MACC1 facilitates chemoresistance and cancer stem cell‑like properties of colon cancer cells through the PI3K/AKT signaling pathway.

Science.gov (United States)

Wang, Jiankai; Wang, Wenjuan; Cai, Hongyi; Du, Binbin; Zhang, Lijuan; Ma, Wen; Hu, Yongguo; Feng, Shifang; Miao, Guoying

2017-12-01

With regards to colon cancer, resistance to 5‑fluorouracil (5‑FU)‑based chemotherapy and cancer stem cells (CSCs) are considered important factors underlying therapy failure. Metastasis‑associated colon cancer 1 (MACC1) has been associated with poor prognosis and the promotion of metastasis within several types of cancer. However, the biological behavior of MACC1 in chemoresistance and CSC‑like properties remains unclear. In the present study, various methods including gene knockdown, gene overexpression, western blotting, quantitative polymerase chain reaction and MTT assay, have been adopted. According to the results of the present study, MACC1 was depleted in two colon cancer cell lines resistant to 5‑FU; subsequently, CSC‑like properties and 5‑FU sensitivity were investigated. Within 5‑FU‑resistant cells, cell death was facilitated by MACC1 knockdown. Furthermore, sphere formation and the expression levels of pluripotent markers, including cluster of differentiation (CD) 44, CD133 and Nanog were reduced due to MACC1 depletion. Additionally, it was indicated that the phosphoinositide 3‑kinase/protein kinase B signaling pathway may be associated with 5‑FU resistance and CSC‑like properties via MACC1.

MACC1 facilitates chemoresistance and cancer stem cell-like properties of colon cancer cells through the PI3K/AKT signaling pathway

Science.gov (United States)

Wang, Jiankai; Wang, Wenjuan; Cai, Hongyi; Du, Binbin; Zhang, Lijuan; Ma, Wen; Hu, Yongguo; Feng, Shifang; Miao, Guoying

2017-01-01

With regards to colon cancer, resistance to 5-fluorouracil (5-FU)-based chemotherapy and cancer stem cells (CSCs) are considered important factors underlying therapy failure. Metastasis-associated colon cancer 1 (MACC1) has been associated with poor prognosis and the promotion of metastasis within several types of cancer. However, the biological behavior of MACC1 in chemoresistance and CSC-like properties remains unclear. In the present study, various methods including gene knockdown, gene overexpression, western blotting, quantitative polymerase chain reaction and MTT assay, have been adopted. According to the results of the present study, MACC1 was depleted in two colon cancer cell lines resistant to 5-FU; subsequently, CSC-like properties and 5-FU sensitivity were investigated. Within 5-FU-resistant cells, cell death was facilitated by MACC1 knockdown. Furthermore, sphere formation and the expression levels of pluripotent markers, including cluster of differentiation (CD) 44, CD133 and Nanog were reduced due to MACC1 depletion. Additionally, it was indicated that the phosphoinositide 3-kinase/protein kinase B signaling pathway may be associated with 5-FU resistance and CSC-like properties via MACC1. PMID:28990068

Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

International Nuclear Information System (INIS)

Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

2014-01-01

Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

A Web Server for MACCS Magnetometer Data

Science.gov (United States)

Engebretson, Mark J.

1998-01-01

NASA Grant NAG5-3719 was provided to Augsburg College to support the development of a web server for the Magnetometer Array for Cusp and Cleft Studies (MACCS), a two-dimensional array of fluxgate magnetometers located at cusp latitudes in Arctic Canada. MACCS was developed as part of the National Science Foundation's GEM (Geospace Environment Modeling) Program, which was designed in part to complement NASA's Global Geospace Science programs during the decade of the 1990s. This report describes the successful use of these grant funds to support a working web page that provides both daily plots and file access to any user accessing the worldwide web. The MACCS home page can be accessed at http://space.augsburg.edu/space/MaccsHome.html.

A new emergency response model for MACCS. Final report

International Nuclear Information System (INIS)

Chanin, D.I.

1992-01-01

Under DOE sponsorship, as directed by the Los Alamos National Laboratory (LANL), the MACCS code (version 1.5.11.1) [Ch92] was modified to implement a series of improvements in its modeling of emergency response actions. The purpose of this effort has been to aid the Westinghouse Savannah River Company (WSRC) in its performance of the Level III analysis for the Savannah River Site (SRS) probabilistic risk analysis (PRA) of K Reactor [Wo90]. To ensure its usefulness to WSRC, and facilitate the new model's eventual merger with other MACCS enhancements, close cooperation with WSRC and the MACCS development team at Sandia National Laboratories (SNL) was maintained throughout the project. These improvements are intended to allow a greater degree of flexibility in modeling the mitigative actions of evacuation and sheltering. The emergency response model in MACCS version 1.5.11.1 was developed to support NRC analyses of consequences from severe accidents at commercial nuclear power plants. The NRC code imposes unnecessary constraints on DOE safety analyses, particularly for consequences to onsite worker populations, and it has therefore been revamped. The changes to the code have been implemented in a manner that preserves previous modeling capabilities and therefore prior analyses can be repeated with the new code

Plutonium explosive dispersal modeling using the MACCS2 computer code

International Nuclear Information System (INIS)

Steele, C.M.; Wald, T.L.; Chanin, D.I.

1998-01-01

The purpose of this paper is to derive the necessary parameters to be used to establish a defensible methodology to perform explosive dispersal modeling of respirable plutonium using Gaussian methods. A particular code, MACCS2, has been chosen for this modeling effort due to its application of sophisticated meteorological statistical sampling in accordance with the philosophy of Nuclear Regulatory Commission (NRC) Regulatory Guide 1.145, ''Atmospheric Dispersion Models for Potential Accident Consequence Assessments at Nuclear Power Plants''. A second advantage supporting the selection of the MACCS2 code for modeling purposes is that meteorological data sets are readily available at most Department of Energy (DOE) and NRC sites. This particular MACCS2 modeling effort focuses on the calculation of respirable doses and not ground deposition. Once the necessary parameters for the MACCS2 modeling are developed and presented, the model is benchmarked against empirical test data from the Double Tracks shot of project Roller Coaster (Shreve 1965) and applied to a hypothetical plutonium explosive dispersal scenario. Further modeling with the MACCS2 code is performed to determine a defensible method of treating the effects of building structure interaction on the respirable fraction distribution as a function of height. These results are related to the Clean Slate 2 and Clean Slate 3 bunkered shots of Project Roller Coaster. Lastly a method is presented to determine the peak 99.5% sector doses on an irregular site boundary in the manner specified in NRC Regulatory Guide 1.145 (1983). Parametric analyses are performed on the major analytic assumptions in the MACCS2 model to define the potential errors that are possible in using this methodology

Plutonium explosive dispersal modeling using the MACCS2 computer code

Energy Technology Data Exchange (ETDEWEB)

Steele, C.M.; Wald, T.L.; Chanin, D.I.

1998-11-01

The purpose of this paper is to derive the necessary parameters to be used to establish a defensible methodology to perform explosive dispersal modeling of respirable plutonium using Gaussian methods. A particular code, MACCS2, has been chosen for this modeling effort due to its application of sophisticated meteorological statistical sampling in accordance with the philosophy of Nuclear Regulatory Commission (NRC) Regulatory Guide 1.145, ``Atmospheric Dispersion Models for Potential Accident Consequence Assessments at Nuclear Power Plants``. A second advantage supporting the selection of the MACCS2 code for modeling purposes is that meteorological data sets are readily available at most Department of Energy (DOE) and NRC sites. This particular MACCS2 modeling effort focuses on the calculation of respirable doses and not ground deposition. Once the necessary parameters for the MACCS2 modeling are developed and presented, the model is benchmarked against empirical test data from the Double Tracks shot of project Roller Coaster (Shreve 1965) and applied to a hypothetical plutonium explosive dispersal scenario. Further modeling with the MACCS2 code is performed to determine a defensible method of treating the effects of building structure interaction on the respirable fraction distribution as a function of height. These results are related to the Clean Slate 2 and Clean Slate 3 bunkered shots of Project Roller Coaster. Lastly a method is presented to determine the peak 99.5% sector doses on an irregular site boundary in the manner specified in NRC Regulatory Guide 1.145 (1983). Parametric analyses are performed on the major analytic assumptions in the MACCS2 model to define the potential errors that are possible in using this methodology.

Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

Science.gov (United States)

Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

2012-01-01

To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

A review of the Melcor Accident Consequence Code System (MACCS): Capabilities and applications

International Nuclear Information System (INIS)

Young, M.

1995-01-01

MACCS was developed at Sandia National Laboratories (SNL) under U.S. Nuclear Regulatory Commission (NRC) sponsorship to estimate the offsite consequences of potential severe accidents at nuclear power plants (NPPs). MACCS was publicly released in 1990. MACCS was developed to support the NRC's probabilistic safety assessment (PSA) efforts. PSA techniques can provide a measure of the risk of reactor operation. PSAs are generally divided into three levels. Level one efforts identify potential plant damage states that lead to core damage and the associated probabilities, level two models damage progression and containment strength for establishing fission-product release categories, and level three efforts evaluate potential off-site consequences of radiological releases and the probabilities associated with the consequences. MACCS was designed as a tool for level three PSA analysis. MACCS performs probabilistic health and economic consequence assessments of hypothetical accidental releases of radioactive material from NPPs. MACCS includes models for atmospheric dispersion and transport, wet and dry deposition, the probabilistic treatment of meteorology, environmental transfer, countermeasure strategies, dosimetry, health effects, and economic impacts. The computer systems MACCS is designed to run on are the 386/486 PC, VAX/VMS, E3M RISC S/6000, Sun SPARC, and Cray UNICOS. This paper provides an overview of MACCS, reviews some of the applications of MACCS, international collaborations which have involved MACCS, current developmental efforts, and future directions

Input-output model for MACCS nuclear accident impacts estimation¹

Energy Technology Data Exchange (ETDEWEB)

Outkin, Alexander V. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bixler, Nathan E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Vargas, Vanessa N [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2015-01-27

Since the original economic model for MACCS was developed, better quality economic data (as well as the tools to gather and process it) and better computational capabilities have become available. The update of the economic impacts component of the MACCS legacy model will provide improved estimates of business disruptions through the use of Input-Output based economic impact estimation. This paper presents an updated MACCS model, bases on Input-Output methodology, in which economic impacts are calculated using the Regional Economic Accounting analysis tool (REAcct) created at Sandia National Laboratories. This new GDP-based model allows quick and consistent estimation of gross domestic product (GDP) losses due to nuclear power plant accidents. This paper outlines the steps taken to combine the REAcct Input-Output-based model with the MACCS code, describes the GDP loss calculation, and discusses the parameters and modeling assumptions necessary for the estimation of long-term effects of nuclear power plant accidents.

Comparison of MACCS users calculations for the international comparison exercise on probabilistic accident consequence assessment code, October 1989--June 1993

International Nuclear Information System (INIS)

Neymotin, L.

1994-04-01

Over the past several years, the OECD/NEA and CEC sponsored an international program intercomparing a group of six probabilistic consequence assessment (PCA) codes designed to simulate health and economic consequences of radioactive releases into atmosphere of radioactive materials following severe accidents at nuclear power plants (NPPs): ARANO (Finland), CONDOR (UK), COSYMA (CEC), LENA (Sweden), MACCS (USA), and OSCAAR (Japan). In parallel with this effort, two separate groups performed similar calculations using the MACCS and COSYMA codes. Results produced in the MACCS Users Group (Greece, Italy, Spain, and USA) calculations and their comparison are contained in the present report. Version 1.5.11.1 of the MACCS code was used for the calculations. Good agreement between the results produced in the four participating calculations has been reached, with the exception of the results related to the ingestion pathway dose predictions. The main reason for the scatter in those particular results is attributed to the lack of a straightforward implementation of the specifications for agricultural production and counter-measures criteria provided for the exercise. A significantly smaller scatter in predictions of other consequences was successfully explained by differences in meteorological files and weather sampling, grids, rain distance intervals, dispersion model options, and population distributions

Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

Science.gov (United States)

Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

2014-01-01

RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

Does geographical variability influence five-year MACCE rates in the multicentre SYNTAX revascularisation trial?

Science.gov (United States)

Roy, Andrew K; Chevalier, Bernard; Lefèvre, Thierry; Louvard, Yves; Segurado, Ricardo; Sawaya, Fadi; Spaziano, Marco; Neylon, Antoinette; Serruys, Patrick A; Dawkins, Keith D; Kappetein, Arie Pieter; Mohr, Friedrich-Wilhelm; Colombo, Antonio; Feldman, Ted; Morice, Marie-Claude

2017-09-20

The use of multiple geographical sites for randomised cardiovascular trials may lead to important heterogeneity in treatment effects. This study aimed to determine whether treatment effects from different geographical recruitment regions impacted significantly on five-year MACCE rates in the SYNTAX trial. Five-year SYNTAX results (n=1,800) were analysed for geographical variability by site and country for the effect of treatment (CABG vs. PCI) on MACCE rates. Fixed, random, and linear mixed models were used to test clinical covariate effects, such as diabetes, lesion characteristics, and procedural factors. Comparing five-year MACCE rates, the pooled odds ratio (OR) between study sites was 0.58 (95% CI: 0.47-0.71), and countries 0.59 (95% CI: 0.45-0.73). By homogeneity testing, no individual site (X2=93.8, p=0.051) or country differences (X2=25.7, p=0.080) were observed. For random effects models, the intraclass correlation was minimal (ICC site=5.1%, ICC country=1.5%, p<0.001), indicating minimal geographical heterogeneity, with a hazard ratio of 0.70 (95% CI: 0.59-0.83). Baseline risk (smoking, diabetes, PAD) did not influence regional five-year MACCE outcomes (ICC 1.3%-5.2%), nor did revascularisation of the left main vs. three-vessel disease (p=0.241), across site or country subgroups. For CABG patients, the number of arterial (p=0.49) or venous (p=0.38) conduits used also made no difference. Geographic variability has no significant treatment effect on MACCE rates at five years. These findings highlight the generalisability of the five-year outcomes of the SYNTAX study.

Ethylene production, ACC and MACC content of freesia buds and florets.

NARCIS (Netherlands)

Spikman, G.

1988-01-01

Changes in ethylene production, ACC (1-aminocyclopropane-1-carboxylic acid) and MACC (1-(malonylamino)-cyclopropane-1-carboxylic acid) content of buds and florets of detached inflorescences were studied. Most of the ethylene produced by the inflorescences came from small buds at the apex. This

AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

Science.gov (United States)

Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

2012-12-01

Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

A parametric study of MELCOR Accident Consequence Code System 2 (MACCS2) Input Values for the Predicted Health Effect

International Nuclear Information System (INIS)

Kim, So Ra; Min, Byung Il; Park, Ki Hyun; Yang, Byung Mo; Suh, Kyung Suk

2016-01-01

The MELCOR Accident Consequence Code System 2, MACCS2, has been the most widely used through the world among the off-site consequence analysis codes. MACCS2 code is used to estimate the radionuclide concentrations, radiological doses, health effects, and economic consequences that could result from the hypothetical nuclear accidents. Most of the MACCS model parameter values are defined by the user and those input parameters can make a significant impact on the output. A limited parametric study was performed to identify the relative importance of the values of each input parameters in determining the predicted early and latent health effects in MACCS2. These results would not be applicable to every case of the nuclear accidents, because only the limited calculation was performed with Kori-specific data. The endpoints of the assessment were early- and latent cancer-risk in the exposed population, therefore it might produce the different results with the parametric studies for other endpoints, such as contamination level, absorbed dose, and economic cost. Accident consequence assessment is important for decision making to minimize the health effect from radiation exposure, accordingly the sufficient parametric studies are required for the various endpoints and input parameters in further research

Mg/O2 Battery Based on the Magnesium-Aluminum Chloride Complex (MACC) Electrolyte

DEFF Research Database (Denmark)

Vardar, Galin; Smith, Jeffrey G.; Thomson, Travis

2016-01-01

Mg/O2 cells employing a MgCl2/AlCl3/DME (MACC/DME) electrolyte are cycled and compared to cells with modified Grignard electrolytes, showing that performance of magnesium/oxygen batteries depends strongly on electrolyte composition. Discharge capacity is far greater for MACC/DME-based cells, whil...

Development of health effect assessment software using MACCS2 code

International Nuclear Information System (INIS)

Hwang, Seok-Won; Park, Jong-Woon; Kang, Kyung Min; Jae, Moosung

2008-01-01

The extended regulatory interests in severe accidents management and enhanced safety regulatory requirements raise a need of more accurate analysis of the effect to the public health by users with diverse disciplines. This facilitates this work to develop web-based radiation health effect assessment software, RASUM, by using the MACCS2 code and HTML language to provide diverse users (regulators, operators, and public) with easy understanding, modeling, calculating, analyzing, documenting and reporting of the radiation health effect under hypothetical severe accidents. The engine of the web-based RASUM uses the MACCS2 as a base code developed by NRC and is composed of five modules such as development module, PSA training module, output module, input data module (source term, population distribution, meteorological data, etc.), and MACCS2 run module. For verification and demonstration of the RASUM, the offsite consequence analysis using the RASUM frame is performed for such as early fatality risk, organ does, and whole body does for two selected scenarios. Moreover, CCDF results from the RASUM for KSNP and CANDU type reactors are presented and compared. (author)

Risk Analysis of Fukushima Accident using MACCS2

Energy Technology Data Exchange (ETDEWEB)

Lee, Seunghee; Kim, Juyoul; Kim, Sukhoon; Kim, Juyub [FNC Technology Co. Ltd., Yongin (Korea, Republic of)

2014-05-15

It has been three years since Fukushima Daiichi accident had occurred. Many efforts have been done for a restoration, however, radioactive materials are still released resulting in a crucial additional damage to a human health and economics and the scale of damage is not much evaluated. Therefore, an estimation of damage degree caused by the released radioactive materials right after a nuclear accident is essential to cope with additional radioactive problems. Here, we report the risk analysis of Fukushima Dai-ichi accident using MELCOR Accident Consequence Code System 2 (MACCS2), which is the Nuclear Regulatory Commission's (NRC's) code for evaluating off-site consequences. It is used in level-3 Probabilistic Risk Analyses (PRA), for planning purposes, for cost-benefit analyses and so on. The purpose of this study is to estimate radiological doses and health risks of Fukushima Daiichi accident through short- and long-term of lifetime using MACCS2. In summary, the health risk for inhabitants near Fukushima Daiichi NPP has been evaluated by considering the long term radiation effect using MACCS2 code. The result indicates that the occurrence and death rate of the cancer have been increased by the radioactive materials released from Fukushima Daiichi accident. The result obtained in this study may provide new insights for taking action after the nuclear reactor accident to mitigate the released radioactive materials and to prepare the countermeasure.

Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

Science.gov (United States)

Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

2013-01-01

Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

Directory of Open Access Journals (Sweden)

Jialin Song

2016-08-01

Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

Consistent Evaluation of ACOS-GOSAT, BESD-SCIAMACHY, CarbonTracker, and MACC Through Comparisons to TCCON

Science.gov (United States)

Kulawik, Susan; Wunch, Debra; O’Dell, Christopher; Frankenberg, Christian; Reuter, Maximilian; Chevallier, Frederic; Oda, Tomohiro; Sherlock, Vanessa; Buchwitz, Michael; Osterman, Greg;

MACC regional multi-model ensemble simulations of birch pollen dispersion in Europe

NARCIS (Netherlands)

Sofiev, M.; Berger, U.; Prank, M.; Vira, J.; Arteta, J.; Belmonte, J.; Bergmann, K.C.; Chéroux, F.; Elbern, H.; Friese, E.; Galan, C.; Gehrig, R.; Khvorostyanov, D.; Kranenburg, R.; Kumar, U.; Marécal, V.; Meleux, F.; Menut, L.; Pessi, A.M.; Robertson, L.; Ritenberga, O.; Rodinkova, V.; Saarto, A.; Segers, A.; Severova, E.; Sauliene, I.; Siljamo, P.; Steensen, B.M.; Teinemaa, E.; Thibaudon, M.; Peuch, V.H.

2015-01-01

This paper presents the first ensemble modelling experiment in relation to birch pollen in Europe. The seven-model European ensemble of MACC-ENS, tested in trial simulations over the flowering season of 2010, was run through the flowering season of 2013. The simulations have been compared with

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

Science.gov (United States)

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-04-12

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

A Near-real-time Data Transport System for Selected Stations in the Magnetometer Array for Cusp and Cleft Studies (MACCS)

Science.gov (United States)

Engebretson, M. J.; Valentic, T. A.; Stehle, R. H.; Hughes, W. J.

2004-05-01

The Magnetometer Array for Cusp and Cleft Studies (MACCS) is a two-dimensional array of eight fluxgate magnetometers that was established in 1992-1993 in the Eastern Canadian Arctic from 75° to over 80° MLAT to study electrodynamic interactions between the solar wind and Earth's magnetosphere and high-latitude ionosphere. A ninth site in Nain, Labrador, extends coverage down to 66° between existing Canadian and Greenland stations. Originally designed as part of NSF's GEM (Geospace Environment Modeling) Program, MACCS has contributed to the study of transients and waves at the magnetospheric boundary and in the near-cusp region as well as to large, cooperative, studies of ionospheric convection and substorm processes. Because of the limitations of existing telephone lines to each site, it has not been possible to economically access MACCS data promptly; instead, each month's collected data is recorded and mailed to the U.S. for processing and eventual posting on a publicly-accessible web site, http://space.augsburg.edu/space. As part of its recently renewed funding, NSF has supported the development of a near-real-time data transport system using the Iridium satellite network, which will be implemented at two MACCS sites in summer 2004. At the core of the new MACCS communications system is the Data Transport Network, software developed with NSF-ITR funding to automate the transfer of scientific data from remote field stations over unreliable, bandwidth-constrained network connections. The system utilizes a store-and-forward architecture based on sending data files as attachments to Usenet messages. This scheme not only isolates the instruments from network outages, but also provides a consistent framework for organizing and accessing multiple data feeds. Client programs are able to subscribe to data feeds to perform tasks such as system health monitoring, data processing, web page updates and e-mail alerts. The MACCS sites will employ the Data Transport Network

Construction of lentiviral shRNA expression vector targeting ...

African Journals Online (AJOL)

ajl yemi

2011-10-26

Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

Science.gov (United States)

Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

2008-11-01

Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

Inter-comparison between HERMESv2.0 and TNO-MACC-II emission data using the CALIOPE air quality system (Spain)

Science.gov (United States)

Guevara, Marc; Pay, María Teresa; Martínez, Francesc; Soret, Albert; Denier van der Gon, Hugo; Baldasano, José M.

2014-12-01

This work examines and compares the performance of two emission datasets on modelling air quality concentrations for Spain: (i) the High-Elective Resolution Modelling Emissions System (HERMESv2.0) and (ii) the TNO-MACC-II emission inventory. For this purpose, the air quality system CALIOPE-AQFS (WRF-ARW/CMAQ/BSC-DREAM8b) was run over Spain for February and June 2009 using the two emission datasets (4 km × 4 km and 1 h). Nitrogen dioxide (NO2), sulphur dioxide (SO2), Ozone (O3) and particular matter (PM10) modelled concentrations were compared with measurements at different type of air quality stations (i.e. rural background, urban, suburban industrial). A preliminary emission comparison showed significant discrepancies between the two datasets, highlighting an overestimation of industrial emissions in urban areas when using TNO-MACC-II. However, simulations showed similar performances of both emission datasets in terms of air quality. Modelled NO2 concentrations were similar between both datasets at the background stations, although TNO-MACC-II presented lower underestimations due to differences in industrial, other mobile sources and residential emissions. At Madrid urban stations NO2 was significantly underestimated in both cases despite the fact that HERMESv2.0 estimates traffic emissions using a more local information and detailed methodology. This NO2 underestimation problem was not found in Barcelona due to the influence of international shipping emissions located in the coastline. An inadequate characterization of some TNO-MACC-II's point sources led to high SO2 biases at industrial stations, especially in northwest Spain where large facilities are grouped. In general, surface O3 was overestimated regardless of the emission dataset used, depicting the problematic of CMAQ on overestimating low ozone at night. On the other hand, modelled PM10 concentrations were less underestimated in urban areas when applying HERMESv2.0 due to the inclusion of road dust

Construction of lentiviral shRNA expression vector targeting ...

African Journals Online (AJOL)

DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

Calculation of the magnitude of long term contaminated area with COSYMA and MACCS

International Nuclear Information System (INIS)

Grupa, J.

1996-09-01

A severe nuclear accident will contaminate large areas of land. This paper discusses the output that can be obtained with COSYMA and MACCS to evaluate this contamination. Both codes associate contamination with deposition of given nuclides and the severity of contamination is expressed in terms of the ground concentration (Bq/m 2 ). However, for this analysis we decided to judge the severity of the land contamination by the dose rate (Sv/year) to the local inhabitants. To explain the differences between the COSYMA and MACCS results some details of the results were compared. This revealed that the results depend strongly on the choice of the grid if severe contamination occurs beyond about 50 to 100 km from the source. Another important factor to take into account when judging the severity of land contamination is the duration of the contamination; i.e. the time it takes until the contamination has decreased below a given level. Since we judge the contamination by the dose to the local public, the 'averted dose' concept has been used to evaluate the duration of the contamination. (orig.)

A simple and robust vector-based shRNA expression system used for RNA interference.

Science.gov (United States)

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

Directory of Open Access Journals (Sweden)

Yu Jin

2008-07-01

Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

Science.gov (United States)

Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

2014-02-04

TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

DEFF Research Database (Denmark)

Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

2008-01-01

  TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

A simple and robust vector-based shRNA expression system used for RNA interference.

Directory of Open Access Journals (Sweden)

Xue-jun Wang

Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

Science.gov (United States)

Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

2015-01-01

In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

The next generation of urban MACCs. Reassessing the cost-effectiveness of urban mitigation options by integrating a systemic approach and social costs

International Nuclear Information System (INIS)

Saujot, Mathieu; Lefèvre, Benoit

2016-01-01

Many cities are implementing policies and climate action plans. Yet local climate policies suffer from a lack of scientific understanding and evaluation methods able to support the definition of efficient mitigation strategies. The purpose of this paper is to build on classical approaches in the energy policy field that exist at the national and international level to propose an urban MACCs methodology able to fulfill this lack and inform local debates. The methodology is an extension of static “expert-based” MACCs; it combines a land use transport integrated model and an abatement cost methodology that integrates co-benefits, and takes into account the spatial and systemic dimensions of cities. The methodology is implemented for the transportation sector of a mid-sized European city (Grenoble, France). Our results present the cost-effectiveness and political feasibility of several proposed measures. We find that the inclusion of co-benefits can profoundly change the cost-benefit assessment of transport mitigation options. Moreover we underline the key parameters determining the cost-effectiveness ranking of mitigation options. These urban MACCs aim to serve as a bridge between urban planning and mitigation policies and can thus contribute to strengthen and align sustainable and climate change agendas at the local level. - Highlights: •Local climate policies lack scientific understanding for prioritizing mitigation actions. •We develop a method to evaluate cost-effectiveness of urban transportation actions. •This method combines urban modeling and MACCs to inform urban planning. •Abatement costs from its application to a mid-sized city are presented. •The impact of the inclusion of co-benefits is analyzed.

Estimation of the Radiological Consequences of Fukushima Dai-ichi Nuclear Power Plant Accident using MACCS2

Energy Technology Data Exchange (ETDEWEB)

Kim, Sora; Min, Byung-Il; Park, Kihyun; Yang, Byung-Mo; Suh, Kyung-suk [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2015-10-15

Three of them have undergone fuel melting and hydrogen explosions. A significant amount of radioactive material was released into the atmosphere from FDNPP and dispersed all over the world. In this study, we assessed the offsite consequences of Fukushima disaster in the region within a 30-km radius of FDNPP using the MELCOR Accident Consequence Code Systems 2(MACCS2) code, which is the Nuclear Regulatory Commission's (NRC's) code. The reflection of the realistic regional characteristics, such as long-term meteorological data, site- and population-specific data, and radiation safety regulatory, is essential to accurately analyze the off-site consequences. The assessment that reflects regional characteristics would contribute to identify main causes of exposure doses and to find the effective countermeasures for minimizing the accidental off-site consequences.

Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

Directory of Open Access Journals (Sweden)

Hai-Bo Xing

2018-01-01

Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

A 3-D evaluation of the MACC reanalysis dust product over the greater European region using CALIOP/CALIPSO satellite observations

Science.gov (United States)

Georgoulias, Aristeidis K.; Tsikerdekis, Athanasios; Amiridis, Vassilis; Marinou, Eleni; Benedetti, Angela; Zanis, Prodromos; Kourtidis, Konstantinos

2016-04-01

Significant amounts of dust are being transferred on an annual basis over the Mediterranean Basin and continental Europe from Northern Africa (Sahara Desert) and Middle East (Arabian Peninsula) as well as from other local sources. Dust affects a number of processes in the atmosphere modulating weather and climate also having an impact on human health and the economy. Therefore, the ability of simulating adequately the amount and optical properties of dust is essential. This work focuses on the evaluation of the MACC reanalysis dust product over the regions mentioned above. The evaluation procedure is based on pure dust satellite retrievals from CALIOP/CALIPSO that cover the period 2007-2012. The CALIOP/CALIPSO data utilized here come from an optimized retrieval scheme that was originally developed within the framework of the LIVAS (Lidar Climatology of Vertical Aerosol Structure for Space-Based LIDAR Simulation Studies) project. CALIOP/CALIPSO dust extinction coefficients and dust optical depth patterns at 532 nm are used for the validation of MACC natural aerosol extinction coefficients and dust optical depth patterns at 550 nm. Overall, it is shown in this work that space-based lidars may play a major role in the improvement of the MACC aerosol product. This research has been financed under the FP7 Programme MarcoPolo (Grand Number 606953, Theme SPA.2013.3.2-01).

[Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

Science.gov (United States)

Li, Lixuan; Li, Jia

2015-05-01

To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

Directory of Open Access Journals (Sweden)

Pham PV

2012-05-01

Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

AIRS Views of Anthropogenic and Biomass Burning CO: INTEX-B/MILAGRO and TEXAQS/GoMACCS

Science.gov (United States)

McMillan, W. W.; Warner, J.; Wicks, D.; Barnet, C.; Sachse, G.; Chu, A.; Sparling, L.

2006-12-01

Utilizing the Atmospheric InfraRed Sounder's (AIRS) unique spatial and temporal coverage, we present observations of anthropogenic and biomass burning CO emissions as observed by AIRS during the 2006 field experiments INTEX-B/MILAGRO and TEXAQS/GoMACCS. AIRS daily CO maps covering more than 75% of the planet demonstrate the near global transport of these emissions. AIRS day/night coverage of significant portions of the Earth often show substantial changes in 12 hours or less. However, the coarse vertical resolution of AIRS retrieved CO complicates its interpretation. For example, extensive CO emissions are evident from Asia during April and May 2006, but it is difficult to determine the relative contributions of biomass burning in Thailand vs. domestic and industrial emissions from China. Similarly, sometimes AIRS sees enhanced CO over and downwind of Mexico City and other populated areas. AIRS low information content and decreasing sensitivity in the boundary layer can result in underestimates of CO total columns and free tropospheric abundances. Building on our analyses of INTEX-A/ICARTT data from 2004, we present comparisons with INTEX-B/MILAGRO and TEXAQS/GoMACCS in situ aircraft measurements and other satellite CO observations. The combined analysis of AIRS CO, water vapor and O3 retrievals; MODIS aerosol optical depths; and forward trajectory computations illuminate a variety of dynamical processes in the troposphere.

Review of the chronic exposure pathways models in MACCS [MELCOR Accident Consequence Code System] and several other well-known probabilistic risk assessment models

International Nuclear Information System (INIS)

Tveten, U.

