dari pada kinerja guru Biologi dan guru Fisika. Kata kunci: evaluasi, kinerja guru, validitas, reliabilitas ______________________________________________________________ AN EVALUATION OF THE PERFORMANCE OF CERTIFIED SCIENCE TEACHERS (PHYSICS, CHEMISTRY AND BIOLOGY OF SENIOR HIGH SCHOOLS Abstract This study was aimed at (1 developing a valid and reliable performance evaluation instruments for teachers, and (2 evaluating the level of Physics, Biology and Chemistry teachers of senior high schools who have been certified and received theprofession allowance. The population of this study included all certified Physics, Biology and Chemistry teachers of senior high schools who have received profession allowance in Banda Aceh, Aceh Besar, and Pidie. The construct validity of the instrument developed was assessed through factor analysis, and the reliability was estimated by using Cronbach’s Alpha formula. The level of teachers’performance was analyzed by the percentage. The result of the research shows that (1 the
RELEVANSI KURIKULUM PRODI PENDIDIKAN SOSIOLOGI ANTROPOLOGI DENGAN KEBUTUHAN MENGAJAR GURU SMA
Directory of Open Access Journals (Sweden)
Totok Rochana
2013-04-01
Full Text Available Materi pembelajaran Sosiologi dan Antropologi yang diajarkan di SMA senantiasa mengalami perubahan. Sementara kurikulum Program Studi Pendidikan Sosiologi dan Antropologi FIS UNNES tidak banyak mengalami perubahan. Dalam penelitian ini, penulis membahas bagaimana relevansi antara Kurikulum Prodi Pendidikan Sosiologi dan Antropologi FIS UNNES dengan kebutuhan mengajar bagi guru Sosiologi dan Antropologi SMA Negeri di Jawa Tengah. Penelitian ini menggunakan pendekatan kualitatif dan bersifat kasus, pengumpulan data menggunakan metode wawancara tertutup dan terbuka, dan analisis data menggunakan metode deskriptif kualitatif. Berdasarkan hasil penelitian disimpulkan bahwa kurikulum Program Studi Pendidikan Sosiologi dan Antropologi FIS UNNES, masih relevan dengan materi pembelajaran Sosiologi dan Antropologi yang diajarakan di SMA. Saran yang diajukan adalah: perlu diselenggarakan penataran-penataran/diklat-diklat peningkatan penguasaan materi pembelajaran Sosiologi dan Antropologi bagi guru-guru Sosiologi dan Antropologi yang bukan berlatar belakang Pendidikan Sosiologi dan Antropologi. Pengangkatan CPNS Guru Sosiologi dan Antropologi perlu diprioritaskan dari lulusan Prodi Pendidikan Sosiologi dan Antropologi. Pengembangan kurikulum Program Studi Pendidikan Sosiologi dan Antropologi tetap mengacu pada relevansinya dengan kebutuhan di lapangan.Sociology and Anthropology instructional materials taught in high school are constantly changing, though the curriculum of Sociology and Anthropology FIS Unnes does not change much. In this study, the author discusses the relevance of the curriculum of Sociology and Anthropology of Education Unnes FIS to the needs of teaching for teachers of Sociology and Anthropology Senior high school in Central Java. The method used in this study is a qualitative approach using descriptive methods. Based on the results of the study it is concluded that the curriculum of Sociology and Anthropology
Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...
Corn and potato starch as an agar alternative for Solanum ...
African Journals Online (AJOL)
STORAGESEVER
2010-01-04
Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).
Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru
2007-05-01
This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.
Directory of Open Access Journals (Sweden)
Bob Laarhoven
Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.
Directory of Open Access Journals (Sweden)
Mei Fita Aryani
2014-11-01
Full Text Available Pendekatan saintifik adalah pendekatan yang digunakan dalam kurikulum 2013. Sebagian besar guru di SMA N 1 Bawang belum menerapkan pendekatan saintifik. Penelitian ini dilakukan di SMA N 1 Bawang Kabupaten Batang dengan menggunakan pendekatan kualitatif studi kasus. Sumber data yang digunakan dalam penelitian ini yaitu sumber data manusia dan benda. Teknik pengumpulan data observasi, wawancara semiterstruktur dan dokumentasi. Keabsahan data diuji melalui triangulasi sumber. Hasil penelitian menunjukan bahwa sebagian guru belum menerapkan pendekatan saintifik dalam pembelajaran. Beberapa guru yang mengajar masih mengalami hambatan dalam penerapan pendekatan saintifik. Dalam perencanaan hambatan yang dialami guru yaitu: (1 hambatan dalam penyusunan RPP 2013, (2 pengembangan RPP, (3 kesulitan dalam menyiapkan media pembelajaran. Dalam pelaksanaan pembelajaran, hambatan yang dialami guru yaitu: (1 sulitnya menarik minat siswa untuk bertanya, (2 kurangnya waktu, (3 rumitnya persiapan, (4 guru kurang mampu mengelola kelas, (5 siswa banyak yang terlambat mengumpulkan tugas. Dalam kegiatan penilaian hambatannya yaitu (1 guru masih kesulitan dalam melakukan penilaian kepada siswa secara bersamaan, (2 guru masih bingung membuat instrument penilaian. Faktor pendukung penerapan pendekatan saintifik di SMA N 1 Bawang sangat di dukung oleh kemampuan guru dan sarana prasarana yang sudah cukup lengkap. Scientific approach is the approach used in the curriculum 2013. Most of the teachers SMA N 1 Bawang not apply scientific approach. This research was conducted in SMA N 1 Bawang in the Batang Regency using a qualitative case study approach. Sources of data used in this research that the human data sources and object. Data collection techniques of observation, semistructured interviews and documentation. The validity is tested through triangulation of data sources. The results showed that the majority of teachers have not applied a scientific approach to learning
Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo
2009-07-03
Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to
Directory of Open Access Journals (Sweden)
Ellen Yeh
Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost
Directory of Open Access Journals (Sweden)
Joost eHordijk
2013-08-01
Full Text Available ESBL/AmpC producing Enterobacteriaceae have been reported worldwide amongst isolates obtained from humans, food-producing animals, companion animals and environmental sources. However, data on prevalence of fecal carriage of ESBL/AmpC producing Enterobacteriaceae in healthy companion animals is limited. This pilot study describes the prevalence of ESBL/AmpC encoding genes in healthy cats and dogs, and cats and dogs with diarrhea. Twenty fecal samples of each group were cultured on MacConkey agar supplemented with 1 mg/L cefotaxime and in LB-enrichment broth supplemented with 1 mg/L cefotaxime, which was subsequently inoculated on MacConkey agar supplemented with 1 mg/L cefotaxime. ESBL/AmpC genes were identified using the Check-Points CT103 micro array kit and subsequently by sequencing analysis. Chromosomal ampC promoter mutations were detected by PCR and sequencing analysis. From the healthy and diarrheic dogs, respectively 45% and 55% were positive for E. coli with reduced susceptibility for cefotaxime. From the healthy and diarrheic cats, the estimated prevalence was respectively 0% and 25%. One diarrheic cat was positive for both reduced susceptible E. coli and P. mirabilis. The ESBL/AmpC genes found in this study were mainly blaCTX-M-1, but also blaCTX-M-14, blaCTX-M-15, blaTEM-52-StPaul, blaSHV-12 and blaCMY-2 were detected. This pilot study showed that the prevalence of ESBL/AmpC producing Enterobacteriaceae in healthy and diarrheic dogs, and diarrheic cats was relatively high. Furthermore the genes found were similar to those found in isolates of both human and food producing animal origin. However, since the size of this study was relatively small, extrapolation of the data to the general population of cats and dogs should be done with great care.
Preparation of amine-impregnated silica foams using agar as the gelling agent
Energy Technology Data Exchange (ETDEWEB)
Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)
2016-10-15
In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.
Preparation of amine-impregnated silica foams using agar as the gelling agent
International Nuclear Information System (INIS)
Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.
2016-01-01
In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.
Spore-to-spore agar culture of the myxomycete Physarum globuliferum.
Liu, Pu; Wang, Qi; Li, Yu
2010-02-01
The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.
Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.
Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia
2015-02-01
For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from
Directory of Open Access Journals (Sweden)
Wahyudi -
2012-04-01
Full Text Available Penelitian ini bertujuan untuk mendeskripsikan penerapan model pembelajaran kooperatif tipe STAD berbasis CTL pada pembelajaran fisika dalam mengembangkan learning community dan meningkatkan hasil belajar siswa serta mengetahui dampak penerapannya terhadap learning community dan hasil belajar siswa kelas X-7 SMA N 1 Tahunan Jepara. Hasil penelitian menunjukkan meningkatnya hasil belajar serta berkembangnya learning community siswa kelas X-7 SMA N 1 Tahunan Jepara setelah penerapan model pembelajaran kooperatif tipe STAD berbasis CTL pada pokok bahasan listrik dinamis.This research is describe the implementation of cooperative learning model STAD CTL-based for Physics learning subject to develop learning community, improve students learning and also find out the outcome of its implementation  to the learning community and learning result of SMA N 1 Tahunan Jepara Students class of X-7. The research result shows that there is an improvement of students’ learning result and also a development of learning community of N 1 Tahunan Jepara Students class of X-7 after implementing cooperative learning model STAD CTL-based for Dynamic Electricity topic.
Directory of Open Access Journals (Sweden)
Mahdi Mahdi
2017-05-01
Full Text Available This study was to determine the role of guidance and counseling teachers in improving student learning success at SMA Negeri 1 Depok Sleman, Yogyakarta. The method used in this research is descriptive qualitative manifold generate descriptive data to describe the behavior of the subject under study. Then the presence of investigators in this study serves as primary research tool. Sources of data in this study are primary data obtained through observation and interview respondents. And secondary data documentation Master's programs of guidance and counseling. Data collection techniques in this study using the method of observation, interviews, and documentation. Selanjtnya data analysis in this study using qualitative data analysis. The results showed that the models of guidance and counseling program in SMA Negeri 1 Depok form their Intensification Program for class XII, intensification program contains material National Examinations and Pathways to college, learning programs in addition to class 10 and 11 to face the Final Exams Semester in order to satisfy student achievement, educational exhibits, and extracurricular programs in SMA Negeri 1 Depok. Then the data findings in the form of involvement or role of teacher guidance and counseling in improving students' success in school is through a program of classical guidance, counseling and personal counseling, tutoring and social counseling, guidance and counseling to learn, and guidance and career counseling.
Directory of Open Access Journals (Sweden)
Wiwiek Tamsyani
2016-06-01
Full Text Available Penelitian ini bertujuan untuk mengkaji hasil belajar penyebaran dengan model pembelajaran penemuan dan inkuiri terbimbing menggunakan rancangan quasi eksperimen dengan desain faktorial 2 × 2. Penelitian dilaksanakan di SMA Negeri 2 Takalar. Sampel penelitian dipilih dengan random sampling teknik acak kelas yang terdiri atas 2 kelas. Kelas XI IPA 1 (34 peserta didik sebagai kelas eksperimen 1 dibelajarkan dengan model pembelajaran penemuan dan kelas XI IPA 2 (33 peserta didik sebagai kelas eksperimen 2 dibelajarkan dengan model pembelajaran inkuiri terbimbing. Instrumen penelitian menggunakan yaitu, angket Inventori Kesadaran Meta kognitif dan tes hasil belajar. Penggunaan program SPSS versi 20.0 menunjukkan bahwa 5 soal essay valid dengan reliabilitas sebesar instrumen sebesar 0.699. Data penelitian dianalisis pada taraf signifikan α = 0.05 dengan uji anova dua jalur. Hasil penelitian menunjukkan bahwa (1 Rata-rata nilai hasil belajar peserta didik yang menggunakan model pembelajaran penemuan, hasilnya lebih tinggi dibandingkan dengan model pembelajaran inkuiri terbimbing. (2 Rata-rata nilai hasil belajar peserta didik dengan kesadaran metakognitif tinggi, hasil belajar peserta didik lebih tinggi dibandingkan dengan rata-rata nilai hasil belajar dengan kesadaran metakognitif rendah. (3 Terjadi interaksi antara model pembelajaran dan kesadaran metakognitif dalam mempengaruhi hasil belajar SMA Negeri 2 Takalar. Jadi, ada pengaruh antara model pembelajaran dan kesadaran metakognitif terhadap hasil belajar peserta didik SMA Negeri 2 Takalar dalam materi pokok asam basa.
ulfa, warni atul
2013-01-01
Penelitian ini bertujuan untuk mengetahui pengaruh penerapan Model Pembelajaran Berbasis Masalah terhadap kemampuan menulis teks eksposisi oleh siswa kelas X SMA Negeri 1 Babalan tahun pembelajaran 2013/2014. Populasi penelitian ini adalah seluruh siswa kelas X SMA Negeri 1 Babalan, yang berjumlah 200 orang dan yang menjadi sampel penelitian sebanyak 40 orang. Pengambilan sampel dilakukan dengan cara menentukan satu kelas yang dijadikan wakil populasi dengan menggunakan teknik Random Sampling...
International Nuclear Information System (INIS)
Ito, Hitoshi
2000-01-01
Effects of gamma-irradiation on some strains of Escherichia coli, Salmonella enteritidis and Staphylococcus aureus were investigated in the presence of N 2 , N 2 O and O 2 and with the hydroxyl radical (OH) scavengers glycerol, polyethylene glycerol and formate. Injured cell membrane of bacteria was detected using with MacConkey agar for E. coli and S. enteritidis and 7% NaCl Triptic soy agar for St. aureus instead of Tryptic soy agar for recovery medium. From this study, addition of glycerol significantly reduced the sensitivity in all of strains, and cell membrane was not injured significantly except in radiation sensitive strain E. coli A4-1. When superoxide radicals (O 2 ) were generated during irradiation in the presence of formate, injured cell membrane increased significantly in all of strains. However, molecular oxygen (O 2 ) and OH radicals also had some effects on the damage of cell membrane. These results suggest that most radiation induced cell lethality was responsible to the cooperative effects of intracellular OH radicals and O 2 on DNA with lessor effect of damage on cell membrane by O 2 radicals, O 2 and OH radicals. On the radiation sensitive strain of E. coli, cell lethality occurred significantly by the injury of cell membrane compared with other strains. (author)
Colony formation in agar: in vitro assay for haemopoietic stem cells
Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van
1971-01-01
Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain
Directory of Open Access Journals (Sweden)
Andrea Luchetti
2015-08-01
Full Text Available Spinal muscular atrophy (SMA is an inherited neuromuscular disorder and the leading genetic cause of death in infants. Despite the disease-causing gene, survival motor neuron (SMN1, encodes a ubiquitous protein, SMN1 deficiency preferentially affects spinal motor neurons (MNs, leaving the basis of this selective cell damage still unexplained. As neural stem cells (NSCs are multipotent self-renewing cells that can differentiate into neurons, they represent an in vitro model for elucidating the pathogenetic mechanism of neurodegenerative diseases such as SMA. Here we characterize for the first time neural stem cells (NSCs derived from embryonic spinal cords of a severe SMNΔ7 SMA mouse model. SMNΔ7 NSCs behave as their wild type (WT counterparts, when we consider neurosphere formation ability and the expression levels of specific regional and self-renewal markers. However, they show a perturbed cell cycle phase distribution and an increased proliferation rate compared to wild type cells. Moreover, SMNΔ7 NSCs are characterized by the differential expression of a limited number of miRNAs, among which miR-335-5p and miR-100-5p, reduced in SMNΔ7 NSCs compared to WT cells. We suggest that such miRNAs may be related to the proliferation differences characterizing SMNΔ7 NSCs, and may be potentially involved in the molecular mechanisms of SMA.
Luchetti, Andrea; Ciafrè, Silvia Anna; Murdocca, Michela; Malgieri, Arianna; Masotti, Andrea; Sanchez, Massimo; Farace, Maria Giulia; Novelli, Giuseppe; Sangiuolo, Federica
2015-08-06
Spinal muscular atrophy (SMA) is an inherited neuromuscular disorder and the leading genetic cause of death in infants. Despite the disease-causing gene, survival motor neuron (SMN1), encodes a ubiquitous protein, SMN1 deficiency preferentially affects spinal motor neurons (MNs), leaving the basis of this selective cell damage still unexplained. As neural stem cells (NSCs) are multipotent self-renewing cells that can differentiate into neurons, they represent an in vitro model for elucidating the pathogenetic mechanism of neurodegenerative diseases such as SMA. Here we characterize for the first time neural stem cells (NSCs) derived from embryonic spinal cords of a severe SMNΔ7 SMA mouse model. SMNΔ7 NSCs behave as their wild type (WT) counterparts, when we consider neurosphere formation ability and the expression levels of specific regional and self-renewal markers. However, they show a perturbed cell cycle phase distribution and an increased proliferation rate compared to wild type cells. Moreover, SMNΔ7 NSCs are characterized by the differential expression of a limited number of miRNAs, among which miR-335-5p and miR-100-5p, reduced in SMNΔ7 NSCs compared to WT cells. We suggest that such miRNAs may be related to the proliferation differences characterizing SMNΔ7 NSCs, and may be potentially involved in the molecular mechanisms of SMA.
Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil
2016-06-01
Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Jansen, M.T.
1962-01-01
Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected
Growth and study of barium oxalate single crystals in agar gel
Indian Academy of Sciences (India)
Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...
Directory of Open Access Journals (Sweden)
Hsi Liu
2016-11-01
Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.
N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-09-01
Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.
