WorldWideScience

Sample records for macc1 specific shrna

  1. Statin and rottlerin small-molecule inhibitors restrict colon cancer progression and metastasis via MACC1.

    Science.gov (United States)

    Juneja, Manisha; Kobelt, Dennis; Walther, Wolfgang; Voss, Cynthia; Smith, Janice; Specker, Edgar; Neuenschwander, Martin; Gohlke, Björn-Oliver; Dahlmann, Mathias; Radetzki, Silke; Preissner, Robert; von Kries, Jens Peter; Schlag, Peter Michael; Stein, Ulrike

    2017-06-01

    MACC1 (Metastasis Associated in Colon Cancer 1) is a key driver and prognostic biomarker for cancer progression and metastasis in a large variety of solid tumor types, particularly colorectal cancer (CRC). However, no MACC1 inhibitors have been identified yet. Therefore, we aimed to target MACC1 expression using a luciferase reporter-based high-throughput screening with the ChemBioNet library of more than 30,000 compounds. The small molecules lovastatin and rottlerin emerged as the most potent MACC1 transcriptional inhibitors. They remarkably inhibited MACC1 promoter activity and expression, resulting in reduced cell motility. Lovastatin impaired the binding of the transcription factors c-Jun and Sp1 to the MACC1 promoter, thereby inhibiting MACC1 transcription. Most importantly, in CRC-xenografted mice, lovastatin and rottlerin restricted MACC1 expression and liver metastasis. This is-to the best of our knowledge-the first identification of inhibitors restricting cancer progression and metastasis via the novel target MACC1. This drug repositioning might be of therapeutic value for CRC patients.

  2. SNPs in the coding region of the metastasis-inducing gene MACC1 and clinical outcome in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Schmid Felicitas

    2012-07-01

    Full Text Available Abstract Background Colorectal cancer is one of the main cancers in the Western world. About 90% of the deaths arise from formation of distant metastasis. The expression of the newly identified gene metastasis associated in colon cancer 1 (MACC1 is a prognostic indicator for colon cancer metastasis. Here, we analyzed for the first time the impact of single nucleotide polymorphisms (SNPs in the coding region of MACC1 for clinical outcome of colorectal cancer patients. Additionally, we screened met proto-oncogene (Met, the transcriptional target gene of MACC1, for mutations. Methods We sequenced the coding exons of MACC1 in 154 colorectal tumors (stages I, II and III and the crucial exons of Met in 60 colorectal tumors (stages I, II and III. We analyzed the association of MACC1 polymorphisms with clinical data, including metachronous metastasis, UICC stages, tumor invasion, lymph node metastasis and patients’ survival (n = 154, stages I, II and III. Furthermore, we performed biological assays in order to evaluate the functional impact of MACC1 SNPs on the motility of colorectal cancer cells. Results We genotyped three MACC1 SNPs in the coding region. Thirteen % of the tumors had the genotype cg (rs4721888, L31V, 48% a ct genotype (rs975263, S515L and 84% a gc or cc genotype (rs3735615, R804T. We found no association of these SNPs with clinicopathological parameters or with patients’ survival, when analyzing the entire patients’ cohort. An increased risk for a shorter metastasis-free survival of patients with a ct genotype (rs975263 was observed in younger colon cancer patients with stage I or II (P = 0.041, n = 18. In cell culture, MACC1 SNPs did not affect MACC1-induced cell motility and proliferation. Conclusion In summary, the identification of coding MACC1 SNPs in primary colorectal tumors does not improve the prediction for metastasis formation or for patients’ survival compared to MACC1 expression analysis alone. The ct genotype (rs

  3. MACC1 facilitates chemoresistance and cancer stem cell‑like properties of colon cancer cells through the PI3K/AKT signaling pathway.

    Science.gov (United States)

    Wang, Jiankai; Wang, Wenjuan; Cai, Hongyi; Du, Binbin; Zhang, Lijuan; Ma, Wen; Hu, Yongguo; Feng, Shifang; Miao, Guoying

    2017-12-01

    With regards to colon cancer, resistance to 5‑fluorouracil (5‑FU)‑based chemotherapy and cancer stem cells (CSCs) are considered important factors underlying therapy failure. Metastasis‑associated colon cancer 1 (MACC1) has been associated with poor prognosis and the promotion of metastasis within several types of cancer. However, the biological behavior of MACC1 in chemoresistance and CSC‑like properties remains unclear. In the present study, various methods including gene knockdown, gene overexpression, western blotting, quantitative polymerase chain reaction and MTT assay, have been adopted. According to the results of the present study, MACC1 was depleted in two colon cancer cell lines resistant to 5‑FU; subsequently, CSC‑like properties and 5‑FU sensitivity were investigated. Within 5‑FU‑resistant cells, cell death was facilitated by MACC1 knockdown. Furthermore, sphere formation and the expression levels of pluripotent markers, including cluster of differentiation (CD) 44, CD133 and Nanog were reduced due to MACC1 depletion. Additionally, it was indicated that the phosphoinositide 3‑kinase/protein kinase B signaling pathway may be associated with 5‑FU resistance and CSC‑like properties via MACC1.

  4. MACC1 facilitates chemoresistance and cancer stem cell-like properties of colon cancer cells through the PI3K/AKT signaling pathway

    Science.gov (United States)

    Wang, Jiankai; Wang, Wenjuan; Cai, Hongyi; Du, Binbin; Zhang, Lijuan; Ma, Wen; Hu, Yongguo; Feng, Shifang; Miao, Guoying

    2017-01-01

    With regards to colon cancer, resistance to 5-fluorouracil (5-FU)-based chemotherapy and cancer stem cells (CSCs) are considered important factors underlying therapy failure. Metastasis-associated colon cancer 1 (MACC1) has been associated with poor prognosis and the promotion of metastasis within several types of cancer. However, the biological behavior of MACC1 in chemoresistance and CSC-like properties remains unclear. In the present study, various methods including gene knockdown, gene overexpression, western blotting, quantitative polymerase chain reaction and MTT assay, have been adopted. According to the results of the present study, MACC1 was depleted in two colon cancer cell lines resistant to 5-FU; subsequently, CSC-like properties and 5-FU sensitivity were investigated. Within 5-FU-resistant cells, cell death was facilitated by MACC1 knockdown. Furthermore, sphere formation and the expression levels of pluripotent markers, including cluster of differentiation (CD) 44, CD133 and Nanog were reduced due to MACC1 depletion. Additionally, it was indicated that the phosphoinositide 3-kinase/protein kinase B signaling pathway may be associated with 5-FU resistance and CSC-like properties via MACC1. PMID:28990068

  5. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  6. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Science.gov (United States)

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  7. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  8. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  9. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  10. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  11. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  12. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  13. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  14. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  15. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  16. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  17. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  18. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

  19. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  20. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  1. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  2. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  3. Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

    Science.gov (United States)

    Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

    2015-09-01

    Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

  4. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  5. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  6. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  7. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  8. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Science.gov (United States)

    Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

    2014-01-01

    Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  9. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Directory of Open Access Journals (Sweden)

    Ami Cohen

    Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  10. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  11. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  12. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  13. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  14. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  15. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  16. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  17. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  18. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  19. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  20. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  1. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  2. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  3. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  4. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  7. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  8. HBV-Specific shRNA is Capable of Reducing the Formation of Hepatitis B Virus Covalently Closed Circular DNA, but has No Effect on Established Covalently Closed Circular DNA in vitro

    OpenAIRE

    Starkey, Jason L.; Chiari, Estelle F.; Isom, Harriet C.

    2009-01-01

    Hepatitis B virus (HBV) covalently closed circular DNA (CCC DNA) is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV expressing HepG2 cells at 10 days post-transduction ge...

  9. Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

    Science.gov (United States)

    Wajih, Nadeem; Owen, John; Wallin, Reidar

    2008-01-01

    Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

  10. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  11. Adenovirally delivered shRNA strongly inhibits Na+-Ca2+ exchanger expression but does not prevent contraction of neonatal cardiomyocytes.

    Science.gov (United States)

    Hurtado, Cecilia; Ander, Bradley P; Maddaford, Thane G; Lukas, Anton; Hryshko, Larry V; Pierce, Grant N

    2005-04-01

    The cardiac Na(+)-Ca(2+) exchanger (NCX1) is the main mechanism for Ca(2+) efflux in the heart and is thought to serve an essential role in cardiac excitation-contraction (E-C) coupling. The demonstration that an NCX1 gene knock-out is embryonic lethal provides further support for this essential role. However, a recent report employing the Cre/loxP technique for cardiac specific knock-out of NCX1 has revealed that cardiac function is remarkably preserved in these mice, which survived to adulthood. This controversy highlights the necessity for further investigation of NCX1 function in the heart. In this study, we report on a novel approach for depletion of NCX1 in postnatal rat myocytes that utilizes RNA interference (RNAi), administered with high efficiency via adenoviral transfection. Depletion of NCX1 was confirmed by immunocytochemical detection, Western blots and radioisotopic assays of Na(+)-Ca(2+) exchange activity. Exchanger expression was inhibited by up to approximately 94%. Surprisingly, spontaneous beating of these cardiomyocytes was still maintained, although at a lower frequency. Electrical stimulation could elicit a normal beating rhythm, although NCX depleted cells exhibited a depressed Ca(2+) transient amplitude, a depressed rate of Ca(2+) rise and decline, elevated diastolic [Ca(2+)], and shorter action potentials. We also observed a compensatory increase in sarcolemmal Ca(2+) pump expression. Our data support an important, though non-essential, role for the NCX1 in E-C coupling in these neonatal heart cells. Furthermore, this approach provides a valuable means for assessing the role of NCX1 and could be utilized to examine other cardiac proteins in physiological and pathological studies.

  12. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  13. Neuron-specific RNA interference using lentiviral vectors

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

    2009-01-01

    BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...

  14. Ubiquitin-specific protease 14 regulates cell proliferation and apoptosis in oral squamous cell carcinoma.

    Science.gov (United States)

    Chen, Xiangyun; Wu, Jingjing; Chen, Yitian; Ye, Dongxia; Lei, Hu; Xu, Hanzhang; Yang, Li; Wu, Yingli; Gu, Wenli

    2016-10-01

    Ubiquitin-specific protease 14, a deubiquitinating enzyme, has been implicated in the tumorigenesis and progression of several cancers, but its role in oral squamous cell carcinoma remains to be elucidated. The aim of this study was to explore the expression pattern and roles of Ubiquitin-specific protease 14 in the occurrence and development of oral squamous cell carcinoma. Interestingly, Ubiquitin-specific protease 14 was overexpressed in oral cancer tissues and cell lines at both mRNA and protein levels. b-AP15, a specific inhibitor of Ubiquitin-specific protease 14, significantly inhibited the growth of cancer cells and increased cell apoptosis in a dose-dependent manner. Moreover, knockdown of Ubiquitin-specific protease 14 by shRNA significantly inhibited the proliferation and migration of cancer cells in vitro. Finally, using a xenograft mouse model of oral squamous cell carcinoma, knockdown of Ubiquitin-specific protease 14 markedly inhibited tumor growth and triggered the cancer cell apoptosis in vivo, supporting previous results. In conclusion, for the first time we have demonstrated the expression pattern of Ubiquitin-specific protease 14 in oral squamous cell carcinoma and verified a relationship with tumor growth and metastasis. These results may highlight new therapeutic strategies for tumor treatment, application of Ubiquitin-specific protease 14 selective inhibitor, such as b-AP15, or knockdown by shRNA. Collectively, Ubiquitin-specific protease 14 could be a potential therapeutic target for oral squamous cell carcinoma patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

    Science.gov (United States)

    Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

    2016-06-21

    To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

  16. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  17. Specifying Specification.

    Science.gov (United States)

    Paulo, Norbert

    2016-03-01

    This paper tackles the accusation that applied ethics is no serious academic enterprise because it lacks theoretical bracing. It does so in two steps. In the first step I introduce and discuss a highly acclaimed method to guarantee stability in ethical theories: Henry Richardson's specification. The discussion shows how seriously ethicists take the stability of the connection between the foundational parts of their theories and their further development as well as their "application" to particular problems or cases. A detailed scrutiny of specification leads to the second step, where I use insights from legal theory to inform the debate around stability from that point of view. This view reveals some of specification's limitations. I suggest that, once specification is sufficiently specified, it appears astonishingly similar to deduction as used in legal theory. Legal theory also provides valuable insight into the functional range of deduction and its relation to other forms of reasoning. This leads to a richer understanding of stability in normative theories and to a smart division of labor between deduction and other forms of reasoning. The comparison to legal theory thereby provides a framework for how different methods such as specification, deduction, balancing, and analogy relate to one another.

  18. Heritable and lineage-specific gene knockdown in zebrafish embryo.

    Directory of Open Access Journals (Sweden)

    Mei Dong

    Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.

  19. Probe specificity

    International Nuclear Information System (INIS)

    Laget, J.M.

    1986-11-01

    Specificity and complementarity of hadron and electron probes must be systematically developed to answer three questions currently asked in intermediate energy nuclear physics: what is nucleus structure at short distances, what is nature of short range correlations, what is three body force nature [fr

  20. HRT Specification

    CERN Document Server

    Möller, M

    1996-01-01

    In the context of the AIS Project (Advanced Informatics Systems for administration and management) a study has been conducted that resulted in the definition of a high level information systems model. Thirteen proposed systems were defined for detailed analysis. The Finance, Foundation, Human Resources, Logistics and Purchasing areas have been studied in detail. These studies have lead to the purchase and implementation of the ORIAC and SIRIAC packages, the Foundation database, the Oracle HR package, the Triton package and EDH and BHT. This specification describes the Human Resources Toolkit (HRT) intended to be used for accessing data in the HR and Foundation systems. This toolkit should help the divisions carry out their Human Resource management, planning and follow-up. It will have extensive report generation capabilities and offer a variety of standard graphs. It should have an easy-to-use graphical user interface and run on the CERN standard desktop platforms.

  1. Myositis specific autoantibodies; specificity and clinical applications.

    NARCIS (Netherlands)

    Hengstman, G.J.D.

    2005-01-01

    The sera of about half of the patients with myositis contain autoantibodies that are specific for this group of diseases compared to other inflammatory connective tissue disorders. In a recent study we showed that these myositis specific autoantibodies (MSAs) are also specific for myositis as

  2. How specific is specific self-efficacy?

    DEFF Research Database (Denmark)

    Nielsen, Tine; Makransky, Guido; Vang, Maria Louison

    2017-01-01

    academic learning self-efficacy (SAL-SE) and specific academic exam self-efficacy (SAE-SE), each scale being measurement invariant relative to age, Gender, admission method and specific course targeted. Furthermore, significant and relevant differences between the SAL-SE and SAE-SE scores dependent......Self-efficacy is an important and much used construct in psychology and social science studies. The validity of the measurements used is not always sufficiently evaluated. The aim was to evaluate the psychometric properties of the Danish translation of the self-efficacy subscale of The Motivated...... Strategies for Learning Questionnaire (MSLQ-SE) within a higher education context. Rasch measurement models were employed focusing on measurement invariance and dimensionality. Results with one students sample showed the MSLQ-SE to be not one, but two separate unidimensional subscales, measuring specific...

  3. Urine specific gravity test

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003587.htm Urine specific gravity test To use the sharing features on this page, please enable JavaScript. Urine specific gravity is a laboratory test that shows the concentration ...

  4. Real-time specifications

    DEFF Research Database (Denmark)

    David, A.; Larsen, K.G.; Legay, A.

    2015-01-01

    A specification theory combines notions of specifications and implementations with a satisfaction relation, a refinement relation, and a set of operators supporting stepwise design. We develop a specification framework for real-time systems using Timed I/O Automata as the specification formalism......, with the semantics expressed in terms of Timed I/O Transition Systems. We provide constructs for refinement, consistency checking, logical and structural composition, and quotient of specifications-all indispensable ingredients of a compositional design methodology. The theory is implemented in the new tool Ecdar...

  5. ELANE mutant-specific activation of different UPR pathways in congenital neutropenia.

    Science.gov (United States)

    Nustede, Rainer; Klimiankou, Maksim; Klimenkova, Olga; Kuznetsova, Inna; Zeidler, Cornelia; Welte, Karl; Skokowa, Julia

    2016-01-01

    A number of studies have demonstrated induction of the unfolded protein response (UPR) in patients with severe congenital neutropenia (CN) harbouring mutations of ELANE, encoding neutrophil elastase. Why UPR is not activated in patients with cyclic neutropenia (CyN) carrying the same ELANE mutations is unclear. We evaluated the effects of ELANE mutants on UPR induction in myeloid cells from CN and CyN patients, and analysed whether additional CN-specific defects contribute to the differences in UPR induction between CN and CyN patients harbouring identical ELANE mutations. We investigated CN-specific p.C71R and p.V174_C181del (NP_001963.1) and CN/CyN-shared p.S126L (NP_001963.1) ELANE mutants. We found that transduction of haematopoietic cells with p.C71R, but not with p.V174_C181del or p.S126L ELANE mutants induced expression of ATF6, and the ATF6 target genes PPP1R15A, DDIT3 and HSPA5. Recently, we found that levels of secretory leucocyte protease inhibitor (SLPI), a natural ELANE inhibitor, are diminished in myeloid cells from CN patients, but not CyN patients. Combined knockdown of SLPI by shRNA and transduction of ELANE p.S126L in myeloid cells led to elevated levels of ATF6, PPP1R15A and HSPA5 RNA, suggesting that normal levels of SLPI in CyN patients might protect them from the UPR induced by mutant ELANE. In summary, different ELANE mutants have different effects on UPR activation, and SLPI regulates the extent of ELANE-triggered UPR. © 2015 John Wiley & Sons Ltd.

  6. Experiences with effects specifications

    DEFF Research Database (Denmark)

    Simonsen, Jesper; Hertzum, Morten; Barlach, Anders

    2011-01-01

    We describe the effects-specification process from a project that was conducted during the fall 2010 and spring of 2011 in this chapter. The project configured and implemented an electronic patient record system at a maternity ward at a hospital located in a European region. The process comprised...... workshops with effects specification with management and end-users and an agile development process including prototypes configured from the effects specifications. We describe the project and the effects-specification process through which effects were related to the system design and instruments...... for measuring effects were designed. The project is analyzed and lessons learned are discussed....

  7. Review of technical specifications

    International Nuclear Information System (INIS)

    Bedrich, M.; Scholz, D.

    1980-01-01

    The present paper deals with position and function of technical specifications before and during the manufacturing of reactor components, their structure and reasons for specific regulations due to safety philosophy and explains the cooperation of supplier, manufacturer, utilities and supervisory organizations. (RW)

  8. Point specificity in acupuncture

    Directory of Open Access Journals (Sweden)

    Choi Emma M

    2012-02-01

    Full Text Available Abstract The existence of point specificity in acupuncture is controversial, because many acupuncture studies using this principle to select control points have found that sham acupoints have similar effects to those of verum acupoints. Furthermore, the results of pain-related studies based on visual analogue scales have not supported the concept of point specificity. In contrast, hemodynamic, functional magnetic resonance imaging and neurophysiological studies evaluating the responses to stimulation of multiple points on the body surface have shown that point-specific actions are present. This review article focuses on clinical and laboratory studies supporting the existence of point specificity in acupuncture and also addresses studies that do not support this concept. Further research is needed to elucidate the point-specific actions of acupuncture.

  9. FOXP3-specific immunity

    DEFF Research Database (Denmark)

    Andersen, Mads Hald

    2013-01-01

    Forkhead box P3 (FOXP3)-specific cytotoxic CD8(+) T cells are present among human peripheral blood mononuclear cells (PBMCs), especially in cancer patients. Such T lymphocytes are able not only to specifically recognize dendritic cells (DCs) that have been exposed to recombinant FOXP3 and regulat...... and regulatory T cells, but also to kill FOXP3(+) malignant T cells. The natural occurrence of FOXP3-specific cytotoxic T lymphocytes among human PBMCs suggests a general role for these cells in the complex network of immune regulation....

  10. Place-Specific Computing

    DEFF Research Database (Denmark)

    Messeter, Jörn; Johansson, Michael

    project place- specific computing is explored through design oriented research. This article reports six pilot studies where design students have designed concepts for place-specific computing in Berlin (Germany), Cape Town (South Africa), Rome (Italy) and Malmö (Sweden). Background and arguments...... for place-specific computing as a genre of interaction design are described. A total number of 36 design concepts designed for 16 designated zones in the four cities are presented. An analysis of the design concepts is presented indicating potentials, possibilities and problems as directions for future......An increased interest in the notion of place has evolved in interaction design. Proliferation of wireless infrastructure, developments in digital media, and a ‘spatial turn’ in computing provides the base for place-specific computing as a suggested new genre of interaction design. In the REcult...

  11. TWRSview system requirements specification

    International Nuclear Information System (INIS)

    Caldwell, J.A.; Lee, A.K.

    1995-12-01

    This document provides the system requirements specification for the TWRSview software system. The TWRSview software system is being developed to integrate electronic data supporting the development of the TWRS technical baseline

  12. specific low back pain

    African Journals Online (AJOL)

    2015-09-01

    Sep 1, 2015 ... SPECIFIC LOW BACK PAIN: IMPLICATION FOR DIRECT HEALTH. CARE COST ... abundant evidence suggesting the benefits of therapeu- tic exercise on pain and ... Exercise and behavioural therapies in chronic pain. 174.

  13. Site Specific Vendor's License

    Data.gov (United States)

    Montgomery County of Maryland — This dataset contains information of a site-specific vendor's license which is required if an individual sells or offers to sell goods or services from a stationary...

  14. Construction and material specification

    Science.gov (United States)

    2002-01-01

    These Construction and Material Specifications are written to the Bidder before award of the : Contract and to the Contractor after award of the Contract. The sentences that direct the Contractor to perform Work are written as commands. For example, ...

  15. Specific radiography technique

    International Nuclear Information System (INIS)

    Abdul Nassir Ibrahim; Azali Muhammad; Ab. Razak Hamzah; Abd. Aziz Mohamed; Mohamad Pauzi Ismail

    2008-01-01

    Beside radiography testing using x-ray machine and gamma source, there are several technique that developed specifically to complete the testing that cannot be done with the two earlier. This technique was specific based on several factor, for the example, the advantages of neutron and electron using to show the image was unique compare to x-ray and gamma. Besides that, these special radiography techniques maybe differ in how to detect the radiation get through the object. These technique can used to inspect thin or specimen that contained radioactive material. There are several technique will discussed in this chapter such as neutron radiography, electron radiography, fluoroscopy and also autoradiography.

  16. Comparative Test Case Specification

    DEFF Research Database (Denmark)

    Kalyanova, Olena; Heiselberg, Per

     This document includes a definition of the comparative test cases DSF200_3 and DSF200_4, which previously described in the comparative test case specification for the test cases DSF100_3 and DSF200_3 [Ref.1]....... This document includes a definition of the comparative test cases DSF200_3 and DSF200_4, which previously described in the comparative test case specification for the test cases DSF100_3 and DSF200_3 [Ref.1]....

  17. IDC System Specification Document.

    Energy Technology Data Exchange (ETDEWEB)

    Clifford, David J.

    2014-12-01

    This document contains the system specifications derived to satisfy the system requirements found in the IDC System Requirements Document for the IDC Reengineering Phase 2 project. Revisions Version Date Author/Team Revision Description Authorized by V1.0 12/2014 IDC Reengineering Project Team Initial delivery M. Harris

  18. Specification of Concurrent Objects

    DEFF Research Database (Denmark)

    Sørensen, Morten U.

    relation over two objects and an event. In the model, objects can be composed by parallel composition, encapsulation, and hiding of operations. Refinement between objects is defined as fair trace inclusion.A specification language is presented where objects can be specified operationally by abstract...

  19. Place-Specific Computing

    DEFF Research Database (Denmark)

    Messeter, Jörn

    2009-01-01

    An increased interest in the notion of place has evolved in interaction design based on the proliferation of wireless infrastructures, developments in digital media, and a ‘spatial turn’ in computing. In this article, place-specific computing is suggested as a genre of interaction design that add......An increased interest in the notion of place has evolved in interaction design based on the proliferation of wireless infrastructures, developments in digital media, and a ‘spatial turn’ in computing. In this article, place-specific computing is suggested as a genre of interaction design...... that addresses the shaping of interactions among people, place-specific resources and global socio-technical networks, mediated by digital technology, and influenced by the structuring conditions of place. The theoretical grounding for place-specific computing is located in the meeting between conceptions...... of place in human geography and recent research in interaction design focusing on embodied interaction. Central themes in this grounding revolve around place and its relation to embodiment and practice, as well as the social, cultural and material aspects conditioning the enactment of place. Selected...

  20. Sports-specific injuries.

    Science.gov (United States)

    Plancher, K D; Minnich, J M

    1996-04-01

    Injuries to the upper extremities can happen in any sport. Injury patterns are common to specific sports. Understanding which injuries occur with these sports allows the examiner to diagnose and treat the athlete easily. This article reviews some of the injuries common in sports such as bicycling, golf, gymnastics, martial arts, racquet sports, and weightlifting.

  1. Site-Specific Innovation

    DEFF Research Database (Denmark)

    Reeh, Henrik; Hemmersam, Peter

    2015-01-01

    Currently, cities across the Northern European region are actively redeveloping their former industrial harbours. Indeed, harbours areas are essential in the long-term transition from industrial to information and experience societies; harbours are becoming sites for new businesses and residences...... question is how innovation may contribute to urban life and site-specific qualities....

  2. Specification of Nonmonotonic Reasoning.

    NARCIS (Netherlands)

    Engelfriet, J.; Treur, J.

    2000-01-01

    Two levels of description of nonmonotonic reasoning are distinguished. For these levels semantical formalizations are given. The first Level is defined semantically by the notion of belief state frame, the second Level by the notion of reasoning frame. We introduce two specification languages to

  3. Specification of Nonmonotonic Reasoning

    NARCIS (Netherlands)

    Engelfriet, J.; Treur, J.

    1996-01-01

    Two levels of description of nonmonotonic reasoning are distinguished. For these levels semantical formalizations are given. The first level is defined semantically by the notion of belief state frame, the second level by the notion of reasoning frame. We introduce two specification languages to

  4. Domain-Specific Multimodeling

    DEFF Research Database (Denmark)

    Hessellund, Anders

    the overall level of abstraction. It does, however, also introduce a new problem of coordinating multiple different languages in a single system. We call this problem the coordination problem. In this thesis, we present the coordination method for domain-specific multimodeling that explicitly targets...

  5. Specific Language Impairment

    Science.gov (United States)

    ... Some of the tests use interactions between the child and puppets and other toys to focus on specific rules of grammar, especially ... is not treated early, it can affect a child’s performance in school. ... language development. This kind of classroom program might enlist normally ...

  6. Specifications in software prototyping

    OpenAIRE

    Luqi; Chang, Carl K.; Zhu, Hong

    1998-01-01

    We explore the use of software speci®cations for software prototyping. This paper describes a process model for software prototyping, and shows how specifications can be used to support such a process via a cellular mobile phone switch example.

  7. New usable technical specifications

    International Nuclear Information System (INIS)

    Webster, S.A.; Tomasi, L.T.; Bernier, R.A.

    1989-01-01

    After 2 yr of preparation, 1988 finally saw the nuclear industry writing operator-oriented technical specifications. This effort is a continuation of previous efforts to develop improved and usable standard technical specifications (STSs), and is being conducted by the four nuclear steam supply system vendor owners' groups under the auspices of the Nuclear Management Resources Council. Each participant is currently preparing a set of improved STSs based on a writer's guide that was developed through a combined industry effort. In May of 1987, a Human Factors Improvements to Technical Specifications (HFITS) task group was formed to prepare a writer's guide for improved, industrywide STSs. This task group was composed of two representatives from each owners' group, one with a human factors background and one with some operations background. Two documents were prepared in 6 months, a human factors report laying the groundwork for the considerations to go into technical specifications and a writer's guide for their preparation. This paper reports on the application of this writer's guide to the writing of improved STS

  8. Sport-specific balance.

    Science.gov (United States)

    Zemková, Erika

    2014-05-01

    This review includes the latest findings based on experimental studies addressing sport-specific balance, an area of research that has grown dramatically in recent years. The main objectives of this work were to investigate the postural sway response to different forms of exercise under laboratory and sport-specific conditions, to examine how this effect can vary with expertise, and to provide examples of the association of impaired balance with sport performance and/or increasing risk of injury. In doing so, sports where body balance is one of the limiting factors of performance were analyzed. While there are no significant differences in postural stability between athletes of different specializations and physically active individuals during standing in a standard upright position (e.g., bipedal stance), they have a better ability to maintain balance in specific conditions (e.g., while standing on a narrow area of support). Differences in magnitude of balance impairment after specific exercises (rebound jumps, repeated rotations, etc.) and mainly in speed of its readjustment to baseline are also observed. Besides some evidence on an association of greater postural sway with the increasing risk of injuries, there are many myths related to the negative influence of impaired balance on sport performance. Though this may be true for shooting or archery, findings have shown that in many other sports, highly skilled athletes are able to perform successfully in spite of increased postural sway. These findings may contribute to better understanding of the postural control system under various performance requirements. It may provide useful knowledge for designing training programs for specific sports.

  9. ENVIRONMENTAL SPECIFICATION REQUIREMENTS

    International Nuclear Information System (INIS)

    TIFFT, S.R.

    2003-01-01

    Through regulations, permitting or binding negotiations, Regulators establish requirements, limits, permit conditions and Notice of Construction (NOC) conditions with which the Office of River Protection (ORP) and the Tank Farm Contractor (TFC) must comply. Operating Specifications are technical limits which are set on a process to prevent injury to personnel, or damage to the facility or environment. The main purpose of this document is to provide specification limits and recovery actions for the TFC Environmental Surveillance Program at the Hanford Site. Specification limits are given for monitoring frequencies and permissible variation of readings from an established baseline or previous reading. The requirements in this document are driven by environmental considerations and data analysis issues, rather than facility design or personnel safety issues. This document is applicable to all single-shell tank (SST) and double-shell tank (DST) waste tanks, and the associated catch tanks and receiver tanks, and transfer systems. This Tank Farm Environmental Specifications Document (ESD) implements environmental-regulatory limits on the configuration and operation of the Hanford Tank Farms facility that have been established by Regulators. This ESD contains specific field operational limits and recovery actions for compliance with airborne effluent regulations and agreements, liquid effluents regulations and agreements, and environmental tank system requirements. The scope of this ESD is limited to conditions that have direct impact on Operations Projects or that Operations/Projects have direct impact upon. This document does not supercede or replace any DOE Orders, regulatory permits, notices of construction, or Regulatory agency agreements binding on the ORP or the TFC. Refer to the appropriate regulation, permit, or NOC for an inclusive listing of requirements

  10. Comparative Test Case Specification

    DEFF Research Database (Denmark)

    Kalyanova, Olena; Heiselberg, Per

    This document includes the specification on the IEA task of evaluation building energy simulation computer programs for the Double Skin Facades (DSF) constructions. There are two approaches involved into this procedure, one is the comparative approach and another is the empirical one. In the comp....... In the comparative approach the outcomes of different software tools are compared, while in the empirical approach the modelling results are compared with the results of experimental test cases. The comparative test cases include: ventilation, shading and geometry....

  11. Empirical Test Case Specification

    DEFF Research Database (Denmark)

    Kalyanova, Olena; Heiselberg, Per

    This document includes the empirical specification on the IEA task of evaluation building energy simulation computer programs for the Double Skin Facades (DSF) constructions. There are two approaches involved into this procedure, one is the comparative approach and another is the empirical one. I....... In the comparative approach the outcomes of different software tools are compared, while in the empirical approach the modelling results are compared with the results of experimental test cases....

  12. ENVIRONMENTAL SPECIFICATION REQUIREMENTS

    International Nuclear Information System (INIS)

    TIFFT, S.R.

    2003-01-01

    Through regulations, permitting or binding negotiations, Regulators establish requirements, limits, permit conditions and Notice of Construction (NOC) conditions with which the Office of River Protection (ORP) and the Tank Farm Contractor (TFC) must comply. Operating Specifications are technical limits which are set on a process to prevent injury to personnel, or damage to the facility or environment. The main purpose of this document is to provide specification limits and recovery actions for the TFC Environmental Surveillance Program at the Hanford Site. Specification limits are given for monitoring frequencies and permissible variation of readings from an established baseline or previous reading. The requirements in this document are driven by environmental considerations and data analysis issues, rather than facility design or personnel safety issues. This document is applicable to all SST and DST waste tanks, and the associated catch tanks and receiver tanks, and transfer systems. This Tank Farm ESD implements environmental-regulatory limits on the configuration and operation of the Hanford Tank Farms facility that have been established by Regulators. This ESD contains specific field operational limits and recovery actions for compliance with airborne effluent regulations and agreements, liquid effluents regulations and agreements, and environmental tank system requirements. The scope of this ESD is limited to conditions that have direct impact on Operations/Projects or that Operations/Projects have direct impact upon. This document does not supercede or replace any DOE Orders, regulatory permits, notices of construction, or Regulatory agency agreements binding on the ORP or the TFC. Refer to the appropriate regulation, permit, or NOC for an inclusive listing of requirements

  13. Allergen-specific immunotherapy

    Directory of Open Access Journals (Sweden)

    Moote William

    2011-11-01

    Full Text Available Abstract Allergen-specific immunotherapy is a potentially disease-modifying therapy that is effective for the treatment of allergic rhinitis/conjunctivitis, allergic asthma and stinging insect hypersensitivity. However, despite its proven efficacy in these conditions, it is frequently underutilized in Canada. The decision to proceed with allergen-specific immunotherapy should be made on a case-by-case basis, taking into account individual patient factors such as the degree to which symptoms can be reduced by avoidance measures and pharmacological therapy, the amount and type of medication required to control symptoms, the adverse effects of pharmacological treatment, and patient preferences. Since this form of therapy carries the risk of anaphylactic reactions, it should only be prescribed by physicians who are adequately trained in the treatment of allergy. Furthermore, injections must be given under medical supervision in clinics that are equipped to manage anaphylaxis. In this article, the authors review the indications and contraindications, patient selection criteria, and the administration, safety and efficacy of allergen-specific immunotherapy.

  14. Data specifications for INSPIRE

    Science.gov (United States)

    Portele, Clemens; Woolf, Andrew; Cox, Simon

    2010-05-01

    In Europe a major recent development has been the entering in force of the INSPIRE Directive in May 2007, establishing an infrastructure for spatial information in Europe to support Community environmental policies, and policies or activities which may have an impact on the environment. INSPIRE is based on the infrastructures for spatial information established and operated by the 27 Member States of the European Union. The Directive addresses 34 spatial data themes needed for environmental applications, with key components specified through technical implementing rules. This makes INSPIRE a unique example of a legislative "regional" approach. One of the requirements of the INSPIRE Directive is to make existing spatial data sets with relevance for one of the spatial data themes available in an interoperable way, i.e. where the spatial data from different sources in Europe can be combined to a coherent result. Since INSPIRE covers a wide range of spatial data themes, the first step has been the development of a modelling framework that provides a common foundation for all themes. This framework is largely based on the ISO 19100 series of standards. The use of common generic spatial modelling concepts across all themes is an important enabler for interoperability. As a second step, data specifications for the first set of themes has been developed based on the modelling framework. The themes include addresses, transport networks, protected sites, hydrography, administrative areas and others. The data specifications were developed by selected experts nominated by stakeholders from all over Europe. For each theme a working group was established in early 2008 working on their specific theme and collaborating with the other working groups on cross-theme issues. After a public review of the draft specifications starting in December 2008, an open testing process and thorough comment resolution process, the draft technical implementing rules for these themes have been

  15. Substructural Logical Specifications

    Science.gov (United States)

    2012-11-14

    and independently in the context of CLF by Schack-Nielsen [SN07] and by Cruz and Hou [CH12]; Schack-Nielsen proves the equivalence of the two specifi...cations, whereas Cruz and Hou used the connection informally. The contribution of this section is to describe a general transformation (of which...Functional Programming (LFP’86), pages 13–27. ACM, 1986. 5.1 [CDE+11] Manuel Clavel, Francisco Durán, Steven Eker, Patrick Lincoln, Narciso Martı́- 290 Oliet

  16. Tendering specification and contracting

    International Nuclear Information System (INIS)

    Koch, E. von

    1975-01-01

    The lecture tendering, specification and contracting is prepared in two parts: This first part deals with technical aspects while part two features the commercial and legal situation in the partnership of two: the supplier of the fuel bundles and the utility. In this lecture a look is given on the way how a supplier can offer its fuel and some certain points are mentioned which are important to compare the bid of one competitor to the other. The major points are summarized which are or at least should be in an offer so as to find out which offer is the best. (orig./FW) [de

  17. Sertoli cell specific knockdown of RAR-related orphan receptor (ROR) alpha at puberty reduces sperm count in rats.

    Science.gov (United States)

    Mandal, Kamal; Sarkar, Rajesh K; Sen Sharma, Souvik; Jain, Ayushi; Majumdar, Subeer S

    2018-01-30

    Globally, there is an alarming decline in sperm count. Very often hormonal supplementation fails to restore normal sperm count. Sertoli cells (Sc) present within seminiferous tubules provide appropriate niche and factors required for the differentiation of germ cells (Gc) into mature sperm (spermatogenesis). Functionally compromised Sc may be one of the reasons for failure of hormones to facilitate normal spermatogenesis. Although role of secretory proteins and signaling molecules of Sc has been studied well, role of transcription factors regulating sperm count has not been addressed appropriately. Retinoic acid receptor-related orphan receptor (ROR)-alpha is one of such transcription factors reported in testis but its role in testicular function is not yet known. In a separate study, we found abundant ROR-alpha binding sites on promoter regions of several genes upregulated in pubertal rat Sc as compared to infant Sc. Immunostaining studies also revealed presence of ROR alpha in nucleus of pubertal Sc. We generated a transgenic knockdown rat model expressing shRNA targeted to ROR-alpha under Sc specific promoter, which is transcriptionally active only at and after puberty. ROR-alpha knockdown animals were found to have abnormal association of Sc and Gc, including Gc sloughing and restricted release of sperm. The knockdown animals displayed compromised spermatogenesis leading to significant reduction in sperm count. This is the first report describing the Sc specific role of ROR-alpha in maintaining quantitatively normal sperm output. Identification of various such molecules can generate avenues to limit or reverse an alarmingly declining sperm count witnessed globally in men. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Disease specific protein corona

    Science.gov (United States)

    Rahman, M.; Mahmoudi, M.

    2015-03-01

    It is now well accepted that upon their entrance into the biological environments, the surface of nanomaterials would be covered by various biomacromolecules (e.g., proteins and lipids). The absorption of these biomolecules, so called `protein corona', onto the surface of (nano)biomaterials confers them a new `biological identity'. Although the formation of protein coronas on the surface of nanoparticles has been widely investigated, there are few reports on the effect of various diseases on the biological identity of nanoparticles. As the type of diseases may tremendously changes the composition of the protein source (e.g., human plasma/serum), one can expect that amount and composition of associated proteins in the corona composition may be varied, in disease type manner. Here, we show that corona coated silica and polystyrene nanoparticles (after interaction with in the plasma of the healthy individuals) could induce unfolding of fibrinogen, which promotes release of the inflammatory cytokines. However, no considerable releases of inflammatory cytokines were observed for corona coated graphene sheets. In contrast, the obtained corona coated silica and polystyrene nanoparticles from the hypofibrinogenemia patients could not induce inflammatory cytokine release where graphene sheets do. Therefore, one can expect that disease-specific protein coronas can provide a novel approach for applying nanomedicine to personalized medicine, improving diagnosis and treatment of different diseases tailored to the specific conditions and circumstances.

  19. Code, standard and specifications

    International Nuclear Information System (INIS)

    Abdul Nassir Ibrahim; Azali Muhammad; Ab. Razak Hamzah; Abd. Aziz Mohamed; Mohamad Pauzi Ismail

    2008-01-01

    Radiography also same as the other technique, it need standard. This standard was used widely and method of used it also regular. With that, radiography testing only practical based on regulations as mentioned and documented. These regulation or guideline documented in code, standard and specifications. In Malaysia, level one and basic radiographer can do radiography work based on instruction give by level two or three radiographer. This instruction was produced based on guideline that mention in document. Level two must follow the specifications mentioned in standard when write the instruction. From this scenario, it makes clearly that this radiography work is a type of work that everything must follow the rule. For the code, the radiography follow the code of American Society for Mechanical Engineer (ASME) and the only code that have in Malaysia for this time is rule that published by Atomic Energy Licensing Board (AELB) known as Practical code for radiation Protection in Industrial radiography. With the existence of this code, all the radiography must follow the rule or standard regulated automatically.

  20. Specification of brachytherapy sources

    Energy Technology Data Exchange (ETDEWEB)

    1984-10-01

    BCRU recommends that the following specification of gamma-ray brachytherapy sources be adopted. Unless otherwise stated, the output of a cylindrical source should be specified in air kerma rate at a point in free space at a distance of 1 m from the source on the radial plane of symmetry, i.e. the plane bisecting the active length and perpendicular to the cylindrical axis of the source. For a wire source the output should be specified for a 1 cm length. For any other construction of source, the point at which the output is specified should be stated. It is also recommended that the units in which the air kerma rate is expressed should be micrograys per hour (..mu..Gy/h).