1990-06-01

The purpose of this report is to document the results of the work performed by the author in connection with the following task, performed for US Nuclear Regulatory Commission, (USNRC) Office of Nuclear Regulatory Research, Division of Systems Research: MACCS Chronic Exposure Pathway Models: Review the chronic exposure pathway models implemented in the MELCOR Accident Consequence Code System (MACCS) and compare those models to the chronic exposure pathway models implemented in similar codes developed in countries that are members of the OECD. The chronic exposures concerned are via: the terrestrial food pathways, the water pathways, the long-term groundshine pathway, and the inhalation of resuspended radionuclides pathway. The USNRC has indicated during discussions of the task that the major effort should be spent on the terrestrial food pathways. There is one chapter for each of the categories of chronic exposure pathways listed above

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

Science.gov (United States)

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

Directory of Open Access Journals (Sweden)

Shin-ichiro Kojima

2014-02-01

Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

The assessment of health effect of Yonggwang site using the MACCS code

International Nuclear Information System (INIS)

Jeong, Dognhan Yu; Kim, Seiung Hwan; Han, Byoung Sub; Song, Jong Soon

1996-12-01

The health effect assessment near the Yonggwang site by using IPE results and its site data was performed. The health effect assessment is an important part of consequence analysis of a nuclear power plant site. The MACCS code developed by SNL was used in the assessment. The necessary input data are source term data, meteorological data, population data, and detailed information about the release of radionuclides. The core inventory data for end-of-cycle are calculated by ORIGEN2 code for conservatism because fission product buildup is greatest at end-of-cycle conditions. Meteorological and population data was derived from the FSAR and environmental impact statement report, and source term release data was derived from the IPE report. by using the MACCS code, the CCDF is obtained as a result and economic impact analysis is also possible. First of all, the average value of early fatality was estimated by changing the initial value of random numbers. The average value obtained from 10 trials is in the rage between 10 -4 and 10 -3 and have a log-uniform distribution. More than 10 data are necessary in order to have a meaningful value statistically. And the calculations about early fatality, early injury, risks of early fatality, population dose within 16.0km, population risk for early fatality within 8.0km are performed. In all cases, STC-3 is the dominant contributor (about 70%), and STC-14 is the next important contributor. Therefore, in case of consequence analysis resulting from internal events, the analysis based on STC-3 which is the failure of early containment isolation is very important. Based on the calculation of CCDF for each risk measure, it is shown that CCDF has a slow slope and thus wide probability distribution in cases of early fatality, early injury, total early fatality risk, and total weighted early fatality risk, And in cases of cancer fatality and population dose within 48 km and 80km, the CCDF curve have a steep slope and thus narrow

Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

Science.gov (United States)

Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

2015-09-01

Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Reevaluation of the emergency planning zone for nuclear power plants in Taiwan using MACCS2 code

International Nuclear Information System (INIS)

Wu, J.; Yang, Y.-M.; Chen, I.-J.; Chen, H.-T.; Chuang, K.-S.

2006-01-01

According to government regulations, the emergency planning zone (EPZ) of a nuclear power plant (NPP) must be designated before operation and reevaluated every 5 years. Corresponding emergency response planning (ERP) has to be made in advance to guarantee that all necessary resources are available under accidental releases of radioisotope. In this study, the EPZ for each of the three operating NPPs, Chinshan, Kuosheng, and Maanshan, in Taiwan was reevaluated using the MELCOR Accident Consequence Code System 2 (MACCS2) developed by Sandia National Laboratory. Meteorological data around the nuclear power plant were collected during 2003. The source term data including inventory, sensible heat content, and timing duration, were based on previous PRA information of each plant. The effective dose equivalent and thyroid dose together with the related individual risk and societal risk were calculated. By comparing the results to the protective action guide and related safety criteria, 1.5, 1.5, and 4.5 km were estimated for Chinshan, Kuosheng, and Maanshan NPPs, respectively. We suggest that a radius of 5.0 km is a reasonably conservative value of EPZ for each of the three operating NPPs in Taiwan

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

Science.gov (United States)

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

Verification of ECMWF and ECMWF/MACC's global and direct irradiance forecasts with respect to solar electricity production forecasts

Directory of Open Access Journals (Sweden)

M. Schroedter-Homscheidt

2017-02-01

Full Text Available The successful electricity grid integration of solar energy into day-ahead markets requires at least hourly resolved 48 h forecasts. Technologies as photovoltaics and non-concentrating solar thermal technologies make use of global horizontal irradiance (GHI forecasts, while all concentrating technologies both from the photovoltaic and the thermal sector require direct normal irradiances (DNI. The European Centre for Medium-Range Weather Forecasts (ECMWF has recently changed towards providing direct as well as global irradiances. Additionally, the MACC (Monitoring Atmospheric Composition & Climate near-real time services provide daily analysis and forecasts of aerosol properties in preparation of the upcoming European Copernicus programme. The operational ECMWF/IFS (Integrated Forecast System forecast system will in the medium term profit from the Copernicus service aerosol forecasts. Therefore, within the MACC‑II project specific experiment runs were performed allowing for the assessment of the performance gain of these potential future capabilities. Also the potential impact of providing forecasts with hourly output resolution compared to three-hourly resolved forecasts is investigated. The inclusion of the new aerosol climatology in October 2003 improved both the GHI and DNI forecasts remarkably, while the change towards a new radiation scheme in 2007 only had minor and partly even unfavourable impacts on the performance indicators. For GHI, larger RMSE (root mean square error values are found for broken/overcast conditions than for scattered cloud fields. For DNI, the findings are opposite with larger RMSE values for scattered clouds compared to overcast/broken cloud situations. The introduction of direct irradiances as an output parameter in the operational IFS version has not resulted in a general performance improvement with respect to biases and RMSE compared to the widely used Skartveit et al. (1998 global to direct irradiance

Uncertainty and sensitivity analysis of early exposure results with the MACCS Reactor Accident Consequence Model

International Nuclear Information System (INIS)

Helton, J.C.; Johnson, J.D.; McKay, M.D.; Shiver, A.W.; Sprung, J.L.

1995-01-01

Uncertainty and sensitivity analysis techniques based on Latin hypercube sampling, partial correlation analysis and stepwise regression analysis are used in an investigation with the MACCS model of the early health effects associated with a severe accident at a nuclear power station. The primary purpose of this study is to provide guidance on the variables to be considered in future review work to reduce the uncertainty in the important variables used in the calculation of reactor accident consequences. The effects of 34 imprecisely known input variables on the following reactor accident consequences are studied: number of early fatalities, number of cases of prodromal vomiting, population dose within 10 mi of the reactor, population dose within 1000 mi of the reactor, individual early fatality probability within 1 mi of the reactor, and maximum early fatality distance. When the predicted variables are considered collectively, the following input variables were found to be the dominant contributors to uncertainty: scaling factor for horizontal dispersion, dry deposition velocity, inhalation protection factor for nonevacuees, groundshine shielding factor for nonevacuees, early fatality hazard function alpha value for bone marrow exposure, and scaling factor for vertical dispersion

Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

Directory of Open Access Journals (Sweden)

Sylvie Rato

2010-02-01

Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

Pathways of low carbon transition at the lowest cost. Pathways of low carbon transition in France at the lowest cost - Dynamics and average abatement costs (MACC)

International Nuclear Information System (INIS)

Perrissin Fabert, Baptiste; Foussard, Alexis

2016-11-01

The objective to divide greenhouse gas emissions in France by a factor four by 2050 implies the mobilisation at the lowest cost of the whole set of known sources of reduction of emissions in all economic sectors. In this context, this report is based on a methodology (D-CAM in French for dynamics - average abatement costs, MACC in English for Medium Abatement Cost Curves) which relies on a theoretical business-as-usual scenario, on a database on the potential, rate of development, and cost of mobilizable sources, and on a dynamic model of cost minimisation. The MACC tool is used to explore, for each sector, scenarios of de-carbonation which allow objectives of reduction of greenhouse gas emissions to be reached at different time horizons. An aggregated approach of this tool modifies the distribution of efforts of emission reduction between sectors with respect to a sector-based approach. Thus, a macro-assessment of low carbon transition does not reveal any obvious over-cost with respect to the business-as-usual scenario. A second document is a Power Point presentation which contains the same information, curves and graphs

In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

Directory of Open Access Journals (Sweden)

Che-Ming Liu

Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

Directory of Open Access Journals (Sweden)

Siyun Xu

2014-10-01

Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

Science.gov (United States)

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

Directory of Open Access Journals (Sweden)

Glen John McIntyre

Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

[Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

Science.gov (United States)

Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

2013-08-01

This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

Science.gov (United States)

Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

2018-02-01

Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

Robustness of an uncertainty and sensitivity analysis of early exposure results with the MACCS reactor accident consequence model

International Nuclear Information System (INIS)

Helton, J.C.; Johnson, J.D.; McKay, M.D.; Shiver, A.W.; Sprung, J.L.

1995-01-01

Uncertainty and sensitivity analysis techniques based on Latin hypercube sampling, partial correlation analysis and stepwise regression analysis were used in an investigation with the MACCS model of the early health effects associated with a severe accident at a nuclear power station. The following results were obtained in tests to check the robustness of the analysis techniques: two independent Latin hypercube samples produced similar uncertainty and sensitivity analysis results; setting important variables to best-estimate values produced substantial reductions in uncertainty, while setting the less important variables to best-estimate values had little effect on uncertainty; similar sensitivity analysis results were obtained when the original uniform and loguniform distributions assigned to the 34 imprecisely known input variables were changed to left-triangular distributions and then to right-triangular distributions; and analyses with rank-transformed and logarithmically-transformed data produced similar results and substantially outperformed analyses with raw (i.e., untransformed) data

[Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

Science.gov (United States)

Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

2008-06-01

To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

Science.gov (United States)

Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

2010-02-01

Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

Directory of Open Access Journals (Sweden)

Shin-ichiro Kojima

2014-05-01

Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

Knock-down of ABCE1 gene induces G1/S arrest in human oral cancer cells

OpenAIRE

Wang, Lei; Zhang, Mei; Liu, Dong-Xu

2014-01-01

Purpose: This study aims to explore the clinical characteristics of ATP binding cassette E1 (ABCE1) in oral squamous cell carcinomas (OSCC) and its roles in the proliferation, invasiveness, migration and apoptosis of the human oral squamous cell carcinoma cells CAL-27. Methods: The expression of ABCE1 and its target protein-RNase L, were first studied in tumor tissues of OSCC and adjacent non-tumor tissues. Moreover, CAL-27cells were transfected by ABCE1-specific shRNA, then MTT assay, the tr...

Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

Science.gov (United States)

Wajih, Nadeem; Owen, John; Wallin, Reidar

2008-01-01

Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

Uncertainty and sensitivity analysis of chronic exposure results with the MACCS reactor accident consequence model

International Nuclear Information System (INIS)

Helton, J.C.; Johnson, J.D.; Rollstin, J.A.; Shiver, A.W.; Sprung, J.L.

1995-01-01

Uncertainty and sensitivity analysis techniques based on Latin hypercube sampling, partial correlation analysis and stepwise regression analysis are used in an investigation with the MACCS model of the chronic exposure pathways associated with a severe accident at a nuclear power station. The primary purpose of this study is to provide guidance on the variables to be considered in future review work to reduce the uncertainty in the important variables used in the calculation of reactor accident consequences. The effects of 75 imprecisely known input variables on the following reactor accident consequences are studied: crop growing season dose, crop long-term dose, water ingestion dose, milk growing season dose, long-term groundshine dose, long-term inhalation dose, total food pathways dose, total ingestion pathways dose, total long-term pathways dose, total latent cancer fatalities, area-dependent cost, crop disposal cost, milk disposal cost, population-dependent cost, total economic cost, condemnation area, condemnation population, crop disposal area and milk disposal area. When the predicted variables are considered collectively, the following input variables were found to be the dominant contributors to uncertainty: dry deposition velocity, transfer of cesium from animal feed to milk, transfer of cesium from animal feed to meat, ground concentration of Cs-134 at which the disposal of milk products will be initiated, transfer of Sr-90 from soil to legumes, maximum allowable ground concentration of Sr-90 for production of crops, fraction of cesium entering surface water that is consumed in drinking water, groundshine shielding factor, scale factor defining resuspension, dose reduction associated with decontamination, and ground concentration of 1-131 at which disposal of crops will be initiated due to accidents that occur during the growing season

Ubiquitin-specific protease 14 regulates cell proliferation and apoptosis in oral squamous cell carcinoma.

Science.gov (United States)

Chen, Xiangyun; Wu, Jingjing; Chen, Yitian; Ye, Dongxia; Lei, Hu; Xu, Hanzhang; Yang, Li; Wu, Yingli; Gu, Wenli

2016-10-01

Ubiquitin-specific protease 14, a deubiquitinating enzyme, has been implicated in the tumorigenesis and progression of several cancers, but its role in oral squamous cell carcinoma remains to be elucidated. The aim of this study was to explore the expression pattern and roles of Ubiquitin-specific protease 14 in the occurrence and development of oral squamous cell carcinoma. Interestingly, Ubiquitin-specific protease 14 was overexpressed in oral cancer tissues and cell lines at both mRNA and protein levels. b-AP15, a specific inhibitor of Ubiquitin-specific protease 14, significantly inhibited the growth of cancer cells and increased cell apoptosis in a dose-dependent manner. Moreover, knockdown of Ubiquitin-specific protease 14 by shRNA significantly inhibited the proliferation and migration of cancer cells in vitro. Finally, using a xenograft mouse model of oral squamous cell carcinoma, knockdown of Ubiquitin-specific protease 14 markedly inhibited tumor growth and triggered the cancer cell apoptosis in vivo, supporting previous results. In conclusion, for the first time we have demonstrated the expression pattern of Ubiquitin-specific protease 14 in oral squamous cell carcinoma and verified a relationship with tumor growth and metastasis. These results may highlight new therapeutic strategies for tumor treatment, application of Ubiquitin-specific protease 14 selective inhibitor, such as b-AP15, or knockdown by shRNA. Collectively, Ubiquitin-specific protease 14 could be a potential therapeutic target for oral squamous cell carcinoma patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

shRNA screening identifies JMJD1C as being required for leukemia maintenance

DEFF Research Database (Denmark)

Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

2014-01-01

Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

Directory of Open Access Journals (Sweden)

Bojie Hu

2014-01-01

Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

Probabilistic accident consequence uncertainty analysis: Food chain uncertainty assessment. Volume 1: Main report

Energy Technology Data Exchange (ETDEWEB)

Brown, J. [National Radiological Protection Board (United Kingdom); Goossens, L.H.J.; Kraan, B.C.P. [Delft Univ. of Technology (Netherlands)] [and others

1997-06-01

This volume is the first of a two-volume document that summarizes a joint project conducted by the US Nuclear Regulatory Commission and the European Commission to assess uncertainties in the MACCS and COSYMA probabilistic accident consequence codes. These codes were developed primarily for estimating the risks presented by nuclear reactors based on postulated frequencies and magnitudes of potential accidents. This document reports on an ongoing project to assess uncertainty in the MACCS and COSYMA calculations for the offsite consequences of radionuclide releases by hypothetical nuclear power plant accidents. A panel of sixteen experts was formed to compile credible and traceable uncertainty distributions for food chain variables that affect calculations of offsite consequences. The expert judgment elicitation procedure and its outcomes are described in these volumes. Other panels were formed to consider uncertainty in other aspects of the codes. Their results are described in companion reports. Volume 1 contains background information and a complete description of the joint consequence uncertainty study. Volume 2 contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures for both panels, (3) the rationales and results for the panels on soil and plant transfer and animal transfer, (4) short biographies of the experts, and (5) the aggregated results of their responses.

Probabilistic accident consequence uncertainty analysis: Food chain uncertainty assessment. Volume 1: Main report

International Nuclear Information System (INIS)

Brown, J.; Goossens, L.H.J.; Kraan, B.C.P.

1997-06-01

This volume is the first of a two-volume document that summarizes a joint project conducted by the US Nuclear Regulatory Commission and the European Commission to assess uncertainties in the MACCS and COSYMA probabilistic accident consequence codes. These codes were developed primarily for estimating the risks presented by nuclear reactors based on postulated frequencies and magnitudes of potential accidents. This document reports on an ongoing project to assess uncertainty in the MACCS and COSYMA calculations for the offsite consequences of radionuclide releases by hypothetical nuclear power plant accidents. A panel of sixteen experts was formed to compile credible and traceable uncertainty distributions for food chain variables that affect calculations of offsite consequences. The expert judgment elicitation procedure and its outcomes are described in these volumes. Other panels were formed to consider uncertainty in other aspects of the codes. Their results are described in companion reports. Volume 1 contains background information and a complete description of the joint consequence uncertainty study. Volume 2 contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures for both panels, (3) the rationales and results for the panels on soil and plant transfer and animal transfer, (4) short biographies of the experts, and (5) the aggregated results of their responses

On the use of MOZAIC-IAGOS data to assess the ability of the MACC reanalysis to reproduce the distribution of ozone and CO in the UTLS over Europe

Directory of Open Access Journals (Sweden)

Audrey Gaudel

2015-12-01

Full Text Available MOZAIC-IAGOS data are used to assess the ability of the MACC reanalysis (REAN to reproduce distributions of ozone (O3 and carbon monoxide (CO, along with vertical and inter-annual variability in the upper troposphere/lower stratosphere region (UTLS over Europe for the period 2003–2010. A control run (CNTRL, without assimilation is compared with the MACC reanalysis (REAN, with assimilation to assess the impact of assimilation. On average over the period, REAN underestimates ozone by 60 ppbv in the lower stratosphere (LS, whilst CO is overestimated by 20 ppbv. In the upper troposphere (UT, ozone is overestimated by 50 ppbv, while CO is partly over or underestimated by up to 20 ppbv. As expected, assimilation generally improves model results but there are some exceptions. Assimilation leads to increased CO mixing ratios in the UT which reduce the biases of the model in this region but the difference in CO mixing ratios between LS and UT has not changed and remains underestimated after assimilation. Therefore, this leads to a significant positive bias of CO in the LS after assimilation. Assimilation improves estimates of the amplitude of the seasonal cycle for both species. Additionally, the observations clearly show a general negative trend of CO in the UT which is rather well reproduced by REAN. However, REAN misses the observed inter-annual variability in summer. The O3–CO correlation in the Ex-UTLS is rather well reproduced by the CNTRL and REAN, although REAN tends to miss the lowest CO mixing ratios for the four seasons and tends to oversample the extra-tropical transition layer (ExTL region in spring. This evaluation stresses the importance of the model gradients for a good description of the mixing in the Ex-UTLS region, which is inherently difficult to observe from satellite instruments.

Triptolide inhibits transcription of hTERT through down-regulation of transcription factor specificity protein 1 in primary effusion lymphoma cells

Energy Technology Data Exchange (ETDEWEB)

Long, Cong; Wang, Jingchao [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Guo, Wei [Department of Pathology and Physiology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Wang, Huan; Wang, Chao; Liu, Yu [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Sun, Xiaoping, E-mail: xsun6@whu.edu.cn [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); State Key Laboratory of Virology, Wuhan University, Wuhan, 430072 (China)

2016-01-01

Primary effusion lymphoma (PEL) is a rare and aggressive non-Hodgkin's lymphoma. Human telomerase reverse transcriptase (hTERT), a key component responsible for the regulation of telomerase activity, plays important roles in cellular immortalization and cancer development. Triptolide purified from Tripterygium extracts displays a broad-spectrum bioactivity profile, including immunosuppressive, anti-inflammatory, and anti-tumor. In this study, it is investigated whether triptolide reduces hTERT expression and suppresses its activity in PEL cells. The mRNA and protein levels of hTERT were examined by real time-PCR and Western blotting, respectively. The activity of hTERT promoter was determined by Dual luciferase reporter assay. Our results demonstrated that triptolide decreased expression of hTERT at both mRNA and protein levels. Further gene sequence analysis indicated that the activity of hTERT promoter was suppressed by triptolide. Triptolide also reduced the half-time of hTERT. Additionally, triptolide inhibited the expression of transcription factor specificity protein 1(Sp1) in PEL cells. Furthermore, knock-down of Sp1 by using specific shRNAs resulted in down-regulation of hTERT transcription and protein expression levels. Inhibition of Sp1 by specific shRNAs enhanced triptolide-induced cell growth inhibition and apoptosis. Collectively, our results demonstrate that the inhibitory effect of triptolide on hTERT transcription is possibly mediated by inhibition of transcription factor Sp1 in PEL cells. - Highlights: • Triptolide reduces expression of hTERT by decreasing its transcription level. • Triptolide reduces promoter activity and stability of hTERT. • Triptolide down-regulates expression of Sp1. • Special Sp1 shRNAs inhibit transcription and protein expression of hTERT. • Triptolide and Sp1 shRNA2 induce cell proliferation inhibition and apoptosis.

Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

Science.gov (United States)

Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

2014-01-01

Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

Directory of Open Access Journals (Sweden)

Ami Cohen

Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

Science.gov (United States)

Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

2017-09-09

Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

Reduction in podocyte SIRT1 accelerates kidney injury in aging mice.

Science.gov (United States)

Chuang, Peter Y; Cai, Weijing; Li, Xuezhu; Fang, Lu; Xu, Jin; Yacoub, Rabi; He, John Cijiang; Lee, Kyung

2017-09-01

Both the incidence and prevalence of chronic kidney disease are increasing in the elderly population. Although aging is known to induce kidney injury, the underlying molecular mechanisms remain unclear. Sirtuin 1 (Sirt1), a longevity gene, is known to protect kidney cell injury from various cellular stresses. In previous studies, we showed that the podocyte-specific loss of Sirt1 aggravates diabetic kidney injury. However, the role of Sirt1 in aging-induced podocyte injury is not known. Therefore, in this study we sought to determine the effects of podocyte-specific reduction of Sirt1 in age-induced kidney injury. We employed the inducible podocyte-specific Sirt1 knockdown mice that express shRNA against Sirt1 (Pod-Sirt1 RNAi ) and control mice that express shRNA for luciferase (Pod-Luci RNAi ). We found that reduction of podocyte Sirt1 led to aggravated aging-induced glomerulosclerosis and albuminuria. In addition, urinary level of 8-hydroxy-2'-deoxyguanosine (8-OHdG), a marker of oxidative stress, was markedly increased in aged Pod-Sirt1 RNAi mice compared with aged Pod-Luci RNAi mice. Although podocyte-specific markers decreased in aged mice compared with the young controls, the decrease was further exacerbated in aged Pod-Sirt1 RNAi compared with Pod-Luci RNAi mice. Interestingly, expression of cellular senescence markers was significantly higher in the glomeruli of Pod-Sirt1 RNAi mice than Pod-Luci RNAi mice, suggesting that cellular senescence may contribute to podocyte loss in aging kidneys. Finally, we confirmed that Pod-Sirt1 RNAi glomeruli were associated with reduced activation of the transcription factors peroxisome proliferator-activated receptor (PPAR)-α coactivador-1 (PGC1α)/PPARγ, forkhead box O (FOXO)3, FOXO4, and p65 NF-κB, through SIRT1-mediated deacetylation. Together, our data suggest that SIRT1 may be a potential therapeutic target to treat patients with aging-related kidney disease.

HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines

International Nuclear Information System (INIS)

Calmon, Marilia Freitas; Sichero, Laura; Boccardo, Enrique; Villa, Luisa Lina; Rahal, Paula

2016-01-01

Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.

HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines

Energy Technology Data Exchange (ETDEWEB)

Calmon, Marilia Freitas [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil); Sichero, Laura [Molecular Biology Laboratory, Centre for Translational Research in Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), São Paulo (Brazil); Boccardo, Enrique [Department of Microbiology, Institute of Biomedical Sciences, University of São Paulo., São Paulo (Brazil); Villa, Luisa Lina [Department of Radiology and Oncology, Faculdade de Medicina, Universidade de São Paulo, São Paulo (Brazil); Rahal, Paula, E-mail: rahalp@yahoo.com.br [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil)

2016-09-15

Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.

Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis.

Science.gov (United States)

Chang, Ling-Chu; Chiang, Shih-Kai; Chen, Shuen-Ei; Yu, Yung-Luen; Chou, Ruey-Hwang; Chang, Wei-Chao

2018-03-01

Ferroptosis is a form of oxidative cell death and has become a chemotherapeutic target for cancer treatment. BAY 11-7085 (BAY), which is a well-known IκBα inhibitor, suppressed viability in cancer cells via induction of ferroptotic death in an NF-κB-independent manner. Reactive oxygen species scavenging, relief of lipid peroxidation, replenishment of glutathione and thiol-containing agents, as well as iron chelation, rescued BAY-induced cell death. BAY upregulated a variety of Nrf2 target genes related to redox regulation, particularly heme oxygenase-1 (HO-1). Studies with specific inhibitors and shRNA interventions suggested that the hierarchy of induction is Nrf2-SLC7A11-HO-1. SLC7A11 inhibition by erastin, sulfasalazine, or shRNA interference sensitizes BAY-induced cell death. Overexperession of SLC7A11 attenuated BAY-inhibited cell viability. The ferroptotic process induced by hHO-1 overexpression further indicated that HO-1 is a key mediator of BAY-induced ferroptosis that operates through cellular redox regulation and iron accumulation. BAY causes compartmentalization of HO-1 into the nucleus and mitochondrion, and followed mitochondrial dysfunctions, leading to lysosome targeting for mitophagy. In this study, we first discovered that BAY induced ferroptosis via Nrf2-SLC7A11-HO-1 pathway and HO-1 is a key mediator by responding to the cellular redox status. Copyright © 2017 Elsevier B.V. All rights reserved.

Stable replication of the EBNA1/OriP-mediated baculovirus vector and its application to anti-HCV gene therapy

Directory of Open Access Journals (Sweden)

Chang Myint OO

2009-10-01

Full Text Available Abstract Background Hepatitis C virus (HCV is one of the main causes of liver-related morbidity and mortality. Although combined interferon-α-ribavirin therapy is effective for about 50% of the patients with HCV, better therapies are needed and preventative vaccines have yet to be developed. Short-hairpin RNAs (shRNAs inhibit gene expression by RNA interference. The application of transient shRNA expression is limited, however, due to the inability of the shRNA to replicate in mammalian cells and its inefficient transduction. The duration of transgene (shRNA expression in mammalian cells can be significantly extended using baculovirus-based shRNA-expressing vectors that contain the latent viral protein Epstein-Barr nuclear antigen 1 (EBNA1 and the origin of latent viral DNA replication (OriP sequences. These recombinant vectors contain compatible promoters and are highly effective for infecting primary hepatocyte and hepatoma cell lines, making them very useful tools for studies of hepatitis B and hepatitis C viruses. Here, we report the use of these baculovirus-based vector-derived shRNAs to inhibit core-protein expression in full-length hepatitis C virus (HCV replicon cells. Results We constructed a long-term transgene shRNA expression vector that contains the EBV EBNA1 and OriP sequences. We also designed baculovirus vector-mediated shRNAs against the highly conserved core-protein region of HCV. HCV core protein expression was inhibited by the EBNA1/OriP baculovirus vector for at least 14 days, which was considerably longer than the 3 days of inhibition produced by the wild-type baculovirus vector. Conclusion These findings indicate that we successfully constructed a long-term transgene (shRNA expression vector (Ac-EP-shRNA452 using the EBNA1/OriP system, which was propagated in Escherichia coli and converted into mammalian cells. The potential anti-HCV activity of the long-term transgene (shRNA expression vector was evaluated with the view

Uncertainty and sensitivity analysis of food pathway results with the MACCS Reactor Accident Consequence Model

International Nuclear Information System (INIS)

Helton, J.C.; Johnson, J.D.; Rollstin, J.A.; Shiver, A.W.; Sprung, J.L.

1995-01-01

Uncertainty and sensitivity analysis techniques based on Latin hypercube sampling, partial correlation analysis and stepwise regression analysis are used in an investigation with the MACCS model of the food pathways associated with a severe accident at a nuclear power station. The primary purpose of this study is to provide guidance on the variables to be considered in future review work to reduce the uncertainty in the important variables used in the calculation of reactor accident consequences. The effects of 87 imprecisely-known input variables on the following reactor accident consequences are studied: crop growing season dose, crop long-term dose, milk growing season dose, total food pathways dose, total ingestion pathways dose, total long-term pathways dose, area dependent cost, crop disposal cost, milk disposal cost, condemnation area, crop disposal area and milk disposal area. When the predicted variables are considered collectively, the following input variables were found to be the dominant contributors to uncertainty: fraction of cesium deposition on grain fields that is retained on plant surfaces and transferred directly to grain, maximum allowable ground concentrations of Cs-137 and Sr-90 for production of crops, ground concentrations of Cs-134, Cs-137 and I-131 at which the disposal of milk will be initiated due to accidents that occur during the growing season, ground concentrations of Cs-134, I-131 and Sr-90 at which the disposal of crops will be initiated due to accidents that occur during the growing season, rate of depletion of Cs-137 and Sr-90 from the root zone, transfer of Sr-90 from soil to legumes, transfer of Cs-137 from soil to pasture, transfer of cesium from animal feed to meat, and the transfer of cesium, iodine and strontium from animal feed to milk

Uncertainty and sensitivity analysis of food pathway results with the MACCS reactor accident consequence model

International Nuclear Information System (INIS)

Helton, J.C.; Johnson, J.D.; Rollstin, J.A.; Shiver, A.W.; Sprung, J.L.

1995-01-01

Uncertainty and sensitivity analysis techniques based on Latin hypercube sampling, partial correlation analysis and stepwise regression analysis are used in an investigation with the MACCS model of the food pathways associated with a severe accident at a nuclear power station. The primary purpose of this study is to provide guidance on the variables to be considered in future review work to reduce the uncertainty in the important variables used in the calculation of reactor accident consequences. The effects of 87 imprecisely-known input variables on the following reactor accident consequences are studied: crop growing-season dose, crop long-term dose, milk growing-season dose, total food pathways dose, total ingestion pathways dose, total long-term pathways dose, area dependent cost, crop disposal cost, milk disposal cost, condemnation area, crop disposal area and milk disposal area. When the predicted variables are considered collectively, the following input variables were found to be the dominant contributors to uncertainty: fraction of cesium deposition on grain fields that is retained on plant surfaces and transferred directly to grain, maximum allowable ground concentrations of Cs-137 and Sr-90 for production of crops, ground concentrations of Cs-134, Cs-137 and I-131 at which the disposal of milk will be initiated due to accidents that occur during the growing season, ground concentrations of Cs-134, I-131 and Sr-90 at which the disposal of crops will be initiated due to accidents that occur during the growing season, rate of depletion of Cs-137 and Sr-90 from the root zone, transfer of Sr-90 from soil to legumes, transfer of Cs-137 from soil to pasture, transfer of cesium from animal feed to meat, and the transfer of cesium, iodine and strontium from animal feed to milk

Inhibition of Rac1 ameliorates neuronal oxidative stress damage via reducing Bcl-2/Rac1 complex formation in mitochondria through PI3K/Akt/mTOR pathway.

Science.gov (United States)

Pan, Yundan; Wang, Na; Xia, Pingping; Wang, E; Guo, Qulian; Ye, Zhi

2018-02-01

Although the neuroprotective effects of Rac1 inhibition have been reported in various cerebral ischemic models, the molecular mechanisms of action have not yet been fully elucidated. In this study, we investigated whether the inhibition of Rac1 provided neuroprotection in a diabetic rat model of focal cerebral ischemia and hyperglycemia-exposed PC-12 cells. Intracerebroventricular administration of lentivirus expressing the Rac1 small hairpin RNA (shRNA) and specific Rac1 inhibitor NSC23766 not only decreased the infarct volumes and improved neurologic deficits with a correlated significant activation of mitochondrial DNA specific proteins, such as OGG1 and POLG, but also elevated Bcl-2 S70 phosphorylation in mitochondria. Furthermore, the levels of p-PI3K, p-Akt and p-mTOR increased, while 8-OHdG, ROS production and Bcl-2/Rac1 complex formation in mitochondria reduced in both Rac1-shRNA- and NSC23766-treated rats. Moreover, to confirm our in vivo observations, inhibition of Rac1 activity by NSC23766 suppressed the interactions between Bcl-2 and Rac1 in the mitochondria of PC-12 cells cultured in high glucose conditions and protected PC-12 cells from high glucose-induced neurotoxicity. More importantly, these beneficial effects of Rac1 inhibition were abolished by PI3K inhibitor LY294002. In contrast to NSC23766 treatment, LY294002 had little effect on the decrement of p-PTEN level. Taken together, these findings revealed novel neuroprotective roles of Rac1 inhibition against cerebral ischemic reperfusion injury in vivo and high glucose-induced neurotoxicity in PC-12 cells in vitro, by reducing Bcl-2/Rac1 complex formation in mitochondria through the activation of PI3K/Akt/mTOR survival pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of severe accident risks: Quantification of major input parameters: MAACS [MELCOR Accident Consequence Code System] input

International Nuclear Information System (INIS)

Sprung, J.L.; Jow, H-N; Rollstin, J.A.; Helton, J.C.