Directory of Open Access Journals (Sweden)
Hanin Fathan Nurfina Istiqomah
2016-11-01
Full Text Available Penelitian ini bertujuan untuk mengetahui ketersediaan dan pengelolaan peralatan praktikum serta mengetahui hasil dari pengelolaan dan penggunaan peralatan praktikum fisika kelas XI di laboratorium fisika SMA Muhammadiyah 1 Yogyakarta. Penelitian ini merupakan penelitian evalusi model countenance stake. Subjek penelitian meliputi penanggungjawab laboratorium fisika, guru, laboran, dan siswa kelas XI MIA SMA Muhammadiyah 1 Yogyakarta. Penelitian dilakukan pada akhir pelaksanaan praktikum pada semester genap tahun pelajaran 2015-2016. Data dikumpulkan dengan wawancara terstruktur, pengamatan (observasi, angket, dokumentasi. Hasil penelitian menunjukkan bahwa ketersediaan peralatan praktikum (masukan [antecedents] yang terdiri dari sarana, prasarana dan alat praktikum tersedia sangat baik dengan persentase sebesar 78,16%. Pengelolaan laboratorium fisika (proses [transaction] yang terdiri dari persiapan pelaksanaan praktikum; kesiapan siswa, guru, laboran; dan pelaksanaan praktikum mendapatkan hasil sangat baik dengan persentase sebesar 81,78%. Hasil yang diperoleh (outcomes dari ketersediaan dan pengelolaan peralatan praktikum di laboratorium fisika termasuk kategori baik (B+ dengan pencapaian Kriteria Ketuntasan Minimal (KKM 100% dari total 233 siswa kelas XI MIA (Matematika dan Ilmu Alam dan beberapa siswa berhasil meraih juara 1 Olimpiade Fisika. This research is aimed to know the availability, management of the laboratory equipment’s and also the result of maintaining and using physics laboratory equipment’s in 11th class of MIA SMA 1 Muhammadiyah Yogyakarta. And this evaluation research used “countenance stake” approach, hence, such as the objects of it is the physics laboratory care taker, teachers, laboratory assistant, and the students. This research was conducted in the last meeting of practicum on last semester 2015-2016 periods. The data was assembled by interview, observation, questionnaire and documentation. The result of this
Directory of Open Access Journals (Sweden)
Andréa de Moraes Carvalho
2013-06-01
Full Text Available The present study reports the presence of enterobacteriaceae in Tegu Lizards (Tupinambis merianaefrom a captive facility in central Brazil. From a total of 30 animals, 10 juveniles and 20 adults (10 males, 10 females, 60 samples were collected, in two periods separated by 15 days. The samples were cultivated in Xylose-lysine-deoxycholate agar (XLT4 and MacConkey agar. The Salmonella enterica were tested for antimicrobial susceptibility. A total of 78 bacteria was isolated, of wich 27 were from juveniles of T. merianae, 30 from adult males and 21 from adult females. Salmonella enterica was the most frequent bacteria followed by Citrobacter freundii, Escherichia coli, Enterobacter sakasakii, Kluivera sp., Citrobacter amalonaticus, Serratia marcescens, Citrobacter diversus, Yersinia frederiksenii, Serratia odorifera, and Serratia liquefaciens. Salmonella enterica subsp. diarizonae and houtenae showed resistance to cotrimoxazole, and serum Salmonella enterica Worthington showed resistance to tetracycline and gentamicin. Salmonella enterica Panama and S. enterica subsp. diarizonae showed intermediate sensitivity to cotrimoxazole. In addition to Enterobacteriaceae in the Tegu lizard, pathogenic serotypes of S. enterica also occur, and their antimicrobial resistance was confirmed.
Omulo, Sylvia; Lofgren, Eric T; Mugoh, Maina; Alando, Moshe; Obiya, Joshua; Kipyegon, Korir; Kikwai, Gilbert; Gumbi, Wilson; Kariuki, Samuel; Call, Douglas R
2017-05-01
Investigators often rely on studies of Escherichia coli to characterize the burden of antibiotic resistance in a clinical or community setting. To determine if prevalence estimates for antibiotic resistance are sensitive to sample handling and interpretive criteria, we collected presumptive E. coli isolates (24 or 95 per stool sample) from a community in an urban informal settlement in Kenya. Isolates were tested for susceptibility to nine antibiotics using agar breakpoint assays and results were analyzed using generalized linear mixed models. We observed a 0.1). Prevalence estimates did not differ for five distinct E. coli colony morphologies on MacConkey agar plates (P>0.2). Successive re-plating of samples for up to five consecutive days had little to no impact on prevalence estimates. Finally, culturing E. coli under different conditions (with 5% CO 2 or micro-aerobic) did not affect estimates of prevalence. For the conditions tested in these experiments, minor modifications in sample processing protocols are unlikely to bias estimates of the prevalence of antibiotic-resistance for fecal E. coli. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Luis H. León Mendoza
2014-12-01
Full Text Available The yellow maize is the third most important crop in Peru and part of the chain maize-poultry-pig, significant impact on the national economic and social activity, however, in 2011, only 40% of the corn offered corresponded to the domestic industry. Looking for alternatives to reduce the use of chemical fertilizers, have performed investigations with plant growth promoting rhizobacteria. Bacteria were isolated from the rhizosphere of maize from districts Monsefú and Reque, Lambayeque. Dilution was made into sterile saline 0.87% NaCl w/v and plated on MacConkey agar, incubating at 30°C for 48 hours. 269 pure cultures of bacteria were obtained, the biochemical reaction was investigated in agar Triple sugar iron agar Iron Lysine, agar Citrate Simons, peptone broth, red broth methyl Voges-Proskauer and nitrate broth, was identified 66% as Enterobacteriaceae of genera Pantoea (49%, Klebsiella (17%, Kluyvera (16%, Serratia (11%, Citrobacter (4% and Hafnia (3%. The native enterobacteria were quantified to 31.67 ppm of fixed nitrogen as ammonia; 54.25 ppm indole acetic acid and 4,78 ppm solubilized phosphorus, activity proteolytic and chitinolytic and antagonistic activity of Fusarium verticillioides were also determined. 16% of native enterobacteria did not affect the emergence of hard yellow maize, 77% affected positively and 7% affected negatively. In turn, none bacteria affected survival. Was demonstrated the potential plant growth promoter of enterobacteria isolated from field crops in the region of Lambayeque.
Kojima, Kensuke; Moriguchi, Hiroyuki; Hattori, Akihiro; Kaneko, Tomoyuki; Yasuda, Kenji
2003-11-01
We have developed a new method that enables agar microstructures to be used to cultivate cells and that allows cell network patterns to be controlled. The method makes use of non-contact three-dimensional photo-thermal etching with a 1480 nm infrared focused laser beam, which is strongly absorbed by water and agar gel, to form the shapes of agar microstructures. It allows microstructures to be easily formed in an agar layer within a few minutes, with cell-culture holes formed by the spot heating of a 100 mW laser and tunnels by the tracing of a 100 microm s(-1), 40 mW laser. We cultivated rat cardiac myocytes in adjacent microstructures and observed synchronized beating in them 90 min after they had made physical contact. Our results indicate that the system can make and use microstructures for cell-network cultivation in a minimal amount of time without any expensive microfabrication facilities or complicated procedures.
Morrison, Kerrie A; Akram, Aneel; Mathews, Ashlyn; Khan, Zoeya A; Patel, Jaimin H; Zhou, Chumin; Hardy, David J; Moore-Kelly, Charles; Patel, Roshani; Odiba, Victor; Knowles, Tim J; Javed, Masood-Ul-Hassan; Chmel, Nikola P; Dafforn, Timothy R; Rothnie, Alice J
2016-12-01
The use of styrene-maleic acid (SMA) copolymers to extract and purify transmembrane proteins, while retaining their native bilayer environment, overcomes many of the disadvantages associated with conventional detergent-based procedures. This approach has huge potential for the future of membrane protein structural and functional studies. In this investigation, we have systematically tested a range of commercially available SMA polymers, varying in both the ratio of styrene and maleic acid and in total size, for the ability to extract, purify and stabilise transmembrane proteins. Three different membrane proteins (BmrA, LeuT and ZipA), which vary in size and shape, were used. Our results show that several polymers, can be used to extract membrane proteins, comparably to conventional detergents. A styrene:maleic acid ratio of either 2:1 or 3:1, combined with a relatively small average molecular mass (7.5-10 kDa), is optimal for membrane extraction, and this appears to be independent of the protein size, shape or expression system. A subset of polymers were taken forward for purification, functional and stability tests. Following a one-step affinity purification, SMA 2000 was found to be the best choice for yield, purity and function. However, the other polymers offer subtle differences in size and sensitivity to divalent cations that may be useful for a variety of downstream applications. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Directory of Open Access Journals (Sweden)
Hendra Setyawan
2015-10-01
Full Text Available Penelitian ini bertujuan menghasilkan model-model permainan Aktivitas Luar kelas (ALK yang layak digunakan sebagai materi pembelajaran penjas, serta efektif untuk mengembangkan ranah kognitif, afektif, dan psikomotorik siswa SMA. Penelitian ini dilakukan dengan langkah-langkah sebagai berikut: (1 pengumpulan informasi di lapangan, (2 menganalisis informasi yang telah dikumpulkan, (3 mengembangkan produk awal, (4 validasi ahli dan revisi, (5 uji coba skala kecil dan revisi, (6 uji coba skala besar dan revisi, dan (7 pembuatan produk final. Uji coba skala kecil dilakukan terhadap siswa kelas X-D dan XI-IPA 4 dari SMA N I Prambanan berjumlah 66 orang. Uji coba skala besar dilakukan terhadap siswa kelas X-G, X-H, XI-IPS 3, dan XI-BHS dari SMA N I Prambanan berjumlah 132 orang. Instrumen pengumpulan data yang digunakan yaitu; (1 pedoman wawancara, (2 skala nilai, (3 pedoman observasi permainan, (4 pedoman observasi keefektifan permainan, (5 pedoman observasi terhadap guru pelaku uji coba, dan (6 rubrik penilaian siswa. Teknik analisis data dengan analisis deskriptif kuantitatif dan kualitatif. Hasil penelitian berupa tujuh model permainan yang layak dan efektif digunakan dalam pembelajaran penjas, hal ini dibuktikan dengan perolehan persentase sebesar 100% dari data hasil kuesioner skala nilai, observasi model permainan, observasi keefektifan permainan, dan observasi guru pelaku uji coba. Model permainan juga efektif untuk mengembangkan ranah kognitif, afektif, dan psikomotorik, yang dibuktikan dengan terjadinya peningkatan persentase nilai rata-rata siswa sebesar 21%. Kata kunci: model, permainan, aktivitas luar kelas, kognitif, afektif, psikomotorik THE OUTDOOR ACTIVITY GAME MODEL TO DEVELOP THE ASPECT OF COGNITIVE, AFFECTIVE, AND PSYCHOMOTOR OF THE SENIOR HIGH SCHOOL STUDENTS Abstract This study aims at producing outdoor activity game models which are proper to be used for physicall education learning and developing cognitive, affective, and
Susi Fatikhah Setiyawati; Heru Kuswanto
2015-01-01
Penelitian ini bertujuan: (1) menghasilkan buku pedoman guru untuk pembelajaran fisika SMA menggunakan model problem solving sesuai level inkuiri yang layak digunakan; (2) mendeskripsikan keberhasilan pembelajaran fisika menggunakan model problem solving (MPS) sesuai dengan level inkuiri sesuai dengan buku pedoman terhadap peningkatan aktivitas peserta didik dan kemampuan berpikir kritis peserta didik. Penelitian ini merupakan penelitian pengembangan, sesuai langkah yang dikembangkan oleh Bor...
Artificial heart for humanoid robot using coiled SMA actuators
Potnuru, Akshay; Tadesse, Yonas
2015-03-01
Previously, we have presented the design and characterization of artificial heart using cylindrical shape memory alloy (SMA) actuators for humanoids [1]. The robotic heart was primarily designed to pump a blood-like fluid to parts of the robot such as the face to simulate blushing or anger by the use of elastomeric substrates for the transport of fluids. It can also be used for other applications. In this paper, we present an improved design by using high strain coiled SMAs and a novel pumping mechanism that uses sequential actuation to create peristalsis-like motions, and hence pump the fluid. Various placements of actuators will be investigated with respect to the silicone elastomeric body. This new approach provides a better performance in terms of the fluid volume pumped.
Ge, Jianfeng; Burnier, Laurent; Adamopoulou, Maria; Kwa, Mei Qi; Schaks, Matthias; Rottner, Klemens; Brakebusch, Cord
2018-04-26
Mesenchymal stem cells (MSC) are suggested to be important progenitors of myofibroblasts in fibrosis. To understand the role of Rho GTPase signaling in TGFβ-induced myofibroblast differentiation of MSC, we generated a novel MSC line and descendants of it lacking functional Rho GTPases and Rho GTPase signaling components. Unexpectedly, our data revealed that Rho GTPase signaling is required for TGFβ-induced expression of αSMA, but not of collagen I α1 (col1a1). While loss of RhoA and Cdc42 reduced αSMA expression, ablation of the Rac1 gene had the opposite effect. Although actin polymerization and MRTFa were crucial for TGFβ-induced αSMA expression, neither Arp2/3 dependent actin polymerization nor cofilin dependent severing and depolymerization of F-actin were required. Instead, F-actin levels were dependent on cell contraction and TGFβ-induced actin polymerisation correlated with increased cell contraction mediated by RhoA and Cdc42. Finally, we observed impaired collagen I secretion in MSC lacking RhoA or Cdc42. These data give novel molecular insights into the role of Rho GTPases in TGFβ signaling and have implications for our understanding of MSC function in fibrosis. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Yan Li
2018-01-01
Full Text Available A bidirectional B-spline QR method (BB-sQRM for the study on the crack control of the reinforced concrete (RC beam embedded with shape memory alloy (SMA wires is presented. In the proposed method, the discretization is performed with a set of spline nodes in two directions of the plane model, and structural displacement fields are constructed by the linear combination of the products of cubic B-spline interpolation functions. To derive the elastoplastic stiffness equation of the RC beam, an explicit form is utilized to express the elastoplastic constitutive law of concrete materials. The proposed model is compared with the ANSYS model in several numerical examples. The results not only show that the solutions given by the BB-sQRM are very close to those given by the finite element method (FEM but also prove the high efficiency and low computational cost of the BB-sQRM. Meanwhile, the five parameters, such as depth-span ratio, thickness of concrete cover, reinforcement ratio, prestrain, and eccentricity of SMA wires, are investigated to learn their effects on the crack control. The results show that depth-span ratio of RC beams and prestrain and eccentricity of SMA wires have a significant influence on the control performance of beam cracks.
Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A
2014-01-01
Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.
Directory of Open Access Journals (Sweden)
Sussono Hadi
2009-09-01
Full Text Available This research is aimed at finding out the impact of academic supervision, teacher’s competence, and discipline towards the performance of teachers of SMA Negeri 3 Slawi, Tegal. This research used survey method. The data was collected using questionnaire and observation. There were 52 teachers as respondents. The data analysis used was percentage, multiple linear regression, F test and t test. The finding was : 1 academic supervision, teacher’s competence and discipline of SMA 3 Slawi teachers were very good, 2 academic supervision, teacher’s competence, and discipline together had impact towards teachers’ performance, 3 academic supervision, teacher’s competence, and discipline separately had impact on teachers’ performance, and 4 discipline had the strongest impact towards teachers’ performance. With this result it is suggested that the Diknas (the regential ministry of education intensify the academic supervision, continually developing teacher’s competence, and enforcing discipline on teachers and schools. Key words: academic supervision, competence, discipline, teacher’s performance
A 3D Printed Implantable Device for Voiding the Bladder Using Shape Memory Alloy (SMA) Actuators.
Hassani, Faezeh Arab; Peh, Wendy Yen Xian; Gammad, Gil Gerald Lasam; Mogan, Roshini Priya; Ng, Tze Kiat; Kuo, Tricia Li Chuen; Ng, Lay Guat; Luu, Percy; Yen, Shih-Cheng; Lee, Chengkuo
2017-11-01
Underactive bladder or detrusor underactivity (DU) is defined as a reduction of contraction strength or duration of the bladder wall. Despite the serious healthcare implications of DU, there are limited solutions for affected individuals. A flexible 3D printed implantable device driven by shape memory alloys (SMA) actuators is presented here for the first time to physically contract the bladder to restore voluntary control of the bladder for individuals suffering from DU. This approach is used initially in benchtop experiments with a rubber balloon acting as a model for the rat bladder to verify its potential for voiding, and that the operating temperatures are safe for the eventual implantation of the device in a rat. The device is then implanted and tested on an anesthetized rat, and a voiding volume of more than 8% is successfully achieved for the SMA-based device without any surgical intervention or drug injection to relax the external sphincter.
International Nuclear Information System (INIS)
Woodhams, Reiko; Nishimaki, Hiroshi; Fujii, Kaoru; Kakita, Satoko; Hayakawa, Kazushige
2010-01-01
Objective: The purpose of this study was to assess the efficacy of multidetector-row CT (MDCT) for the diagnosis of non-occlusive mesenteric ischemia (NOMI) by analyzing morphology and diameter of superior mesenteric artery (SMA). We assessed whether MDCT was as useful as angiography for the diagnosis of NOMI. Materials and methods: Four patients who were diagnosed with NOMI were retrospectively analyzed. All patients had 8-row MDCT followed by laparotomy. Two of them underwent angiography after MDCT. The morphology and diameter of SMA of these cases was analyzed on multi-planar reconstructed (MPR) images. The mean diameter of SMA of NOMI cases was compared to that of 13 control cases. Results: MPR images of all NOMI cases showed irregular narrowing of the SMA, spasm of the arcades of SMA, and poor demonstration of intramural vessels. MPR images of two patients who had angiography were concordant with their angiograms. The mean diameter of SMA of NOMI patients was 3.4 ± 1.1 mm, which was statistically smaller than that of 13 control patients, 6.0 ± 1.5 mm (P < 0.05, Wilcoxon rank sum tests). Conclusion: Angiography has been recognized essential for the diagnosis of NOMI. This study shows the possibility of MDCT to be an equivalently useful modality compared to angiography for the diagnosis of NOMI by interpreting morphologic appearance and diameter of SMA. Introduction of MDCT in the decision tree of NOMI treatment may bring the benefit of prompt diagnosis and subsequent early and efficient initiation of therapy, which may improve the mortality.