  1. Site specific plan

    International Nuclear Information System (INIS)

    Hutchison, J.; Jernigan, G.

    1989-12-01

    The Environmental Restoration and Waste Management Five-Year Plan (FYP) covers the period for FY 1989 through FY 1995. The plan establishes a Department of Energy -- Headquarters (DOE-HQ) agenda for cleanup and compliance against which overall progress can be measured. The FYP covers three areas: Corrective Activities, Environmental Restoration, and Waste Management Operations. Corrective Activities are those activities necessary to bring active or standby facilities into compliance with local, state, and federal environmental regulations. Environmental restoration activities include the assessment and cleanup of surplus facilities and inactive waste sites. Waste management operations includes the treatment, storage, and disposal of wastes which are generated as a result of ongoing operations. This Site Specific Plan (SSP) has been prepared by the Savannah River Site (SRS) in order to show how environmental restoration and waste management activities that were identified during the preparation of the FYP will be implemented, tracked, and reported. The SSP describes DOE Savannah River (DOE-SR) and operating contractor, Westinghouse Savannah River Company (WSRC), organizations that are responsible, for undertaking the activities identified in this plan. The SSP has been prepared in accordance with guidance received from DOE-HQ. DOE-SR is accountable to DOE-HQ for the implementation of this plan. 8 refs., 46 figs., 23 tabs

  2. ADANS database specification

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-01-16

    The purpose of the Air Mobility Command (AMC) Deployment Analysis System (ADANS) Database Specification (DS) is to describe the database organization and storage allocation and to provide the detailed data model of the physical design and information necessary for the construction of the parts of the database (e.g., tables, indexes, rules, defaults). The DS includes entity relationship diagrams, table and field definitions, reports on other database objects, and a description of the ADANS data dictionary. ADANS is the automated system used by Headquarters AMC and the Tanker Airlift Control Center (TACC) for airlift planning and scheduling of peacetime and contingency operations as well as for deliberate planning. ADANS also supports planning and scheduling of Air Refueling Events by the TACC and the unit-level tanker schedulers. ADANS receives input in the form of movement requirements and air refueling requests. It provides a suite of tools for planners to manipulate these requirements/requests against mobility assets and to develop, analyze, and distribute schedules. Analysis tools are provided for assessing the products of the scheduling subsystems, and editing capabilities support the refinement of schedules. A reporting capability provides formatted screen, print, and/or file outputs of various standard reports. An interface subsystem handles message traffic to and from external systems. The database is an integral part of the functionality summarized above.

  3. Assessing somatic hypermutation in Ramos B cells after overexpression or knockdown of specific genes.

    Science.gov (United States)

    Upton, Dana C; Unniraman, Shyam

    2011-11-01

    -activated cell scanning (FACS) provides a quick read-out for the level of SHM. A more quantitative measurement of SHM can be obtained by directly sequencing the antibody genes. Since Ramos cells are difficult to transfect, we produce stable derivatives that have increased or lowered expression of an individual gene by infecting cells with retroviral or lentiviral constructs that contain either an overexpression cassette or a short hairpin RNA (shRNA), respectively. Here, we describe how we infect Ramos cells and then use these cells to investigate the role of specific genes on SHM (Figure 1).

  4. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  5. Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice

    NARCIS (Netherlands)

    Koornneef, Annemart; Maczuga, Piotr; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Ritsema, Tita; van Deventer, Sander; Petry, Harald; Konstantinova, Pavlina

    2011-01-01

    Serum low-density lipoprotein cholesterol (LDL-C) levels are proportionate to the risk of atherosclerotic cardiovascular disease. In order to reduce serum total cholesterol and LDL-C levels in mice, RNA interference (RNAi) was used to inhibit expression of the structural protein of LDL-C,

  6. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... construct itself or its delivery vehicle (Rao et al., 2009). Through choosing ... Cell culture, transfection and intramuscular injection. MEFs were isolated ..... A system for stable expression of ... Adv. Drug Deliv. Rev. 61: 746-759.

  7. Triptolide inhibits transcription of hTERT through down-regulation of transcription factor specificity protein 1 in primary effusion lymphoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Long, Cong; Wang, Jingchao [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Guo, Wei [Department of Pathology and Physiology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Wang, Huan; Wang, Chao; Liu, Yu [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Sun, Xiaoping, E-mail: xsun6@whu.edu.cn [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); State Key Laboratory of Virology, Wuhan University, Wuhan, 430072 (China)

    2016-01-01

    Primary effusion lymphoma (PEL) is a rare and aggressive non-Hodgkin's lymphoma. Human telomerase reverse transcriptase (hTERT), a key component responsible for the regulation of telomerase activity, plays important roles in cellular immortalization and cancer development. Triptolide purified from Tripterygium extracts displays a broad-spectrum bioactivity profile, including immunosuppressive, anti-inflammatory, and anti-tumor. In this study, it is investigated whether triptolide reduces hTERT expression and suppresses its activity in PEL cells. The mRNA and protein levels of hTERT were examined by real time-PCR and Western blotting, respectively. The activity of hTERT promoter was determined by Dual luciferase reporter assay. Our results demonstrated that triptolide decreased expression of hTERT at both mRNA and protein levels. Further gene sequence analysis indicated that the activity of hTERT promoter was suppressed by triptolide. Triptolide also reduced the half-time of hTERT. Additionally, triptolide inhibited the expression of transcription factor specificity protein 1(Sp1) in PEL cells. Furthermore, knock-down of Sp1 by using specific shRNAs resulted in down-regulation of hTERT transcription and protein expression levels. Inhibition of Sp1 by specific shRNAs enhanced triptolide-induced cell growth inhibition and apoptosis. Collectively, our results demonstrate that the inhibitory effect of triptolide on hTERT transcription is possibly mediated by inhibition of transcription factor Sp1 in PEL cells. - Highlights: • Triptolide reduces expression of hTERT by decreasing its transcription level. • Triptolide reduces promoter activity and stability of hTERT. • Triptolide down-regulates expression of Sp1. • Special Sp1 shRNAs inhibit transcription and protein expression of hTERT. • Triptolide and Sp1 shRNA2 induce cell proliferation inhibition and apoptosis.

  8. Adequate procedures for specific exams

    International Nuclear Information System (INIS)

    Staevie, G.L.G.; Gattringer, D.K.; Dal Mas, C.R.; Tessman, M.

    1996-01-01

    Some ideal procedures for specific radiographic exams are briefly presented. The aim is to improve the quality standard, establishing a specific method for each exam in order to decrease films waste and reduce the patient dose exposure

  9. Teaching English for Specific Purposes

    Directory of Open Access Journals (Sweden)

    Nijolė Netikšienė

    2011-04-01

    Full Text Available Teaching English for Specific Purposes and General English is analysed in the article. The scientific approach of a scientist M. Rosenberg is presented. The experience of teaching English for Specific Purposesat VGTU is alsopresented. The ideas and teaching methods from the classes of general English can be transferred to the classes of English for Specific Purposes.

  10. Functional genomics identifies specific vulnerabilities in PTEN-deficient breast cancer.

    Science.gov (United States)

    Tang, Yew Chung; Ho, Szu-Chi; Tan, Elisabeth; Ng, Alvin Wei Tian; McPherson, John R; Goh, Germaine Yen Lin; Teh, Bin Tean; Bard, Frederic; Rozen, Steven G

    2018-03-22

    Phosphatase and tensin homolog (PTEN) is one of the most frequently inactivated tumor suppressors in breast cancer. While PTEN itself is not considered a druggable target, PTEN synthetic-sick or synthetic-lethal (PTEN-SSL) genes are potential drug targets in PTEN-deficient breast cancers. Therefore, with the aim of identifying potential targets for precision breast cancer therapy, we sought to discover PTEN-SSL genes present in a broad spectrum of breast cancers. To discover broad-spectrum PTEN-SSL genes in breast cancer, we used a multi-step approach that started with (1) a genome-wide short interfering RNA (siRNA) screen of ~ 21,000 genes in a pair of isogenic human mammary epithelial cell lines, followed by (2) a short hairpin RNA (shRNA) screen of ~ 1200 genes focused on hits from the first screen in a panel of 11 breast cancer cell lines; we then determined reproducibility of hits by (3) identification of overlaps between our results and reanalyzed data from 3 independent gene-essentiality screens, and finally, for selected candidate PTEN-SSL genes we (4) confirmed PTEN-SSL activity using either drug sensitivity experiments in a panel of 19 cell lines or mutual exclusivity analysis of publicly available pan-cancer somatic mutation data. The screens (steps 1 and 2) and the reproducibility analysis (step 3) identified six candidate broad-spectrum PTEN-SSL genes (PIK3CB, ADAMTS20, AP1M2, HMMR, STK11, and NUAK1). PIK3CB was previously identified as PTEN-SSL, while the other five genes represent novel PTEN-SSL candidates. Confirmation studies (step 4) provided additional evidence that NUAK1 and STK11 have PTEN-SSL patterns of activity. Consistent with PTEN-SSL status, inhibition of the NUAK1 protein kinase by the small molecule drug HTH-01-015 selectively impaired viability in multiple PTEN-deficient breast cancer cell lines, while mutations affecting STK11 and PTEN were largely mutually exclusive across large pan-cancer data sets. Six genes showed PTEN

  11. Technical specification use and application

    International Nuclear Information System (INIS)

    Williamson, D.; Hoffman, D.R.

    1991-01-01

    Since early 1988 intensive efforts have been under way to produce a new and improved Standard Technical Specification. The program involves a coordinated effort between utility personnel representing each of the four nuclear steam supply system (NSSS) product lines, the NSSS vendors, and the US Nuclear Regulatory Commission (NRC). This intensive work period is actually the culmination of a decade of rhetoric about shortcomings of the existing technical specifications. Work on the improved technical specifications provided a unique forum for intense philosophical discussions between the users and enforcers of technical specifications, the outcome of which could have an impact on all licensees. Some of the more intriguing difficulties in the use and application of existing technical specifications, as well as discussions of the resolutions being applied in the improved technical specifications and the dilemmas remaining to be resolved are discussed in the paper

  12. [Multilingualism and specific language impairment].

    Science.gov (United States)

    Arkkila, Eva; Smolander, Sini; Laasonen, Marja

    2013-01-01

    Specific language impairment is one of the most common developmental disturbances in childhood. With the increase of the foreign language population group an increasing number of children assimilating several languages and causing concern in language development attend clinical examinations. Knowledge of factors underlying the specific language impairment and the specific impairment in general, special features of language development of those learning several languages, as well as the assessment and support of the linguistic skills of a multilingual child is essential. The risk of long-term problems and marginalization is high for children having specific language impairment.

  13. Trojan technical specification verification project

    International Nuclear Information System (INIS)

    Bates, L.; Rickenback, M.

    1991-01-01

    The Trojan Technical Specification Verification (TTSV) project at the Trojan plant of Portland General Electric Company was motivated by the recognition that many numbers in the Trojan technical specifications (TTS) potentially lacked the consideration of instrument- and/or process-related errors. The plant setpoints were known to consider such errors, but many of the values associated with the limiting conditions for operation (LCO) did not. In addition, the existing plant instrument error analyses were based on industry values that do not reflect the Trojan plant-specific experience. The purpose of this project is to ensure that the Trojan plant setpoint and LCO values include plant-specific instrument error

  14. A role for Insulin-like growth factor 2 in specification of the fast skeletal muscle fibre

    Directory of Open Access Journals (Sweden)

    Ting Tao

    2007-06-01

    Full Text Available Abstract Background Fibre type specification is a poorly understood process beginning in embryogenesis in which skeletal muscle myotubes switch myosin-type to establish fast, slow and mixed fibre muscle groups with distinct function. Growth factors are required to establish slow fibres; it is unknown how fast twitch fibres are specified. Igf-2 is an embryonically expressed growth factor with established in vitro roles in skeletal muscle. Its localisation and role in embryonic muscle differentiation had not been established. Results Between E11.5 and E15.5 fast Myosin (FMyHC localises to secondary myotubes evenly distributed throughout the embryonic musculature and gradually increasing in number so that by E15.5 around half contain FMyHC. The Igf-2 pattern closely correlates with FMyHC from E13.5 and peaks at E15.5 when over 90% of FMyHC+ myotubes also contain Igf-2. Igf-2 lags FMyHC and it is absent from muscle myotubes until E13.5. Igf-2 strongly down-regulates by E17.5. A striking feature of the FMyHC pattern is its increased heterogeneity and attenuation in many fibres from E15.5 to day one after birth (P1. Transgenic mice (MIG which express Igf-2 in all of their myotubes, have increased FMyHC staining, a higher proportion of FMyHC+ myotubes and loose their FMyHC staining heterogeneity. In Igf-2 deficient mice (MatDi FMyHC+ myotubes are reduced to 60% of WT by E15.5. In vitro, MIG induces a 50% excess of FMyHC+ and a 30% reduction of SMHyC+ myotubes in C2 cells which can be reversed by Igf-2-targeted ShRNA resulting in 50% reduction of FMyHC. Total number of myotubes was not affected. Conclusion In WT embryos the appearance of Igf-2 in embryonic myotubes lags FMyHC, but by E15.5 around 45% of secondary myotubes contain both proteins. Forced expression of Igf-2 into all myotubes causes an excess, and absence of Igf-2 suppresses, the FMyHC+ myotube component in both embryonic muscle and differentiated myoblasts. Igf-2 is thus required, not for

  15. Hanford Site environmental management specification

    International Nuclear Information System (INIS)

    Grygiel, M.L.

    1998-01-01

    The US Department of Energy, Richland Operations Office (RL) uses this Hanford Site Environmental Management Specification (Specification) to document top-level mission requirements and planning assumptions for the prime contractors involved in Hanford Site cleanup and infrastructure activities under the responsibility of the US Department of Energy, Office of Environmental Management. This Specification describes at a top level the activities, facilities, and infrastructure necessary to accomplish the cleanup of the Hanford Site and assigns this scope to Site contractors and their respective projects. This Specification also references the key National Environmental Policy Act of 1969 (NEPA), Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA), and safety documentation necessary to accurately describe the cleanup at a summary level. The information contained in this document reflects RL's application of values, priorities, and critical success factors expressed by those involved with and affected by the Hanford Site project. The prime contractors and their projects develop complete baselines and work plans to implement this Specification. These lower-level documents and the data that support them, together with this Specification, represent the full set of requirements applicable to the contractors and their projects. Figure 1-1 shows the relationship of this Specification to the other basic Site documents. Similarly, the documents, orders, and laws referenced in this specification represent only the most salient sources of requirements. Current and contractual reference data contain a complete set of source documents

  16. Hanford Site environmental management specification

    Energy Technology Data Exchange (ETDEWEB)

    Grygiel, M.L.

    1998-06-10

    The US Department of Energy, Richland Operations Office (RL) uses this Hanford Site Environmental Management Specification (Specification) to document top-level mission requirements and planning assumptions for the prime contractors involved in Hanford Site cleanup and infrastructure activities under the responsibility of the US Department of Energy, Office of Environmental Management. This Specification describes at a top level the activities, facilities, and infrastructure necessary to accomplish the cleanup of the Hanford Site and assigns this scope to Site contractors and their respective projects. This Specification also references the key National Environmental Policy Act of 1969 (NEPA), Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA), and safety documentation necessary to accurately describe the cleanup at a summary level. The information contained in this document reflects RL`s application of values, priorities, and critical success factors expressed by those involved with and affected by the Hanford Site project. The prime contractors and their projects develop complete baselines and work plans to implement this Specification. These lower-level documents and the data that support them, together with this Specification, represent the full set of requirements applicable to the contractors and their projects. Figure 1-1 shows the relationship of this Specification to the other basic Site documents. Similarly, the documents, orders, and laws referenced in this specification represent only the most salient sources of requirements. Current and contractual reference data contain a complete set of source documents.

  17. Measuring wood specific gravity, correctly

    Science.gov (United States)

    G. Bruce Williamson; Michael C. Wiemann

    2010-01-01

    The specific gravity (SG) of wood is a measure of the amount of structural material a tree species allocates to support and strength. In recent years, wood specific gravity, traditionally a forester’s variable, has become the domain of ecologists exploring the universality of plant functional traits and conservationists estimating global carbon stocks. While these...

  18. SPECIFIC RESISTANCE AND SPECIFIC INTENSITY OF BELT SANDING OF WOOD

    Directory of Open Access Journals (Sweden)

    Boleslaw Porankiewicz

    2010-06-01

    Full Text Available This paper examines and discusses the specific belt sanding resistance K (N·cm-2 and specific belt sanding intensity SI (g·cm-2·min-1, for wood of Pinus sylvestris L., Picea abies L., Quercus robra L., Acer pseudoplatanus L., Alnus glutinosa Gaertn., and Populus Nigra L., by different sanding pressure pS, different sanding grit NG number, and different wood grain angles Phi(v.

  19. Specificity of immunoassays. Pt. 2

    International Nuclear Information System (INIS)

    Pratt, J.J.; Woldring, M.G.; Boonman, R.; Kittikool, J.

    1979-01-01

    Practical aspects of the measurement of the specificity of immunoassay are reviewed. Antibody heterogeneity in an antiserum makes a pragmatic rather than a theoretical approach necessary. A new method for the measurement of immunoassay specificity is described. This method is based on the errors caused by the cross-reacting antigens and is directly relevant to the validity of results obtained by immunoassay methods. The effect of selectively blocking the least specific antibodies in antisera raised against steroid haptens is tested. The practical consequences of these considerations are tested using steroid radioimmunoassay and enzyme-immunoassay. (orig.) [de

  20. Patient-Specific Computational Modeling

    CERN Document Server

    Peña, Estefanía

    2012-01-01

    This book addresses patient-specific modeling. It integrates computational modeling, experimental procedures, imagine clinical segmentation and mesh generation with the finite element method (FEM) to solve problems in computational biomedicine and bioengineering. Specific areas of interest include cardiovascular problems, ocular and muscular systems and soft tissue modeling. Patient-specific modeling has been the subject of serious research over the last seven years and interest in the area is continually growing and this area is expected to further develop in the near future.

  1. Bid specifications and bid evaluations

    International Nuclear Information System (INIS)

    Zijl, N.A. van

    1977-01-01

    Bid specifications are in view of the size of these projects important and comprehensive documents. The basic content and set up of the specifications are discussed such as: 1) Bid invitation letter, 2) instruction to bidders, 3) draft contract (terms and conditions), 4) technical specifications, 5) side data and information. - The evaluations of bids for nuclear power stations is due to the complexity of such bids a difficult undertaking. Evaluation methods and approaches which can be applied for such bid evaluations are discussed as well as the preparations which are required for carrying out such evaluations. (orig.) [de

  2. Synergy of Technical Specification, functional specifications and scenarios in requirements specifications

    NARCIS (Netherlands)

    Miedema, J.; van der Voort, Mascha C.; Lutters, Diederick; van Houten, Frederikus J.A.M.; Krause, Frank-Lothar

    2007-01-01

    In the (mechanical) design process, the requirements specification is a formal registration of the conditions that are imposed on a new or altered product design, both preceding as well as during the corresponding product development cycle. For a long time, the use of technical specifications has

  3. Youth job market specific features

    Directory of Open Access Journals (Sweden)

    Evgeniya Yu. Zhuravleva

    2011-05-01

    Full Text Available The article considers youth job market peculiarities, its specific features and regulation means, determines theoretical and application tasks of qualitative and quantitative comparison of vocations, which are highly in demand at the job market.

  4. GPS Civil Monitoring Performance Specification

    Science.gov (United States)

    2009-02-10

    This Civil Monitoring Performance Specification (CMPS) is published and maintained at : the direction of the Program Manager for Civil Applications, Global Positioning Systems : Wing (GPSW). The purpose of this document is to provide a comprehensive ...

  5. The role of formal specifications

    International Nuclear Information System (INIS)

    McHugh, J.

    1994-01-01

    The role of formal requirements specification is discussed under the premise that the primary purpose of such specifications is to facilitate clear and unambiguous communications among the communities of interest for a given project. An example is presented in which the failure to reach such an understanding resulted in an accident at a chemical plant. Following the example, specification languages based on logical formalisms and notations are considered. These are rejected as failing to serve the communications needs of diverse communities. The notion of a specification as a surrogate for a program is also considered and rejected. The paper ends with a discussion of the type of formal notation that will serve the communications role and several encouraging developments are noted

  6. CCL22-specific T Cells

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Munir Ahmad, Shamaila; Hansen, Morten

    2016-01-01

    Tumor cells and tumor-infiltrating macrophages produce the chemokine CCL22, which attracts regulatory T cells (Tregs) into the tumor microenvironment, decreasing anticancer immunity. Here, we investigated the possibility of targeting CCL22-expressing cells by activating specific T cells. We...... analyzed the CCL22 protein signal sequence, identifying a human leukocyte antigen A2- (HLA-A2-) restricted peptide epitope, which we then used to stimulate peripheral blood mononuclear cells (PMBCs) to expand populations of CCL22-specific T cells in vitro. T cells recognizing an epitope derived from...... the signal-peptide of CCL22 will recognize CCL22-expressing cells even though CCL22 is secreted out of the cell. CCL22-specific T cells recognized and killed CCL22-expressing cancer cells. Furthermore, CCL22-specific T cells lysed acute monocytic leukemia cells in a CCL22 expression-dependent manner. Using...

  7. Eternity Variables to Simulate Specifications

    NARCIS (Netherlands)

    Hesselink, WH; Boiten, EA; Moller, B

    2002-01-01

    Simulation of specifications is introduced as a unification and generalization of refinement mappings, history variables, forward simulations, prophecy variables, and backward simulations. Eternity variables are introduced as a more powerful alternative for prophecy variables and backward

  8. Autonomic Fuselet Specification and Composition

    National Research Council Canada - National Science Library

    Mills, Peter H

    2006-01-01

    ... model for its business logic, and to perform workflow composition from a goal and specifications to executable model in a manner that enables feedback mechanisms that can assess and adapt the process...

  9. ATR Technical Specification Upgrade Program

    International Nuclear Information System (INIS)

    McCracken, R.T.; Durney, J.L.; Freund, G.A.

    1990-01-01

    The Advanced Test Reactor (ATR) is a 250 MW, uranium-aluminum fueled test reactor which began full power operation in 1969. The initial operation was controlled by an Operating Limits document based on the original Safety Analysis Report. Additional safety bases were later developed to support Technical Specifications which were approved and implemented in 1977. The Technical Specifications which were initially developed with content and format specified in ANSI/ANS--15.1, ''The Development of Technical Specifications for Research Reactors.'' The safety basis documentation and the Technical Specifications have been updated as required to maintain them current with the ATR facility configuration. All revisions have been made with a content, format and style consistent with the original. A major, two-phase program to upgrade the content, format and style is in progress. This paper describes the first phase of this program

  10. Specific immunotherapy ameliorates ulcerative colitis.

    Science.gov (United States)

    Cai, Min; Zeng, Lu; Li, Lin-Jing; Mo, Li-Hua; Xie, Rui-Di; Feng, Bai-Sui; Zheng, Peng-Yuan; Liu, Zhi-Gang; Liu, Zhan-Ju; Yang, Ping-Chang

    2016-01-01

    Hypersensitivity reaction to certain allergens plays a role in the pathogenesis of inflammatory bowel disease (IBD). This study aims to observe the effect of specific immunotherapy in a group of IBD patients. Patients with both ulcerative colitis (UC) and food allergy were recruited into this study. Food allergy was diagnosed by skin prick test and serum specific IgE. The patients were treated with specific immunotherapy (SIT) and Clostridium butyricum (CB) capsules. After treating with SIT and CB, the clinical symptoms of UC were markedly suppressed as shown by reduced truncated Mayo scores and medication scores. The serum levels of specific IgE, interleukin (IL)-4 and tumor necrosis factor (TNF)-α were also suppressed. Treating with SIT alone or CB alone did not show appreciable improvement of the clinical symptoms of UC. UC with food allergy can be ameliorated by administration with SIT and butyrate-production probiotics.

  11. SPECIFIC EMISSIONS FROM BIOMASS COMBUSTION

    Directory of Open Access Journals (Sweden)

    Pavel Skopec

    2014-02-01

    Full Text Available This paper deals with determining the specific emissions from the combustion of two kinds of biomass fuels in a small-scale boiler. The tested fuels were pellets made of wood and pellets made of rape plant straw. In order to evaluate the specific emissions, several combustion experiments were carried out using a commercial 25 kW pellet-fired boiler. The specific emissions of CO, SO2 and NOx were evaluated in relation to a unit of burned fuel, a unit of calorific value and a unit of produced heat. The specific emissions were compared with some data acquired from the reference literature, with relatively different results. The differences depend mainly on the procedure used for determining the values, and references provide no information about this. Although some of our experimental results may fit with one of the reference sources, they do not fit with the other. The reliability of the references is therefore disputable.

  12. Grade 6 Science Curriculum Specifications.

    Science.gov (United States)

    Alberta Dept. of Education, Edmonton. Curriculum Branch.

    This material describes curriculum specifications for grade 6 science in Alberta. Emphases recommended are: (1) process skills (50%); (2) psychomotor skills (10%); (3) attitudes (10%); and (4) subject matter (30%). Priorities within each category are identified. (YP)

  13. Patient-specific surgical simulation.

    Science.gov (United States)

    Soler, Luc; Marescaux, Jacques

    2008-02-01

    Technological innovations of the twentieth century have provided medicine and surgery with new tools for education and therapy definition. Thus, by combining Medical Imaging and Virtual Reality, patient-specific applications providing preoperative surgical simulation have become possible.

  14. Base compaction specification feasibility analysis.

    Science.gov (United States)

    2012-12-01

    The objective of this research is to establish the technical engineering and cost : analysis concepts that will enable WisDOT management to objectively evaluate the : feasibility of switching construction specification philosophies for aggregate base...

  15. [Tissue-specific nucleoprotein complexes].

    Science.gov (United States)

    Riadnova, I Iu; Shataeva, L K; Khavinson, V Kh

    2000-01-01

    A method of isolation of native nucleorprotein complexes from cattle cerebral cortex, thymus, and liver was developed. Compositions of these complexes were studied by means of gel-chromatography and ion-exchange chromatography. These preparations were shown to consist of several fractions of proteins and their complexes differ by molecular mass and electro-chemical properties. Native nucleoprotein complexes revealed high tissue specific activity, which was not species-specific.

  16. XML specifications DanRIS

    DEFF Research Database (Denmark)

    2009-01-01

    XML specifications for DanRIS (Danish Registration- og InformationsSystem), where the the aim is: Improved exchange of data Improved data processing Ensuring future access to all gathered data from the year 1999 until now......XML specifications for DanRIS (Danish Registration- og InformationsSystem), where the the aim is: Improved exchange of data Improved data processing Ensuring future access to all gathered data from the year 1999 until now...

  17. Niche-specific cognitive strategies

    DEFF Research Database (Denmark)

    Hulgard, K.; Ratcliffe, J. M.

    2014-01-01

    Related species with different diets are predicted to rely on different cognitive strategies: those best suited for locating available and appropriate foods. Here we tested two predictions of the niche-specific cognitive strategies hypothesis in bats, which suggests that predatory species should...... the niche-specific cognitive strategies hypothesis and suggest that for gleaning and clutter-resistant aerial hawking bats, learning to associate shape with food interferes with subsequent spatial memory learning....

  18. Defective neuronal migration and inhibition of bipolar to multipolar transition of migrating neural cells by Mesoderm-Specific Transcript, Mest, in the developing mouse neocortex.

    Science.gov (United States)

    Ji, Liting; Bishayee, Kausik; Sadra, Ali; Choi, Seunghyuk; Choi, Wooyul; Moon, Sungho; Jho, Eek-Hoon; Huh, Sung-Oh

    2017-07-04

    Brain developmental disorders such as lissencephaly can result from faulty neuronal migration and differentiation during the formation of the mammalian neocortex. The cerebral cortex is a modular structure, where developmentally, newborn neurons are generated as a neuro-epithelial sheet and subsequently differentiate, migrate and organize into their final positions in the cerebral cortical plate via a process involving both tangential and radial migration. The specific role of Mest, an imprinted gene, in neuronal migration has not been previously studied. In this work, we reduced expression of Mest with in utero electroporation of neuronal progenitors in the developing embryonic mouse neocortex. Reduction of Mest levels by shRNA significantly reduced the number of neurons migrating to the cortical plate. Also, Mest-knockdown disrupted the transition of bipolar neurons into multipolar neurons migrating out of the sub-ventricular zone region. The migrating neurons also adopted a more tangential migration pattern upon knockdown of the Mest message, losing their potential to attach to radial glia cells, required for radial migration. The differentiation and migration properties of neurons via Wnt-Akt signaling were affected by Mest changes. In addition, miR-335, encoded in a Mest gene intron, was identified as being responsible for blocking the default tangential migration of the neurons. Our results suggest that Mest and its intron product, miR-335, play important roles in neuronal migration with Mest regulating the morphological transition of primary neurons required in the formation of the mammalian neocortex. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  19. NIF optical specifications - the importance of the RMS gradient specification

    International Nuclear Information System (INIS)

    Auerbach, J. M.; Cotton, C. T.; English, R. E.; Henesian, M. A.; Hunt, J. T.; Kelly, J. H.; Lawson, J. K.; Sacks, J. B.; Shoup, M. J.; Trenholme, W. H.

    1998-01-01

    The performance of the National Ignition Facility (NIF), especially in terms of laser focusability, will be determined by several key factors. One of these key factors is the optical specification for the thousands of large aperture optics that will comprise the 192 beamlines. We have previously reported on the importance of the specification of the power spectral density (PSD) on NIF performance. Recently, we have been studying the importance of long spatial wavelength (>33 mm) phase errors on focusability. We have concluded that the preferred metric for determining the impact of these long spatial wavelength phase errors is the rms phase gradient. In this paper, we outline the overall approach to NIF optical specifications, detail the impact of the rms phase gradient on NIF focusability, discuss its trade-off with the PSD in determining the spot size and review measurements of optics similar to those to be manufactured for NIF

  20. α-Fetoprotein promoter-driven Cre/LoxP-switched RNA interference for hepatocellular carcinoma tissue-specific target therapy.

    Directory of Open Access Journals (Sweden)

    Yuan-Fei Peng

    Full Text Available RNA interference (RNAi has recently emerged as a potential treatment modality for hepatocellular carcinoma (HCC therapy, but the lack of cellular targets and sustained efficacy limits its application. The purpose of this study is to develop an HCC tissue-specific RNAi system and investigate its possibility for HCC treatment.Two different HCC-specific RNAi systems in which therapeutic miRNA or shRNA against target gene (Beclin 1 was directly or indirectly driven by alpha-fetoprotein promoter (AFP-miRNA and AFP-Cre/LoxP-shRNA were constructed. Human HCC cell lines (HepG2, Hep3B and HCCLM3 and non-HCC cell lines (L-02, Hela and SW1116 were infected with the systems. The effectiveness and tissue-specificity of the systems were examined by Q-PCR and western blot analysis. The efficacy of the systems was further tested in mouse model of HCC by intravenous or intratumoral administration. The feasibility of the system for HCC treatment was evaluated by applying the system as adjuvant therapy to enhance sorafenib treatment. An AFP-Cre/LoxP-shRNA system targeting Atg5 gene (AFP-Cre/LoxP-shRNA-Atg5 was constructed and its efficacy in sensitizing HCC cells (MHCC97L/PLC to sorafenib treatment was examined by apoptosis assay in vitro and tumorigenesis assay in vivo.The AFP-miRNA system could silence target gene (Beclin 1 but required a high titer which was lethal to target cells. The AFP-Cre/LoxP-shRNA system could efficiently knockdown target gene while maintain high HCC specificity. Intratumoral injection of the AFP-Cre/LoxP-shRNA system could efficiently silence target gene (Beclin 1 in vivo while intravenous administration could not. The AFP-Cre/LoxP-shRNA system target Atg5 gene could significantly sensitize MHCC97L/PLC cells to sorafenib-induced apoptosis in vitro and tumor growth suppression in vivo.An efficient HCC tissue-specific RNAi system (AFP-Cre/LoxP-shRNA was successfully established. The system provides a usable tool for HCC-specific RNAi

  1. CASL, the Common Algebraic Specification Language

    DEFF Research Database (Denmark)

    Mossakowski, Till; Haxthausen, Anne Elisabeth; Sannella, Donald

    2008-01-01

    CASL is an expressive specification language that has been designed to supersede many existing algebraic specification languages and provide a standard. CASL consists of several layers, including basic (unstructured) specifications, structured specifications and architectural specifications...

  2. Standard Technical Specifications, Westinghouse plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (STS) for Westinghouse Plants and documents the positions of the Nuclear Regulatory Commission based on the Westinghouse Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council (NUMARC). The improved STS were developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. This document, Volume 3, contains the Bases for Sections 3.4--3.9 of the improved STS

  3. Standard Technical Specifications, Westinghouse Plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (STS) for Westinghouse Plants and documents the positions of the Nuclear Regulatory Commission based on the Westinghouse Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council (NUMARC). The improved STS were developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the unproved STS. Volume 3 contains the Bases for Sections 3.4--3.9 of the improved STS which contain information on safety limits, reactivity control systems, power distribution limits, and instrumentation

  4. Industry specific financial distress modeling

    Directory of Open Access Journals (Sweden)

    Naz Sayari

    2017-01-01

    Full Text Available This study investigates uncertainty levels of various industries and tries to determine financial ratios having the greatest information content in determining the set of industry characteristics. It then uses these ratios to develop industry specific financial distress models. First, we employ factor analysis to determine the set of ratios that are most informative in specified industries. Second, we use a method based on the concept of entropy to measure the level of uncertainty in industries and also to single out the ratios that best reflect the uncertainty levels in specific industries. Finally, we conduct a logistic regression analysis and derive industry specific financial distress models which can be used to judge the predictive ability of selected financial ratios for each industry. The results show that financial ratios do indeed echo industry characteristics and that information content of specific ratios varies among different industries. Our findings show diverging impact of industry characteristics on companies; and thus the necessity of constructing industry specific financial distress models.

  5. Technical specification for vacuum systems

    International Nuclear Information System (INIS)

    Khaw, J.

    1987-01-01

    The vacuum systems at the Stanford Linear Accelerator Center (SLAC) are primarily of all-metal construction and operate at pressures from 10 -5 to 10 -11 Torr. The primary gas loads during operation result from thermal desorption and beam-induced desorption from the vacuum chamber walls. These desorption rates can be extremely high in the case of hydrocarbons and other contaminants. These specifications place a major emphasis on eliminating contamination sources. The specifications and procedures have been written to insure the cleanliness and vacuum integrity of all SLAC vacuum systems, and to assist personnel involved with SLAC vacuum systems in choosing and designing components that are compatible with existing systems and meet the quality and reliability of SLAC vacuum standards. The specification includes requirements on design, procurement, fabrication, chemical cleaning, clean room practices, welding and brazing, helium leak testing, residual gas analyzer testing, bakeout, venting, and pumpdown. Also appended are specifications regarding acceptable vendors, isopropyl alcohol, bakeable valve cleaning procedure, mechanical engineering safety inspection, notes on synchrotron radiation, and specifications of numerous individual components

  6. Standard Technical Specifications, Westinghouse plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (STS) for Westinghouse Plants and documents the positions of the Nuclear Regulatory Commission based on the Westinghouse Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council (NUMARC). The improved STS were developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. This document, Volume 1, contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. Volume 3 contains the Bases for Sections 3.4--3.9 of the improved STS

  7. Age‑specific Serum Prostate Specific Antigen Ranges Among ...

    African Journals Online (AJOL)

    ethnic differences.[16] Although similar studies have been presented for a number of different groups of men and few studies have looked at the pattern of serum PSA among Nigerians[17‑20] but no such studies on normal serum PSA ranges and the age‑specific pattern have been carried out among healthy Nigerian men.

  8. ROS signalling - specificity is required

    DEFF Research Database (Denmark)

    Møller, Ian M; Sweetlove, Lee J

    2010-01-01

    Reactive oxygen species (ROS) production increases in plants under stress. ROS can damage cellular components, but they can also act in signal transduction to help the cell counteract the oxidative damage in the stressed compartment. H2O2 might induce a general stress response, but it does not have...... the required specificity to selectively regulate nuclear genes required for dealing with localized stress, e.g. in chloroplasts or mitochondria. Here we argue that peptides deriving from proteolytic breakdown of oxidatively damaged proteins have the requisite specificity to act as secondary ROS messengers...... and regulate source-specific genes and in this way contribute to retrograde ROS signalling during oxidative stress. Likewise, unmodified peptides deriving from the breakdown of redundant proteins could help coordinate organellar and nuclear gene expression...

  9. Methylation-Specific PCR Unraveled

    Directory of Open Access Journals (Sweden)

    Sarah Derks

    2004-01-01

    Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.

  10. Double transduction of a Cre/LoxP lentiviral vector: a simple method to generate kidney cell-specific knockdown mice.

    Science.gov (United States)

    Nam, Bo Young; Kim, Dong Ki; Park, Jung Tak; Kang, Hye-Young; Paeng, Jisun; Kim, Seonghun; Park, Jimin; Um, Jae Eun; Oh, Hyung Jung; Han, Seung Hyeok; Yoo, Tae-Hyun; Kang, Shin-Wook

    2015-12-15

    In a lentivirus-based gene delivery system, the incorporated gene is continuously expressed for a long time. In this study, we devised a simple way to knock down a specific gene in a kidney cell-specific pattern in adult mice by lentivirus-assisted transfer of short hairpin RNA (shRNA). Kidney collecting duct (CD)-specific aquaporin-3 (AQP3)-knockdown mice were generated by consecutive injection of Hoxb7-Cre-expressing lentivirus (LV-Hoxb7 Cre) and loxP-AQP3 shRNA-expressing lentivirus (LV-loxP shAQP3) in adult C57BL6/J mice. LV-Hoxb7 Cre was designed to express mCherry, while LV-loxP shAQP3 was designed with a floxed enhanced green fluorescent protein (EGFP)-tagged stop sequence, and thus EGFP would be expressed only in the absence of Cre recombination. In mice treated with LV-Hoxb7 Cre alone, mCherry protein expression, which indicates the presence of Cre recombinase, occurred only in CD cells. However, LV-loxP shAQP3 injection alone resulted in an increase in EGFP expression in all kidney cells, indicating the transcription of the floxed region. When LV-Hoxb7 Cre and LV-loxP shAQP3 were sequentially transduced, EGFP expression was attenuated while mCherry expression was sustained in CD cells, demonstrating a CD cell-specific recombination of the floxed region. AQP3 expression in mice injected with LV-Hoxb7 Cre or LV-loxP shAQP3 alone did not differ, but consecutive injection of LV-Hoxb7 Cre and LV-loxP shAQP3 significantly reduced AQP3 expression in CD cells. However, the expression levels of AQP3 were not altered in other cell types. Double transduction of Cre- and loxP-based lentivirus can easily generate kidney cell-specific knockdown mice, and this method might be applicable to other species. Copyright © 2015 the American Physiological Society.

  11. Portable File Format (PFF) specifications

    Energy Technology Data Exchange (ETDEWEB)

    Dolan, Daniel H. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-02-01

    Created at Sandia National Laboratories, the Portable File Format (PFF) allows binary data transfer across computer platforms. Although this capability is supported by many other formats, PFF files are still in use at Sandia, particularly in pulsed power research. This report provides detailed PFF specifications for accessing data without relying on legacy code.

  12. Human-Specific Endogenous Retroviruses

    Directory of Open Access Journals (Sweden)

    Anton Buzdin

    2007-01-01

    Full Text Available This review focuses on a small family of human-specific genomic repetitive elements, presented by 134 members that shaped ~330 kb of the human DNA. Although modest in terms of its copy number, this group appeared to modify the human genome activity by endogenizing ~50 functional copies of viral genes that may have important implications in the immune response, cancer progression, and antiretroviral host defense. A total of 134 potential promoters and enhancers have been added to the human DNA, about 50% of them in the close gene vicinity and 22% in gene introns. For 60 such human-specific promoters, their activity was confirmed by in vivo assays, with the transcriptional level varying ~1000-fold from hardly detectable to as high as ~3% of β-actin transcript level. New polyadenylation signals have been provided to four human RNAs, and a number of potential antisense regulators of known human genes appeared due to human-specific retroviral insertional activity. This information is given here in the context of other major genomic changes underlining differences between human and chimpanzee DNAs. Finally, a comprehensive database, is available for download, of human-specific and polymorphic endogenous retroviruses is presented, which encompasses the data on their genomic localization, primary structure, encoded viral genes, human gene neighborhood, transcriptional activity, and methylation status.

  13. Manufacturer Usage Description Specification Implementation

    OpenAIRE

    Srinivasan, Kaushik

    2017-01-01

    Manufacturer Usage Description Specification (MUDS) is aframework under RFC development that aims to automate Internet access control rules for IoT devices . These access controls prevent malicious IoT devices from attacking other devices and also protect the IoT devices from being attacked by other devices.We are implementing this framework and trying to improve its security.

  14. Competitive Procurement and Asset Specificity

    NARCIS (Netherlands)

    Sorana, V.