1990-12-01

Estimation of offsite accident consequences is the customary final step in a probabilistic assessment of the risks of severe nuclear reactor accidents. Recently, the Nuclear Regulatory Commission reassessed the risks of severe accidents at five US power reactors (NUREG-1150). Offsite accident consequences for NUREG-1150 source terms were estimated using the MELCOR Accident Consequence Code System (MACCS). Before these calculations were performed, most MACCS input parameters were reviewed, and for each parameter reviewed, a best-estimate value was recommended. This report presents the results of these reviews. Specifically, recommended values and the basis for their selection are presented for MACCS atmospheric and biospheric transport, emergency response, food pathway, and economic input parameters. Dose conversion factors and health effect parameters are not reviewed in this report. 134 refs., 15 figs., 110 tabs

Standard technical specifications: Combustion engineering plants. Volume 1, Revision 1: Specifications

International Nuclear Information System (INIS)

1995-04-01

This report documents the results of the combined effort of the NRC and the industry to produce improved Standard Technical Specifications (STS), Revision 1 for Combustion Engineering Plants. The changes reflected in Revision 1 resulted from the experience gained from license amendment applications to convert to these improved STS or to adopt partial improvements to existing technical specifications. This NUREG is the result of extensive public technical meetings and discussions between the Nuclear Regulatory Commission (NRC) staff and various nuclear power plant licensees, Nuclear Steam Supply System (NSSS) Owners Groups, NSSS vendors, and the Nuclear Energy Institute (NEI). The improved STS were developed based on the criteria in the Final Commission Policy Statement on Technical Specifications Improvements for Nuclear Power Reactors, dated July 22, 1993. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. Volume 3 contains the Bases for Sections 3.4--3.9 of the improved STS

A bottom-up method to develop pollution abatement cost curves for coal-fired utility boilers

International Nuclear Information System (INIS)

Vijay, Samudra; DeCarolis, Joseph F.; Srivastava, Ravi K.

2010-01-01

This paper illustrates a new method to create supply curves for pollution abatement using boiler-level data that explicitly accounts for technology cost and performance. The Coal Utility Environmental Cost (CUECost) model is used to estimate retrofit costs for five different NO x control configurations on a large subset of the existing coal-fired, utility-owned boilers in the US. The resultant data are used to create technology-specific marginal abatement cost curves (MACCs) and also serve as input to an integer linear program, which minimizes system-wide control costs by finding the optimal distribution of NO x controls across the modeled boilers under an emission constraint. The result is a single optimized MACC that accounts for detailed, boiler-specific information related to NO x retrofits. Because the resultant MACCs do not take into account regional differences in air-quality standards or pre-existing NO x controls, the results should not be interpreted as a policy prescription. The general method as well as NO x -specific results presented here should be of significant value to modelers and policy analysts who must estimate the costs of pollution reduction.

SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

OpenAIRE

Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

2015-01-01

Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

Science.gov (United States)

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

Uncertainty and sensitivity analysis of chronic exposure results with the MACCS reactor accident consequence model

International Nuclear Information System (INIS)

Helton, J.C; Johnson, J.D; Rollstin, J.A; Shiver, A.W; Sprung, J.L

1995-01-01

Uncertainty and sensitivity analysis techniques based on Latin hypercube sampling, partial correlation analysis and stepwise regression analysis are used in an investigation with the MACCS model of the chronic exposure pathways associated with a severe accident at a nuclear power station. The primary purpose of this study is to provide guidance on the variables to be considered in future review work to reduce the uncertainty in the important variables used in the calculation of reactor accident consequences. The effects of 75 imprecisely known input variables on the following reactor accident consequences are studied: crop growing-season dose, crop long-term dose, water ingestion dose, milk growing-season dose, long-term groundshine dose, long-term inhalation dose, total food pathways dose, total ingestion pathways dose, total long-term pathways dose, total latent cancer fatalities, area-dependent cost, crop disposal cost, milk disposal cost, population-dependent cost, total economic cost, condemnation area, condemnation population, crop disposal area and milk disposal area. When the predicted variables are considered collectively, the following input variables were found to be the dominant contributors to uncertainty: dry deposition velocity, transfer of cesium from animal feed to milk, transfer of cesium from animal feed to meet, ground concentration of Cs-134 at which the disposal of milk products will be initiated, transfer of Sr-90 from soil to legumes, maximum allowable ground concentration of Sr-90 for production of crops, fraction of cesium entering surface water that is consumed in drinking water, groundshine shielding factor, scale factor defining resuspension, dose reduction associated with decontamination, and ground concentration of I-131 at which disposal of crops will be initiated due to accidents that occur during the growing season. Reducing the uncertainty in the preceding variables was found to substantially reduce the uncertainty in the

Use of HGSYSTEM/UF6 and MACCS2 for the Building 9204-2E safety analysis report consequence analysis: General overview and comparison of models

International Nuclear Information System (INIS)

Lombardi, D.A.; Brock, W.R.

1998-01-01

Building 9204-2E is used for assembly, disassembly, and storage of weapons components, and quality operations. The building, built in 1971, is a three story structure approximately 101 m long, 51 m wide, and 21 m high located in the western exclusion area of the Y-12 Plant, Oak Ridge, Tennessee. For these activities, several types of hazardous and radioactive materials are used and stored in Building 9204-2E. During a fire, criticality event, or other accident, the potential exists for the release of uranium and other hazardous materials from the building to the atmosphere. A Safety Analysis Report (SAR) is being prepared for Building 9204-2E, in which the consequences of such releases to on-site workers and the off-site public are being analyzed. Consequence estimates from accidental airborne releases are generally calculated using computer models that simulate dispersion and transport of the plume as it travels downwind. For the Building 9204-2E SAR, two candidate atmospheric dispersion candidate models have bene identified for use: (1) the Heavy Gas System-Uranium Hexafluoride (HGSYSTEM/UF 6 ) Model Suite, and (2) the MELCOR Accident Consequence Code System-2 (MACCS2). The purpose of this paper is to provide a general description of the two model suites and compared model results for generic release cases, representative of those that will be analyzed in the Building 9204-2E SAR. Recommendations for use of the model suites in the SAR are also discussed

Multiple-pollutant cost-effectiveness of greenhouse gas mitigation measures in the UK agriculture

International Nuclear Information System (INIS)

Eory, Vera; Topp, Cairistiona F.E.; Moran, Dominic

2013-01-01

Highlights: ► Multiple-pollutant marginal abatement cost curves can inform integrated environmental policy. ► We incorporated the co-effects on NH 3 , NO 3 − , P and sediment, as monetary values, into the UK GHG MACC. ► Adding co-effects modifies the GHG MACC, though with little impact unless using high damage values. ► Further research is needed on the co-effects of GHG mitigation measures and on damage values. ► Analysis should focus on the co-effects of measures that are slightly above or below the threshold. -- Abstract: This paper develops multiple-pollutant marginal abatement cost curve analysis to identify an optimal set of greenhouse gas (GHG) mitigation measures considering the trade-offs and synergies with other environmental pollutants. The analysis is applied to UK agriculture, a sector expected to make a contribution to the national GHG mitigation effort. Previous analyses using marginal abatement cost curves (MACCs) have determined the sector's GHG abatement potential based on the cost-effectiveness of a variety of technically feasible mitigation measures. Most of these measures have external effects on other pollution loads arising from agricultural activities. Here the monetary values of four of the most important impacts to water and air (specifically ammonia, nitrate, phosphorous and sediment) are included in the cost-effectiveness analysis. The resulting multiple-pollutant marginal abatement cost curve (MP MACC) informs the design of sustainable climate change policies by showing how the MP MACC for the UK agriculture can differ from the GHG MACC. The analysis also highlights research gaps, and suggests a need to understand the wider environmental effects of GHG mitigation options and to reduce the uncertainty in pollutant damage cost estimates

Marginal abatement cost curves in general equilibrium: The influence of world energy prices

International Nuclear Information System (INIS)

Klepper, Gernot; Peterson, Sonja

2006-01-01

Marginal abatement cost curves (MACCs) are a favorite instrument to analyze international emissions trading. This paper focuses on the question of how to define MACCs in a general equilibrium context where the global abatement level influences energy prices and in turn national MACCs. We discuss the mechanisms theoretically and then use the CGE model DART for quantitative simulations. The result is, that changes in energy prices resulting from different global abatement levels do indeed affect national MACCs. Also, we compare different possibilities of defining MACCs-of which some are robust against changes in energy prices while others vary considerably. (author)

Clinical outcomes of patients with hypothyroidism undergoing percutaneous coronary intervention

Science.gov (United States)

Zhang, Ming; Sara, Jaskanwal D.S.; Matsuzawa, Yasushi; Gharib, Hossein; Bell, Malcolm R.; Gulati, Rajiv; Lerman, Lilach O.

2016-01-01

Abstract Aims The aim of this study was to investigate the association between hypothyroidism and major adverse cardiovascular and cerebral events (MACCE) in patients undergoing percutaneous coronary intervention (PCI). Methods and results Two thousand four hundred and thirty patients who underwent PCI were included. Subjects were divided into two groups: hypothyroidism ( n = 686) defined either as a history of hypothyroidism or thyroid-stimulating hormone (TSH) ≥5.0 mU/mL, and euthyroidism ( n = 1744) defined as no history of hypothyroidism and/or 0.3 mU/mL ≤ TSH hypothyroidism were further categorized as untreated ( n = 193), or those taking thyroid replacement therapy (TRT) with adequate replacement (0.3 mU/mL ≤ TSH hypothyroidism compared with those with euthyroidism (MACCE: HR: 1.28, P = 0.0001; myocardial infarction (MI): HR: 1.25, P = 0.037; heart failure: HR: 1.46, P = 0.004; revascularization: HR: 1.26, P = 0.0008; stroke: HR: 1.62, P = 0.04). Compared with untreated patients or those with inadequate replacement, adequately treated hypothyroid patients had a lower risk of MACCE (HR: 0.69, P = 0.005; HR: 0.78, P = 0.045), cardiac death (HR: 0.43, P = 0.008), MI (HR: 0.50, P = 0.0004; HR: 0.60, P = 0.02), and heart failure (HR: 0.50, P = 0.02; HR: 0.52, P = 0.017). Conclusion Hypothyroidism is associated with a higher incidence of MACCE compared with euthyroidism in patients undergoing PCI. Maintaining adequate control on TRT is beneficial in preventing MACCE. PMID:26757789

Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathway-mediated neurogenesis.

Science.gov (United States)

Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua

2013-12-23

This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.

RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

Directory of Open Access Journals (Sweden)

Johanna Meier-Soelch

2018-04-01

Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

Changes in geriatric nutritional risk index and risk of major adverse cardiac and cerebrovascular events in incident peritoneal dialysis patients

Directory of Open Access Journals (Sweden)

Mi Jung Lee

2017-12-01

Full Text Available Background: Geriatric nutritional risk index (GNRI is a validated nutritional assessment method, and lower GNRI values are closely associated with adverse clinical outcomes in dialysis patients. This study investigated the impact of changes in GNRI during the first year of dialysis on cardiovascular outcomes in incident peritoneal dialysis (PD patients. Methods: We reviewed medical records in 133 incident PD patients to determine GNRI at the start of PD and after 12 months. Patients were categorized into improved (delta GNRI > 0 and worsening/stationary (delta GNRI ≤ 0 groups. The primary outcome was major adverse cardiac and cerebrovascular events (MACCEs. Results: During a mean follow-up of 51.1 months, the primary outcome was observed in 42 patients (31.6%. The baseline GNRI at PD initiation was not significantly associated with MACCEs (log-rank test, P = 0.40. However, the cumulative event-free rate was significantly lower in the worsening or stationary GNRI group than in the improved group (log-rank test, P = 0.004. Multivariate Cox analysis revealed that a worsening or stationary GNRI was independently associated with higher risk for MACCEs (hazard ratio, 2.47; 95% confidence interval, 1.15–5.29; P = 0.02. In subgroup analysis, patients with worsening or stationary GNRI were at significantly greater risk for MACCEs in both the lower (P = 0.04 and higher (P = 0.01 baseline GNRI groups. Conclusion: Baseline GNRI was not associated with MACCEs, but patients with deteriorating or stationary nutritional status were at significantly greater risk for MACCEs, suggesting that serial monitoring of nutritional status is important to stratify cardiovascular risk in incident PD patients.

Standard technical specifications: General Electric plants, BWR/4. Volume 1, Revision 1: Specifications

International Nuclear Information System (INIS)

1995-04-01

This report documents the results of the combined effort of the NRC and the industry to produce improved Standard Technical Specifications (STS), Revision 1 for General Electric BWR/4 Plants. The changes reflected in Revision 1 resulted from the experience gained from license amendment applications to convert to these improved STS or to adopt partial improvements to existing technical specifications. This NUREG is the result of extensive public technical meetings and discussions between the Nuclear Regulatory Commission (NRC) staff and various nuclear power plant licensees, Nuclear Steam Supply System (NSSS) Owners Groups, NSSS vendors, and the Nuclear Energy Institute (NEI). The improved STS were developed based on the criteria in the Final Commission Policy Statement on Technical Specifications Improvements for Nuclear Power Reactors, dated July 22, 1993. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. Volume 3 contains the Bases for Sections 3.4--3.10 of the improved STS

RNAi Knockdown of Hypoxia-Inducible Factor-1α Decreased the Proliferation, Migration, and Invasion of Hypoxic Hepatocellular Carcinoma Cells.

Science.gov (United States)

Chen, ChengShi; Liu, Rong; Wang, JianHua; Yan, ZhiPing; Qian, Sheng; Zhang, Wei

2015-04-01

The obstruction of hepatic arterial blood flow results in tumor tissue hypoxia and elevated expression of hypoxia-inducible factor-1alpha (HIF-1α). Our study evaluated whether lentivirus-mediated short interference RNA against HIF-1α inhibits proliferation, invasion, and migration of hepatocellular carcinoma (HCC) cells under hypoxia. RNA interference knockdown of HIF-1α was achieved by HIF-1α-directed lentiviral shRNA, in a rat HCC cell line cultured under hypoxia condition for varying length of times. The expression levels of HIF-1α and vascular endothelial growth factor were examined using reverse transcription polymerase chain reaction and western blot analyses. Cell proliferation, migration, and invasion were measured by cell viability, transwell migration, and invasion assays, respectively. Inhibition of HIF-1α expression by shRNA suppressed vascular endothelial growth factor mRNA and protein levels under both normoxia and hypoxia. It also suppressed cell migration and invasion, which were enhanced under hypoxic conditions. RNAi knockdown of HIF-1α further suppressed hypoxia-mediated inhibition of the cell proliferation. These data suggest that shRNA of HIF-1α could antagonize the hypoxia-mediated increase in hepatic cancer cell migration and invasion, and synergize with hypoxia to inhibit the cell proliferation in HCC cells.

Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

Directory of Open Access Journals (Sweden)

Peng Cheng

2015-05-01

Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

CSFV proliferation is associated with GBF1 and Rab2

Indian Academy of Sciences (India)

2016-12-29

Dec 29, 2016 ... 2.4 GBF1and Rab2 shRNA vector construction and cell ... CSFV RNA in ST cells at the earliest time point were selected as ... Real-time PCR for detection of GBF1 ..... pathways are also regulated by GBF1 and are involved in.

Inhibiting trophoblast PAR-1 overexpression suppresses sFlt-1-induced anti-angiogenesis and abnormal vascular remodeling: a possible therapeutic approach for preeclampsia.

Science.gov (United States)

Zhao, Yin; Zheng, YanFang; Liu, XiaoXia; Luo, QingQing; Wu, Di; Liu, XiaoPing; Zou, Li

2018-03-01

Is it possible to improve vascular remodeling by inhibiting the excessive expression of protease-activated receptor 1 (PAR-1) in trophoblast of abnormal placenta? Inhibition of trophoblast PAR-1 overexpression may promote placental angiogenesis and vascular remodeling, offering an alternative therapeutic approach for preeclampsia. PAR-1 is high-affinity receptor of thrombin. Thrombin increases sFlt-1 secretion in trophoblast via the activation of PAR-1. It is reported that the expression of both thrombin and PAR-1 expression are increased in placentas of preeclampsia patients compared with normal placentas. Trophoblast cells were transfected with PAR-1 short hairpin RNA (shRNA) or PAR-1 overexpression plasmids in vitro. Tube formation assays and a villus-decidua co-culture system were used to study the effect of PAR-1 inhibition on placental angiogenesis and vascular remodeling, respectively. Placentas from rats with preeclampsia were transfected with PAR-1 shRNA to confirm the effect of inhibiting PAR-1 overexpression in placenta. The trophoblast cell line HTR-8/SVneo was transfected with PAR-1 shRNA or PAR-1 overexpression plasmids. After 48 h, supernatant was collected and the level of sFlt-1 secretion was measured by ELISA. Human umbilical cord epithelial cells and a villus-decidua co-culture system were treated with conditioned media to study the effect of PAR-1 inhibition on tube formation and villi vascular remodeling. A preeclampsia rat model was established by intraperitoneal injection of L-NAME. Plasmids were injected into the placenta of the preeclampsia rats and systolic blood pressure was measured on Days 15 and 19. The effect of different treatments was evaluated by proteinuria, placental weights, fetal weights and fetal numbers in study and control groups. The level of serum sFlt-1 in rats with preeclampsia was also measured. Changes in the placenta microvessels were studied by histopathological staining. PAR-1 shRNA inhibited PAR-1 expression and

Neuron-specific RNA interference using lentiviral vectors

DEFF Research Database (Denmark)

Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

2009-01-01

BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...

Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

Energy Technology Data Exchange (ETDEWEB)

Wang, Chunmao; Ding, Chao; Kong, Minjian [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Dong, Aiqiang, E-mail: dr_dongaiqiang@sina.com [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Qian, Jianfang; Jiang, Daming; Shen, Zhonghua [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China)

2011-07-08

Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the

Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

International Nuclear Information System (INIS)

Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua

2011-01-01

Highlights: → We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. → We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. → We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. → Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 ± 6% and by liposomal magnetofection by 85.1 ± 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R

DOSFAC2 user`s guide

Energy Technology Data Exchange (ETDEWEB)

Young, M.L.; Chanin, D.

1997-12-01

This document describes the DOSFAC2 code, which is used for generating dose-to-source conversion factors for the MACCS2 code. DOSFAC2 is a revised and updated version of the DOSFAC code that was distributed with version 1.5.11 of the MACCS code. included are (1) an overview and background of DOSFAC2, (2) a summary of two new functional capabilities, and (3) a user`s guide. 20 refs., 5 tabs.

Improved early risk stratification of patients with ST-segment elevation myocardial infarction undergoing primary percutaneous coronary intervention using a combination of serum soluble ST2 and NT-proBNP.

Directory of Open Access Journals (Sweden)

Jongwook Yu

Full Text Available Although soluble suppression of tumorigenicity 2 (sST2 in serum is known to be associated with ischemic heart disease and heart failure, data regarding its prognostic impact in ST-segment elevation myocardial infarction (STEMI is limited. We evaluated the prognostic impacts of serum sST2 and other serum biomarkers in STEMI patients undergoing primary percutaneous coronary intervention (PCI.Consecutive all 323 patients with STEMI that underwent primary PCI were enrolled. Blood tests and samples were obtained in an emergency room. The primary endpoint was 1-year major adverse cardiovascular and cerebrovascular events (MACCEs, defined as a composite of cardiovascular death, non-fatal MI, non-fatal stroke, and ischemia-driven revascularization.Mean age was 59.1±13.1 years (men 84%. MACCE (20 cardiovascular deaths, 7 non-fatal MI, 4 non-fatal stroke, 7 ischemia-driven revascularizations occurred in 38 patients (12%. After adjusting for confounding factors, Cox regression analysis revealed that high serum sST2 (>75.8 ng/mL mean value, adjusted hazard ratio 2.098, 95% CI 1.008-4.367, p = 0.048 and high serum NT-proBNP level (>400 pg/mL, adjusted hazard ratio 2.606, 95% CI 1.086-6.257, p = 0.032 at the time of presentation independently predicted MACCE within a year of primary PCI. Furthermore, when high serum sST2 level was combined with high serum NT-proBNP level, the hazard ratio of MACCE was highest (adjusted hazard ratio 7.93, 95% CI 2.97-20.38, p<0.001.Elevated serum levels of sST2 or NT-proBNP at the time of presentation were found to predict 1-year MACCE independently and elevated serum levels of sST2 plus NT-proBNP were associated with even poorer prognosis in patients with STEMI undergoing primary PCI.

Isoform-specific regulation of osteogenic factors by polypeptide N-Acetylgalactosaminyltransferases 1 and 4

International Nuclear Information System (INIS)

Tang, Juan; Zheng, Hanxi; Chen, Ling; Gao, Shangshang; Shi, Xiaorui; Liu, Jingjing; Xu, Lan

2017-01-01

The family of UDP-GalNAc polypeptide: N-Acetylgalactosaminlytransfersases (ppGalNAcTs) catalyzes the initial step of O-linked protein glycosylation. Mucin-type O-glycoproteins are abundant in the bone and may play an important role in osteogenesis. Herein, we examined the effects of ppGalNAc-T isoforms on osteogenesis of MC3T3-E1 pre-osteoblasts. We found that ppGalNAc-T1 and -T4 isoforms were highly expressed during osteogenesis of MC3T3-E1 and their knockdown by short hairpin RNA (shRNA) decreased osteoblast formation and bone mineralization. Knockdown of ppGalNAc-T1 or -T4 decreased mRNA and protein levels of bone sialoprotein (BSP). Knockdown of ppGalNAc-T1decreased mRNA levels of osteocalcin (OC), osteoprotegerin (OPG). Knockdown ofppGalNAc-T4 isoform decreased mRNA levels of OC, OPG and vitamin D receptor (VDR). While knockdown of T1 or T4 isoforms did not change the expression of osteopontin (OPN), COLLI, receptor activator for nuclear factor-κB ligand (RANKL) and transforming growth factor-β (TGF-β). Our results demonstrated that the ppGalNAc-T4 was highly expressed in MC3T3-E1 cells during osteogenesis for the first time. We also found that ppGalNAc-T1 and -T4 affected the expression of different osteogenic factors, suggesting distinct roles ppGalNAc-T isoformsplay in regulating osteogenesis in vitro. - Highlights: • ppGalNAc-T1 and T4 are highly expressed during MC3T3 cell osteogenesis. • Knockdown of ppGalNAc-T1 and -T4 decreases osteogenic differentiation and mineralization. • Expression of osteogenic factors are differentially affected by decreased ppGalNAc-T1 and -T4 expression.

Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors

Directory of Open Access Journals (Sweden)

Kruithof Egbert KO

2004-08-01

Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained

Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

Science.gov (United States)

Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

2018-01-01

Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

TNF-α receptor 1 knockdown in the subfornical organ ameliorates sympathetic excitation and cardiac hemodynamics in heart failure rats.

Science.gov (United States)

Yu, Yang; Wei, Shun-Guang; Weiss, Robert M; Felder, Robert B

2017-10-01

In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ that lacks an effective blood-brain barrier and senses circulating humors. We hypothesized that the tumor necrosis factor-α (TNF-α) receptor 1 (TNFR1) in the SFO contributes to sympathetic excitation and cardiac dysfunction in HF rats. Rats received SFO microinjections of a TNFR1 shRNA or a scrambled shRNA lentiviral vector carrying green fluorescent protein, or vehicle. One week later, some rats were euthanized to confirm the accuracy of the SFO microinjections and the transfection potential of the lentiviral vector. Other rats underwent coronary artery ligation (CL) to induce HF or a sham operation. Four weeks after CL, vehicle- and scrambled shRNA-treated HF rats had significant increases in TNFR1 mRNA and protein, NF-κB activity, and mRNA for inflammatory mediators, RAS components and c-Fos protein in the SFO and downstream in the hypothalamic paraventricular nucleus, along with increased plasma norepinephrine levels and impaired cardiac function, compared with vehicle-treated sham-operated rats. In HF rats treated with TNFR1 shRNA, TNFR1 was reduced in the SFO but not paraventricular nucleus, and the central and peripheral manifestations of HF were ameliorated. In sham-operated rats treated with TNFR1 shRNA, TNFR1 expression was also reduced in the SFO but there were no other effects. These results suggest a key role for TNFR1 in the SFO in the pathophysiology of systolic HF. NEW & NOTEWORTHY Activation of TNF-α receptor 1 in the subfornical organ (SFO) contributes to sympathetic excitation in heart failure rats by increasing inflammation and renin-angiotensin system activity in the SFO and downstream in the hypothalamic

Heritable and lineage-specific gene knockdown in zebrafish embryo.

Directory of Open Access Journals (Sweden)

Mei Dong

Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.

Neuropilin-1 interacts with the second branchial arch microenvironment to mediate chick neural crest cell dynamics

Science.gov (United States)

McLennan, Rebecca; Kulesa, Paul M.

2011-01-01

Cranial neural crest cells (NCCs) require neuropilin signaling to reach and invade the branchial arches. Here, we use an in vivo chick model to investigate whether the neuropilin-1 knockdown phenotype is specific to the second branchial arch (ba2), changes in NCC behaviors and phenotypic consequences, and whether neuropilins work together to facilitate entry into and invasion of ba2. We find that cranial NCCs with reduced neuropilin-1 expression displayed shorter protrusions and decreased cell body and nuclear length-to-width ratios characteristic of a loss in polarity and motility, after specific interaction with ba2. Directed NCC migration was rescued by transplantation of transfected cells into rhombomere 4 of younger hosts. Lastly, reduction of neuropilin-2 expression by shRNA either solely or with reduction of neuropilin-1 expression did not lead to a stronger head phenotype. Thus, NCCs, independent of rhombomere origin, require neuropilin-1, but not neuropilin-2 to maintain polarity and directed migration into ba2. PMID:20503363

RNAi-mediated downregulation of oral cancer overexpressed 1 (ORAOV1) inhibits vascular endothelial cell proliferation, migration, invasion, and tube formation.

Science.gov (United States)

Zhao, Xin; Liu, Dongjuan; Wang, Lili; Wu, Ruiqing; Zeng, Xin; Dan, Hongxia; Ji, Ning; Jiang, Lu; Zhou, Yu; Chen, Qianming

2016-04-01

Oral squamous cell carcinoma (OSCC) is one of the top ten tumors threatening human health. Oral cancer overexpressed 1 (ORAOV1) identified within chromosomal region 11q13, one of the most frequently amplified regions in OSCC, has been suggested as a novel candidate oncogene in OSCC, regulating cell cycle, apoptosis, and angiogenesis. In this study, we investigated the role of ORAOV1 in OSCC-induced angiogenesis in vitro. EA.hy926 human endothelial cells were co-cultured with OSCC cells (HSC-3 and SCC-25) transfected with ORAOV1-specific shRNA to downregulate ORAOV1 expression, and analyzed for proliferation, migration, invasion, and tube formation by specific assays. EA.hy926 endothelial cells co-cultured with ORAOV1-deficient OSCC cells exhibited significantly lower proliferation, migration, and invasion, as well as the activity in tube formation compared to that in the control cells. Our results show, for the first time, that ORAOV1 expressed by OSCC cells promotes tube formation by endothelial cells, indicating its involvement in OSCC angiogenesis. Considering the importance of neovascularization in tumor development and metastasis, these findings suggest that targeting ORAOV1 may be a potential therapeutic strategy against OSCC. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Dual oxidase maturation factor 1 (DUOXA1) overexpression increases reactive oxygen species production and inhibits murine muscle satellite cell differentiation.

Science.gov (United States)

Sandiford, Shelley D E; Kennedy, Karen A M; Xie, Xiaojun; Pickering, J Geoffrey; Li, Shawn S C

2014-01-11

Dual oxidase maturation factor 1 (DUOXA1) has been associated with the maturation of the reactive oxygen species (ROS) producing enzyme, dual oxidase 1 (DUOX1) in the adult thyroid. However, ROS have also been implicated in the development of several tissues. We found that activated muscle satellite cells and primary myoblasts isolated from mice express robust levels of DUOXA1 and that its levels are altered as cells differentiate. To determine whether DUOXA1 levels affect muscle differentiation, we used an adenoviral construct (pCMV5-DUOXA1-GFP) to drive constitutive overexpression of this protein in primary myoblasts. High levels of DUOXA1 throughout myogenesis resulted in enhanced H2O2 production, fusion defects, reduced expression of early (myogenin) and late (myosin heavy chain) markers of differentiation, and elevated levels of apoptosis compared to control cells infected with an empty adenoviral vector (pCMV5-GFP). DUOXA1 knockdown (using a DUOXA1 shRNA construct) resulted in enhanced differentiation compared to cells subjected to a control shRNA, and subjecting DUOXA1 overexpressing cells to siRNAs targeting DUOX1 or apoptosis signal-regulating kinase 1 (ASK1) rescued the phenotype. This study represents the first to demonstrate the importance of DUOXA1 in skeletal muscle myoblasts and that DUOXA1 overexpression in muscle stem cells induces apoptosis and inhibits differentiation through DUOX1 and ASK1.

JNK1 protects against glucolipotoxicity-mediated beta-cell apoptosis

DEFF Research Database (Denmark)

Prause, Michala; Christensen, Dan Ploug; Billestrup, Nils

2014-01-01

Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity. Endoplas......Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity....... Endoplasmic reticulum (ER) and oxidative stress are elicited by palmitate and high glucose concentrations further potentiating JNK activity. Our aim was to determine the role of the JNK subtypes JNK1, JNK2 and JNK3 in palmitate and high glucose-induced β-cell apoptosis. We established insulin-producing INS1...... INS1 cells showed increased apoptosis and cleaved caspase 9 and 3 compared to non-sense shRNA expressing control INS1 cells when exposed to palmitate and high glucose associated with increased CHOP expression, ROS formation and Puma mRNA expression. JNK2 shRNA expressing INS1 cells did not affect...

Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

2012-01-01

Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

Science.gov (United States)

Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

2018-01-01

The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effect of acid-sensing ion channel 1a on the process of liver fibrosis under hyperglycemia

International Nuclear Information System (INIS)

Wang, Huan; Wang, Ying-hong; Yang, Feng; Li, Xiao-feng; Tian, Yuan-yao; Ni, Ming-ming; Zuo, Long-quan; Meng, Xiao-Ming; Huang, Yan

2015-01-01

Metabolic syndrome characterized by hyperglycemia contributes to nonalcoholic steatohepatitis-associated liver fibrosis. This study was to investigate the effects of Acid-sensing ion Channel 1a (ASIC1a) on the process of liver fibrosis under hyperglycemia. Results showed that high glucose significantly worsen the pathology of liver fibrosis in vivo. In vitro, high glucose stimulated proliferation, activation and extracellular matrix (ECM) production in HSCs, and enhanced the effect of PDGF-BB on the activation and proliferation of HSCs. These effects could be attenuated by ASIC1a specific inhibitor Psalmotoxin-1(PcTx1) or specific ShRNA for ASIC1a through Notch1/Hes-1 pathways. These data indicate that ASIC1a plays an important role in diabetes complication liver fibrosis. - Highlights: • Hyperglycemia is a risk factor for the process of liver fibrosis. • ASIC1a may be a key factor linking between high glucose and liver fibrosis. • Notch1/Hes-1 may involve to the process of liver fibrosis under hyperglycemia.