Wheeler, Robert W.; Lagoudas, Dimitris C.
2017-04-01
Shape memory alloys (SMAs), due to their ability to repeatably recover substantial deformations under applied mechanical loading, have the potential to impact the aerospace, automotive, biomedical, and energy industries as weight and volume saving replacements for conventional actuators. While numerous applications of SMA actuators have been flight tested and can be found in industrial applications, these actuators are generally limited to non-critical components, are not widely implemented and frequently one-off designs, and are generally overdesigned due to a lack of understanding of the effect of the loading path on the fatigue life and the lack of an accurate method for predicting actuator lifetimes. In recent years, multiple research efforts have increased our understanding of the actuation fatigue process of SMAs. These advances can be utilized to predict the fatigue lives and failure loads in SMA actuators. Additionally, these prediction methods can be implemented in order to intelligently design actuators in accordance with their fatigue and failure limits. In the following paper, both simple and complex thermomechanical loading paths have been considered. Experimental data was utilized from two material systems: equiatomic Nickel-Titanium and Nickelrich Nickel-Titanium.
Directory of Open Access Journals (Sweden)
Moh. Nasrul Fuad
2016-12-01
Full Text Available Penelitian ini merupakan penelitian deskriptif kualitatif yang bertujuan untuk mendeskripsikan secara lengkap representasi matematis siswa SMA dalam memecahkan masalah persamaan kuadrat ditinjau dari perbedaan gender. Subjek penelitian terdiri dari dua siswa SMA Negeri 3 Kediri kelas 10 pada tahun pelajaran 2015/2016, yaitu satu siswa laki-laki dan satu siswa perempuan. Tahap penelitian dimulai dengan pemilihan subjek penelitian yang ditentukan berdasarkan gender dan hasil tes kemampuan matematika yang setara. Setelah terpilih subjek kemudian dilanjutkan dengan pemberian tugas pemecahan masalah persamaan kuadrat dan wawancara. Keabsahan data dilakukan dengan menggunakan triangulasi waktu yaitu pemberian tugas pemecahan masalah persamaan kuadrat yang setara pada waktu yang berbeda. Hasil penelitian ini berupa deskripsi matematis dari siswa SMA laki-laki dan perempuan dalam memecahkan masalah persamaan kuadrat untuk setiap tahap pemecahan masalah menurut tahapan Polya. Representasi matematis dari siswa SMA laki-laki yaitu : Pada tahap memahami masalah, dari apa yang diketahui representasi matematis yang dihasilkan siswa berupa kombinasi antara teks tertulis dan simbol. Sedangkan dari apa yang ditanyakan, representasi matematis yang dihasilkan siswa yaitu berupa simbol dan juga teks tertulis. Pada tahap menyusun rencana pemecahan masalah, representasi matematis yang dihasilkan siswa berupa persamaan matematik dan juga kata-kata secara lisan. Pada tahap melaksanakan rencana pemecahan masalah, langkah – langkah pemecahan masalah direpresentasikan oleh siswa kedalam bentuk persamaan matematik dan simbol aljabar. Siswa menginterpretasi hasil penyelesaian masalah dengan menggunakan representasi berupa teks tertulis. Pada tahap memeriksa kembali penyelesaian masalah siswa tidak memiliki representasi. Sedangkan representasi matematis dari siswa SMA perempuan yaitu : Pada tahap memahami masalah dari apa yang diketahui representasi matematis yang
Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena
2011-01-01
Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.
DEFF Research Database (Denmark)
Saeed, I.; Roepstorff, A.; Rasmussen, T.
2001-01-01
Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...
Comparison of the Etest and the routine multi-disc agar diffusion ...
African Journals Online (AJOL)
Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.
Hubungan Facebook Addiction Disorder (Fad) dengan Perilaku Asertif Remaja di SMA Kristen 1 Tomohon
Polii, Gloria Gratia; Bidjuni, Hendro; Wowiling, Ferdinand
2014-01-01
: Facebook addiction berarti menghabiskan jumlah waktu yang berlebihan di facebook. Facebook merupakan situs jejaring sosial yang mudah digunakan, dan yang paling penting adalah mempunyai efek mencandu. Secara psikologis, dampak negatif kecanduan facebook dapat dibagi atas: Pribadi yang anti sosial dan Dualisme kepribadian. Tujuan penelitian ini untuk mengetahui hubungan Facebook Addiction Disorder (FAD) dengan Perilaku Asertif Remaja di SMA Kristen 1 Tomohon. Desain penelitian ini dilaksanak...
Directory of Open Access Journals (Sweden)
Marilia Bonifácio Baranauskas
2008-04-01
por ultrasonido a través de modelo experimental de gelatina. MÉTODO: Fue desarrollado un modelo experimental con un recipiente lleno de gelatina y aceituna sumergida. Nueve residentes se distribuyeron aleatoriamente en tres grupos (G1, G2, G3 compuestos cada uno, por un R1, un R2 y un R3. Los tres grupos recibieron una explicación teórica. El G1 recibió dos horas de entrenamiento práctico, el G2 una hora y el G3 no fue entrenado. Acto seguido, se les solicitó a los participantes que pusiesen la aguja en el punto medio de la pared de la aceituna, cerca del transductor y reposicionar la aguja entre la aceituna y el fondo del recipiente, simulando la inyección perineural del anestésico. Se evaluaron la velocidad y la eficacia de las tareas, además de las fallas técnicas. RESULTADOS: El G1 presentó un promedio de tiempo para la realización de las tareas de 37,63 segundos, sin fallas técnicas; en el G2 se observó un promedio de 64,40 segundos, ocurriendo dos fallas técnicas y el G3 presentó un promedio de 93,83 segundos, con doce fallas técnicas. CONCLUSIONES: El estudio permite concluir que el mayor tiempo de entrenamiento en un modelo experimental de bloqueos periféricos guiados por ultrasonido mejoró la curva de aprendizaje en el simulacro de la técnica.BACKGROUND AND OBJECTIVES: The use of ultrasound imaging in peripheral nerve block has been increasing. However, there are few reports in the literature on the learning curve of the ultrasound technique. The objective of this report was to evaluate the learning curve of CET-SMA/HSL Anesthesiology residents of ultrasound-guided peripheral block using an experimental agar model. METHODS: An experimental model was developed by filling a bowl with agar and olives. Nine residents were randomly divided in three groups (G1, G2, and G3, each one with a R1, a R2, and a R3. All three groups received theoretical explanation. G1 also had two hours of practical training, G2 had one hour, and G3 had no training
Hersant, Barbara; SidAhmed-Mezi, Mounia; Chossat, Adrien; Meningaud, Jean Paul
2017-01-01
Due to the increasing demand for aesthetic procedures, especially facial aesthetic surgery, a new laser technology has been developed for facial skin rejuvenation and wrinkle treatment. The aim of this study was to objectively and subjectively assess the clinical efficacy and safety of Erbium:YAG laser combined with Spatially Modulated Ablation (Er:YAG + SMA) on facial skin rejuvenation. Patients with Fitzpatrick skin type's I-IV were prospectively included. Inclusion criteria consisted of having wrinkles and irregular skin texture. All patients underwent two Er:YAG + SMA sessions (1 month apart) to stimulate tissue regeneration. Er:YAG laser emits wavelength at 2,940 nm and when combined with SMA, a resonance effect is produced in the dermis to promote tissue regeneration. Facial skin elasticity and firmness were objectively assessed by Cutometer at baseline and month 6 (M6). Aesthetic improvement was qualitatively assessed using digital photographs. Patient satisfaction with regard to their facial appearance was self-assessed using the validated FACE-Q scale and the patient-perceived age VAS scale at baseline, M1, and M6. Side effects were investigated after each session. Thirty-four patients were included, 50% (18 patients) had Fitzpatrick skin type III and 41% (14 patients) were smokers. Skin elasticity indices were significantly improved: from 0.335 ± 0.015 at baseline to 0.387 ± 0.021 at M6 (P = 0.05*) for R5 (net elasticity). Skin firmness was assessed through R7 (biological elasticity) and R6 (viscoelastic ratio) at baseline and M6: a significant increase from 0.235 ± 0.01 to 0.2709 ± 0.009 (P technology offers an effective and safe treatment alternative for facial skin rejuvenation. It reduces the recovery time compared to conventional lasers such as carbon dioxide laser. Lasers Surg. Med. 49:78-83, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Suroso Mukti Leksono
2013-11-01
Full Text Available Abstrak: Tujuan penelitian ini adalah untuk mengetahui penguasaan konsep konservasi biodiversitas guru biologi dan cara mengajarkannya. Penelitian ini menggunakan metode deskriptif dengan menggunakan angket pada 31 guru SMA/MA di Kota/Kab Serang. Hasil penelitian menunjukkan bahwa 52% guru telah memahami konsep biodiversitas, namun hanya 3% yang memahami konsep konservasi. Model yang digunakan guru dalam mengajarkan konservasi biodiversitas, 58% menggunakan observasi, 45% diskusi, 23% ceramah dan 16% tanya jawab. Untuk tingkat kesukaran, 87% guru beranggapan mudah memahami materi konservasi biodiversitas dan 81% beranggapan mudah mengajarkannya dibandingkan dengan materi IPA lainnya. Guru-guru selama ini hanya 6% saja yang memperoleh pengetahuan tentang konservasi biodiversitas pada saat pelatihan. Oleh sebab itu diperlukan pelatihan-pelatihan melalui Continuing Professional Development (CPD. Kata Kunci: guru profesional, konservasi biodiversitas, continuing professional development (CPD BIOLOGY TEACHERS’ PROFESSIONAL ABILITY IN UNDERSTANDING AND DESIGNING INSTRUCTION ON BIODIVERSITY CONSERVATION IN SMA Abstract: The purpose of this study was to gain the knowledge about biology teachers’ concept mastery on biodiversity conservation as well as how to teach it. This study used descriptive methods with the questionnaires to 31 respondents of SMA/MA in Kota/KabSerang. The research result showed that 52% respondents had mastered the biodiversity concept. However, only 3% of respondents had fully mastered biodiversity conservation. In addition, for the teaching methods 58% respondents used observation, 45% respondents used discussion, 23% respondents used lecturing and 16% respondents used an interactive method. Moreover, for the difficulty level, 87% of respondents argued that it was easy to master the biodiversity conservation materials and 81% said that it was easier to teach the concept than other concepts. Only 6% of the teachers had gained
Radiation sterilization of triple sugar iron agar
International Nuclear Information System (INIS)
Altmann, G.; Eisenberg, E.; Bogokowsky, B.
1979-01-01
Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)
Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.
2016-01-01
An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water
Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar
Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.
2013-01-01
Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772
Syahputra, Edi; Surya, Edy
2017-01-01
This paper is a summary study of team Postgraduate on 11th grade. The objective of this study is to develop a learning model based on problem solving which can construct high-order thinking on the learning mathematics in SMA/MA. The subject of dissemination consists of Students of 11th grade in SMA/MA in 3 kabupaten/kota in North Sumatera, namely:…
An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.
Directory of Open Access Journals (Sweden)
Emma R Cold
Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.
SU-F-J-10: Sliding Mode Control of a SMA Actuated Active Flexible Needle for Medical Procedures
International Nuclear Information System (INIS)
Podder, T
2016-01-01
Purpose: In medical interventional procedures such as brachytherapy, ablative therapies and biopsy precise steering and accurate placement of needles are very important for anatomical obstacle avoidance and accurate targeting. This study presents the efficacy of a sliding mode controller for Shape Memory Alloy (SMA) actuated flexible needle for medical procedures. Methods: Second order system dynamics of the SMA actuated active flexible needle was used for deriving the sliding mode control equations. Both proportional-integral-derivative (PID) and adaptive PID sliding mode control (APIDSMC) algorithms were developed and implemented. The flexible needle was attached at the end of a 6 DOF robotic system. Through LabView programming environment, the control commands were generated using the PID and APIDSMC algorithms. Experiments with artificial tissue mimicking phantom were performed to evaluate the performance of the controller. The actual needle tip position was obtained using an electromagnetic (EM) tracking sensor (Aurora, NDI, waterloo, Canada) at a sampling period of 1ms. During experiment, external disturbances were created applying force and thermal shock to investigate the robustness of the controllers. Results: The root mean square error (RMSE) values for APIDSMC and PID controllers were 0.75 mm and 0.92 mm, respectively, for sinusoidal reference input. In the presence of external disturbances, the APIDSMC controller showed much smoother and less overshooting response compared to that of the PID controller. Conclusion: Performance of the APIDSMC was superior to the PID controller. The APIDSMC was proved to be more effective controller in compensating the SMA uncertainties and external disturbances with clinically acceptable thresholds.
SU-F-J-10: Sliding Mode Control of a SMA Actuated Active Flexible Needle for Medical Procedures
Energy Technology Data Exchange (ETDEWEB)
Podder, T [University Hospitals Case Medical Center, Cleveland, OH (United States)
2016-06-15
Purpose: In medical interventional procedures such as brachytherapy, ablative therapies and biopsy precise steering and accurate placement of needles are very important for anatomical obstacle avoidance and accurate targeting. This study presents the efficacy of a sliding mode controller for Shape Memory Alloy (SMA) actuated flexible needle for medical procedures. Methods: Second order system dynamics of the SMA actuated active flexible needle was used for deriving the sliding mode control equations. Both proportional-integral-derivative (PID) and adaptive PID sliding mode control (APIDSMC) algorithms were developed and implemented. The flexible needle was attached at the end of a 6 DOF robotic system. Through LabView programming environment, the control commands were generated using the PID and APIDSMC algorithms. Experiments with artificial tissue mimicking phantom were performed to evaluate the performance of the controller. The actual needle tip position was obtained using an electromagnetic (EM) tracking sensor (Aurora, NDI, waterloo, Canada) at a sampling period of 1ms. During experiment, external disturbances were created applying force and thermal shock to investigate the robustness of the controllers. Results: The root mean square error (RMSE) values for APIDSMC and PID controllers were 0.75 mm and 0.92 mm, respectively, for sinusoidal reference input. In the presence of external disturbances, the APIDSMC controller showed much smoother and less overshooting response compared to that of the PID controller. Conclusion: Performance of the APIDSMC was superior to the PID controller. The APIDSMC was proved to be more effective controller in compensating the SMA uncertainties and external disturbances with clinically acceptable thresholds.
Directory of Open Access Journals (Sweden)
Muhammad Syahrul Kahar
2017-06-01
Full Text Available This research aims to know the level of mathematical thinking ability of students by using scored model Graded Response Model (GRM. The subject here is the students of Class XI IPA 1 SMA Negeri 3 Sorong the 2016/2017 academic year, which amounted to 38 students with 22 students are male and 16 female students. This research is a descriptive research experiment. The results of this study indicate that the scored model GRM is effective in analyzing the ability of mathematical thinking of students. The effectiveness is shown an increase in student learning outcomes grade XI IPA 1 SMA Negeri 3 Kota Sorong, where the average grade results visible increase of 56.7 until 78, and the value of the completeness students improved significantly, and student learning outcomes were shown in graded contents relevance criteria students with score 4 there are 18 students (47.37%, while the relevance of the contents with a score of 1 there are 4 students (10.53%. From the criteria of completeness students who achieve complete answers by a score of 4, there are 1 students (2.64%, and the answers are far from finished with a score of 1 there were 7 students (19.52%. Then to organizing criteria, students are working on a very systematic, there are 8 students (21.05%, and organizing with not systematically there are 10 students (26.32%. Penelitian ini bertujuan untuk mengetahui tingkat kemampuan berpikir matematis siswa dengan menggunakan model penyekoran Graded Response Model (GRM. Subjek penelitian disini adalah siswa kelas XI IPA 1 SMA Negeri 3 Kota Sorong tahun ajaran 2016/2017, yang berjumlah 38 siswa dengan 22 siswa laki-laki dan 16 siswa perempuan. Penelitian ini adalah penelitian eksperimen yang bersifat Deskriptif. Hasil penelitian ini menunjukkan bahwa model penyekoran GRM ini efektif dalam menganalisis kemampuan berpikir matematis siswa. Keefektifan tersebut terlihat adanya peningkatan hasil belajar siswa kelas XI IPA 1 SMA Negeri 3 Kota Sorong, dimana
Directory of Open Access Journals (Sweden)
Raquel Lourdes Faria
2011-10-01
Full Text Available OBJECTIVE: The objective of this study was to compare the antimicrobial effect of mouthwashes containing Calendula officinalis L., Camellia sinensis (L. Kuntze and 0.12% chlorhexidine digluconate on the adherence of microorganisms to suture materials after extraction of unerupted third molars. MATERIAL AND METHODS: Eighteen patients with unerupted maxillary third molars indicated for extraction were selected (n=6 per mouthwash. First, the patients were subjected to extraction of the left tooth and instructed not to use any type of antiseptic solution at the site of surgery (control group. After 15 days, the right tooth was extracted and the patients were instructed to use the Calendula officinalis, Camellia sinensis or chlorhexidine mouthwash during 1 week (experimental group. For each surgery, the sutures were removed on postoperative day 7 and placed in sterile phosphate-buffered saline. Next, serial dilutions were prepared and seeded onto different culture media for the growth of the following microorganisms: blood agar for total microorganism growth; Mitis Salivarius bacitracin sucrose agar for mutans group streptococci; mannitol agar for Staphylococcus spp.; MacConkey agar for enterobacteria and Pseudomonas spp., and Sabouraud dextrose agar containing chloramphenicol for Candida spp. The plates were incubated during 24-48 h at 37ºC for microorganism count (CFU/mL. RESULTS: The three mouthwashes tested reduced the number of microorganisms adhered to the sutures compared to the control group. However, significant differences between the control and experimental groups were only observed for the mouthwash containing 0.12% chlorhexidine digluconate. CONCLUSIONS: Calendula officinalis L. and Camellia sinensis (L. Kuntze presented antimicrobial activity against the adherence of microorganisms to sutures but were not as efficient as chlorhexidine digluconate.