    2003-01-01

    This paper studies the effects of asset specificity on the performance of procurement auctions with subcontracting and asset sales.The analysis highlights the role of several asset features like transfer costs, type of alternative uses and maintenance requirements.It is argued that, if bargaining

  15. Final Empirical Test Case Specification

    DEFF Research Database (Denmark)

    Kalyanova, Olena; Heiselberg, Per

    This document includes the empirical specification on the IEA task of evaluation building energy simulation computer programs for the Double Skin Facades (DSF) constructions. There are two approaches involved into this procedure, one is the comparative approach and another is the empirical one....

  16. LOTOS specification style for OSI

    NARCIS (Netherlands)

    Turner, K.J.; van Sinderen, Marten J.; Bolognesi, T.; van de Lagemaat, J.; Vissers, C.A.

    1995-01-01

    The architecture of OSI is used to derive guidelines for writing LOTOS specifications of distributed systems. In particular, the architectural concepts that underlie service and protocol designs are examined in detail. For each of these concepts a representation in LOTOS is given. Examples are

  17. LOTOS specification style for OSI

    NARCIS (Netherlands)

    Brinksma, Hendrik; Turner, K.J.; Bolognesi, T.; van Sinderen, Marten J.; Vissers, C.A.

    1992-01-01

    The architecture of OSI is used to derive guidelines for writing LOTOS specifications of distributed systems. In particular, the architectural concepts that underlie service and protocol designs are examined in detail. For each of these concepts a representation in LOTOS is given. Examples are

  18. THE SPECIFICITY OF INTRACOMMUNITY TRANSACTIONS

    Directory of Open Access Journals (Sweden)

    PALIU-POPA LUCIA

    2011-09-01

    Full Text Available Considered from the perspective of Romania's accession to the European Union, we can say that starting with 1 January 2007, foreign trade transactions were delimited in relation to the customs borders in intra-Community transactions and international transactions. In this context, the way of conducting these operations is influenced by both the economic and financial features specific to both categories of transactions, that relate to the economic character of the activity, the diversity and specificity of the foreign trade activity, transport of goods, the complexity and regulation of intra-Community and international commercial transactions, and by the specific features of each category of transaction. Starting from the consideration that the economic and financial characteristics of foreign trade activity, specific to intra-Community commercial transactions, have a significant influence in the organization and management of accounting of the entities involved in such transactions, determining in a greater or lesser extent, the way of capitalization of the financial and accounting information in the processes of analysis, decision and control, in this paper we proposed to address the features of intra-Community trade.

  19. Microbeams, microdosimetry and specific dose

    International Nuclear Information System (INIS)

    Randers-Pehrson, H.

    2002-01-01

    Dose and its usefulness as a single parameter to describe the amount of radiation absorbed are well established for most situations. The conditions where the concept of dose starts to break down are well known, mostly from the study of microdosimetry. For low doses of high LET radiation it is noted that the process of taking the limiting value of the energy absorbed within a test volume divided by the mass within that volume yields either zero or a relatively large value. The problem is further exacerbated with microbeam irradiations where the uniformity of the energy deposition is experimentally manipulated on the spatial scale of cells being irradiated. Booz introduced a quantity to deal with these problems: the unfortunately named 'mean specific energy in affected volumes'. This quantity multiplied by the probability that a test volume has received an energy deposit is equal to dose (in situations where dose can be defined). I propose that Booz's quantity be renamed 'specific dose', that is the mean energy deposited divided by the mass within a specified volume. If we believe for instance that the nucleus of a cell is the critical volume for biological effects, we can refer to the nuclear specific dose. A microbeam experiment wherein 10 per cent of the cell nuclei were targeted with 10 alpha particles would be described as delivering a nuclear specific dose of 1.6 Gy to 10 per cent of the population. (author)

  20. [Specificities in children wound healing].

    Science.gov (United States)

    Sanchez, J; Antonicelli, F; Tuton, D; Mazouz Dorval, S; François, C

    2016-10-01

    Children have specific characteristics of wound healing. The aim of this study was to describe the specific clinical characteristics of wounds healing in children and to present the current knowledge on the specific mechanisms with regard to infant age. The tissue insult or injury in fetus can heal without scar, mainly due to reduced granulation tissue associated to diminished or even no inflammatory phase, modified extracellular matrix such as the concentration of hyaluronic acid in amniotic liquid, expression and arrangement of collagen and tenascin. Thickness of children skin is a serious negative factor in case of trauma, whereas poor co-morbidities and efficient growth tissue mechanisms are beneficial to good evolution, even in cases of extensive damage and loss of tissue. The subsequent tissue mechanical forces, wound healing during childhood, spanning from the age of 2 until the end of puberty, is associated with more hypertrophic scars, both in duration and in intensity. Consequently, unnecessary surgery has to be avoided during this period when possible, and children with abnormal or pathologic wound healing should benefit from complementary treatments (hydration, massage, brace, silicone, hydrotherapy…), which represent efficient factors to minimize tissue scarring. After wound healing, the growth body rate can be responsible for specific complications, such as contractures, alopecia, and scar intussusceptions. Its evolutionary character implies the need of an attentive follow-up until adult age. Psychologic repercussions, as a consequence of pathologic scars, must be prevented and investigated by the surgeon. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  1. Specific and non-specific match effects in negative priming.

    Science.gov (United States)

    Labossière, Danielle I; Leboe-McGowan, Jason P

    2018-01-01

    The negative priming effect occurs when withholding a response to a stimulus impairs generation of subsequent responding to a same or a related stimulus. Our goal was to use the negative priming procedure to obtain insights about the memory representations generated by ignoring vs. attending/responding to a prime stimulus. Across three experiments we observed that ignoring a prime stimulus tends to generate higher identity-independent, non-specific repetition effects, owing to an overlap in the coarse perceptual form of a prime distractor and a probe target. By contrast, attended repetition effects generate predominantly identity-specific sources of facilitation. We use these findings to advocate for using laboratory phenomena to illustrate general principles that can be of practical use to non-specialists. In the case of the negative priming procedure, we propose that the procedure provides a useful means for investigating attention/memory interactions, even if the specific cause (or causes) of negative priming effects remain unresolved. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. [Specific immunotherapy with depigmented allergoids].

    Science.gov (United States)

    Klimek, L; Thorn, C; Pfaar, O

    2010-01-01

    Specific immunotherapy is the only available causative treatment for IgE-mediated allergic conditions. The state of the art is treatment via the subcutaneous route with crude extracts in a water solution, with physically linked (semidepot) extracts or chemically modified semidepot extracts (allergoids). A relatively new purification method combines depigmentation followed by polymerization with glutaraldehyde. This modification results in increased tolerance with a reduction in both local and systemic adverse effects. As controlled clinical trials have shown, the effectiveness is comparable to that of specific immunotherapy with crude allergen extracts. Recent data suggest that the modified polymerized allergoids allow a safe rush titration in a few days or even in 1 day (ultra-rush titration).

  3. UNBIASED ESTIMATORS OF SPECIFIC CONNECTIVITY

    Directory of Open Access Journals (Sweden)

    Jean-Paul Jernot

    2011-05-01

    Full Text Available This paper deals with the estimation of the specific connectivity of a stationary random set in IRd. It turns out that the "natural" estimator is only asymptotically unbiased. The example of a boolean model of hypercubes illustrates the amplitude of the bias produced when the measurement field is relatively small with respect to the range of the random set. For that reason unbiased estimators are desired. Such an estimator can be found in the literature in the case where the measurement field is a right parallelotope. In this paper, this estimator is extended to apply to measurement fields of various shapes, and to possess a smaller variance. Finally an example from quantitative metallography (specific connectivity of a population of sintered bronze particles is given.

  4. Vibrio chromosome-specific families

    DEFF Research Database (Denmark)

    Lukjancenko, Oksana; Ussery, David

    2014-01-01

    We have compared chromosome-specific genes in a set of 18 finished Vibrio genomes, and, in addition, also calculated the pan- and core-genomes from a data set of more than 250 draft Vibrio genome sequences. These genomes come from 9 known species and 2 unknown species. Within the finished...... chromosomes, we find a core set of 1269 encoded protein families for chromosome 1, and a core of 252 encoded protein families for chromosome 2. Many of these core proteins are also found in the draft genomes (although which chromosome they are located on is unknown.) Of the chromosome specific core protein...... families, 1169 and 153 are uniquely found in chromosomes 1 and 2, respectively. Gene ontology (GO) terms for each of the protein families were determined, and the different sets for each chromosome were compared. A total of 363 different "Molecular Function" GO categories were found for chromosome 1...

  5. Specific bibliography on Anastrepha fraterculus

    International Nuclear Information System (INIS)

    Salles, L.A.; Jaldo, H.

    1999-01-01

    Most publications on Anastrepha fraterculus are in the literature sources from South America, and papers were published in Spanish or Portuguese. Many literature sources mentioned in this list are not indexed in entomological abstracts and, consequently, are not easily available outside their home state or country. Due to this fact, the inclusion of a list of specific bibliography on A. fraterculus could be a help for researchers and students interested in fruit flies. In this list are included only references directly dealing with Anastrepha fraterculus. Obviously, many more references exist that consider this species, but general or non-specific work or data concerning A. fraterculus were not included in the present list. (author)

  6. Multilingualism and Specific Language Impairment

    OpenAIRE

    Engel de Abreu, Pascale

    2014-01-01

    Is a multilingual education beneficial for children? What are the optimal conditions under which a child can become perfectly multilingual? When should we be concerned about a multilingual child's language skills? What are the signs of Specific Language Impairment in a child who speaks more than one language? Developmental psychologist and Associate Professor in multilingual cognitive development at the University of Luxembourg Pascale Engel de Abreu will address these questions based on what...

  7. Nanobody Based Dual Specific CARs

    Directory of Open Access Journals (Sweden)

    Stijn De Munter

    2018-01-01

    Full Text Available Recent clinical trials have shown that adoptive chimeric antigen receptor (CAR T cell therapy is a very potent and possibly curative option in the treatment of B cell leukemias and lymphomas. However, targeting a single antigen may not be sufficient, and relapse due to the emergence of antigen negative leukemic cells may occur. A potential strategy to counter the outgrowth of antigen escape variants is to broaden the specificity of the CAR by incorporation of multiple antigen recognition domains in tandem. As a proof of concept, we here describe a bispecific CAR in which the single chain variable fragment (scFv is replaced by a tandem of two single-antibody domains or nanobodies (nanoCAR. High membrane nanoCAR expression levels are observed in retrovirally transduced T cells. NanoCARs specific for CD20 and HER2 induce T cell activation, cytokine production and tumor lysis upon incubation with transgenic Jurkat cells expressing either antigen or both antigens simultaneously. The use of nanobody technology allows for the production of compact CARs with dual specificity and predefined affinity.

  8. Nanobody Based Dual Specific CARs.

    Science.gov (United States)

    De Munter, Stijn; Ingels, Joline; Goetgeluk, Glenn; Bonte, Sarah; Pille, Melissa; Weening, Karin; Kerre, Tessa; Abken, Hinrich; Vandekerckhove, Bart

    2018-01-30

    Recent clinical trials have shown that adoptive chimeric antigen receptor (CAR) T cell therapy is a very potent and possibly curative option in the treatment of B cell leukemias and lymphomas. However, targeting a single antigen may not be sufficient, and relapse due to the emergence of antigen negative leukemic cells may occur. A potential strategy to counter the outgrowth of antigen escape variants is to broaden the specificity of the CAR by incorporation of multiple antigen recognition domains in tandem. As a proof of concept, we here describe a bispecific CAR in which the single chain variable fragment (scFv) is replaced by a tandem of two single-antibody domains or nanobodies (nanoCAR). High membrane nanoCAR expression levels are observed in retrovirally transduced T cells. NanoCARs specific for CD20 and HER2 induce T cell activation, cytokine production and tumor lysis upon incubation with transgenic Jurkat cells expressing either antigen or both antigens simultaneously. The use of nanobody technology allows for the production of compact CARs with dual specificity and predefined affinity.

  9. Mutational specificity of SOS mutagenesis

    International Nuclear Information System (INIS)

    Kato, Takeshi

    1986-01-01

    In an approach to the isolation of mutants of E. coli unable to produce mutations by ultraviolet light, the author has found new umuC-mutants. Their properties could be explained by ''SOS hypothesis of Radman and Witkin'', which has now been justified by many investigators. Analysis of the umuC region of E. coli chromosome cloned in pSK 100 has led to the conclusion that two genes, umuD and umuC, having the capacity of mutation induction express in the same mechanism as that of SOS genes, which is known to be inhibited by LexA protein bonding to ''SOS box'' found at promotor region. Suppressor analysis for mutational specificity has revealed: (i) umuDC-independent mutagens, such as EMS and (oh) 4 Cy, induce selected base substitution alone; and (ii) umuDC-dependent mutagens, such as X-rays and gamma-rays, induce various types of base substitution simultaneously, although they have mutational specificity. In the umuDC-dependent processes of basechange mutagenesis, the spectra of base substitution were a mixture of base substitution reflecting the specific base damages induced by individual mutagens and nonspecific base substitution. In conclusion, base substitution plays the most important role in umuDC-dependent mutagenesis, although mutagenesis of umuDC proteins remains uncertain. (Namekawa, K.)

  10. Conversion of NEK standard technical specifications into improved technical specifications

    International Nuclear Information System (INIS)

    Glaser, B.

    2003-01-01

    Neck is currently using a standard format of operation's Technical Specifications - STS (based on NUREG-0452), which are planned to be converted into Improved Technical Specifications - ITS (based on NUREG-1431). To facilitate the development of individual ITS, each reactor vendor owners group (OG) and the NRC staff developed improved standard TS (ISTS). For Westinghouse plants, the ISTS are published as NUREG-1431, and this document is going to be the basis for the new NEK ITS. It has been recognized that nuclear safety in all plants would benefit from improvement and standardization of ITS, so this was also addressed and recognized by the NRC. There are several plants around Europe and US, which have replaced the format into ITS which brings a lot of improvements and practical value in operations. The main objective of conversion is to completely rewrite, reformat, and streamline the existing STS. Emphasis is placed on human factors principles to improve clarity and understanding. The Bases section will be significantly expanded to clarify and better explain the purpose and foundation of each specification. There might be some proposed changes to the existing STS that deviated from the ITS in NUREG-1431 and constitute a relaxation of the existing STS. Each of these additional proposed changes will be described and evaluated in amendment application and justified on a case-by-case basis. Since the NEK is going to operate for more than 20 year without considering life extension, such conversion will be beneficial for operation personnel as well as regulation, surveillance and focus on operation's safety. At the present, only preliminary plan of STS conversion exists, showing the time frame of approximately 2 years of conversion process and numerous tasks that need to be performed. The plan is to begin with process in year 2004 and finish project in 2006, which means use of new ITS in main control room in year 2007. Beside the main process of conversion, there are

  11. JBK-75 microstructure specification recommendation

    International Nuclear Information System (INIS)

    Brewer, A.W.

    1977-01-01

    Since the ASTM-E-45 standard for microcleanliness is not applicable to superalloys like JBK-75 stainless steel (Modified A-286), Rocky Flats should adopt the Ladish microcleanliness standard (APML Cleanliness Classification of High Temperature Alloys Chart, 1971), as a guide for setting material acceptance specifications for JBK-75. Inclusion ratings of S-2, N-2, C-2, and M-2 should be acceptable. The microstructure should have a grain size of 5 or finer, but not smaller than 9, and microsegregation (banding) should be kept to a minimum

  12. Gender specific determinants of goitre

    International Nuclear Information System (INIS)

    Jamshid, F.; Kerstin, C.; Elena, G.; Wilhelm, O.; Karl, W.; Hwe, M.

    2004-01-01

    Despite the strong implications of differences between females and males in the risk of goitre, gender-specific issues have not been extensively addressed in investigations of goitre prevalence. The Objective of our analysis was to investigate the gender-specific determinants of goitre. Methods: A total of 853 healthy employees from 4 institutions in western part of Germany aged between 18 and 68 years were examined by ultrasound of the neck to determine the thyroid volume between April 2001 and April 2002. Information on sex, age, daily use of iodised salt, the history of goitre in the first degree relatives, type and amount of' smoking, oral contraceptives and number of pregnancies were assessed by standardised questionnaires. Gender-specific predictors of goitre prevalence were assessed by multivariate logistic regression. Results: The overall prevalence of goitre among study subjects was (204/853) 23.9%. Goitre was present in 80 out of 370 females (21.6%) vs. 124/483 (25.7%) in males.In general smoking (<0.0001), increasing age (p<0.0001) and lack of daily intake of iodised salt (p=0.004) associated with goitre prevalence, but not sex (0.4) and family history of goitre (p=0.2). In 370 females, parity (p=0.004) and lack of daily intake of iodised salt (p=0.01) were the major determinants for goitre, whereas, age (p=0.2), oral contraceptives (p=0.8), family history of goitre (p=0.3), and smoking (p=0.1) did not affect the goitre prevalence. In 483 males, smoking (p<0.0001) and age (p<0.001) affected the goitre prevalence, but not family history of goitre (p=0.4) and the iodine status failed just to reach the significant level (p=0.08) in this analysis. Conclusions: Gender specific determinants of goitre are parity and iodine status in females and smoking and increasing age in males. (authors)

  13. Specification for personal photographic dosemeters

    International Nuclear Information System (INIS)

    1981-01-01

    The 1981 British/International Standard Specification, prepared under the direction of the Nuclear Engineering Standards Committee and TC85 of the International Organization for Standardization, is described for personal photographic dosemeters. The Standard specifies classification, characteristics and test procedures to determine absorbed doses due to X or gamma radiations (energy less than 3 MeV) and absorbed doses due to beta radiation (max. energy 0.6 to 3 MeV), whether or not accompanied by X, gamma or bremsstrahlung photon radiation. The Standard is particularly applicable to dosemeters intended to be carried on the chest or wrist. (U.K.)

  14. Domain specific MT in use

    DEFF Research Database (Denmark)

    Offersgaard, Lene; Povlsen, Claus; Almsten, Lisbeth Kjeldgaard

    2008-01-01

    point scale evaluate the sentence from the point of view of the post-editor. The post-editor profile defined by the LSP is based on the experiences of introducing MT in the LSP workflow. The relation between the Translation Edit Rate (TER) scores and “Usability” scores is tested. We find TER a candidate......The paper focuses on domain specific use of MT with a special focus on SMT in the workflow of a Language Service Provider (LSP). We report on the feedback of post-editors using fluency/adequacy evaluation and the evaluation metric ’Usability’, understood in this context as where users on a three...

  15. Central Solenoid Insert Technical Specification

    Energy Technology Data Exchange (ETDEWEB)

    Martovetsky, Nicolai N [ORNL; Smirnov, Alexandre [ORNL

    2011-09-01

    The US ITER Project Office (USIPO) is responsible for the ITER central solenoid (CS) contribution to the ITER project. The Central Solenoid Insert (CSI) project will allow ITER validation the appropriate lengths of the conductors to be used in the full-scale CS coils under relevant conditions. The ITER Program plans to build and test a CSI to verify the performance of the CS conductor. The CSI is a one-layer solenoid with an inner diameter of 1.48 m and a height of 4.45 m between electric terminal ends. The coil weight with the terminals is approximately 820 kg without insulation. The major goal of the CSI is to measure the temperature margin of the CS under the ITER direct current (DC) operating conditions, including determining sensitivity to load cycles. Performance of the joints, ramp rate sensitivity, and stability against thermal or electromagnetic disturbances, electrical insulation, losses, and instrumentation are addressed separately and therefore are not major goals in this project. However, losses and joint performance will be tested during the CSI testing campaign. The USIPO will build the CSI that will be tested at the Central Solenoid Model Coil (CSMC) Test Facility at the Japan Atomic Energy Agency (JAEA), Naka, Japan. The industrial vendors (the Suppliers) will report to the USIPO (the Company). All approvals to proceed will be issued by the Company, which in some cases, as specified in this document, will also require the approval of the ITER Organization. Responsibilities and obligations will be covered by respective contracts between the USIPO, called Company interchangeably, and the industrial Prime Contractors, called Suppliers. Different stages of work may be performed by more than one Prime Contractor, as described in this specification. Technical requirements of the contract between the Company and the Prime Contractor will be covered by the Fabrication Specifications developed by the Prime Contractor based on this document and approved by

  16. The Specificity of Human Aesthetics

    DEFF Research Database (Denmark)

    Bouchet, Dominique

    2015-01-01

    Today, humankind is being reintroduced within nature. Humankind is no longer presented as supernatural to nature. There is no longer a clear divide between animal and human. What makes us human is neither culture, nor language nor labor, nor art, but the degree of complexity those products and ca...... creativity. Art is fundamentally about shaping visions and very closely related to this specific human ability to make projects. Especially in times of crisis, when the old sources of meaning hardly can make sense in a new context, imagination must be used in order to survive....

  17. Advances in bacterial specific imaging

    International Nuclear Information System (INIS)

    Wareham, David; Das, Satya; London Univ.

    2005-01-01

    Nuclear medicine is a powerful diagnostic technique able to detect inflammatory foci in human disease. A wide range of agents have been evaluated for their ability to distinguish lesions due to microbial infection from those due to sterile inflammation. Advances continue to be made on the use of radiolabelled antibiotics which as well as being highly specific in the diagnosis of infection may be useful in monitoring the treatment and course of disease. Here we provide an update on in-vitro and clinical studies with a number of established and novel radiopharmaceuticals. (author)

  18. Logic programming and metadata specifications

    Science.gov (United States)

    Lopez, Antonio M., Jr.; Saacks, Marguerite E.

    1992-01-01

    Artificial intelligence (AI) ideas and techniques are critical to the development of intelligent information systems that will be used to collect, manipulate, and retrieve the vast amounts of space data produced by 'Missions to Planet Earth.' Natural language processing, inference, and expert systems are at the core of this space application of AI. This paper presents logic programming as an AI tool that can support inference (the ability to draw conclusions from a set of complicated and interrelated facts). It reports on the use of logic programming in the study of metadata specifications for a small problem domain of airborne sensors, and the dataset characteristics and pointers that are needed for data access.

  19. Food Odours Direct Specific Appetite

    Directory of Open Access Journals (Sweden)

    Harriët F. A. Zoon

    2016-02-01

    Full Text Available Olfactory food cues were found to increase appetite for products similar in taste. We aimed to replicate this phenomenon for taste (sweet/savoury, determine whether it extends to energy density (high/low as well, and uncover whether this effect is modulated by hunger state. Twenty-nine healthy-weight females smelled four odours differing in the energy density and taste they signalled, one non-food odour, and one odourless solution (control, in random order, for three minutes each. Appetite for 15 food products was rated in the following two minutes. Mixed model analyses revealed that exposure to an odour signalling a specific taste (respectively sweet, savoury led to a greater appetite for congruent food products (sweet/savoury compared to incongruent food products (savoury p < 0.001; sweet p < 0.001 or neutral food products (p = 0.02; p = 0.003. A similar pattern was present for the energy-density category (respectively high-energy dense, low-energy dense signalled by the odours (low-energy products p < 0.001; high-energy products p = 0.008. Hunger state did not have a significant impact on sensory-specific appetite. These results suggest that exposure to food odours increases appetite for congruent products, in terms of both taste and energy density, irrespective of hunger state. We speculate that food odours steer towards intake of products with a congruent macronutrient composition.

  20. Hanford Site Environmental Management Specification

    International Nuclear Information System (INIS)

    DAILY, J.L.

    2001-01-01

    The US Department of Energy, Richland Operations Office (RL) has established a document hierarchy as part of its integrated management system. The Strategic Plan defines the vision, values, missions, strategic goals, high-level outcomes, and the basic strategies in achieving those outcomes. As shown in Figure 1-1, the Site Specification derives requirements from the Strategic Plan and documents the top-level mission technical requirements for the work involved in the RL Hanford Site cleanup and infrastructure activities under the responsibility of the U.S. Department of Energy, Office of Environmental Management (EM). It also provides the basis for all contract technical requirements. Since this is limited to the EM work, neither the Fast Flux Test Facility (FFTF) nor the Pacific Northwest National Laboratory (PNNL) non-EM science activities are included. Figure 1-1 also shows the relationship between this Site Specification and the other Site management and planning documents. Similarly, the documents, orders, and laws referenced in this document represent only the most salient sources of requirements. Current and contractual reference data contain a complete set of source documents

  1. [Specific immunotherapy. Hyposensitization with allergens].

    Science.gov (United States)

    Wedi, B; Kapp, A

    2004-04-01

    Successful allergen-specific immunotherapy (SIT) induces complex immunologic chan-ges resulting in reduced allergic inflammatory reactions. SIT has long-term effects in mild forms of inhalant allergies and is effective even when standard pharmacotherapy fails. Moreover, the risk to develop additional allergic sensitizations and the development of asthma is significantly reduced in children with allergic rhinitis. SIT is the treatment of choice in patients with systemic reactions to hymenoptera venoms. Although the exact effector mechanisms of SIT still have to be clarified, the most probable effect is a modulation of regulatory T cells associated with a switch of allergen-specific B-cells towards IgG4 production. The critical point to insure efficacy and safety is the selection of patients and allergens, task best performed by a specialist trained in allergology. Further details are available in the position papers of the German allergy societies - DGAI(Deutsche Gesellschaft fiir Allergologie und Klinische Immunologie) and ADA (Arzte-verband Deutscher Allergologen) - which can be found at www.dgaki.de.

  2. Is sexual victimization gender specific?

    DEFF Research Database (Denmark)

    Sundaram, Vanita; Laursen, Bjarne; Helweg-Larsen, Karin

    2008-01-01

    The present study investigates the prevalence of sexual victimization and correlations between sexual victimization and indicators of poor health in two representative samples of men and women in Denmark. Specifically, the authors explore the prevalence of self-reported victimization among...... adolescents (N = 5,829) and adults (N = 3,932) and analyze differences in self-reported health outcomes between male and female victims and corresponding controls. Gender differences are found in the reported prevalence of sexual victimization. Significantly more females than males reported forced sexual...... experiences in both samples. Associations between sexual victimization and poor health outcomes are found for both genders. Comparable patterns of association for men and women are found on a number of variables, particularly those pertaining to risk behavior....

  3. Compositional specification of commercial contracts

    DEFF Research Database (Denmark)

    Andersen, Jesper; Elsborg, Ebbe; Henglein, Fritz

    2006-01-01

    -definable analysis of their state before, during and after execution. We provide several realistic examples of commercial contracts and their analyses. A variety of (real) contracts can be expressed in such a fashion as to support their integration, management and analysis in an operational environment......We present a declarative language for compositional specification of contracts governing the exchange of resources. It extends Eber and Peyton Jones’s declarative language for specifying financial contracts (Jones et al. in The Fun of Programming. 2003) to the exchange of money, goods and services...... amongst multiple parties and complements McCarthy’s Resources, Events and Agents (REA) accounting model (McCarthy in Account Rev. LVII(3), 554–578, 1982) with a view- independent formal contract model that supports definition of user-defined contracts, automatic monitoring under execution and user...

  4. Specificity of discoveries in radiochemistry

    International Nuclear Information System (INIS)

    Krivomazov, A.N.

    1977-01-01

    The development of radiochemistry as a science is elucidated. On the basis of original papers and archives materials which have become available only recently, specific features of opening the law of radioactive displacements and isotopy of radioactive elements are presented in detail. A contribution of Hevesy, Russel, Fajans, and Soddy into the solution of this problem is considered; an important role of Rutherford in putting down the priority conflict is shown. Two stages of scientific generalization are singled out in the history of opening the law of radioactive displacements: the stage of the rules and the stage of the laws. On this basis the solutions of the priority problems have been reconsidered. It is shown that the history of radiochemistry is rich in discoveries which have undergone a relatively long evolution

  5. Genetic specificity of face recognition.

    Science.gov (United States)

    Shakeshaft, Nicholas G; Plomin, Robert

    2015-10-13

    Specific cognitive abilities in diverse domains are typically found to be highly heritable and substantially correlated with general cognitive ability (g), both phenotypically and genetically. Recent twin studies have found the ability to memorize and recognize faces to be an exception, being similarly heritable but phenotypically substantially uncorrelated both with g and with general object recognition. However, the genetic relationships between face recognition and other abilities (the extent to which they share a common genetic etiology) cannot be determined from phenotypic associations. In this, to our knowledge, first study of the genetic associations between face recognition and other domains, 2,000 18- and 19-year-old United Kingdom twins completed tests assessing their face recognition, object recognition, and general cognitive abilities. Results confirmed the substantial heritability of face recognition (61%), and multivariate genetic analyses found that most of this genetic influence is unique and not shared with other cognitive abilities.

  6. Testing of badminton specific endurance

    DEFF Research Database (Denmark)

    Madsen, Christian Møller; Højlyng, Mads; Nybo, Lars

    2016-01-01

    In the present study, a novel intermittent badminton endurance test (B-ENDURANCE) was developed and tested in elite (n=17) and skilled (n=9) badminton players as well as in age-matched physically active men (non-badminton players; n=8). In addition, B-ENDURANCE test-retest reproducibility...... was evaluated in nine badminton players.B-ENDURANCE is an incremental test where each level consists of repeated sequences of badminton specific actions towards the four corners on the court. The subject starts in the center of the court in front of a computer screen and within each sequence he must...... decreases until the subjects cannot follow the dictated tempo.B-ENDURANCE performance for elite players was better (Pbadminton players. In addition, B-ENDURANCE performance correlated (r=0.8; P

  7. FY97 ICCS prototype specification

    International Nuclear Information System (INIS)

    Woodruff, J.

    1997-01-01

    The ICCS software team will implement and test two iterations of their software product during FY97. This document specifies the products to be delivered in that first prototype and projects the direction that the second prototype will take. Detailed specification of the later iteration will be written when the results of the first iteration are complete. The selection of frameworks to be implemented early is made on a basis of risk analysis from the point of view of future development in the ICCS project. The prototype will address risks in integration of object- oriented components, in refining our development process, and in emulation testing for FEP devices. This document is a specification that identifies products and processes to undertake for resolving these risks. The goals of this activity are to exercise our development process at a modest scale and to probe our architecture plan for fundamental limits and failure modes. The product of the iterations will be the framework software which will be useful in future ICCS code. Thus the FY97 products are intended for internal usage by the ICCS team and for demonstration to the FEP software developers of the strategy for integrating supervisory software with FEP computers. This will be the first of several expected iterations of the software development process and the performance measurements that ICCS will demonstrate, intended to support confidence in our ability to meet project RAM goals. The design of the application software is being carried out in a separate WBS 1.5.2 activity. The design activity has as its FY97 product a series of Software Design Documents that will specify the functionality of the controls software of ICCS. During the testing of this year''s prototypes, the application functionality needed for test will be provided by sample maintenance controls. These are early precursors of controls that can be used for low level device control. Since the devices under test will be represented by

  8. Eternity Variables to Prove Simulation of Specifications

    NARCIS (Netherlands)

    Hesselink, Wim H.

    2005-01-01

    Simulations of specifications are introduced as a unification and generalization of refinement mappings, history variables, forward simulations, prophecy variables, and backward simulations. A specification implements another specification if and only if there is a simulation from the first one to

  9. Are specific emotions narrated differently?

    Science.gov (United States)

    Habermas, Tilmann; Meier, Michaela; Mukhtar, Barbara

    2009-12-01

    Two studies test the assertion that anger, sadness, fear, pride, and happiness are typically narrated in different ways. Everyday events eliciting these 5 emotions were narrated by young women (Study 1) and 5- and 8-year-old girls (Study 2). Negative narratives were expected to engender more effort to process the event, be longer, more grammatically complex, more often have a complication section, and use more specific emotion labels than global evaluations. Narratives of Hogan's (2003) juncture emotions anger and fear were expected to focus more on action and to contain more core narrative sections of orientation, complication, and resolution than narratives of the outcome emotions sadness and happiness. Hypotheses were confirmed for adults except for syntactic complexity, whereas children showed only some of these differences. Hogan's theory that juncture emotions are restricted to the complication section was not confirmed. Finally, in adults, indirect speech was more frequent in anger narratives and internal monologue in fear narratives. It is concluded that different emotions should be studied in how they are narrated, and that narratives should be analyzed according to qualitatively different emotions.

  10. [Amusia and its topic specification].

    Science.gov (United States)

    Buklina, S B; Skvortsova, V B

    2007-01-01

    A historical development of views on amusia and its clinical phenomenology is reviewed. The authors present a case of atypical amusia in a patient aged 32 years with glioma of the right temporal lobe including the upper temporal gyrus. Amusia was combined with euphoria and disturbances of evaluation of speech intonation. It has been assumed that different mechanisms implicated with different regions of both brain hemispheres may underlie amusia. Sometimes these mechanisms appear to be universal, e.g. disorders of symbolic gnosis in posterior hemisphere lesions, being comorbid with amusia as disturbances in reading music and letter agnosia. In our case, the right temporal lobe lesion, especially with involvement of the upper temporal gyrus, caused specific music agnosia with disturbances of perception of some notes and duration of their phonation or a musical contour of the whole melody. Motor amusia is developed due to additional disturbances of motor and premotor brain functions, with significant contribution of the Broca's speech area. Music may be a model for investigation into processes of multimodal integration and hemisphere interaction.

  11. Advances in bacterial specific imaging

    Directory of Open Access Journals (Sweden)

    David Wareham

    2005-10-01

    Full Text Available Nuclear medicine is a powerful diagnostic technique able to detect inflammatory foci in human disease. A wide range of agents have been evaluated for their ability to distinguish lesions due to microbial infection from those due to sterile inflammation. Advances continue to be made on the use of radiolabelled antibiotics which as well as being highly specific in the diagnosis of infection may be useful in monitoring the treatment and course of disease. Here we provide an update on in-vitro and clinical studies with a number of established and novel radiopharmaceuticalsA medicina nuclear é uma técnica poderosa de diagnóstico capaz de detectar focos inflamatórios em doenças humanas. Uma ampla gama de agentes tem sido avaliada em sua capacidade de distinguir lesões, devidas a infecções microbianas daquelas causadas por inflamações estéreis. Avanços continuam sendo realizados no uso de antibióticos radiomarcados que, da mesma forma que têm sido usados no diagnóstico altamente específico de infecções, podem ser úteis na monitoração do tratamento e do curso da doença. Neste estudo, nós apresentamos uma atualização sobre estudos in vitro e clínicos, com alguns novos radiofármacos e outros já consagrados.

  12. Specificities of sustainable tourism planning

    Directory of Open Access Journals (Sweden)

    Jegdić Vaso

    2013-01-01

    Full Text Available In the past two decades, companies have been mentioning achievement of sustainability in their activities as a target of companies, governments and non-profit organizations, although measuring the degree to which an organization conducts its activities in a sustainable manner, can be very difficult. Sustainable tourism development requires a process of planning and management that will unite the interests of various stakeholders in a sustainable and strategic way. It requires an understanding of the meaning of sustainable development and guiding values for promoting sustainable tourism. The paper points to the importance of cross-sector partnerships and the roles of different stakeholders in the planning of sustainable tourism projects. Special importance is given to the community of which a willingness to understand the impacts of tourism industry is expected, as well as various procedures of engagement in participatory planning, consensus building and conflict resolution among all stakeholders. The aim of this research is to find an optimal model of planning of sustainable tourism projects that would take into consideration the interests of all stakeholders and reflect the specificities imposed by the acceptance of the concept of sustainable development by all participants in the project.

  13. 31 CFR 596.309 - Specific license.

    Science.gov (United States)

    2010-07-01

    ... FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY TERRORISM LIST GOVERNMENTS SANCTIONS REGULATIONS General Definitions § 596.309 Specific license. The term specific license means any license or...

  14. The Specificity Principle in Acculturation Science

    Science.gov (United States)

    Bornstein, Marc H.

    2016-01-01

    The Specificity Principle in Acculturation Science asserts that specific setting conditions of specific people at specific times moderate specific domains in acculturation by specific processes. Our understanding of acculturation depends critically on what is studied where, in whom, how, and when. This article defines, explains, and illustrates the Specificity Principle in Acculturation Science. Research hypotheses about acculturation can be more adequately tested, inconsistencies and discrepancies in the acculturation literature can be satisfactorily resolved, acculturation interventions can be tailored to be more successful, and acculturation policies can be brought to new levels of effectiveness if the specificity principle that governs acculturation science is more widely recognized. PMID:28073331

  15. Specific CT findings of eclampsia

    International Nuclear Information System (INIS)

    Takahashi, Hiroshi; Nakazawa, Shozo; Imaya, Hisatoshi

    1985-01-01

    Two cases of specific computed tomographic (CT) findings of eclampsia were reported. Case 1 was a 25-year-old primipara in the 10th month of pregnancy, and Case 2 was a 36-year-old primipara in the 9th month of pregnancy. Both were brought to our hospital because of attacks of preeclampsia and eclampsia. On admission, they were in a comatose state. Computed tomography (CT) on admission showed low- and high-density areas in the basal ganglia regions in Case 1 and low-density areas in the same regions in Case 2. In Case 1, cerebral angiograms obtained two days after the attack showed diffuse cerebral vasospasms in the anterior and middle cerebral arteries of both sides and the basilar artery. In Case 2, however, cerebral angiograms obtained three days after the attack showed no abnormal findings. The patients were saved by crisis-overcoming emergency treatment and care. The neurological condition gradually improved. Repeated CT three weeks after the onset showed only a slight low-density area and a small high-density area in the left basal ganglia region in Case 1, while the low-density areas in the bilateral basal ganglia regions disappeared in Case 2. Seven weeks after the attack, cerebral angiography was again performed, but the diffuse vasospasms had disappeared. The clinical courses were good, and the patients were discharged about eight weeks after the onset, by which time their consciousness had become clear and the neurological deficits had been well overcome. Cerebrovascular disorders caused by toxemia of pregnancy is rare; when they do occur, the main lesions of the brain are edema, focal ischemia, thrombosis, and hemorrhage. They may be related to cerebral vasospasm, and subsequent ischemic changes are observed at times with eclampsia. (author)

  16. ShRNA en tratamiento in vivo: perspectiva terapéutica en la enfermedad de Alzheimer

    Directory of Open Access Journals (Sweden)

    Kenneth Kosik

    2005-03-01

    Full Text Available Las enfermedades neurodegenerativas son un problema creciente en la población senil, con más de 20 millones de personas afectadas por la enfermedad de Alzheimer (EA esporádica en el mundo y más de 5.000 portadores de EA familiar sólo en el departamento de Antioquia.

  17. Gender-Specific Health Challenges Facing Women

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Gender-Specific Health Challenges Facing Women Global Research Global ... adverse reactions to the drugs. Women also suffer gender-specific consequences of HIV, including recurrent vaginal yeast ...

  18. Model Commissioning Plan and Guide Specifications

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    The objectives of Model Commissioning Plan and Guide Specifications are to ensure that the design team applies commissioning concepts to the design and prepares commissioning specifications and a commission plan for inclusion in the bid construction documents.

  19. Technical specification improvement through safety margin considerations

    International Nuclear Information System (INIS)

    Howard, R.C.; Jansen, R.L.

    1986-01-01

    Westinghouse has developed an approach for utilizing safety analysis margin considerations to improve plant operability through technical specification revision. This approach relies on the identification and use of parameter interrelations and sensitivities to identify acceptable operating envelopes. This paper summarizes technical specification activities to date and presents the use of safety margin considerations as another viable method to obtain technical specification improvement

  20. Genre-Specific Semantic Video Indexing

    NARCIS (Netherlands)

    Wu, J.; Worring, M.

    2010-01-01

    In many applications, we find large video collections from different genres where the user is often only interested in one or two specific video genres. So, when users are querying the system with a specific semantic concept, they are likely aiming a genre specific instantiation of this concept.

  1. 42 CFR 37.203 - Autopsy specifications.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Autopsy specifications. 37.203 Section 37.203... EXAMINATIONS SPECIFICATIONS FOR MEDICAL EXAMINATIONS OF UNDERGROUND COAL MINERS Autopsies § 37.203 Autopsy specifications. (a) Every autopsy for which a claim for payment is submitted pursuant to this part: (1) Shall be...

  2. Specific cooling capacity of liquid nitrogen

    Science.gov (United States)

    Kilgore, R. A.; Adcock, J. B.

    1977-01-01

    The assumed cooling process and the method used to calculate the specific cooling capacity of liquid nitrogen are described, and the simple equation fitted to the calculated specific cooling capacity data, together with the graphical form calculated values of the specific cooling capacity of nitrogen for stagnation temperatures from saturation to 350 K and stagnation pressures from 1 to 10 atmospheres, are given.

  3. Isothermal Gravitational Segregation: Algorithms and Specifications

    DEFF Research Database (Denmark)

    Halldórsson, Snorri; Stenby, Erling Halfdan

    2000-01-01

    New algorithms for calculating the isothermal equilibrium state of reservoir fluids under the influence of gravity are presented. Two types of specifications are considered: the specification of pressure and composition at a reference depth; and the specification of the total overall content of t...

  4. Information Concerning Preparation of Specifications for Carpeting.

    Science.gov (United States)

    Gilliland, John W.

    This paper argues for detailed, written carpeting specifications to assure that schools obtain quality products at competitive prices. The advantages of and specifications for school carpeting are given. A sample written specification contains items on: scope, general features, materials, acoustic characteristics, identification and acoustic…

  5. 14 CFR 91.1015 - Management specifications.