Effect of acid-sensing ion channel 1a on the process of liver fibrosis under hyperglycemia

Energy Technology Data Exchange (ETDEWEB)

Wang, Huan, E-mail: wanghuan7@126.com [School of Pharmacy, Anhui Medical University, Hefei, 230032 (China); Institute for Liver Diseases of Anhui Medical University (AMU), Anhui Medical University, Hefei, 230032 (China); Wang, Ying-hong; Yang, Feng; Li, Xiao-feng; Tian, Yuan-yao; Ni, Ming-ming; Zuo, Long-quan; Meng, Xiao-Ming [School of Pharmacy, Anhui Medical University, Hefei, 230032 (China); Institute for Liver Diseases of Anhui Medical University (AMU), Anhui Medical University, Hefei, 230032 (China); Huang, Yan, E-mail: aydhy@126.com [School of Pharmacy, Anhui Medical University, Hefei, 230032 (China); Institute for Liver Diseases of Anhui Medical University (AMU), Anhui Medical University, Hefei, 230032 (China)

2015-12-25

Metabolic syndrome characterized by hyperglycemia contributes to nonalcoholic steatohepatitis-associated liver fibrosis. This study was to investigate the effects of Acid-sensing ion Channel 1a (ASIC1a) on the process of liver fibrosis under hyperglycemia. Results showed that high glucose significantly worsen the pathology of liver fibrosis in vivo. In vitro, high glucose stimulated proliferation, activation and extracellular matrix (ECM) production in HSCs, and enhanced the effect of PDGF-BB on the activation and proliferation of HSCs. These effects could be attenuated by ASIC1a specific inhibitor Psalmotoxin-1(PcTx1) or specific ShRNA for ASIC1a through Notch1/Hes-1 pathways. These data indicate that ASIC1a plays an important role in diabetes complication liver fibrosis. - Highlights: • Hyperglycemia is a risk factor for the process of liver fibrosis. • ASIC1a may be a key factor linking between high glucose and liver fibrosis. • Notch1/Hes-1 may involve to the process of liver fibrosis under hyperglycemia.

PD-L1-specific T cells

DEFF Research Database (Denmark)

Ahmad, Shamaila Munir; Borch, Troels Holz; Hansen, Morten

2016-01-01

-specific T cells that recognize both PD-L1-expressing immune cells and malignant cells. Thus, PD-L1-specific T cells have the ability to modulate adaptive immune reactions by reacting to regulatory cells. Thus, utilization of PD-L1-derived T cell epitopes may represent an attractive vaccination strategy...... for targeting the tumor microenvironment and for boosting the clinical effects of additional anticancer immunotherapy. This review summarizes present information about PD-L1 as a T cell antigen, depicts the initial findings about the function of PD-L1-specific T cells in the adjustment of immune responses...

11 CFR 1.14 - Specific exemptions.

Science.gov (United States)

2010-01-01

... to refer apparent violations of the Act to the Attorney General or other law enforcement authorities... 11 Federal Elections 1 2010-01-01 2010-01-01 false Specific exemptions. 1.14 Section 1.14 Federal Elections FEDERAL ELECTION COMMISSION PRIVACY ACT § 1.14 Specific exemptions. (a) No individual, under the...

Effects of short-hairpin RNA-inhibited {beta}-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo

Energy Technology Data Exchange (ETDEWEB)

Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)

2012-06-15

Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.

Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

Science.gov (United States)

Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

2011-11-10

Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

International Nuclear Information System (INIS)

Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

2010-01-01

Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

Inhibition of histone deacetylases 1 and 6 enhances cytarabine-induced apoptosis in pediatric acute myeloid leukemia cells.

Science.gov (United States)

Xu, Xuelian; Xie, Chengzhi; Edwards, Holly; Zhou, Hui; Buck, Steven A; Ge, Yubin

2011-02-16

Pediatric acute myeloid leukemia (AML) remains a challenging disease to treat even with intensified cytarabine-based chemotherapy. Histone deacetylases (HDACs) have been reported to be promising therapeutic targets for treating AML. However, HDAC family members that are involved in chemotherapy sensitivities remain unknown. In this study, we sought to identify members of the HDAC family that are involved in cytarabine sensitivities, and to select the optimal HDACI that is most efficacious when combined with cytarabine for treating children with AML. Expression profiles of classes I, II, and IV HDACs in 4 pediatric AML cell lines were determined by Western blotting. Inhibition of class I HDACs by different HDACIs was measured post immnunoprecipitation. Individual down-regulation of HDACs in pediatric AML cells was performed with lentiviral shRNA. The effects of cytarabine and HDACIs on apoptosis were determined by flow cytometry analysis. Treatments with structurally diverse HDACIs and HDAC shRNA knockdown experiments revealed that down-regulation of both HDACs 1 and 6 is critical in enhancing cytarabine-induced apoptosis in pediatric AML, at least partly mediated by Bim. However, down-regulation of HDAC2 may negatively impact cytarabine sensitivities in the disease. At clinically achievable concentrations, HDACIs that simultaneously inhibited both HDACs 1 and 6 showed the best anti-leukemic activities and significantly enhanced cytarabine-induced apoptosis. Our results further confirm that HDACs are bona fide therapeutic targets for treating pediatric AML and suggest that pan-HDACIs may be more beneficial than isoform-specific drugs.

Synergistic effect of intervention of glypican-3 gene transcription combined with antitumor drugs in inhibiting hepatoma cell proliferation

Directory of Open Access Journals (Sweden)

YANG Jie

2016-12-01

.20 μmol/L, 7.85±2.00 nmol/L, and 18.36±0.56 μmol/L, respectively, and their combination with shRNA1 had an HepG2 cell inhibition rate of 95.11%. ConclusionIntervention of GPC3 gene transcription with specific shRNA can inhibit hepatoma cell proliferation, migration and movement, and invasion ability, induce hepatoma cell apoptosis, and inhibit hepatoma cell proliferation when combined with antitumor drugs in a synergistic manner. This suggests that GPC3 may be an effective therapeutic target for liver cancer and that combined targeted therapy can provide better strategies for the treatment of liver cancer.

Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

Directory of Open Access Journals (Sweden)

Monika Stimac

Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

Science.gov (United States)

Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

2015-01-01

Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

IDC System Specification Document Version 1.1.

Energy Technology Data Exchange (ETDEWEB)

Harris, James M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lober, Randall R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2015-02-01

This document contains the system specifications derived to satisfy the system requirements found in the IDC System Requirements Document for the IDC Reengineering Phase 2 project. Revisions Version Date Author/Team Revision Description Authorized by V1.0 12/2014 IDC Reengineering Project Team Initial delivery M. Harris V1.1 2/2015 IDC Reengineering Project Team Iteration I2 Review Comments M. Harris

Establishment and Evaluation of Stable Cell Lines Inhibiting Foot-and-Mouth Disease Virus by RNA Interference

Directory of Open Access Journals (Sweden)

Yuan-xing Gu

2014-01-01

Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.

RNA interference gene therapy in dominant retinitis pigmentosa and cone-rod dystrophy mouse models caused by GCAP1 mutations

Directory of Open Access Journals (Sweden)

Li eJiang

2014-04-01

Full Text Available RNA interference (RNAi knockdown is an efficacious therapeutic strategy for silencing genes causative for dominant retinal dystrophies. To test this, we used self-complementary (sc AAV2/8 vector to develop an RNAi-based therapy in two dominant retinal degeneration mouse models. The allele-specific model expresses transgenic bovine GCAP1(Y99C establishing a rapid RP-like phenotype, whereas the nonallele-specific model expresses mouse GCAP1(L151F producing a slowly progressing cone/rod dystrophy (CORD. The late onset GCAP1(L151F-CORD mimics the dystrophy observed in human GCAP1-CORD patients. Subretinal injection of scAAV2/8 carrying shRNA expression cassettes specific for bovine or mouse GCAP1 showed strong expression at one week post-injection. In both allele-specific (GCAP1(Y99C-RP and nonallele-specific (GCAP1(L151F-CORD models of dominant retinal dystrophy, RNAi-mediated gene silencing enhanced photoreceptor survival, delayed onset of degeneration and improved visual function. Such results provide a proof of concept toward effective RNAi-based gene therapy mediated by scAAV2/8 for dominant retinal disease based on GCAP1 mutation. Further, nonallele-specific RNAi knockdown of GCAP1 may prove generally applicable toward the rescue of any human GCAP1-based dominant cone-rod dystrophy.

ELANE mutant-specific activation of different UPR pathways in congenital neutropenia.

Science.gov (United States)

Nustede, Rainer; Klimiankou, Maksim; Klimenkova, Olga; Kuznetsova, Inna; Zeidler, Cornelia; Welte, Karl; Skokowa, Julia

2016-01-01

A number of studies have demonstrated induction of the unfolded protein response (UPR) in patients with severe congenital neutropenia (CN) harbouring mutations of ELANE, encoding neutrophil elastase. Why UPR is not activated in patients with cyclic neutropenia (CyN) carrying the same ELANE mutations is unclear. We evaluated the effects of ELANE mutants on UPR induction in myeloid cells from CN and CyN patients, and analysed whether additional CN-specific defects contribute to the differences in UPR induction between CN and CyN patients harbouring identical ELANE mutations. We investigated CN-specific p.C71R and p.V174_C181del (NP_001963.1) and CN/CyN-shared p.S126L (NP_001963.1) ELANE mutants. We found that transduction of haematopoietic cells with p.C71R, but not with p.V174_C181del or p.S126L ELANE mutants induced expression of ATF6, and the ATF6 target genes PPP1R15A, DDIT3 and HSPA5. Recently, we found that levels of secretory leucocyte protease inhibitor (SLPI), a natural ELANE inhibitor, are diminished in myeloid cells from CN patients, but not CyN patients. Combined knockdown of SLPI by shRNA and transduction of ELANE p.S126L in myeloid cells led to elevated levels of ATF6, PPP1R15A and HSPA5 RNA, suggesting that normal levels of SLPI in CyN patients might protect them from the UPR induced by mutant ELANE. In summary, different ELANE mutants have different effects on UPR activation, and SLPI regulates the extent of ELANE-triggered UPR. © 2015 John Wiley & Sons Ltd.

Loss of Selenium-Binding Protein 1 Decreases Sensitivity to Clastogens and Intracellular Selenium Content in HeLa Cells.

Science.gov (United States)

Zhao, Changhui; Zeng, Huawei; Wu, Ryan T Y; Cheng, Wen-Hsing

2016-01-01

Selenium-binding protein 1 (SBP1) is not a selenoprotein but structurally binds selenium. Loss of SBP1 during carcinogenesis usually predicts poor prognosis. Because genome instability is a hallmark of cancer, we hypothesize that SBP1 sequesters cellular selenium and sensitizes cancer cells to DNA-damaging agents. To test this hypothesis, we knocked down SBP1 expression in HeLa cervical cancer cells by employing a short hairpin RNA (shRNA) approach. Reduced sensitivity to hydrogen peroxide, paraquat and camptothecin, reactive oxygen species content, and intracellular retention of selenium after selenomethionine treatment were observed in SBP1 shRNA HeLa cells. Results from Western analyses showed that treatment of HeLa cells with selenomethionine resulted in increased SBP1 protein expression in a dose-dependent manner. Knockdown of SBP1 rendered HeLa cells increased expression of glutathione peroxidase-1 but not glutathione peroxidase-4 protein levels and accelerated migration from a wound. Altogether, SBP1 retains supplemental selenium and sensitizes HeLa cancer cells to clastogens, suggesting a new cancer treatment strategy by sequestering selenium through SBP1.

SYNTAX score based on coronary computed tomography angiography may have a prognostic value in patients with complex coronary artery disease: An observational study from a retrospective cohort.

Science.gov (United States)

Suh, Young Joo; Han, Kyunghwa; Chang, Suyon; Kim, Jin Young; Im, Dong Jin; Hong, Yoo Jin; Lee, Hye-Jeong; Hur, Jin; Kim, Young Jin; Choi, Byoung Wook

2017-09-01

The SYNergy between percutaneous coronary intervention with TAXus and cardiac surgery (SYNTAX) score is an invasive coronary angiography (ICA)-based score for quantifying the complexity of coronary artery disease (CAD). Although the SYNTAX score was originally developed based on ICA, recent publications have reported that coronary computed tomography angiography (CCTA) is a feasible modality for the estimation of the SYNTAX score.The aim of our study was to investigate the prognostic value of the SYNTAX score, based on CCTA for the prediction of major adverse cardiac and cerebrovascular events (MACCEs) in patients with complex CAD.The current study was approved by the institutional review board of our institution, and informed consent was waived for this retrospective cohort study. We included 251 patients (173 men, mean age 66.0 ± 9.29 years) who had complex CAD [3-vessel disease or left main (LM) disease] on CCTA. SYNTAX score was obtained on the basis of CCTA. Follow-up clinical outcome data regarding composite MACCEs were also obtained. Cox proportional hazards models were developed to predict the risk of MACCEs based on clinical variables, treatment, and computed tomography (CT)-SYNTAX scores.During the median follow-up period of 1517 days, there were 48 MACCEs. Univariate Cox hazards models demonstrated that MACCEs were associated with advanced age, low body mass index (BMI), and dyslipidemia (P < .2). In patients with LM disease, MACCEs were associated with a higher SYNTAX score. In patients with CT-SYNTAX score ≥23, patients who underwent coronary artery bypass graft surgery (CABG) and percutaneous coronary intervention had significantly lower hazard ratios than patients who were treated with medication alone. In multivariate Cox hazards model, advanced age, low BMI, and higher SYNTAX score showed an increased hazard ratio for MACCE, while treatment with CABG showed a lower hazard ratio (P < .2).On the basis of our results, CT-SYNTAX score

Developing a methodology for identifying correlations between LERF and early fatality

International Nuclear Information System (INIS)

Kang, Kyung Min; Jae, Moo Sung; Ahn, Kwang Il

2009-01-01

The correlations between Large Early Release Frequency (LERF) and Early Fatality need to be investigated for risk-informed application and regulation. In RG-1.174, there are decision-making criteria using the measures of CDF and LERF, while there are no specific criteria on LERF. Since there are both huge uncertainty and large cost need in off-site consequence calculation, a LERF assessment methodology need to be developed and its correlation factor needs to be identified for risk-informed decision-making. This regards, the robust method for estimating off-site consequence has been performed for assessing health effects caused by radioisotopes released from severe accidents of nuclear power plants. And also, MACCS2 code are used for validating source term quantitatively regarding health effects depending on release characteristics of radioisotopes during severe accidents has been performed. This study developed a method for identifying correlations between LERF and Early Fatality and validates the results of the model using MACCS2 code. The results of this study may contribute to defining LERF and finding a measure for risk-informed regulations and risk-informed decision making

Prognostic impact of alkaline phosphatase measured at time of presentation in patients undergoing primary percutaneous coronary intervention for ST-segment elevation myocardial infarction.

Directory of Open Access Journals (Sweden)

Pyung Chun Oh

Full Text Available Serum alkaline phosphatase (ALP has been shown to be a prognostic factor in several subgroups of patients due to its promotion of vascular calcification. However, the prognostic impact of serum ALP level in ST-segment elevation myocardial infarction (STEMI patients with a relatively low calcification burden has not been determined. We aimed to investigate the association of ALP level measured at time of presentation on clinical outcomes in patients with STEMI requiring primary percutaneous coronary intervention (PCI.A total of 1178 patients with STEMI undergoing primary PCI between 2007 and 2014 were retrospectively enrolled from the INTERSTELLAR registry and classified into tertiles by ALP level (83 IU/L. The primary study outcome was a major adverse cardiac or cerebrovascular event (MACCE, defined as the composite of all-cause death, non-fatal myocardial infarction, non-fatal stroke, and ischemia-driven revascularization.Median follow-up duration was 25 months (interquartile range, 10-39 months. The incidence of MACCE significantly increased as ALP level increased, that is, for the 83 IU/L tertiles incidences were 8.7%, 11.7%, and 15.7%, respectively; p for trend = 0.003. After adjustment for potential confounders, the adjusted hazard ratios for MACCE in the middle and highest tertiles were 1.69 (95% CI 1.01-2.81 and 2.46 (95% CI 1.48-4.09, respectively, as compared with the lowest ALP tertile.Elevated ALP level at presentation, but within the higher limit of normal, was found to be independently associated with higher risk of MACCE after primary PCI in patients with STEMI.

Yin Yang 1 Promotes Hepatic Gluconeogenesis Through Upregulation of Glucocorticoid Receptor

Science.gov (United States)

Lu, Yan; Xiong, Xuelian; Wang, Xiaolin; Zhang, Zhijian; Li, Jin; Shi, Guojun; Yang, Jian; Zhang, Huijie; Ning, Guang; Li, Xiaoying

2013-01-01

Gluconeogenesis is critical in maintaining blood glucose levels in a normal range during fasting. In this study, we investigated the role of Yin Yang 1 (YY1), a key transcription factor involved in cell proliferation and differentiation, in the regulation of hepatic gluconeogenesis. Our data showed that hepatic YY1 expression levels were induced in mice during fasting conditions and in a state of insulin resistance. Overexpression of YY1 in livers augmented gluconeogenesis, raising fasting blood glucose levels in C57BL/6 mice, whereas liver-specific ablation of YY1 using adenoviral shRNA ameliorated hyperglycemia in wild-type and diabetic db/db mice. At the molecular level, we further demonstrated that the major mechanism of YY1 in the regulation of hepatic glucose production is to modulate the expression of glucocorticoid receptor. Therefore, our study uncovered for the first time that YY1 participates in the regulation of hepatic gluconeogenesis, which implies that YY1 might serve as a potential therapeutic target for hyperglycemia in diabetes. PMID:23193188

DecoyFinder: an easy-to-use python GUI application for building target-specific decoy sets.

Science.gov (United States)

Cereto-Massagué, Adrià; Guasch, Laura; Valls, Cristina; Mulero, Miquel; Pujadas, Gerard; Garcia-Vallvé, Santiago

2012-06-15

Decoys are molecules that are presumed to be inactive against a target (i.e. will not likely bind to the target) and are used to validate the performance of molecular docking or a virtual screening workflow. The Directory of Useful Decoys database (http://dud.docking.org/) provides a free directory of decoys for use in virtual screening, though it only contains a limited set of decoys for 40 targets.To overcome this limitation, we have developed an application called DecoyFinder that selects, for a given collection of active ligands of a target, a set of decoys from a database of compounds. Decoys are selected if they are similar to active ligands according to five physical descriptors (molecular weight, number of rotational bonds, total hydrogen bond donors, total hydrogen bond acceptors and the octanol-water partition coefficient) without being chemically similar to any of the active ligands used as an input (according to the Tanimoto coefficient between MACCS fingerprints). To the best of our knowledge, DecoyFinder is the first application designed to build target-specific decoy sets. A complete description of the software is included on the application home page. A validation of DecoyFinder on 10 DUD targets is provided as Supplementary Table S1. DecoyFinder is freely available at http://URVnutrigenomica-CTNS.github.com/DecoyFinder.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

Science.gov (United States)

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

A revised global ozone dry deposition estimate based on a new two-layer parameterisation for air-sea exchange and the multi-year MACC composition reanalysis

Science.gov (United States)

Luhar, Ashok K.; Woodhouse, Matthew T.; Galbally, Ian E.

2018-03-01

Dry deposition at the Earth's surface is an important sink of atmospheric ozone. Currently, dry deposition of ozone to the ocean surface in atmospheric chemistry models has the largest uncertainty compared to deposition to other surface types, with implications for global tropospheric ozone budget and associated radiative forcing. Most global models assume that the dominant term of surface resistance in the parameterisation of ozone dry deposition velocity at the oceanic surface is constant. There have been recent mechanistic parameterisations for air-sea exchange that account for the simultaneous waterside processes of ozone solubility, molecular diffusion, turbulent transfer, and first-order chemical reaction of ozone with dissolved iodide and other compounds, but there are questions about their performance and consistency. We present a new two-layer parameterisation scheme for the oceanic surface resistance by making the following realistic assumptions: (a) the thickness of the top water layer is of the order of a reaction-diffusion length scale (a few micrometres) within which ozone loss is dominated by chemical reaction and the influence of waterside turbulent transfer is negligible; (b) in the water layer below, both chemical reaction and waterside turbulent transfer act together and are accounted for; and (c) chemical reactivity is present through the depth of the oceanic mixing layer. The new parameterisation has been evaluated against dry deposition velocities from recent open-ocean measurements. It is found that the inclusion of only the aqueous iodide-ozone reaction satisfactorily describes the measurements. In order to better quantify the global dry deposition loss and its interannual variability, modelled 3-hourly ozone deposition velocities are combined with the 3-hourly MACC (Monitoring Atmospheric Composition and Climate) reanalysis ozone for the years 2003-2012. The resulting ozone dry deposition is found to be 98.4 ± 30.0 Tg O3 yr-1 for the ocean

Inhibition of histone deacetylases 1 and 6 enhances cytarabine-induced apoptosis in pediatric acute myeloid leukemia cells.

Directory of Open Access Journals (Sweden)

Xuelian Xu

Full Text Available BACKGROUND: Pediatric acute myeloid leukemia (AML remains a challenging disease to treat even with intensified cytarabine-based chemotherapy. Histone deacetylases (HDACs have been reported to be promising therapeutic targets for treating AML. However, HDAC family members that are involved in chemotherapy sensitivities remain unknown. In this study, we sought to identify members of the HDAC family that are involved in cytarabine sensitivities, and to select the optimal HDACI that is most efficacious when combined with cytarabine for treating children with AML. METHODOLOGY: Expression profiles of classes I, II, and IV HDACs in 4 pediatric AML cell lines were determined by Western blotting. Inhibition of class I HDACs by different HDACIs was measured post immnunoprecipitation. Individual down-regulation of HDACs in pediatric AML cells was performed with lentiviral shRNA. The effects of cytarabine and HDACIs on apoptosis were determined by flow cytometry analysis. RESULTS: Treatments with structurally diverse HDACIs and HDAC shRNA knockdown experiments revealed that down-regulation of both HDACs 1 and 6 is critical in enhancing cytarabine-induced apoptosis in pediatric AML, at least partly mediated by Bim. However, down-regulation of HDAC2 may negatively impact cytarabine sensitivities in the disease. At clinically achievable concentrations, HDACIs that simultaneously inhibited both HDACs 1 and 6 showed the best anti-leukemic activities and significantly enhanced cytarabine-induced apoptosis. CONCLUSION: Our results further confirm that HDACs are bona fide therapeutic targets for treating pediatric AML and suggest that pan-HDACIs may be more beneficial than isoform-specific drugs.

Radionuclide behavior in the environment

International Nuclear Information System (INIS)

Tveten, U.

1991-09-01

The purpose of this report is to document the results of the following task: Review for quality and consistency the available data on measurements of initial ground contamination of Chernobyl radionuclides in various parts of Norway and subsequent concentrations of these radionuclides in various environmental media as functions of time. Utilize the data obtained to verify the existing models, or to improve them, for describing radionuclide behavior in the environment. Some of the processes standard were: migration into soil; weathering; resuspension; food-chain contamination; and loss or reconcentration by run-off. The task performed within this contract has been to use post-Chernobyl data from Norway to verify or find areas for possible improvement in the chronic exposure pathway models utilized in MACCS. Work has consisted mainly of collecting and evaluating post-Chernobyl information from Norway or other countries when relevant; but has also included experimental work performed specifically for the current task. In most connections the data available show the models and data in MACCS to be appropriate. A few areas where the data indicate that the MACCS approach is faulty or inadequate are, however, pointed out in the report. These should be examined carefully, and appropriate modifications should eventually be made. 14 refs., 12 figs., 22 tabs

A Large-Scale RNAi Screen Identifies SGK1 as a Key Survival Kinase for GBM Stem Cells.

Science.gov (United States)

Kulkarni, Shreya; Goel-Bhattacharya, Surbhi; Sengupta, Sejuti; Cochran, Brent H

2018-01-01

Glioblastoma multiforme (GBM) is the most common type of primary malignant brain cancer and has a very poor prognosis. A subpopulation of cells known as GBM stem-like cells (GBM-SC) have the capacity to initiate and sustain tumor growth and possess molecular characteristics similar to the parental tumor. GBM-SCs are known to be enriched in hypoxic niches and may contribute to therapeutic resistance. Therefore, to identify genetic determinants important for the proliferation and survival of GBM stem cells, an unbiased pooled shRNA screen of 10,000 genes was conducted under normoxic as well as hypoxic conditions. A number of essential genes were identified that are required for GBM-SC growth, under either or both oxygen conditions, in two different GBM-SC lines. Interestingly, only about a third of the essential genes were common to both cell lines. The oxygen environment significantly impacts the cellular genetic dependencies as 30% of the genes required under hypoxia were not required under normoxic conditions. In addition to identifying essential genes already implicated in GBM such as CDK4, KIF11 , and RAN , the screen also identified new genes that have not been previously implicated in GBM stem cell biology. The importance of the serum and glucocorticoid-regulated kinase 1 (SGK1) for cellular survival was validated in multiple patient-derived GBM stem cell lines using shRNA, CRISPR, and pharmacologic inhibitors. However, SGK1 depletion and inhibition has little effect on traditional serum grown glioma lines and on differentiated GBM-SCs indicating its specific importance in GBM stem cell survival. Implications: This study identifies genes required for the growth and survival of GBM stem cells under both normoxic and hypoxic conditions and finds SGK1 as a novel potential drug target for GBM. Mol Cancer Res; 16(1); 103-14. ©2017 AACR . ©2017 American Association for Cancer Research.

Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

Directory of Open Access Journals (Sweden)

John S Cho

2009-09-01

Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

Noxa/Mcl-1 Balance Regulates Susceptibility of Cells to Camptothecin-Induced Apoptosis1

Science.gov (United States)

Mei, Yide; Xie, Chongwei; Xie, Wei; Tian, Xu; Li, Mei; Wu, Mian

2007-01-01

Although camptothecin (CPT) has been reported to induce apoptosis in various cancer cells, the molecular details of this regulation remain largely unknown. In this study, we demonstrate that BH3-only protein Noxa is upregulated during CPT-induced apoptosis, which is independent of p53. In addition, we show that phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathway is responsible for Noxa's induction. Luciferase assay and cAMP response element binding protein (CREB) knockdown experiments further demonstrate that CREB is involved in the transcriptional upregulation of Noxa. Moreover, blocking Noxa expression using specific small interfering ribonucleic acid (siRNA) significantly reduces the apoptosis in response to CPT, indicating that Noxa is an essential mediator for CPT-induced apoptosis. Interestingly, antiapoptotic Mcl-1 was also upregulated through PI3K/Akt signaling pathway upon CPT treatment. Using immunoprecipitation assay, Noxa was found to interact with Mcl-1 in the presence or absence of CPT. Knockdown of Mcl-1 expression by short hairpin ribonucleic acid (shRNA) was shown to potentiate CPT-induced apoptosis. Consistently, ectopic overexpression of Mcl-1 rescued cells from apoptosis induced by CPT. Cells coexpressing Noxa and Mcl-1 at different ratio correlates well with the extent of apoptosis, suggesting that the balance between Noxa and Mcl-1 may determine the susceptibility of HeLa cells to CPT-induced apoptosis. PMID:17971907

CONSTRUCTION OF A CALIBRATED PROBABILISTIC CLASSIFICATION CATALOG: APPLICATION TO 50k VARIABLE SOURCES IN THE ALL-SKY AUTOMATED SURVEY

International Nuclear Information System (INIS)

Richards, Joseph W.; Starr, Dan L.; Miller, Adam A.; Bloom, Joshua S.; Brink, Henrik; Crellin-Quick, Arien; Butler, Nathaniel R.

2012-01-01

With growing data volumes from synoptic surveys, astronomers necessarily must become more abstracted from the discovery and introspection processes. Given the scarcity of follow-up resources, there is a particularly sharp onus on the frameworks that replace these human roles to provide accurate and well-calibrated probabilistic classification catalogs. Such catalogs inform the subsequent follow-up, allowing consumers to optimize the selection of specific sources for further study and permitting rigorous treatment of classification purities and efficiencies for population studies. Here, we describe a process to produce a probabilistic classification catalog of variability with machine learning from a multi-epoch photometric survey. In addition to producing accurate classifications, we show how to estimate calibrated class probabilities and motivate the importance of probability calibration. We also introduce a methodology for feature-based anomaly detection, which allows discovery of objects in the survey that do not fit within the predefined class taxonomy. Finally, we apply these methods to sources observed by the All-Sky Automated Survey (ASAS), and release the Machine-learned ASAS Classification Catalog (MACC), a 28 class probabilistic classification catalog of 50,124 ASAS sources in the ASAS Catalog of Variable Stars. We estimate that MACC achieves a sub-20% classification error rate and demonstrate that the class posterior probabilities are reasonably calibrated. MACC classifications compare favorably to the classifications of several previous domain-specific ASAS papers and to the ASAS Catalog of Variable Stars, which had classified only 24% of those sources into one of 12 science classes.

CONSTRUCTION OF A CALIBRATED PROBABILISTIC CLASSIFICATION CATALOG: APPLICATION TO 50k VARIABLE SOURCES IN THE ALL-SKY AUTOMATED SURVEY

Energy Technology Data Exchange (ETDEWEB)

Richards, Joseph W.; Starr, Dan L.; Miller, Adam A.; Bloom, Joshua S.; Brink, Henrik; Crellin-Quick, Arien [Astronomy Department, University of California, Berkeley, CA 94720-3411 (United States); Butler, Nathaniel R., E-mail: jwrichar@stat.berkeley.edu [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States)

2012-12-15

With growing data volumes from synoptic surveys, astronomers necessarily must become more abstracted from the discovery and introspection processes. Given the scarcity of follow-up resources, there is a particularly sharp onus on the frameworks that replace these human roles to provide accurate and well-calibrated probabilistic classification catalogs. Such catalogs inform the subsequent follow-up, allowing consumers to optimize the selection of specific sources for further study and permitting rigorous treatment of classification purities and efficiencies for population studies. Here, we describe a process to produce a probabilistic classification catalog of variability with machine learning from a multi-epoch photometric survey. In addition to producing accurate classifications, we show how to estimate calibrated class probabilities and motivate the importance of probability calibration. We also introduce a methodology for feature-based anomaly detection, which allows discovery of objects in the survey that do not fit within the predefined class taxonomy. Finally, we apply these methods to sources observed by the All-Sky Automated Survey (ASAS), and release the Machine-learned ASAS Classification Catalog (MACC), a 28 class probabilistic classification catalog of 50,124 ASAS sources in the ASAS Catalog of Variable Stars. We estimate that MACC achieves a sub-20% classification error rate and demonstrate that the class posterior probabilities are reasonably calibrated. MACC classifications compare favorably to the classifications of several previous domain-specific ASAS papers and to the ASAS Catalog of Variable Stars, which had classified only 24% of those sources into one of 12 science classes.

Impact of the components of Mediterranean nutrition regimen on long-term prognosis of diabetic patients with coronary artery disease

Directory of Open Access Journals (Sweden)

Soheila Mosharraf

2013-11-01

Full Text Available BACKGROUND: The impact of different nutritional regimens on long-term prognosis and outcome in diabetic patients with coronary artery disease (CAD has been questioned. Therefore, the objective of the present study was to determine the effects of different nutritional components of Mediterranean regimen on long-term cardiovascular events in diabetic patients with CAD in the Iranian population. METHODS: In a prospective cohort study, we recruited 233 consecutive patients with the diagnosis of type 2 diabetes mellitus and with at least 6 months of documented CAD. Nutritional assessment was obtained by a validated semi-quantitative food frequency questionnaire (FFQ and the diet score was calculated on the basis of the Mediterranean diet quality index (Med-DQI. For Assessing long-term CAD prognosis, the patients were followed by telephone for one year. The study endpoint was long-term major adverse cardiac and cerebrovascular event (MACCE. RESULTS: Death was observed in 19 patients (8.2% during the one-year follow-up. Two patients (0.9% suffered non-fatal myocardial infarction and 14 (6.0% needed revascularization within 1 year after discharge from hospital. Overall MACCE within one year in the study population was 12.4%. There were significant differences between number of deaths and dietary scores of saturated fatty acid, cholesterol, meats, fish, and fruit and vegetables (P < 0.05. Moreover, significant differences were found between MACCE rate and dietary scores of saturated fatty acid, cholesterol, and fruit and vegetables (P < 0.05. Using multivariate logistic regression models, Mediterranean dietary regimen could effectively predict long-term death as well as MACCE adjusted for gender and age variables. CONCLUSION: Mediterranean dietary regimens, including low level of cholesterol and saturated fatty acid, can effectively improve long-term outcome including death and MACCE in diabetic patients with CAD.   Keywords: Diabetes Mellitus, Coronary

Marginal abatement cost curve for NOx incorporating controls, renewable electricity, energy efficiency and fuel switching

Science.gov (United States)

A marginal abatement cost curve (MACC) traces out the relationship between the quantity of pollution abated and the marginal cost of abating each additional unit. In the context of air quality management, MACCs typically are developed by sorting end-of-pipe controls by their resp...