Iyer, Chitra C; McGovern, Vicki L; Murray, Jason D; Gombash, Sara E; Zaworski, Phillip G; Foust, Kevin D; Janssen, Paul M L; Burghes, Arthur H M
2015-11-01
Spinal Muscular Atrophy (SMA) is an autosomal recessive disorder characterized by loss of lower motor neurons. SMA is caused by deletion or mutation of the Survival Motor Neuron 1 (SMN1) gene and retention of the SMN2 gene. The loss of SMN1 results in reduced levels of the SMN protein. SMN levels appear to be particularly important in motor neurons; however SMN levels above that produced by two copies of SMN2 have been suggested to be important in muscle. Studying the spatial requirement of SMN is important in both understanding how SMN deficiency causes SMA and in the development of effective therapies. Using Myf5-Cre, a muscle-specific Cre driver, and the Cre-loxP recombination system, we deleted mouse Smn in the muscle of mice with SMN2 and SMNΔ7 transgenes in the background, thus providing low level of SMN in the muscle. As a reciprocal experiment, we restored normal levels of SMN in the muscle with low SMN levels in all other tissues. We observed that decreasing SMN in the muscle has no phenotypic effect. This was corroborated by muscle physiology studies with twitch force, tetanic and eccentric contraction all being normal. In addition, electrocardiogram and muscle fiber size distribution were also normal. Replacement of Smn in muscle did not rescue SMA mice. Thus the muscle does not appear to require high levels of SMN above what is produced by two copies of SMN2 (and SMNΔ7). © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Design, fabrication, and testing of a SMA hybrid composite jet engine chevron
Turner, Travis L.; Cabell, Randolph H.; Cano, Roberto J.; Fleming, Gary A.
2006-01-01
Control of jet noise continues to be an important research topic. Exhaust nozzle chevrons have been shown to reduce jet noise, but parametric effects are not well understood. Additionally, thrust loss due to chevrons at cruise suggests significant benefit from deployable chevrons. The focus of this study is development of an active chevron concept for the primary purpose of parametric studies for jet noise reduction in the laboratory and technology development to leverage for full scale systems. The active chevron concept employed in this work consists of a laminated composite structure with embedded shape memory alloy (SMA) actuators, termed a SMA hybrid composite (SMAHC). The actuators are embedded on one side of the middle surface such that thermal excitation generates a moment and deflects the structure. A brief description of the chevron design is given followed by details of the fabrication approach. Results from bench top tests are presented and correlated with numerical predictions from a model for such structures that was recently implemented in MSC.Nastran and ABAQUS. Excellent performance and agreement with predictions is demonstrated. Results from tests in a representative flow environment are also presented. Excellent performance is again achieved for both open- and closed-loop tests, the latter demonstrating control to a specified immersion into the flow. The actuation authority and immersion performance is shown to be relatively insensitive to nozzle pressure ratio (NPR). Very repeatable immersion control with modest power requirements is demonstrated.
Yersinia pseudotuberculosis septicemia in a beaver from Washington State.
Gaydos, Joseph K; Zabek, Erin; Raverty, Stephen
2009-10-01
An emaciated, free-ranging, sub-adult, male beaver (Castor canadensis) was found dead and was necropsied. Microscopically, the beaver had acute necrotizing hepatitis and splenitis with florid lobulated colonies of extracellular coccobacilli. Intravascular septic emboli were identified in lung, small intestine, and kidney, and discrete ulcers with scattered superficial extracellular accumulation of coccobacilli were noted on tail margins and plantar surfaces of the hind feet. Yersinia pseudotuberculosis was cultured on Columbia blood and MacConkey agar and identified by API 20E. Based on the pathology and acute mortality described in this case, as well as historical reports of Y. pseudotuberculosis related mortality in other beavers, this species could serve as a public health sentinel for localized occurrences of this bacterium.
Control of the pattern of perithecium development in Sordaria fimicola on agar medium.
Pollock, R T
1975-06-01
In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.
Directory of Open Access Journals (Sweden)
Jong Wan Hu
2014-02-01
Full Text Available In this paper, the superelastic shape memory alloy (SMA slit damper system as an alternative design approach for steel structures is intended to be evaluated with respect to inelastic behavior simulated by refined finite element (FE analyses. Although the steel slit dampers conventionally used for aseismic design are able to dissipate a considerable amount of energy generated by the plastic yielding of the base materials, large permanent deformation may occur in the entire structure. After strong seismic events, extra damage repair costs are required to restore the original configuration and to replace defective devices with new ones. Innovative slit dampers fabricated by superelastic SMAs that automatically recover their initial conditions only by the removal of stresses without heat treatment are introduced with a view toward mitigating the problem of permanent deformation. The cyclically tested FE models are calibrated to experimental results for the purpose of predicting accurate behavior. This study also focuses on the material constitutive model that is able to reproduce the inherent behavior of superelastic SMA materials by taking phase transformation between austenite and martensite into consideration. The responses of SMA slit dampers are compared to those of steel slit dampers. Axial stress and strain components are also investigated on the FE models under cyclic loading in an effort to validate the adequacy of FE modeling and then to compare between two slit damper systems. It can be shown that SMA slit dampers exhibit many structural advantages in terms of ultimate strength, moderate energy dissipation and recentering capability.
International Nuclear Information System (INIS)
Rossi, C.E.
1992-01-01
Problems with the helical springs were discovered during a series of dynamic tests that were conducted with a motor-operated wedge-gate valve from the decommissioned Shippingport Atomic Power Station (Shippingport). The valve was installed in a portion of the piping system that had been modified to simulate the stiffness of a typical US piping system. The valve was 30 years old and had its original Limitorque SMA-type motor operator. One of the main objectives of these tests was to determine the operating capability of the valve when subjected to simultaneous internal hydraulic and seismic loadings. This was typically accomplished by operating the valve to achieve maximum hydraulic loading during maximum seismic loading. During testing, an operability problem with the valve motor operator occurred. The design of the SMA-type motor operator is such that the torque switch helical spring is in its most compressed condition when the valve is closed. Thus, a normally closed valve is more likely to experience permanent deformation of the helical torque spring. A review of the Shippingport records indicated that both of these valves had been used as normally closed valves at Shippingport. Thus, normally closed, safety-related valves with Limitorque SMA-type motor operators may not accomplish their intended safety-related function because the original torque switch setting may result in lower output torque caused by the permanent deformation of their torque switch helical springs
Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.
Moskowitz, L B; Chester, B
1982-01-01
A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.
DEFF Research Database (Denmark)
Justesen, U S; Acar, Ziyap; Olsson, K
2013-01-01
This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....
Pose de la première pierre du bâtiment SMA18 du Cern
CERN Press Office. Geneva
1999-01-01
On 30 April 1999, Jean Pépin, Sénateur for the Department of the Ain and President of the Conseil Général, and Professor Luciano Maiani the Director-General of CERN will lay the foundation stone of Building SMA18, financed by the Department of the Ain in the framework of France's special contribution to CERN's Large Hadron Collider (LHC) project.
International Nuclear Information System (INIS)
Bodaghi, M.; Damanpack, A.R.; Aghdam, M.M.; Shakeri, M.
2013-01-01
In this paper, a simple and robust phenomenological model for shape memory alloys (SMAs) is proposed to simulate main features of SMAs under uniaxial as well as biaxial combined axial–torsional proportional/non-proportional loadings. The constitutive model for polycrystalline SMAs is developed within the framework of continuum thermodynamics of irreversible processes. The model nominates the volume fractions of self-accommodated and oriented martensite as scalar internal variables and the preferred direction of oriented martensitic variants as directional internal variable. An algorithm is introduced to develop explicit relationships for the thermo-mechanical behavior of SMAs under uniaxial and biaxial combined axial–torsional proportional/non-proportional loading conditions and also thermal loading. It is shown that the model is able to simulate main aspects of SMAs including self-accommodation, martensitic transformation, orientation and reorientation of martensite, shape memory effect, ferro-elasticity and pseudo-elasticity. A description of the time-discrete counterpart of the proposed SMA model is presented. Experimental results of uniaxial tension and biaxial combined tension–torsion non-proportional tests are simulated and a good qualitative correlation between numerical and experimental responses is achieved. Due to simplicity and accuracy, the model is expected to be used in the future studies dealing with the analysis of SMA devices in which two stress components including one normal and one shear stress are dominant
Qin, Qi-Long; Li, Yi; Sun, Mei-Ling; Rong, Jin-Cheng; Liu, Sheng-Bo; Chen, Xiu-Lan; Su, Hai-Nan; Zhou, Bai-Cheng; Xie, Bin-Bin; Zhang, Yu-Zhong; Zhang, Xi-Ying
2015-01-01
Many marine bacteria secrete exopolysaccharides (EPSs) that have important ecological and physiological functions. Numerous nutritional and environmental factors influence bacterial EPS production. However, the regulatory mechanisms of EPS production are poorly understood. The deep-sea Bacteroidetes bacterium Zunongwangia profunda SM-A87 can produce high quantities of EPS, and its EPS production is enhanced significantly by lactose. Here, we studied the reasons behind the significant advantage that lactose has over other carbon sources in EPS production in SM-A87. RNA-seq technologies were used to study lactose-regulated genes in SM-A87. The expression level of genes within the EPS gene cluster was up-regulated when lactose was added. Supplement of lactose also influenced the expression of genes located outside the EPS gene cluster that are also involved in EPS biosynthesis. The major glycosyl components of SM-A87 EPS are mannose, glucose and galactose. Genomic metabolic pathway analyses showed that the EPS precursor GDP-mannose can be synthesized from glucose, while the precursor UDP-glucose must be synthesized from galactose. Lactose can provide glucose and galactose simultaneously and prevent glucose inhibition. Lactose can also greatly stimulate the growth of SM-A87. Taken together, lactose acts not only as an inducer but also as a carbohydrate source for EPS production. This research broadens our knowledge of the regulation of EPS production in marine bacteria. PMID:25679965
Energy Technology Data Exchange (ETDEWEB)
Bazzi, Aurea de Souza
1999-07-01
Membrane composed by poly(N-vinyl-2-pyrrolidone) (PVP) and agar was formulated with and without poly(dimethylsiloxane-g-ethylene oxide) (SEO) irradiated with electron beam with doses between 10-50 kGy. The radiolytic behaviour of each component, PVP, agar and SEO, was studied when irradiated by gamma ray, in the absence and presence of air and water, by electron paramagnetic resonance (EPR) at 77 K. The chemical interaction of SEO with PVP/agar membrane was investigated by: infrared spectroscopy, energy dispersive X-ray fluorescence, dynamic-mechanical analysis, scanning electron microscopy, gel and swelling analysis. The cytotoxicity of the PVP/agar/SEO membrane was evaluated by cellular suppression. The membrane radicals from PVP ({phi}NC.) and from water (H., OH. and H{sub 2}O) was observed by EPR at 77K. The agar radicals formed by hydrogen abstraction of C{sub 1} and C{sub 3} of {beta}-D-galactose and/or C{sub 1} and C{sub 4} of {alpha}-L-galactose, reacted primarily with water radicals in despite of they also took part in the membrane by chemical bond. The radicals from SEO (.CH{sub 2}{approx}, .Si{approx}, .O{approx}) participated in the inter and intramolecular crosslinking as co-crosslinker by polymeric bridge. The co-crosslinked action depended on its concentration associated to PVP concentration. The presence op acrylates increases the tensile break of the PVP/agar/SEO membrane significantly. (author)
Directory of Open Access Journals (Sweden)
Fabíola Silveira-Gomes
2011-08-01
Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.
Directory of Open Access Journals (Sweden)
Umi Latifah
2015-08-01
Full Text Available Background:Adolescence isa periodof transition fromchildhood toadulthood.Adolescence tendtowantto learnnew thingssotheyappear towant to be doublebehavior, one of which is illicit sex. Based onpreliminary studiesconducted inSMAN1Sedayuobtained informationsome students donot understandthe impact of freesex.Theyalso lackknowledgeabout reproductive health. Objectives:Thepurposeof thisstudi todeterminetherelationshipbetween the level of knowledgeaboutadolescent reproductivehealthattitudes towardsex inSMA N 1SedayuBantul Yogyakarta.Methods : The method in this research is descriptive analytic with cross sectional approach.Sampleswere takenwithquotasampling technique in which168 students aged16-18years inSMAN1Sedayu.The research instrument was a questionnaireand the results wereanalyzedby Kendall Taucorrelation formula. Results : The level of knowledge about adolescent reproductive health inSMAN1SedayuBantulmostlywellas78students(46.4%.Attitudes towardsex inSMA 1SedayuBantul Yogyakarta Sedayumostlypositiveasmanyas133 students(79.2%. Theresultsof thecorrelation test of Kendall Tauobtained p-valueof 0,000<(0,05.Conclusion : There is a significant relationship between the level of knowledge about adolescentreproductivehealthattitudes toward sex inSMAN1SedayuBantul, Yogyakarta.
Directory of Open Access Journals (Sweden)
Purwatib
2018-01-01
Full Text Available The problem of cheating for learners is not something new in the world of school. When school programs begin to enter the stage of assessment, then there are also various behavior patterns of learners to prepare themselves to face a test or test. In fact, in schools such as SMA Negeri 11 Ambon there are some students of class X IPS do cheat behavior at the time of replication take place. The research was conducted in SMA Negeri 11 Ambon, the result of the research showed that there were differences of learners behavior, before and after the students got guidance and counseling service. Of the 40 respondents who originally cheated, after being given guidance almost all declared no and have abandoned the attitude of cheating.
Gamma radiation effect on agar viscosity for use in food industry
International Nuclear Information System (INIS)
Aliste, Antonio J.; Del Mastro, Nelida L.
1999-01-01
The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)
Directory of Open Access Journals (Sweden)
Isvandiari Fitri Utami
2016-01-01
Full Text Available Unsur kimia yang terdiri dari banyak unsur sering membuat siswa malas dengan mata pelajaran kimia khususnya dalam hal menghafal sistem periodik unsur kimia. Terkait dengan masalah ini, salah satu solusi yang ditawarkan adalah melalui media pembelajaran. Salah satu cara untuk membantu siswa melalui media pembelajaran dapat dilakukan dengan memanfaaatkan teknologi smartphone yang telah banyak dimiliki. Melihat banyaknya siswa yang telah menggunakan smartphone setiap harinya memungkinkan untuk memadukan kedua hal tersebut, sehingga siswa tidak hanya menggunakan smartphone sebagai sarana komunikasi, sosial media dan bermain game, tetapi dapat dialihkan menjadi sebuah inovasi positif dalam hal edukasi untuk menunjang sistem belajar yang interaktif. Tujuan dari penelitian ini adalah membuat aplikasi teka-teki unsur kimia sebagai media pembelajaran kimia interaktif bagi siswa SMA kelas X berbasis android. Salah satu manfaat dari penelitian ini adalah hasil penelitian dapat dijadikan rujukan bagi perkembangan dunia teknologi dan berguna juga untuk menjadi referensi bagi mahasiswa yang melakukan pengembangan produk teknologi khususnya mengenai media pembelajaran berbasis android. Dalam melakukan penelitian ini, aplikasi dibangun dengan menggunakan metode pengembangan multimedia development life cycle, data dan informasi mengenai unsur- unsur kimia dalam sistem periodik unsur diperoleh dari buku materi kimia SMA kelas X berdasarkan kurikulum 2006, beberapa jurnal, dan dari pengajar kimia untuk materi SMA kelas X secara langsung. Pada tahapan implementasi, program dibuat dengan drag and drop serta menggunakan bahasa pemrograman Javascript. Pengujian yang dilakukan pada aplikasi adalah dengan menggunakan metode whitebox. Berdasarkan hasil pengujian yang dilakukan pada aplikasi teka-teki unsur kimia sebagai media pembelajaran kimia interaktif berbasis aplikasi android, aplikasi sudah mampu berjalan cukup maksimal. Hasil pengujian mampu menampilkan
Effects of season on the yield and quality of agar from Gelidium ...
African Journals Online (AJOL)
The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...
Can serums be replaced by Mueller‑Hinton agar in germ tube test?
African Journals Online (AJOL)
2016-03-03
Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...
Directory of Open Access Journals (Sweden)
Wardani Rahayu
2014-03-01
Full Text Available This study aims to compare five question packages used in the 2011 National Examination, specifically for Maths for Social Studies subject between public senior high school (SMA and Islamic senior high school (MA in Jakarta. It employed simple random sampling as its data collection technique. The independent variables used were the category of high schools and the Five Question Packages used in the National Examination. The schools were divided into two: regular senior high school (SMA and Islamic senior high school or Madrasah Aliyah (MA. The packages chosen to be analyzed were package number: 12, 25, 39, 46 and 54. The data was analyzed by two-factor ANOVA for its 11 Differential Item Function (DIF and 29 non Differential Item Function (non-DIF items. The items used for this study are the items that fit the three-parameter logistic model. This study found that no difference between the scores on both the DIF and non-DIF items in either for SMA or Ma is found.
SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.
Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu
2017-12-18
Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first
Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface
Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan
2016-01-01
The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.
Xu, H.; Davey, A. B.; Crossland, W. A.; Chu, D. P.