    Science.gov (United States)

    2010-01-01

    ... complete and separate set of its management specifications at its principal base of operations, or at a... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Management specifications. 91.1015 Section... Operations Program Management § 91.1015 Management specifications. (a) Each person conducting operations...

  6. Towards a theory of product design specifications

    DEFF Research Database (Denmark)

    Hansen, Claus Thorp; Andreasen, Mogens Myrup

    2004-01-01

    , which express the customers¿ need and perception of value. In this paper we will scrutinize this assumption. We outline the roles and tasks of the product design specification in order to identify the requirements on a theory of product design specifications and we identify existing theory elements....... In the design methodology literature we find guidelines and methods to compile a product design specification. The contributions are based on the common underlying assumption that it is meaningful and the only feasible approach to interpret the result of a need analysis into a set of technical specifications...... to build such a theory of product design specifications upon....

  7. Standard technical specifications combustion engineering plants

    International Nuclear Information System (INIS)

    1992-09-01

    This report documents the results of the combined effort of the NRC and the industry to produce improved Standard Technical Specifications (STS) for Combustion Engineering Plants. The improved STS wee developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. This document, Volume 1, contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Sections 3.4--3.9 of the improved STS

  8. In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

    Science.gov (United States)

    Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.

    2013-01-01

    SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013

  9. Technical specifications and performance of CANDU fuel

    International Nuclear Information System (INIS)

    Sejnoha, R.

    1997-01-01

    The relations between Technical Specifications and fuel performance are discussed in terms of design limits and margins. The excellent performance record of CANDU reactor fuel demonstrates that the fuel design defined in the Technical Specifications (and with it other components of the procurement cycle, such as fuel manufacturing), satisfy the requirements. New requirements, changing conditions of fuel application and accumulating experience make periodic updates of the Technical Specifications necessary. Under the CANDU Owners Group (COG) Working Party 9, a Work Package has been conducted to support the review of the Specifications and the documentation of the rationales for their requirements. So far, the review has been completed for 4 Specifications: 1 for Zircaloy tubing, and 3 for uranium dioxide powder. It is planned to complete the review of all 11 currently used specifications by 1999. The paper summarizes the results achieved to mid 1997. (author)

  10. An Algebraic Specification of the Semantic Web

    OpenAIRE

    Ksystra, Katerina; Triantafyllou, Nikolaos; Stefaneas, Petros; Frangos, Panayiotis

    2011-01-01

    We present a formal specification of the Semantic Web, as an extension of the World Wide Web using the well known algebraic specification language CafeOBJ. Our approach allows the description of the key elements of the Semantic Web technologies, in order to give a better understanding of the system, without getting involved with their implementation details that might not yet be standardized. This specification is part of our work in progress concerning the modeling the Social Semantic Web.

  11. Map Specifications and Exchange of Geographical Information

    DEFF Research Database (Denmark)

    Frederiksen, Poul

    1999-01-01

    Specifications for Technical Maps 1993 – 99 are described giving an overview of the specification structure including the object description of the latest version: TK99.The technical map specifications are related to the standards for topographical maps - especially the TOP10DK standard. Common...... object definitions are essential for the standards. Technical as well as topographical map information is exchangeable through the Danish developed “Standard for Exchange of Digital Map Information”, known as the DSFL-format....

  12. Cervical cancer: intracavitary dose specification and prescription

    International Nuclear Information System (INIS)

    Potish, R.A.; Gerbi, B.J.

    1987-01-01

    Dose and volume specifications for reporting intracavitary therapy were analyzed according to criteria recommended by the International Commission on Radiation Units and Measurements (ICRU). Ninety Fletcher-Suit radium applications were studied to examine the validity of the assumptions of the ICRU and the merit of their routine reporting. It was demonstrated that the reporting recommendations were inconsistent with clinical prescription systems and added little to dose specification. The distinction between dose specification and dose prescription was stressed

  13. Product specifications for the end use

    International Nuclear Information System (INIS)

    Navaretta, G.

    1992-01-01

    This paper reports on the concept of total quality which provides a foundation upon which NGL specifications could be built. Total quality has been embraced by a large constituency within the Refining and Petrochemical business, so, the NGL industry can not afford to discount it. As a concept, total quality certainly includes a specific management approach, but the roots of the quality movement lie with traditional product quality values. Naturally, the subject of product quality leads directly to product specifications, thus proving the intimate relationship between the total quality concept and NGL specifications

  14. Steps in Modular Specifications for Concurrent Modules

    DEFF Research Database (Denmark)

    Da Rocha Pinto, Pedro; Dinsdale-Young, Thomas; Gardner, Philippa

    2015-01-01

    The specification of a concurrent program module is a difficult problem. The specifications must be strong enough to enable reasoning about the intended clients without reference to the underlying module implementation. We survey a range of verification techniques for specifying concurrent module......, in particular highlighting four key concepts: auxiliary state, interference abstraction, resource ownership and atomicity. We show how these concepts combine to provide powerful approaches to specifying concurrent modules.......The specification of a concurrent program module is a difficult problem. The specifications must be strong enough to enable reasoning about the intended clients without reference to the underlying module implementation. We survey a range of verification techniques for specifying concurrent modules...

  15. Technical specifications for the Bulk Shielding Reactor

    International Nuclear Information System (INIS)

    1982-04-01

    Technical specifications are presented concerning the safety limits and limiting safety system settings; limiting conditions for operation; surveillance requirements; design features; and administrative controls

  16. AOV Facility Tool/Facility Safety Specifications -

    Data.gov (United States)

    Department of Transportation — Develop and maintain authorizing documents that are standards that facilities must follow. These standards are references of FAA regulations and are specific to the...

  17. User Interface Technology for Formal Specification Development

    Science.gov (United States)

    Lowry, Michael; Philpot, Andrew; Pressburger, Thomas; Underwood, Ian; Lum, Henry, Jr. (Technical Monitor)

    1994-01-01

    Formal specification development and modification are an essential component of the knowledge-based software life cycle. User interface technology is needed to empower end-users to create their own formal specifications. This paper describes the advanced user interface for AMPHION1 a knowledge-based software engineering system that targets scientific subroutine libraries. AMPHION is a generic, domain-independent architecture that is specialized to an application domain through a declarative domain theory. Formal specification development and reuse is made accessible to end-users through an intuitive graphical interface that provides semantic guidance in creating diagrams denoting formal specifications in an application domain. The diagrams also serve to document the specifications. Automatic deductive program synthesis ensures that end-user specifications are correctly implemented. The tables that drive AMPHION's user interface are automatically compiled from a domain theory; portions of the interface can be customized by the end-user. The user interface facilitates formal specification development by hiding syntactic details, such as logical notation. It also turns some of the barriers for end-user specification development associated with strongly typed formal languages into active sources of guidance, without restricting advanced users. The interface is especially suited for specification modification. AMPHION has been applied to the domain of solar system kinematics through the development of a declarative domain theory. Testing over six months with planetary scientists indicates that AMPHION's interactive specification acquisition paradigm enables users to develop, modify, and reuse specifications at least an order of magnitude more rapidly than manual program development.

  18. Motorcycle Education Curriculum Specifications. Final Report.

    Science.gov (United States)

    McKnight, A. James; And Others

    This report contains specifications for a motorcycle safety education curriculum designed to reduce the incidence and severity of motorcycle accidents. The specifications prescribe objectives, prerequisites, methods, materials, equipment, facilities, and proficiency measures for six units of instruction: (1) basic riding skills, (2) street riding…

  19. Domain-specific languages in perspective

    NARCIS (Netherlands)

    J. Heering (Jan); M. Mernik (Marjan)

    2007-01-01

    textabstractDomain-specific languages (DSLs) are languages tailored to a specific application domain. They offer substantial gains in expressiveness and ease of use compared with general-purpose languages in their domain of application. Although the use of DSLs is by no means new, it is receiving

  20. The Logic of the RAISE Specification Language

    DEFF Research Database (Denmark)

    George, Chris; Haxthausen, Anne Elisabeth

    2003-01-01

    This paper describes the logic of the RAISE Specification Language, RSL. It explains the particular logic chosen for RAISE, and motivates this choice as suitable for a wide spectrum language to be used for designs as well as initial specifications, and supporting imperative and concurrent...

  1. Specific and social phobias in ICD-11

    NARCIS (Netherlands)

    Emmelkamp, P.M.G.

    2012-01-01

    The purpose of this article is to discuss the current status of research with respect to specific phobias and social phobia as defined in the ICD-10 and DSM-IV, and to provide op- tions for their classification in the ICD-11. Both ICD-10 and DSM-IV identify three main classes of phobias: specific

  2. Technical specifications: Health Physics Research Reactor

    International Nuclear Information System (INIS)

    1979-02-01

    The technical specifications define the key limitations that must be observed for safe operation of the Health Physics Research Reactor (HPRR) and an envelope of operation within which there is assurance that these limits will not be exceeded. The specifications were written to satisfy the requirements of the Department of Energy (DOE) Manual Chapter 0540, September 1, 1972

  3. Guidelines for writing user friendly technical specifications

    International Nuclear Information System (INIS)

    Webster, S.A.; Braun, J.C.; Pearce, R.T.

    1986-01-01

    This study investigates some of the ergonomic considerations of writer's guides for the preparation of instructions. It is a precedent for the preparation of such a writer's guide for technical specifications for nuclear power plants. This writer's guide will be part of a revision to the industry's standard ANSI/ANS 58.4, Criteria for Technical Specifications for Nuclear Power Stations

  4. Specific skills and social competence in schizophrenia

    NARCIS (Netherlands)

    Appelo, M.T.; van Nieuwenhuizen, C.J.; Emmelkamp, P.M.G.; Slooff, C.J.; Louwerens, J.W.

    1992-01-01

    Generalization of skills is a major problem in social skills training for schizophrenic patients. Assessment of skills is mostly not based on objective indices of specific skill deficits. The results of this study show that global competence of schizophrenics can be differentiated from specific

  5. The Logic of the RAISE Specification Language

    DEFF Research Database (Denmark)

    George, Chris; Haxthausen, Anne Elisabeth

    2008-01-01

    This chapter describes the logic of the RAISE Specification Language, RSL. It explains the particular logic chosen for RAISE, and motivates this choice as suitable for a wide spectrum language to be used for designs as well as initial specifications, and supporting imperative and concurrent...

  6. Specific heats of degenerate ideal gases

    OpenAIRE

    Caruso, Francisco; Oguri, Vitor; Silveira, Felipe

    2017-01-01

    From arguments based on Heisenberg's uncertainty principle and Pauli's exclusion principle, the molar specific heats of degenerate ideal gases at low temperatures are estimated, giving rise to values consistent with the Nerst-Planck Principle (third law of Thermodynamics). The Bose-Einstein condensation phenomenon based on the behavior of specific heat of massive and non-relativistic boson gases is also presented.

  7. Shape configuration and category-specificity

    DEFF Research Database (Denmark)

    Gerlach, Christian; Law, Ian; Paulson, Olaf B.

    2006-01-01

    a recent account of category-specificity and lends support to the notion that category-specific impairments can occur for both natural objects and artefacts following damage to pre-semantic stages in visual object recognition. The implications of the present findings are discussed in relation to theories...

  8. Fundamental Characteristics of Industrial Variant Specification Systems

    DEFF Research Database (Denmark)

    Hansen, Benjamin Loer; Hvam, Lars

    2004-01-01

    fundamental concepts related to this task, which are relevant to understand for academia and practitioners working with the subject. This is done through a description of variant specification tasks and typical aspects of system solutions. To support the description of variant specification tasks and systems...

  9. SPECIFIC SKILLS AND SOCIAL COMPETENCE IN SCHIZOPHRENIA

    NARCIS (Netherlands)

    APPELO, MT; WOONINGS, FMJ; VANNIEUWENHUIZEN, CJ; EMMELKAMP, PMG; SLOOFF, CJ; LOUWERENS, JW

    Generalization of skills is a major problem in social skills training for schizophrenic patients. Assessment of skills is mostly not based on objective indices of specific skill deficits. The results of this study show that global competence of schizophrenics can be differentiated from specific

  10. Building finite automata from DI specifications

    NARCIS (Netherlands)

    Udding, J.T

    1998-01-01

    Numerous formalisms exist to specify delay-insensitive computations and their implementations. It is not always straightforward to compare specifications in the different formalisms. One way of comparing specifications is transforming them to automata in which nodes are annotated with progress

  11. The Specificity of Creativity: Figurative and Scientific

    Science.gov (United States)

    Bernal, Ana; Esparza, Javier; Ruiz, María-José; Ferrando, Mercedes; Sainz, Marta

    2017-01-01

    Introduction: This work tackles the question about the nature of creativity as a general vs. domain-specific ability. First we deal with the concept of creativity and then, the main approaches to the debate of generality vs. specificity are exposed. Method: A total of 133 students attending 3rd grade of secondary education in Murcia Region took…

  12. Efficient genre-specific semantic video indexing

    NARCIS (Netherlands)

    Wu, J.; Worring, M.

    2012-01-01

    Large video collections such as YouTube contain many different video genres, while in many applications the user might be interested in one or two specific video genres only. Thus, when users are querying the system with a specific semantic concept like AnchorPerson, and MovieStars, they are likely

  13. Autonomy Level Specification for Intelligent Autonomous Vehicles

    Science.gov (United States)

    2003-09-01

    Autonomy Level Specification for Intelligent Autonomous Vehicles : Interim Progress Report Hui-Min Huang, Elena Messina, James Albus...Level Specification for Intelligent Autonomous Vehicles : Interim Progress Report 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6

  14. 324 and 327 Facilities Environmental Effluent Specifications

    International Nuclear Information System (INIS)

    JOHNSON, D.L.

    1999-01-01

    These effluent specifications address requirements for the 324/321 Facilities, which are undergoing stabilization activities. Effluent specifications are imposed to protect personnel, the environment and the public, by ensuring adequate implementation and compliance with federal and state regulatory requirements and Hanford programs

  15. PCR specific for Actinobacillus pleuropneumoniae serotype 3

    DEFF Research Database (Denmark)

    Zhou, L.; Jones, S.C.P.; Angen, Øystein

    2008-01-01

    , but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...

  16. ITER ISS system alternative specification study

    International Nuclear Information System (INIS)

    Kveton, O.K.

    1990-08-01

    Recent comments suggested that the fuel systems, in particular the ISS, could be simplified if the ITER specifications were relaxed from the data specified for ITER. This interim report addresses the first part of the analysis, which considers the impact of design specifications on fuel systems design

  17. Plutonium Immobilization Can Loading Preliminary Specifications

    Energy Technology Data Exchange (ETDEWEB)

    Kriikku, E.

    1998-11-25

    This report discusses the Plutonium Immobilization can loading preliminary equipment specifications and includes a process block diagram, process description, equipment list, preliminary equipment specifications, plan and elevation sketches, and some commercial catalogs. This report identifies loading pucks into cans and backfilling cans with helium as the top priority can loading development areas.

  18. Technical specifications: Tower Shielding Reactor II

    International Nuclear Information System (INIS)

    1979-02-01

    The technical specifications define the key limitations that must be observed for safe operation of the Tower Shielding Reactor II (TSR-II) and an envelope of operation within which there is reasonable assurance that these limits cannot be exceeded. The specifications were written to satisfy the requirements of the Department of Energy (DOE) Manual Chapter 0540, September 1, 1972

  19. Development of technical specifications for research reactors

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    This standard identifies and establishes the content of technical specifications for research reactors. Areas addressed are: definitions, safety limits, limiting safety system settings, limiting conditions for operation, surveillance requirements, design features and administrative controls. Sufficient detail is incorporated so that applicable specifications can be derived or extracted

  20. 11 CFR 1.14 - Specific exemptions.

    Science.gov (United States)

    2010-01-01

    ... to refer apparent violations of the Act to the Attorney General or other law enforcement authorities... 11 Federal Elections 1 2010-01-01 2010-01-01 false Specific exemptions. 1.14 Section 1.14 Federal Elections FEDERAL ELECTION COMMISSION PRIVACY ACT § 1.14 Specific exemptions. (a) No individual, under the...

  1. Determining the specific electric resistance of rock

    Energy Technology Data Exchange (ETDEWEB)

    Persad' ko, V.Ia.

    1982-01-01

    Data are presented on perfecting the method of laboratory determination of the specific electric resistance of a rock formation. The average error in determining the specific electric resistance of the core at various locations is no more than two percent with low resistance values (2-5 ohms).

  2. Specific phobia predicts psychopathology in young women

    NARCIS (Netherlands)

    Trumpf, J.; Margraf, J.; Vriends, N.; Meyer, A.H.; Becker, E.S.

    2010-01-01

    Although specific phobia is characterized by an early age at onset and by high rates of comorbidity, few studies have examined comorbid relationships prospectively. The present study investigated the association between specific phobia and the risk of a broad range of psychopathology among young

  3. Screening specifications for Gulf Coast salt domes

    International Nuclear Information System (INIS)

    Brunton, G.D.; Laughon, R.B.; McClain, W.C.

    1978-01-01

    A reconnaissance survey of the salt domes of Mississippi, Louisiana, and east Texas is being planned to identify study areas for potential sites for radioactive waste disposal. Preliminary screening specifications were derived for each of the geological evaluation criteria by application of the significant factors that will have an impact on the reconnaissance survey. The procedure for the derivation of each screening specification is discussed. The screening specifications are the official OWI values to be used for the first-cut acceptance for salt dome study areas along the Gulf Coast. The derivation of the screening specifications is illustrated by (1) a statement of the geological evaluation criterion, (2) a discussion of the pertinent factors affecting the criterion, and (3) the evaluation of the value of the specification

  4. Tissue Specific Promoters in Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    A. R. Rama

    2015-01-01

    Full Text Available Colorectal carcinoma is the third most prevalent cancer in the world. In the most advanced stages, the use of chemotherapy induces a poor response and is usually accompanied by other tissue damage. Significant progress based on suicide gene therapy has demonstrated that it may potentiate the classical cytotoxic effects in colorectal cancer. The inconvenience still rests with the targeting and the specificity efficiency. The main target of gene therapy is to achieve an effective vehicle to hand over therapeutic genes safely into specific cells. One possibility is the use of tumor-specific promoters overexpressed in cancers. They could induce a specific expression of therapeutic genes in a given tumor, increasing their localized activity. Several promoters have been assayed into direct suicide genes to cancer cells. This review discusses the current status of specific tumor-promoters and their great potential in colorectal carcinoma treatment.

  5. Specifications in early conceptual design work

    DEFF Research Database (Denmark)

    Hansen, Claus Thorp; Andreasen, Mogens Myrup

    2007-01-01

    In early conceptual design the design team is working in an uncertain situation, where the understanding of a need is limited and not much is known about the solution space. In this situation the design team has to both analyse need and explore solution space. Thus, the team has to formulate design...... specifications, which express attractive product goals, and has to synthesise the product idea. The authors of this paper see a challenge to enhance and improve our understanding of the nature of design specifications as a means to support the synthesis of a product idea. In this empirical study we analyse...... the structure and content of design specifications during early ideation activities, where initial design specifications are formulated and a product idea is synthesised. We have analysed specification documents of 19 teams of novice designers. Our analysis indicates that a productive product design...

  6. Improvements to Technical Specifications surveillance requirements

    International Nuclear Information System (INIS)

    Lobel, R.; Tjader, T.R.

    1992-12-01

    In August 1983 an NRC task group was formed to investigate problems with surveillance testing required by Technical Specifications, and to recommend approaches to effect improvements. NUREG-1024 (''Technical Specifications-Enhancing Safety Impact'') resulted, and it contained recommendations to review the basis for test frequencies; to ensure that the tests promote safety and do not degrade equipment; and to review surveillance tests so that they do not unnecessarily burden personnel. The Technical Specifications Improvement Program (TSIP) was established in December 1984 to provide the framework for rewriting and improving the Technical Specifications. As an element of the TSIP, all Technical Specifications surveillance requirements were comprehensively examined as recommended in NUREG-1024. The results of that effort are presented in this report. The study found that while some testing at power is essential to verify equipment and system operability, safety can be improved, equipment degradation decreased, and unnecessary personnel burden relaxed by reducing the amount of testing at power

  7. Standard Technical Specifications, Babcock and Wilcox plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (STS) for Babcock and Wilcox (B ampersand W) Plants and documents the positions of the Nuclear Regulatory Commission based on the B ampersand W Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council (NUMARC). The unproved STS were developed based on the, criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop proved plant-specific technical specifications. This report contains three volumes. This document, Volume 1 contains the Specifications for all chapters and sections of the improved STS

  8. Rf system specifications for a linear accelerator

    International Nuclear Information System (INIS)

    Young, A.; Eaton, L.E.

    1992-01-01

    A linear accelerator contains many systems; however, the most complex and costly is the RF system. The goal of an RF system is usually simply stated as maintaining the phase and amplitude of the RF signal within a given tolerance to accelerate the charged particle beam. An RF system that drives a linear accelerator needs a complete system specification, which should contain specifications for all the subsystems (i.e., high-power RF, low-level RF, RF generation/distribution, and automation control). This paper defines a format for the specifications of these subsystems and discusses each RF subsystem independently to provide a comprehensive understanding of the function of each subsystem. This paper concludes with an example of a specification spreadsheet allowing one to input the specifications of a subsystem. Thus, some fundamental parameters (i.e., the cost and size) of the RF system can be determined

  9. Specificity of transmembrane protein palmitoylation in yeast.

    Directory of Open Access Journals (Sweden)

    Ayelén González Montoro

    Full Text Available Many proteins are modified after their synthesis, by the addition of a lipid molecule to one or more cysteine residues, through a thioester bond. This modification is called S-acylation, and more commonly palmitoylation. This reaction is carried out by a family of enzymes, called palmitoyltransferases (PATs, characterized by the presence of a conserved 50- aminoacids domain called "Asp-His-His-Cys- Cysteine Rich Domain" (DHHC-CRD. There are 7 members of this family in the yeast Saccharomyces cerevisiae, and each of these proteins is thought to be responsible for the palmitoylation of a subset of substrates. Substrate specificity of PATs, however, is not yet fully understood. Several yeast PATs seem to have overlapping specificity, and it has been proposed that the machinery responsible for palmitoylating peripheral membrane proteins in mammalian cells, lacks specificity altogether.Here we investigate the specificity of transmembrane protein palmitoylation in S. cerevisiae, which is carried out predominantly by two PATs, Swf1 and Pfa4. We show that palmitoylation of transmembrane substrates requires dedicated PATs, since other yeast PATs are mostly unable to perform Swf1 or Pfa4 functions, even when overexpressed. Furthermore, we find that Swf1 is highly specific for its substrates, as it is unable to substitute for other PATs. To identify where Swf1 specificity lies, we carried out a bioinformatics survey to identify amino acids responsible for the determination of specificity or Specificity Determination Positions (SDPs and showed experimentally, that mutation of the two best SDP candidates, A145 and K148, results in complete and partial loss of function, respectively. These residues are located within the conserved catalytic DHHC domain suggesting that it could also be involved in the determination of specificity. Finally, we show that modifying the position of the cysteines in Tlg1, a Swf1 substrate, results in lack of palmitoylation, as

  10. Validating Avionics Conceptual Architectures with Executable Specifications

    Directory of Open Access Journals (Sweden)

    Nils Fischer

    2012-08-01

    Full Text Available Current avionics systems specifications, developed after conceptual design, have a high degree of uncertainty. Since specifications are not sufficiently validated in the early development process and no executable specification exists at aircraft level, system designers cannot evaluate the impact of their design decisions at aircraft or aircraft application level. At the end of the development process of complex systems, e. g. aircraft, an average of about 65 per cent of all specifications have to be changed because they are incorrect, incomplete or too vaguely described. In this paper, a model-based design methodology together with a virtual test environment is described that makes complex high level system specifications executable and testable during the very early levels of system design. An aircraft communication system and its system context is developed to demonstrate the proposed early validation methodology. Executable specifications for early conceptual system architectures enable system designers to couple functions, architecture elements, resources and performance parameters, often called non-functional parameters. An integrated executable specification at Early Conceptual Architecture Level is developed and used to determine the impact of different system architecture decisions on system behavior and overall performance.

  11. Position paper: the science of deep specification.

    Science.gov (United States)

    Appel, Andrew W; Beringer, Lennart; Chlipala, Adam; Pierce, Benjamin C; Shao, Zhong; Weirich, Stephanie; Zdancewic, Steve

    2017-10-13

    We introduce our efforts within the project 'The science of deep specification' to work out the key formal underpinnings of industrial-scale formal specifications of software and hardware components, anticipating a world where large verified systems are routinely built out of smaller verified components that are also used by many other projects. We identify an important class of specification that has already been used in a few experiments that connect strong component-correctness theorems across the work of different teams. To help popularize the unique advantages of that style, we dub it deep specification , and we say that it encompasses specifications that are rich , two-sided , formal and live (terms that we define in the article). Our core team is developing a proof-of-concept system (based on the Coq proof assistant) whose specification and verification work is divided across largely decoupled subteams at our four institutions, encompassing hardware microarchitecture, compilers, operating systems and applications, along with cross-cutting principles and tools for effective specification. We also aim to catalyse interest in the approach, not just by basic researchers but also by users in industry.This article is part of the themed issue 'Verified trustworthy software systems'. © 2017 The Author(s).

  12. Cell-cycle phase specificity of chloroethylnitrosoureas

    International Nuclear Information System (INIS)

    Linfoot, P.A.

    1986-01-01

    Although the cancer chemotherapeutic agent 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) is considered a non-cell cycle phase specific drug, it has been shown to produce differential cell killing in G 1 , S, and G 2 /M phase cells, with S phase cells appearing relatively resistant. Studies of cell cycle phase specific cell killing produced by nitrosoureas with different chemical reactivities, clearly indicated that the ability of compounds to cross-link DNA was important in determining their phase specificity. Cells that lacked guanine O 6 -alkytransferase activity showed similar patterns of BCNU phase specificity regardless of their intrinsic sensitivity to BCNU. DNA inter-strand cross-linking, as measured by alkaline elution, was similar in cells exposed to BCNU in G 1 or S phase. 3 H [1-chloroethyl-1nitrosourea] binding to DNA was the same in G 1 , S and G 2 /M phase cells indicating that phase-specific differences in drug uptake and intracellular drug dose were not responsible for phase specific cell kill. These studies suggest that cross-link lesions, other than DNA inter-strand cross-links, and/or effects on DNA repair, other than guanine O 6 -alkyltransferase, are additional important determinants of BCNU phase specific cell killing

  13. Formal specifications for safety grade systems

    International Nuclear Information System (INIS)

    Chisholm, G.H.; Smith, B.T.; Wojcik, A.S.

    1992-01-01

    The authors describe the findings of a study into the application of formal methods to the specification of a safety system for an operating nuclear reactor. They developed a formal specification that is used to verify and validate that no unsafe condition will result from action or inaction of the system. For this reason, the specification must facilitate thinking about, talking about, and implementing the system. In fact, the specification must provide a bridge between people (designers, engineers, policy makers) and diverse implementations (hardware, software, sensors, power supplies) at all levels. For a specification to serve as an effective linkage, it must have the following properties: (1) completeness, (2) conciseness, (3) unambiguity, and (4) communicativeness. In this paper they describe the development of a specification that has three properties. This development is based on the use of formal methods, i.e., methods that add mathematical rigor to the development, analysis and operation of computer systems and to applications based thereon (Neumann). They demonstrate that a specification derived from a formal basis facilitates development of the design and its subsequent verification

  14. Non-specific immunization against babesiosis

    International Nuclear Information System (INIS)

    Cox, F.E.G.

    1980-01-01

    The rodent babesias, Babesia rodhaini and the less virulent B. microti, are useful models with which to study immunity to and immunization against babesiosis. In contrast with the difficulty in inducing specific immunity to these parasites it is comparatively easy to induce non-specific immunity by prior exposure to related and unrelated intra-erythrocytic protozoa, micro-organisms such as Mycobacterium bovis (BCG) and Corynebacterium parvum, microbial extracts and muramyl dipeptide. This non-specific immunity is long lasting and extremely effective. It is characterized by the facts that (a) it occurs early in the infection at the height of the first peak of parasitaemia, and (b) it involves the intra-erythrocytic death of the parasites. After the primary parasitaemia has resolved, some parasites continue to persist at a low level and when introduced into clean mice produce only low-level 'attenuated' infections in these. Non-specific immunity is not equally effective in all strains of mice. It is suggested that immunity to babesiosis, and infections caused by other intra-erythrocytic protozoa, involves two mechanisms, the first non-specific and the second specific. The actual balance between these two mechanisms varies from parasite to parasite and from host to host. An effective vaccine would have to be based on an understanding of the roles of non-specific immunity in the actual disease under consideration, and would ideally combine an adjuvant that would also stimulate non-specific immunity and an attenuated strain of parasite that would induce a specific response. (author)

  15. Assessment of the specificity of norethisterone radioimmunoassays

    Energy Technology Data Exchange (ETDEWEB)

    Bedolla-Tovar, N; Rahman, S A; Cekan, S Z; Diczfalusy, E [Swedish Medical Research Council, Karolinska Hospital, Stockholm

    1978-06-01

    It is concluded that (1) the significance of cross- reaction studies as well as that of the parallelism test for the assessment of the over-all specificity of the assay is limited, (2) a single chromatography prior to the radioimmunoassay proper improves the assay specificity, but may not be sufficient to remove all interfering compounds, (3) a comparison of the direct and chromatographic assay procedures using several antisera is useful for the selection of the relatively most specific radioimmunoassay procedure. In the present study, this is the technique employing either antiserum C or antiserum D, the latter, however, only after chromatography.

  16. PD-L1-specific T cells

    DEFF Research Database (Denmark)

    Ahmad, Shamaila Munir; Borch, Troels Holz; Hansen, Morten

    2016-01-01

    -specific T cells that recognize both PD-L1-expressing immune cells and malignant cells. Thus, PD-L1-specific T cells have the ability to modulate adaptive immune reactions by reacting to regulatory cells. Thus, utilization of PD-L1-derived T cell epitopes may represent an attractive vaccination strategy...... for targeting the tumor microenvironment and for boosting the clinical effects of additional anticancer immunotherapy. This review summarizes present information about PD-L1 as a T cell antigen, depicts the initial findings about the function of PD-L1-specific T cells in the adjustment of immune responses...

  17. Quality Assurance for Iraqi Bottled Water Specifications

    Directory of Open Access Journals (Sweden)

    May George Kassir

    2015-10-01

    Full Text Available In this research the specifications of Iraqi drinking bottled water brands are investigated throughout the comparison between local brands, Saudi Arabia and the World Health Organization (WHO for bottled water standard specifications. These specifications were also compared to that of Iraqi Tap Water standards. To reveal variations in the specifications for Iraqi bottled water, and above mentioned standards some quality control tools are conducted for more than 33% of different bottled water brands (of different origins such as spring, purified,..etc in Iraq by investigating the selected quality parameters registered on their marketing labels. Results employing Minitab software (ver. 16 to generate X bar, and Pareto chart. It was found from X bar charts that the quality parameters of some drinking bottled water brands are not within Iraqi standards set by the “Central Agency for Standardization and Quality Control” such as pH values, Fe, Na, and Mg concentrations. While the comparison of previously mentioned standard specifications through radar chart many important issues are detected such as the absence of lower limits the whole bottled water quality parameters such as for Na and Mg also the radar chart shows that Iraqi bottled and tap water specifications are almost equal in their quality values. Also the same chart pictured the limited range of Iraqi specifications compared to that of Saudi Arabia, and WHO and the need to introduce other water specifications such as K, Na, etc. This confirms the need to improve Iraqi bottled water specifications since it was introduced on 2000. These results also highlighted the weakness of quality assurance activities since only 33 % of the investigated companies registered the whole water quality specifications as shown in Pareto chart. Other companies do not register any quality characteristics. Also certain companies should be stopped due to non-conforming specifications, yet these companies are

  18. Technical specification optimization program - engineered safety features

    International Nuclear Information System (INIS)

    Andre, G.R.; Jansen, R.L.

    1986-01-01

    The Westinghouse Technical Specification Program (TOP) was designed to evaluate on a quantitative basis revisions to Nuclear Power Plant Technical Specifications. The revisions are directed at simplifying plant operation, and reducing unnecessary transients, shutdowns, and manpower requirements. In conjunction with the Westinghouse Owners Group, Westinghouse initiated a program to develop a methodology to justify Technical Specification revisions; particularly revisions related to testing and maintenance requirements on plant operation for instrumentation systems. The methodology was originally developed and applied to the reactor trip features of the reactor protection system (RPS). The current study further refined the methodology and applied it to the engineered safety features of the RPS

  19. Table of specific activities of selected isotopes

    International Nuclear Information System (INIS)

    Shipley, G.

    The bulk of this publication consists of a table of the half-lives, decay modes, and specific activities of isotopes selected for their particular interest to the Environmental Health and Safety Department, LBL. The specific activities were calculated with a PDP 9/15 computer. Also included in the report is a table of stable isotopes, the Th and U decay chains, a chart of the nuclides for elements 101 through 106, the heavy element region of the periodic table, and a specific activity monograph. 5 figures, 2 tables

  20. Mining software specifications methodologies and applications

    CERN Document Server

    Lo, David

    2011-01-01

    An emerging topic in software engineering and data mining, specification mining tackles software maintenance and reliability issues that cost economies billions of dollars each year. The first unified reference on the subject, Mining Software Specifications: Methodologies and Applications describes recent approaches for mining specifications of software systems. Experts in the field illustrate how to apply state-of-the-art data mining and machine learning techniques to address software engineering concerns. In the first set of chapters, the book introduces a number of studies on mining finite

  1. Breckinridge Project, initial effort. Report III, Volume 2. Specifications

    Energy Technology Data Exchange (ETDEWEB)

    None

    1982-01-01

    Report III, Volume 2 contains those specifications numbered K through Y, as follows: Specifications for Compressors (K); Specifications for Piping (L); Specifications for Structures (M); Specifications for Insulation (N); Specifications for Electrical (P); Specifications for Concrete (Q); Specifications for Civil (S); Specifications for Welding (W); Specifications for Painting (X); and Specifications for Special (Y). The standard specifications of Bechtel Petroleum Incorporated have been amended as necessary to reflect the specific requirements of the Breckinridge Project and the more stringent specifications of Ashland Synthetic Fuels, Inc. These standard specifications are available for the Initial Effort (Phase Zero) work performed by all contractors and subcontractors.

  2. Interior Design's Role in Educational Specifications.

    Science.gov (United States)

    Keller, Mary Ann

    1986-01-01

    An experienced interior designer, equipped with a well-written educational specification, will specify the best materials and coordinate colors, materials, and furnishings in line with the district's budget. (MLF)

  3. Cockpit management and Specific Behavioral Objectives (SBOs)

    Science.gov (United States)

    Mudge, R. W.

    1987-01-01

    One of the primary tools used to accomplish the task of effective training is the specific behavioral objective (SBO). An SBO is simply a statement which specifically identifies a small segment of the final behavior sought, and a little more. The key word is specific. The company pinpoints exactly what it is it wants the pilot to do after completing training, and what it should evaluate from the point of view of both the program and the pilot. It tells the junior crewmember exactly, specifically, what he should monitor and support insofar as the management function is concerned. It gives greater meaning to the term second in command. And finally, it tells the supervisory pilot exactly what he should observe, evaluate, and instruct, insofar as the management function is concerned.

  4. 14 CFR 211.10 - Filing specifications.

    Science.gov (United States)

    2010-01-01

    ...) ECONOMIC REGULATIONS APPLICATIONS FOR PERMITS TO FOREIGN AIR CARRIERS General Requirements § 211.10 Filing... in § 302.3 of this chapter as to execution, number of copies, and formal specifications of papers. (b...

  5. Non-specific immunization against parasites

    International Nuclear Information System (INIS)

    Cox, F.E.G.

    1981-01-01

    Non-specific resistance to tumours can be induced by pretreating animals with micro-organisms, microbial extracts or various synthetic substances. Mycobacterium bovis, Corynebacterium parvum and a number of other micro-organisms also protect mice against rodent piroplasms and there is evidence that they are also protective against other parasites including Schistosoma mansoni. The actual mechanisms of non-specific immunity are still unclear but it is influenced by both the genetic make-up of the host and the nature of the parasite. Non-specific immunization may be a possible alternative to specific immunization and may avoid many of the potential immunopathological changes induced during parasite infections. Irradiated vaccines (Dictyocaulus viviparus, schistomiasis) are mentioned marginally only

  6. Standard specification for silvered flat glass mirror

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This specification covers the requirements for silvered flat glass mirrors of rectangular shape supplied as cut sizes, stock sheets or as lehr ends and to which no further processing (such as edgework or other fabrication) has been done. 1.2 This specification covers the quality requirements of silvered annealed monolithic clear and tinted flat glass mirrors up to 6 mm (¼ in.) thick. The mirrors are intended to be used indoors for mirror glazing, for components of decorative accessories or for similar uses. 1.3 This specification does not address safety glazing materials nor requirements for mirror applications. Consult model building codes and other applicable standards for safety glazing applications. 1.4 Mirrors covered in this specification are not intended for use in environments where high humidity or airborne corrosion promoters, or both, are consistently present (such as swimming pool areas, ocean-going vessels, chemical laboratories and other corrosive environments). 1.5 The dimensional val...

  7. Chemical cleaning specification: few tube test model

    International Nuclear Information System (INIS)

    Hampton, L.V.; Simpson, J.L.

    1979-09-01

    The specification is for the waterside chemical cleaning of the 2 1/4 Cr - 1 Mo steel steam generator tubes. It describes the reagents and conditions for post-chemical cleaning passivation of the evaporator tubes

  8. Performance evaluation and specification of trackless tack.

    Science.gov (United States)

    2016-09-01

    Several trackless tack products have come to market in Texas; however, there are currently no specifications to : ensure the products have trackless properties and adequate bond strength. The objectives of this project were to : (1) evaluate the trac...

  9. ROS signalling – Specificity is required

    DEFF Research Database (Denmark)

    Møller, Ian Max; Sweetlove, Lee J

    2011-01-01

    The production of reactive oxygen species (ROS) increases in plants under stress. ROS can damage cellular components, but they can also act in signal transduction to help the cell counteract the oxidative damage in the stressed compartment. H2O2 may induce a general stress response, but it does...... messengers and regulate source-specific genes and in this way contribute to retrograde ROS signalling during oxidative stress. (This is a new project funded by FNU) References: Møller, I.M. & Sweetlove, L.J. 2010. ROS signalling – Specificity is required. Trends Plant Sci. 15: 370-374...... not have the required specificity to selectively regulate nuclear genes required for dealing with localized stress, e.g., in chloroplasts or mitochondria. We here argue that peptides deriving from proteolytic breakdown of oxidatively damaged proteins have the requisite specificity to act as secondary ROS...

  10. Technical specifications: Health Physics Research Reactor

    International Nuclear Information System (INIS)

    1986-03-01

    These technical specifications define the key limitations that must be observed for safe operation of the Health Physics Research Reactor (HPRR) and an envelope of operation within which there is assurance that these limits will not be exceeded

  11. Iteration and Prototyping in Creating Technical Specifications.

    Science.gov (United States)

    Flynt, John P.

    1994-01-01

    Claims that the development process for computer software can be greatly aided by the writers of specifications if they employ basic iteration and prototyping techniques. Asserts that computer software configuration management practices provide ready models for iteration and prototyping. (HB)

  12. Computational network design from functional specifications

    KAUST Repository

    Peng, Chi Han; Yang, Yong Liang; Bao, Fan; Fink, Daniel; Yan, Dongming; Wonka, Peter; Mitra, Niloy J.

    2016-01-01

    of people in a workspace. Designing such networks from scratch is challenging as even local network changes can have large global effects. We investigate how to computationally create networks starting from only high-level functional specifications

  13. Double-Shell Tank (DST) Utilities Specification

    International Nuclear Information System (INIS)

    SUSIENE, W.T.

    2000-01-01

    This specification establishes the performance requirements and provides the references to the requisite codes and standards to he applied during the design of the Double-Shell Tank (DST) Utilities Subsystems that support the first phase of waste feed delivery (WFD). The DST Utilities Subsystems provide electrical power, raw/potable water, and service/instrument air to the equipment and structures used to transfer low-activity waste (LAW) and high-level waste (HLW) to designated DST staging tanks. The DST Utilities Subsystems also support the equipment and structures used to deliver blended LAW and HLW feed from these staging tanks to the River Protection Project (RPP) Privatization Contractor facility where the waste will be immobilized. This specification is intended to be the basis for new projects/installations. This specification is not intended to retroactively affect previously established project design criteria without specific direction by the program

  14. Specific energy released in power reactors

    International Nuclear Information System (INIS)

    Zaritskaya, T.S.; Kiselev, G.V.; Rudik, A.P.; Tsenter, Eh.M.