Marginal abatement cost curves for NOx that account for renewable electricity, energy efficiency, and fuel switching

Science.gov (United States)

A marginal abatement cost curve (MACC) traces out the relationship between the quantity of pollution abated and the marginal cost of abating each additional unit. In the context of air quality management, MACCs typically are developed by sorting end-of-pipe controls by their resp...

Marginal abatement cost curve for NOx incorporating controls, renewable electricity, energy efficiency and fuel switching

Science.gov (United States)

A marginal abatement cost curve (MACC) traces out the relationship between the quantity of pollution abated and the marginal cost of abating each additional unit. In the context of air quality management, MACCs typically are developed by sorting end-of-pipe controls by their rela...

Regional and sectoral marginal abatement cost curves for NOx incorporating controls, renewable electricity, energy efficiency and fuel switching

Science.gov (United States)

A marginal abatement cost curve (MACC) traces out the relationship between the quantity of pollution abated and the marginal cost of abating each additional unit. In the context of air quality management, MACCs typically are developed by sorting end-of-pipe controls by their resp...

Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

Science.gov (United States)

Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

2016-11-22

Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

Study on the code system for the off-site consequences assessment of severe nuclear accident

Energy Technology Data Exchange (ETDEWEB)

Kim, Sora; Mn, Byung Il; Park, Ki Hyun; Yang, Byung Mo; Suh, Kyung Suk [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2016-12-15

The importance of severe nuclear accidents and probabilistic safety assessment (PSA) were brought to international attention with the occurrence of severe nuclear accidents caused by the extreme natural disaster at Fukushima Daiichi nuclear power plant in Japan. In Korea, studies on level 3 PSA had made little progress until recently. The code systems of level 3 PSA, MACCS2 (MELCORE Accident Consequence Code System 2, US), COSYMA (COde SYstem from MAria, EU) and OSCAAR (Off-Site Consequence Analysis code for Atmospheric Releases in reactor accidents, JAPAN), were reviewed in this study, and the disadvantages and limitations of MACCS2 were also analyzed. Experts from Korea and abroad pointed out that the limitations of MACCS2 include the following: MACCS2 cannot simulate multi-unit accidents/release from spent fuel pools, and its atmospheric dispersion is based on a simple Gaussian plume model. Some of these limitations have been improved in the updated versions of MACCS2. The absence of a marine and aquatic dispersion model and the limited simulating range of food-chain and economic models are also important aspects that need to be improved. This paper is expected to be utilized as basic research material for developing a Korean code system for assessing off-site consequences of severe nuclear accidents.

Study on the code system for the off-site consequences assessment of severe nuclear accident

International Nuclear Information System (INIS)

Kim, Sora; Mn, Byung Il; Park, Ki Hyun; Yang, Byung Mo; Suh, Kyung Suk

2016-01-01

The importance of severe nuclear accidents and probabilistic safety assessment (PSA) were brought to international attention with the occurrence of severe nuclear accidents caused by the extreme natural disaster at Fukushima Daiichi nuclear power plant in Japan. In Korea, studies on level 3 PSA had made little progress until recently. The code systems of level 3 PSA, MACCS2 (MELCORE Accident Consequence Code System 2, US), COSYMA (COde SYstem from MAria, EU) and OSCAAR (Off-Site Consequence Analysis code for Atmospheric Releases in reactor accidents, JAPAN), were reviewed in this study, and the disadvantages and limitations of MACCS2 were also analyzed. Experts from Korea and abroad pointed out that the limitations of MACCS2 include the following: MACCS2 cannot simulate multi-unit accidents/release from spent fuel pools, and its atmospheric dispersion is based on a simple Gaussian plume model. Some of these limitations have been improved in the updated versions of MACCS2. The absence of a marine and aquatic dispersion model and the limited simulating range of food-chain and economic models are also important aspects that need to be improved. This paper is expected to be utilized as basic research material for developing a Korean code system for assessing off-site consequences of severe nuclear accidents

Up-Regulation of Follistatin-Like 1 By the Androgen Receptor and Melanoma Antigen-A11 in Prostate Cancer.

Science.gov (United States)

Su, Shifeng; Parris, Amanda B; Grossman, Gail; Mohler, James L; Wang, Zengjun; Wilson, Elizabeth M

2017-04-01

High affinity androgen binding to the androgen receptor (AR) activates genes required for male sex differentiation and promotes the development and progression of prostate cancer. Human AR transcriptional activity involves interactions with coregulatory proteins that include primate-specific melanoma antigen-A11 (MAGE-A11), a coactivator that increases AR transcriptional activity during prostate cancer progression to castration-resistant/recurrent prostate cancer (CRPC). Microarray analysis and quantitative RT-PCR were performed to identify androgen-regulated MAGE-A11-dependent genes in LAPC-4 prostate cancer cells after lentivirus shRNA knockdown of MAGE-A11. Chromatin immunoprecipitation was used to assess androgen-dependent AR recruitment, and immunocytochemistry to localize an androgen-dependent protein in prostate cancer cells and tissue and in the CWR22 human prostate cancer xenograft. Microarray analysis of androgen-treated LAPC-4 prostate cancer cells indicated follistatin-like 1 (FSTL1) is up-regulated by MAGE-A11. Androgen-dependent up-regulation of FSTL1 was inhibited in LAPC-4 cells by lentivirus shRNA knockdown of AR or MAGE-A11. Chromatin immunoprecipitation demonstrated AR recruitment to intron 10 of the FSTL1 gene that contains a classical consensus androgen response element. Increased levels of FSTL1 protein in LAPC-4 cells correlated with higher levels of MAGE-A11 relative to other prostate cancer cells. FSTL1 mRNA levels increased in CRPC and castration-recurrent CWR22 xenografts in association with predominantly nuclear FSTL1. Increased nuclear localization of FSTL1 in prostate cancer was suggested by predominantly cytoplasmic FSTL1 in benign prostate epithelial cells and predominantly nuclear FSTL1 in epithelial cells in CRPC tissue and the castration-recurrent CWR22 xenograft. AR expression studies showed nuclear colocalization of AR and endogenous FSTL1 in response to androgen. AR and MAGE-A11 cooperate in the up-regulation of FSTL1 to

Probabilistic accident consequence uncertainty analysis -- Late health effects uncertain assessment. Volume 2: Appendices

Energy Technology Data Exchange (ETDEWEB)

Little, M.P.; Muirhead, C.R. [National Radiological Protection Board (United Kingdom); Goossens, L.H.J.; Kraan, B.C.P.; Cooke, R.M. [Delft Univ. of Technology (Netherlands); Harper, F.T. [Sandia National Labs., Albuquerque, NM (United States); Hora, S.C. [Univ. of Hawaii, Hilo, HI (United States)

1997-12-01

The development of two new probabilistic accident consequence codes, MACCS and COSYMA, was completed in 1990. These codes estimate the consequence from the accidental releases of radiological material from hypothesized accidents at nuclear installations. In 1991, the US Nuclear Regulatory Commission and the Commission of the European Communities began cosponsoring a joint uncertainty analysis of the two codes. The ultimate objective of this joint effort was to systematically develop credible and traceable uncertainty distributions for the respective code input variables. A formal expert judgment elicitation and evaluation process was identified as the best technology available for developing a library of uncertainty distributions for these consequence parameters. This report focuses on the results of the study to develop distribution for variables related to the MACCS and COSYMA late health effects models. This volume contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures, (3) the rationales and results for the expert panel on late health effects, (4) short biographies of the experts, and (5) the aggregated results of their responses.

Probabilistic accident consequence uncertainty analysis -- Uncertainty assessment for deposited material and external doses. Volume 2: Appendices

Energy Technology Data Exchange (ETDEWEB)

Goossens, L.H.J.; Kraan, B.C.P.; Cooke, R.M. [Delft Univ. of Technology (Netherlands); Boardman, J. [AEA Technology (United Kingdom); Jones, J.A. [National Radiological Protection Board (United Kingdom); Harper, F.T.; Young, M.L. [Sandia National Labs., Albuquerque, NM (United States); Hora, S.C. [Univ. of Hawaii, Hilo, HI (United States)

1997-12-01

The development of two new probabilistic accident consequence codes, MACCS and COSYMA, was completed in 1990. These codes estimate the consequence from the accidental releases of radiological material from hypothesized accidents at nuclear installations. In 1991, the US Nuclear Regulatory Commission and the Commission of the European Communities began cosponsoring a joint uncertainty analysis of the two codes. The ultimate objective of this joint effort was to systematically develop credible and traceable uncertainty distributions for the respective code input variables. A formal expert judgment elicitation and evaluation process was identified as the best technology available for developing a library of uncertainty distributions for these consequence parameters. This report focuses on the results of the study to develop distribution for variables related to the MACCS and COSYMA deposited material and external dose models. This volume contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures, (3) the rationales and results for the panel on deposited material and external doses, (4) short biographies of the experts, and (5) the aggregated results of their responses.

Probabilistic accident consequence uncertainty analysis -- Early health effects uncertainty assessment. Volume 2: Appendices

Energy Technology Data Exchange (ETDEWEB)

Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States); Harper, F.T. [Sandia National Labs., Albuquerque, NM (United States); Goossens, L.H.J.; Kraan, B.C.P. [Delft Univ. of Technology (Netherlands)

1997-12-01

The development of two new probabilistic accident consequence codes, MACCS and COSYMA, was completed in 1990. These codes estimate the consequence from the accidental releases of radiological material from hypothesized accidents at nuclear installations. In 1991, the US Nuclear Regulatory Commission and the Commission of the European Communities began cosponsoring a joint uncertainty analysis of the two codes. The ultimate objective of this joint effort was to systematically develop credible and traceable uncertainty distributions for the respective code input variables. A formal expert judgment elicitation and evaluation process was identified as the best technology available for developing a library of uncertainty distributions for these consequence parameters. This report focuses on the results of the study to develop distribution for variables related to the MACCS and COSYMA early health effects models. This volume contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures, (3) the rationales and results for the panel on early health effects, (4) short biographies of the experts, and (5) the aggregated results of their responses.

Probabilistic accident consequence uncertainty analysis -- Uncertainty assessment for internal dosimetry. Volume 2: Appendices

Energy Technology Data Exchange (ETDEWEB)

Goossens, L.H.J.; Kraan, B.C.P.; Cooke, R.M. [Delft Univ. of Technology (Netherlands); Harrison, J.D. [National Radiological Protection Board (United Kingdom); Harper, F.T. [Sandia National Labs., Albuquerque, NM (United States); Hora, S.C. [Univ. of Hawaii, Hilo, HI (United States)

1998-04-01

The development of two new probabilistic accident consequence codes, MACCS and COSYMA, was completed in 1990. These codes estimate the consequence from the accidental releases of radiological material from hypothesized accidents at nuclear installations. In 1991, the US Nuclear Regulatory Commission and the Commission of the European Communities began cosponsoring a joint uncertainty analysis of the two codes. The ultimate objective of this joint effort was to systematically develop credible and traceable uncertainty distributions for the respective code input variables. A formal expert judgment elicitation and evaluation process was identified as the best technology available for developing a library of uncertainty distributions for these consequence parameters. This report focuses on the results of the study to develop distribution for variables related to the MACCS and COSYMA internal dosimetry models. This volume contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures, (3) the rationales and results for the panel on internal dosimetry, (4) short biographies of the experts, and (5) the aggregated results of their responses.

Target-specific M1 inputs to infragranular S1 pyramidal neurons

Science.gov (United States)

Fanselow, Erika E.; Simons, Daniel J.

2016-01-01

The functional role of input from the primary motor cortex (M1) to primary somatosensory cortex (S1) is unclear; one key to understanding this pathway may lie in elucidating the cell-type specific microcircuits that connect S1 and M1. Recently, we discovered that a subset of pyramidal neurons in the infragranular layers of S1 receive especially strong input from M1 (Kinnischtzke AK, Simons DJ, Fanselow EE. Cereb Cortex 24: 2237–2248, 2014), suggesting that M1 may affect specific classes of pyramidal neurons differently. Here, using combined optogenetic and retrograde labeling approaches in the mouse, we examined the strengths of M1 inputs to five classes of infragranular S1 neurons categorized by their projections to particular cortical and subcortical targets. We found that the magnitude of M1 synaptic input to S1 pyramidal neurons varies greatly depending on the projection target of the postsynaptic neuron. Of the populations examined, M1-projecting corticocortical neurons in L6 received the strongest M1 inputs, whereas ventral posterior medial nucleus-projecting corticothalamic neurons, also located in L6, received the weakest. Each population also possessed distinct intrinsic properties. The results suggest that M1 differentially engages specific classes of S1 projection neurons, thereby regulating the motor-related influence S1 exerts over subcortical structures. PMID:27334960

HMGA1 silencing reduces stemness and temozolomide resistance in glioblastoma stem cells.

Science.gov (United States)

Colamaio, Marianna; Tosti, Nadia; Puca, Francesca; Mari, Alessia; Gattordo, Rosaria; Kuzay, Yalçın; Federico, Antonella; Pepe, Anna; Sarnataro, Daniela; Ragozzino, Elvira; Raia, Maddalena; Hirata, Hidenari; Gemei, Marica; Mimori, Koshi; Del Vecchio, Luigi; Battista, Sabrina; Fusco, Alfredo

2016-10-01

Glioblastoma multiforme (GBM) develops from a small subpopulation of stem-like cells, which are endowed with the ability to self-renew, proliferate and give rise to progeny of multiple neuroepithelial lineages. These cells are resistant to conventional chemo- and radiotherapy and are hence also responsible for tumor recurrence. HMGA1 overexpression has been shown to correlate with proliferation, invasion, and angiogenesis of GBMs and to affect self-renewal of cancer stem cells from colon cancer. The role of HMGA1 in GBM tumor stem cells is not completely understood. We have investigated the role of HMGA1 in brain tumor stem cell (BTSC) self-renewal, stemness and resistance to temozolomide by shRNA- mediated HMGA1 silencing. We first report that HMGA1 is overexpressed in a subset of BTSC lines from human GBMs. Then, we show that HMGA1 knockdown reduces self-renewal, sphere forming efficiency and stemness, and sensitizes BTSCs to temozolomide. Interestingly, HMGA1 silencing also leads to reduced tumor initiation ability in vivo. These results demonstrate a pivotal role of HMGA1 in cancer stem cell gliomagenesis and endorse HMGA1 as a suitable target for CSC-specific GBM therapy.

Marginal abatement cost curve for nitrogen oxides incorporating controls, renewable electricity, energy efficiency, and fuel switching.

Science.gov (United States)

Loughlin, Daniel H; Macpherson, Alexander J; Kaufman, Katherine R; Keaveny, Brian N

2017-10-01

A marginal abatement cost curve (MACC) traces out the relationship between the quantity of pollution abated and the marginal cost of abating each additional unit. In the context of air quality management, MACCs are typically developed by sorting control technologies by their relative cost-effectiveness. Other potentially important abatement measures such as renewable electricity, energy efficiency, and fuel switching (RE/EE/FS) are often not incorporated into MACCs, as it is difficult to quantify their costs and abatement potential. In this paper, a U.S. energy system model is used to develop a MACC for nitrogen oxides (NO x ) that incorporates both traditional controls and these additional measures. The MACC is decomposed by sector, and the relative cost-effectiveness of RE/EE/FS and traditional controls are compared. RE/EE/FS are shown to have the potential to increase emission reductions beyond what is possible when applying traditional controls alone. Furthermore, a portion of RE/EE/FS appear to be cost-competitive with traditional controls. Renewable electricity, energy efficiency, and fuel switching can be cost-competitive with traditional air pollutant controls for abating air pollutant emissions. The application of renewable electricity, energy efficiency, and fuel switching is also shown to have the potential to increase emission reductions beyond what is possible when applying traditional controls alone.

PRMT1-Mediated Translation Regulation is a Crucial Vulnerability of Cancer | Office of Cancer Genomics

Science.gov (United States)

Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control.

Standard technical specifications General Electric plants, BWR/6. Volume 1, Revision 1

International Nuclear Information System (INIS)

1995-04-01

This report documents the results of the combined effort of the NRC and the industry to produce improved Standard Technical Specifications (STS), Revision 1 for General Electric BWR/6 Plants. The changes reflected in Revision 1 resulted from the experience gained from license amendment applications to convert to these improved STS or to adopt partial improvements to existing technical specifications. This NUREG is the result of extensive public technical meetings and discussions between the Nuclear Regulatory Commission (NRC) staff and various nuclear power plant licensees, Nuclear Steam Supply System (NSSS) Owners Groups, NSSS vendors, and the Nuclear Energy Institute (NEI). The improved STS were developed based on the criteria in the Final Commission Policy Statement on Technical Specifications Improvements for Nuclear Power Reactors, dated July 22, 1993. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. Volume 3 contains the Bases for Sections 3.4--3.10 of the improved STS

Von Hippel-Lindau tumor suppressor gene loss in renal cell carcinoma promotes oncogenic epidermal growth factor receptor signaling via Akt-1 and MEK-1.

Science.gov (United States)

Lee, S Justin; Lattouf, Jean-Baptiste; Xanthopoulos, Julie; Linehan, W Marston; Bottaro, Donald P; Vasselli, James R

2008-10-01

Clear-cell renal cell carcinoma (RCC) is the most prevalent form of kidney cancer and is frequently associated with loss of von Hippel-Lindau (VHL) gene function, resulting in the aberrant transcriptional activation of genes that contribute to tumor growth and metastasis, including transforming growth factor-alpha (TGF-alpha), a ligand of the epidermal growth factor receptor (EGFR) tyrosine kinase. To determine the functional impact of EGFR activation on RCC, we suppressed critical components of this pathway: EGFR, Akt-1, and MEK-1. Stable transfection of RCC cells with plasmids bearing shRNA directed against each of these genes was used to individually suppress their expression. Transfectants were characterized for growth and invasiveness in vitro and tumorigenesis in vivo. RCC cell transfectants displayed significantly reduced growth rate and matrix invasion in vitro and RCC tumor xenograft growth rate in vivo. Analysis of tumor cells that emerged after extended periods in each model showed that significant EGFR suppression was sustained, whereas Akt-1 and MEK-1 knock-down cells had escaped shRNA suppression. EGFR, Akt-1, and MEK-1 are individually critical for RCC cell invasiveness in vitro and tumorigenicity in vivo, and even partial suppression of each can have a significant impact on tumor progression. The emergence of transfectants that had escaped Akt-1 and MEK-1 suppression during tumorigenicity experiments suggests that these effectors may each be more critical than EGFR for RCC tumorigenesis, consistent with results from clinical trials of EGFR inhibitors for RCC, where durable clinical responses have not been seen.

Von Hippel-Lindau Tumor Suppressor Gene Loss in Renal Cell Carcinoma Promotes Oncogenic Epidermal Growth Factor Receptor Signaling via Akt-1 and MEK1

Science.gov (United States)

Lee, S. Justin; Lattouf, Jean-Baptiste; Xanthopoulos, Julie; Linehan, W. Marston; Bottaro, Donald P.; Vasselli, James R.

2008-01-01

Objectives Clear-cell renal cell carcinoma (RCC) is the most prevalent form of kidney cancer and is frequently associated with loss of von Hippel-Lindau (VHL) gene function, resulting in the aberrant transcriptional activation of genes that contribute to tumor growth and metastasis, including transforming growth factor-α (TGF-α), a ligand of the epidermal growth factor receptor (EGFR) tyrosine kinase. To determine the functional impact of EGFR activation on RCC, we suppressed critical components of this pathway: EGFR, Akt-1, and MEK-1. Methods Stable transfection of RCC cells with plasmids bearing shRNA directed against each of these genes was used to individually suppress their expression. Transfectants were characterized for growth and invasiveness in vitro and tumorigenesis in vivo. Results RCC cell transfectants displayed significantly reduced growth rate and matrix invasion in vitro and RCC tumor xenograft growth rate in vivo. Analysis of tumor cells that emerged after extended periods in each model showed that significant EGFR suppression was sustained, whereas Akt-1 and MEK-1 knockdown cells had escaped shRNA suppression. Conclusions EGFR, Akt-1, and MEK-1 are individually critical for RCC cell invasiveness in vitro and tumorigenicity in vivo, and even partial suppression of each can have a significant impact on tumor progression. The emergence of transfectants that had escaped Akt-1 and MEK-1 suppression during tumorigenicity experiments suggests that these effectors may each be more critical than EGFR for RCC tumorigenesis, consistent with results from clinical trials of EGFR inhibitors for RCC, where durable clinical responses have not been seen. PMID:18243508

A simplified model for calculating early offsite consequences from nuclear reactor accidents

International Nuclear Information System (INIS)

Madni, I.K.; Cazzoli, E.G.; Khatib-Rahbar, M.

1988-07-01

A personal computer-based model, SMART, has been developed that uses an integral approach for calculating early offsite consequences from nuclear reactor accidents. The solution procedure uses simplified meteorology and involves direct analytic integration of air concentration equations over time and position. This is different from the discretization approach currently used in the CRAC2 and MACCS codes. The SMART code is fast-running, thereby providing a valuable tool for sensitivity and uncertainty studies. The code was benchmarked against both MACCS version 1.4 and CRAC2. Results of benchmarking and detailed sensitivity/uncertainty analyses using SMART are presented. 34 refs., 21 figs., 24 tabs

Autophagy influences the low-dose hyper-radiosensitivity of human lung adenocarcinoma cells by regulating MLH1.

Science.gov (United States)

Wang, Qiong; Xiao, Zhuya; Lin, Zhenyu; Zhou, Jie; Chen, Weihong; Jie, Wuyun; Cao, Xing; Yin, Zhongyuan; Cheng, Jing

2017-06-01

To investigate the impact of autophagy on the low-dose hyper-radiosensitivity (HRS) of human lung adenocarcinoma cells via MLH1 regulation. Immunofluorescent staining, Western blotting, and electron microscopy were utilized to detect autophagy in A549 and H460 cells. shRNA was used to silence MLH1 expression. The levels of MLH1, mTOR, p-mTOR, BNIP3, and Beclin-1 were measured by real-time polymerase chain reaction (PCR) and Western blotting. A549 cells, which have low levels of MLH1 expression, displayed HRS/induced radioresistance (IRR). Conversely, the radiosensitivity of H460 cells, which express high levels of MLH1, conformed to the linear-quadratic (LQ) model. After down-regulating MLH1 expression, A549 cells showed increased HRS and inhibition of autophagy, whereas H460 cells exhibited HRS/IRR. The levels of mTOR, p-mTOR, and BNIP3 were reduced in cells harboring MLH1 shRNA, and the changes in the mTOR/p-mTOR ratio mirrored those in MLH1 expression. Low MLH1-expressing A549 cells may exhibit HRS. Both the mTOR/p-mTOR and BNIP3/Beclin-1 signaling pathways were found to be related to HRS, but only mTOR/p-mTOR is involved in the regulation of HRS via MLH1 and autophagy.

Protein tyrosine phosphatase 1B (PTP1B) is required for cardiac lineage differentiation of mouse embryonic stem cells.

Science.gov (United States)

Eshkiki, Zahra Shokati; Ghahremani, Mohammad Hossein; Shabani, Parisa; Firuzjaee, Sattar Gorgani; Sadeghi, Asie; Ghanbarian, Hossein; Meshkani, Reza

2017-01-01

Protein tyrosine phosphatase 1B (PTP1B) has been shown to regulate multiple cellular events such as differentiation, cell growth, and proliferation; however, the role of PTP1B in differentiation of embryonic stem (ES) cells into cardiomyocytes remains unexplored. In the present study, we investigated the effects of PTP1B inhibition on differentiation of ES cells into cardiomyocytes. PTP1B mRNA and protein levels were increased during the differentiation of ES cells into cardiomyocytes. Accordingly, a stable ES cell line expressing PTP1B shRNA was established. In vitro, the number and size of spontaneously beating embryoid bodies were significantly decreased in PTP1B-knockdown cells, compared with the control cells. Decreased expression of cardiac-specific markers Nkx2-5, MHC-α, cTnT, and CX43, as assessed by real-time PCR analysis, was further confirmed by immunocytochemistry of the markers. The results also showed that PTP1B inhibition induced apoptosis in both differentiated and undifferentiated ES cells, as presented by increasing the level of cleaved caspase-3, cytochrome C, and cleaved PARP. Further analyses revealed that PTP1B inhibition did not change proliferation and pluripotency of undifferentiated ES cells. Taken together, the data presented here suggest that PTP1B is essential for proper differentiation of ES cells into cardiomyocytes.

Establishment of novel monoclonal antibodies KMab-1 and MMab-1 specific for IDH2 mutations

Energy Technology Data Exchange (ETDEWEB)

Kaneko, Mika Kato [Regional Innovation Strategy Support Program, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai, Miyagi 980-8575 (Japan); Molecular Tumor Marker Research Team, Global COE Program, Yamagata University Faculty of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Morita, Shunpei; Tsujimoto, Yuta; Yanagiya, Ryo; Nasu, Kana; Sasaki, Hiroko [Molecular Tumor Marker Research Team, Global COE Program, Yamagata University Faculty of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Hozumi, Yasukazu; Goto, Kaoru [Department of Anatomy and Cell Biology, Yamagata University School of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Natsume, Atsushi [Department of Neurosurgery, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 (Japan); Watanabe, Mika [Department of Pathology and Histotechnology, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai, Miyagi 980-8575 (Japan); Kumabe, Toshihiro [Department of Neurosurgery, Tohoku University Graduate School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai, Miyagi 980-8574 (Japan); Takano, Shingo [Department of Neurosurgery, Institute of Clinical Medicine, University of Tsukuba, 1-1-1 Tennoudai, Tsukuba, Ibaraki 305-8575 (Japan); Kato, Yukinari, E-mail: yukinari-k@bea.hi-ho.ne.jp [Regional Innovation Strategy Support Program, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai, Miyagi 980-8575 (Japan); Molecular Tumor Marker Research Team, Global COE Program, Yamagata University Faculty of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan)

2013-03-01

Highlights: ► IDH1/2 mutations are early and frequent genetic alterations in gliomas. ► We established anti-mutated IDH2-specific mAbs KMab-1 and MMab-1. ► KMab-1 or MMab-1 specifically reacted with mutated IDH2 in ELISA. ► MMab-1 specifically stained IDH2-R172M-expressing CHO cells in ICC. ► MMab-1 specifically stained IDH2-R172M-expressing gliomas in IHC. - Abstract: Isocitrate dehydrogenase 1/2 (IDH1/2) mutations have been detected in gliomas, cartilaginous tumors, and leukemias. IDH1/2 mutations are early and frequent genetic alterations, are specific to a single codon in the conserved and functionally important Arginine 132 (R132) in IDH1 and Arginine 172 (R172) in IDH2. We previously established several monoclonal antibodies (mAbs), which are specific for IDH1 mutations: clones IMab-1 or HMab-1 against IDH1-R132H or clone SMab-1 against IDH1-R132S. However, specific mAbs against IDH2 mutations have not been reported. To establish IDH2-mutation-specific mAbs, we immunized mice or rats with each mutation-containing IDH2 peptides including IDH2-R172K and IDH2-R172M. After cell fusion, IDH2 mutation-specific mAbs were screened in Enzyme-Linked Immunosorbent Assay (ELISA). Established mAbs KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M peptides, respectively, but not with IDH2-wild type (WT) in ELISA. Western-blot analysis also showed that KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M recombinant proteins, respectively, not with IDH2-WT or other IDH2 mutants, indicating that KMab-1 and MMab-1 are IDH2-mutation-specific. Furthermore, MMab-1 specifically stained the IDH2-R172M-expressing cells in immunocytochemistry, but did not stain IDH2-WT and other IDH2-mutation-containing cells. In immunohistochemical analysis, MMab-1 specifically stained IDH2-R172M-expressing glioma. This is the first report to establish anti-IDH2-mutation-specific mAbs, which could be useful in diagnosis of mutation-bearing tumors.

Establishment of novel monoclonal antibodies KMab-1 and MMab-1 specific for IDH2 mutations

International Nuclear Information System (INIS)

Kaneko, Mika Kato; Morita, Shunpei; Tsujimoto, Yuta; Yanagiya, Ryo; Nasu, Kana; Sasaki, Hiroko; Hozumi, Yasukazu; Goto, Kaoru; Natsume, Atsushi; Watanabe, Mika; Kumabe, Toshihiro; Takano, Shingo; Kato, Yukinari

2013-01-01

Highlights: ► IDH1/2 mutations are early and frequent genetic alterations in gliomas. ► We established anti-mutated IDH2-specific mAbs KMab-1 and MMab-1. ► KMab-1 or MMab-1 specifically reacted with mutated IDH2 in ELISA. ► MMab-1 specifically stained IDH2-R172M-expressing CHO cells in ICC. ► MMab-1 specifically stained IDH2-R172M-expressing gliomas in IHC. - Abstract: Isocitrate dehydrogenase 1/2 (IDH1/2) mutations have been detected in gliomas, cartilaginous tumors, and leukemias. IDH1/2 mutations are early and frequent genetic alterations, are specific to a single codon in the conserved and functionally important Arginine 132 (R132) in IDH1 and Arginine 172 (R172) in IDH2. We previously established several monoclonal antibodies (mAbs), which are specific for IDH1 mutations: clones IMab-1 or HMab-1 against IDH1-R132H or clone SMab-1 against IDH1-R132S. However, specific mAbs against IDH2 mutations have not been reported. To establish IDH2-mutation-specific mAbs, we immunized mice or rats with each mutation-containing IDH2 peptides including IDH2-R172K and IDH2-R172M. After cell fusion, IDH2 mutation-specific mAbs were screened in Enzyme-Linked Immunosorbent Assay (ELISA). Established mAbs KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M peptides, respectively, but not with IDH2-wild type (WT) in ELISA. Western-blot analysis also showed that KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M recombinant proteins, respectively, not with IDH2-WT or other IDH2 mutants, indicating that KMab-1 and MMab-1 are IDH2-mutation-specific. Furthermore, MMab-1 specifically stained the IDH2-R172M-expressing cells in immunocytochemistry, but did not stain IDH2-WT and other IDH2-mutation-containing cells. In immunohistochemical analysis, MMab-1 specifically stained IDH2-R172M-expressing glioma. This is the first report to establish anti-IDH2-mutation-specific mAbs, which could be useful in diagnosis of mutation-bearing tumors

Ex-plant consequence assessment for NUREG-1150: models, typical results, uncertainties

International Nuclear Information System (INIS)

Sprung, J.L.

1988-01-01

The assessment of ex-plant consequences for NUREG-1150 source terms was performed using the MELCOR Accident Consequence Code System (MACCS). This paper briefly discusses the following elements of MACCS consequence calculations: input data, phenomena modeled, computational framework, typical results, controlling phenomena, and uncertainties. Wherever possible, NUREG-1150 results will be used to illustrate the discussion. 28 references

Isolation of Mal d 1 and Api g 1 - specific recombinant antibodies from mouse IgG Fab fragment libraries - Mal d 1-specific antibody exhibits cross-reactivity against Bet v 1.