2012-10-01
High brightness trans-reflective bi-stable displays based on smectic A (SmA) liquid crystals (LCs) can have nearly perfect transparency in the clear state and very high reflection in the scattered state. Because the LC material in use is stable under UV radiation, this kind of displays can stand for strong day-light and therefore be ideal for outdoor applications from e-books to public signage and advertisement. However, the colour application has been limited because the traditional colourants in use are conventional dyes which are lack of UV stability and that their colours are easily photo bleached. Here we present a colour SmA display demonstrator using pigments as colourant. Mixing pigments with SmA LCs and maintain the desirable optical switching performance is not straightforward. We show here how it can be done, including how to obtain fine sized pigment nano-particles, the effects of particle size and size distribution on the display performance. Our optimized pigments/SmA compositions can be driven by a low frequency waveform (~101Hz) to a scattered state to exhibit colour while by a high frequency waveform (~103Hz) to a cleared state showing no colour. Finally, we will present its excellent UV life-time (at least <7.2 years) in comparison with that of dye composition (~2.4 years). The complex interaction of pigment nano-particles with LC molecules and the resulting effects on the LC electro-optical performances are still to be fully understood. We hope this work will not only demonstrate a new and practical approach for outdoor reflective colour displays but also provide a new material system for fundamental liquid crystal colloid research work.
Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater
A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...
Sense of agency is related to gamma band coupling in an inferior parietal-preSMA circuitry
DEFF Research Database (Denmark)
Ritterband-Rosenbaum, Anina; Nielsen, Jens Bo; Christensen, Mark Schram
2014-01-01
with no SoA in the late task phase, but the test of the early task phase did not reveal any differences between presence and absence of SoA. We show that SoA is associated with a directionally specific between frequencies coupling from IPC to preSMA in the higher gamma (ɣ) band in the late task phase...
High-resolution SMA imaging of bright submillimetre sources from the SCUBA-2 Cosmology Legacy Survey
Hill, Ryley; Chapman, Scott C.; Scott, Douglas; Petitpas, Glen; Smail, Ian; Chapin, Edward L.; Gurwell, Mark A.; Perry, Ryan; Blain, Andrew W.; Bremer, Malcolm N.; Chen, Chian-Chou; Dunlop, James S.; Farrah, Duncan; Fazio, Giovanni G.; Geach, James E.; Howson, Paul; Ivison, R. J.; Lacaille, Kevin; Michałowski, Michał J.; Simpson, James M.; Swinbank, A. M.; van der Werf, Paul P.; Wilner, David J.
2018-06-01
We have used the Submillimeter Array (SMA) at 860 μm to observe the brightest sources in the Submillimeter Common User Bolometer Array-2 (SCUBA-2) Cosmology Legacy Survey (S2CLS). The goal of this survey is to exploit the large field of the S2CLS along with the resolution and sensitivity of the SMA to construct a large sample of these rare sources and to study their statistical properties. We have targeted 70 of the brightest single-dish SCUBA-2 850 μm sources down to S850 ≈ 8 mJy, achieving an average synthesized beam of 2.4 arcsec and an average rms of σ860 = 1.5 mJy beam-1 in our primary beam-corrected maps. We searched our SMA maps for 4σ peaks, corresponding to S860 ≳ 6 mJy sources, and detected 62, galaxies, including three pairs. We include in our study 35 archival observations, bringing our sample size to 105 bright single-dish submillimetre sources with interferometric follow-up. We compute the cumulative and differential number counts, finding them to overlap with previous single-dish survey number counts within the uncertainties, although our cumulative number count is systematically lower than the parent S2CLS cumulative number count by 14 ± 6 per cent between 11 and 15 mJy. We estimate the probability that a ≳10 mJy single-dish submillimetre source resolves into two or more galaxies with similar flux densities to be less than 15 per cent. Assuming the remaining 85 per cent of the targets are ultraluminous starburst galaxies between z = 2 and 3, we find a likely volume density of ≳400 M⊙ yr-1 sources to be {˜ } 3^{+0.7}_{-0.6} {× } 10^{-7} Mpc-3. We show that the descendants of these galaxies could be ≳4 × 1011 M⊙ local quiescent galaxies, and that about 10 per cent of their total stellar mass would have formed during these short bursts of star formation.
Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G
2010-01-01
In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.
Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R
2014-01-01
The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.
Directory of Open Access Journals (Sweden)
Ahmad Rosidi -
2017-02-01
Full Text Available Abstract: Vocabulary mastery is the activity to enrich the vocabulary, they master the vocabulary in order to be able to master four language skills. The problem formulation of this research are; (1 Is there any difference influence of using Scrabble and Bingo Game Technique toward Students’ Vocabulary Mastery at The Tenth Grade of SMA N 2 Metro Academic Year 2013/3014? (2 Which one is more effective between Scrabble and Bingo Game Technique toward Students’ Vocabulary Mastery at The Tenth Grade of SMA N 2 Metro Academic Year 2013/3014 ?, The object of this research are; (1 To know whether there is any difference Influence of using Scrabble and Bingo Game Technique toward Students’ Vocabulary Mastery at The Tenth Grade of SMA N 2 Metro Academic Year 2013/3014, (2 To know which one is more effective between Scrabble and Bingo Game Technique toward Students’ Vocabulary Mastery at The Tenth Grade of SMA N 2 Metro Academic Year 2013/3014. This research is Quantitative research. Research design that will be used in this research is true experimental design (pretest posttest control group design.. The population of this research is the students’ of SMA N 2 Metro Academic Year 2013/2014 that consist of 660 students. The sample is 60 students. As the sample, 30 as experimental class and 30 as control class. In taking sample, the researcher used the cluster stratified random sampling. The data collecting tehniques the researcher used try-out, pre-test, treatment and post-test. The data analyzing tehniques, the researcher used normality test, homogenity test and hypothesis test. The differences of both the tehnique are Scrabble Game can make the students feel enjoy, creative and have a challenge and Bingo Game gives the students opportunity to identify the word interestingly. Based on the data analysis, the researcher uses t-test formula. The researcher got the result of tobserved = 3,69 and ttable is 2.00. it means that tobserved > ttable
Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso
2011-09-01
The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 °C; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 °C. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Agus Yuliono
2013-04-01
Full Text Available Tujuan penelitian ini adalah untuk mendeskripsikan bentuk budaya sekolah berprestasi, proses penanaman nilai dan etos berprestasi kepada peserta didik dan mengetahui implikasi dari pengembangan budaya sekolah berprestasi di SMA Karangturi. Penelitian ini menggunakan pendekatan deskriptif kualitatif. Pengumpulan data menggunakan teknik observasi, wawancara dan dokumentasi. Hasil penelitian menunjukkan bahwa bentuk budaya sekolah berprestasi di SMA Karangturi mencakup empat poin yaitu: keseimbangan antara pembinaan akademik dan nonakademik, penanaman karakter melalui pelajaran, budaya mencintai almamater dan pentingnya nilai kerokhanian. Penanaman nilai dan etos berprestasi pada peserta didik dilakukan melalui kegiatan orientasi sekolah, proses pembelajaran, evaluasi belajar, ekstrakurikuler, penghargaan prestasi, kecintaan terhadap almamater, keteladanan guru, kerjasama dengan orangtua peserta didik dan seragam patriot sebagai media penanaman budaya berprestasi. Implikasi penanaman pengembangan budaya sekolah berprestasi di SMA Karangturi terdapat dalam input (penerimaan siswa baru dan pencarian siswa berpotensi, proses (pengembangan program sekolah serta pengembangan kerjasama dan output (prestasi akademik dan nonakademik serta jumlah alumni yang melanjutkan ke perguruan tinggi. The objective of this study is to describe a model of school achievement culture, the cultivation of values ​​and ethos of achievement to students and know the implications of the development of school culture on students’ achievement in Karangturi high school. This study used a qualitative descriptive approach. Techniques of collecting data were observation, interviews and documentation. This study uses sources and methods triangulation for data validation. The results show that the school achievement culture in Karangturi high school contains four pillars, namely: a balance between academic and non-academic achievement, building character
Yoo, S; Ghafoor, K; Kim, S; Sun, Y W; Kim, J U; Yang, K; Lee, D-U; Shahbaz, H M; Park, J
2015-09-01
The aim of this study was to study inactivation of different pathogenic bacteria on agar model surface using TiO2-UV photocatalysis (TUVP). A unified food surface model was simulated using Bacto(™) agar, a routinely used microbial medium. The foodborne pathogenic bacteria Escherichia coli K12 (as a surrogate for E. coli O157:H7), Salmonella Typhimurium, Staphylococcus aureus and Listeria monocytogenes were inoculated onto the agar surface, followed by investigation of TUVP-assisted inactivation and morphological changes in bacterial cells. The TUVP process showed higher bacterial inactivation, particularly for Gram-negative bacteria, than UVC alone and a control (dark reaction). A TUVP treatment of 17·2 mW cm(-2) (30% lower than the UVC light intensity) reduced the microbial load on the agar surface by 4·5-6·0 log CFU cm(-2). UVC treatment of 23·7 mW cm(-2) caused 3·0-5·3 log CFU cm(-2) reduction. The use of agar model surface is effective for investigation of bacterial disinfection and TUVP is a promising nonthermal technique. The results showing effects of photocatalysis and other treatments for inactivation of bacterial pathogens on model surface can be useful for applying such processes for disinfection of fruit, vegetables and other similar surfaces. © 2015 The Society for Applied Microbiology.
Colomer, J; Moya, M; Marco, V; De Paredes, C; Escrivá, F; Vila, R
1975-06-01
Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.
Directory of Open Access Journals (Sweden)
M. N. Brahmbhatt
2013-06-01
Full Text Available Aim: The study was undertaken to isolate pathogenic E. coli from milk and various milk products, detection of virulence gene using Polymerase chain reaction (PCR and investigate their antibiotic sensitivity pattern. Materials and Methods: Altogether 250 milk and various milk products samples consisting of raw milk (50, cheese (50, ice-cream (50, mawa (50 and dahi (50 were collected from milk vendors, retail shops located in Anand city, under aseptic precautions. For the enrichment of the organism from the collected samples, MacConkey broth was used and inoculation was carried out on MacConkey agar and EMB agar. Later on, to confirm the isolates, various biochemical tests such as IMViC test, Urease test were performed. Evaluation of antibiotic sensitivity pattern of E. coli was assessed by disk diffusion method. Finally the E. coli isolates were screened for the presence of virulence associated genes by PCR . Results: The prevalence of E. coli was observed 32 % in the samples comprising of milk (52.00%, cheese (28.00%, icecream (20.00%, mawa (44.00%, and dahi (16.00%. Antibiotic sensitivity was recorded high for Co-trimoxazole (100% followed by Gentamicin (96.73%, Trimithoprime (93.47% and Doxycycline hydochloride (92.39%. Least sensitivity was recorded for Ampicillin (8.69%. In this study, out of 80 E. coli isolates, 25 isolates (31.25% were positive for stx genes, of which 7 (8.75% isolates were positive for stx1 gene only, while 12 (15.00% isolates were positive for stx2 gene only and 5 (6.25% isolates were positive for both stx1 and stx2, 7 isolates (8.75% were positive for eaeA gene and all the isolate were negetive for rfb O157 gene. Conclusions: Current study supports the finding that raw milk and various milk products can be regarded as critical source of pathogenic E. coli This explains the need of strict monitoring and surveillance for effective measures of hygiene and sanitary practice during production of milk and various milk
DEFF Research Database (Denmark)
Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.
2014-01-01
In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...
Energy Technology Data Exchange (ETDEWEB)
Gonçalves, J.O.; Tannuri, A.C.A.; Coelho, M.C.M.; Bendit, I.; Tannuri, U. [Laboratório de Pesquisa em Cirurgia Pediátrica (LIM-30), Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil)
2014-08-15
We previously described a selective bile duct ligation model to elucidate the process of hepatic fibrogenesis in children with biliary atresia or intrahepatic biliary stenosis. Using this model, we identified changes in the expression of alpha smooth muscle actin (α-SMA) both in the obstructed parenchyma and in the hepatic parenchyma adjacent to the obstruction. However, the expression profiles of desmin and TGF-β1, molecules known to be involved in hepatic fibrogenesis, were unchanged when analyzed by semiquantitative polymerase chain reaction (RT-PCR). Thus, the molecular mechanisms involved in the modulation of liver fibrosis in this experimental model are not fully understood. This study aimed to evaluate the molecular changes in an experimental model of selective bile duct ligation and to compare the gene expression changes observed in RT-PCR and in real-time quantitative PCR (qRT‐PCR). Twenty-eight Wistar rats of both sexes and weaning age (21-23 days old) were used. The rats were separated into groups that were assessed 7 or 60 days after selective biliary duct ligation. The expression of desmin, α-SMA and TGF-β1 was examined in tissue from hepatic parenchyma with biliary obstruction (BO) and in hepatic parenchyma without biliary obstruction (WBO), using RT-PCR and qRT‐PCR. The results obtained in this study using these two methods were significantly different. The BO parenchyma had a more severe fibrogenic reaction, with increased α-SMA and TGF-β1 expression after 7 days. The WBO parenchyma presented a later, fibrotic response, with increased desmin expression 7 days after surgery and increased α-SMA 60 days after surgery. The qRT‐PCR technique was more sensitive to expression changes than the semiquantitative method.
International Nuclear Information System (INIS)
Gonçalves, J.O.; Tannuri, A.C.A.; Coelho, M.C.M.; Bendit, I.; Tannuri, U.
2014-01-01
We previously described a selective bile duct ligation model to elucidate the process of hepatic fibrogenesis in children with biliary atresia or intrahepatic biliary stenosis. Using this model, we identified changes in the expression of alpha smooth muscle actin (α-SMA) both in the obstructed parenchyma and in the hepatic parenchyma adjacent to the obstruction. However, the expression profiles of desmin and TGF-β1, molecules known to be involved in hepatic fibrogenesis, were unchanged when analyzed by semiquantitative polymerase chain reaction (RT-PCR). Thus, the molecular mechanisms involved in the modulation of liver fibrosis in this experimental model are not fully understood. This study aimed to evaluate the molecular changes in an experimental model of selective bile duct ligation and to compare the gene expression changes observed in RT-PCR and in real-time quantitative PCR (qRT‐PCR). Twenty-eight Wistar rats of both sexes and weaning age (21-23 days old) were used. The rats were separated into groups that were assessed 7 or 60 days after selective biliary duct ligation. The expression of desmin, α-SMA and TGF-β1 was examined in tissue from hepatic parenchyma with biliary obstruction (BO) and in hepatic parenchyma without biliary obstruction (WBO), using RT-PCR and qRT‐PCR. The results obtained in this study using these two methods were significantly different. The BO parenchyma had a more severe fibrogenic reaction, with increased α-SMA and TGF-β1 expression after 7 days. The WBO parenchyma presented a later, fibrotic response, with increased desmin expression 7 days after surgery and increased α-SMA 60 days after surgery. The qRT‐PCR technique was more sensitive to expression changes than the semiquantitative method
Dulaimi, Samar Abdulkareem Khalifa Al; Ibrahim, Nazlina
2018-04-01
This study is aimed at determining the presence of Escherichia coli and characterizing the availability of Shiga toxin gene in beef meat samples imported from South Africa. Meat samples (n=47) were randomly collected from meat sections at different supermarkets in the United Arab Emirates (UAE) from the beginning of August 2016 till the end of March 2017. Samples were diluted and inoculated on MacConkey agar and Eosin methylene blue agar (EMB), and the colony forming units (CFU) were recorded. API 20E identification kit was used for biochemical identification of E. coli. Detection of the 16S rRNA and shiga toxin genes by PCR amplification was done. Our results revealed that 14 (29.7%) out of the total 47 samples were positive for E. coli. The bacterial burden of E. coli as determined by colony growth showed variable level of contamination. From the PCR amplification, the shiga toxin gene carried by the E. coli is the Stx2 gene. This study revealed moderately high contamination levels of E. coli in beef samples imported from South Africa and marketed in UAE which mostly carries the shiga toxin gene Stx2.
Directory of Open Access Journals (Sweden)
Irkham Kharisma
2015-06-01
Full Text Available The purpose of this study to determine, describe, and analyze the role of teachers in addressing student misbehavior penjasorkes Public High School students in Kendal. This study used qualitative methods, the location of the research conducted in SMA se-Kendal. Research subjects in this study were penjasorkes teacher, principal, BK teachers and students. Data collected by using observation, interviews and documentation. The validity of using triangulation source. Data analysis using descriptive analysis model according to Miles and Huberman. Based on the results of research conducted and has been linked with the theory Suparwoto, et al. It can be concluded that the role of teachers penjasorkes (1 in terms of preventive prevent student misbehavior is good. (2 is good in terms of repression. (3 in terms of curative and rehabilitation are good. The conclusions that can be drawn from this research is the teacher's role in addressing delinquency penjasorkes students in SMA se-Kendal has been running both in terms of preventive, repressive and curative or rehabilitation.
Kim, Yeon-Hee; Lee, Si Young
2015-02-01
Mitis-salivarius (MS) agar has been used widely in microbial epidemiological studies because oral viridans streptococci can be selectively grown on this medium. Even though the previous findings reported the limited selecting power of MS agar for streptococcus strains, the identities of non-streptococcal strains from human oral samples which can grow on this medium are not clear yet. In this study, we identified non-streptococcal organisms grown on MS agar plates by polymerase chain reaction (PCR) amplification and sequencing of the 16S ribosomal RNA (rRNA) gene. Eighty bacterial colonies on MS plates were isolated from plaque samples, and bacterial identification was achieved with the rapid ID 32 Strep system and mini API reader. The bacterial colonies identified as non-streptococci by the API system were selected for further identification. The 16S rRNA gene was amplified by PCR and verified using DNA sequencing analysis for identification. Sequences were compared with those of reference organisms in the genome database of the National Center for Biotechnology Information using the Basic Local Alignment Search Tool (BLAST). Among the 11 isolated non-streptococcal strains on MS plates, 3 strains were identified as Actinomyces naeslundii, 7 strains were identified as Actinomyces oris and 1 strain were identified as Actinomyces sp. using Blastn. In this study, we showed that some oral Actinomyces species can grow on Streptococcus-selective MS agar plates. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
M.V. Sánchez
2016-03-01
Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.
Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard
2010-03-01
In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.
Tsai, Li-Kai; Chen, Yi-Chun; Cheng, Wei-Cheng; Ting, Chen-Hung; Dodge, James C; Hwu, Wuh-Liang; Cheng, Seng H; Passini, Marco A
2012-01-01
The efficacy of administering a recombinant adeno-associated virus (AAV) vector encoding human IGF-1 (AAV2/1-hIGF-1) into the deep cerebellar nucleus (DCN) of a type III SMA mouse model was evaluated. High levels of IGF-1 transcripts and protein were detected in the spinal cord at 2 months post-injection demonstrating that axonal connections between the cerebellum and spinal cord were able to act as conduits for the viral vector and protein to the spinal cord. Mice treated with AAV2/1-hIGF-1 and analyzed 8 months later showed changes in endogenous Bax and Bcl-xl levels in spinal cord motor neurons that were consistent with IGF-1-mediated anti-apoptotic effects on motor neurons. However, although AAV2/1-hIGF-1 treatment reduced the extent of motor neuron cell death, the majority of rescued motor neurons were non-functional, as they lacked axons that innervated the muscles. Furthermore, treated SMA mice exhibited abnormal muscle fibers, aberrant neuromuscular junction structure, and impaired performance on motor function tests. These data indicate that although CNS-directed expression of IGF-1 could reduce motor neuron cell death, this did not translate to improvements in motor function in an adult mouse model of type III SMA. Copyright © 2011 Elsevier Inc. All rights reserved.
Colonyzer: automated quantification of micro-organism growth characteristics on solid agar
Directory of Open Access Journals (Sweden)
Young Alexander
2010-05-01
Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by
DEFF Research Database (Denmark)
Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian
2002-01-01
Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...
Analisis Dampak Negatif Facebook pada Remaja Kelas X IPS SMA Kemala Bhayangkari Kubu Raya
Malindo, Hari
2017-01-01
The negative impact of the use of facebook is a result caused the use of facebook excessively that can give rise to abuse and diversion to brpengaruh directly to the consumer, and often waste time just to tamper with his facebook account, if not used wisely facebook will have a negative impact to pengggunanya it sendiri..Oleh because the researchers wanted to know more profound analysis of the negative impact on teenagers facebook IPS class X SMA Kemala Bhayangkari Kubu Raya.A common problem ...
Hubungan Merokok Dengan Kejadian Insomnia Pada Remaja Di SMA Negeri 1 Remboken Kabupaten Minahasa
Kairupan, Juwinda Meini Ayu; Rottie, Julia; Malara, Reginus
2016-01-01
: Insomnia is difficulty initiating and maintaining sleep so can not meet the need for adequate sleep , both quantity and quality. Smoking is one of the causes of insomnia. Smoking is an act of burning a tabacco which inhaled the smoke from the burning process in a form of cigarette or a pipe. The purpose of this study was to analyze the relationship of smoking with the incidence of insomnia in adolescents at SMA N 1 Remboken Minahasa District. The research method is used observational analy...
Directory of Open Access Journals (Sweden)
Ira Nofita Sari
2016-09-01
Full Text Available Penelitian ini bertujuan untuk mengetahui penerapan pembelajaran model kooperatif tipe think-pair-share dalam materi usaha dan energi ditinjau dari gender siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang. Adapun variabel dalam penelitian ini adalah hasil belajar siswa laki-laki dan hasil belajar siswa perempuan. Metode yang digunakan dalam peneltian ini adalah metode eksperimen dan bentuk penelitian eksperimen yang digunakan adalah Pre-Eksperimental Designs dengan rancangan penelitian The One-Shot Case Study.Sampel yang digunakan ialah kelas XI IPA 1 yang diambil secara purposive sampling.. Teknik pengumpul data yang digunakan dalam penelitian ini adalah teknik pengukuran dengan alat pengumpul data berupa tes yang berbentuk essay. Berdasarkan hasil analisis data penelitian diperoleh kesimpulan: (1 Rata-rata hasil belajar siswa laki-laki yang diajarkan model pembelajaran kooperatif tipe think-pair-share dalam materi usaha dan energi siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang mencapai KKM (72 dengan nilai signifikansi lebih besar dari taraf signifikansi 5% (0,715 > 0,05. (2 Rata-rata hasil belajar siswa perempuan yang diajarkan model pembelajaran kooperatif tipe think-pair-share dalam materi usaha dan energi siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang mencapai KKM (72 dengan nilai signifikansi lebih besar dari taraf signifikansi 5% (0,185 > 0,05. (3 Terdapat perbedaan antara rata-rata hasil belajar siswa laki-laki dengan rata-rata hasil belajar siswa perempuan yang diajarkan model pembelajaran kooperatif tipe Think-Pair-Share dalam materi usaha dan energi siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang dengan nilai signifikansi lebih besar dari taraf signifikansi 5% (0,101 > 0,05.
Directory of Open Access Journals (Sweden)
Franz-Josef Scharfenberg
2015-08-01
Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.
Hubungan Bermain Video Game Terhadap Kejadian Insomnia Pada Kalangan Remaja Di Sma Negeri 12 Medan
Pangaribuan, Hotman Parasian
2015-01-01
The number of adolescent who played video game was increased now days. This can cause many problems in social relationship, behavioral, and their sleep pattern like insomnia. This cross sectional study aimed to evaluate the relationship between playing video game with insomnia among the adolescent. Our total sample was 100 students in SMA Negeri 12 Medan. The sample was chosen by consequtive sampling. The data was taken by interview using questionnaire. From our result, the major...
Wiwin Kuswinardi, Marissa Renny Leon/
2014-01-01
Leon, Marissa Renny. 2014. Development of web based Management Information System of Student Complaints In SMA PGRI 6 Malang Using Waterfall Method. 109Thesis, information systems Study Program, Faculty of Information Technology, kanjuruhan Universitas of Malang. Supervisor: Wiwin Kuswinardi,Kom., M.KomDelivering complaint of students is still less effective Students write complaints on paper, but there are some constraints faced by the homeroom teacher, if the paper of ...
Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories
International Nuclear Information System (INIS)
Losse, G.; Mueller, F.; Fischer, S.
1989-01-01
It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)
Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories
Energy Technology Data Exchange (ETDEWEB)
Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E
1989-05-01
It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).
van Gaal, S.; Scholte, H.S.; Lamme, V.A.F.; Fahrenfort, J.J.; Ridderinkhof, K.R.
2011-01-01
The presupplementary motor area (pre-SMA) is considered key in contributing to voluntary action selection during response conflict. Here we test whether individual differences in the ability to select appropriate actions in the face of strong (conscious) and weak (virtually unconscious) distracting
Energy Technology Data Exchange (ETDEWEB)
Han, Yosep; Choi, Junhyun [Department of Mineral Resources and Energy Engineering, Chonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do 561–756 (Korea, Republic of); Tong, Meiping, E-mail: tongmeiping@iee.pku.edu.cn [The Key Laboratory of Water and Sediment Sciences, Ministry of Education, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Kim, Hyunjung, E-mail: kshjkim@jbnu.ac.kr [Department of Mineral Resources and Energy Engineering, Chonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do 561–756 (Korea, Republic of)
2014-04-01
Millimeter-sized spherical silica foams (SSFs) with hierarchical multi-modal pore structure featuring high specific surface area and ordered mesoporous frameworks were successfully prepared using aqueous agar addition, foaming and drop-in-oil processes. The pore-related properties of the prepared spherical silica (SSs) and SSFs were systematically characterized by field emission-scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), small-angle X-ray diffraction (SAXRD), Hg intrusion porosimetry, and N{sub 2} adsorption–desorption isotherm measurements. Improvements in the BET surface area and total pore volume were observed at 504 m{sup 2} g{sup −1} and 5.45 cm{sup 3} g{sup −1}, respectively, after an agar addition and foaming process. Despite the increase in the BET surface area, the mesopore wall thickness and the pore size of the mesopores generated from the block copolymer with agar addition were unchanged based on the SAXRD, TEM, and BJH methods. The SSFs prepared in the present study were confirmed to have improved BET surface area and micropore volume through the agar loading, and to exhibit interconnected 3-dimensional network macropore structure leading to the enhancement of total porosity and BET surface area via the foaming process. - Highlights: • Millimeter-sized spherical silica foams (SSFs) are successfully prepared. • SSFs exhibit high BET surface area and ordered hierarchical pore structure. • Agar addition improves BET surface area and micropore volume of SSFs. • Foaming process generates interconnected 3-D network macropore structure of SSFs.
DEFF Research Database (Denmark)
Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh
2018-01-01
. G., Penninkhof, B., Rudolph, B., & De Ruiter, G. A. (1999). A novel high-performance anion-exchange chromatographic method for the analysis of carrageenans and agars containing 3,6-anhydrogalactose. Analytical Biochemistry, 268, 213-222. Table 3 Overview of seaweed type (hydrocolloid source......), hydrocolloid extraction method (direct water-extraction or after alkali treatment), hydrocolloid and monomer1 yields, and sulfate levels [data given as means ± SD]. Different roman superscript letters indicate significant differences (P agar yields, monosaccharides...
Icu Pathogens: A Continuous Challenge
International Nuclear Information System (INIS)
Hafeez, A.; Munir, T.; Najeeb, S.; Rehman, S.; Gilani, M.
2016-01-01
Objective: To determine the frequency and antibiogram of pathogens in an intensive care unit (ICU). Study Design: Cross-sectional, observational study. Place and Duration of Study: Department of Microbiology, Army Medical College, National University of Science and Technology, Islamabad, from January 2013 to January 2014. Methodology: Clinical samples, received from patients admitted in ICU, were inoculated on various medias like blood agar, chocolate agar, MacConkey agar and urine samples on CLED. These were then incubated at 37 degree C for 24 hours. Isolates were identified by colony morphology, Gram reaction, catalase test, oxidase test. Species identification in case of Gram Negative Rods was done by using API 20E (BioMerieux). Antibiotic susceptibility was done by using modified KirbyBauer disc diffusion technique. Bacterial isolates were prepared and inoculated on Mueller-Hinton agar plates followed by application of various antibiotic disc (Oxoid, UK) as per manufacturer's instructions. The plates were then incubated at 37 degree C aerobically for 18 - 24 hours. Zone diameters were measured and interpreted as sensitive and resistant, according to Clinical and Laboratory Standards Institute (CLSI) guidelines. Results: Out of the 367 positive cultures, 116 (31.08 percent) were Acinetobacter baumanniisusceptible to minocycline and tigecycline followed by Klebsiella pneumoniae (n=71, 16 percent) susceptible to tigecycline and meropenem. Others were Pseudomonas aeruginosa, Escherichia coli Coagulase Negative Staphylococcus, Staphylococcus aureus, Enterococcus spp., Streptococcus spp., Klebsiella oxytoca, Stenotrophomonas maltophilia, and Candida spp. Conclusion: Acinetobacter baumannii was the most frequently isolated pathogen. Most of the cultures yielding pathogens were from respiratory tract samples. Gram negative isolates were multidrug resistant but most were tigecycline and susceptible to meropenem. (author)
PENGARUH PROJECT BASED LEARNING TERHADAP KETERAMPILAN PROSES SAINS SISWA KELAS X SMA NEGERI SIDOARJO
Directory of Open Access Journals (Sweden)
Nuril Maghfiroh
2016-08-01
Tujuan penelitian ini adalah untuk mengetahui pengaruh pembelajaran Project Based Learning terhadap keterampilan proses sains siswa kelas X SMA Negeri 4 Sidoarjo. Penelitian ini menggunakan metode Quasi Eksperimen dengan rancangan pretest postest non-equivalent control group design. Penentuan sampel mempertimbangkan kemampuan kognitif yang setara antara dua kelas yang menjadi kelompok kontrol dan kelompok eksperimen. Keterampilan proses sains diukur melalui tes tulis yang kemudian dianalisis dengan rubrik penilaian yang sudah disesuaikan untuk setiap aspek keterampilan proses sains. Hasil penelitian menunjukkan bahwa ada pengaruh pembelajaran Project Based Learning terhadap keterampilan proses sains siswa.
Jin, Hu; Dong, Erbao; Xu, Min; Liu, Chunshan; Alici, Gursel; Jie, Yang
2016-08-01
This paper introduces the design and fabrication of a multi-layered smart modular structure (SMS) that has been inspired by the muscular organs and modularity in soft animals. The SMS is capable of planar reciprocal motion of bending in heating process and recovering in cooling process when SMA wires carry out phase transformation. An adaptive regulation heating strategy is applied to avoid overheating and achieve bending range control of the SMS based on the resistance feedback of the SMA wires which as actuator of the SMS. The SMS can modular assemble soft robots with multiple morphologies such as lateral robots, bilateral robots and actinomorphic robots. A five-armed actinomorphic soft robot is conducted to crawling in terrestrial ground (max speed: 140 mm s-1, 0.7 body s-1), swimming in underwater environment (max speed: 67 mm s-1, 2.5 height s-1) and griping fragile objects (max object weight: 0.91 kg, 15 times the weight of itself). Those demonstrate that the performance of the SMS is good enough to be modular units to establish soft robots which possess a high speed of response, good adaptability and a safe interaction with their environments.
Directory of Open Access Journals (Sweden)
Nur Efendi
2013-02-01
Full Text Available Mutu pembelajaran Biologi masih rendah. Rendahnya mutu pembelajaran ini disebabkan oleh faktor pembelajaran yang masih berpusat pada guru (teacher centered tanpa melibatkan siswa untuk berpatisipasi pada proses untuk mendapatkan informasi dari kegiatan pembelajaran tersebut. Pengajaran Resiprok (Reciprocal Teaching merupakan salah satu strategi pendekatan pembelajaran yang dapat diterapkan untuk meningkatkan ketuntasan belajar siswa pada mata pelajaran biologi SMA, sehingga mutu pembelajaran mengalami ketercapaian ketuntasan hasil belajar yang ditetapkan. Tahapan Pengajajaran Resiprok adalah: (1 membaca dan mencari ide pokok bacaan berdasarkan teks bacaan yang disediakan, (2 membuat pertanyaan, (3 menjawab pertanyaan, (4 merangkum informasi yang penting, (5 memprediksi, (6 mengidentifikasi hal-hal yang tidak jelas dari teks bacaan, (7 mengklarifikasi hal-hal yang tidak jelas tersebut.
International Nuclear Information System (INIS)
Tani, Yuji; Tanaka, Katsuhito; Yabutani, Tomoki; Mishima, Yuji; Sakuraba, Haruhiko; Ohshima, Toshihisa; Motonaka, Junko
2008-01-01
A novel biosensor for determination of D-amino acids (DAAs) in biological samples by using an electrode based on immobilization of a thermostable D-Proline dehydrogenase (D-Pro DH) within an agar gel membrane was developed. The electrode was simply prepared by spin-coating the agar solution with the D-Pro DH on a glassy carbon (GC) electrode. An electrocatalytic oxidation current of 2,6-dichloroindophenol (DCIP) was observed at -100 mV vs. Ag/AgCl with the addition of 5 and 20 mmol L -1 D-proline. The current response and its relative standard deviation were 0.15 μA and 7.6% (n = 3), respectively, when it was measured in a pH 8.0 phosphate buffer solution containing 10 mmol L -1 D-proline and 0.5 mmol L -1 DCIP at 50 deg. C. The current response of D-proline increased with increase of the temperature of the sample solution up to 70 deg. C. The electrocatalytic response at the D-Pro DH/agar immobilized electrode subsequently maintained for 80 days. Finally, the D-Pro DH/agar immobilized electrode was applied to determination of DAAs in a human urine sample. The determined value of DAAs in the human urine and its R.S.D. were 1.39 ± 0.12 mmol L -1 and 8.9% (n = 3), respectively
Directory of Open Access Journals (Sweden)
Kathryn J Swoboda
2010-08-01
Full Text Available Valproic acid (VPA has demonstrated potential as a therapeutic candidate for spinal muscular atrophy (SMA in vitro and in vivo.Two cohorts of subjects were enrolled in the SMA CARNIVAL TRIAL, a non-ambulatory group of "sitters" (cohort 1 and an ambulatory group of "walkers" (cohort 2. Here, we present results for cohort 1: a multicenter phase II randomized double-blind intention-to-treat protocol in non-ambulatory SMA subjects 2-8 years of age. Sixty-one subjects were randomized 1:1 to placebo or treatment for the first six months; all received active treatment the subsequent six months. The primary outcome was change in the modified Hammersmith Functional Motor Scale (MHFMS score following six months of treatment. Secondary outcomes included safety and adverse event data, and change in MHFMS score for twelve versus six months of active treatment, body composition, quantitative SMN mRNA levels, maximum ulnar CMAP amplitudes, myometry and PFT measures.At 6 months, there was no difference in change from the baseline MHFMS score between treatment and placebo groups (difference = 0.643, 95% CI = -1.22-2.51. Adverse events occurred in >80% of subjects and were more common in the treatment group. Excessive weight gain was the most frequent drug-related adverse event, and increased fat mass was negatively related to change in MHFMS values (p = 0.0409. Post-hoc analysis found that children ages two to three years that received 12 months treatment, when adjusted for baseline weight, had significantly improved MHFMS scores (p = 0.03 compared to those who received placebo the first six months. A linear regression analysis limited to the influence of age demonstrates young age as a significant factor in improved MHFMS scores (p = 0.007.This study demonstrated no benefit from six months treatment with VPA and L-carnitine in a young non-ambulatory cohort of subjects with SMA. Weight gain, age and treatment duration were significant confounding variables that
Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿
Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael
2010-01-01
BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.