    1986-01-01

    Technique of determination are described and analysis of specific energy for different methods of critically maintance of RBMK and WWER-440 reactors are conducted. Characteristics of the optimal mode of critically maintanance are determined

  15. Finding Specification Pages from the Web

    Science.gov (United States)

    Yoshinaga, Naoki; Torisawa, Kentaro

    This paper presents a method of finding a specification page on the Web for a given object (e.g., ``Ch. d'Yquem'') and its class label (e.g., ``wine''). A specification page for an object is a Web page which gives concise attribute-value information about the object (e.g., ``county''-``Sauternes'') in well formatted structures. A simple unsupervised method using layout and symbolic decoration cues was applied to a large number of the Web pages to acquire candidate attributes for each class (e.g., ``county'' for a class ``wine''). We then filter out irrelevant words from the putative attributes through an author-aware scoring function that we called site frequency. We used the acquired attributes to select a representative specification page for a given object from the Web pages retrieved by a normal search engine. Experimental results revealed that our system greatly outperformed the normal search engine in terms of this specification retrieval.

  16. High Flux Isotope Reactor technical specifications

    International Nuclear Information System (INIS)

    1985-11-01

    This report gives technical specifications for the High Flux Isotope Reactor (HFIR) on the following: safety limits and limiting safety system settings; limiting conditions for operation; surveillance requirements; design features; and administrative controls

  17. Cdc42-mediated tubulogenesis controls cell specification

    DEFF Research Database (Denmark)

    Kesavan, Gokul; Sand, Fredrik Wolfhagen; Greiner, Thomas Uwe

    2009-01-01

    Understanding how cells polarize and coordinate tubulogenesis during organ formation is a central question in biology. Tubulogenesis often coincides with cell-lineage specification during organ development. Hence, an elementary question is whether these two processes are independently controlled......, or whether proper cell specification depends on formation of tubes. To address these fundamental questions, we have studied the functional role of Cdc42 in pancreatic tubulogenesis. We present evidence that Cdc42 is essential for tube formation, specifically for initiating microlumen formation and later...... for maintaining apical cell polarity. Finally, we show that Cdc42 controls cell specification non-cell-autonomously by providing the correct microenvironment for proper control of cell-fate choices of multipotent progenitors. For a video summary of this article, see the PaperFlick file with the Supplemental Data...

  18. Site-specific weed control technologies

    DEFF Research Database (Denmark)

    Christensen, Svend; Søgaard, Henning Tangen; Kudsk, Per

    2009-01-01

    Site-specific weed control technologies are defined as machinery or equipment embedded with technologies that detect weeds growing in a crop and, taking into account predefined factors such as economics, takes action to maximise the chances of successfully controlling them. In the article, we...... describe the basic parts of site specific weed control technologies, comprising of weed sensing systems, weed management models and precision weed control implements. A review of state-of-the-art technologies shows that several weed sensing systems and precision implements have been developed over the last...... of knowledge about the economic and environmental potential for increasing the resolution of weed control. The integration of site-specific information on weed distribution, weed species composition and density, and the effect on crop yield, is decisive for successful site-specific weed management.   Keywords...

  19. Cancer Chemotherapy Specific to Acidic Nests.

    Science.gov (United States)

    Kobayashi, Hiroshi

    2017-04-20

    The realization of cancer therapeutics specific to cancer cells with less of an effect on normal tissues is our goal. Many trials have been carried out for this purpose, but this goal is still far from being realized. It was found more than 80 years ago that solid cancer nests are acidified, but in vitro studies under acidic conditions have not been extensively studied. Recently, in vitro experiments under acidic conditions were started and anti-cancer drugs specific to acidic areas have been identified. Many genes have been reported to be expressed at a high level under acidic conditions, and such genes may be potent targets for anti-cancer drugs specific to acidic nests. In this review article, recent in vitro, in vivo, and clinical achievements in anti-cancer drugs with marked efficacy under acidic conditions are summarized, and the clinical use of anti-cancer drugs specific to acidic nests is discussed.

  20. Specification for symbol for ionizing radiation

    International Nuclear Information System (INIS)

    1974-01-01

    This Malaysia Standard specification specifies a symbol recommended for use only to signify the actual or potential presence of ionizing radiation (#betta#, α, #betta# only) and to identify objects, devices, materials or combinations of materials which emit such radiation. (author)

  1. Standard Technical Specifications, Babcock and Wilcox Plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (STS) for Babcock and Wilcox (B ampersand W) plants and documents the positions of the Nuclear Regulatory Commission (NRC) based on the B ampersand W Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council. The improved STS were developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for developing improved plant-specific technical specifications by individual nuclear power plant licensees. This volume contains sections 3.4--3.9 which cover: Reactor coolant systems, emergency core cooling systems, containment systems, plant systems, electrical power systems, refueling operations

  2. Factors influencing women's decisions to purchase specific ...

    African Journals Online (AJOL)

    aimed at identifying the factors that influence women's decisions to purchase specific .... influence of all the factors influencing their decision to purchase a selected .... one free” promotions seemed to have had the greatest influence on this ...

  3. Disease specific therapies in leukodystrophies and leukoencephalopathies

    NARCIS (Netherlands)

    Helman, Guy; van Haren, Keith; Bonkowsky, Joshua L.; Bernard, Genevieve; Pizzino, Amy; Braverman, Nancy; Suhr, Dean; Patterson, Marc C.; Ali Fatemi, S.; Leonard, Jeff; van der Knaap, Marjo S.; Back, Stephen A.; Damiani, Stephen; Goldman, Steven A.; Takanohashi, Asako; Petryniak, Magdalena; Rowitch, David; Messing, Albee; Wrabetz, Lawrence; Schiffmann, Raphael; Eichler, Florian; Escolar, Maria L.; Vanderver, Adeline

    2015-01-01

    Leukodystrophies are a heterogeneous, often progressive group of disorders manifesting a wide range of symptoms and complications. Most of these disorders have historically had no etiologic or disease specific therapeutic approaches. Recently, a greater understanding of the pathologic mechanisms

  4. Peptide binding specificity of the chaperone calreticulin

    DEFF Research Database (Denmark)

    Sandhu, N.; Duus, K.; Jorgensen, C.S.

    2007-01-01

    Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length and composit......Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length...... than 5 amino acids showed binding and a clear correlation with hydrophobicity was demonstrated for oligomers of different hydrophobic amino acids. Insertion of hydrophilic amino acids in a hydrophobic sequence diminished or abolished binding. In conclusion our results show that calreticulin has...

  5. Prostate-Specific Antigen (PSA) Test

    Science.gov (United States)

    ... Cancer Prostate Cancer Screening Research Prostate-Specific Antigen (PSA) Test On This Page What is the PSA ... parts of the body before being detected. The PSA test may give false-positive or false-negative ...

  6. Bottomland Hardwood Planting: Example Contract Specifications

    National Research Council Canada - National Science Library

    Humprey, Monica

    2002-01-01

    This technical note provides an example of contract specifications that can be used as a template by USACE biologists, engineers, or contracting officers for contracting the planting of bottomland hardwood (BLH) seedlings...

  7. Specific detection of proteins using Nanomechanical resonators

    DEFF Research Database (Denmark)

    Fischer, Lee MacKenzie; Wright, V.A.; Guthy, C.

    2008-01-01

    of probes onto their surfaces in order to enable the specificity of the detection. Such nanoresonator-based specific detection of proteins is here reported using streptavidin as target system, and immobilized biotin as probe. Nanomechanical resonators resistant to stiction were first realized from silicon...... carbonitride using a novel fabrication method. Vapor-phase deposition of mercaptopropyl trimethoxysilane was performed, and an added mass of 2.22 +/- 0.07 fg/mu m(2) was measured. This linker molecule was used to attach biotin onto the devices, enabling the specific detection of streptavidin. A mass of 3.6 fg....../mu m(2) was attributed to the added streptavidin, corresponding to one molecule per 27 nm(2). The specificity of this recognition was confirmed by exposing the devices to a solution of streptavidin that was already saturated with biotin. An additional negative control was also performed by also...

  8. Analyzing Security-Enhanced Linux Policy Specifications

    National Research Council Canada - National Science Library

    Archer, Myla

    2003-01-01

    NSA's Security-Enhanced (SE) Linux enhances Linux by providing a specification language for security policies and a Flask-like architecture with a security server for enforcing policies defined in the language...

  9. Technical specifications for the bulk shielding reactor

    International Nuclear Information System (INIS)

    1986-05-01

    This report provides information concerning the technical specifications for the Bulk Shielding Reactor. Areas covered include: safety limits and limiting safety settings; limiting conditions for operation; surveillance requirements; design features; administrative controls; and monitoring of airborne effluents. 10 refs

  10. Technical specifications for the pool critical assembly

    International Nuclear Information System (INIS)

    1978-07-01

    Technical specifications for the ORNL-PCA Reactor are presented concerning safety limits and limiting safety system settings, limiting conditions for operation, surveillance requirements, design features, and administrative controls

  11. Index to Drug-Specific Information

    Science.gov (United States)

    ... Postmarket Drug Safety Information for Patients and Providers Index to Drug-Specific Information Share Tweet Linkedin Pin ... options Linkedin Pin it Email Print Note: This Index does not include all FDA approved drugs. It ...

  12. Regression of mouse-derived renal cancer by adoptive transfer of ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Mizuguchi et al., 2005) and negative control shRNA targeting none specific gene ..... factor-beta type II receptor suppresses ocular inflammation and fibrosis. ... in bone marrow cells through a retroviral-mediated gene therapy in mice.

  13. Project NEO Specific Impulse Testing Solutions

    Science.gov (United States)

    Baffa, Bill

    2018-01-01

    The Neo test stand is currently configured to fire a horizontally mounted rocket motor with up to 6500 lbf thrust. Currently, the Neo test stand can measure flow of liquid propellant and oxidizer, pressures residing in the closed system up to the combustion chamber. The current configuration does not have the ability to provide all data needed to compute specific impulse. This presents three methods to outfit the NEO test fixture with instrumentation allowing for calculation of specific impulse.

  14. Affect and person specificity in mood regulation

    OpenAIRE

    Corby, Emma Kate

    2007-01-01

    489 university students in three countries completed questionnaires in a study investigating affect and person specificity in the use of mood regulation strategies. The major aims of the study were to (1) describe the relationship between specific affective states and the strategies utilised, (2) explore the role that individual differences variables played in the tendency to use particular strategies, and (3) measure the impact that the use of different strategies had upon subjective well-b...

  15. Production of Monoclonal Antibodies specific for Progesterone

    OpenAIRE

    YÜCEL, Fatıma

    2014-01-01

    Progesterone levels in milk and serum are indicators of pregnancy in cattle. The progesterone level reaches a peak on the 21 st and 22 nd days of pregnancy. Monoclonal antibodies specific to progesterone could be used for the immunodetection of milk and serum progesterone levels. We report here the development of hybrid cells prdoducing monoclonal antibodies specific for progesterone using hybridoma technology. Hybridoma cells secreting monoclonal antibodies against progesterone (MAM 2H1...

  16. Chemical and radiochemical specifications - PWR power plants

    International Nuclear Information System (INIS)

    Stutzmann, A.

    1997-01-01

    Published by EDF this document gives the chemical specifications of the PWR (Pressurized Water Reactor) nuclear power plants. Among the chemical parameters, some have to be respected for the safety. These parameters are listed in the STE (Technical Specifications of Exploitation). The values to respect, the analysis frequencies and the time states of possible drops are noticed in this document with the motion STE under the concerned parameter. (A.L.B.)

  17. [Psychological specificities of living donor kidney transplantation].

    Science.gov (United States)

    Papeloux-Heitzmann, Élodie

    2016-12-01

    For people with end-stage kidney disease, a transplant is the promise of a future without dialysis. Living donor kidney transplantation comprises many specificities and is distinct from cadaveric donor transplantation. Some psychological aspects explain these specificities. They may be subconscious and difficult to access, but it is essential to decipher them in order to adapt the support provided to these people. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  18. Patient-Specific Modeling in Tomorrow's Medicine

    CERN Document Server

    2012-01-01

    This book reviews the frontier of research and clinical applications of Patient Specific Modeling, and provides a state-of-the-art update as well as perspectives on future directions in this exciting field. The book is useful for medical physicists, biomedical engineers and other engineers who are interested in the science and technology aspects of Patient Specific Modeling, as well as for radiologists and other medical specialists who wish to be updated about the state of implementation.

  19. Task-Specific Training and Job Design

    OpenAIRE

    Felipe Balmaceda

    2006-01-01

    This paper provides a simple theoretical framework based on a new type of human capital introduced by Gibbons and Waldman (2004), called task-specific training, to understand job design. Mainly, in the presence of task-specific training, promotions might result ex-post in the underutilization of human capital and thus firms at the time of designing jobs should attempt to diversify this risk.

  20. Specific phobia predicts psychopathology in young women

    OpenAIRE

    Trumpf, Julia; Margraf, Jürgen; Vriends, Noortje; Meyer, Andrea Hans; Becker, Eni S.

    2010-01-01

    Background Although specific phobia is characterized by an early age at onset and by high rates of comorbidity, few studies have examined comorbid relationships prospectively. Objectives The present study investigated the association between specific phobia and the risk of a broad range of psychopathology among young women in the community. Method Data came from the Dresden Predictor Study in which 1,538 German women (18?25?years) completed a diagnostic interview at two time points. Results W...

  1. Enzyme specific activity in functionalized nanoporous supports

    International Nuclear Information System (INIS)

    Lei Chenghong; Soares, Thereza A; Shin, Yongsoon; Liu Jun; Ackerman, Eric J

    2008-01-01

    Here we reveal that enzyme specific activity can be increased substantially by changing the protein loading density (P LD ) in functionalized nanoporous supports so that the enzyme immobilization efficiency (I e , defined as the ratio of the specific activity of the immobilized enzyme to the specific activity of the free enzyme in solution) can be much higher than 100%. A net negatively charged glucose oxidase (GOX) and a net positively charged organophosphorus hydrolase (OPH) were entrapped spontaneously in NH 2 - and HOOC-functionalized mesoporous silica (300 A, FMS) respectively. The specific activity of GOX entrapped in FMS increased with decreasing P LD . With decreasing P LD , I e of GOX in FMS increased from 150%. Unlike GOX, OPH in HOOC-FMS showed increased specific activity with increasing P LD . With increasing P LD , the corresponding I e of OPH in FMS increased from 100% to>200%. A protein structure-based analysis of the protein surface charges directing the electrostatic interaction-based orientation of the protein molecules in FMS demonstrates that substrate access to GOX molecules in FMS is limited at high P LD , consequently lowering the GOX specific activity. In contrast, substrate access to OPH molecules in FMS remains open at high P LD and may promote a more favorable confinement environment that enhances the OPH activity

  2. Autobiographical memory specificity in dissociative identity disorder.

    Science.gov (United States)

    Huntjens, Rafaële J C; Wessel, Ineke; Hermans, Dirk; van Minnen, Agnes

    2014-05-01

    A lack of adequate access to autobiographical knowledge has been related to psychopathology. More specifically, patients suffering from depression or a history of trauma have been found to be characterized by overgeneral memory, in other words, they show a relative difficulty in retrieving a specific event from memory located in time and place. Previous studies of overgeneral memory have not included patients with dissociative disorders. These patients are interesting to consider, as they are hypothesized to have the ability to selectively compartmentalize information linked to negative emotions. This study examined avoidance and overgeneral memory in patients with dissociative identity disorder (DID; n = 12). The patients completed the autobiographical memory test (AMT). Their performance was compared with control groups of posttraumatic stress disorder (PTSD) patients (n = 26), healthy controls (n = 29), and DID simulators (n = 26). Specifically, we compared the performance of separate identity states in DID hypothesized to diverge in the use of avoidance as a coping strategy to deal with negative affect. No significant differences in memory specificity were found between the separate identities in DID. Irrespective of identity state, DID patients were characterized by a lack of memory specificity, which was similar to the lack of memory specificity found in PTSD patients. The converging results for DID and PTSD patients add empirical evidence for the role of overgeneral memory involved in the maintenance of posttraumatic psychopathology.

  3. Standardized Technical Specifications for Westinghouse PWRs

    International Nuclear Information System (INIS)

    1978-01-01

    This Standard Technical Specification (STS) has been structured for the broadest possible use on Westinghouse plants currently being reviewed for an Operating License. Accordingly, the document contains specifications applicable to plants (1) with either 3 or 4 loops and (2) with and without loop stop valves. In addition, four separate and discrete containment specification sections are provided for each of the following containment types: Atmospheric, Ice Condenser, Sub-Atmospheric, and Dual. Optional specifications are provided for those features and systems which may be included in individual plant designs but are not generic in their scope of application. Alternate specifications are provided in a limited number of cases to cover situations where alternate specification requirements are necessary on a generic basis because of design differences. The format of the STS addresses the categories required by 10 CFR 50 and consists of six sections covering the areas of: Definitions, Safety Limits and Limiting Safety System Settings, Limiting Conditions for Operation, Surveillance Requirements, Design Features, and Administrative Controls

  4. Age-specific reference ranges of serum prostate-specific antigen in Iranian men

    Directory of Open Access Journals (Sweden)

    Gholamreza Pourmand

    2015-08-01

    Conclusion: Findings of the present study showed that PSA levels are correlated with age. It was also revealed that the PSA age-specific reference range obtained in this study is different from other races and is specific to Iranian men. Therefore, age-specific reference ranges of PSA obtained in the present study can increase PSA test sensitivity and specificity by reducing unnecessary diagnostic procedures and early detection of prostate cancer in Iranian men.

  5. Domain Specific Language Support for Exascale

    Energy Technology Data Exchange (ETDEWEB)

    Mellor-Crummey, John [Rice Univ., Houston, TX (United States)

    2017-10-20

    A multi-institutional project known as D-TEC (short for “Domain- specific Technology for Exascale Computing”) set out to explore technologies to support the construction of Domain Specific Languages (DSLs) to map application programs to exascale architectures. DSLs employ automated code transformation to shift the burden of delivering portable performance from application programmers to compilers. Two chief properties contribute: DSLs permit expression at a high level of abstraction so that a programmer’s intent is clear to a compiler and DSL implementations encapsulate human domain-specific optimization knowledge so that a compiler can be smart enough to achieve good results on specific hardware. Domain specificity is what makes these properties possible in a programming language. If leveraging domain specificity is the key to keep exascale software tractable, a corollary is that many different DSLs will be needed to encompass the full range of exascale computing applications; moreover, a single application may well need to use several different DSLs in conjunction. As a result, developing a general toolkit for building domain-specific languages was a key goal for the D-TEC project. Different aspects of the D-TEC research portfolio were the focus of work at each of the partner institutions in the multi-institutional project. D-TEC research and development work at Rice University focused on on three principal topics: understanding how to automate the tuning of code for complex architectures, research and development of the Rosebud DSL engine, and compiler technology to support complex execution platforms. This report provides a summary of the research and development work on the D-TEC project at Rice University.

  6. Formal specification level concepts, methods, and algorithms

    CERN Document Server

    Soeken, Mathias

    2015-01-01

    This book introduces a new level of abstraction that closes the gap between the textual specification of embedded systems and the executable model at the Electronic System Level (ESL). Readers will be enabled to operate at this new, Formal Specification Level (FSL), using models which not only allow significant verification tasks in this early stage of the design flow, but also can be extracted semi-automatically from the textual specification in an interactive manner.  The authors explain how to use these verification tasks to check conceptual properties, e.g. whether requirements are in conflict, as well as dynamic behavior, in terms of execution traces. • Serves as a single-source reference to a new level of abstraction for embedded systems, known as the Formal Specification Level (FSL); • Provides a variety of use cases which can be adapted to readers’ specific design flows; • Includes a comprehensive illustration of Natural Language Processing (NLP) techniques, along with examples of how to i...

  7. Standard Technical Specifications, Babcock and Wilcox plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (STS) for Babcock and Wilcox (B ampersand W) Plants and documents the positions of the Nuclear Regulatory Commission based on the B ampersand W Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council (NUMARC). The improved STS were developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. This document Volume 2, contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. Volume 3 contains the Bases for Sections 3.4--3.10 of the improved STS

  8. Standard Technical Specifications, Combustion Engineering plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (M) for Combustion Engineering (CE) Plants and documents the positions of the Nuclear Regulatory Commission based on the CE Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council (NUMARC). The improved STS were developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. This document Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. Volume 3 contains the Bases for Sections 3.4--3.9 of the improved STS

  9. Chromosome-specific DNA Repeat Probes

    Energy Technology Data Exchange (ETDEWEB)

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  10. Standard Technical Specifications, Combustion Engineering plants

    International Nuclear Information System (INIS)

    1992-09-01

    This NUREG contains improved Standard Technical Specifications (STS) for Combustion Engineering (CE) Plants and documents the positions of the Nuclear Regulatory Commission based on the CE Owners Group's proposed STS. This document is the result of extensive technical meetings and discussions among the NRC staff, the Nuclear Steam Supply System (NSSS) Owners Groups, the NSSS vendors, and the Nuclear Management and Resources Council (NUMARC). The improved STS were developed based on the criteria in the interim Commission Policy Statement on Technical Specification Improvements for Nuclear Power Reactors, dated February 6, 1987. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved SM. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. This document Volume 3 contains the Bases for Sections 3.4--3.9 of the improved M

  11. The specificity and organisation of autobiographical memories.

    Science.gov (United States)

    Schulkind, Matthew D; Rahhal, Tamara A; Klein, Megan R; Lacher, Samantha R

    2012-01-01

    Previous research suggests that autobiographical memories are over-general and are organised according to life periods. One experiment assessed the specificity and organisation of autobiographical memory by manipulating two variables. The retrieval cues were either a set of three words (a theme, a time period, and an emotional valence) or a short narrative that included a specific theme, time period, and emotional valence. The instructions either encouraged the participants to respond as though they were conversing with a friend (social instructions) or did not specify a target audience (standard instructions). Narrative cues and standard instructions elicited more specific responses than word cues and social instructions, respectively. Whereas word cues elicited memories that were most likely to match the cues in terms of time period, narrative cues elicited memories that were most likely to match the cues in terms of theme. These data suggest that previous research underestimated the specificity of the autobiographical knowledge base and overestimated the importance of temporally defined life periods for organising autobiographical memory. Previous conclusions regarding the specificity and organisation of autobiographical memory may reflect the structure of autobiographical narratives and the methodologies used to collect such narratives rather than the content of autobiographical memory itself.

  12. The Role of Non-specific and Specific Immune Systems in Poultry against Newcastle Disease

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2015-09-01

    Full Text Available Newcastle disease (ND is caused by avian paramyxovirus-1 which belong to Avulavirus genus and Paramyxoviridae family. The birds have abnormalities in humoral (bursa fabricius and cellular (thymus and spleen lymphoid organs. Lesions decrease the immune system. Immune system consists of non-specific and specific immune systems. The main components of non-specific immunity are physical and chemical barrier (feather and skin or mucosa, phagocytic cells (macrophages and natural killer, protein complement and the mediator of inflammation and cytokines. Interferons (IFNs belong to a group of cytokines that play a major role in the nonspecific or innate (natural immunity. The virulent ND virus encodes protein of V gene can be suppressed IFN type I. This leads to non-specific immune system fail to respond to the virulent strains resulting in severe pathogenicity. The defense mechanism of the host is replaced by specific immunity (adaptive immunity when natural immunity fails to overcome the infection. The specific immune system consists of humoral mediated immunity (HMI and cell-mediated immunity (CMI. The cells of immune system that react specifically with the antigen are B lymphocytes producing the antibodies, T lymphocytes that regulate the synthesis of antibodies and T cells as effector or the direct cytotoxic cells. Both non-specific and specific immunities are complementary against the invasion of ND virus in the birds. The objective of this article is to discuss the role of non specific and specific immune system in ND.

  13. Forum on specification and Design Languages

    CERN Document Server

    Maehne, Torsten

    2015-01-01

    This book brings together a selection of the best papers from the sixteenth edition of the Forum on specification and Design Languages Conference (FDL), which was held in September 2013 in Paris, France. FDL is a well-established international forum devoted to dissemination of research results, practical experiences and new ideas in the application of specification, design and verification languages to the design, modeling and verification of integrated circuits, complex hardware/software embedded systems, and mixed-technology systems. • Covers applications of formal methods for specification, verification and debug; • Includes embedded analog and mixed-signal system design; • Enables model-driven engineering for embedded systems design and development.

  14. Safety of MR liver specific contrast media

    Energy Technology Data Exchange (ETDEWEB)

    Bellin, Marie-France [Hopital Paul Brousse, Universite Paris 11, Villejuif Cedex (France); Webb, Judith A.W. [St. Bartholomew' s Hospital, Department of Diagnostic Imaging, London (United Kingdom); Molen, Aart J. van der [Leiden University Medical Centre, Department of Radiology, Leiden (Netherlands); Thomsen, Henrik S. [Copenhagen University Hospital at Herlev, Department of Diagnostic Radiology 54E2, Herlev (Denmark); Morcos, Sameh K. [Northern General Hospital, Sheffield Teaching Hospitals NHS Trust, Department of Diagnostic Imaging, Sheffield (United Kingdom)

    2005-08-01

    Over the past few years a number of magnetic resonance (MR) liver specific contrast agents have been introduced. In this report the safety issues of these agents are addressed. A literature search was carried out. Based on the available information, simple guidelines on the safety issue of liver specific contrast agents have been produced by the Contrast Media Safety Committee of the European Society of Urogenital Radiology. The report and guidelines were discussed at the 11th European Symposium on Urogenital Radiology in Santiago de Compostela. Liver specific contrast agents appear in general to be safe and well tolerated. However, the incidence of adverse reactions with iron oxides and the intravenous manganese based agent seems to be slightly higher than with gadolinium based agents. However, no safety information from comparative clinical trials has been published. Guidelines on the safety aspects are presented. (orig.)

  15. Safety of MR liver specific contrast media

    International Nuclear Information System (INIS)

    Bellin, Marie-France; Webb, Judith A.W.; Molen, Aart J. van der; Thomsen, Henrik S.; Morcos, Sameh K.

    2005-01-01

    Over the past few years a number of magnetic resonance (MR) liver specific contrast agents have been introduced. In this report the safety issues of these agents are addressed. A literature search was carried out. Based on the available information, simple guidelines on the safety issue of liver specific contrast agents have been produced by the Contrast Media Safety Committee of the European Society of Urogenital Radiology. The report and guidelines were discussed at the 11th European Symposium on Urogenital Radiology in Santiago de Compostela. Liver specific contrast agents appear in general to be safe and well tolerated. However, the incidence of adverse reactions with iron oxides and the intravenous manganese based agent seems to be slightly higher than with gadolinium based agents. However, no safety information from comparative clinical trials has been published. Guidelines on the safety aspects are presented. (orig.)

  16. Procedures for evaluating technical specifications (PETS)

    International Nuclear Information System (INIS)

    Samanta, P.K.; Boccio, J.L.; Vesely, W.E.

    1987-01-01

    In this paper, aspects of technical specifications relating to Generic Issues B-56 and B-61 are discussed from a risk-standpoint. These primarily deal with the risk issues associated with (1) adaptive diesel test requirements/surveillance test intervals, and (2) the effectiveness of cumulative outage time requirements for controlling downtime risk. Risk and reliability approaches are presented which (1) allow risk-acceptable test intervals to be determined for any diesel and (2) show the potential risk-control capability of prescribed allowed cumulative outage times. This work was conducted through NRC's Procedures for Evaluating Technical Specifications (PETS) Program. The overall objective of this program is to develop and demonstrate methodologies that utilize risk insights and reliability techniques for evaluating the scope, detailed requirements, and safety impact of plant technical specifications

  17. Technical specifications requirements: Automated reasoning applications

    International Nuclear Information System (INIS)

    Lidsky, L.M.; Dobrzeniecki, A.B.

    1990-03-01

    Several software systems were developed and tested to determine what advantages could be gained from explicitly translating complicated regulatory requirements into computerized relationships. The Technical Specifications for US nuclear power plants were chosen as the test-bed application domain, and two analysis systems were developed to monitor plant compliance with operational limits, and track and schedule equipment test and maintenance activities mandated by Technical Specifications. Choosing PROLOG as the computer language to represent these regulatory requirements resulted in a natural match between the semantic structure of the written specifications and the corollary coded rules. Additional research results affirmed the utility of declarative programming styles, explicit management of problem complexity, and attention to the robustness and flexibility of the overall software systems. 5 refs., 2 figs

  18. Specifications for human factors guiding documents

    Energy Technology Data Exchange (ETDEWEB)

    Rhodes, W; Szlapetis, I; MacGregor, C [Rhodes and Associates Inc., Toronto, ON (Canada)

    1995-04-01

    This report specifies the content, function and appearance of three proposed human factors guiding documents to be used by the Atomic Energy Control board and its licensees. These three guiding documents, to be developed at a later date, are: (a) Human Factors Process Guide; (b) Human Factors Activities Guide; and (c) Human Factors Design Integration Guide. The specifications were developed by examining the best documents as identified in a previous contract with the AECB (Review of Human Factors Guidelines and Methods by W. Rhodes, I. Szlapetis et al. 1992), and a brief literature review. The best features and content were selected from existing documents and used to develop specifications for the guiding documents. The developer of the actual guides would use these specifications to produce comprehensive and consolidated documents at a later date. (author). 128 ref., 7 figs.

  19. Specifications for human factors guiding documents

    International Nuclear Information System (INIS)

    Rhodes, W.; Szlapetis, I.; MacGregor, C.

    1995-04-01

    This report specifies the content, function and appearance of three proposed human factors guiding documents to be used by the Atomic Energy Control board and its licensees. These three guiding documents, to be developed at a later date, are: (a) Human Factors Process Guide; (b) Human Factors Activities Guide; and (c) Human Factors Design Integration Guide. The specifications were developed by examining the best documents as identified in a previous contract with the AECB (Review of Human Factors Guidelines and Methods by W. Rhodes, I. Szlapetis et al. 1992), and a brief literature review. The best features and content were selected from existing documents and used to develop specifications for the guiding documents. The developer of the actual guides would use these specifications to produce comprehensive and consolidated documents at a later date. (author). 128 ref., 7 figs

  20. Property Specification Patterns for intelligence building software

    Science.gov (United States)

    Chun, Seungsu

    2018-03-01

    In this paper, through the property specification pattern research for Modal MU(μ) logical aspects present a single framework based on the pattern of intelligence building software. In this study, broken down by state property specification pattern classification of Dwyer (S) and action (A) and was subdivided into it again strong (A) and weaknesses (E). Through these means based on a hierarchical pattern classification of the property specification pattern analysis of logical aspects Mu(μ) was applied to the pattern classification of the examples used in the actual model checker. As a result, not only can a more accurate classification than the existing classification systems were easy to create and understand the attributes specified.

  1. Emergency Medicine Gender-specific Education.

    Science.gov (United States)

    Ashurst, John V; McGregor, Alyson J; Safdar, Basmah; Weaver, Kevin R; Quinn, Shawn M; Rosenau, Alex M; Goyke, Terrence E; Roth, Kevin R; Greenberg, Marna R

    2014-12-01

    The 2014 Academic Emergency Medicine consensus conference has taken the first step in identifying gender-specific care as an area of importance to both emergency medicine (EM) and research. To improve patient care, we need to address educational gaps in this area concurrent with research gaps. In this article, the authors highlight the need for sex- and gender-specific education in EM and propose guidelines for medical student, resident, and faculty education. Specific examples of incorporating this content into grand rounds, simulation, bedside teaching, and journal club sessions are reviewed. Future challenges and strategies to fill the gaps in the current education model are also described. © 2014 by the Society for Academic Emergency Medicine.

  2. Computational network design from functional specifications

    KAUST Repository

    Peng, Chi Han

    2016-07-11

    Connectivity and layout of underlying networks largely determine agent behavior and usage in many environments. For example, transportation networks determine the flow of traffic in a neighborhood, whereas building floorplans determine the flow of people in a workspace. Designing such networks from scratch is challenging as even local network changes can have large global effects. We investigate how to computationally create networks starting from only high-level functional specifications. Such specifications can be in the form of network density, travel time versus network length, traffic type, destination location, etc. We propose an integer programming-based approach that guarantees that the resultant networks are valid by fulfilling all the specified hard constraints and that they score favorably in terms of the objective function. We evaluate our algorithm in two different design settings, street layout and floorplans to demonstrate that diverse networks can emerge purely from high-level functional specifications.

  3. Transactions in domain-specific information systems

    Science.gov (United States)

    Zacek, Jaroslav

    2017-07-01

    Substantial number of the current information system (IS) implementations is based on transaction approach. In addition, most of the implementations are domain-specific (e.g. accounting IS, resource planning IS). Therefore, we have to have a generic transaction model to build and verify domain-specific IS. The paper proposes a new transaction model for domain-specific ontologies. This model is based on value oriented business process modelling technique. The transaction model is formalized by the Petri Net theory. First part of the paper presents common business processes and analyses related to business process modeling. Second part defines the transactional model delimited by REA enterprise ontology paradigm and introduces states of the generic transaction model. The generic model proposal is defined and visualized by the Petri Net modelling tool. Third part shows application of the generic transaction model. Last part of the paper concludes results and discusses a practical usability of the generic transaction model.

  4. Spent nuclear fuel project product specification

    International Nuclear Information System (INIS)

    Pajunen, A.L.

    1998-01-01

    Product specifications are limits and controls established for each significant parameter that potentially affects safety and/or quality of the Spent Nuclear Fuel (SNF) packaged for transport to dry storage. The product specifications in this document cover the spent fuel packaged in MultiCanister Overpacks (MCOs) to be transported throughout the SNF Project. The SNF includes N Reactor fuel and single-pass reactor fuel. The FRS removes the SNF from the storage canisters, cleans it, and places it into baskets. The MCO loading system places the baskets into MCO/Cask assembly packages. These packages are then transferred to the Cold Vacuum Drying (CVD) Facility. After drying at the CVD Facility, the MCO cask packages are transferred to the Canister Storage Building (CSB), where the MCOs are removed from the casks, staged, inspected, sealed (by welding), and stored until a suitable permanent disposal option is implemented. The key criteria necessary to achieve these goals are documented in this specification

  5. Naturally occurring, tumor-specific, therapeutic proteins.

    Science.gov (United States)

    Argiris, Konstantinos; Panethymitaki, Chrysoula; Tavassoli, Mahvash

    2011-05-01

    The emerging approach to cancer treatment known as targeted therapies offers hope in improving the treatment of therapy-resistant cancers. Recent understanding of the molecular pathogenesis of cancer has led to the development of targeted novel drugs such as monoclonal antibodies, small molecule inhibitors, mimetics, antisense and small interference RNA-based strategies, among others. These compounds act on specific targets that are believed to contribute to the development and progression of cancers and resistance of tumors to conventional therapies. Delivered individually or combined with chemo- and/or radiotherapy, such novel drugs have produced significant responses in certain types of cancer. Among the most successful novel compounds are those which target tyrosine kinases (imatinib, trastuzumab, sinutinib, cetuximab). However, these compounds can cause severe side-effects as they inhibit pathways such as epidermal growth factor receptor (EGFR) or platelet-derived growth factor receptor, which are also important for normal functions in non-transformed cells. Recently, a number of proteins have been identified which show a remarkable tumor-specific cytotoxic activity. This toxicity is independent of tumor type or specific genetic changes such as p53, pRB or EGFR aberrations. These tumor-specific killer proteins are either derived from common human and animal viruses such as E1A, E4ORF4 and VP3 (apoptin) or of cellular origin, such as TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) and MDA-7 (melanoma differentiation associated-7). This review aims to present a current overview of a selection of these proteins with preferential toxicity among cancer cells and will provide an insight into the possible mechanism of action, tumor specificity and their potential as novel tumor-specific cancer therapeutics.

  6. Engineered waste-package-system design specification

    International Nuclear Information System (INIS)

    1983-05-01

    This report documents the waste package performance requirements and geologic and waste form data bases used in developing the conceptual designs for waste packages for salt, tuff, and basalt geologies. The data base reflects the latest geotechnical information on the geologic media of interest. The parameters or characteristics specified primarily cover spent fuel, defense high-level waste, and commercial high-level waste forms. The specification documents the direction taken during the conceptual design activity. A separate design specification will be developed prior to the start of the preliminary design activity

  7. Automated effect-specific mammographic pattern measures

    DEFF Research Database (Denmark)

    Raundahl, Jakob; Loog, Marco; Pettersen, Paola

    2008-01-01

    We investigate the possibility to develop methodologies for assessing effect specific structural changes of the breast tissue using a general statistical machine learning framework. We present an approach of obtaining objective mammographic pattern measures quantifying a specific biological effect......, such as hormone replacement therapy (HRT). We compare results using this approach to using standard density measures. We show that the proposed method can quantify both age related effects and effects caused by HRT. Age effects are significantly detected by our method where standard methodologies fail...

  8. System specifications for the NDS EXFOR System

    International Nuclear Information System (INIS)

    Attree, P.M.; Smith, P.M.

    1979-07-01

    EXFOR is the agreed exchange format for the magnetic-tape exchange of nuclear reaction data between national and international nuclear data centres for the benefit of nuclear data users in all countries. The NDS EXFOR System is a computerized system for the storage and retrieval of EXFOR information compiled or received by the IAEA. This document is an internal manual for the system specifications of the NDS EXFOR System. It includes flow charts, system and program summaries, input and output specifications and file and record descriptions. The manual is updated from time to time when system modifications are made

  9. Technical specifications for PWR secondary water chemistry

    International Nuclear Information System (INIS)

    Weeks, J.R.; van Rooyen, D.

    1977-08-01

    The bases for establishing Technical Specifications for PWR secondary water chemistry are reviewed. Whereas extremely stringent control of secondary water needs to be maintained to prevent denting in some units, sound bases for establishing limits that will prevent stress corrosion, wastage, and denting do not exist at the present time. This area is being examined very thoroughly by industry-sponsored research programs. Based on the evidence available to date, short term control limits are suggested; establishment of these or other limits as Technical Specifications is not recommended until the results of the research programs have been obtained and evaluated

  10. Asian product specifications to tighten by 2000

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    The Asia/Pacific region is characterized by much diversity in environmental standards for petroleum products. Specifications in Japan, for example, are quite stringent, while, in India, kerosene--even that used for cooking or lighting--may contain as much as 0.2% sulfur. Widhyawan Prawiraatmadja and Fereidun Fesharaki of the East-West Center in Honolulu outlined regional product quality in a report titled, ''Trends in Petroleum Product Specifications in the Asia-Pacific Region: A Supply/Demand Analysis and Government Policy Responses.'' This paper summarizes the findings of this report with emphasis on gasoline, diesel fuels, and fuel oil demand, fuel consumption, and quality

  11. Site-Specific Infrared Probes of Proteins

    Science.gov (United States)

    Ma, Jianqiang; Pazos, Ileana M.; Zhang, Wenkai; Culik, Robert M.; Gai, Feng

    2015-01-01

    Infrared spectroscopy has played an instrumental role in studying a wide variety of biological questions. However, in many cases it is impossible or difficult to rely on the intrinsic vibrational modes of biological molecules of interest, such as proteins, to reveal structural and/or environmental information in a site-specific manner. To overcome this limitation, many recent efforts have been dedicated to the development and application of various extrinsic vibrational probes that can be incorporated into biological molecules and used to site-specifically interrogate their structural and/or environmental properties. In this Review, we highlight some recent advancements of this rapidly growing research area. PMID:25580624

  12. Clojure for domain-specific languages

    CERN Document Server

    Kelker, Ryan D

    2013-01-01

    An example-oriented approach to develop custom domain-specific languages.If you've already developed a few Clojure applications and wish to expand your knowledge on Clojure or domain-specific languages in general, then this book is for you. If you're an absolute Clojure beginner, then you may only find the detailed examples of the core Clojure components of value. If you've developed DSLs in other languages, this Lisp and Java-based book might surprise you with the power of Clojure.

  13. Photomask specifications for high energy physics detectors

    CERN Document Server

    Pindo, M

    2002-01-01

    Planar technologies used for radiation detector fabrication imply an extensive use of photomasks whose characteristics are critical in determining final detector performance. Compatibly with their manufacturing process, photomasks must satisfy the application-specific requirements dictated both by wafer manufacturers and detector final users. The design and realization of microstrip and pixel detectors, widely used in high energy physics experiments, ask for intensive scientific effort, advanced technology and important economical investments. Photomask specification definition is one of the fundamental steps to optimize detector fabrication processes and fulfill experimental requirements at the most appropriate cost.

  14. System specifications for the NDS EXFOR System

    Energy Technology Data Exchange (ETDEWEB)

    Attree, P M; Smith, P M

    1982-06-01

    EXFOR is the agreed exchange format for the magnetic-tape exchange of nuclear reaction data between national and international nuclear data centers for the benefit of nuclear data users in all countries. The NDS EXFOR System is a computerized system for the storage and retrieval of EXFOR information compiled or received of the IAEA. This document is an internal manual for the system specifications of the NDS EXFOR System. It includes flow charts, system and program summaries, input and output specifications and file and record descriptions. The manual is updated from time to time when system modifications are made; the first version was issued in July 1979. (author)

  15. Immunotherapy with GD2 specific monoclonal antibodies

    International Nuclear Information System (INIS)

    Cheung, N.K.V.; Medof, E.M.; Munn, D.