Science.gov (United States)

Haka, Jaana; Niemi, Merja H; Iljin, Kristiina; Reddy, Vanga Siva; Takkinen, Kristiina; Laukkanen, Marja-Leena

2015-05-27

Around 3-5% of the population suffer from IgE-mediated food allergies in Western countries and the number of food-allergenic people is increasing. Individuals with certain pollen allergies may also suffer from a sensitisation to proteins in the food products. As an example a person sensitised to the major birch pollen allergen, Bet v 1, is often sensitised to its homologues, such as the major allergens of apple, Mal d 1, and celery, Api g 1, as well. Development of tools for the reliable, sensitive and quick detection of allergens present in various food products is essential for allergic persons to prevent the consumption of substances causing mild and even life-threatening immune responses. The use of monoclonal antibodies would ensure the specific detection of the harmful food content for a sensitised person. Mouse IgG antibody libraries were constructed from immunised mice and specific recombinant antibodies for Mal d 1 and Api g 1 were isolated from the libraries by phage display. More detailed characterisation of the resulting antibodies was carried out using ELISA, SPR experiments and immunoprecipitation assays. The allergen-specific Fab fragments exhibited high affinity towards the target recombinant allergens. Furthermore, the Fab fragments also recognised native allergens from natural sources. Interestingly, isolated Mal d 1-specific antibody bound also to Bet v 1, the main allergen eliciting the cross-reactivity syndrome between the birch pollen and apple. Despite the similarities in Api g 1 and Bet v 1 tertiary structures, the isolated Api g 1-specific antibodies showed no cross-reactivity to Bet v 1. Here, high-affinity allergen-specific recombinant antibodies were isolated with interesting binding properties. With further development, these antibodies can be utilised as tools for the specific and reliable detection of allergens from different consumable products. This study gives new preliminary insights to elucidate the mechanism behind the pollen

Procedural and clinical outcomes after use of the glycoprotein IIb/IIIa inhibitor abciximab for saphenous vein graft interventions

Energy Technology Data Exchange (ETDEWEB)

Harskamp, Ralf E., E-mail: r.e.harskamp@gmail.com [Academic Medical Center–University of Amsterdam, Amsterdam (Netherlands); VU University Medical Center, Amsterdam (Netherlands); Duke Clinical Research Institute, Durham, NC (United States); Hoedemaker, Niels [Academic Medical Center–University of Amsterdam, Amsterdam (Netherlands); Newby, L. Kristin [Duke Clinical Research Institute, Durham, NC (United States); Woudstra, Pier; Grundeken, Maik J.; Beijk, Marcel A.; Piek, Jan J.; Tijssen, Jan G. [Academic Medical Center–University of Amsterdam, Amsterdam (Netherlands); Mehta, Rajendra H. [Duke Clinical Research Institute, Durham, NC (United States); Winter, Robbert J. de [Academic Medical Center–University of Amsterdam, Amsterdam (Netherlands)

2016-01-15

Background: Percutaneous coronary intervention (PCI) of saphenous vein grafts (SVG) poses a high-risk for distal coronary thromboembolic events. Glycoprotein IIb/IIIa inhibitors are frequently used in hope of reducing the impact of this, although the safety and efficacy of these drugs to improve outcomes in this setting are understudied. Methods: Patients were included if they had prior coronary artery bypass surgery and subsequently underwent PCI of ≥ 1 SVG graft at a Dutch academic center between 1997 and 2008. These patients were matched 1:1 based on peri-procedural use of abciximab using a propensity-score matching algorithm based on 17 variables. Conditional logistic regression and Cox regression stratified on matched pairs were performed to evaluate the association between abciximab use and MACCE (the composite measure of mortality, myocardial infarction, stroke and repeat revascularization) at 30 days and up to 1 year. Results: The composite of 30-day MACCE occurred in 18 patients (15.3%) in the abciximab group and 16 patients (13.6%) in the propensity matched control group (OR: 1.13, 95% CI: 0.57–2.21, p = 0.73). At 1-year follow-up, MACCE rates were also similar (32.5% vs. 33.9%, HR: 0.97, 95% CI: 0.59–1.59). Major bleeding (BARC types 3a–c) was higher in the abciximab group (11.9% vs. 4.2%, OR: 2.80, 95% CI: 1.01–7.77). Ischemic outcomes did not differ among patients with acute coronary syndromes. Conclusion: The use of intravenous abciximab was not associated with improved clinical outcomes up to 1-year among patients undergoing SVG PCI, but was related to more bleeding. - Highlights: • PCI of SVG poses a high-risk for distal coronary thromboembolic events. • Glycoprotein IIb/IIIa inhibitors are frequently used in an attempt to reduce this risk. • We evaluated the safety and efficacy of abciximab (a glycoprotein IIb/IIIa inhibitor) using a propensity-score matched analysis of 236 patients at a large academic medical center. • Thirty

CLDN6 promotes chemoresistance through GSTP1 in human breast cancer

Directory of Open Access Journals (Sweden)

Minlan Yang

2017-11-01

Full Text Available Abstract Background Claudin-6 (CLDN6, a member of CLDN family and a key component of tight junction, has been reported to function as a tumor suppressor in breast cancer. However, whether CLDN6 plays any role in breast cancer chemoresistance remains unclear. In this study, we investigated the role of CLDN6 in the acquisition of chemoresistance in breast cancer cells. Methods We manipulated the expression of CLDN6 in MCF-7 and MCF-7/MDR cells with lv-CLDN6 and CLDN6-shRNA and investigated whether CLDN6 manipulation lead to different susceptibilities to several chemotherapeutic agents in these cells. The cytotoxicity of adriamycin (ADM, 5-fluorouracil (5-FU, and cisplatin (DDP was tested by cck-8 assay. Cell death was determined by DAPI nuclear staining. The enzyme activity of glutanthione S-transferase-p1 (GSTP1 was detected by a GST activity kit. Then lv-GSTP1 and GSTP1-shRNA plasmids were constructed to investigate the potential of GSTP1 in regulating chemoresistance of breast cancer. The TP53-shRNA was adopted to explore the regulation mechanism of GSTP1. Finally, immunohistochemistry was used to explore the relationship between CLDN6 and GSTP1 expression in breast cancer tissues. Results Silencing CLDN6 increased the cytotoxicity of ADM, 5-FU, and DDP in MCF-7/MDR cells. Whereas overexpression of CLDN6 in MCF-7, the parental cell line of MCF-7/MDR expressing low level of CLDN6, increased the resistance to the above drugs. GSTP1 was upregulated in CLDN6-overexpressed MCF-7 cells. RNAi –mediated silencing of CLDN6 downregulated both GSTP1 expression and GST enzyme activity in MCF-7/MDR cells. Overexpresssion of GSTP1 in CLDN6 silenced MCF-7/MDR cells restored chemoresistance, whereas silencing GSTP1 reduced the chemoresistance due to ectopic overexpressed of CLDN6 in MCF-7 cells. These observations were also repeated in TNBC cells Hs578t. We further confirmed that CLDN6 interacted with p53 and promoted translocation of p53 from nucleus to

Incidence, predicting factors, and clinical outcomes of periprocedural myocardial infarction after percutaneous coronary intervention for chronic total occlusion in the era of new-generation drug-eluting stents.

Science.gov (United States)

Kim, Jin-Ho; Kim, Byeong-Keuk; Kim, Seunghwan; Ahn, Chul-Min; Kim, Jung-Sun; Ko, Young-Guk; Choi, Donghoon; Hong, Myeong-Ki; Jang, Yangsoo

2017-12-20

This study aimed to examine predictors and clinical outcomes of periprocedural myocardial infarction (PMI) after chronic total occlusion (CTO) intervention. There are limited data on the clinical implications of PMI after CTO intervention in the new-generation drug-eluting stent (DES) era. We enrolled 337 patients who underwent CTO intervention and met the study criteria. We evaluated the incidence and predictors of PMI, defined as an increase in creatine kinase-MB ≥3× the upper limit of normal (ULN) after intervention and compared the occurrence rates of major adverse cardiac and cerebrovascular events (MACCE, defined as the composite of cardiac death, myocardial infarction, stent thrombosis, target-vessel revascularization, or cerebrovascular accidents) between the PMI and non-PMI groups. PMI occurred in 23 (6.8%) patients after CTO intervention. Significant independent predictors were previous bypass surgery [odds ratio (OR) = 5.52, 95% confidence interval (CI) = 1.17-25.92; P = 0.03], Japan-CTO score ≥3 (OR = 7.06, 95%CI = 2.57-19.39; P PMI group had a significantly higher MACCE rate than the non-PMI group (23.7 vs. 5.6%, P = 0.008 by log-rank test). PMI was an independent predictor of MACCE (HR = 4.26, 95%CI = 1.35-13.43; P = 0.01). The MACCE rate gradually increased in a CK-MB-dependent fashion and was highest in patients with ≥10× ULN (P = 0.005). Previous bypass surgery, high Japan-CTO score, side branch occlusion, and longer procedure time were strongly related to PMI occurrence after CTO intervention. PMI was significantly associated with worse clinical outcomes in the new-generation DES era. © 2017 Wiley Periodicals, Inc.

Lentiviral Delivery of a Vesicular Glutamate Transporter 1 (VGLUT1)-Targeting Short Hairpin RNA Vector Into the Mouse Hippocampus Impairs Cognition

NARCIS (Netherlands)

King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.

Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target

The Role of MMP-1 in Breast Cancer Growth and Metastasis to the Brain in a Xenograft Model

Science.gov (United States)

2012-12-07

particles (with puromycin as selection marker) (Thermo Scientific Co) targeting the following sequences: sh1: GAGTACAACTTACATCGTG; sh2 ...data not shown). shRNA lentiviruses targeting sh1 and sh2 sequences were used to infected 231-BR and 231-BR3 cells. Two pools of selected 231-BR cells...lentiviruses targeting sh1 and sh2 sequences were named sh1 and sh2 respectively. RNA-isolation and real-time RT-PCR Total RNAs from different cell lines and

Targeting tumor multicellular aggregation through IGPR-1 inhibits colon cancer growth and improves chemotherapy.

Science.gov (United States)

Woolf, N; Pearson, B E; Bondzie, P A; Meyer, R D; Lavaei, M; Belkina, A C; Chitalia, V; Rahimi, N

2017-09-18

Adhesion to extracellular matrix (ECM) is crucially important for survival of normal epithelial cells as detachment from ECM triggers specific apoptosis known as anoikis. As tumor cells lose the requirement for anchorage to ECM, they rely on cell-cell adhesion 'multicellular aggregation' for survival. Multicellular aggregation of tumor cells also significantly determines the sensitivity of tumor cells to the cytotoxic effects of chemotherapeutics. In this report, we demonstrate that expression of immunoglobulin containing and proline-rich receptor-1 (IGPR-1) is upregulated in human primary colon cancer. Our study demonstrates that IGPR-1 promotes tumor multicellular aggregation, and interfering with its adhesive function inhibits multicellular aggregation and, increases cell death. IGPR-1 supports colon carcinoma tumor xenograft growth in mouse, and inhibiting its activity by shRNA or blocking antibody inhibits tumor growth. More importantly, IGPR-1 regulates sensitivity of tumor cells to the chemotherapeutic agent, doxorubicin/adriamycin by a mechanism that involves doxorubicin-induced AKT activation and phosphorylation of IGPR-1 at Ser220. Our findings offer novel insight into IGPR-1's role in colorectal tumor growth, tumor chemosensitivity, and as a possible novel anti-cancer target.

Depression, anxiety and major adverse cardiovascular and cerebrovascular events in patients following coronary artery bypass graft surgery

DEFF Research Database (Denmark)

Tully, Phillip J; Winefield, Helen R; Baker, Robert A

2015-01-01

anhedonia, anxious arousal and general distress/negative affect symptom dimensions. Incident MACCE was defined as fatal or non-fatal; myocardial infarction, unstable angina pectoris, repeat revascularization, heart failure, sustained arrhythmia, stroke or cerebrovascular accident, left ventricular failure......BACKGROUND: Although depression and anxiety have been implicated in risk for major adverse cardiovascular and cerebrovascular events (MACCE), a theoretical approach to identifying such putative links is lacking. The objective of this study was to examine the association between theoretical...... and mortality due to cardiac causes. Time-to-MACCE was determined by hazard modelling after adjustment for EuroSCORE, smoking, body mass index, hypertension, heart failure and peripheral vascular disease. RESULTS: In the total sample, there were 698 cumulative person years of survival for analysis with a median...

Establishment of a novel monoclonal antibody SMab-1 specific for IDH1-R132S mutation

Energy Technology Data Exchange (ETDEWEB)

Kaneko, Mika Kato; Tian, Wei [Molecular Tumor Marker Research Team, The Oncology Research Center, Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Takano, Shingo [Department of Neurosurgery, Institute of Clinical Medicine, University of Tsukuba, 1-1-1 Tennoudai, Tsukuba, Ibaraki 305-8575 (Japan); Suzuki, Hiroyuki [Department of Experimental Pathology, Graduate School of Comprehensive Human Sciences, University of Tsukuba, 1-1-1 Tennoudai, Tsukuba, Ibaraki 305-8575 (Japan); Sawa, Yoshihiko [Section of Functional Structure, Department of Morphological Biology, Division of Biomedical Sciences, Fukuoka Dental College, 2-15-1 Tamura, Sawara-ku, Fukuoka 814-0193 (Japan); Hozumi, Yasukazu; Goto, Kaoru [Department of Anatomy and Cell Biology, Yamagata University School of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Yamazaki, Kentaro [Department of Forensic Medicine, Yamagata University School of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Kitanaka, Chifumi [Department of Molecular Cancer Science, Yamagata University School of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Kato, Yukinari, E-mail: yukinari-k@bea.hi-ho.ne.jp [Molecular Tumor Marker Research Team, The Oncology Research Center, Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan)

2011-03-25

Research highlights: {yields} IDH1 mutations are early and frequent genetic alterations in gliomas. {yields} We newly established an anti-IDH1-R132S-specific mAb SMab-1. {yields} SMab-1 reacted with the IDH1-R132S peptide, but not with other IDH1 mutants. {yields} SMab-1 specifically stained the IDH1-R132S-expressing glioblastoma cells in immunocytochemistry and immunohistochemistry. {yields} SMab-1 should be useful in diagnosis of mutation-bearing gliomas. -- Abstract: Isocitrate dehydrogenase 1 (IDH1) mutations, which are early and frequent genetic alterations in gliomas, are specific to a single codon in the conserved and functionally important Arginine 132 (R132) in IDH1. We earlier established a monoclonal antibody (mAb), IMab-1, which is specific for R132H-containing IDH1 (IDH1-R132H), the most frequent IDH1 mutation in gliomas. To establish IDH1-R132S-specific mAb, we immunized mice with R132S-containing IDH1 (IDH1-R132S) peptide. After cell fusion using Sendai virus envelope, IDH1-R132S-specific mAbs were screened in ELISA. One mAb, SMab-1, reacted with the IDH1-R132S peptide, but not with other IDH1 mutants. Western-blot analysis showed that SMab-1 reacted only with the IDH1-R132S protein, not with IDH1-WT protein or IDH1 mutants, indicating that SMab-1 is IDH1-R132S-specific. Furthermore, SMab-1 specifically stained the IDH1-R132S-expressing glioblastoma cells in immunocytochemistry and immunohistochemistry, but did not react with IDH1-WT or IDH1-R132H-containing glioblastoma cells. We newly established an anti-IDH1-R132S-specific mAb SMab-1 for use in diagnosis of mutation-bearing gliomas.

Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

International Nuclear Information System (INIS)

Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

2009-01-01

Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

Standard technical specifications: Babcock and Wilcox Plants. Revision 1

International Nuclear Information System (INIS)

1995-04-01

This report documents the results of the combined effort of the NRC and the industry to produce improved Standard Technical Specifications (STS), Revision 1 for Babcock ampersand Wilcox Plants. The changes reflected in Revision 1 resulted from the experience gained from license amendment applications to convert to these improved STS or to adopt partial improvements to existing technical specifications. This NUREG is the result of extensive public technical meetings and discussions between the Nuclear Regulatory Commission (NRC) staff and various nuclear power plant licensees, Nuclear Steam Supply System (NSSS) Owners Groups, NSSS vendors, and the Nuclear Energy Institute (NEI). The improved STS were developed based on the criteria in the Final Commission Policy Statement on Technical Specifications Improvements for Nuclear Power Reactors, dated July 22, 1993. The improved STS will be used as the basis for individual nuclear power plant licensees to develop improved plant-specific technical specifications. This report contains three volumes. Volume 1 contains the Specifications for all chapters and sections of the improved STS. Volume 2 contains the Bases for Chapters 2.0 and 3.0, and Sections 3.1--3.3 of the improved STS. Volume 3 contains the Bases for Sections 3.4--3.9 of the improved STS

Overexpression of Prdx1 in hilar cholangiocarcinoma: a predictor for recurrence and prognosis.

Science.gov (United States)

Zhou, Jie; Shen, Weiwen; He, Xiaojing; Qian, Jing; Liu, Shiyuan; Yu, Guanzhen

2015-01-01

Prdx1 is an important member of peroxiredoxins (Prdxs) regulating various cellular signaling and differentiation. Prdx1 confers an aggressive survival phenotype of cancer cells and drug-resistance, yet its role in hilar cholangiocarcinoma is not fully investigated. In present study, we detected the expression profile of Prdx1 in 88 hilar cholangiocarcinoma by tissue arrays and immunohistochemistry. Prdx1 level was down-regulated by specific Prdx1-shRNA in vitro and the possible mechanism was investigated. Overexpression of Prdx1 was observed in 53 of 88 cases (60.2%). Prdx1 expression was significantly associated with tumor invasion, nodal metastasis, advanced disease stage. Down-regulation of Prdx1 inhibited cell proliferation and colony formation of QBC939 cells and reduced the level of SNAT1 expression. Patients with Prdx1 overexpression had a shorter disease-free survival and overall survival than those without Prdx1 expression. Multivariate analysis showed that Prdx1 was an independent prognostic factor for patients with hilar cholangiocarcinoma. The data indicate that Prdx1 may contribute to the development and progression of hilar cholangiocarcinoma, partially through regulating SNAT1 expression, and may be used as a biomarker in predicting the outcome of patients with hilar cholangiocarcinoma.

The ranking of negative-cost emissions reduction measures

International Nuclear Information System (INIS)

Taylor, Simon

2012-01-01

A flaw has been identified in the calculation of the cost-effectiveness in marginal abatement cost curves (MACCs). The problem affects “negative-cost” emissions reduction measures—those that produce a return on investment. The resulting ranking sometimes favours measures that produce low emissions savings and is therefore unreliable. The issue is important because incorrect ranking means a potential failure to achieve the best-value outcome. A simple mathematical analysis shows that not only is the standard cost-effectiveness calculation inadequate for ranking negative-cost measures, but there is no possible replacement that satisfies reasonable requirements. Furthermore, the concept of negative cost-effectiveness is found to be unsound and its use should be avoided. Among other things, this means that MACCs are unsuitable for ranking negative-cost measures. As a result, MACCs produced by a range of organizations including UK government departments may need to be revised. An alternative partial ranking method has been devised by making use of Pareto optimization. The outcome can be presented as a stacked bar chart that indicates both the preferred ordering and the total emissions saving available for each measure without specifying a cost-effectiveness. - Highlights: ► Marginal abatement cost curves (MACCs) are used to rank emission reduction measures. ► There is a flaw in the standard ranking method for negative-cost measures. ► Negative values of cost-effectiveness (in £/tC or equivalent) are invalid. ► There may be errors in published MACCs. ► A method based on Pareto principles provides an alternative ranking method.

Interleukin-1 is required for cancer eradication mediated by tumor-specific Th1 cells.

Science.gov (United States)

Haabeth, Ole Audun Werner; Lorvik, Kristina Berg; Yagita, Hideo; Bogen, Bjarne; Corthay, Alexandre

The role of inflammation in cancer is controversial as both tumor-promoting and tumor-suppressive aspects of inflammation have been reported. In particular, it has been shown that pro-inflammatory cytokines, like interleukin-1α (IL-1α), IL-1β, IL-6, and tumor necrosis factor α (TNFα), may either promote or suppress cancer. However, the cellular and molecular basis underlying these opposing outcomes remains enigmatic. Using mouse models for myeloma and lymphoma, we have recently reported that inflammation driven by tumor-specific T helper 1 (Th1) cells conferred protection against B-cell cancer and that interferon-γ (IFN-γ) was essential for this process. Here, we have investigated the contribution of several inflammatory mediators. Myeloma eradication by Th1 cells was not affected by inhibition of TNF-α, TNF-related weak inducer of apoptosis (TWEAK), or TNF-related apoptosis-inducing ligand (TRAIL). In contrast, cancer elimination by tumor-specific Th1 cells was severely impaired by the in vivo neutralization of both IL-1α and IL-1β (collectively named IL-1) with IL-1 receptor antagonist (IL-1Ra). The antitumor functions of tumor-specific Th1 cells and tumor-infiltrating macrophages were both affected by IL-1 neutralization. Secretion of the Th1-derived cytokines IL-2 and IFN-γ at the incipient tumor site was severely reduced by IL-1 blockade. Moreover, IL-1 was shown to synergize with IFN-γ for induction of tumoricidal activity in tumor-infiltrating macrophages. This synergy between IL-1 and IFN-γ may explain how inflammation, when driven by tumor-specific Th1 cells, represses rather than promotes cancer. Collectively, the data reveal a central role of inflammation, and more specifically of the canonical pro-inflammatory cytokine IL-1, in enhancing Th1-mediated immunity against cancer.

UPC Language and Library Specifications, Version 1.3

Energy Technology Data Exchange (ETDEWEB)

UPC Consortium; Bonachea, Dan; Funck, Gary

2013-11-16

UPC is an explicitly parallel extension to the ISO C 99 Standard. UPC follows the partitioned global address space programming model. This document is the formal specification for the UPC language and library syntax and semantics, and supersedes prior specification version 1.2 (LBNL-59208).

Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice.

Directory of Open Access Journals (Sweden)

Gene-Errol E Ringpis

Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either

α-Fetoprotein promoter-driven Cre/LoxP-switched RNA interference for hepatocellular carcinoma tissue-specific target therapy.

Directory of Open Access Journals (Sweden)

Yuan-Fei Peng

Full Text Available RNA interference (RNAi has recently emerged as a potential treatment modality for hepatocellular carcinoma (HCC therapy, but the lack of cellular targets and sustained efficacy limits its application. The purpose of this study is to develop an HCC tissue-specific RNAi system and investigate its possibility for HCC treatment.Two different HCC-specific RNAi systems in which therapeutic miRNA or shRNA against target gene (Beclin 1 was directly or indirectly driven by alpha-fetoprotein promoter (AFP-miRNA and AFP-Cre/LoxP-shRNA were constructed. Human HCC cell lines (HepG2, Hep3B and HCCLM3 and non-HCC cell lines (L-02, Hela and SW1116 were infected with the systems. The effectiveness and tissue-specificity of the systems were examined by Q-PCR and western blot analysis. The efficacy of the systems was further tested in mouse model of HCC by intravenous or intratumoral administration. The feasibility of the system for HCC treatment was evaluated by applying the system as adjuvant therapy to enhance sorafenib treatment. An AFP-Cre/LoxP-shRNA system targeting Atg5 gene (AFP-Cre/LoxP-shRNA-Atg5 was constructed and its efficacy in sensitizing HCC cells (MHCC97L/PLC to sorafenib treatment was examined by apoptosis assay in vitro and tumorigenesis assay in vivo.The AFP-miRNA system could silence target gene (Beclin 1 but required a high titer which was lethal to target cells. The AFP-Cre/LoxP-shRNA system could efficiently knockdown target gene while maintain high HCC specificity. Intratumoral injection of the AFP-Cre/LoxP-shRNA system could efficiently silence target gene (Beclin 1 in vivo while intravenous administration could not. The AFP-Cre/LoxP-shRNA system target Atg5 gene could significantly sensitize MHCC97L/PLC cells to sorafenib-induced apoptosis in vitro and tumor growth suppression in vivo.An efficient HCC tissue-specific RNAi system (AFP-Cre/LoxP-shRNA was successfully established. The system provides a usable tool for HCC-specific RNAi

Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

Science.gov (United States)

Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

2017-12-01

This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

FHOD1 formin is upregulated in melanomas and modifies proliferation and tumor growth

International Nuclear Information System (INIS)

Peippo, Minna; Gardberg, Maria; Lamminen, Tarja; Kaipio, Katja; Carpén, Olli; Heuser, Vanina D.

2017-01-01

The functional properties of actin-regulating formin proteins are diverse and in many cases cell-type specific. FHOD1, a formin expressed predominantly in cells of mesenchymal lineage, bundles actin filaments and participates in maintenance of cell shape, migration and cellular protrusions. FHOD1 participates in cancer-associated epithelial to mesenchymal transition (EMT) in oral squamous cell carcinoma and breast cancer. The role of FHOD1 in melanomas has not been characterized. Here, we show that FHOD1 expression is typically strong in cutaneous melanomas and cultured melanoma cells while the expression is low or absent in benign nevi. By using shRNA to knockdown FHOD1 in melanoma cells, we discovered that FHOD1 depleted cells are larger, rounder and have smaller focal adhesions and inferior migratory capacity as compared to control cells. Importantly, we found FHOD1 depleted cells to have reduced colony-forming capacity and attenuated tumor growth in vivo, a finding best explained by the reduced proliferation rate caused by cell cycle arrest. Unexpectedly, FHOD1 depletion did not prevent invasive growth at the tumor margins. These results suggest that FHOD1 participates in key cellular processes that are dysregulated in malignancy, but may not be essential for melanoma cell invasion.

MicroRNA-129-5p inhibits the development of autoimmune encephalomyelitis-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway.

Science.gov (United States)

Liu, Ai-Hua; Wu, Ya-Ting; Wang, Yu-Ping

2017-06-01

The study aimed to explore the effects of microRNA-129-5p (miR-129-5p) on the development of autoimmune encephalomyelitis (AE)-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway in a rat model. AE-related epilepsy models were established. Sprague-Dawley (SD) rats were randomly divided into control, model, miR-129-5p mimics, miR-129-5p inhibitor, HMGB1 shRNA, TLR4/NF-kB (TLR4/NF-kB signaling pathway was inhibited) and miR-129-5p mimics+HMGB1 shRNA groups respectively. Latency to a first epilepsy seizure attack was recorded. Neuronal injuries in the hippocampus regions were detected using HE, Nissl and FJB staining methods 24h following model establishment. Microglial cells were detected by OX-42 immunohistochemistry. Expressions of miR-129-5p, HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by qRT-PCR. Protein expressions of HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by Western blotting. Dual luciferase reporter gene assay showed that miR-129-5p was negatively targeting HMGB1. Neurons of hippocampal tissues in rats were heavily injured by an injection of lithium chloride. Compared with the model and control groups, neuronal injury of the hippocampus and AE-related epilepsy decreased and microglial cells increased in the miR-129-5p mimics, HMGB1 shRNA and TLR4/NF-kB groups; however, in the miR-129-5p inhibitor group, miR-129-5p expression decreased, HMGB1 expression increased, TLR4/NF-kB signaling pathway was activated, latency to a first epilepsy seizure attack was shortened, and neuronal injury increased. This study provides evidence that miR-129-5p inhibits the development of AE-related epilepsy by suppressing HMGB1 expression and inhibiting TLR4/NF-kB signaling pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ

Directory of Open Access Journals (Sweden)

Pingping Xia

2018-03-01

Full Text Available Background/Aims: Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. Methods: The cerebral injury was established by middle cerebral artery occlusion (MCAO. in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD. ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. Results: We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO. Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. Conclusion: The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling

Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ.

Science.gov (United States)

Xia, Pingping; Pan, Yundan; Zhang, Fan; Wang, Na; Wang, E; Guo, Qulian; Ye, Zhi

2018-01-01

Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. The cerebral injury was established by middle cerebral artery occlusion (MCAO). in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD). ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO). Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH) release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA) could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling pathway. Moreover, the inhibition of Rac1 promoted this function

The Johnson Space Center Management Information Systems (JSCMIS). 1: Requirements Definition and Design Specifications for Versions 2.1 and 2.1.1. 2: Documented Test Scenario Environments. 3: Security Design and Specifications

Science.gov (United States)

1986-01-01

The Johnson Space Center Management Information System (JSCMIS) is an interface to computer data bases at NASA Johnson which allows an authorized user to browse and retrieve information from a variety of sources with minimum effort. This issue gives requirements definition and design specifications for versions 2.1 and 2.1.1, along with documented test scenario environments, and security object design and specifications.

Calpastatin is regulated by protein never in mitosis gene A interacting-1 (PIN1) in endothelial cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Tongzheng, E-mail: liu.tongzheng@mayo.edu [Division of Oncology Research, Department of Oncology, Mayo Clinic, Rochester, MN 55905 (United States); Schneider, Ryan A., E-mail: schneiderr@findlay.edu [College of Pharmacy, The University of Findlay, Findlay, OH 45840 (United States); Hoyt, Dale G., E-mail: hoyt.27@osu.edu [The Dorothy M. Davis Heart and Lung Research Institute, and the Division of Pharmacology, College of Pharmacy, The Ohio State University, 500 West Twelfth Avenue, Columbus, OH 43210 (United States)

2011-10-28

Highlights: Black-Right-Pointing-Pointer Depletion of PIN1 increases inhibitory effect of calpastatin against calpain in endothelial cells. Black-Right-Pointing-Pointer PIN1 associates with calpastatin. Black-Right-Pointing-Pointer PIN1, but not mutants, reduces the inhibitory activity of calpastatin in vitro. Black-Right-Pointing-Pointer Depletion of calpastatin shows that it is required for PIN1 depletion to reduce calpain activity. -- Abstract: The peptidyl-proline isomerase, protein never in mitosis gene A interacting-1 (PIN1) binds and isomerizes proteins phosphorylated on serine/threonine before a proline. It was previously found that depletion of PIN1 greatly increased induction of cyclooxygenase-2 and inducible nitric oxide synthase by lowering calpain activity in murine aortic endothelial cells (MAEC). Here we investigated the effect of PIN1 on the endogenous inhibitor of heterodimeric {mu}- and m-calpains, calpastatin. MAEC were transduced with small hairpin (sh) RNA to knock down PIN1 (KD) or an inactive Control shRNA. Cells were also treated with non-targeted double stranded small inhibitory RNA (siRNA) or siRNA designed to deplete calpastatin. Despite reducing calpain activity, PIN1 KD did not significantly affect the expression of {mu}- and m-calpains, or calpastatin, compared to Control shRNA. Instead, depletion of PIN1 increased the inhibitory activity of calpastatin. Calpastatin co-immunoprecipitated with endogenous PIN1 and was pulled down with glutathione-S-transferase (GST)-PIN1 fusion protein. Adding GST-PIN1 to KD cell extracts lacking PIN1 reduced calpastatin inhibitory activity. Substrate binding and catalytic domain mutants of PIN1 failed to do so. These results suggest that protein interaction and the proline isomerase functions of PIN1 are required for it to inhibit calpastatin. Furthermore, depletion of calpastatin raised calpain activity and reduced calpain inhibitory activity to similar levels in KD and Control MAEC, indicating that

Calpastatin is regulated by protein never in mitosis gene A interacting-1 (PIN1) in endothelial cells

International Nuclear Information System (INIS)

Liu, Tongzheng; Schneider, Ryan A.; Hoyt, Dale G.

2011-01-01

Highlights: ► Depletion of PIN1 increases inhibitory effect of calpastatin against calpain in endothelial cells. ► PIN1 associates with calpastatin. ► PIN1, but not mutants, reduces the inhibitory activity of calpastatin in vitro. ► Depletion of calpastatin shows that it is required for PIN1 depletion to reduce calpain activity. -- Abstract: The peptidyl-proline isomerase, protein never in mitosis gene A interacting-1 (PIN1) binds and isomerizes proteins phosphorylated on serine/threonine before a proline. It was previously found that depletion of PIN1 greatly increased induction of cyclooxygenase-2 and inducible nitric oxide synthase by lowering calpain activity in murine aortic endothelial cells (MAEC). Here we investigated the effect of PIN1 on the endogenous inhibitor of heterodimeric μ- and m-calpains, calpastatin. MAEC were transduced with small hairpin (sh) RNA to knock down PIN1 (KD) or an inactive Control shRNA. Cells were also treated with non-targeted double stranded small inhibitory RNA (siRNA) or siRNA designed to deplete calpastatin. Despite reducing calpain activity, PIN1 KD did not significantly affect the expression of μ- and m-calpains, or calpastatin, compared to Control shRNA. Instead, depletion of PIN1 increased the inhibitory activity of calpastatin. Calpastatin co-immunoprecipitated with endogenous PIN1 and was pulled down with glutathione-S-transferase (GST)–PIN1 fusion protein. Adding GST–PIN1 to KD cell extracts lacking PIN1 reduced calpastatin inhibitory activity. Substrate binding and catalytic domain mutants of PIN1 failed to do so. These results suggest that protein interaction and the proline isomerase functions of PIN1 are required for it to inhibit calpastatin. Furthermore, depletion of calpastatin raised calpain activity and reduced calpain inhibitory activity to similar levels in KD and Control MAEC, indicating that calpastatin is required for PIN1 depletion to lower calpain activity. Thus, PIN1 apparently restrains

Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase

KAUST Repository

Kim, Dongjin; Ntui, Valentine Otang; Zhang, Nianshu; Xiong, Liming

2015-01-01

Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.

Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase

KAUST Repository

Kim, Dongjin

2015-10-09

Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.

Department of Defense Dictionary Of Military and Associated Terms

Science.gov (United States)

2010-12-31

authorities, military support to civilian law enforcement agencies, and military assistance for civil disturbances. Also called MACA . (DODD 3025.1...Center MACA military assistance to civil authorities MACB multinational acquisition and contracting board MACCS Marine air command and control

Identification of NDRG1-regulated genes associated with invasive potential in cervical and ovarian cancer cells

International Nuclear Information System (INIS)

Zhao, Gang; Chen, Jiawei; Deng, Yanqiu; Gao, Feng; Zhu, Jiwei; Feng, Zhenzhong; Lv, Xiuhong; Zhao, Zheng

2011-01-01

Highlights: → NDRG1 was knockdown in cervical and ovarian cancer cell lines by shRNA technology. → NDRG1 knockdown resulted in increased cell invasion activities. → Ninety-six common deregulated genes in both cell lines were identified by cDNA microarray. → Eleven common NDRG1-regulated genes might enhance cell invasive activity. → Regulation of invasion by NDRG1 is an indirect and complicated process. -- Abstract: N-myc downstream regulated gene 1 (NDRG1) is an important gene regulating tumor invasion. In this study, shRNA technology was used to suppress NDRG1 expression in CaSki (a cervical cancer cell line) and HO-8910PM (an ovarian cancer cell line). In vitro assays showed that NDRG1 knockdown enhanced tumor cell adhesion, migration and invasion activities without affecting cell proliferation. cDNA microarray analysis revealed 96 deregulated genes with more than 2-fold changes in both cell lines after NDRG1 knockdown. Ten common upregulated genes (LPXN, DDR2, COL6A1, IL6, IL8, FYN, PTP4A3, PAPPA, ETV5 and CYGB) and one common downregulated gene (CLCA2) were considered to enhance tumor cell invasive activity. BisoGenet network analysis indicated that NDRG1 regulated these invasion effector genes/proteins in an indirect manner. Moreover, NDRG1 knockdown also reduced pro-invasion genes expression such as MMP7, TMPRSS4 and CTSK. These results suggest that regulation of invasion and metastasis by NDRG1 is a highly complicated process.

Anti-Proliferation and Anti-Invasion Effects of Diosgenin on Gastric Cancer BGC-823 Cells with HIF-1α shRNAs

Directory of Open Access Journals (Sweden)

Yuan-Neng Chou

2012-05-01

Full Text Available Drug resistance is a major factor for the limited efficacy of chemotherapy in gastric cancer treatment. Hypoxia-inducible factor-1α (HIF-1α, a central transcriptional factor in hypoxia, is suggested to participate in the resistance. Here, we identified a hypoxia-mimic (cobalt chloride sensitive gastric cell line BGC-823 to explore whether diosgenin, an aglycone of steroidal saponins, can inhibit cancer cell invasion and survival of solid tumor in a hypoxic mimic microenvironment. We have shown that diosgenin is a potent candidate for decreasing the ability of invasion and survival in cobalt chloride treated BGC-823 cells. In addition, when combined with HIF-1α specific short hairpin RNA (shRNA, diosgenin can inhibit BGC-823 cells more effectively. The anti-invasion role of diosgenin may be related to E-cadherin, integrinα5 and integrinβ6. These results suggest that diosgenin may be a useful compound in controlling gastric cancer cells in hypoxia condition, especially when combined with down-regulated HIF-1α.

International assessment of PCA codes

International Nuclear Information System (INIS)

Neymotin, L.; Lui, C.; Glynn, J.; Archarya, S.

1993-11-01

Over the past three years (1991-1993), an extensive international exercise for intercomparison of a group of six Probabilistic Consequence Assessment (PCA) codes was undertaken. The exercise was jointly sponsored by the Commission of European Communities (CEC) and OECD Nuclear Energy Agency. This exercise was a logical continuation of a similar effort undertaken by OECD/NEA/CSNI in 1979-1981. The PCA codes are currently used by different countries for predicting radiological health and economic consequences of severe accidents at nuclear power plants (and certain types of non-reactor nuclear facilities) resulting in releases of radioactive materials into the atmosphere. The codes participating in the exercise were: ARANO (Finland), CONDOR (UK), COSYMA (CEC), LENA (Sweden), MACCS (USA), and OSCAAR (Japan). In parallel with this inter-code comparison effort, two separate groups performed a similar set of calculations using two of the participating codes, MACCS and COSYMA. Results of the intercode and inter-MACCS comparisons are presented in this paper. The MACCS group included four participants: GREECE: Institute of Nuclear Technology and Radiation Protection, NCSR Demokritos; ITALY: ENEL, ENEA/DISP, and ENEA/NUC-RIN; SPAIN: Universidad Politecnica de Madrid (UPM) and Consejo de Seguridad Nuclear; USA: Brookhaven National Laboratory, US NRC and DOE

Cardiac Iodine-123 metaiodobenzylguanidine (123I-MIBG) scintigraphy parameter predicts cardiac and cerebrovascular events in type 2 diabetic patients without structural heart disease

International Nuclear Information System (INIS)

Yufu, Kunio; Takahashi, Naohiko; Okada, Norihiro; Shinohara, Tetsuji; Nakagawa, Mikiko; Hara, Masahide; Yoshimatsu, Hironobu; Saikawa, Tetsunori

2012-01-01

Cardiac iodine-123 metaiodobenzylguanidine ( 123 I-MIBG) scintigraphy is an established method of assessment of cardiovascular sympathetic function. The aim of the present study was to investigate the long-term cardiovascular predictive value of cardiac 123 I-MIBG scintigraphy parameters in Japanese type 2 diabetic patients without structural heart disease. Cardiac 123 I-MIBG scintigraphy in 108 patients with type 2 diabetes who did not have structural heart disease, was evaluated. The washout rate (WR) was considered enhanced if it was ≥40%. Accurate follow-up information for 4.6 years was obtained in 54 enhanced WR patients (27 male; mean age, 61±11 years) and in 54 sex- and age-matched preserved WR patients (27 male; mean age, 61±10 years). Major adverse cardiac and cerebrovascular events (MACCE) were investigated. During follow-up, 10 enhanced WR patients developed MACCE including cardiac death, coronary revascularization, stroke, and congestive heart failure, while MACCE occurred in only 3 male patients. The Kaplan-Meier curves indicated that enhanced WR patients had higher incidence of MACCE than those with preserved WR (P 123 I-MIBG scintigraphy at baseline has long-term cardiovascular predictive value in Japanese patients with type 2 diabetes without structural heart disease. (author)

ERK1/2 signalling pathway is involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion.

Science.gov (United States)

Chen, Liping; Pan, Yuqin; Gu, Ling; Nie, Zhenlin; He, Bangshun; Song, Guoqi; Li, Rui; Xu, Yeqiong; Gao, Tianyi; Wang, Shukui

2013-08-01

This study aimed to investigate the role of CD147 in the progression of gastric cancer and the signalling pathway involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion. Short hairpin RNA (shRNA) expression vectors targeting CD147 were constructed to silence CD147, and the expression of CD147 was monitored by quantitative realtime reverse transcriptase polymerase chain reaction and Western blot and further confirmed by immunohistochemistry in vivo. Cell proliferation was determined by Cell Counting Kit-8 assay, the activities of matrix metalloproteinase (MMP)-2 and MMP-9 were determined by gelatin zymography, and the invasion of SGC7901 was determined by invasion assay. The phosphorylation and non-phosphorylation of the mitogen-activated protein kinases, extracellular signal-regulated kinase1/2 (ERK1/2), P38 and c-Jun NH2-terminal kinase were examined by Western blot. Additionally, the ERK1/2 inhibitor U0126 were used to confirm the signalling pathway involved in CD147-mediated SGC7901 progression. The BALB/c nude mice were used to study tumour progression in vivo. The results revealed that CD147 silencing inhibited the proliferation and invasion of SGC7901 cells, and down-regulated the activities of MMP-2 and MMP-9 and the phosphorylation of the ERK1/2 in SGC7901 cells. ERK1/2 inhibitor U0126 decreased the proliferation, and invasion of SGC7901 cells, and down-regulated the MMP-2 and MMP-9 activities. In a nude mouse model of subcutaneous xenografts, the tumour volume was significantly smaller in the SGC7901/shRNA group compared to the SGC7901 and SGC7901/snc-RNA group. Immunohistochemistry analysis showed that CD147 and p-ERK1/2 protein expressions were down-regulated in the SGC7901/shRNA2 group compared to the SGC7901 and SGC7901/snc-RNA group. These results suggest that ERK1/2 pathway involves in CD147-mediated gastric cancer growth and invasion. These findings further highlight the importance of CD147 in cancer progression

Plant specific PTS analysis of Kori Unit 1

Energy Technology Data Exchange (ETDEWEB)

Sung-Yull, Hong; Changheui, Jang; Ill-Seok, Jeong [Korea Eletric Power Research Inst., Daejon (Korea, Republic of); Tae-Eun, Jin [Korea Power Engineering Company, Yonging (Korea, Republic of)

1997-09-01

Currently, a nuclear PLIM (Plant Lifetime Management) program is underway in Korea to extend the operation life of Kori-1 which was originally licensed for 30 years. For the life extension of nuclear power plants, the residual lives of major components should be evaluated for the extended operation period. According to the residual life evaluation of reactor pressure vessel, which was classified as one of the major components crucial to life extension, it was found by screening analysis that reference PTS temperature would exceed screening criteria before the target extended operation years. In order to deal with this problem, a plant-specific PTS analysis for Kori-1 RPV has been initiated. In this paper, the relationship between PTS analysis and Kori-1 PLIM program is briefly described. The plant-specific PTS analysis covers system transient analysis, downcomer mixing analysis, and probabilistic fracture mechanics analysis to check the integrity or RPV during various PTS transients. The step-by-step procedure of the analysis will be described in detail. Finally, various issues regarding RPV materials and its integrity will be briefly mentioned, and their implications on Kori-1 PTS analysis will be discussed. Despite of the screening analysis result concern, it is now expected that Kori-1 PTS issues can be handled through the plant-specific PTS analysis. (author). 14 refs, 4 figs, 2 tabs.

Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

Directory of Open Access Journals (Sweden)

Yao Hailan

2012-08-01

Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.

Programmed death-1 expression on HIV-1-specific CD8+ T cells is shaped by epitope specificity, T-cell receptor clonotype usage and antigen load

DEFF Research Database (Denmark)

Kløverpris, Henrik N; McGregor, Reuben; McLaren, James E

2014-01-01

of differentiation on HIV-1-specific CD8+ T-cell populations(n = 128) spanning 11 different epitope targets. RESULTS: Expression levels of PD-1, but not CD244 or LAG-3, varied substantially across epitope specificities both within and between individuals. Differential expression of PD-1 on T-cell receptor (TCR...

TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells

Directory of Open Access Journals (Sweden)

Nikolett Sándor

2015-10-01

Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.

Electronic Biometric Transmission Specification. Version 1.2

Science.gov (United States)

2006-11-08

Prescribed by ANSI Std Z39-18 Electronic Biometric Transmission Specification DIN: DOD_BTF_TS_EBTS_ Nov06_01.02.00 i Revision History Revision...contains: • the ORI • a Greenwich Mean (a.k.a. Zulu or UTC) date/time stamp • a code for the software used at the point of collection/transmission...long names and would generally include the tribe name. Subfield 1 Item 1 Character Type AS Characters 1 to 50 Special Characters: Any 7-bit non

Monoclonal antibodies against pregnancy-specific β1-glycoprotein (SP1) in immunohistochemistry and radioimmunoassay

International Nuclear Information System (INIS)

Wahlstroem, T.; Heikinheimo, M.

1983-01-01

Monoclonal mouse antibodies against pregnancy-specific beta-1-glycoprotein (SP 1 ) have been studied for their suitability in immunoperoxidase staining and radioimmunoassay methodologies. These antibodies were useful in staining normal placentas, hydatidiform moles, invasive moles and choriocarcinomas. They showed good specificity, with minimal background staining, and will thus be superior to conventional polyclonal antisera in immunohistochemistry. However, the presently tested monoclonal anti-SP 1 antibodies were found not to be suitable for radioimmunoassay. (Auth.)

Engineered Cpf1 variants with altered PAM specificities.

Science.gov (United States)

Gao, Linyi; Cox, David B T; Yan, Winston X; Manteiga, John C; Schneider, Martin W; Yamano, Takashi; Nishimasu, Hiroshi; Nureki, Osamu; Crosetto, Nicola; Zhang, Feng

2017-08-01

The RNA-guided endonuclease Cpf1 is a promising tool for genome editing in eukaryotic cells. However, the utility of the commonly used Acidaminococcus sp. BV3L6 Cpf1 (AsCpf1) and Lachnospiraceae bacterium ND2006 Cpf1 (LbCpf1) is limited by their requirement of a TTTV protospacer adjacent motif (PAM) in the DNA substrate. To address this limitation, we performed a structure-guided mutagenesis screen to increase the targeting range of Cpf1. We engineered two AsCpf1 variants carrying the mutations S542R/K607R and S542R/K548V/N552R, which recognize TYCV and TATV PAMs, respectively, with enhanced activities in vitro and in human cells. Genome-wide assessment of off-target activity using BLISS indicated that these variants retain high DNA-targeting specificity, which we further improved by introducing an additional non-PAM-interacting mutation. Introducing the identified PAM-interacting mutations at their corresponding positions in LbCpf1 similarly altered its PAM specificity. Together, these variants increase the targeting range of Cpf1 by approximately threefold in human coding sequences to one cleavage site per ∼11 bp.

Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

International Nuclear Information System (INIS)

Dai, Guodong; Peng, Tao; Zhou, Xuhong; Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi; Yuan, Yulin

2013-01-01

Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and

Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

Energy Technology Data Exchange (ETDEWEB)

Dai, Guodong [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Peng, Tao; Zhou, Xuhong [Department of Otolaryngology-Head and Neck Surgery, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Yuan, Yulin, E-mail: yuanyulin19620120@126.com [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China)

2013-11-01

Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and

Diabetes mellitus: long-term prognostic value of whole-body MR imaging for the occurrence of cardiac and cerebrovascular events.

Science.gov (United States)

Bamberg, Fabian; Parhofer, Klaus G; Lochner, Elena; Marcus, Roy P; Theisen, Daniel; Findeisen, Hannes M; Hoffmann, Udo; Schönberg, Stefan O; Schlett, Christopher L; Reiser, Maximilian F; Weckbach, Sabine

2013-12-01

To study the predictive value of whole-body magnetic resonance (MR) imaging for the occurrence of cardiac and cerebrovascular events in a cohort of patients with diabetes mellitus (DM). This HIPAA-compliant study was approved by the institutional review board. Informed consent was obtained from all patients before enrollment into the study. The authors followed up 65 patients with DM (types 1 and 2) who underwent a comprehensive, contrast material-enhanced whole-body MR imaging protocol, including brain, cardiac, and vascular sequences at baseline. Follow-up was performed by phone interview. The primary endpoint was a major adverse cardiac and cerebrovascular event (MACCE), which was defined as composite cardiac-cerebrovascular death, myocardial infarction, cerebrovascular event, or revascularization. MR images were assessed for the presence of systemic atherosclerotic vessel changes, white matter lesions, and myocardial changes. Kaplan-Meier survival and Cox regression analyses were performed to determine associations. Follow-up was completed in 61 patients (94%; median age, 67.5 years; 30 women [49%]; median follow-up, 70 months); 14 of the 61 patients (23%) experienced MACCE. Although normal whole-body MR imaging excluded MACCE during the follow-up period (0%; 95% confidence interval [CI]: 0%, 17%), any detectable ischemic and/or atherosclerotic changes at whole-body MR imaging (prevalence, 66%) conferred a cumulative event rate of 20% at 3 years and 35% at 6 years. Whole-body MR imaging summary estimate of disease was strongly predictive for MACCE (one increment of vessel score and each territory with atherosclerotic changes: hazard ratio, 13.2 [95% CI: 4.5, 40.1] and 3.9 [95% CI: 2.2, 7.5], respectively), also beyond clinical characteristics as well as individual cardiac or cerebrovascular MR findings. These initial data indicate that disease burden as assessed with whole-body MR imaging confers strong prognostic information in patients with DM. Online

Development of web-based Off-Site Consequence Analysis Program (OSCAP) for extending ILRT intervals and its application

International Nuclear Information System (INIS)

Jeon, Ho-Jun; Hwang, Seok-Won; Oh, Ji-Yong

2012-01-01

Highlights: ► We develop web-based offsite consequence analysis program based on MACCS II code. ► The program has an automatic processing module to make the main input data. ► It is effective in conducting risk assessments according to extending ILRT intervals. ► Even a beginner can perform offsite consequence analysis with the program. - Abstract: For an offsite consequence analysis, MELCOR Accident Consequence Code System (MACCS) II code is widely used as a tool. In this study, the algorithm of web-based Off-Site Consequence Analysis Program (OSCAP) using the MACCS II code was developed for an integrated leak rate test (ILRT) interval extension and Level 3 probabilistic safety assessment (PSA), and verification and validation (V and V) of the program was performed. The main input data of the MACCS II code are meteorological data, population distribution data and source term data. However, it requires lots of time and efforts to generate the main input data for an offsite consequence analysis using the MACCS II code. For example, the meteorological data are collected from each nuclear power site in real time, but the formats of the raw data collected are different from each other as a site. To reduce efforts and time for risk assessments, the web-based OSCAP has an automatic processing module which converts the format of the raw data collected from each site in Korea to the input data format of the MACCS II code. The program also provides an automatic function of converting the latest population data from Statistics Korea, the National Statistical Office, to the population distribution input data format of the MACCS II code. In case of the source term data, the program includes the release fraction of each source term category resulting from Modular Accident Analysis Program (MAAP) code analysis and the core inventory data from ORIGEN code analysis. These analysis results of each plant in Korea are stored in a database module of the web-based OSCAP, so a

Isozyme-specific fluorescent inhibitor of glutathione s-transferase omega 1.

Science.gov (United States)

Son, Junghyun; Lee, Jae-Jung; Lee, Jun-Seok; Schüller, Andreas; Chang, Young-Tae

2010-05-21

Recently, the glutathione S-transferase omega 1 (GSTO1) is suspected to be involved in certain cancers and neurodegenerative diseases. However, profound investigation on the pathological roles of GSTO1 has been hampered by the lack of specific methods to determine or modulate its activity in biological systems containing other isoforms with similar catalytic function. Here, we report a fluorescent compound that is able to inhibit and monitor the activity of GSTO1. We screened 43 fluorescent chemicals and found a compound (6) that binds specifically to the active site of GSTO1. We observed that compound 6 inhibits GSTO1 by covalent modification but spares other isoforms in HEK293 cells and demonstrated that compound 6 could report the activity of GSTO1 in NIH/3T3 or HEK293 cells by measuring the fluorescence intensity of the labeled amount of GSTO1 in SDS-PAGE. Compound 6 is a useful tool to study GSTO1, applicable as a specific inhibitor and an activity reporter.

Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

Directory of Open Access Journals (Sweden)

Yong Wang

Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

Alpha1a-Adrenoceptor Genetic Variant Triggers Vascular Smooth Muscle Cell Hyperproliferation and Agonist Induced Hypertrophy via EGFR Transactivation Pathway.

Directory of Open Access Journals (Sweden)

Irina Gradinaru

Full Text Available α1a Adrenergic receptors (α1aARs are the predominant AR subtype in human vascular smooth muscle cells (SMCs. α1aARs in resistance vessels are crucial in the control of blood pressure, yet the impact of naturally occurring human α1aAR genetic variants in cardiovascular disorders remains poorly understood. To this end, we present novel findings demonstrating that 3D cultures of vascular SMCs expressing human α1aAR-247R (247R genetic variant demonstrate significantly increased SMC contractility compared with cells expressing the α1aAR-WT (WT receptor. Stable expression of 247R genetic variant also triggers MMP/EGFR-transactivation dependent serum- and agonist-independent (constitutive hyperproliferation and agonist-dependent hypertrophy of SMCs. Agonist stimulation reduces contractility Using pathway-specific inhibitors we determined that the observed hyperproliferation of 247R-expressing cells is triggered via β-arrestin1/Src/MMP-2/EGFR/ERK-dependent mechanism. MMP-2-specific siRNA inhibited 247R-triggered hyperproliferation indicating MMP-2 involvement in 247R-triggered hyperproliferation in SMCs. β-arrestin1-specific shRNA also inhibited 247R-triggered hyperproliferation but did not affect hypertrophy in 247R-expressing SMCs, indicating that agonist-dependent hypertrophy is independent of β-arrestin1. Our data reveal that in different cardiovascular cells the same human receptor genetic variant can activate alternative modulators of the same signaling pathway. Thus, our findings in SMCs demonstrate that depending on the type of cells expressing the same receptor (or receptor variant, different target-specific inhibitors could be used to modulate aberrant hyperproliferative or hypertrophic pathways in order to restore normal phenotype.

BRCA1 Is a Histone-H2A-Specific Ubiquitin Ligase

Directory of Open Access Journals (Sweden)

Reinhard Kalb

2014-08-01

Full Text Available The RING domain proteins BRCA1 and BARD1 comprise a heterodimeric ubiquitin (E3 ligase that is required for the accumulation of ubiquitin conjugates at sites of DNA damage and for silencing at DNA satellite repeat regions. Despite its links to chromatin, the substrate and underlying function of the BRCA1/BARD1 ubiquitin ligase remain unclear. Here, we show that BRCA1/BARD1 specifically ubiquitylates histone H2A in its C-terminal tail on lysines 127 and 129 in vitro and in vivo. The specificity for K127-129 is acquired only when H2A is within a nucleosomal context. Moreover, site-specific targeting of the BRCA1/BARD1 RING domains to chromatin is sufficient for H2Aub foci formation in vivo. Our data establish BRCA1/BARD1 as a histone-H2A-specific E3 ligase, helping to explain its localization and activities on chromatin in cells.

Regression of mouse-derived renal cancer by adoptive transfer of ...

African Journals Online (AJOL)

USER

2010-08-16

Mizuguchi et al., 2005) and negative control shRNA targeting none specific gene ..... factor-beta type II receptor suppresses ocular inflammation and fibrosis. ... in bone marrow cells through a retroviral-mediated gene therapy in mice.

Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases

Directory of Open Access Journals (Sweden)

Saito Koji

2005-08-01

Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1

Lactoferrin promote primary rat osteoblast proliferation and differentiation via up-regulation of insulin-like growth factor-1 expression.

Science.gov (United States)

Hou, Jian-ming; Wu, Man; Lin, Qing-ming; Lin, Fan; Xue, Ying; Lan, Xu-hua; Chen, En-yu; Wang, Mei-li; Yang, Hai-yan; Wang, Feng-xiong

2014-08-01

The aim of this study was to explore the effect of lactoferrin (LF) in primary fetal rat osteoblasts proliferation and differentiation and investigate the underlying molecular mechanisms. Primary rat osteoblasts were obtained from the calvarias of neonatal rats. Osteoblasts were treated with LF (0.1-1000 μg/mL), or OSI-906 [a selective inhibitor of insulin-like growth factor 1 (IGF-1) receptor and insulin receptor]. The IGF-1 was then knocked down by small hairpin RNA (shRNA) technology and then was treated with recombinant human IGF-1 or LF. Cell proliferation and differentiation were measured by MTT assay and alkaline phosphatase (ALP) assay, respectively. The expression of IGF-1 and IGF binding protein 2 (IGFBP2) mRNA were analyzed using real-time PCR. LF promotes the proliferation and differentiation of osteoblasts in a certain range (1-100 μg/mL) in time- and dose-dependent manner. The mRNA level of IGF-1 was significantly increased, while the expression of IGFBP2 was suppressed by LF treatment. Knockdown of IGF-1 by shRNA in primary rat osteoblast dramatically decreased the abilities of proliferation and differentiation of osteoblasts and blocked the proliferation and differentiation effect of LF in osteoblasts. OSI906 (5 μM) blocked the mitogenic and differentiation of LF in osteoblasts. Proliferation and differentiation of primary rat osteoblasts in response to LF are mediated in part by stimulating of IGF-1 gene expression and alterations in the gene expression of IGFBP2.

DNMT1 is associated with cell cycle and DNA replication gene sets in diffuse large B-cell lymphoma.

Science.gov (United States)

Loo, Suet Kee; Ab Hamid, Suzina Sheikh; Musa, Mustaffa; Wong, Kah Keng

2018-01-01

Dysregulation of DNA (cytosine-5)-methyltransferase 1 (DNMT1) is associated with the pathogenesis of various types of cancer. It has been previously shown that DNMT1 is frequently expressed in diffuse large B-cell lymphoma (DLBCL), however its functions remain to be elucidated in the disease. In this study, we gene expression profiled (GEP) shRNA targeting DNMT1(shDNMT1)-treated germinal center B-cell-like DLBCL (GCB-DLBCL)-derived cell line (i.e. HT) compared with non-silencing shRNA (control shRNA)-treated HT cells. Independent gene set enrichment analysis (GSEA) performed using GEPs of shRNA-treated HT cells and primary GCB-DLBCL cases derived from two publicly-available datasets (i.e. GSE10846 and GSE31312) produced three separate lists of enriched gene sets for each gene sets collection from Molecular Signatures Database (MSigDB). Subsequent Venn analysis identified 268, 145 and six consensus gene sets from analyzing gene sets in C2 collection (curated gene sets), C5 sub-collection [gene sets from gene ontology (GO) biological process ontology] and Hallmark collection, respectively to be enriched in positive correlation with DNMT1 expression profiles in shRNA-treated HT cells, GSE10846 and GSE31312 datasets [false discovery rate (FDR) 0.8) with DNMT1 expression and significantly downregulated (log fold-change <-1.35; p<0.05) following DNMT1 silencing in HT cells. These results suggest the involvement of DNMT1 in the activation of cell cycle and DNA replication in DLBCL cells. Copyright © 2017 Elsevier GmbH. All rights reserved.

Test Specification of A1-1 Test for OECD-ATLAS Project

International Nuclear Information System (INIS)

Kang, Kyoung-Ho; Moon, Sang-Ki; Lee, Seung-Wook; Choi, Ki-Yong; Song, Chul-Hwa

2014-01-01

In the OECD-ATLAS project, design extension conditions (DECs) such as a station blackout (SBO) and a total loss of feed water (TLOFW) will be experimentally investigated to meet the international interests in the multiple high-risk DECs raised after the Fukushima accident. The proposed test matrix for the OECD-ATLAS project is summarized in Table 1.. In this study, detailed specification of the first test named as A1-1 in the OECD-ATLAS project was described. The target scenario of the A1-1 test is a prolonged SBO with delayed supply of turbine-driven auxiliary feedwater to only SG number 2 (SG-2). A SBO is one of the most important DECs in that without any proper operator actions, a total loss of heat sink leads to core uncover, to core damage, and ultimately a core melt-down scenario under high pressure. Due to this safety importance, a SBO is considered to be a base test item of the OECD-ATLAS project. A detailed specification of the first test named as A1-1 in the OECD-ATLAS project was described. The target scenario of the A1-1 test is a prolonged SBO with delayed supply of turbine-driven auxiliary feedwater to only SG-2 in order to consider an accident mitigation measure. The pre-test analysis using MARS code was performed with an aim of setting up the detailed test procedures for A1-1 test and also gaining the physical insights for a prolonged SBO transient. In the A1-1 test, a prolonged SBO transient will be simulated with two temporal phases: Phase (I) for conservative SBO transient without supply of turbine-driven auxiliary feedwater and Phase (II) for asymmetric cooling via single trained supply of turbine-driven auxiliary feedwater

Cytosolic malate dehydrogenase regulates RANKL-mediated osteoclastogenesis via AMPK/c-Fos/NFATc1 signaling

Energy Technology Data Exchange (ETDEWEB)

Oh, Se Jeong [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Gu, Dong Ryun [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Jin, Su Hyun [Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Park, Keun Ha [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Lee, Seoung Hoon, E-mail: leesh2@wku.ac.kr [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Wonkwang Institute of Biomaterials and Implant, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of)

2016-06-17

Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.

Cytosolic malate dehydrogenase regulates RANKL-mediated osteoclastogenesis via AMPK/c-Fos/NFATc1 signaling

International Nuclear Information System (INIS)

Oh, Se Jeong; Gu, Dong Ryun; Jin, Su Hyun; Park, Keun Ha; Lee, Seoung Hoon

2016-01-01

Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.

HIV-1-Specific IgA Monoclonal Antibodies from an HIV-1 Vaccinee Mediate Galactosylceramide Blocking and Phagocytosis

Science.gov (United States)

2018-01-01

ABSTRACT Vaccine-elicited humoral immune responses comprise an array of antibody forms and specificities, with only a fraction contributing to protective host immunity. Elucidation of antibody effector functions responsible for protective immunity against human immunodeficiency virus type 1 (HIV-1) acquisition is a major goal for the HIV-1 vaccine field. Immunoglobulin A (IgA) is an important part of the host defense against pathogens; however, little is known about the role of vaccine-elicited IgA and its capacity to mediate antiviral functions. To identify the antiviral functions of HIV-1-specific IgA elicited by vaccination, we cloned HIV-1 envelope-specific IgA monoclonal antibodies (MAbs) by memory B cell cultures from peripheral blood mononuclear cells from an RV144 vaccinee and produced two IgA clonal cell lines (HG129 and HG130) producing native, nonrecombinant IgA MAbs. The HG129 and HG130 MAbs mediated phagocytosis by monocytes, and HG129 blocked HIV-1 Env glycoprotein binding to galactosylceramide, an alternative HIV-1 receptor. These findings elucidate potential antiviral functions of vaccine-elicited HIV-1 envelope-specific IgA that may act to block HIV-1 acquisition at the portal of entry by preventing HIV-1 binding to galactosylceramide and mediating antibody Fc receptor-mediated virion phagocytosis. Furthermore, these findings highlight the complex and diverse interactions of vaccine-elicited IgA with pathogens that depend on IgA fine specificity and form (e.g., multimeric or monomeric) in the systemic circulation and mucosal compartments. IMPORTANCE Host-pathogen interactions in vivo involve numerous immune mechanisms that can lead to pathogen clearance. Understanding the nature of antiviral immune mechanisms can inform the design of efficacious HIV-1 vaccine strategies. Evidence suggests that both neutralizing and nonneutralizing antibodies can mediate some protection against HIV in animal models. Although numerous studies have characterized the

Marginal abatement cost curves for NOx that account for ...

Science.gov (United States)

A marginal abatement cost curve (MACC) traces out the relationship between the quantity of pollution abated and the marginal cost of abating each additional unit. In the context of air quality management, MACCs typically are developed by sorting end-of-pipe controls by their respective cost effectiveness. Alternative measures, such as renewable electricity, energy efficiency, and fuel switching (RE/EE/FS), are not considered as it is difficult to quantify their abatement potential. In this paper, we demonstrate the use of an energy system model to develop a MACC for nitrogen oxides (NOx) that incorporates both end-of-pipe controls and these alternative measures. We decompose the MACC by sector, and evaluate the cost-effectiveness of RE/EE/FS relative to end-of-pipe controls. RE/EE/FS are shown to produce considerable emission reductions after end-of-pipe controls have been exhausted. Furthermore, some RE/EE/FS are shown to be cost-competitive with end-of-pipe controls. Demonstrate how the MARKAL energy system model can be used to evaluate the potential role of renewable electricity, energy efficiency and fuel switching (RE/EE/FS) in achieving NOx reductions. For this particular analysis, we show that RE/EE/FSs are able to increase the quantity of NOx reductions available for a particular marginal cost (ranging from $5k per ton to $40k per ton) by approximately 50%.