Hubungan Penggunaan Media Sosial Dengan Kemampuan Interaksi Sosial Remaja di SMA Negeri 1 Kota Medan
Nugraheni, Auliya Tunnisaa
2016-01-01
Social media today is considered as an important daily need. The intensity of using it by adolescents is influenced by their need for information, either academic or non-academic information. The inclination of using it as a communication facility can directly effects one of the social interactions aspect among individual. The objective of this research was to find out the correlation of using social media with the capacity of social interaction in adolescents at SMA Negeri 1, Medan, using co...
Jarnawi Afgani Dahlan; Yaya Sukjaya Kusumah; Mr Heri Sutarno
2011-01-01
The focus of this research is on the development of mathematics teaching and learning activity which is based on the application of computer software. The aim of research is as follows : 1) to identify some mathematics topics which feasible to be presented by computer-based e-learning, 2) design, develop, and implement computer-based e-learning on mathematics, and 3) analyze the impact of computer-based e-learning in the enhancement of SMA students’ high order mathematical thinking. All activ...
Shariati, Laleh; Validi, Majid; Tabatabaiefar, Mohammad Amin; Karimi, Ali; Nafisi, Mohammad Reza
2010-12-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a nosocomial pathogen. Our main objective was to compare oxacillin disk test, oxacillin E-test, and oxacillin agar screen for detection of methicillin resistance in S. aureus, using real-time PCR for mecA as the "gold standard" comparison assay. 196 S. aureus isolates were identified out of 284 Staphylococcus isolates. These isolates were screened for MRSA with several methods: disk diffusion, agar screen (6.0 μg/ml), oxacillin E-test, and real-time PCR for detection of mecA gene. Of the 196 S. aureus isolates tested, 96 isolates (49%) were mecA-positive and 100 isolates (51%) mecA-negative. All methods tested had a statistically significant agreement with real-time PCR. E-test was 100% sensitive and specific for mecA presence. The sensitivity and specificity of oxacillin agar screen method were 98 and 99%, respectively and sensitivity and specificity of oxacillin disk diffusion method were 95 and 93%, respectively. In the present study, oxacillin E-test is proposed as the best phenotypic method. For economic reasons, the oxacillin agar screen method (6.0 μg/ml), which is suitable for the detection of MRSA, is recommended due to its accuracy and low cost.
Aditya Wardana, Ata; Dewanti Widyaningsih, Tri
2017-12-01
Sausage spoilage has been identified as a cause of some food poisoning cases. Development of a bioindicator film is one of the alternative methods to detect sausage deterioration. The objectives of this paper were to develop a bioindicator edible films (BEF) from tapioca starch (TS), agar, and red cabbage juice (RC), and to evaluate its performance on sausage deterioration detection. The experiment had a 3x3 randomized factorial experimental design (agar: 3, 5, 7% by weight of TS; RC: 10, 15, 20% v/v based on 100% of suspension). Glycerol was used as the plasticizer. The results showed that the addition of agar into the film solution increased the thickness, elongation, and tensile strength, and decreased water vapour transmission rate (WVTR). While the addition of RC increased the thickness, but decreased elongation, tensile strength, and WVTR. BEF consisting of 2% tapioca starch, 7% (w/w) agar and 10 % (v/v) RC was chosen to apply on sausage. It could detect an increase in the microbial population and in the pH variations as result of sausage deterioration at 24, 48, and 72 h shown through color changes of BEF from bright purple at 0 h to light purple, dark purple-blue, and purple-green color respectively.
Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species
Marol Serhat; Yücesoy Mine
2003-01-01
Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...
Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma
DEFF Research Database (Denmark)
Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf
2009-01-01
A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...
Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM
Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen
2012-01-01
There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM
Rahbani, Janane
2012-12-26
There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.
Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen
2013-02-01
There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Koeri Ulinuha
2016-02-01
Full Text Available Tujuan penelitian ini adalah untuk mengetahui apakah buku teks ekonomi SMA kelas X yang digunakan di Kabupaten Semarang sudah memenuhi standar kelayakan isi buku teks ekonomi menurut BSNP. Dan manfaat penelitian ini dapat memilih dan mempertimbankan dalam memilih buku teks pelajaran untuk refrensi belajar baik pihak siswa, guru dan pihak sekolahPenelitian ini dilakuakan terhadap isi buku teks pelajaran yang dianalisis secara kualitatif. Sehingga penelitian ini disebut penelitian deskriptif kualitatif. Teknik penelitian yang di gunakan adalah adalah teknik triangulasi. Analisis buku teks ekonomi untuk SMA kelas X melibatkan 5 orang penilai, yaitu 5 guru ekonomi. Dari 5 SMAN yang mengunakan buku teks pelajaran ekonomi dengan pengarang Alam S. dan penerbit Esis. Teknik pengumpulan data dengan lembar penilaian buku teks ekonomi dari BSNP dan menggunakan teknik wawancara terhadap dua guru ekonomi untuk memperkuat hasil dari penilaian dari buku teks ekonomi kelas X.Data yang diperoleh dalam penelitian ini berupa hasil penilaian yang berupa skor penilian dan hasil wawancara. Berdasarkan hasil analisis dapat disimpulkan bahwa buku ekonomi SMA Kelas X karangan Alam S. yang digunakan di Kabupaten Semarang sudah memenuhi standar kelayakan isi menurut BSNP. Buku teks ekonomi untuk SMA Kelas X karangan Alam S. dapat digunakan sebagai sumber belajar dalam pembelajaran ekonomi di SMA kelas X. Selain itu, perlu diadakan penelitian lebih lanjut untuk menganalisis buku teks ekonomi lain yang digunakan di Kabupaten Semarang.. The purpose of this research was to know whether textbooks high school economics class X used in Semarang Regancy already meet the standards of eligibility of the contents of the textbook economics according to BSNP. Analysis of economic text books for high school classes X involves 5 persons appraisers, i.e. 5 economics teacher. From 5 SMAN using textbook economics lessons with author and Publisher Alam S. Esis.. Data collection techniques
Kondisi Stres Akademik Siswa SMA Negeri di Kota Padang
Directory of Open Access Journals (Sweden)
Taufik Taufik
2014-01-01
Full Text Available This research conduct base from increasing the National Examination standards from recent years, and overload student’s learning activity in Senior High School (SMA. These conditions as triggers stress students, from a long time, its influence on their learning. Based that, the research is to identify level of student academic stress, and differences base gender, and school location. This research use Cluster Random Sampling. Samples are grouped into 3 (three, that’s school is located in downtown, midtown and the Suburbs. Research findings show that there are 15% of student’s stress academic at low levels of, 71,8% experiencing stress academic at medium level, and 13.2% of students experiencing stress academic at high level. There was no significant difference between the academic stress Student SMAN in Padang by location and gender. These research findings can then be an important basic need for guidance and counseling services in order to decrease the level of stress of academic students in Padang city, so that they can learn by making every effort that is optimal.
Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick
2012-06-01
A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.
Enterobacterial colonization in captive red-eared sliders (Trachemys scripta elegans).
Gioia-Di Chiacchio, Rosely; Penido Júnior, Gilberto Nogueira; De Souza, Claudia Almeida Igayara; Prioste, Fabiola Eloisa Setim; Prado, Miriam Siqueira; Knöbl, Terezinha; Menão, Marcia Cristina; Matushima, Eliana Reiko
2014-12-01
The handling of turtles and other reptiles can be associated with risk of pathogenic enterobacteria transmission, mainly Salmonella spp. The aim of this study was to identify the enterobacteria in cloacal swabs of 39 red-eared sliders (Trachemys scripta elegans). Cloacal swabs from 39 captive individuals were analyzed. After sample enrichment in brain-heart infusion broth and 1% peptone water, bacterial isolation was performed through cultivation in blood, MacConkey and xylose lysine desoxycholate agar. Bacterial identification was achieved through conventional tests and automated turbidity analysis. The results indicated the growth of Kluyvera ascorbata (38/39), Leclercia adecarboxylata (37/39), Raoultella planticola (30/39), Citrobacter freundii (20/39), Proteus spp. (15/39), and Escherichia coli (5/39). Salmonella spp. were not detected. The intestinal enterobacteria identified inthis study differed from that reported in the literature for other reptiles.
HUBUNGAN KETERPAPARAN MEDIA MASSA, PERAN TEMAN SEBAYA TERHADAP TINDAKAN SEKSUAL DI SMA AN-NAAS
Directory of Open Access Journals (Sweden)
rika istawati
2017-06-01
Full Text Available Masa remaja merupakan masa peralihan antara tahap anak dan dewasa dimana pada masa ini mereka sangat rentan terpapar informasi dari media massa dan teman sebaya terutama seks bebas. Data SKRRI mempunyai teman yang pernah berhubungan seksual pada usia 14-19 tahun dengan persentasi perempuan 37,7% dan laki-laki 30,9% dan Kementerian Komunikasi dan Informasi menyebut 62,1% siswa mengaku penah melakukan hubungan seks. Observasi yang di lakukan oleh peneliti di SMA AN-NAAS Pekanbaru diketahui adanya 2 siswa yang tertangkap menyimpan dan menonton video porno di handphone dan melalui wawancara peneliti dengan 8 siswi mereka mengatakan adanya 1 siswi yang hamil diluar nikah dan 2 siswi diantaranya mengaku sering datang ketempat yang berisiko terhadap tindakan seksual. Tujuan Penelitian ini untuk mengetahui hubungan keterpaparan media massa dan peran teman sebaya terhadap tindakan seksual. Desain penelitian yang digunakan adalah cross sectional, populasi penelitian adalah seluruh siswa kelas SMA AN-NAAS Pekanbaru yaitu 123 responden. Sampel penelitian 94 orang dengan teknik stratified random sampling. Alat ukur yang digunakan adalah angket, data diolah menggunakan komputer. Analisa data secara univariat dan bivariat dengan uji chi square dengan ketentuan α (0,5. Hasil penelitian didapatkan uji statistik menunjukkan adanya hubungan keterpaparan media massa dengan tindakan seksual dimana nilai p value 0,000 < 0,05, terdapat hubungan yang bermakna antara peran teman sebaya dengan tindakan seksual, dimana p value 0,001 < 0,05. Bagi pihak sekolah diharapkan untuk meningkatkan kegiatan di sekolah seperti ekstrakurikuler dan guru membimbing serta memberi pengawasan yang ketat terhadap siswanya.
DEFF Research Database (Denmark)
Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf
2002-01-01
trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...
Wang, Xueyan; Duan, Delin; Xu, Jiachao; Gao, Xin; Fu, Xiaoting
2015-10-01
A bacterial strain capable of hydrolyzing sulfate ester bonds of p-nitrophenyl sulfate (pNPS) and agar was isolated from the coast area of Qingdao, China. It was identified as Marinomonas based on its 16S rRNA gene sequence and named as Marinomonas sp. FW-1. An arylsulfatase with a recovery of 13 % and a fold of 12 was purified to a homogeneity using ion exchange and gel filtration chromatographies. The enzyme was composed of a single polypeptide chain with the molecular mass of 33 kDa estimated using SDS-PAGE. The optimal pH and temperature of arylsulfatase were pH 9.0 and 45, respectively. Arylsulfatase was stable over pH 8-11 and at temperature below 55 °C. The K m and V max of this enzyme for the hydrolysis of pNPS were determined to be 13.73 and 270.27 μM/min, respectively. The desulfation ratio against agar from red seaweed Gelidium amansii and Gracilaria lemaneiformis were 86.11 and 89.61 %, respectively. There was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated G. amansii agar and that of the commercial agarose. Therefore, this novel alkaline arylsulfatase might have a great potential for application in enzymatic conversion of agar to agarose.
Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican
2017-12-01
Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.
Mashaan, Nuha Salim; Karim, Mohamed Rehan
2013-01-01
Today, rapid economic and industrial growth generates increasing amounts of waste materials such as waste tyre rubber. Attempts to inspire a green technology which is more environmentally friendly that can produce economic value are a major consideration in the utilization of waste materials. The aim of this study is to evaluate the effect of waste tyre rubber (crumb rubber modifier (CRM)), in stone mastic asphalt (SMA 20) performance. The virgin bitumen (80/100) penetration grade was used, modified with crumb rubber at four different modification levels, namely, 6%, 12%, 16%, and 20% by weight of the bitumen. The testing undertaken on the asphalt mix comprises the indirect tensile (dynamic stiffness), dynamic creep, and wheel tracking tests. By the experimentation, the appropriate amount of CRM was found to be 16% by weight of bitumen. The results show that the addition of CRM into the mixture has an obvious significant effect on the performance properties of SMA which could improve the mixture's resistance against permanent deformation. Further, higher correlation coefficient was obtained between the rut depth and permanent strain as compared to resilient modulus; thus dynamic creep test might be a more reliable test in evaluating the rut resistance of asphalt mixture.
Directory of Open Access Journals (Sweden)
Nuha Salim Mashaan
2013-01-01
Full Text Available Today, rapid economic and industrial growth generates increasing amounts of waste materials such as waste tyre rubber. Attempts to inspire a green technology which is more environmentally friendly that can produce economic value are a major consideration in the utilization of waste materials. The aim of this study is to evaluate the effect of waste tyre rubber (crumb rubber modifier (CRM, in stone mastic asphalt (SMA 20 performance. The virgin bitumen (80/100 penetration grade was used, modified with crumb rubber at four different modification levels, namely, 6%, 12%, 16%, and 20% by weight of the bitumen. The testing undertaken on the asphalt mix comprises the indirect tensile (dynamic stiffness, dynamic creep, and wheel tracking tests. By the experimentation, the appropriate amount of CRM was found to be 16% by weight of bitumen. The results show that the addition of CRM into the mixture has an obvious significant effect on the performance properties of SMA which could improve the mixture's resistance against permanent deformation. Further, higher correlation coefficient was obtained between the rut depth and permanent strain as compared to resilient modulus; thus dynamic creep test might be a more reliable test in evaluating the rut resistance of asphalt mixture.
Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan
2010-02-01
Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.
Usada, Elisa; Isnawati, Anggun Fitrian; Fatimah, Dewi
2010-01-01
SMA Yos Sudarso merupakan salah satu sekolah yang sudah memanfaatkan komputer untuk menyelesaikan berbagai macam tugas, tetapi pemanfaatannya masih belum maksimal karena ada bagian administrasi yang masih menggunakan metode manual, yaitu pada administrasi pembayaran. Penelitian ini berusaha membuat sebuah aplikasi client server berteknologi JAVA dan MySQL untuk mengelola data pembayaran sekolah meliputi pembayaran SPP, pembayaran uang gedung serta pembayaran ujian. Metode waterfal...
PEMBELAJARAN MENULIS TEKS PIDATO DAN BERPIDATO KELAS X DI SMA NEGERI 3 SUKOHARJO
Directory of Open Access Journals (Sweden)
Jaka Santosa
2016-02-01
Full Text Available This study has four aims, (1 the procedure of learning to write text to speech and speech in the classroom, (2 learning strategies and what the media writes text to speech and speech in the classroom, (3 student activity in learning to write text to speech and speech in the classroom, and (4 learning outcomes writing text to speech and speech. This includes descriptive qualitative research which took place in SMA Negeri 3 Sukoharjo. Data in the form of words and actions. Sources of data obtained from sources, events, and documents. Informant is Indonesian teachers and students. Events are learning activities Indonesian X1 class 2nd semester of academic year 2012/2013. The document in question is a document relating to the teaching of writing. Data collection techniques were interviews, observation, and documentary. Research findings in the field, among others, (1 the learning procedure by submitting a text to speech material on speech. Then compose the theme is developed into a framework and final drafting speeches, (2 application of learning strategies to write text to speech and speech with the approach that has been programmed patterns , the approach of process skills and communicative approach, (3 students activate in learning writing text to speech and speech have been carried out by providing learning facilities and trust management using effective learning infrastructure, (4 learning to write text to speech and speech by using the approach of process skills and communicative approaches undertaken by teachers Indonesian subjects in SMA Negeri 3 Sukoharjo obtain following result, students who earn good grades for writing text to speech 80 % and 88 % speech practice, then students who received grades enough to write the speech 20 % and 3 % speech practice, and students who obtain less value to the writing of the speech is not there, to practice speech while there were 9 % .
Mesoscale simulation of elastocaloric cooling in SMA films
International Nuclear Information System (INIS)
Wendler, Frank; Ossmer, Hinnerk; Chluba, Christoph; Quandt, Eckhard; Kohl, Manfred
2017-01-01
A model for the evolution of the mechanical and thermal properties of shape memory alloy (SMA) films during elastocaloric cycling is developed and compared with experiments. The focus is on Ti-Ni-Cu-Co films of 20 μm thickness showing ultra-low fatigue properties. The films undergo a highly localized pseudoelastic transformation under tensile load cycling featuring strain and temperature band patterns that depend on the loading conditions. The corresponding temperature change is of special interest for film-based elastocaloric cooling applications. Starting from a thermodynamics-based Gibbs free energy model comprising mechanical and chemical contributions, we include a martensite-austenite interface free energy term, for which formulations from a phase-field model are adapted. A 3D continuum mechanics description is modified to treat plane stress conditions appropriate for polycrystalline thin films. The nucleation mechanism of strain bands under dynamic loading is described by introducing a spatial random distribution of the transformation stress barriers reflecting the degree of material inhomogeneity. Heat transfer due to conduction and convection is taken into account. The simulations predict the correlated mechanical and thermal local response of the films including band formation and evolution, tilt angle as well as strain-rate dependence. Macroscopic stress-strain characteristics and thermal evolution curves well represent the experimental results.
DEFF Research Database (Denmark)
Overy, David Patrick; Zidorn, C.; Petersen, B.O.
2005-01-01
Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...