    1988-01-01

    Targeted immunotherapy focuses anti-tumor activity of antibodies and effector cells, which are actively developed by the host or adoptively transferred, onto tumor cells and into tumor sites. Such tumor selective therapy can be more specific and efficient. The value of such an approach is evident in the classical interaction of antibodies. This paper reports that the ganglioside G D2 is an ideal antigen for specific tumor targeting because of its relative lack of heterogeneity among human neuroblastoma, its high density on tumor cells, its lack of antigen modulation upon binding to antibody, and its restricted distribution in normal tissues

  16. A Class-Specific Optimizing Compiler

    Directory of Open Access Journals (Sweden)

    Michael D. Sharp

    1993-01-01

    Full Text Available Class-specific optimizations are compiler optimizations specified by the class implementor to the compiler. They allow the compiler to take advantage of the semantics of the particular class so as to produce better code. Optimizations of interest include the strength reduction of class:: array address calculations, elimination of large temporaries, and the placement of asynchronous send/recv calls so as to achieve computation/communication overlap. We will outline our progress towards the implementation of a C++ compiler capable of incorporating class-specific optimizations.

  17. DOE site-specific threat assessment

    International Nuclear Information System (INIS)

    West, D.J.; Al-Ayat, R.A.; Judd, B.R.

    1985-01-01

    A facility manager faced with the challenges of protecting a nuclear facility against potential threats must consider the likelihood and consequences of such threats, know the capabilities of the facility safeguards and security systems, and make informed decisions about the cost-effectivness of safeguards and security upgrades. To help meet these challenges, the San Francisco Operations Office of the Department of Energy, in conjunction with the Lawrence Livermore Laboratory, has developed a site-specific threat assessment approach and a quantitative model to improve the quality and consistency of site-specific threat assessment and resultant security upgrade decisions at sensitive Department of Energy facilities. 5 figs

  18. Software engineering with application-specific languages

    Science.gov (United States)

    Campbell, David J.; Barker, Linda; Mitchell, Deborah; Pollack, Robert H.

    1993-01-01

    Application-Specific Languages (ASL's) are small, special-purpose languages that are targeted to solve a specific class of problems. Using ASL's on software development projects can provide considerable cost savings, reduce risk, and enhance quality and reliability. ASL's provide a platform for reuse within a project or across many projects and enable less-experienced programmers to tap into the expertise of application-area experts. ASL's have been used on several software development projects for the Space Shuttle Program. On these projects, the use of ASL's resulted in considerable cost savings over conventional development techniques. Two of these projects are described.

  19. System specifications for the NDS Dictionary System

    International Nuclear Information System (INIS)

    Attree, P.M.; Smith, P.M.

    1979-09-01

    The NDS Dictionary System is a computerized system for maintaining and distributing the EXFOR dictionaries and for preparing internal versions of these dictionaries for use in the NDS EXFOR System and other NDS systems. This document is an internal manual for the system specifications of the NDS Dictionary System. It includes flow charts, system and program summaries, input and output specifications and file and record descriptions. This manual is updated from time to time when system modifications are made; this is the version of January 1979

  20. [Development of domain specific search engines].

    Science.gov (United States)

    Takai, T; Tokunaga, M; Maeda, K; Kaminuma, T

    2000-01-01

    As cyber space exploding in a pace that nobody has ever imagined, it becomes very important to search cyber space efficiently and effectively. One solution to this problem is search engines. Already a lot of commercial search engines have been put on the market. However these search engines respond with such cumbersome results that domain specific experts can not tolerate. Using a dedicate hardware and a commercial software called OpenText, we have tried to develop several domain specific search engines. These engines are for our institute's Web contents, drugs, chemical safety, endocrine disruptors, and emergent response for chemical hazard. These engines have been on our Web site for testing.

  1. Specifications from a biotechnology industry perspective.

    Science.gov (United States)

    Garnick, R L

    1997-01-01

    The emergence of new analytical technology and the production of pharmaceuticals for a global market in a cost-effective manner necessitate the establishment of worldwide specifications that are appropriate for the product and the manufacturing process. This requires a thorough knowledge of the protein and control of the systems that produce it as well as an understanding of the accuracy and precision of the assays used for testing. Harmonization of specifications among the worldwide regulatory authorities is critical for the future development of new pharmaceuticals. A continuing dialogue between industry and regulators to achieve this goal needs to be encouraged and supported.

  2. From UML Specification into FPGA Implementation

    Directory of Open Access Journals (Sweden)

    Grzegorz Bazydlo

    2014-01-01

    Full Text Available In the paper a method of using the Unified Modeling Language for specification of digital systems, especially logic controllers, is presented. The proposed method is based mainly on the UML state machine diagrams and uses Hierarchical Concurrent Finite State Machines (HCFSMs as a temporary model. The paper shows a way to transform the UML diagrams, expressed in XML language, to the form that is acceptable by reconfigurable FPGAs (Field Programmable Gate Arrays. The UML specification is used to generate an effective program in Hardware Description Languages (HDLs, especially Verilog.

  3. Domain Specific Language Support for Exascale

    Energy Technology Data Exchange (ETDEWEB)

    Sadayappan, Ponnuswamy [The Ohio State Univ., Columbus, OH (United States)

    2017-02-24

    Domain-Specific Languages (DSLs) offer an attractive path to Exascale software since they provide expressive power through appropriate abstractions and enable domain-specific optimizations. But the advantages of a DSL compete with the difficulties of implementing a DSL, even for a narrowly defined domain. The DTEC project addresses how a variety of DSLs can be easily implemented to leverage existing compiler analysis and transformation capabilities within the ROSE open source compiler as part of a research program focusing on Exascale challenges. The OSU contributions to the DTEC project are in the area of code generation from high-level DSL descriptions, as well as verification of the automatically-generated code.

  4. NEEDS ANALYSIS IN ENGLISH FOR SPECIFIC PURPOSES

    Directory of Open Access Journals (Sweden)

    SIMION MINODORA OTILIA

    2015-03-01

    Full Text Available Needs analysis is considered to be the cornerstone of English for Specific Purposes(ESP. The concept of Needs analysis has been different along the decades. At the initial stages of ESP( the 1960s and early 1970s, needs analysis consisted in assessing the communicative needs of the learners and the techniques of achieving specific teaching objectives. Nowadays, the tasks of needs analysis is much more complex: it aims at collecting information about the learners and at defining the target situation and environment of studying ESP.

  5. Spent Nuclear Fuel (SNF) Project Product Specification

    International Nuclear Information System (INIS)

    PAJUNEN, A.L.

    2000-01-01

    The process for removal of Spent Nuclear Fuel (SNF) from the K Basins has been divided into major sub-systems. The Fuel Retrieval System (FRS) removes fuel from the existing storage canisters, cleans it, and places it into baskets. The multi-canister overpack (MCO) loading system places the baskets into an MCO that has been pre-loaded in a cask. The cask, containing a loaded MCO, is then transferred to the Cold Vacuum Drying (CVD) Facility. After drying at the CVD Facility, the cask, and MCO, are transferred to the Canister Storage Building (CSB), where the MCO is removed from the cask, staged, inspected, sealed (by welding), and stored until a suitable permanent disposal option is implemented. The purpose of this document is to specify the process related characteristics of an MCO at the interface between major process systems. The characteristics are derived from the primary technical documents that form the basis for safety analysis and design calculations. This document translates the calculation assumptions into implementation requirements and describes the method of verifying that the requirement is achieved. These requirements are used to define validation test requirements and describe requirements that influence multiple sub-project safety analysis reports. This product specification establishes limits and controls for each significant process parameter at interfaces between major sub-systems that potentially affect the overall safety and/or quality of the SNF packaged for processing, transport, and interim dry storage. The product specifications in this document cover the SNF packaged in MCOs to be transported throughout the SNF Project. The description of the product specifications are organized in the document as follows: Section 2.0--Summary listing of product specifications at each major sub-system interface. Section 3.0--Summary description providing guidance as to how specifications are complied with by equipment design or processing within a major

  6. Spent Nuclear Fuel (SNF) Project Product Specification

    Energy Technology Data Exchange (ETDEWEB)

    PAJUNEN, A.L.

    2000-12-07

    The process for removal of Spent Nuclear Fuel (SNF) from the K Basins has been divided into major sub-systems. The Fuel Retrieval System (FRS) removes fuel from the existing storage canisters, cleans it, and places it into baskets. The multi-canister overpack (MCO) loading system places the baskets into an MCO that has been pre-loaded in a cask. The cask, containing a loaded MCO, is then transferred to the Cold Vacuum Drying (CVD) Facility. After drying at the CVD Facility, the cask, and MCO, are transferred to the Canister Storage Building (CSB), where the MCO is removed from the cask, staged, inspected, sealed (by welding), and stored until a suitable permanent disposal option is implemented. The purpose of this document is to specify the process related characteristics of an MCO at the interface between major process systems. The characteristics are derived from the primary technical documents that form the basis for safety analysis and design calculations. This document translates the calculation assumptions into implementation requirements and describes the method of verifying that the requirement is achieved. These requirements are used to define validation test requirements and describe requirements that influence multiple sub-project safety analysis reports. This product specification establishes limits and controls for each significant process parameter at interfaces between major sub-systems that potentially affect the overall safety and/or quality of the SNF packaged for processing, transport, and interim dry storage. The product specifications in this document cover the SNF packaged in MCOs to be transported throughout the SNF Project. The description of the product specifications are organized in the document as follows: Section 2.0--Summary listing of product specifications at each major sub-system interface. Section 3.0--Summary description providing guidance as to how specifications are complied with by equipment design or processing within a major

  7. Ultrahigh Specific Impulse Nuclear Thermal Propulsion

    Energy Technology Data Exchange (ETDEWEB)

    Anne Charmeau; Brandon Cunningham; Samim Anghaie

    2009-02-09

    Research on nuclear thermal propulsion systems (NTP) have been in forefront of the space nuclear power and propulsion due to their design simplicity and their promise for providing very high thrust at reasonably high specific impulse. During NERVA-ROVER program in late 1950's till early 1970's, the United States developed and ground tested about 18 NTP systems without ever deploying them into space. The NERVA-ROVER program included development and testing of NTP systems with very high thrust (~250,000 lbf) and relatively high specific impulse (~850 s). High thrust to weight ratio in NTP systems is an indicator of high acceleration that could be achieved with these systems. The specific impulse in the lowest mass propellant, hydrogen, is a function of square root of absolute temperature in the NTP thrust chamber. Therefor optimizing design performance of NTP systems would require achieving the highest possible hydrogen temperature at reasonably high thrust to weight ratio. High hydrogen exit temperature produces high specific impulse that is a diret measure of propellant usage efficiency.

  8. Language specific bootstraps for UG categories

    NARCIS (Netherlands)

    van Kampen, N.J.

    2005-01-01

    This paper argues that the universal categories N/V are not applied to content words before the grammatical markings for reference D(eterminers) and predication I(nflection) have been acquired (van Kampen, 1997, contra Pinker, 1984). Child grammar starts as proto-grammar with language-specific

  9. DETERMINATION OF THE SPECIFIC GROWTH RATE ON ...

    African Journals Online (AJOL)

    Sewage generation is one of the dense problems Nigerians encounter on daily bases, mostly at the urbanized area where factories and industries are located. This paper is aimed at determining the specific growth rate “K” of biological activities on cassava wastewater during degradation using Michaelis-Menten Equation.

  10. Side-Specific Reward Memories in Honeybees

    Science.gov (United States)

    Gil, Mariana; Menzel, Randolf; De Marco, Rodrigo J.

    2009-01-01

    We report a hitherto unknown form of side-specific learning in honeybees. We trained bees individually by coupling gustatory and mechanical stimulation of each antenna with either increasing or decreasing volumes of sucrose solution offered to the animal's proboscis along successive learning trials. Next, we examined their proboscis extension…

  11. Autobiographical Memory Specificity in Dissociative Identity Disorder

    NARCIS (Netherlands)

    Huntjens, R.J.C.; Wessel, I.; Hermans, D.; Minnen, A. van

    2014-01-01

    A lack of adequate access to autobiographical knowledge has been related to psychopathology. More specifically, patients suffering from depression or a history of trauma have been found to be characterized by overgeneral memory, in other words, they show a relative difficulty in retrieving a

  12. Autobiographical memory specificity in dissociative identity disorder

    NARCIS (Netherlands)

    Huntjens, Rafaële J. C.; Wessel, Ineke; Hermans, Dirk; van Minnen, Agnes

    A lack of adequate access to autobiographical knowledge has been related to psychopathology. More specifically, patients suffering from depression or a history of trauma have been found to be characterized by overgeneral memory, in other words, they show a relative difficulty in retrieving a

  13. Patient-specific models of cardiac biomechanics

    Science.gov (United States)

    Krishnamurthy, Adarsh; Villongco, Christopher T.; Chuang, Joyce; Frank, Lawrence R.; Nigam, Vishal; Belezzuoli, Ernest; Stark, Paul; Krummen, David E.; Narayan, Sanjiv; Omens, Jeffrey H.; McCulloch, Andrew D.; Kerckhoffs, Roy C. P.

    2013-07-01

    Patient-specific models of cardiac function have the potential to improve diagnosis and management of heart disease by integrating medical images with heterogeneous clinical measurements subject to constraints imposed by physical first principles and prior experimental knowledge. We describe new methods for creating three-dimensional patient-specific models of ventricular biomechanics in the failing heart. Three-dimensional bi-ventricular geometry is segmented from cardiac CT images at end-diastole from patients with heart failure. Human myofiber and sheet architecture is modeled using eigenvectors computed from diffusion tensor MR images from an isolated, fixed human organ-donor heart and transformed to the patient-specific geometric model using large deformation diffeomorphic mapping. Semi-automated methods were developed for optimizing the passive material properties while simultaneously computing the unloaded reference geometry of the ventricles for stress analysis. Material properties of active cardiac muscle contraction were optimized to match ventricular pressures measured by cardiac catheterization, and parameters of a lumped-parameter closed-loop model of the circulation were estimated with a circulatory adaptation algorithm making use of information derived from echocardiography. These components were then integrated to create a multi-scale model of the patient-specific heart. These methods were tested in five heart failure patients from the San Diego Veteran's Affairs Medical Center who gave informed consent. The simulation results showed good agreement with measured echocardiographic and global functional parameters such as ejection fraction and peak cavity pressures.

  14. Community-Specific Strategies of Intergenerational Language ...

    African Journals Online (AJOL)

    This study concerns minority language maintenance, specifically it explores local practices that make it possible for a community to sustain its traditional language. Two variables were the focus of the research; speakers' attitudes and language use patterns. These were examined to determine their influence in facilitating ...

  15. SPECIFICITY IN DEVELOPMENT OF CONSTRUCTION INDUSTRY

    Directory of Open Access Journals (Sweden)

    O. S. Golubova

    2012-01-01

    Full Text Available Specificity in development of construction industry of the Republic of Belarus determines  character of competition on the construction market, forms a pricing, marketing and product policy of building companies. Construction represents itself as a highly developed complex where interaction of business entities is of rather complicated multilateral character.

  16. Essential Specification Elements for Heat Exchanger Replacement

    Energy Technology Data Exchange (ETDEWEB)

    Bower, L.

    2015-07-01

    Performance upgrade and equipment degradation are the primary impetuses for a nuclear power plant to engage in the large capital cost project of heat exchanger replacement. Along with attention to these issues, consideration of heat exchanger Codes and Standards, material improvements, thermal redesign, and configuration are essential for developing User’s Design Specifications for successful replacement projects. The User’s Design Specification is the central document in procuring ASME heat exchangers. Properly stated objectives for the heat exchanger replacement are essential for obtaining the materials, configurations and thermal designs best suited for the nuclear power plant. Additionally, the code of construction required and the applied manufacturing standard (TEMA or HEI) affects how the heat exchanger may be designed or configured to meet the replacement goals. Knowledge of how Codes and Standards affect design and configuration details will aid in writing the User’s Design Specification. Joseph Oat Corporation has designed and fabricated many replacement heat exchangers for the nuclear power industry. These heat exchangers have been constructed per ASME Section III to various Code-Years or ASME Section VIII-1 to the current Code-Year also in accordance with TEMA and HEI. These heat exchangers have been a range of like-for-like replacement to complete thermal, material and configuration redesigns. Several examples of these heat exchangers with their Code, Standard and specification implications are presented. (Author.

  17. Research overview : design specifications for hybrid vehicles

    NARCIS (Netherlands)

    Hofman, T.; Druten, van R.M.

    2004-01-01

    In this paper a method is proposed for determination of the design specifications regarding the energy exchange systems for different chargesustaining hybrid vehicles of different vehicle classes. Hybrid drivetrains for vehicles combine multiple power sources in order to increase the driving

  18. Isotope specific arbitrary material flow meter

    Science.gov (United States)

    Barty, Christopher P. J.; Post, John C.; Jones, Edwin

    2016-10-25

    A laser-based mono-energetic gamma-ray source is used to provide non-destructive and non-intrusive, quantitative determination of the absolute amount of a specific isotope contained within pipe as part of a moving fluid or quasi-fluid material stream.

  19. Composing a Tumor Specific Bacterial Promoter.

    Directory of Open Access Journals (Sweden)

    Igor V Deyneko

    Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

  20. Specific Ion Effects in Cholesterol Monolayers

    Directory of Open Access Journals (Sweden)

    Teresa Del Castillo-Santaella

    2016-05-01

    Full Text Available The interaction of ions with interfaces and, in particular, the high specificity of these interactions to the particular ions considered, are central questions in the field of surface forces. Here we study the effect of different salts (NaI, NaCl, CaCl2 and MgCl2 on monolayers made of cholesterol molecules, both experimentally (surface area vs. lateral pressure isotherms measured by a Langmuir Film Balance and theoretically (molecular dynamics (MD all-atomic simulations. We found that surface isotherms depend, both quantitatively and qualitatively, on the nature of the ions by altering the shape and features of the isotherm. In line with the experiments, MD simulations show clear evidences of specific ionic effects and also provide molecular level details on ion specific interactions with cholesterol. More importantly, MD simulations show that the interaction of a particular ion with the surface depends strongly on its counterion, a feature ignored so far in most theories of specific ionic effects in surface forces.

  1. Measurement of low-temperature specific heat

    International Nuclear Information System (INIS)

    Stewart, G.R.

    1983-01-01

    The measurement of low-temperature specific heat (LTSH) (0.1 K< T<60 K) has seen a number of breakthroughs both in design concepts and instrumentation in the last 15 years: particularly in small sample calorimetry. This review attempts to provide an overview of both large and small sample calorimetry techniques at temperatures below 60 K, with sufficient references to enable more detailed study. A comprehensive review is made of the most reliable measurements of the LTSH of 84 of the elements to illustrate briefly some of the problems of measurements and analysis, as well as to provide additional references. More detail is devoted to three special areas of low-temperature calorimetry that have seen rapid development recently: (1) measurement of the specific heat of highly radioactive samples, (2) measurement of the specific heat of materials in high magnetic fields (18 T), and (3) measurement of the specific heat of very small (100 μg) samples. The review ends with a brief discussion of the frontier research currently underway on microcalorimetry for nanogram sample weights

  2. Specificity, Transfer, and the Development of Expertise

    Science.gov (United States)

    Brookes, David T.; Ross, Brian H.; Mestre, Jose P.

    2011-01-01

    In this paper we present the results of two experiments designed to understand how physics students' learning of the concept of refraction is influenced by the cognitive phenomenon of "specificity." In both experiments participants learned why light bends as it travels from one optical medium to another with an analogy made to a car…

  3. 21 CFR 107.100 - Nutrient specifications.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Nutrient specifications. 107.100 Section 107.100 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD... Maximum level Protein Grams 1.8 4.5 Fat do 3.3 6.0 Percent calories 30 54 Linoleic acid Milligrams 300...

  4. Population specific analysis of Yakut exomes

    NARCIS (Netherlands)

    Zlobin, A. S.; Sharapov, S. Sh.; Guryev, V. P.; Bevova, M. R.; Tsepilov, Y. A.; Sivtseva, T. M.; Boyarskih, U. A.; Sokolova, E. A.; Aulchenko, Y. S.; Filipenko, M. L.; Osakovsky, V. L.

    We studied the genetic diversity of the Yakut population using exome sequencing. We performed comparative analysis of the Yakut population and the populations that are included in the "1000 Genomes" project and we identified the alleles specific to the Yakut population. We showed, that the Yakuts

  5. Brayton Isotope Power System (BIPS) facility specification

    International Nuclear Information System (INIS)

    1976-01-01

    General requirements for the Brayton Isotope Power System (BIPS)/Ground Demonstration System (GDS) assembly and test facility are defined. The facility will include provisions for a complete test laboratory for GDS checkout, performance, and endurance testing, and a contamination-controlled area for assembly, fabrication, storage, and storage preparation of GDS components. Specifications, schedules, and drawings are included

  6. Prospects for site specific weed management

    DEFF Research Database (Denmark)

    Christensen, Svend; Rasmussen, Jesper; Pedersen, Søren Marcus

    2014-01-01

    Research on Site Specific Weed Management (SSWM) started in the late 80's. Since that moment, considerable research has been conducted on different aspects of SSWM, from fundamental studies on the spatial ecology of weeds to the applied development and testing of new technologies for weed detection...

  7. Social-psychological specific of individual adaptation

    OpenAIRE

    Ovsyanik, Olga

    2012-01-01

    There is analyzing of specific of social-psychological adaptation person by model of adaptation. Structure model of adaptation of women of our age group, which was named “adaptation complex” was made by theoretic analyzes of problem of adaptation adult.

  8. Structural similarity and category-specificity

    DEFF Research Database (Denmark)

    Gerlach, Christian; Law, Ian; Paulson, Olaf B

    2004-01-01

    It has been suggested that category-specific recognition disorders for natural objects may reflect that natural objects are more structurally (visually) similar than artefacts and therefore more difficult to recognize following brain damage. On this account one might expect a positive relationshi...

  9. Methodes for identification of specific language impairment

    Directory of Open Access Journals (Sweden)

    Toktam Maleki Shahmahmood

    2014-06-01

    Full Text Available Background and Aim: Specific language impiarment (SLI is one of the most prevalent developmental language disorders its diagnosis is a problematic issue among researchers and clinicians because of the heterogeneity of language profiles in the affected population and overlapping with other developmental language disorders. The aim of this study was to review the suggested diagnostic criteria for this disorder, controversies about these criteria and identify the most accurate diagnostic methods.Methods: Published article from 1980 to 2012 in bibliographic and publisher databases including Pubmed, Google scholar, Cochran library, Web of Science, ProQuest, Springer, Oxford, Science direct, Ovid, Iran Medex and Magiran about the diagnostic methods for discriminating preschoool children with specific language impiarment from normal developing children were reviewd in this article. These keywords were used for research: “specific language impairment”, “SLI”, “diagnosis or identification”, “standardized tests”, and “tests for language development”.Conclusion: The results of this study show inspite of agreement of researchers and clinicians about exclusionary criteria as one basic part of the diagnosis of specific language impiarment , there is no consensus about the other part, inclusionary criteria. Different studies used different inclusionary criteria which can be divided to categories of clincal judgment, discrepancy-based criteria, standardized testing, clinical markers and markers from spontaneous speech samples. Advantages, disadvantages, and clinical applicability of each diagnostic method are discussed in this article.

  10. IPv6-specific misconfigurations in the DNS

    NARCIS (Netherlands)

    Hendriks, Luuk; de Boer, Pieter-Tjerk; Pras, Aiko

    2017-01-01

    With the Internet transitioning from IPv4 to IPv6, the number of IPv6-specific DNS records (AAAA) increases. Misconfigurations in these records often go unnoticed, as most systems are provided with connectivity over both IPv4 and IPv6, and automatically fall back to IPv4 in case of connection

  11. 31 CFR 595.312 - Specific license.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Specific license. 595.312 Section 595.312 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY TERRORISM SANCTIONS REGULATIONS General Definitions...

  12. Ultrasonic hydrometer. [Specific gravity of electrolyte

    Science.gov (United States)

    Swoboda, C.A.

    1982-03-09

    The disclosed ultrasonic hydrometer determines the specific gravity (density) of the electrolyte of a wet battery, such as a lead-acid battery. The hydrometer utilizes a transducer that when excited emits an ultrasonic impulse that traverses through the electrolyte back and forth between spaced sonic surfaces. The transducer detects the returning impulse, and means measures the time t between the initial and returning impulses. Considering the distance d between the spaced sonic surfaces and the measured time t, the sonic velocity V is calculated with the equation V = 2d/t. The hydrometer also utilizes a thermocouple to measure the electrolyte temperature. A hydrometer database correlates three variable parameters including sonic velocity in and temperature and specific gravity of the electrolyte, for temperature values between 0 and 40/sup 0/C and for specific gravity values between 1.05 and 1.30. Upon knowing two parameters (the calculated sonic velocity and the measured temperature), the third parameter (specific gravity) can be uniquely found in the database. The hydrometer utilizes a microprocessor for data storage and manipulation.

  13. COMPARATIVE STUDY ON SPECIFIC AND EARLY DETECTION ...

    African Journals Online (AJOL)

    The objective of this study was to compare the sensitivity and specificity of smear and culture methods with rapid serological EIA myco kits manufactured by Omega diagnostics, for the early detection of Mycobacterium tuberculosis (MTB) complex. Sera from various categories of smear and culture results were compared ...

  14. 32 CFR 292.4 - Specific policy.

    Science.gov (United States)

    2010-07-01

    ... INFORMATION ACT PROGRAM DEFENSE INTELLIGENCE AGENCY (DIA) FREEDOM OF INFORMATION ACT § 292.4 Specific policy... of source and object codes, regardless of medium are not agency records. (This does not include the... existing computer program or printout for retrieval of the requested information. (c) The prior application...

  15. Radioimmunoassay for a human prostate specific antigen

    International Nuclear Information System (INIS)

    Machida, T.; Miki, M.; Ohishi, Y.; Kido, A.; Morikawa, J.; Ogawa, Y.

    1983-01-01

    As a marker for prostatic cancer, a prostate-specific antigen was purified from human prostatic tissues. Double antibody radioimmunoassay utilizing immune reaction was developed on the basis of the purified prostatic antigen (PA). Measurement results have revealed that PA radioimmunoassay is much better than prostatic acid phosphatase (PAP) radioimmunoassay in the diagnosis of prostatic cancer

  16. Justifying group-specific common morality.

    Science.gov (United States)

    Strong, Carson

    2008-01-01

    Some defenders of the view that there is a common morality have conceived such morality as being universal, in the sense of extending across all cultures and times. Those who deny the existence of such a common morality often argue that the universality claim is implausible. Defense of common morality must take account of the distinction between descriptive and normative claims that there is a common morality. This essay considers these claims separately and identifies the nature of the arguments for each claim. It argues that the claim that there is a universal common morality in the descriptive sense has not been successfully defended to date. It maintains that the claim that there is a common morality in the normative sense need not be understood as universalist. This paper advocates the concept of group specific common morality, including country-specific versions. It suggests that both the descriptive and the normative claims that there are country-specific common moralities are plausible, and that a country-specific normative common morality could provide the basis for a country's bioethics.

  17. Modular specification of real-time systems

    DEFF Research Database (Denmark)

    Inal, Recep

    1994-01-01

    Duration Calculus, a real-time interval logic, has been embedded in the Z specification language to provide a notation for real-time systems that combines the modularisation and abstraction facilities of Z with a logic suitable for reasoning about real-time properties. In this article the notation...

  18. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael

    2011-01-01

    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  19. Specificity of Structural Assessment of Knowledge

    Science.gov (United States)

    Trumpower, David L.; Sharara, Harold; Goldsmith, Timothy E.

    2010-01-01

    This study examines the specificity of information provided by structural assessment of knowledge (SAK). SAK is a technique which uses the Pathfinder scaling algorithm to transform ratings of concept relatedness into network representations (PFnets) of individuals' knowledge. Inferences about individuals' overall domain knowledge based on the…

  20. Parallel object-oriented specification language

    NARCIS (Netherlands)

    Florescu, O.; Voeten, J.P.M.; Theelen, B.D.; Geilen, M.C.W.; Corporaal, H.; Burns, Alan

    2008-01-01

    The Parallel Object-Oriented Specification Language (POOSL) is an expressive modelling language for hardware/software systems [10]. It was originally defined in [7] as an object-oriented extension of process algebra CCS [6], supporting (conditional) synchronous message passing between

  1. Primary Auditory Cortex Regulates Threat Memory Specificity

    Science.gov (United States)

    Wigestrand, Mattis B.; Schiff, Hillary C.; Fyhn, Marianne; LeDoux, Joseph E.; Sears, Robert M.

    2017-01-01

    Distinguishing threatening from nonthreatening stimuli is essential for survival and stimulus generalization is a hallmark of anxiety disorders. While auditory threat learning produces long-lasting plasticity in primary auditory cortex (Au1), it is not clear whether such Au1 plasticity regulates memory specificity or generalization. We used…

  2. 48 CFR 836.202 - Specifications.

    Science.gov (United States)

    2010-10-01

    ... specifications. (b) During the design stage, contract architect-engineers must not use “brand name or equal” or... phase, prior to award of a contract for design. (c) If VA has determined that only one product will meet.... This clause places bidders on notice that the “brand name or equal” provisions of the clause found at...

  3. Specificity in liquid metal induced embrittlement

    CSIR Research Space (South Africa)

    Fernandes, PJL

    1996-12-01

    Full Text Available One of the most intriguing features of liquid metal induced embrittlement (LMIE) is the observation that some liquid metal-solid metal couples are susceptible to embrittlement, while others appear to be immune. This is referred to as the specificity...

  4. Age-Specific Correlates of Child Growth

    NARCIS (Netherlands)

    M. Rieger (Matthias); S.K. Trommlerová (Sofia Karina)

    2016-01-01

    textabstractGrowth faltering describes a widespread phenomenon that height- and weight-for-age of children in developing countries collapse rapidly in the first two years of life. We study age-specific correlates of child nutrition using Demographic and Health Surveys from 56 developing countries to

  5. Brayton Isotope Power System (BIPS) facility specification

    Energy Technology Data Exchange (ETDEWEB)

    1976-05-31

    General requirements for the Brayton Isotope Power System (BIPS)/Ground Demonstration System (GDS) assembly and test facility are defined. The facility will include provisions for a complete test laboratory for GDS checkout, performance, and endurance testing, and a contamination-controlled area for assembly, fabrication, storage, and storage preparation of GDS components. Specifications, schedules, and drawings are included.

  6. 12 CFR 347.119 - Specific consent.

    Science.gov (United States)

    2010-01-01

    ... processing procedure. (d) Specific consent. Direct or indirect investments in or activities of foreign... control such organization as a result of a foreign investment; or (ii) A bank would be establishing a... foreign country. (1) Applicable law or practice in the foreign country where the foreign organization or...

  7. TAL effectors specificity stems from negative discrimination.

    Directory of Open Access Journals (Sweden)

    Basile I M Wicky

    Full Text Available Transcription Activator-Like (TAL effectors are DNA-binding proteins secreted by phytopathogenic bacteria that interfere with native cellular functions by binding to plant DNA promoters. The key element of their architecture is a domain of tandem-repeats with almost identical sequences. Most of the polymorphism is located at two consecutive amino acids termed Repeat Variable Diresidue (RVD. The discovery of a direct link between the RVD composition and the targeted nucleotide allowed the design of TAL-derived DNA-binding tools with programmable specificities that revolutionized the field of genome engineering. Despite structural data, the molecular origins of this specificity as well as the recognition mechanism have remained unclear. Molecular simulations of the recent crystal structures suggest that most of the protein-DNA binding energy originates from non-specific interactions between the DNA backbone and non-variable residues, while RVDs contributions are negligible. Based on dynamical and energetic considerations we postulate that, while the first RVD residue promotes helix breaks--allowing folding of TAL as a DNA-wrapping super-helix--the second provides specificity through a negative discrimination of matches. Furthermore, we propose a simple pharmacophore-like model for the rationalization of RVD-DNA interactions and the interpretation of experimental findings concerning shared affinities and binding efficiencies. The explanatory paradigm presented herein provides a better comprehension of this elegant architecture and we hope will allow for improved designs of TAL-derived biotechnological tools.

  8. Accounting valuation development of specific assets

    Directory of Open Access Journals (Sweden)

    I.V. Zhigley

    2017-12-01

    Full Text Available The current issues of accounting estimate development are considered. The necessity of the development of accounting estimate in the context of the non-institutional theory principles based on the selection of a number of reasons is grounded. The reasons for deterioration of accounting reputation as a separate socio-economic institute in the context of developing the methodology for specific assets accounting are discovered. The system of normative regulation of accounting estimate of enterprise non-current assets in the case of diminishing their usefulness is analyzed. The procedure for determining and accounting for the depreciation of assets in accordance with IFRS 36 «Depreciation of Assets» is developed. The features of the joint use of the concept of «value in use» and «fair value» in the accounting system are disclosed. The procedure for determining the value of compensation depending on the degree of specificity of assets is developed. The necessity to clarify the features that indicate the possibility of diminishing the usefulness of specific assets (termination or pre-term termination of the contract for the use of a specific asset is grounded.

  9. Iron addition to soil specifically stabilized lignin

    Science.gov (United States)

    Steven J. Hall; Whendee L. Silver; Vitaliy I. Timokhin; Kenneth E. Hammel

    2016-01-01

    The importance of lignin as a recalcitrant constituent of soil organic matter (SOM) remains contested. Associations with iron (Fe) oxides have been proposed to specifically protect lignin from decomposition, but impacts of Fe-lignin interactions on mineralization rates remain unclear. Oxygen (O2) fluctuations characteristic of humid tropical...

  10. Chapter 9: Questions from CNEN specific exams

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2018-04-01

    The following are real questions from CNEN specific exams for obtaining the certification of RSO for gamma irradiators. These are questions that require essay answers, that are interpretative ones and therefore that may accept more than one interpretation, therefore more than one answer. For this reason, suggestions of answers will be presented in the second part of this chapter.

  11. 14 CFR 29.1397 - Color specifications.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Color specifications. 29.1397 Section 29.1397 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT...) Aviation green— x is not greater than 0.440−0.320y; x is not greater than y−0.170; and y is not less than 0...

  12. 14 CFR 23.1397 - Color specifications.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Color specifications. 23.1397 Section 23.1397 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT... greater than 0.002. (b) Aviation green— x is not greater than 0.440−0.320y; x is not greater than y−0.170...

  13. 14 CFR 25.1397 - Color specifications.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Color specifications. 25.1397 Section 25.1397 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT...) Aviation green— x is not greater than 0.440−0.320y ; x is not greater than y−0.170; and y is not less than...

  14. 14 CFR 27.1397 - Color specifications.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Color specifications. 27.1397 Section 27.1397 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT...) Aviation green— x is not greater than 0.440−0.320y; x is not greater than y−0.170; and y is not less than 0...

  15. MODEL OF TEACHING PROFESSION SPECIFIC BILATERAL TRANSLATION

    Directory of Open Access Journals (Sweden)

    Yana Fabrychna

    2017-03-01

    Full Text Available The article deals with the author’s interpretation of the process of teaching profession specific bilateral translation to student teacher of English in the Master’s program. The goal of the model of teaching profession specific bilateral translation development is to determine the logical sequence of educational activities of the teacher as the organizer of the educational process and students as its members. English and Ukrainian texts on methods of foreign languages and cultures teaching are defined as the object of study. Learning activities aimed at the development of student teachers of English profession specific competence in bilateral translation and Translation Proficiency Language Portfolio for Student Teachers of English are suggested as teaching tools. The realization of the model of teaching profession specific bilateral translation to student teachers of English in the Master’s program is suggested within the module topics of the academic discipline «Practice of English as the first foreign language»: Globalization; Localization; Education; Work; The role of new communication technologies in personal and professional development. We believe that the amount of time needed for efficient functioning of the model is 48 academic hours, which was determined by calculating the total number of academic hours allotted for the academic discipline «Practice of English as the first foreign language» in Ukrainian universities. Peculiarities of the model realization as well as learning goals and content of class activities and home self-study work of students are outlined.

  16. Slicing AADL specifications for model checking

    NARCIS (Netherlands)

    Odenbrett, M.R.; Nguyen, V.Y.; Noll, T.

    2010-01-01

    To combat the state-space explosion problem in model checking larger systems, abstraction techniques can be employed. Here, methods that operate on the system specification before constructing its state space are preferable to those that try to minimize the resulting transition system as they

  17. [The "specific" liability regime for blood products].

    Science.gov (United States)

    Byk, Christian

    2017-10-13

    Based on the system of liability for defective products as organized by the European Directive of 25 July 1985, responsibility for blood products does not therefore constitute a genuine specific regime. However, European law leaves States a margin of discretion in the implementation of the Directive with regard to health products. This is the case in particular with the exemption for development risk.

  18. Digital PET compliance to EARL accreditation specifications

    NARCIS (Netherlands)

    Koopman, Daniëlle; Groot Koerkamp, Maureen; Jager, Pieter L.; Arkies, Hester; Knollema, Siert; Slump, Cornelis H.; Sanches, Pedro G.; van Dalen, Jorn A.

    2017-01-01

    Background: Our aim was to evaluate if a recently introduced TOF PET system with digital photon counting technology (Philips Healthcare), potentially providing an improved image quality over analogue systems, can fulfil EANM research Ltd (EARL) accreditation specifications for tumour imaging with

  19. Chapter 9: Questions from CNEN specific exams

    International Nuclear Information System (INIS)

    2018-01-01

    The following are real questions from CNEN specific exams for obtaining the certification of RSO for gamma irradiators. These are questions that require essay answers, that are interpretative ones and therefore that may accept more than one interpretation, therefore more than one answer. For this reason, suggestions of answers will be presented in the second part of this chapter

  20. Standard specification for agencies performing nondestructive testing

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This specification covers minimum requirements for agencies performing nondestructive testing (NDT). 1.2 When using this specification to assess the capability of, or to accredit NDT agencies, Guide E 1359 shall be used as a basis for the survey. It can be supplemented as necessary with more detail in order to meet the auditor's specific needs. 1.3 This specification can be used as a basis to evaluate testing or inspection agencies, or both, and is intended for use for the qualifying or accrediting, or both, of testing or inspection agencies, public or private. 1.4 The use of SI or inch-pound units, or combination thereof, will be the responsibility of the technical committee whose standards are referred to in this standard. 1.5 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to...

  1. NIF small optics laser damage test specifications

    International Nuclear Information System (INIS)

    Sheehan, L

    1999-01-01

    The Laser Damage Group is currently conducting tests on small optics samples supplied for initial evaluation of potential NIF suppliers. This document is meant to define the specification of laser-induced damage for small optics and the test methods used to collect the data. A rating system which will be applied for vendor selection is presented

  2. Spent nuclear fuel project product specification

    International Nuclear Information System (INIS)

    PAJUNEN, A.L.

    1999-01-01

    This document establishes the limits and controls for the significant parameters that could potentially affect the safety and/or quality of the Spent Nuclear Fuel (SNF) packaged for processing, transport, and storage. The product specifications in this document cover the SNF packaged in Multi-Canister Overpacks to be transported throughout the SNF Project

  3. A camera specification for tendering purposes

    International Nuclear Information System (INIS)

    Lunt, M.J.; Davies, M.D.; Kenyon, N.G.

    1985-01-01

    A standardized document is described which is suitable for sending to companies which are being invited to tender for the supply of a gamma camera. The document refers to various features of the camera, the performance specification of the camera, maintenance details, price quotations for various options and delivery, installation and warranty details. (U.K.)

  4. Teaching Case: Enterprise Architecture Specification Case Study

    Science.gov (United States)

    Steenkamp, Annette Lerine; Alawdah, Amal; Almasri, Osama; Gai, Keke; Khattab, Nidal; Swaby, Carval; Abaas, Ramy

    2013-01-01

    A graduate course in enterprise architecture had a team project component in which a real-world business case, provided by an industry sponsor, formed the basis of the project charter and the architecture statement of work. The paper aims to share the team project experience on developing the architecture specifications based on the business case…

  5. Ontology Assisted Formal Specification Extraction from Text

    Directory of Open Access Journals (Sweden)

    Andreea Mihis

    2010-12-01

    Full Text Available In the field of knowledge processing, the ontologies are the most important mean. They make possible for the computer to understand better the natural language and to make judgments. In this paper, a method which use ontologies in the semi-automatic extraction of formal specifications from a natural language text is proposed.

  6. Cell-specific targeting by heterobivalent ligands.

    Science.gov (United States)

    Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J

    2011-07-20

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.

  7. microRNA expression during trophectoderm specification.

    Directory of Open Access Journals (Sweden)

    Srinivas R Viswanathan

    2009-07-01

    Full Text Available Segregation of the trophectoderm from the inner cell mass of the embryo represents the first cell-fate decision of mammalian development. Transcription factors essential for specifying trophectoderm have been identified, but the role of microRNAs (miRNAs in modulating this fate-choice has been largely unexplored. We have compared miRNA expression in embryonic stem cell (ESC-derived trophectoderm and in staged murine embryos to identify a set of candidate miRNAs likely to be involved in trophectoderm specification.We profiled embryonic stem cells (ESCs as they were induced to differentiate into trophectodermal cells by ectopic expression of HRas/Q61L. We also profiled murine embryos at progressive stages of preimplantation development (zygote, 2-cell, 4-cell, 8-cell, morula, and blastocyst, which includes the time window in which the trophectoderm is specified in vivo Q61L/H.We describe miRNA expression changes that occur during trophectoderm specification and validate that our in vitro system faithfully recapitulates trophectoderm specification in vivo. By comparing our in vitro and in vivo datasets, we have identified a minimal set of candidate miRNAs likely to play a role in trophectoderm specification. These miRNAs are predicted to regulate a host of development-associated target genes, and many of these miRNAs have previously reported roles in development and differentiation. Additionally, we highlight a number of miRNAs whose tight developmental regulation may reflect a functional role in other stages of embryogenesis. Our embryo profiling data may be useful to investigators studying trophectoderm specification and other stages of preimplantation development.

  8. Hepatocyte specific expression of human cloned genes

    Energy Technology Data Exchange (ETDEWEB)

    Cortese, R

    1986-01-01

    A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

  9. Hand Specific Representations in Language Comprehension

    Directory of Open Access Journals (Sweden)

    Claire eMoody-Triantis

    2014-06-01

    Full Text Available Theories of embodied cognition argue that language comprehension involves sensory-motor re-enactments of the actions described. However, the degree of specificity of these re-enactments as well as the relationship between action and language remains a matter of debate. Here we investigate these issues by examining how hand-specific information (left or right hand is recruited in language comprehension and action execution. An fMRI study tested right-handed participants in two separate tasks that were designed to be as similar as possible to increase sensitivity of the comparison across task: an action execution go/no-go task where participants performed right or left hand actions, and a language task where participants read sentences describing the same left or right handed actions as in the execution task. We found that language-induced activity did not match the hand-specific patterns of activity found for action execution in primary somatosensory and motor cortex, but it overlapped with pre-motor and parietal regions associated with action planning. Within these pre-motor regions, both right hand actions and sentences elicited stronger activity than left hand actions and sentences - a dominant hand effect -. Importantly, both dorsal and ventral sections of the left pre-central gyrus were recruited by both tasks, suggesting different action features being recruited. These results suggest that (a language comprehension elicits motor representations that are hand-specific and akin to multimodal action plans, rather than full action re-enactments; and (b language comprehension and action execution share schematic hand-specific representations that are richer for the dominant hand, and thus linked to previous motor experience.

  10. Are videogame training gains specific or general?

    Science.gov (United States)

    Oei, Adam C; Patterson, Michael D

    2014-01-01

    Many recent studies using healthy adults document enhancements in perception and cognition from playing commercial action videogames (AVGs). Playing action games (e.g., Call of Duty, Medal of Honor) is associated with improved bottom-up lower-level information processing skills like visual-perceptual and attentional processes. One proposal states a general improvement in the ability to interpret and gather statistical information to predict future actions which then leads to better performance across different perceptual/attentional tasks. Another proposal claims all the tasks are separately trained in the AVGs because the AVGs and laboratory tasks contain similar demands. We review studies of action and non-AVGs to show support for the latter proposal. To explain transfer in AVGs, we argue that the perceptual and attention tasks share common demands with the trained videogames (e.g., multiple object tracking (MOT), rapid attentional switches, and peripheral vision). In non-AVGs, several studies also demonstrate specific, limited transfer. One instance of specific transfer is the specific enhancement to mental rotation after training in games with a spatial emphasis (e.g., Tetris). In contrast, the evidence for transfer is equivocal where the game and task do not share common demands (e.g., executive functioning). Thus, the "common demands" hypothesis of transfer not only characterizes transfer effects in AVGs, but also non-action games. Furthermore, such a theory provides specific predictions, which can help in the selection of games to train human cognition as well as in the design of videogames purposed for human cognitive and perceptual enhancement. Finally this hypothesis is consistent with the cognitive training literature where most post-training gains are for tasks similar to the training rather than general, non-specific improvements.

  11. Are videogame training gains specific or general?

    Directory of Open Access Journals (Sweden)

    Adam C. Oei

    2014-04-01

    Full Text Available Many recent studies using healthy adults document enhancements in perception and cognition from playing commercial action videogames. Playing action games (e.g., Call of Duty, Medal of Honor is associated with improved bottom-up lower-level information processing skills like visual-perceptual and attentional processes. One proposal states a general improvement in the ability to interpret and gather statistical information to predict future actions which then leads to better performance across different perceptual/attentional tasks. Another proposal claims all the tasks are separately trained in the action videogames because the action videogames and laboratory tasks contain similar demands. We review studies of action and non-action videogames to show support for the latter proposal. To explain transfer in action videogames, we argue that the perceptual and attention tasks share common demands with the trained videogames (e.g., multiple object tracking, rapid attentional switches, and peripheral vision. In non-action videogames, several studies also demonstrate specific, limited transfer. One instance of specific transfer is the specific enhancement to mental rotation after training in games with a spatial emphasis (e.g, Tetris. In contrast, the evidence for transfer is equivocal where the game and task do not share common demands (e.g., executive functioning. Thus, the common demands hypothesis of transfer not only characterizes transfer effects in action videogames, but also non-action games. Furthermore, such a theory provides specific predictions, which can help in the selection of games to train human cognition as well as in the design of videogames purposed for human cognitive and perceptual enhancement. Finally this hypothesis is consistent with the cognitive training literature where most post-training gains are for tasks similar to the training rather than general, non-specific improvements.

  12. Are videogame training gains specific or general?

    Science.gov (United States)

    Patterson, Michael D.

    2014-01-01

    Many recent studies using healthy adults document enhancements in perception and cognition from playing commercial action videogames (AVGs). Playing action games (e.g., Call of Duty, Medal of Honor) is associated with improved bottom-up lower-level information processing skills like visual-perceptual and attentional processes. One proposal states a general improvement in the ability to interpret and gather statistical information to predict future actions which then leads to better performance across different perceptual/attentional tasks. Another proposal claims all the tasks are separately trained in the AVGs because the AVGs and laboratory tasks contain similar demands. We review studies of action and non-AVGs to show support for the latter proposal. To explain transfer in AVGs, we argue that the perceptual and attention tasks share common demands with the trained videogames (e.g., multiple object tracking (MOT), rapid attentional switches, and peripheral vision). In non-AVGs, several studies also demonstrate specific, limited transfer. One instance of specific transfer is the specific enhancement to mental rotation after training in games with a spatial emphasis (e.g., Tetris). In contrast, the evidence for transfer is equivocal where the game and task do not share common demands (e.g., executive functioning). Thus, the “common demands” hypothesis of transfer not only characterizes transfer effects in AVGs, but also non-action games. Furthermore, such a theory provides specific predictions, which can help in the selection of games to train human cognition as well as in the design of videogames purposed for human cognitive and perceptual enhancement. Finally this hypothesis is consistent with the cognitive training literature where most post-training gains are for tasks similar to the training rather than general, non-specific improvements. PMID:24782722

  13. Hand specific representations in language comprehension.

    Science.gov (United States)

    Moody-Triantis, Claire; Humphreys, Gina F; Gennari, Silvia P

    2014-01-01

    Theories of embodied cognition argue that language comprehension involves sensory-motor re-enactments of the actions described. However, the degree of specificity of these re-enactments as well as the relationship between action and language remains a matter of debate. Here we investigate these issues by examining how hand-specific information (left or right hand) is recruited in language comprehension and action execution. An fMRI study tested self-reported right-handed participants in two separate tasks that were designed to be as similar as possible to increase sensitivity of the comparison across task: an action execution go/no-go task where participants performed right or left hand actions, and a language task where participants read sentences describing the same left or right handed actions as in the execution task. We found that language-induced activity did not match the hand-specific patterns of activity found for action execution in primary somatosensory and motor cortex, but it overlapped with pre-motor and parietal regions associated with action planning. Within these pre-motor regions, both right hand actions and sentences elicited stronger activity than left hand actions and sentences-a dominant hand effect. Importantly, both dorsal and ventral sections of the left pre-central gyrus were recruited by both tasks, suggesting different action features being recruited. These results suggest that (a) language comprehension elicits motor representations that are hand-specific and akin to multimodal action plans, rather than full action re-enactments; and (b) language comprehension and action execution share schematic hand-specific representations that are richer for the dominant hand, and thus linked to previous motor experience.

  14. Adolescents with specific learning disabilities - perceptions of specific learning disabilities in the environment of secondary schools

    OpenAIRE

    Pospíšilová, Zuzana

    2012-01-01

    The thesis focuses on adolescents with specific learning disabilities in the milieu of secondary schools. It is divided into a theoretical part and an empirical part. The first part introduces a topic of specific learning disabilities in the developmental stage of adolescence. It first describes the most relevant aspects of adolescent development. The attention is then paid to typical manifestations of specific learning disabilities in adolescence, and also to secondary symptoms usually conne...

  15. Specific developmental pathways underlie host specificity in the parasitic plant Orobanche

    Science.gov (United States)

    Hiscock, Simon

    2010-01-01

    Parasitic angiosperms are an ecologically and economically important group of plants. However our understanding of the basis for host specificity in these plants is embryonic. Recently we investigated host specificity in the parasitic angiosperm Orobanche minor, and demonstrated that this host generalist parasite comprises genetically defined races that are physiologically adapted to specific hosts. Populations occurring naturally on red clover (Trifolium pratense) and sea carrot (Daucus carota subsp. gummifer) respectively, showed distinct patterns of host specificity at various developmental stages, and a higher fitness on their natural hosts, suggesting these races are locally adapted. Here we discuss the implications of our findings from a broader perspective. We suggest that differences in signal responsiveness and perception by the parasite, as well as qualitative differences in signal production by the host, may elicit host specificity in this parasitic plant. Together with our earlier demonstration that these O. minor races are genetically distinct based on molecular markers, our recent data provide a snapshot of speciation in action, driven by host specificity. Indeed, host specificity may be an underestimated catalyst for speciation in parasitic plants generally. We propose that identifying host specific races using physiological techniques will complement conventional molecular marker-based approaches to provide a framework for delineating evolutionary relationships among cryptic host-specific parasitic plants. PMID:20081361

  16. Risk management through dynamic technical specifications

    International Nuclear Information System (INIS)

    Klopp, George T.; Petersen, Thomas A.

    2004-01-01

    The wide deployment of plant specific probabilistic risk assessments for nuclear power plants has provided the means to effect a fresh risk management perspective and a fresh, risk based, regulatory outlook on nuclear power. There has been a great deal of conversation on risk based regulation within the U. S. nuclear power industry but, curiously, very little on effective risk management. This paper proposes a means to link the two subjects through the plant Technical Specifications. A revised concept for Technical Specifications is suggested which is based on deterministic analyses and probabilistic risk assessments for each plant. The revised Technical Specifications would consider, on a real-time basis, the exact state of the plant in terms of the status of key components and systems. It would depict current plant risk levels and compare those levels to the desired and limiting (alert/action) levels. It would advise the plant operator on the risk impact of proposed actions through a simple query system and illustrate the impact of such actions on plant status relative to designated risk values. The basis for the proposed approach lies in realistic deterministic plant analyses and probabilistic risk assessment (PRA) deployment tools being developed, in parallel, by a number of parties in the U.S. today. These PRAs are based primarily on the existing plant responses to Generic Letter 88-20, 'Individual Plant Examinations' (IPEs). Each of these tools allows the plant operator to input, on a real-time basis, the status of key equipment and systems. The tools then provide explicit illustrations of dependency effects; updated, 'real-time' risk status indications such as core damage frequency; and, in some cases, allow the operator to assess the risk impact of removing from service selected components for maintenance or testing. These systems generally operate on personal computers and provide nearly instantaneous responses to plant queries. Moving from these tools to

  17. Nanoparticles for Site Specific Genome Editing

    Science.gov (United States)

    McNeer, Nicole Ali

    Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to

  18. Development of industrial variant specification systems

    DEFF Research Database (Denmark)

    Hansen, Benjamin Loer

    be developed from a holistic and strategically anchored point of view. Another assumption is that this is a challenge for many industrial companies. Even though the literature presents many considerations on general issues covering new information technology, little work is found on the business perspectives...... are discussed. A list of structural variables and solution components has been created. These are related to four design aspects in the holistic system design covering the aspects of process design, selection of resources (such as hardware, software and humans), the design of information structures...... solution elements and structural variables to be used in the design of variant specification systems. The thesis presents a “top-down” procedure to be used to develop variant specification systems from a strategically anchored and holistic point of view. A methodology and related task variables...

  19. Risk based technique for improving technical specifications

    International Nuclear Information System (INIS)

    Kim, I. S.; Jae, M. S.; Kim, B. S.; Hwang, S. W.; Kang, K. M.; Park, S. S.; Yu, Y. S.

    2001-03-01

    The objective of this study is to develop the systematic guidance for reviewing the documents associated with the changes of technical specifications. The work done in this fiscal year is the following : surveys in TS requirements, TS improvements and TS regulations in foreign countries as well as Korea, surveys on the state-of-the-art of RITSs and their use in Korea, development of a decision-making framework for both the licensee and the regulation agency, description of risk measures, assessment methodology on STI/AOT, and adverse effects caused by periodic maintenance, which are explained in appendix. The results of this study might contribute to enhancing the quality of the current technical specifications and contribute to preparing the risk informed regulation program using the decision-making framework developed in this study

  20. Duration and specificity of olfactory nonassociative memory.

    Science.gov (United States)

    Freedman, Kaitlin G; Radhakrishna, Sreya; Escanilla, Olga; Linster, Christiane

    2013-05-01

    Olfactory habituation is a simple form of nonassociative memory in which responsiveness to stable but behaviorally nonsignificant stimuli is decreased. Olfactory habituation has recently become a paradigm widely used to probe the neural substrate underlying olfactory perception and memory. This simple behavioral paradigm has been used successfully used to probe many aspects of olfactory processing, and it has recently become clear that the neural processes underlying olfactory habituation can depend on the task parameters used. We here further investigate memory specificity and duration using 2 variations in task parameters: the number of habituation trials and the time delay between habituation and cross-habituation testing. We find that memory specificity increases with the number of habituation trials but decreases with time after the last habituation trial.

  1. Reversal of target-specific oral anticoagulants

    Science.gov (United States)

    Siegal, D.M.; Cuker, Adam

    2014-01-01

    Target-specific oral anticoagulants (TSOACs) provide safe and effective anticoagulation for the prevention and treatment of thrombosis in a variety of clinical settings by interfering with the activity of thrombin (dabigatran) or factor Xa (rivaroxaban, apixaban, edoxaban, betrixaban). Although TSOACs have practical advantages over vitamin K antagonists (VKAs), there are currently no antidotes to reverse their anticoagulant effect. Herein we summarize the available evidence for TSOAC reversal using nonspecific and specific reversal agents. We discuss important limitations of existing evidence, which is derived from studies in human volunteers, animal models and in vitro experiments. Studies evaluating the safety and efficacy of reversal agents on clinical outcomes such as bleeding and mortality in patients with TSOAC-associated bleeding are needed. PMID:24880102

  2. The Econometric Procedures of Specific Transaction Identification

    Directory of Open Access Journals (Sweden)

    Doszyń Mariusz

    2017-06-01

    Full Text Available The paper presents the econometric procedures of identifying specific transactions, in which atypical conditions or attributes may occur. These procedures are based on studentized and predictive residuals of the accordingly specified econometric models. The dependent variable is a unit transactional price, and explanatory variables are both the real properties’ attributes and accordingly defined artificial binary variables. The utility of the proposed method has been verified by means of a real market data base. The proposed procedures can be helpful during the property valuation process, making it possible to reject real properties that are specific (both from the point of view of the transaction conditions and the properties’ attributes and, consequently, to select an appropriate set of similar attributes that are essential for the valuation process.

  3. Wp specific methylation of highly proliferated LCLs

    International Nuclear Information System (INIS)

    Park, Jung-Hoon; Jeon, Jae-Pil; Shim, Sung-Mi; Nam, Hye-Young; Kim, Joon-Woo; Han, Bok-Ghee; Lee, Suman

    2007-01-01

    The epigenetic regulation of viral genes may be important for the life cycle of EBV. We determined the methylation status of three viral promoters (Wp, Cp, Qp) from EBV B-lymphoblastoid cell lines (LCLs) by pyrosequencing. Our pyrosequencing data showed that the CpG region of Wp was methylated, but the others were not. Interestingly, Wp methylation was increased with proliferation of LCLs. Wp methylation was as high as 74.9% in late-passage LCLs, but 25.6% in early-passage LCLs. From two Burkitt's lymphoma cell lines, Wp specific hypermethylation was also found (>80%). Interestingly, the expression of EBNA2 gene which located directly next to Wp was associated with its methylation. Our data suggested that Wp specific methylation may be important for the indicator of the proliferation status of LCLs, and the epigenetic viral gene regulation of EBNA2 gene by Wp should be further defined possibly with other biological processes

  4. Beta-endorphin radioimmunoassay: specificity studies

    Energy Technology Data Exchange (ETDEWEB)

    Colas-Linhart, N.; Perdrisot, R.; Petiet, A.; Bok, B.

    1986-01-01

    This note describes the technical details of a cerebrospinal fluid (CSF) B-Endorphin (B-End) radioimmunoassay (RIA). We used an antiserum raised in rabbits against human B-End which cross-reacs 100% with B-Lipotrophin (B-Lph). Thus, filtration chromatography is used to separate both peptides. The assay is sensitive (limit detection=14 pmoles/l), reproducible (the intra and inter assay coefficients of variation are 5 and 6% respectively). Specificity studies are performed to verify the cross-reactions with other opioid peptides and the non specific reactions with the biological fluid (CSF). In order to evaluate the effects of iodine-containing contrast media on the RIA, additional standard curves were analyzed in the presence of varying concentrations of two contrast materials.

  5. Psoralen photomutagenic specificity in Salmonella typhimurium

    International Nuclear Information System (INIS)

    Koch, W.H.

    1986-01-01

    The cytotoxic and mutagenic specificity of two therapeutically employed psoralens was examined in several Ames Salmonella typhimurium strains with near ultraviolet light activation. Photomutagenic activity of 8-methoxypsoralen (8MOP) and 4,5',8-trimethylpsoralen (TMP) was found to be sequence-specific, and additionally was dependent on the level of DNA-repair proficiency. Phototoxicity was essentially identical in hisC3076, hisD3052 and hisG46 strains; uvrB - excision-repair-deficient bacteria were considerably more susceptible to lethal effects than wild-type parental strains. Finally, the data show that psoralens are potent frameshift photomutagens in Salmonella hisC3076 strains and demonstrate the potential utility of these strains in evaluating photomutagenic and phototoxic activity of new furocoumarin derivatives. (Auth.)

  6. Production of high specific activity silicon-32

    International Nuclear Information System (INIS)

    Phillips, D.R.; Brzezinski, M.A.

    1998-01-01

    This is the final report of a three-year, Laboratory Directed Research and Development Project (LDRD) at Los Alamos National Laboratory (LANL). There were two primary objectives for the work performed under this project. The first was to take advantage of capabilities and facilities at Los Alamos to produce the radionuclide 32 Si in unusually high specific activity. The second was to combine the radioanalytical expertise at Los Alamos with the expertise at the University of California to develop methods for the application of 32 Si in biological oceanographic research related to global climate modeling. The first objective was met by developing targetry for proton spallation production of 32 Si in KCl targets and chemistry for its recovery in very high specific activity. The second objective was met by developing a validated field-useable, radioanalytical technique, based upon gas-flow proportional counting, to measure the dynamics of silicon uptake by naturally occurring diatoms

  7. Specificity and robustness in transcription control networks.

    Science.gov (United States)

    Sengupta, Anirvan M; Djordjevic, Marko; Shraiman, Boris I

    2002-02-19

    Recognition by transcription factors of the regulatory DNA elements upstream of genes is the fundamental step in controlling gene expression. How does the necessity to provide stability with respect to mutation constrain the organization of transcription control networks? We examine the mutation load of a transcription factor interacting with a set of n regulatory response elements as a function of the factor/DNA binding specificity and conclude on theoretical grounds that the optimal specificity decreases with n. The predicted correlation between variability of binding sites (for a given transcription factor) and their number is supported by the genomic data for Escherichia coli. The analysis of E. coli genomic data was carried out using an algorithm suggested by the biophysical model of transcription factor/DNA binding. Complete results of the search for candidate transcription factor binding sites are available at http://www.physics.rockefeller.edu/~boris/public/search_ecoli.

  8. Specificity of economic and social nature tourism

    Directory of Open Access Journals (Sweden)

    Chabanjuk Oleg Vasil'evich

    2015-11-01

    Full Text Available The article considers a number of factors specific to the tourism industry: a multiplier effect, a kind of method of generating working capital, specific "invisible exports", the factor most risky activities, the principle of direct and inverse transformation, and others. The data of experts of the World Tourism Organization (UNWTO on tourism as an indicator of welfare. It is emphasized along with the economic function of tourism on the social dimension of tourism in its mass phenomenon. The paper highlights the main problems and shortcomings of tourism as a complex socio-economic system; analysis of theoretical approaches to periodization of tourism that reflects the genesis of approaches regarding the nature of tourism; The factors of external and internal tourism development, made their ranking to measure the relationship between the measurement periods allocated for tourism development using the Spearman rank correlation coefficient.

  9. Cell-Specific Aptamers as Emerging Therapeutics

    Directory of Open Access Journals (Sweden)

    Cindy Meyer

    2011-01-01

    Full Text Available Aptamers are short nucleic acids that bind to defined targets with high affinity and specificity. The first aptamers have been selected about two decades ago by an in vitro process named SELEX (systematic evolution of ligands by exponential enrichment. Since then, numerous aptamers with specificities for a variety of targets from small molecules to proteins or even whole cells have been selected. Their applications range from biosensing and diagnostics to therapy and target-oriented drug delivery. More recently, selections using complex targets such as live cells have become feasible. This paper summarizes progress in cell-SELEX techniques and highlights recent developments, particularly in the field of medically relevant aptamers with a focus on therapeutic and drug-delivery applications.

  10. Shape configuration and category-specificity

    DEFF Research Database (Denmark)

    Gerlach, Christian; Law, I; Paulson, Olaf B.

    2006-01-01

    and fragmented drawings. We also examined whether fragmentation had different impact on the recognition of natural objects and artefacts and found that recognition of artefacts was more affected by fragmentation than recognition of natural objects. Thus, the usual finding of an advantage for artefacts...... in difficult object decision tasks, which is also found in the present experiments with outlines, is reversed when the stimuli are fragmented. This interaction between category (natural versus artefacts) and stimulus type (outlines versus fragmented forms) is in accordance with predictions derived from...... a recent account of category-specificity and lends support to the notion that category-specific impairments can occur for both natural objects and artefacts following damage to pre-semantic stages in visual object recognition. The implications of the present findings are discussed in relation to theories...

  11. A beta-endorphin radioimmunoassay: specificity studies

    International Nuclear Information System (INIS)

    Colas-Linhart, N.; Perdrisot, R.; Petiet, A.; Bok, B.

    1986-01-01

    This note describes the technical details of a cerebrospinal fluid (CSF) B-Endorphin (B-End) radioimmunoassay (RIA). We used an antiserum raised in rabbits against human B-End which cross-reacs 100% with B-Lipotrophin (B-Lph). Thus, filtration chromatography is used to separate both peptides. The assay is sensitive (limit detection=14 pmoles/l), reproducible (the intra and inter assay coefficients of variation are 5 and 6% respectively). Specificity studies are performed to verify the cross-reactions with other opioid peptides and the non specific reactions with the biological fluid (CSF). In order to evaluate the effects of iodine-containing contrast media on the RIA, additional standard curves were analyzed in the presence of varying concentrations of two contrast materials [fr

  12. Phase-II Associative Memory ASIC Specifications

    CERN Document Server

    Stabile, Alberto; Warren, Matthew; Green, Barry; Konstantinidis, Nikolaos; Motuk, Halil Erdem; Frontini, Luca; Liberali, Valentino; Crescioli, Francesco; Fedi, Giacomo; Sotiropoulou, Calliope-louisa; De Canio, Francesco; Traversi, Gianluca; Shojaii, Seyed Ruhollah; Kubota, Takashi; Calderini, Giovanni; Palla, Fabrizio; Checcucci, Bruno; Spiller, Laurence Anthony; Mcnamara, Peter Charles

    2018-01-01

    This documents defines the specifications for the Associative Memory ASIC for Phase-II. The work-flow toward the final ASIC is organized in the following three steps • AM08 prototype: small area MPW prototype to test all the full custom features, the VHDL logic and the I/O. This chip must be fully functional with smaller memory area than the final ASIC; • AM09pre pre-production: full area ASIC to be fabricated with a full-mask set pilot run. Production corner wafers will be created; • AM09 production: full area ASIC with refinements for the mass production. The AM09 will be developed built on the AM08 extending the memory area, therefore the specification of both versions must be compatible.

  13. Accessing Specific Peptide Recognition by Combinatorial Chemistry

    DEFF Research Database (Denmark)

    Li, Ming

    Molecular recognition is at the basis of all processes for life, and plays a central role in many biological processes, such as protein folding, the structural organization of cells and organelles, signal transduction, and the immune response. Hence, my PhD project is entitled “Accessing Specific...... Peptide Recognition by Combinatorial Chemistry”. Molecular recognition is a specific interaction between two or more molecules through noncovalent bonding, such as hydrogen bonding, metal coordination, van der Waals forces, π−π, hydrophobic, or electrostatic interactions. The association involves kinetic....... Combinatorial chemistry was invented in 1980s based on observation of functional aspects of the adaptive immune system. It was employed for drug development and optimization in conjunction with high-throughput synthesis and screening. (chapter 2) Combinatorial chemistry is able to rapidly produce many thousands...

  14. Atmospheric pollution and specific tolerance of lichens

    Energy Technology Data Exchange (ETDEWEB)

    De Sloover, J

    1968-01-01

    An ecological method has been designed which allows a quantitative estimation of specific sensitivity of lichens to atmospheric pollution. That method is based on a comparison of the ''cortege moyen specifique'' i.e. the mean number of lichens growing with each species in a given area. Four of the obtained sequences are compared (The Dender valley and the area surrounding Gand, Belgium: the Oslo and the Helsinki areas); they show the order to toxiphoby of the related epiphytic lichens.

  15. Extinction Generates Outcome-Specific Conditioned Inhibition.

    Science.gov (United States)

    Laurent, Vincent; Chieng, Billy; Balleine, Bernard W

    2016-12-05

    Extinction involves altering a previously established predictive relationship between a cue and its outcome by repeatedly presenting that cue alone. Although it is widely accepted that extinction generates some form of inhibitory learning [1-4], direct evidence for this claim has been lacking, and the nature of the associative changes induced by extinction have, therefore, remained a matter of debate [5-8]. In the current experiments, we used a novel behavioral approach that we recently developed and that provides a direct measure of conditioned inhibition [9] to compare the influence of extinguished and non-extinguished cues on choice between goal-directed actions. Using this approach, we provide direct evidence that extinction generates outcome-specific conditioned inhibition. Furthermore, we demonstrate that this inhibitory learning is controlled by the infralimbic cortex (IL); inactivation of the IL using M4 DREADDs abolished outcome-specific inhibition and rendered the cue excitatory. Importantly, we found that context modulated this inhibition. Outside its extinction context, the cue was excitatory and functioned as a specific predictor of its previously associated outcome, biasing choice toward actions earning the same outcome. In its extinction context, however, the cue acted as a specific inhibitor and biased choice toward actions earning different outcomes. Context modulation of these excitatory and inhibitory memories was mediated by the dorsal hippocampus (HPC), suggesting that the HPC and IL act in concert to control the influence of conditioned inhibitors on choice. These findings demonstrate for the first time that extinction turns a cue into a net inhibitor that can influence choice via counterfactual action-outcome associations. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. HAL/S-FC compiler system specifications

    Science.gov (United States)

    1976-01-01

    This document specifies the informational interfaces within the HAL/S-FC compiler, and between the compiler and the external environment. This Compiler System Specification is for the HAL/S-FC compiler and its associated run time facilities which implement the full HAL/S language. The HAL/S-FC compiler is designed to operate stand-alone on any compatible IBM 360/370 computer and within the Software Development Laboratory (SDL) at NASA/JSC, Houston, Texas.

  17. Performance specifications for proton medical facility

    Energy Technology Data Exchange (ETDEWEB)

    Chu, W.T.; Staples, J.W.; Ludewigt, B.A.; Renner, T.R.; Singh, R.P.; Nyman, M.A.; Collier, J.M.; Daftari, I.K.; Petti, P.L.; Alonso, J.R. [Lawrence Berkeley Lab., CA (United States); Kubo, H.; Verhey, L.J. [University of California Davis Medical Center, Sacramento, CA (United States). Cancer Center]|[California Univ., San Francisco, CA (United States). School of Medicine; Castro, J.R. [Lawrence Berkeley Lab., CA (United States)]|[University of California Davis Medical Center, Sacramento, CA (United States). Cancer Center]|[California Univ., San Francisco, CA (United States). School of Medicine

    1993-03-01

    Performance specifications of technical components of a modern proton radiotherapy facility are presented. The technical items specified include: the accelerator; the beam transport system including rotating gantry; the treatment beamline systems including beam scattering, beam scanning, and dosimetric instrumentation; and an integrated treatment and accelerator control system. Also included are treatment ancillary facilities such as diagnostic tools, patient positioning and alignment devices, and treatment planning systems. The facility specified will accommodate beam scanning enabling the three-dimensional conformal therapy deliver .

  18. Gender-specific information search behavior

    OpenAIRE

    Parinaz Maghferat; Wolfgang G. Stock

    2010-01-01

    This paper presents an empirical gender study in the context of information science. It discusses an exploratory investigation, which provides empirical data about differences of information seeking activities by female and male students. The research focus was on whether there are gender-specific differences when people perform searches with the aid of general search engines and specialized Deep Web information services. It has been observed how the participants behaved in getting informatio...

  19. A Requirement Specification Language for AADL

    Science.gov (United States)

    2016-06-01

    models. The objective of ReqSpec is to support the elicitation , definition, and modeling of requirements for real-time embedded systems in an iterative...A Requirement Specification Language for AADL Peter H. Feiler Julien Delange Lutz Wrage June 2016 TECHNICAL REPORT CMU/SEI-2016-TR-008...is required for any other external and/or commercial use. Requests for permission should be directed to the Software En- gineering Institute at

  20. 50 CFR 648.200 - Specifications.

    Science.gov (United States)

    2010-10-01

    ..., unless an OY that exceeds MSY in a specific year is consistent with a control rule that ensures the... northerly along the Hague Line to the U.S.-Canadian border, to include state and Federal waters adjacent to...., northeasterly to the Hague Line at 42°53′14″ N. lat., 67°44′35″ W. long. [72 FR 11277, Mar. 12, 2007, as amended...

  1. EFFECTS OF MACRONUTRIENT COMPOSITION ON SPECIFIC ...

    African Journals Online (AJOL)

    Admin

    (6.1%) and lastly high and medium fat-fed mice (3.9% and 4.5%). KEY WORDS: ..... Sucrose. 147. 350. 172.8. 68.8. Cellulose. 50. 50. 50. 50. Soya oil. 25. 25. 25. 25. Lard. 20 .... J. Clin. Invest. 4, 353-387. McCue, M. D., 2006. Specific dynamic action: A century ... between certain amino acids and proteins with reference to ...

  2. Specific heat of praseodymium and neodymium

    International Nuclear Information System (INIS)

    Narayana Murthy, J.V.S.S.; Ramji Rao, R.

    1983-01-01

    The elements of the dynamical matrix of an ideal deep lattice, with nearest neighbour central interactions, have been obtained in a homogeneously strained state. The dispersion relations along the [0001] direction, on this model, have been presented for Pr and Nd. The frequency distribution function g(ω) is obtained and the lattice specific heat is calculated for Pr and Nd and the temperature variation of the equivalent Debye temperature is presented. (author)

  3. Domain-Specific Control of Selective Attention

    Science.gov (United States)

    Lin, Szu-Hung; Yeh, Yei-Yu

    2014-01-01

    Previous research has shown that loading information on working memory affects selective attention. However, whether the load effect on selective attention is domain-general or domain-specific remains unresolved. The domain-general effect refers to the findings that load in one content (e.g. phonological) domain in working memory influences processing in another content (e.g., visuospatial) domain. Attentional control supervises selection regardless of information domain. The domain-specific effect refers to the constraint of influence only when maintenance and processing operate in the same domain. Selective attention operates in a specific content domain. This study is designed to resolve this controversy. Across three experiments, we manipulated the type of representation maintained in working memory and the type of representation upon which the participants must exert control to resolve conflict and select a target into the focus of attention. In Experiments 1a and 1b, participants maintained digits and nonverbalized objects, respectively, in working memory while selecting a target in a letter array. In Experiment 2, we presented auditory digits with a letter flanker task to exclude the involvement of resource competition within the same input modality. In Experiments 3a and 3b, we replaced the letter flanker task with an object flanker task while manipulating the memory load on object and digit representation, respectively. The results consistently showed that memory load modulated distractibility only when the stimuli of the two tasks were represented in the same domain. The magnitude of distractor interference was larger under high load than under low load, reflecting a lower efficacy of information prioritization. When the stimuli of the two tasks were represented in different domains, memory load did not modulate distractibility. Control of processing priority in selective attention demands domain-specific resources. PMID:24866977

  4. Domain Specific Languages for Interactive Web Services

    DEFF Research Database (Denmark)

    Brabrand, Claus

    This dissertation shows how domain specific languages may be applied to the domain of interactive Web services to obtain flexible, safe, and efficient solutions. We show how each of four key aspects of interactive Web services involving sessions, dynamic creation of HTML/XML documents, form field......, , that supports virtually all aspects of the development of interactive Web services and provides flexible, safe, and efficient solutions....

  5. Reasoning About Higher-Order Relational Specifications

    OpenAIRE

    Wang , Yuting; Chaudhuri , Kaustuv; Gacek , Andrew; Nadathur , Gopalan

    2013-01-01

    International audience; The logic of hereditary Harrop formulas (HH) has proven useful for specifying a wide range of formal systems. This logic includes a form of hypothetical judgment that leads to dynamically changing sets of assumptions and that is key to encoding side conditions and contexts that occur frequently in structural operational semantics (SOS) style presentations. Specifications are often useful in reasoning about the systems they describe. The Abella theorem prover supports s...

  6. Cultural Specifics of Management in Multinational Companies

    OpenAIRE

    Křečková Kroupová, Zuzana

    2002-01-01

    Nowadays the world is becoming increasingly economically connected, and cultural diversity of employees is gaining importance as a crucial competitive advantage. Cross-cultural communication ability is becoming a key management skill in multinational firms and is equally important for other employees who are exposed to other cultures in the workplace. This work mainly focuses on cultural specifics of management in multinational firms. The goal of this thesis is to discover how different natio...

  7. Learning LM Specificity for Ganglion Cells

    Science.gov (United States)

    Ahumada, Albert J.

    2015-01-01

    Unsupervised learning models have been proposed based on experience (Ahumada and Mulligan, 1990;Wachtler, Doi, Lee and Sejnowski, 2007) that allow the cortex to develop units with LM specific color opponent receptive fields like the blob cells reported by Hubel and Wiesel on the basis of visual experience. These models used ganglion cells with LM indiscriminate wiring as inputs to the learning mechanism, which was presumed to occur at the cortical level.

  8. On emotion specificity in decision making

    OpenAIRE

    Marcel Zeelenberg; Rob M. A. Nelissen; Seger M. Breugelmans; Rik Pieters

    2008-01-01

    We present a motivational account of the impact of emotion on decision making, termed the feeling-is-for-doing approach. We first describe the psychology of emotion and argue for a need to be specific when studying emotion's impact on decision making. Next we describe what our approach entails and how it relates emotion, via motivation to behavior. Then we offer two illustrations of our own research that provide support for two important elements in our reasoning. We end with specifying four ...

  9. Sedentary behavior and residual-specific mortality

    OpenAIRE

    Paul D. Loprinzi; Meghan K. Edwards; Eveleen Sng; Ovuokerie Addoh

    2016-01-01

    Background: The purpose of this study was to examine the association of accelerometer-assessed sedentary behavior and residual-specific mortality. Methods: Data from the 2003-2006 National Health and Nutrition Examination Survey (NHANES) were used (N = 5536), with follow-up through 2011. Sedentary behavior was objectively measured over 7 days via accelerometry. Results: When expressing sedentary behavior as a 60 min/day increase, the hazard ratio across the models ranged from 1.07-1.40 (P < 0...

  10. Specific methods on in-pile gammametry

    International Nuclear Information System (INIS)

    Pointud, M.-L.; Michel, Francois.

    1979-01-01

    The gammametry technique in nuclear research reactors has evolved by the adequation of its means and the quality of its results since its beginnings in 1972. We do not propose here to make a detailed presentation, nor describe the kinds of well known results that can henceforth be attained with it in a conventional manner; our intention, on the other hand, is to describe a few specific methods developed for using it in the SILOE reactor of the CEN/G [fr

  11. RD53A Integrated Circuit Specifications

    OpenAIRE

    Garcia-Sciveres, Mauricio

    2015-01-01

    Specifications for the RD53 collaboration’s first engineering wafer run of an integrated circuit (IC) for hybrid pixel detector readout, called RD53A. RD53A is intended to demonstrate in a large format IC the suitability of the technology (including radiation tolerance), the stable low threshold operation, and the high hit and trigger rate capabilities, required for HL-LHC upgrades of ATLAS and CMS. The wafer scale production will permit the experiments to prototype bump bonding assembly with...

  12. Modality-specificity of Selective Attention Networks

    OpenAIRE

    Stewart, Hannah J.; Amitay, Sygal

    2015-01-01

    Objective: To establish the modality specificity and generality of selective attention networks. Method: Forty-eight young adults completed a battery of four auditory and visual selective attention tests based upon the Attention Network framework: the visual and auditory Attention Network Tests (vANT, aANT), the Test of Everyday Attention (TEA), and the Test of Attention in Listening (TAiL). These provided independent measures for auditory and visual alerting, orienting, and conflict resoluti...

  13. Diagrammatic Representations in Domain-Specific Languages

    OpenAIRE

    Tourlas, Konstantinos

    2002-01-01

    One emerging approach to reducing the labour and costs of software development favours the specialisation of techniques to particular application domains. The rationale is that programs within a given domain often share enough common features and assumptions to enable the incorporation of substantial support mechanisms into domain-specific programming languages and associated tools. Instead of being machine-oriented, algorithmic implementations, programs in many domain-speci...

  14. Specifications development for "Karbatril" codenamed tablets

    Directory of Open Access Journals (Sweden)

    L. I. Kucherenko

    2017-08-01

    Full Text Available Introduction. According to current legislation of Ukraine the specifications of tablets include the following indicators: description, identification, average weight, disintegration and assay. The aim of the study. The development of specifications and project of quality control methods for "Karbatril" codenamed tablets. Materials and methods. During the study we analyzed 6 series of tablets "Karbatril." For the description, identification, determination of the average mass, disintegration, active ingredients quantify of "Karbatril" codenamed tablets we used appropriate methods and instruments. Results and discussion. Tablets "Karbatril" were analyzed for the following parameters: - Overview - Tablets white or nearly white; - Average weight - during the study the average weight of 6 series of obtained tablets ranged from 339,0 mg to 369,9 mg according to SPU from 337,0 mg to 373,0 mg; - Disintegration – according to SPU the disintegration for tablet without shell shall not exceed 15 min. Analyzed tablets disintegrated in the period from 5 to 10 minutes; - Identification and quantification of the active ingredients of tablets were conducted using modified HPLC methods. During the identification obtained chromatograms show compliance with SPU. In quantitative determination of the active ingredients content in "Karbatril" codenamed tablets we found carbamazepine from 148.18 mg to 150.19 mg, thiotriazoline - from 98.93 mg to 99.71 mg. This data is consistent to SPU which regulates content of carbamazepine - 150 mg ± 7,5%, thiotriazoline - 100 mg ± 10%. Conclusions. This study has developed specification for "Karbatril" codenamed tablets and also methods of HPLC qualitative and quantitative determination of active ingredients. In the specification the following parameters are included: description, identification, average weight, disintegration and assay. The study drafted quality control methods which are planned to be later offered to the

  15. Salt bridges: geometrically specific, designable interactions.

    Science.gov (United States)

    Donald, Jason E; Kulp, Daniel W; DeGrado, William F

    2011-03-01

    Salt bridges occur frequently in proteins, providing conformational specificity and contributing to molecular recognition and catalysis. We present a comprehensive analysis of these interactions in protein structures by surveying a large database of protein structures. Salt bridges between Asp or Glu and His, Arg, or Lys display extremely well-defined geometric preferences. Several previously observed preferences are confirmed, and others that were previously unrecognized are discovered. Salt bridges are explored for their preferences for different separations in sequence and in space, geometric preferences within proteins and at protein-protein interfaces, co-operativity in networked salt bridges, inclusion within metal-binding sites, preference for acidic electrons, apparent conformational side chain entropy reduction on formation, and degree of burial. Salt bridges occur far more frequently between residues at close than distant sequence separations, but, at close distances, there remain strong preferences for salt bridges at specific separations. Specific types of complex salt bridges, involving three or more members, are also discovered. As we observe a strong relationship between the propensity to form a salt bridge and the placement of salt-bridging residues in protein sequences, we discuss the role that salt bridges might play in kinetically influencing protein folding and thermodynamically stabilizing the native conformation. We also develop a quantitative method to select appropriate crystal structure resolution and B-factor cutoffs. Detailed knowledge of these geometric and sequence dependences should aid de novo design and prediction algorithms. Copyright © 2010 Wiley-Liss, Inc.