Energy Technology Data Exchange (ETDEWEB)
Mori, Nobuko; Takamori, Yasuhiko; Hori, Yasuharu [Radiation Center of Osaka Prefecture, Sakai (Japan)
1982-03-01
Colony-forming efficiency in soft agar of radiation-induced thymoma in NIH Swiss mice was determined in the presence of cultured medium of reticulo-epitherial cells from normal thymus of NIH Swiss mouse as conditioned medium. A similar experiment was done with thymomas spontaneously developed in AKR mice. Most of colonies developed in soft agar were not composed of thymic lymphoma cells, but of macrophage-like cells. The ratio of the number of colonies to that of the seeded cells significantly increased in thymomas comparing with that in normal thymus. This result corresponded with the increased number of macrophages in thymoma, as determined by counting phagocytic cells of adherent cells.
Survival of bioluminescent Listeria monocytogenes and Escherichia coli O157:H7 in soft cheeses.
Ramsaran, H; Chen, J; Brunke, B; Hill, A; Griffiths, M W
1998-07-01
Pasteurized and raw milks that had been inoculated at 10(4) cfu/ml with bioluminescent strains of Listeria monocytogenes and Escherichia coli O157:H7 were used in the manufacture of Camembert and Feta cheeses with or without nisin-producing starter culture. Survival of both organisms was determined during the manufacture and storage of Camembert and Feta cheeses at 2 +/- 1 degree C for 65 and 75 d, respectively. Bacterial bioluminescence was used as an indicator to enumerate the colonies plated on selective Listeria agar and on MacConkey agar. Escherichia coli O157:H7 survived the manufacturing process of both cheeses and was present at the end of the storage period in greater numbers than in the initial inoculum. At the end of 75 d of storage, E. coli O157:H7 was found in the brine of Feta cheese. The counts of L. monocytogenes increased as the pH of the Camembert cheese increased, and there were significant differences between the counts from samples taken from the inside and the counts from samples obtained near the surface of the cheese. The Feta cheese that contained nisin was the only cheese in which L. monocytogenes was at the level of the initial inoculum after 75 d of storage.
Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.
Directory of Open Access Journals (Sweden)
Lai Kuan Tan
Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.
Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp
Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin
2014-01-01
Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941
Directory of Open Access Journals (Sweden)
Rochmiatun Rochmiatun
2017-02-01
Full Text Available The research aim was to describe the improvement of grade X.3 SMA N 3 (State Senior High School student’s economic learning outcome through group discussion method. The respondents of this research were 32 Grade X.3 students of SMA N 3 Sukoharjo. The research was conducted in two cycles, every cycle had four steps. The steps were (1 planning, (2 acting, (3 observing, (4 reflecting. The results of this action research were divided in two cycles. In the first, cycle students average score was 70,31 higher than before. In the second cycle, students average score was 79,59. Based on those results, the implementation of group discussion method improved the learning outcome of grade X.3 students of SMA N 3 Sukoharjo in the economic subject. Keywords : Group Discussion Method, Learning Outcome, Economic
EVALUASI DAN STRATEGI PENGEMBANGAN SMA INDONESISCH NERDERLANDSCHE SCHOOL (INS KAYUTANAM
Directory of Open Access Journals (Sweden)
David David
2016-06-01
Full Text Available Penelitian ini bertujuan untuk: (1 mengevaluasi SMA INS Kayutanam dan (2 menyusuan strategi pengembangan SMA INS Kayutanam berdasarkan hasil evaluasi tersebut. Pendekatan yang digunakan dalam penelitian ini adalah kuantitatif dan kualitatif. Sumber data dalam penelitian ini adalah 50 siswa kelas X dan XI, satu kepala sekolah, empat wakil kepala sekolah, 30 guru, dua pembina asrama dan dua orang dari pemerintahan. Hasil penelitian dibagi dalam dua kelompok yaitu hasil evaluasi dan strategi pengembangan. Berdasarkan hasil evaluasi ditemukan bahwa ada beberapa komponen yang perlu perbaikan yaitu kurikulum, kompetensi pendidik dan tenaga kependidikan, fasilitas, peran serta masyarakat, dana dan organisasi. Strategi pengembangan terdiri dari: (1 perumusan kurikulum terintegrasi yang memuat tujuan dan sasaran pendidikan yang diprakarsai oleh Sjafei; (2 perumusan metode mengajar yang sesuai dengan tujuan dan sasaran pendidikan yang diprakasai Sjafei; (3 pengelolaan aset produktif dengan pemanfaatan modal sosial; (4 pemanfaatan basis alumni; (5 membangun kerja sama dengan instansi terkait seperti sekolah lain, pemerintah daerah, dan pihak swasta. Kata kunci: evaluasi, strategi pengembangan THE EVALUATION AND THE STRATEGY FOR DEVELOPING INDONESISCH NEDERLANDSCHE SCHOOL (INS KAYUTANAM SENIOR HIGH SCHOOL Abstract The study was to: (1 evaluate the development of INS Kayutanam Senior High School; and (2 design the strategy to develop INS Kayutanam Senior High School based on the results of the evaluation. The approach used of in the study was quantitative and qualitative. The data source in the study was 50 students from the X grade and the XI grade, one principal, four vice principals, 30 teachers, two dormitory advisors and two government representatives. The results of the study were divided into two groups namely the evaluation results and the development strategies. Based on the results of the study, the researcher found that there were several
Directory of Open Access Journals (Sweden)
Junwon Seo
2015-07-01
Full Text Available Although the steel slit dampers commonly utilized for aseismic design approach can dissipate considerable energy created by the yielding of base materials, large residual deformation may happen in the entire frame structure. After strong external excitation, repair costs will be incurred in restoring a structure to its original condition and to replace broken components. For this reason, alternative recentering devices characterized by smart structures, which mitigate the damage for such steel energy dissipation slit dampers, are developed in this study. These devices, feasibly functioning as seismic restrainers, can be improved by implementing superelastic shape memory alloy (SMA bending bars in a parallel motion with the steel energy-dissipating damper. The bending bars fabricated with superelastic SMAs provide self-centering forces upon unloading, and accordingly contribute to reducing permanent deformation in the integrated slit damper system. The steel slit dampers combined with the superelastic SMA bending bars are evaluated with respect to inelastic behavior as simulated by refined finite element (FE analyses. The FE slit damper models subjected to cyclic loads are calibrated to existing test results in an effort to predict behavior accurately. The responses of the proposed slit damper systems are compared to those of the conventionally used slit damper systems. From the analysis results, it is concluded that innovative steel slit dampers combined with superelastic SMA bending bars generate remarkable performance improvements in terms of post-yield strength, energy dissipation, and recentering capability.
Kurikulum Tersembunyi Lingkungan di dalam Materi Energi Terbarukan untuk Fisika SMA
Directory of Open Access Journals (Sweden)
Desnita Desnita
2015-12-01
Full Text Available Abstract Renewable energy resources education, in essence, is the treatment of various topics and issues related to enewable energy resources and technologies as an environmental hidden curriculum in physics education at Senior High School. Based on the statement, environmental Hidden Curriculum in teaching physics concept, especially renewable energy resource was developed. Used research and development method, with step: need assessment, development theoretic models, validation, trial, and revision. The development result is a curriculum with contain: concept of green energy renewal resource and waste cooking oil as a kind of the resources, producing process, and learning strategies to implementation the curriculum. Implementation as trial this curriculum was conducted at a senior high school in South of Jakarta. Didactic exploration improves the learning process, link or integration in physics concept, when worksheets were used in the physics lab and multimedia system. The worksheet content are picture, video, and text or article about green renewable energy resources. Used project based learning and cooperative learning, using the worksheet was improve not only cognitive aspect of the student, but also their skill and attitude to save environmental. Kata-kata Kunci: environmental hidden curricullum, green renewable energy resources, learning strategies. Abstrak Inti dari pendidikan tentang sumber energi terbarukan adalah ujicoba terhadap sejumlah topik dan isu yang terkait dengan sumber energi terbarukan ramah lingkungan dan teknologinya sebagai sebuah kurikulum tersembunyi dalam pendidikan fisika pada tingkat SMA. Berdasarkan alasan tersebut, telah dikembangkan kurikulum lingkungan yang tersembunyi di dalam mengajar konsep fisika, khususnya sumber energi ramah lingkungan. Hasil pengembangan adalah kurikulum yang berisi konsep sumber energi terbarukan ramah lingkungan dan minyak jelanta sebagai salah satu jenisnya, proses produksi, dan
Satterwhite, Thomas; Son, Ji; Carey, Joseph; Echo, Anthony; Spurling, Terry; Paro, John; Gurtner, Geoffrey; Chang, James; Lee, Gordon K
2014-05-01
We previously reported results of our on-line microsurgery training program, showing that residents who had access to our website significantly improved their cognitive and technical skills. In this study, we report an objective means for expert evaluators to reliably rate trainees' technical skills under the microscope, with the use of our novel global rating scale. "Microsurgery Essentials" (http://smartmicrosurgery.com) is our on-line training curriculum. Residents were randomly divided into 2 groups: 1 group reviewed this online resource and the other did not. Pre- and post-tests consisted of videotaped microsurgical sessions in which the trainee performed "microsurgery" on 3 different models: latex glove, penrose drain, and the dorsal vessel of a chicken foot. The SMaRT (Stanford Microsurgery and Resident Training) scale, consisting of 9 categories graded on a 5-point Likert scale, was used to assess the trainees. Results were analyzed with ANOVA and Student t test, with P less than 0.05 indicating statistical significance. Seventeen residents participated in the study. The SMaRT scale adequately differentiated the performance of more experienced senior residents (PGY-4 to PGY-6, total average score=3.43) from less experienced junior residents (PGY-1 to PGY-3, total average score=2.10, P0.05). Additionally, junior residents who had access to our website showed a significant increase in their graded technical performance by 0.7 points when compared to residents who did not have access to the website who showed an improvement of only 0.2 points (P=0.01). Our SMaRT scale is valid and reliable in assessing the microsurgical skills of residents and other trainees. Current trainees are more likely to use self-directed on-line education because of its easy accessibility and interactive format. Our global rating scale can help ensure residents are achieving appropriate technical milestones.
Directory of Open Access Journals (Sweden)
Regina Márcia Zuccolotto Felippe Paranhos
2007-02-01
Full Text Available In addition to an initial socket discomfort, ocular prosthesis (OP installation may allow the adherence of fungi and/or bacteria due to the superficial characteristics of the prosthesis' material, use of inadequate cleansing solutions and methods, or because the void located between the internal portion of the prosthesis and the anophthalmic cavity (AC mucosa. Objective: The aim of this study was to evaluate OP biofilm formation and the level of contamination of the internal portion of the OP and the AC in 24 patients. Material and Methods: Material was collected from the AC at the beginning of the study and 15 days after cleansing of the OP with 3 cleansing solutions: a neutral liquid soap, a multiuse solution for contact lens (Complete and 0.12% chlorhexidine (Periogard. The collected materials were sowed in Petri dishes containing selective media for aerobic and facultative microorganisms, specifically staphylococci (Hipersalt agar with egg yolk, aerobic microorganisms (Brain Heart Infusion Blood Agar, streptococci (Mitis salivarius Agar, gram-negative bacilli (MacConkey Agar and yeasts (Chromagar CandidaTM, incubated at 35ºC or 37ºC and the number of colony forming units were counted. Data were analyzed statistically by ANOVA, Friedman's test and Spearman's correlation. Results: Aerobic microorganisms, gram-negative bacilli and S. aureus were found in the OP biofilm and in the AC. There was statistically significant difference (p<0.05 between the number of microorganisms before and after the use of the cleansing solutions. Conclusion: There was positive correlation with respect to the microorganisms present in the OP biofilm and AC for the 4 proposed treatments, indicating that the decrease of OP contamination leads to AC contamination as well.
Directory of Open Access Journals (Sweden)
Jensen Lars
2008-09-01
Full Text Available Abstract Background Screening and enumeration of antimicrobial resistant Escherichia coli directly from samples is needed to identify emerging resistant clones and obtain quantitative data for risk assessment. Aim of this study was to evaluate the performance of 3M™ Petrifilm™ Select E. coli Count Plate (SEC plate supplemented with antimicrobials to discriminate antimicrobial-resistant and non-resistant E. coli. Method A range of E. coli isolates were tested by agar dilution method comparing the Minimal Inhibitory Concentration (MIC for eight antimicrobials obtained by Mueller-Hinton II agar, MacConkey agar and SEC plates. Kappa statistics was used to assess the levels of agreement when classifying strains as resistant, intermediate or susceptible. Results SEC plate showed that 74% of all strains agreed within ± 1 log2 dilution when comparing MICs with Mueller-Hinton II media. High agreement levels were found for gentamicin, ampicillin, chloramphenicol and cefotaxime, resulting in a kappa value of 0.9 and 100% agreement within ± 1 log2 dilution. Significant variances were observed for oxytetracycline and sulphamethoxazole. Further tests showed that the observed discrepancy in classification of susceptibility to oxytetracycline by the two media could be overcome when a plate-dependent breakpoint of 64 mg/L was used for SEC plates. For sulphamethoxazole, SEC plates provided unacceptably high MICs. Conclusion SEC plates showed good agreement with Mueller-Hinton II agar in MIC studies and can be used to screen and discriminate resistant E. coli for ampicillin, cephalothin, streptomycin, chloramphenicol, cefotaxime and gentamicin using CLSI standardized breakpoints, but not for sulphamethoxazole. SEC plates can also be used to discriminate oxytetracycline-resistant E. coli if a plate-dependent breakpoint value of 64 mg/L is used.
Gambaran Perilaku Remaja Terhadap Penggunaan Earphone Pada Siswa SMA Negeri Kota Padang
Directory of Open Access Journals (Sweden)
Tiara Rahma Zain
2016-09-01
Full Text Available AbstrakEarphone adalah alat yang digunakan untukmendengarkan musik dari telepon genggam dan perangkat audio lainnya.Sebuah survey yang dilakukan oleh American Speech Languageand Hearing Association (2006 menemukan bahwa remaja lebih banyak menggunakan perangkat dengar pribadidengan volume keras dan dalam waktu yang lama. Penelitian ini bertujuan untuk mengetahui gambaran perilaku remaja terhadap pengunaan earphone pada siswa SMA Negeri Kota PadangPenelitian ini dilakukan dengan metode deskriptif pada siswa SMAN Negeri Kota Padang yang berjumlah 13.105 orang.Didapatkan sampel berjumlah 427 orang, pengambilan sampel dilakukan dengan teknik Cluster Sampling.Data diambil dengan menggunakan kuesioner.Analisis data menggunakan analisis univarat dengan menggunakan program SPSS (Statistical Product and Service Solution 21.00 for Windows. Hasil didapatkan proporsi pengguna earphone pada siswa SMA Negeri Kota Padangberjumlah 83,6%. Perilaku siswa dibagi menjadi 3 kategori yaitu pengetahuan, sikap dan tindakan. Hasilnya didapatkan siswa tersebut memiliki pengetahuan dan sikap yang baik terhadap penggunaan earphone dengan persentase 93,4% dan 80,9%. Tindakan siswa ketika menggunakan earphone cukup baik dengan persentasi 66,3%. Kesimpulan penelitian ini adalah sebagian besar siswa SMA Negeri Kota Padang menggunakan earphone.Siswa tersebut memiliki pengetahuan yang baik mengenai dampak penggunaan earphone dan cara pencegahannya. Siswa juga memiliki sikap yang baik terhadap penggunaan earphone dan bertindak cukup baik ketika menggunakan earphone.Kata Kunci :Earphone, remaja, perilaku AbstractEarphone is a device that used for listening music from their mobile phone and other devices. A survey conducted by American Speech Languageand Hearing Association (2006 found that many teenagers use their personal audio device with maximum volume within a long time. This research aims to describe the teenager
Achieving dynamic switchable filter based on a transmutable metasurface using SMA
Chen, Xin; Gao, Jinsong; Kang, Bonan
2017-09-01
We propose a switchable filter composed of transmutable array using shape memory alloys (SMA). It could exhibit a temperature induced morphology change spontaneously like the biological excitability, acting as a shutter that allows the incident energy to be selectively transmitted or reflected with in excess of 12dB isolation at the certain frequencies for both polarizations. Equivalent circuit models describe the operational principle qualitatively and the switching effect is underpinned by the full-wave analysis. A further physical mechanism is shown by contrasting the distributions of electric field and surface current on the surface at the same frequency for the two working modes. The experimental results consist with the theoretical simulations, indicating that the metasurface could serve as one innovative solution for manipulating the electromagnetic waves and enlighten the next generation of advanced electromagnetic materials with more freedom in the processes of design and manufacturing.
Achieving dynamic switchable filter based on a transmutable metasurface using SMA
Directory of Open Access Journals (Sweden)
Xin Chen
2017-09-01
Full Text Available We propose a switchable filter composed of transmutable array using shape memory alloys (SMA. It could exhibit a temperature induced morphology change spontaneously like the biological excitability, acting as a shutter that allows the incident energy to be selectively transmitted or reflected with in excess of 12dB isolation at the certain frequencies for both polarizations. Equivalent circuit models describe the operational principle qualitatively and the switching effect is underpinned by the full-wave analysis. A further physical mechanism is shown by contrasting the distributions of electric field and surface current on the surface at the same frequency for the two working modes. The experimental results consist with the theoretical simulations, indicating that the metasurface could serve as one innovative solution for manipulating the electromagnetic waves and enlighten the next generation of advanced electromagnetic materials with more freedom in the processes of design and manufacturing.
Substances used as gelling agent alternative to the agar in culture media for in vitro propagation
Directory of Open Access Journals (Sweden)
Darío Alonso Martin Gordo
2012-10-01
Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.
Haakensen, M; Schubert, A; Ziola, B
2009-03-15
Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.