  16. One step processing for future diesel specifications

    International Nuclear Information System (INIS)

    Brierley, G.R.

    1997-01-01

    The trend in diesel fuel specifications is to limit the sulfur level to less than 0.05 wt- per cent. Many regions have also specified that diesel fuels must have lower aromatic levels, higher cetane numbers, and lower distillation end points. These changes will require significant refinery investment to meet the new diesel fuel specifications. The changes may also significantly affect the value of synthetic crude stocks. UOP has developed a new hydroprocessing catalyst which makes it possible to meet the new diesel specifications in one single processing step and at minimal cost. The catalyst saturates aromatics while opening ring structures at the same time. By selectively cracking heavy components into the diesel range with minimal cracking to gas or naphtha, heavier feedstocks can be upgraded to diesel, and refinery diesel yield can be augmented. Synthetic crude distillate is often high in aromatics and low in cetane number. This new UOP hydroprocessing system will allow synthetic crude producers and refiners to produce diesel fuels with higher cetane numbers, high-quality distillate blendstocks and distillate fuels. 26 figs

  17. Trait-specific dependence in romantic relationships.

    Science.gov (United States)

    Ellis, Bruce J; Simpson, Jeffry A; Campbell, Lorne

    2002-10-01

    Informed by three theoretical frameworks--trait psychology, evolutionary psychology, and interdependence theory--we report four investigations designed to develop and test the reliability and validity of a new construct and accompanying multiscale inventory, the Trait-Specific Dependence Inventory (TSDI). The TSDI assesses comparisons between present and alternative romantic partners on major dimensions of mate value. In Study 1, principal components analyses revealed that the provisional pool of theory-generated TSDI items were represented by six factors: Agreeable/Committed, Resource Accruing Potential, Physical Prowess, Emotional Stability, Surgency, and Physical Attractiveness. In Study 2, confirmatory factor analysis replicated these results on a different sample and tested how well different structural models fit the data. Study 3 provided evidence for the convergent and discriminant validity of the six TSDI scales by correlating each one with a matched personality trait scale that did not explicitly incorporate comparisons between partners. Study 4 provided further validation evidence, revealing that the six TSDI scales successfully predicted three relationship outcome measures--love, time investment, and anger/upset--above and beyond matched sets of traditional personality trait measures. These results suggest that the TSDI is a reliable, valid, and unique construct that represents a new trait-specific method of assessing dependence in romantic relationships. The construct of trait-specific dependence is introduced and linked with other theories of mate value.

  18. Development of Specifications for Radioactive Waste Packages

    International Nuclear Information System (INIS)

    2006-10-01

    The main objective of this publication is to provide guidelines for the development of waste package specifications that comply with waste acceptance requirements for storage and disposal of radioactive waste. It will assist waste generators and waste package producers in selecting the most significant parameters and in developing and implementing specifications for each individual type of waste and waste package. This publication also identifies and reviews the activities and technical provisions that are necessary to meet safety requirements; in particular, selection of the significant safety parameters and preparation of specifications for waste forms, waste containers and waste packages using proven approaches, methods and technologies. This report provides guidance using a systematic, stepwise approach, integrating the technical, organizational and administrative factors that need to be considered at each step of planning and implementing waste package design, fabrication, approval, quality assurance and control. The report reflects the considerable experience and knowledge that has been accumulated in the IAEA Member States and is consistent with the current international requirements, principles, standards and guidance for the safe management of radioactive waste

  19. Development of Specifications for Radioactive Waste Packages

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-10-15

    The main objective of this publication is to provide guidelines for the development of waste package specifications that comply with waste acceptance requirements for storage and disposal of radioactive waste. It will assist waste generators and waste package producers in selecting the most significant parameters and in developing and implementing specifications for each individual type of waste and waste package. This publication also identifies and reviews the activities and technical provisions that are necessary to meet safety requirements; in particular, selection of the significant safety parameters and preparation of specifications for waste forms, waste containers and waste packages using proven approaches, methods and technologies. This report provides guidance using a systematic, stepwise approach, integrating the technical, organizational and administrative factors that need to be considered at each step of planning and implementing waste package design, fabrication, approval, quality assurance and control. The report reflects the considerable experience and knowledge that has been accumulated in the IAEA Member States and is consistent with the current international requirements, principles, standards and guidance for the safe management of radioactive waste.

  20. Specification of volume and dose in radiotherapy

    International Nuclear Information System (INIS)

    Levernes, S.

    1997-01-01

    As a result of a questionnaire about dose and volume specifications in radiotherapy in the Nordic countries, a group has been set up to propose common recommendations for these countries. The proposal is partly based on ICRU 50, but with major extensions. These extensions fall into three areas: patient geometry, treatment geometry, and dose specifications. For patient geometry and set-up one need alignment markings and anatomical reference points, the latter can be divided into internal and external reference points. These points are necessary to get relationships between coordinate systems related to patient and to treatment unit. For treatment geometry the main volume will be an anatomical target volume which just encompass the clinical target volume with all its variations and movements. This anatomical volume are the most suitable volume for prescription, optimization and reporting dose. A set-up margin should be added to the beam periphery in beams-eye-view to get the minimum size and shape of the beam. For dose specification the most important parameter for homogeneous dose distributions is the arithmetic mean of dose to the anatomical target volume together with its standard deviation. In addition the dose to the ICRU reference point should be reported for intercomparison, together with minimum and maximum doses or dose volume histograms for the anatomical target volume. (author)

  1. Testing of Badminton-Specific Endurance.

    Science.gov (United States)

    Madsen, Christian M; Højlyng, Mads; Nybo, Lars

    2016-09-01

    Madsen, CM, Højlyng, M, and Nybo, L. Testing of badminton-specific endurance. J Strength Cond Res 30(9): 2582-2590, 2016-In the present study, a novel intermittent badminton endurance (B-ENDURANCE) test was developed and tested in elite (n = 17) and skilled (n = 9) badminton players and in age-matched physically active men (nonbadminton players; n = 8). In addition, B-ENDURANCE test-retest reproducibility was evaluated in 9 badminton players. The B-ENDURANCE test is an incremental test where each level consists of repeated sequences of badminton-specific actions toward the 4 corners of the court. The subject starts in the center of the court in front of a computer screen and within each sequence, he must, in a randomized order, complete 8 actions as dictated by the computer, providing the audiovisual input and verifying that the appropriate sensor is activated within the allocated time. Recovery time between each sequence is 10 seconds throughout the test, but the time to complete each sequence is gradually decreased until the subjects cannot follow the dictated tempo. The B-ENDURANCE test performance for elite players was better (p ≤ 0.05) compared with the skilled players and nonbadminton players. In addition, the B-ENDURANCE test performance correlated (r = 0.8 and p badminton-specific endurance but at least 1 familiarization trial is recommended if the test is used for evaluation of longitudinal changes, e.g., tracking training effects.

  2. Treatment of specific phobia in older adults

    Directory of Open Access Journals (Sweden)

    Nancy A Pachana

    2007-10-01

    Full Text Available Nancy A Pachana1, Rana M Woodward1, Gerard JA Byrne21School of Psychology, University of Queensland, Brisbane, Australia 2School of Medicine, University of Queensland, Brisbane, AustraliaAbstract: Phobias are common in later life, yet treatment research in this population remains scant. The efficacy of exposure therapy, in combination with other Cognitive-Behavioral Therapy (CBT components, in the treatment of specific phobia with a middle and older aged sample was examined. Sixteen adults aged 45–68 with DSM-IV diagnosis of a specific phobia received a manualized intervention over ten weeks, and were compared with a control group. Results indicated significant time effects in the treatment group for the primary outcome variables of phobic severity and avoidance as well as secondary outcome variables including depression and anxiety. Symptom presence and severity also significantly declined in the treatment group. No significant changes in state anxiety were noted across the treatment period. Such results provide support for the efficacy of exposure combined with CBT treatment for specific phobia in middle to older aged adults.Keywords: anxiety, phobia, older adults, cognitive behavioral therapy

  3. Site-Specific PEGylation of Therapeutic Proteins

    Directory of Open Access Journals (Sweden)

    Jonathan K. Dozier

    2015-10-01

    Full Text Available The use of proteins as therapeutics has a long history and is becoming ever more common in modern medicine. While the number of protein-based drugs is growing every year, significant problems still remain with their use. Among these problems are rapid degradation and excretion from patients, thus requiring frequent dosing, which in turn increases the chances for an immunological response as well as increasing the cost of therapy. One of the main strategies to alleviate these problems is to link a polyethylene glycol (PEG group to the protein of interest. This process, called PEGylation, has grown dramatically in recent years resulting in several approved drugs. Installing a single PEG chain at a defined site in a protein is challenging. Recently, there is has been considerable research into various methods for the site-specific PEGylation of proteins. This review seeks to summarize that work and provide background and context for how site-specific PEGylation is performed. After introducing the topic of site-specific PEGylation, recent developments using chemical methods are described. That is followed by a more extensive discussion of bioorthogonal reactions and enzymatic labeling.

  4. Determination of specificity influencing residues for key transcription factor families

    DEFF Research Database (Denmark)

    Patel, Ronak Y.; Garde, Christian; Stormo, Gary D.

    2015-01-01

    Transcription factors (TFs) are major modulators of transcription and subsequent cellular processes. The binding of TFs to specific regulatory elements is governed by their specificity. Considering the gap between known TFs sequence and specificity, specificity prediction frameworks are highly de...

  5. Testing Moral Foundation Theory: Are Specific Moral Emotions Elicited by Specific Moral Transgressions?

    Science.gov (United States)

    Landmann, Helen; Hess, Ursula

    2018-01-01

    Moral foundation theory posits that specific moral transgressions elicit specific moral emotions. To test this claim, participants (N = 195) were asked to rate their emotions in response to moral violation vignettes. We found that compassion and disgust were associated with care and purity respectively as predicted by moral foundation theory.…

  6. Simplicity and Specificity in Language: Domain-General Biases Have Domain-Specific Effects

    Science.gov (United States)

    Culbertson, Jennifer; Kirby, Simon

    2016-01-01

    The extent to which the linguistic system—its architecture, the representations it operates on, the constraints it is subject to—is specific to language has broad implications for cognitive science and its relation to evolutionary biology. Importantly, a given property of the linguistic system can be “specific” to the domain of language in several ways. For example, if the property evolved by natural selection under the pressure of the linguistic function it serves then the property is domain-specific in the sense that its design is tailored for language. Equally though, if that property evolved to serve a different function or if that property is domain-general, it may nevertheless interact with the linguistic system in a way that is unique. This gives a second sense in which a property can be thought of as specific to language. An evolutionary approach to the language faculty might at first blush appear to favor domain-specificity in the first sense, with individual properties of the language faculty being specifically linguistic adaptations. However, we argue that interactions between learning, culture, and biological evolution mean any domain-specific adaptations that evolve will take the form of weak biases rather than hard constraints. Turning to the latter sense of domain-specificity, we highlight a very general bias, simplicity, which operates widely in cognition and yet interacts with linguistic representations in domain-specific ways. PMID:26793132

  7. Is Case-Specificity Content-Specificity? An Analysis of Data from Extended-Matching Questions

    Science.gov (United States)

    Dory, Valerie; Gagnon, Robert; Charlin, Bernard

    2010-01-01

    Case-specificity, i.e., variability of a subject's performance across cases, has been a consistent finding in medical education. It has important implications for assessment validity and reliability. Its root causes remain a matter of discussion. One hypothesis, content-specificity, links variability of performance to variable levels of relevant…

  8. Modality-specificity of Selective Attention Networks.

    Science.gov (United States)

    Stewart, Hannah J; Amitay, Sygal

    2015-01-01

    To establish the modality specificity and generality of selective attention networks. Forty-eight young adults completed a battery of four auditory and visual selective attention tests based upon the Attention Network framework: the visual and auditory Attention Network Tests (vANT, aANT), the Test of Everyday Attention (TEA), and the Test of Attention in Listening (TAiL). These provided independent measures for auditory and visual alerting, orienting, and conflict resolution networks. The measures were subjected to an exploratory factor analysis to assess underlying attention constructs. The analysis yielded a four-component solution. The first component comprised of a range of measures from the TEA and was labeled "general attention." The third component was labeled "auditory attention," as it only contained measures from the TAiL using pitch as the attended stimulus feature. The second and fourth components were labeled as "spatial orienting" and "spatial conflict," respectively-they were comprised of orienting and conflict resolution measures from the vANT, aANT, and TAiL attend-location task-all tasks based upon spatial judgments (e.g., the direction of a target arrow or sound location). These results do not support our a-priori hypothesis that attention networks are either modality specific or supramodal. Auditory attention separated into selectively attending to spatial and non-spatial features, with the auditory spatial attention loading onto the same factor as visual spatial attention, suggesting spatial attention is supramodal. However, since our study did not include a non-spatial measure of visual attention, further research will be required to ascertain whether non-spatial attention is modality-specific.

  9. Modality-specificity of selective attention networks

    Directory of Open Access Journals (Sweden)

    Hannah Jamieson Stewart

    2015-11-01

    Full Text Available Objective: To establish the modality specificity and generality of selective attention networks. Method: Forty-eight young adults completed a battery of four auditory and visual selective attention tests based upon the Attention Network framework: the visual and auditory Attention Network Tests (vANT, aANT, the Test of Everyday Attention (TEA, and the Test of Attention in Listening (TAiL. These provided independent measures for auditory and visual alerting, orienting, and conflict resolution networks. The measures were subjected to an exploratory factor analysis to assess underlying attention constructs. Results: The analysis yielded a four-component solution. The first component comprised of a range of measures from the TEA and was labeled ‘general attention’. The third component was labeled ‘auditory attention’, as it only contained measures from the TAiL using pitch as the attended stimulus feature. The second and fourth components were labeled as ‘spatial orienting’ and ‘spatial conflict’, respectively – they were comprised of orienting and conflict resolution measures from the vANT, aANT and TAiL attend-location task – all tasks based upon spatial judgments (e.g., the direction of a target arrow or sound location. Conclusions: These results do not support our a-priori hypothesis that attention networks are either modality specific or supramodal. Auditory attention separated into selectively attending to spatial and non-spatial features, with the auditory spatial attention loading onto the same factor as visual spatial attention, suggesting spatial attention is supramodal. However, since our study did not include a non-spatial measure of visual attention, further research will be required to ascertain whether non-spatial attention is modality-specific.

  10. Formal specification is an experimental science

    Energy Technology Data Exchange (ETDEWEB)

    Bjorner, D. [Technical Univ., Lyngby (Denmark)

    1992-09-01

    Traditionally, abstract models of large, complex systems have been given in free-form mathematics, combining - often in ad-hoc, not formally supported ways - notions from the disciplines of partial differential equations, functional analysis, mathematical statistics, etc. Such models have been very useful for assimilation of information, analysis (investigation), and prediction (simulation). These models have, however, usually not been helpful in deriving computer representations of the modelled systems - for the purposes of computerized monitoring and control, Computing science, concerned with how to construct objects that can exist within the computer, offers ways of complementing, and in some cases, replacing or combining traditional mathematical models. Formal, model-, as well as property-oriented, specifications in the styles of denotational (respectively, algebraic semantics) represent major approaches to such modelling. In this expository, discursive paper we illustrate what we mean by model-oriented specifications of large, complex technological computing systems. The three modelling examples covers the introvert programming methodological subject of SDEs: software development environments, the distributed computing system subject of wfs`s: (transaction) work flow systems, and the extrovert subject of robots: robotics! the thesis is, just as for mathematical modelling, that we can derive much understanding, etc., from experimentally creating such formally specified models - on paper - and that we gain little in additionally building ad-hoc prototypes. Our models are expressed in a model-oriented style using the VDM specification language Meta-IV In this paper the models only reflect the {open_quotes}data modelling{close_quotes} aspects. We observe that such data models are more easily captured in the model-oriented siyle than in the algebraic semantics property-oriented style which originally was built of the abstraction of operations. 101 refs., 4 figs.

  11. Specification and Verification of Hybrid System

    International Nuclear Information System (INIS)

    Widjaja, Belawati H.

    1997-01-01

    Hybrid systems are reactive systems which intermix between two components, discrete components and continuous components. The continuous components are usually called plants, subject to disturbances which cause the state variables of the systems changing continuously by physical laws and/or by the control laws. The discrete components can be digital computers, sensor and actuators controlled by programs. These programs are designed to select, control and supervise the behavior of the continuous components. Specification and verification of hybrid systems has recently become an active area of research in both computer science and control engineering, many papers concerning hybrid system have been published. This paper gives a design methodology for hybrid systems as an example to the specification and verification of hybrid systems. The design methodology is based on the cooperation between two disciplines, control engineering and computer science. The methodology brings into the design of control loops and decision loops. The external behavior of control loops are specified in a notation which is understandable by the two disciplines. The design of control loops which employed theory of differential equation is done by control engineers, and its correctness is also guaranteed analytically or experimentally by control engineers. The decision loops are designed in computing science based on the specifications of control loops. The verification of systems requirements can be done by computing scientists using a formal reasoning mechanism. For illustrating the proposed design, a problem of balancing an inverted pendulum which is a popular experiment device in control theory is considered, and the Mean Value Calculus is chosen as a formal notation for specifying the control loops and designing the decision loops

  12. EDF specifications on nuclear grade resins

    International Nuclear Information System (INIS)

    Mascarenhas, Darren; Gressier, Frederic; Taunier, Stephane; Le-Calvar, Marc; Ranchoux, Gilles; Marteau, Herve; Labed, Veronique

    2012-09-01

    Ion exchange resins are widely used across EDF, especially within the nuclear division for the purification of water. Important applications include primary circuit, secondary circuit and effluent treatment, which require high quality nuclear grade resins to retain the dissolved species, some of which may be radioactive. There is a need for more and more efficient purification in order to decrease worker dose during maintenance but also to decrease volumes of radioactive resin waste. Resin performance is subject to several forms of degradation, including physical, chemical, thermal and radioactive, therefore appropriate resin properties have to be selected to reduce such effects. Work has been done with research institutes, manufacturers and on EDF sites to select these properties, create specifications and to continuously improve on these specifications. An interesting example of research regarding resin performance is the resin degradation under irradiation. Resins used in the CVCS circuit of EDF nuclear power plants are subject to irradiation over their lifetime. A study was carried out on the effects of total integrated doses of 0.1, 1 and 10 MGy on typically used EDF mixed bed resins in a 'mini-CVCS' apparatus to simultaneously test actual primary circuit fluid. The tests confirmed that the resins still perform efficiently after a typical CVCS radiation dose. Certain resins also need additional specifications in order to maintain the integrity of the particular circuits they are used in. Recently, EDF has updated its requirements on these high purity nuclear grade resins, produced generic doctrines for all products and materials used on site which include resins of all grades, and as a result have also updated a guide on recommended resin usage for the French fleet of reactors. An overview of the evolutions will be presented. (authors)

  13. Host Range Specificity in Verticillium dahliae.

    Science.gov (United States)

    Bhat, R G; Subbarao, K V

    1999-12-01

    ABSTRACT Verticillium dahliae isolates from artichoke, bell pepper, cabbage, cauliflower, chili pepper, cotton, eggplant, lettuce, mint, potato, strawberry, tomato, and watermelon and V. albo-atrum from alfalfa were evaluated for their pathogenicity on all 14 hosts. One-month-old seedlings were inoculated with a spore suspension of about 10(7) conidia per ml using a root-dip technique and incubated in the greenhouse. Disease incidence and severity, plant height, and root and shoot dry weights were recorded 6 weeks after inoculation. Bell pepper, cabbage, cauliflower, cotton, eggplant, and mint isolates exhibited host specificity and differential pathogenicity on other hosts, whereas isolates from artichoke, lettuce, potato, strawberry, tomato, and watermelon did not. Bell pepper was resistant to all Verticillium isolates except isolates from bell pepper and eggplant. Thus, host specificity exists in some isolates of V. dahliae. The same isolates were characterized for vegetative compatibility groups (VCGs) through complementation of nitrate nonutilizing (nit) mutants. Cabbage and cauliflower isolates did not produce nit mutants. The isolate from cotton belonged to VCG 1; isolates from bell pepper, eggplant, potato, and tomato, to VCG 4; and the remaining isolates, to VCG 2. These isolates were also analyzed using the random amplified polymorphic DNA (RAPD) method. Forty random primers were screened, and eighteen of them amplified DNA from Verticillium. Based on RAPD banding patterns, cabbage and cauliflower isolates formed a unique group, distinct from other V. dahliae and V. albo-atrum groups. Minor genetic variations were observed among V. dahliae isolates from other hosts, regardless of whether they were host specific or not. There was no correlation among pathogenicity, VCGs, and RAPD banding patterns. Even though the isolates belonged to different VCGs, they shared similar RAPD profiles. These results suggest that management of Verticillium wilt in some crops

  14. Tumour-specific radiosensitizers for radiation therapy

    International Nuclear Information System (INIS)

    Denekamp, J.

    1977-01-01

    Recently Adams and coworkers at the Gray Laboratory have developed a new class of radiosensitizers which act specifically on hypoxic cells by abolishing the protection afforded by low oxygen concentrations. Since most experimental tumours contain a high proportion of oxygen-deprived cells, and most normal tissues are well oxygenated, these drugs are tumour specific radiosensitizers. Based on the hypothesis that sensitization increases with increasing electron affinity, the two nitroimidazoles, metronidazole (Flagyl) and Ro-07/0582 were identified as potent radiosensitizers with low toxicity. These drugs are effective only in the absence of oxygen, and only if the drug is present at the time of irradiation. The degree of sensitization increases with drug concentration rapidly over the range 0.1 to 1.0mg/g body weight for Ro-07-0582, and more gradually for Flagyl. Tumour studies have been performed on at least 12 different experimental tumours, using a variety of end points. Significant sensitization has been observed in every tumour studied, often corresponding to a dose reduction factor of 2.0 for high but non-toxic drug doses. Fractionated studies have also been performed on a few tumour lines. In most cases a useful therapeutic advantage was observed, although the sensitization was smaller. Ro-07-0582 used with X-rays gives a therapeutic gain comparable with that from cyclotron-produced fast neutrons. Neutrons used together with Ro-07-0582 are even more effective. In addition to the radiosensitization there is a specific cytotoxicity to hypoxic cells after prolonged exposure to Ro-07-0582. This cytotoxicity can be greatly enhanced in vitro by moderate hyperthermia. Flagyl and Ro-07-0582 have been used clinically as radiosensitizers, with promising early results. The clinical application is limited to certain dose fractionation patterns because of neurotoxicity. (author)

  15. Gender specific issues in hereditary ocular disorders.

    Science.gov (United States)

    Iragavarapu, Saradha; Gorin, Michael B

    2015-02-01

    This review is intended to summarize the current knowledge from basic science and clinical medical literature cited within PubMed that pertain to gender-related factors and affect those individuals with hereditary ocular disorders. We consider gender-related biological factors that (a) affect disease onset and progression, (b) gender differences for major X-linked ocular disorders, (c) gender-specific conditions, (d) medications that may influence genetic eye disorders, and finally, (e) gender-related issues that influence the management and quality of life of these patients. Several studies have demonstrated the manner in which sex-related hormones in animal models are capable of influencing cell pathway and survival that are likely to affect hereditary eye disorders. There are very few clinical studies that provide compelling evidence for gender differences in human ocular conditions, other than for a number of X-linked disorders. Disease expression for X-linked disorders may be impacted by genetic mechanisms such as lyonization or uniparental disomy. Clinical evidence regarding the impact of gender-related medical conditions and therapies on eye conditions is extremely limited and primarily based on anecdotal evidence. Gender-specific factors may play a major role in the underlying biological pathways that influence the onset, rate of progression, and clinical findings associated with ocular genetic conditions. Clinicians need to be aware of the variable phenotypes observed in female carriers of X-linked disorders of gender specific issues, many of which are inadequately addressed in the current literature. Clinicians need to be sensitive to gender differences in social, cultural, and religious systems and they should also be aware of how their own gender biases may influence how they counsel patients. Finally, it is clear that the lack of effective clinical studies in this area creates an opportunity for future research that will have real benefits for these

  16. EMI Execution Service Specification 1.0

    CERN Document Server

    Schuller, B. (JUELICH); Smirnova, O (Lund University); Konstantinov, A. (Oslo University); Skou Andersen, M. (University of Copenhagen); Riedel, M. (JUELICH); Memon, A.S. (JUELICH); Memon, M.S. (JUELICH); Zangrando, L. (INFN); Sgaravatto, M. (INFN); Frizziero, E. (INFN)

    2010-01-01

    This document provides the interface specification, including related data models such as state model, activity description, resource and activity information, of an execution service, matching the needs of the EMI production middleware stack composed of ARC, gLite and UNICORE components. This service therefore is referred to as the EMI Execution Service (or “ES” for short). This document is a continuation of the work previously known as the GENEVA, then AGU (“ARC, gLite UNICORE”), then PGI execution service.

  17. EMI Execution Service (EMI-ES) Specification

    CERN Document Server

    Schuller, B

    2010-01-01

    This document provides the interface specification, including related data models such as state model, activity description, resource and activity information, of an execution service, matching the needs of the EMI production middleware stack composed of ARC, gLite and UNICORE components. This service therefore is referred to as the EMI Execution Service (or “ES” for short). This document is a continuation of the work previously know as the GENEVA, then AGU (“ARC, gLite UNICORE”), then PGI execution service. As a starting point, the v0.42 of the “PGI Execution Service Specification” (doc15839) was used.

  18. Specification of EDITH motion control system

    International Nuclear Information System (INIS)

    Breitwieser, H.; Frank, A.; Holler, E.; Suess, U.; Leinemann, K.

    1990-09-01

    EDITH is an experimental device for in vessel handling at NET/ITER. The purpose of EDITH is: Testing of ABS (articulated boom system) components; testing and validation of remote handling procedures; testing and validation of ABS end-effectors; testing of ABS control system features and verification of control system concepts. This document, after describing the environment in which the control system is to operate, specifies architecture and functionality to be implemented by the EDITH motion control system software, thereby taking full reference to the control system specification for TARM, which was decided to be the base for the implementation. (orig.) [de

  19. On emotion specificity in decision making

    Directory of Open Access Journals (Sweden)

    Marcel Zeelenberg

    2008-01-01

    Full Text Available We present a motivational account of the impact of emotion on decision making, termed the feeling-is-for-doing approach. We first describe the psychology of emotion and argue for a need to be specific when studying emotion's impact on decision making. Next we describe what our approach entails and how it relates emotion, via motivation to behavior. Then we offer two illustrations of our own research that provide support for two important elements in our reasoning. We end with specifying four criteria that we consider to be important when studying how feeling guides our everyday doing.

  20. The programming language HAL: A specification

    Science.gov (United States)

    1971-01-01

    HAL accomplishes three significant objectives: (1) increased readability, through the use of a natural two-dimensional mathematical format; (2) increased reliability, by providing for selective recognition of common data and subroutines, and by incorporating specific data-protect features; (3) real-time control facility, by including a comprehensive set of real-time control commands and signal conditions. Although HAL is designed primarily for programming on-board computers, it is general enough to meet nearly all the needs in the production, verification and support of aerospace, and other real-time applications.

  1. HAL/S-360 compiler system specification

    Science.gov (United States)

    Johnson, A. E.; Newbold, P. N.; Schulenberg, C. W.; Avakian, A. E.; Varga, S.; Helmers, P. H.; Helmers, C. T., Jr.; Hotz, R. L.

    1974-01-01

    A three phase language compiler is described which produces IBM 360/370 compatible object modules and a set of simulation tables to aid in run time verification. A link edit step augments the standard OS linkage editor. A comprehensive run time system and library provide the HAL/S operating environment, error handling, a pseudo real time executive, and an extensive set of mathematical, conversion, I/O, and diagnostic routines. The specifications of the information flow and content for this system are also considered.

  2. Civil forensic psychiatry - Part 2: specific issues.

    Science.gov (United States)

    Samuels, Anthony H

    2018-06-01

    This paper describes the main areas of civil forensic psychiatry (FP) and the skills required by psychiatric experts. Some specific areas of civil FP are discussed, including tort law reform, reliability of psychiatric evidence, contentious psychiatric disorders, and the many domains of civil FP. Civil FP is an important sub-specialty component of forensic psychiatry that requires greater emphasis in the training and continuing education of psychiatrists. A process of accrediting psychiatrists as having competency in advanced civil FP may be of value.

  3. Species-specific challenges in dog cloning.

    Science.gov (United States)

    Kim, G A; Oh, H J; Park, J E; Kim, M J; Park, E J; Jo, Y K; Jang, G; Kim, M K; Kim, H J; Lee, B C

    2012-12-01

    Somatic cell nuclear transfer (SCNT) is now an established procedure used in cloning of several species. SCNT in dogs involves multiple steps including the removal of the nuclear material, injection of a donor cell, fusion, activation of the reconstructed oocytes and finally transfer to a synchronized female recipient. There are therefore many factors that contribute to cloning efficiency. By performing a retrospective analysis of 2005-2012 published papers regarding dog cloning, we define the optimum procedure and summarize the specific feature for dog cloning. © 2012 Blackwell Verlag GmbH.

  4. A data base processor semantics specification package

    Science.gov (United States)

    Fishwick, P. A.

    1983-01-01

    A Semantics Specification Package (DBPSSP) for the Intel Data Base Processor (DBP) is defined. DBPSSP serves as a collection of cross assembly tools that allow the analyst to assemble request blocks on the host computer for passage to the DBP. The assembly tools discussed in this report may be effectively used in conjunction with a DBP compatible data communications protocol to form a query processor, precompiler, or file management system for the database processor. The source modules representing the components of DBPSSP are fully commented and included.

  5. Genome position specific priors for genomic prediction

    DEFF Research Database (Denmark)

    Brøndum, Rasmus Froberg; Su, Guosheng; Lund, Mogens Sandø

    2012-01-01

    casual mutation is different between the populations but affects the same gene. Proportions of a four-distribution mixture for SNP effects in segments of fixed size along the genome are derived from one population and set as location specific prior proportions of distributions of SNP effects...... for the target population. The model was tested using dairy cattle populations of different breeds: 540 Australian Jersey bulls, 2297 Australian Holstein bulls and 5214 Nordic Holstein bulls. The traits studied were protein-, fat- and milk yield. Genotypic data was Illumina 777K SNPs, real or imputed Results...

  6. Optimisation of technical specifications using probabilistic methods

    International Nuclear Information System (INIS)

    Ericsson, G.; Knochenhauer, M.; Hultqvist, G.

    1986-01-01

    During the last few years the development of methods for modifying and optimising nuclear power plant Technical Specifications (TS) for plant operations has received increased attention. Probalistic methods in general, and the plant and system models of probabilistic safety assessment (PSA) in particular, seem to provide the most forceful tools for optimisation. This paper first gives some general comments on optimisation, identifying important parameters and then gives a description of recent Swedish experiences from the use of nuclear power plant PSA models and results for TS optimisation

  7. Specific Electrostatic Molecular Recognition in Water

    DEFF Research Database (Denmark)

    Li, Ming; Hoeck, Casper; Schoffelen, Sanne

    2016-01-01

    The identification of pairs of small peptides that recognize each other in water exclusively through electrostatic interactions is reported. The target peptide and a structure-biased combinatorial ligand library consisting of ≈78 125 compounds were synthesized on different sized beads. Peptide......-bead binding assay and by 2D NMR spectroscopy. Molecular dynamics (MD) studies revealed a putative mode of interaction for this unusual electrostatic binding event. High binding specificity occurred through a combination of topological matching and electrostatic and hydrogen-bond complementarities. From MD...

  8. Prostate specific antigen and its clinical application

    International Nuclear Information System (INIS)

    Xu Yang

    2000-01-01

    Prostate-Specific Antigen (PSA), a serine proteases, is a glycoprotein consisting of a single polypeptide chain. Secreted exclusively by epithelial cells of the prostate gland, PSA is found largely in seminal plasma. Only a small amount of PSA can be found in normal serum. Serum PSA levels are found to be, considerably increased in prostate cancer patients. A number of studies on PSA have made great achievement on its biochemistry, analytical method and clinical application. PSA as one of the most important tumor marker, is used to help diagnosis and monitor the therapeutic efficacy of prostate cancer

  9. A Framework for the Specificity of Addictions

    Science.gov (United States)

    Sussman, Steve; Leventhal, Adam; Bluthenthal, Ricky N.; Freimuth, Marilyn; Forster, Myriam; Ames, Susan L.

    2011-01-01

    Research over the last two decades suggests that a wide range of substance and behavioral addictions may serve similar functions. Yet, co-occurrence of addictions has only been reported among a minority of addicts. “Addiction specificity” pertains to a phenomenon in which one pattern of addictive behaviors may be acquired whereas another is not. This paper presents the PACE model as a framework which might help explain addiction specificity. Pragmatics, attraction, communication, and expectation (PACE) variables are described, which may help give some direction to future research needs in this arena. PMID:21909314

  10. Specifications for surface reaction analysis apparatus

    International Nuclear Information System (INIS)

    Teraoka, Yuden; Yoshigoe, Akitaka

    2001-03-01

    A surface reaction analysis apparatus was installed at the JAERI soft x-ray beamline in the SPring-8 as an experimental end-station for the study of surface chemistry. The apparatus is devoted to the study concerning the influence of translational kinetic energy of incident molecules to chemical reactions on solid surfaces with gas molecules. In order to achieve the research purpose, reactive molecular scattering experiments and photoemission spectroscopic measurements using synchrotron radiation are performed in that apparatus via a supersonic molecular beam generator, an electron energy analyzer and a quadrupole mass analyzer. The detail specifications for the apparatus are described in this report. (author)

  11. Estimation of antibodies specific for dextran

    International Nuclear Information System (INIS)

    Matsuuchi, L.; Morrison, S.L.

    1978-01-01

    Methods are described for the isolation and characterization of picogram quantities of anti-dextran antibodies. 14 C-dextrans produced by using the dextransucrases of Leuconostoc mesenteroides strains B1355 and B512 were used in a radioimmunoassay. The specificity of this assay was verified by using cell cytoplasmic lysates from mouse plasmacytomas, J558 (anti-α 1 → 3 dextran) and W3129 (anti-α 1 → 6 dextran). Dextran produced by strain B1355 and insolubilized with epichlorohydrin was used as an immunoabsorbent

  12. Radioimmunological demonstration of DNA specific antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Falck, P [Akademie der Wissenschaften der DDR, Berlin-Buch. Zentralinstitut fuer Isotopen- und Strahlenforschung

    1976-01-01

    Using /sup 125/I chemically labelled denatured (d) and native (n) DNA, specifically binding antibodies were demonstrated in the sera of Lupus erythemathodes patients by means of the Farr technique. (NH/sub 4/)/sub 2/SO/sub 4/ was used to separate the immunologically bound /sup 125/I-d-DNA. For /sup 125/I-n-DNA the use of a secondary antiserum for the precipitation of the primary immune complex is advantageous. The influence of antigen concentration upon the binding rate was studied. Titre determinations can be made with the proposed method.

  13. An introduction to programming with specifications

    CERN Document Server

    1991-01-01

    A feature of modern advanced computing is the functional approach to programming. In this book, the authors present an introduction to the mathematics which underline functional programming, emphasizing the understanding of definition and specification--a prerequisite of good programming and problem solving with a computer. The book is self-contained, requiring a low level of mathematical sophistication and may be used as an introduction to the mathematics of programming.Provides an introduction to the functional approach to programming**Emphasizes the problem to be solved, not the pro

  14. Review of specific radiological accident considerations

    International Nuclear Information System (INIS)

    Elder, J.

    1984-01-01

    Specific points of guidance provided in the forthcoming document A Guide to Radiological Accident Considerations for Siting and Design of Nonreactor Nuclear Facilities are discussed. Of these, the following are considered of particular interest to analysts of hypothetical accidents: onsite dose limits; population dose, public health effects, and environmental contamination as accident consequences which should be addressed; risk analysis; natural phenomena as accident initiators; recommended dose models; multiple organ equivalent dose; and recommended methods and parameters for source terms and release amount calculations. Comments are being invited on this document, which is undergoing rewrite after the first stage of peer review

  15. Optimization Specifications for CUDA Code Restructuring Tool

    KAUST Repository

    Khan, Ayaz

    2017-03-13

    In this work we have developed a restructuring software tool (RT-CUDA) following the proposed optimization specifications to bridge the gap between high-level languages and the machine dependent CUDA environment. RT-CUDA takes a C program and convert it into an optimized CUDA kernel with user directives in a configuration file for guiding the compiler. RTCUDA also allows transparent invocation of the most optimized external math libraries like cuSparse and cuBLAS enabling efficient design of linear algebra solvers. We expect RT-CUDA to be needed by many KSA industries dealing with science and engineering simulation on massively parallel computers like NVIDIA GPUs.

  16. CONCEPTUAL STUDY OFRELEVANT SPECIFICS OF INTERNETMARKETING

    Directory of Open Access Journals (Sweden)

    Maria B. Ponyavina

    2015-01-01

    Full Text Available The article presents methodological and methodical bases of research relevant specifics of Internet marketing conducted by Russian companies in the Interenet. The paper is focused on the research of the leading Russian online publications, their practices and characteristics. This work dwells on the comparison of competitiveness with adjacent categories. It is established that the development of information technologies, among which one of the key places has taken the Internet, the emergence and rapid growth of e-Commerce became the basis for the emergence of a new trend in the modern concept of relationship marketing - Internet marketing.

  17. Orientation specific deposition of mesoporous particles

    Directory of Open Access Journals (Sweden)

    Tomas Kjellman

    2014-11-01

    Full Text Available We present a protocol for a facile orientation specific deposition of plate-like mesoporous SBA-15 silica particles onto a surface (mesopores oriented normal to surface. A drop of an aqueous dispersion of particles is placed on the surface and water vaporizes under controlled relative humidity. Three requirements are essential for uniform coverage: particle dispersion should not contain aggregates, a weak attraction between particles and surface is needed, and evaporation rate should be low. Aggregates are removed by stirring/sonication. Weak attraction is realized by introducing cationic groups to the surface. Insight into the mechanisms of the so-called coffee stain effect is also provided.

  18. Morphing patient-specific musculoskeletal models

    DEFF Research Database (Denmark)

    Rasmussen, John; Galibarov, Pavel E.; Al-Munajjed, Amir

    the resulting models do indeed represent the patients’ biomechanics. As a particularly challenging case, foot deformities based only on point sets recovered from surface scans are considered as shown in the figure. The preliminary results are promising for the cases of severe flat foot and metatarsalgia while...... other conditions may require CT or MRI data. The method and its theoretical assumptions, advantages and limitations are presented, and several examples will illustrate morphing to patient-specific models. [1] Carbes S; Tørholm S; Rasmussen, J. A Detailed Twenty-six Segments Kinematic Foot model...

  19. Acquired agranulocytosis with granulocyte specific cytotoxic autoantibody.

    Science.gov (United States)

    Blaschke, J; Goeken, N E; Thompson, J S; Dick, F R; Gingrich, R D

    1979-05-01

    Multiple infections and severe neutropenia were found in a previously healthy 29 year old man with no history of similar syndromes in the family, drug ingestion or exposure to environmental toxins. There was no evidence at the time of presentation of diseases previously associated with agranulocytosis (e.g., neoplasia, thyrotoxicosis, chronic infection, collagen-vascular disease or leukoagglutinating antibody). His serum contained a nonagglutinating, complement-dependent, cytotoxic antibody, however, reactive with peripheral blood granulocytes from 35 per cent of normal donors. The neutropenia was not affected by steroids but resolved promptly after splenectomy. Microscopic examination of the spleen revealed ingestion of polymorphonuclear leukocytes by splenic macrophages. Family studies indicated that the target antigen was non-HLA and that the antibody was not absorbed by lymphocytes or platelets. We conclude that the agranulocytosis was autoimmune in origin and suggest that similar myeloid-specific immune responses could influence granulocyte tranfusion and bone marrow transplantation by alloimmune "rejection" that would not be avoided by matching only for HLA specificities.

  20. Meeting the challenges in product specifications

    International Nuclear Information System (INIS)

    Perez, A.

    1999-01-01

    The current state of the Canadian petroleum refining industry was discussed with special emphasis on the challenges the industry is facing regarding product specification and relevant public policy. In order to remain competitive and avoid the risk of losing much of its eastern and British Columbia markets to integrated North American supply alternatives, the refining industry has undergone severe restructuring, in the process closing 17 refineries in Canada since 1983. Although there has been an increased emphasis on lower cost feedstocks, processing has become more environmentally challenging. For example, the sulphur content in gasoline must meet stringent specifications. Air quality issues are pushing both vehicle technology and fuel formulation, and both vehicle and fuel manufacturers are looking for global solutions. Proposed Canadian regulations were described as not well geared to dealing with these solutions, i.e. fuel formulation standards are looked at in isolation from from each other, or from vehicle technology advancements. As an example the proposed regulation concerning sulphur in gasoline was cited, alleging that requiring lower levels two years in advance of the next generation of low emission vehicles will create a serious threat to the competitiveness of domestic refiners vis-a-vis their U.S. counterparts. 1 tab., 3 figs