Pancreas lineage allocation and specification are regulated by sphingosine-1-phosphate signalling

Science.gov (United States)

Serafimidis, Ioannis; Rodriguez-Aznar, Eva; Lesche, Mathias; Yoshioka, Kazuaki; Takuwa, Yoh; Dahl, Andreas; Pan, Duojia; Gavalas, Anthony

2017-01-01

During development, progenitor expansion, lineage allocation, and implementation of differentiation programs need to be tightly coordinated so that different cell types are generated in the correct numbers for appropriate tissue size and function. Pancreatic dysfunction results in some of the most debilitating and fatal diseases, including pancreatic cancer and diabetes. Several transcription factors regulating pancreas lineage specification have been identified, and Notch signalling has been implicated in lineage allocation, but it remains unclear how these processes are coordinated. Using a combination of genetic approaches, organotypic cultures of embryonic pancreata, and genomics, we found that sphingosine-1-phosphate (S1p), signalling through the G protein coupled receptor (GPCR) S1pr2, plays a key role in pancreas development linking lineage allocation and specification. S1pr2 signalling promotes progenitor survival as well as acinar and endocrine specification. S1pr2-mediated stabilisation of the yes-associated protein (YAP) is essential for endocrine specification, thus linking a regulator of progenitor growth with specification. YAP stabilisation and endocrine cell specification rely on Gαi subunits, revealing an unexpected specificity of selected GPCR intracellular signalling components. Finally, we found that S1pr2 signalling posttranscriptionally attenuates Notch signalling levels, thus regulating lineage allocation. Both S1pr2-mediated YAP stabilisation and Notch attenuation are necessary for the specification of the endocrine lineage. These findings identify S1p signalling as a novel key pathway coordinating cell survival, lineage allocation, and specification and linking these processes by regulating YAP levels and Notch signalling. Understanding lineage allocation and specification in the pancreas will shed light in the origins of pancreatic diseases and may suggest novel therapeutic approaches. PMID:28248965

Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models

Directory of Open Access Journals (Sweden)

Rahul Jandial

2018-01-01

Full Text Available Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1 to detoxify the toxic glycolytic byproduct methylglyoxal (MG and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs. Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM, the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA approaches. Inhibition of GLO1 with S-(p-bromobenzyl glutathione dicyclopentyl ester (p-BrBzGSH(Cp2 increased levels of the DNA-AGE N2-1-(carboxyethyl-2′-deoxyguanosine (CEdG, a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE; and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p-BrBzGSH(Cp2 exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors.

Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models.

Science.gov (United States)

Jandial, Rahul; Neman, Josh; Lim, Punnajit P; Tamae, Daniel; Kowolik, Claudia M; Wuenschell, Gerald E; Shuck, Sarah C; Ciminera, Alexandra K; De Jesus, Luis R; Ouyang, Ching; Chen, Mike Y; Termini, John

2018-01-30

Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1) to detoxify the toxic glycolytic byproduct methylglyoxal (MG) and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs). Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM), the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA) approaches. Inhibition of GLO1 with S -( p -bromobenzyl) glutathione dicyclopentyl ester ( p- BrBzGSH(Cp)₂) increased levels of the DNA-AGE N ²-1-(carboxyethyl)-2'-deoxyguanosine (CEdG), a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE); and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p -BrBzGSH(Cp)₂ exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors.

A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

Directory of Open Access Journals (Sweden)

Ma Weiwei

2009-01-01

Full Text Available RNA interference (RNAi is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene.

A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

Science.gov (United States)

Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

2009-01-01

RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

Inflammation-Specific T1 Imaging Using Anti-Intercellular Adhesion Molecule 1 Antibody-Conjugated Gadolinium Diethylenetriaminepentaacetic Acid

Directory of Open Access Journals (Sweden)

Kyu-Sil Choi

2007-03-01

Full Text Available To examine inflammatory tissue, an initial and common symptom of various types of pathogenesis, we designed inflammation-targeted T1 contrast agents prepared by bioconjugation of gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA with anti-intercellular adhesion molecule 1 (ICAM-1 antibody. The anti-ICAM-1 antibody was coupled with DTPA and was then conjugated with Gd. The specific binding of the Gd-DTPA-anti-ICAM-1 antibody complex to the ICAM-1-expressing cells was examined in the cultured endothelial cells where ICAM-1 expression was stimulated. Inflammation-specific T1 imaging was then assessed using a mouse abscess model with the 1.5-Tesla module. The Gd-DTPA-anti-ICAM-1 antibody displayed increased r1, which was two times higher than that of Gd-DTPA and showed predominant binding to cultured endothelial cells, which expressed a high level of ICAM-1. Moreover, the inflammation-specific T1 enhancement was imaged with the Gd-DTPA-anti-ICAM-1 antibody in the mouse acute inflammation model. The Gd-DTPA-anti-ICAM-1 antibody showed significantly increased vascular circulation time, which thereby offered a greater chance for its binding to the target cells. The Gd-DTPA-anti-ICAM-1 antibody displays a potential targeted T1 contrast agent specific to the inflammatory tissue that expresses ICAM-1.

Noxa/Mcl-1 Balance Regulates Susceptibility of Cells to Camptothecin-Induced Apoptosis

Directory of Open Access Journals (Sweden)

Yide Mei

2007-10-01

Full Text Available Although camptothecin (CPT has been reported to induce apoptosis in various cancer cells, the molecular details of this regulation remain largely unknown. In this study, we demonstrate that 131-113-only protein Noxa is upregulated during CPT-induced apoptosis, which is independent of p53. In addition, we show that phosphatidylinositol 3-kinase (PI3K/Akt signaling pathway is responsible for Noxa's induction. Luciferase assay, cAMP response element binding protein (CREB knockdown experiments further demonstrate that CREB is involved in the transcriptional upregulation of Noxa. Moreover, blocking Noxa expression using specific small interfering ribonucleic acid (siRNA significantly reduces the apoptosis in response to CPT, indicating that Noxa is an essential mediator for CPT-induced apoptosis. Interestingly, antiapoptotic Mcl-1 was also upregulated through PI3K/Akt signaling pathway upon CPT treatment. Using immunoprecipitation assay, Noxa was found to interact with Mcl-1 in the presence or absence of CPT. Knockdown of Mcl-1 expression by short hairpin ribonucleic acid (shRNA was shown to potentiate CPT-induced apoptosis. Consistently, ectopic overexpression of Mcl-1 rescued cells from apoptosis induced by CPT. Cells coexpressing Noxa, Mcl-1 at different ratio correlates well with the extent of apoptosis, suggesting that the balance between Noxa, Mcl-1 may determine the susceptibility of HeLa cells to CPT-induced apoptosis.

ERK1/2 signaling plays an important role in topoisomerase II poison-induced G2/M checkpoint activation.

Science.gov (United States)

Kolb, Ryan H; Greer, Patrick M; Cao, Phu T; Cowan, Kenneth H; Yan, Ying

2012-01-01

Topo II poisons, which target topoisomerase II (topo II) to generate enzyme mediated DNA damage, have been commonly used for anti-cancer treatment. While clinical evidence demonstrate a capability of topo II poisons in inducing apoptosis in cancer cells, accumulating evidence also show that topo II poison treatment frequently results in cell cycle arrest in cancer cells, which was associated with subsequent resistance to these treatments. Results in this report indicate that treatment of MCF-7 and T47D breast cancer cells with topo II poisons resulted in an increased phosphorylation of extracellular signal-regulated kinase 1 and 2 (ERK1/2) and an subsequent induction of G2/M cell cycle arrest. Furthermore, inhibition of ERK1/2 activation using specific inhibitors markedly attenuated the topo II poison-induced G2/M arrest and diminished the topo II poison-induced activation of ATR and Chk1 kinases. Moreover, decreased expression of ATR by specific shRNA diminished topo II poison-induced G2/M arrest but had no effect on topo II poison-induced ERK1/2 activation. In contrast, inhibition of ERK1/2 signaling had little, if any, effect on topo II poison-induced ATM activation. In addition, ATM inhibition by either incubation of cells with ATM specific inhibitor or transfection of cells with ATM specific siRNA did not block topo II poison-induced G2/M arrest. Ultimately, inhibition of ERK1/2 signaling greatly enhanced topo II poison-induced apoptosis. These results implicate a critical role for ERK1/2 signaling in the activation of G2/M checkpoint response following topo II poison treatment, which protects cells from topo II poison-induced apoptosis.

OTULIN antagonizes LUBAC signaling by specifically hydrolyzing met1-linked polyubiquitin

DEFF Research Database (Denmark)

Keusekotten, K.; Elliott, P.R.; Kulathu, Y.

2013-01-01

The linear ubiquitin (Ub) chain assembly complex (LUBAC) is an E3 ligase that specifically assembles Met1-linked (also known as linear) Ub chains that regulate nuclear factor κB (NF-κB) signaling. Deubiquitinases (DUBs) are key regulators of Ub signaling, but a dedicated DUB for Met1 linkages has...... not been identified. Here, we reveal a previously unannotated human DUB, OTULIN (also known as FAM105B), which is exquisitely specific for Met1 linkages. Crystal structures of the OTULIN catalytic domain in complex with diubiquitin reveal Met1-specific Ub-binding sites and a mechanism of substrate...

The critical role of myostatin in differentiation of sheep myoblasts

Energy Technology Data Exchange (ETDEWEB)

Liu, Chenxi [College of Life Science and Technology, Xinjiang University, Urumqi (China); Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Li, Wenrong; Zhang, Xuemei; Zhang, Ning; He, Sangang; Huang, Juncheng [Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Laboratory of Grass-fed Animal Genetics, Breeding and Reproduction of Ministry of Agriculture, Urumqi (China); Animal Biotechnological Research Center, Xinjiang Academy of Animal Science, Urumqi (China); Ge, Yubin [The State Engineering Laboratory of AIDS Vaccine, College of Life Science, Jilin University, Changchun (China); Liu, Mingjun, E-mail: xjlmj2004@yahoo.com.cn [Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Laboratory of Grass-fed Animal Genetics, Breeding and Reproduction of Ministry of Agriculture, Urumqi (China); Animal Biotechnological Research Center, Xinjiang Academy of Animal Science, Urumqi (China)

2012-06-08

Highlights: Black-Right-Pointing-Pointer Identification of the effective and specific shRNA to knockdown MSTN. Black-Right-Pointing-Pointer Overexpression of MSTN reversibly suppressed myogenic differentiation. Black-Right-Pointing-Pointer shRNA knockdown of endogenous MSTN promoted ovine myoblast differentiation. Black-Right-Pointing-Pointer MSTN inhibits myogenic differentiation through down-regulation of MyoD and Myogenin and up-regulation of Smad3. Black-Right-Pointing-Pointer Provides a promise for the generation of transgenic sheep to improve meat productivity. -- Abstract: Myostatin [MSTN, also known as growth differentiation factor 8 (GDF8)], is an inhibitor of skeletal muscle growth. Blockade of MSTN function has been reported to result in increased muscle mass in mice. However, its role in myoblast differentiation in farm animals has not been determined. In the present study, we sought to determine the role of MSTN in the differentiation of primary sheep myoblasts. We found that ectopic overexpression of MSTN resulted in lower fusion index in sheep myoblasts, which indicated the repression of myoblast differentiation. This phenotypic change was reversed by shRNA knockdown of the ectopically expressed MSTN in the cells. In contrast, shRNA knockdown of the endogenous MSTN resulted in induction of myogenic differentiation. Additional studies revealed that the induction of differentiation by knocking down the ectopically or endogenously expressed MSTN was accompanied by up-regulation of MyoD and myogenin, and down-regulation of Smad3. Our results demonstrate that MSTN plays critical role in myoblast differentiation in sheep, analogous to that in mice. This study also suggests that shRNA knockdown of MSTN could be a potentially promising approach to improve sheep muscle growth, so as to increase meat productivity.

The critical role of myostatin in differentiation of sheep myoblasts

International Nuclear Information System (INIS)

Liu, Chenxi; Li, Wenrong; Zhang, Xuemei; Zhang, Ning; He, Sangang; Huang, Juncheng; Ge, Yubin; Liu, Mingjun

2012-01-01

Highlights: ► Identification of the effective and specific shRNA to knockdown MSTN. ► Overexpression of MSTN reversibly suppressed myogenic differentiation. ► shRNA knockdown of endogenous MSTN promoted ovine myoblast differentiation. ► MSTN inhibits myogenic differentiation through down-regulation of MyoD and Myogenin and up-regulation of Smad3. ► Provides a promise for the generation of transgenic sheep to improve meat productivity. -- Abstract: Myostatin [MSTN, also known as growth differentiation factor 8 (GDF8)], is an inhibitor of skeletal muscle growth. Blockade of MSTN function has been reported to result in increased muscle mass in mice. However, its role in myoblast differentiation in farm animals has not been determined. In the present study, we sought to determine the role of MSTN in the differentiation of primary sheep myoblasts. We found that ectopic overexpression of MSTN resulted in lower fusion index in sheep myoblasts, which indicated the repression of myoblast differentiation. This phenotypic change was reversed by shRNA knockdown of the ectopically expressed MSTN in the cells. In contrast, shRNA knockdown of the endogenous MSTN resulted in induction of myogenic differentiation. Additional studies revealed that the induction of differentiation by knocking down the ectopically or endogenously expressed MSTN was accompanied by up-regulation of MyoD and myogenin, and down-regulation of Smad3. Our results demonstrate that MSTN plays critical role in myoblast differentiation in sheep, analogous to that in mice. This study also suggests that shRNA knockdown of MSTN could be a potentially promising approach to improve sheep muscle growth, so as to increase meat productivity.

Monitoring Air Quality over China: Evaluation of the modeling system of the PANDA project

Science.gov (United States)

Bouarar, Idir; Katinka Petersen, Anna; Brasseur, Guy; Granier, Claire; Xie, Ying; Wang, Xuemei; Fan, Qi; Wang, Lili

2015-04-01

Air pollution has become a pressing problem in Asia and specifically in China due to rapid increase in anthropogenic emissions related to growth of China's economic activity and increasing demand for energy in the past decade. Observed levels of particulate matter and ozone regularly exceed World Health Organization (WHO) air quality guidelines in many parts of the country leading to increased risk of respiratory illnesses and other health problems. The EU-funded project PANDA aims to establish a team of European and Chinese scientists to monitor air pollution over China and elaborate air quality indicators in support of European and Chinese policies. PANDA combines state-of-the-art air pollution modeling with space and surface observations of chemical species to improve methods for monitoring air quality. The modeling system of the PANDA project follows a downscaling approach: global models such as MOZART and MACC system provide initial and boundary conditions to regional WRF-Chem and EMEP simulations over East Asia. WRF-Chem simulations at higher resolution (e.g. 20km) are then performed over a smaller domain covering East China and initial and boundary conditions from this run are used to perform simulations at a finer resolution (e.g. 5km) over specific megacities like Shanghai. Here we present results of model simulations for January and July 2010 performed during the first year of the project. We show an intercomparison of the global (MACC, EMEP) and regional (WRF-Chem) simulations and a comprehensive evaluation with satellite measurements (NO2, CO) and in-situ data (O3, CO, NOx, PM10 and PM2.5) at several surface stations. Using the WRF-Chem model, we demonstrate that model performance is influenced not only by the resolution (e.g. 60km, 20km) but also the emission inventories used (MACCity, HTAPv2), their resolution and diurnal variation, and the choice of initial and boundary conditions (e.g. MOZART, MACC analysis).

Construction of RNAi lentiviral vector targeting mouse Islet-1 gene

Directory of Open Access Journals (Sweden)

Shen-shen ZHI

2011-02-01

Full Text Available Objective To construct and select RNAi lentiviral vectors that can silence mouse Islet-1 gene effectively.Methods Three groups of RNAi-target of mouse Islet-1 gene were designed,and corresponding shRNA oligo(sh1,sh2 and sh3 were synthesized,and then they were respectively inserted to the PLVTHM vector that had been digested by endonuclease.Agarose gel electrophoresis and sequencing were used to select and indentify the positive clones.The positive clones were extracted and then mixed with E.coli to amplify positive clones.The amplified clones were then infected into 293T along with the other 3 helper plasmids to produce lentiviral vector.After the construction of the lentiviral vector,plaque formation test was performed to determine the titer of lentiviral vector.The lentiviral vectors were then infected into C3H10T1/2 cells.The transfect efficiency of the lentiviral vectors was determined with flow cytometry with detection of green fluorescent protein(GFP.Q-PCR was employed to detect the RNAi efficiency of the lentiviral vectors.Results Agarose gel electrophoresis analysis showed that the clones with right gene at the target size were successfully established;gene sequencing showed that the right DNA fragments had been inserted;plaque formation test showed that the titer of the virus solution was 3.87×108TU/ml;the transfect efficiency of the lentiviral vector infected into C3H10T1/2 cells was 90.36%.All the 3 groups of shRNA targets(sh1,sh2 and sh3 showed an inhibitory effect on Islet-1 gene,and the sh1 showed the highest inhibitory effect(76.8%,as compared with that of normal cells(P < 0.05.Conclusion The RNAi lentiviral vector that can effectively silence the mouse Islet-1 gene has been constructed successfully,which may lay a foundation for further investigation of Islet-1 gene.

Treatment of aortic stenosis with a self-expanding transcatheter valve

DEFF Research Database (Denmark)

Linke, Axel; Wenaweser, Peter; Gerckens, Ulrich

2014-01-01

and cerebrovascular events (MACCE; all-cause mortality, myocardial infarction, stroke, or reintervention) and mortality at 30 days and 1 year. Endpoint-related events were independently adjudicated based on Valve Academic Research Consortium definitions. A total of 1015 patients [mean logistic EuroSCORE 19.4 ± 12...

Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells.

Science.gov (United States)

Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B

2017-04-01

Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.

Inhibition of Ape1 Redox Activity Promotes Odonto/osteogenic Differentiation of Dental Papilla Cells.

Science.gov (United States)

Chen, Tian; Liu, Zhi; Sun, Wenhua; Li, Jingyu; Liang, Yan; Yang, Xianrui; Xu, Yang; Yu, Mei; Tian, Weidong; Chen, Guoqing; Bai, Ding

2015-12-07

Dentinogenesis is the formation of dentin, a substance that forms the majority of teeth, and this process is performed by odontoblasts. Dental papilla cells (DPCs), as the progenitor cells of odontoblasts, undergo the odontogenic differentiation regulated by multiple cytokines and paracrine signal molecules. Ape1 is a perfect paradigm of the function complexity of a biological macromolecule with two major functional regions for DNA repair and redox regulation, respectively. To date, it remains unclear whether Ape1 can regulate the dentinogenesis in DPCs. In the present study, we firstly examed the spatio-temporal expression of Ape1 during tooth germ developmental process, and found the Ape1 expression was initially high and then gradually reduced along with the tooth development. Secondly, the osteo/odontogenic differentiation capacity of DPCs was up-regulated when treated with either Ape1-shRNA or E3330 (a specific inhibitor of the Ape1 redox function), respectively. Moreover, we found that the canonical Wnt signaling pathway was activated in this process, and E3330 reinforced-osteo/odontogenic differentiation capacity was suppressed by Dickkopf1 (DKK1), a potent antagonist of canonical Wnt signaling pathway. Taken together, we for the first time showed that inhibition of Ape1 redox regulation could promote the osteo/odontogenic differentiation capacity of DPCs via canonical Wnt signaling pathway.

Identification of Four-Jointed Box 1 (FJX1-Specific Peptides for Immunotherapy of Nasopharyngeal Carcinoma.

Directory of Open Access Journals (Sweden)

San Jiun Chai

Full Text Available Nasopharyngeal carcinoma (NPC is highly prevalent in South East Asia and China. The poor outcome is due to late presentation, recurrence, distant metastasis and limited therapeutic options. For improved treatment outcome, immunotherapeutic approaches focusing on dendritic and autologous cytotoxic T-cell based therapies have been developed, but cost and infrastructure remain barriers for implementing these in low-resource settings. As our prior observations had found that four-jointed box 1 (FJX1, a tumor antigen, is overexpressed in NPCs, we investigated if short 9-20 amino acid sequence specific peptides matching to FJX1 requiring only intramuscular immunization to train host immune systems would be a better treatment option for this disease. Thus, we designed 8 FJX1-specific peptides and implemented an assay system to first, assess the binding of these peptides to HLA-A2 molecules on T2 cells. After, ELISPOT assays were used to determine the peptides immunogenicity and ability to induce potential cytotoxicity activity towards cancer cells. Also, T-cell proliferation assay was used to evaluate the potential of MHC class II peptides to stimulate the expansion of isolated T-cells. Our results demonstrate that these peptides are immunogenic and peptide stimulated T-cells were able to induce peptide-specific cytolytic activity specifically against FJX1-expressing cancer cells. In addition, we demonstrated that the MHC class II peptides were capable of inducing T-cell proliferation. Our results suggest that these peptides are capable of inducing specific cytotoxic cytokines secretion against FJX1-expressing cancer cells and serve as a potential vaccine-based therapy for NPC patients.

Identification of Four-Jointed Box 1 (FJX1)-Specific Peptides for Immunotherapy of Nasopharyngeal Carcinoma

Science.gov (United States)

Chai, San Jiun; Yap, Yoke Yeow; Foo, Yoke Ching; Yap, Lee Fah; Ponniah, Sathibalan; Teo, Soo Hwang; Cheong, Sok Ching; Patel, Vyomesh; Lim, Kue Peng

2015-01-01

Nasopharyngeal carcinoma (NPC) is highly prevalent in South East Asia and China. The poor outcome is due to late presentation, recurrence, distant metastasis and limited therapeutic options. For improved treatment outcome, immunotherapeutic approaches focusing on dendritic and autologous cytotoxic T-cell based therapies have been developed, but cost and infrastructure remain barriers for implementing these in low-resource settings. As our prior observations had found that four-jointed box 1 (FJX1), a tumor antigen, is overexpressed in NPCs, we investigated if short 9–20 amino acid sequence specific peptides matching to FJX1 requiring only intramuscular immunization to train host immune systems would be a better treatment option for this disease. Thus, we designed 8 FJX1-specific peptides and implemented an assay system to first, assess the binding of these peptides to HLA-A2 molecules on T2 cells. After, ELISPOT assays were used to determine the peptides immunogenicity and ability to induce potential cytotoxicity activity towards cancer cells. Also, T-cell proliferation assay was used to evaluate the potential of MHC class II peptides to stimulate the expansion of isolated T-cells. Our results demonstrate that these peptides are immunogenic and peptide stimulated T-cells were able to induce peptide-specific cytolytic activity specifically against FJX1-expressing cancer cells. In addition, we demonstrated that the MHC class II peptides were capable of inducing T-cell proliferation. Our results suggest that these peptides are capable of inducing specific cytotoxic cytokines secretion against FJX1-expressing cancer cells and serve as a potential vaccine-based therapy for NPC patients. PMID:26536470

Synthesis of [diene-"1"4C] curcumin at high specific activity

International Nuclear Information System (INIS)

Filer, Crist N.; Lacy, James M.; Wright, Christopher

2016-01-01

An efficient method is described to label curcumin with "1"4C at high specific activity. - Highlights: • This paper describes the synthesis of ["1"4C] Curcumin at the highest specific activity and total activity amount yet reported. • The "1"4C label was installed in the diene framework of Curcumin. • This paper also describes the characterization of ["1"4C] Curcumin by HPLC and mass spectrometry.

Binding of Candida albicans to Human CEACAM1 and CEACAM6 Modulates the Inflammatory Response of Intestinal Epithelial Cells

Directory of Open Access Journals (Sweden)

Esther Klaile

2017-03-01

Full Text Available Candida albicans colonizes human mucosa, including the gastrointestinal tract, as a commensal. In immunocompromised patients, C. albicans can breach the intestinal epithelial barrier and cause fatal invasive infections. Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1; CD66a, CEACAM5 (CEA, and CEACAM6 (CD66c are immunomodulatory receptors expressed on human mucosa and are recruited by bacterial and viral pathogens. Here we show for the first time that a fungal pathogen (i.e., C. albicans also binds directly to the extracellular domain of human CEACAM1, CEACAM3, CEACAM5, and CEACAM6. Binding was specific for human CEACAMs and mediated by the N-terminal IgV-like domain. In enterocytic C2BBe1 cells, C. albicans caused a transient tyrosine phosphorylation of CEACAM1 and induced higher expression of membrane-bound CEACAM1 and soluble CEACAM6. Lack of the CEACAM1 receptor after short hairpin RNA (shRNA knockdown abolished CXCL8 (interleukin-8 secretion by C2BBe1 cells in response to C. albicans. In CEACAM1-competent cells, the addition of recombinant soluble CEACAM6 reduced the C. albicans-induced CXCL8 secretion.

Comparative evaluation of the impact of WRF/NMM and WRF/ARW meteorology on CMAQ simulations for PM2.5 and its related precursors during the 2006 TexAQS/GoMACCS study

Directory of Open Access Journals (Sweden)

S. T. Rao

2012-05-01

Full Text Available This study presents a comparative evaluation of the impact of WRF-NMM and WRF-ARW meteorology on CMAQ simulations of PM2.5, its composition and related precursors over the eastern United States with the intensive observations obtained by aircraft (NOAA WP-3, ship and surface monitoring networks (AIRNow, IMPROVE, CASTNet and STN during the 2006 TexAQS/GoMACCS study. The results at the AIRNow surface sites show that both ARW-CMAQ and NMM-CMAQ reproduced day-to-day variations of observed PM2.5 and captured the majority of observed PM2.5 within a factor of 2 with a NMB value of −0.4% for ARW-CMAQ and −18% for NMM-CMAQ. Both models performed much better at the urban sites than at the rural sites, with greater underpredictions at the rural sites. Both models consistently underestimated the observed PM2.5 at the rural IMPROVE sites by −1% for the ARW-CMAQ and −19% for the NMM-CMAQ. The greater underestimations of SO42−, OC and EC by the NMM-CMAQ contributed to increased underestimation of PM2.5 at the IMPROVE sites. The NMB values for PM2.5 at the STN urban sites are 15% and −16% for the ARW-CMAQ and NMM-CMAQ, respectively. The underestimation of PM2.5 at the STN sites by the NMM-CMAQ mainly results from the underestimations of the SO42−, NH4+ and TCM components, whereas the overestimation of PM2.5 at the STN sites by the ARW-CMAQ results from the overestimations of SO42−, NO3−, and NH4+. The Comparison with WP-3 aircraft measurements reveals that both ARW-CMAQ and NMM-CMAQ have very similar model performance for vertical profiles for PM2.5 chemical components (SO42−, NH4+ and related gaseous species (HNO3, SO2, NH3, isoprene, toluene, terpenes as both models used the same chemical mechanisms and emissions. The results of ship along the coast of southeastern Texas over the Gulf of Mexico show that both models captured the temporal variations and broad synoptic change seen in the observed HCHO and acetaldehyde with the means NMB 2.

Renal Impairment and Prognosis of Patients with Atrial Fibrillation Undergoing Coronary Intervention - The AFCAS Trial.

Directory of Open Access Journals (Sweden)

Heli M Lahtela

Full Text Available Renal impairment is a well-known risk factor for cardiovascular complications, but the effect of different stages of renal impairment on thrombotic/thromboembolic and bleeding complications in patients with atrial fibrillation (AF undergoing percutaneous coronary intervention (PCI remains largely unknown. We sought to evaluate the incidence and clinical impact of four stages of renal impairment in patients with AF undergoing PCI.We assessed renal function by estimated glomerular filtration rate (eGFR and outcomes in 781 AF patients undergoing PCI by using the data from a prospective European multicenter registry. End-points included all-cause mortality, major adverse cardiac and cerebrovascular events (MACCE and bleeding events at 12 months.A total of 195 (25% patients had normal renal function (eGFR ≥90 mL/min, 290 (37% mild renal impairment (eGFR 60-89, 263 (34% moderate renal impairment (eGFR 30-59 and 33 (4% severe renal impairment (eGFR <30. Degree of renal impairment remained an independent predictor of mortality and MACCE in an adjusted a Cox regression model. Even patients with mild renal impairment had a higher risk of all-cause mortality (HR 2.25, 95%CI 1.02-4.98, p=0.04 and borderline risk for MACCE (HR 1.56, 95%CI 0.98- 2.50, p=0.06 compared to those with normal renal function.Renal impairment is common in patients with AF undergoing PCI and even mild renal impairment has an adverse prognostic effect in these patients requiring multiple antithrombotic medications.

Specificity and sensitivity of commercially available assays for glucagon-like peptide-1 (GLP-1)

DEFF Research Database (Denmark)

Bak, Monika Judyta; Albrechtsen, Nicolai Jacob Wewer; Pedersen, Jens

2014-01-01

assessed with 3 commercial kits. RESULTS: The USCN LIFE assay detected none of the GLP-1 isoforms. The active GLP-1 ELISAs from Millipore and DRG seemed identical and were specific for intact GLP-1 in buffer and plasma. The Meso Scale Discovery Total GLP-1 kit detected all six GLP-1 isoforms, although...

RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

PRIDE Surveillance Projects Data Packaging Project Information Package Specification Version 1.1

Energy Technology Data Exchange (ETDEWEB)

Kelleher, D. M.; Shipp, R. L.; Mason, J. D.

2010-08-31

Information Package Specification version 1.1 describes an XML document format called an information package that can be used to store information in information management systems and other information archives. An information package consists of package information, the context required to understand and use that information, package metadata that describes the information, and XML signatures that protect the information. The information package described in this specification was designed to store Department of Energy (DOE) and National Nuclear Security Administration (NNSA) information and includes the metadata required for that information: a unique package identifier, information marking that conforms to DOE and NNSA requirements, and access control metadata. It is an implementation of the Open Archival Information System (OAIS) Reference Model archival information package tailored to meet NNSA information storage requirements and designed to be used in the computing environments at the Y-12 National Security Complex and at other NNSA sites.

Short hairpin RNA interference therapy for ischemic heart disease

Science.gov (United States)

Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

2013-01-01

Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

API Specification Q1: The quality system specification for the oil and gas industry

International Nuclear Information System (INIS)

Peurifoy, C.K.

1994-01-01

The Oil and Gas Production Industry began using the American Petroleum Institute's Specification Q1, ''Specification for Quality Programs'' (1st Edition, January 1, 1985) in late 1984. The generic ISO 9000 Series Standards, ''Quality management and quality assurance standards,'' were developed at about the same time and were published for public use in 1987. By late 1989 and into the early nineties, the formation of the European Economic Community and the issuance of the EC Procurement Directives sparked a rush by companies worldwide to comply with all the requirements necessary to do business in Europe. The ensuing ''ISO Mania'' has created a windfall for any company providing ISO 9000 quality system certification, consulting, training and almost anything to do with ISO 9000. It is difficult to miss one of the hundreds of newspaper and trade magazine articles promoting the ISO 9000 Quality Standards for use in almost every industry. This paper discusses the latest developments of both the lesser known API Spec Q1 and the much publicized ISO 9001 as well as discusses some of the similarities and differences between them and possible future trends. It also reviews some of the strengths and weaknesses of both documents to support the sentiment that API Spec Q1, in conjunction with the API Monogram Program, is the best quality standard for use in ordering equipment, materials and services for the Oil and Gas Industry

Targeting Sulfotransferase (SULT) 2B1b as a Regulator of Cholesterol Metabolism in Prostate Cancer

Science.gov (United States)

2015-10-01

next  subtask.       Subtask 2: Production of infective Lentivirus using co-transfection of HEK293 (pCa cells LNCaP, PC3, DU145, and VCaP...PCa lines. We determined that the level of shRNA expression from a stably intergrated transgene gene delivered by lentivirus was too low...effects  on  SULT2B1b  enzyme  activity  of   cholesterol  sulfate   production  in  vitro.     We  developed  a

PTPRZ1 regulates calmodulin phosphorylation and tumor progression in small-cell lung carcinoma

International Nuclear Information System (INIS)

Makinoshima, Hideki; Ishii, Genichiro; Kojima, Motohiro; Fujii, Satoshi; Higuchi, Youichi; Kuwata, Takeshi; Ochiai, Atsushi

2012-01-01

Small-cell lung carcinoma (SCLC) is a neuroendocrine tumor subtype and comprises approximately 15% of lung cancers. Because SCLC is still a disease with a poor prognosis and limited treatment options, there is an urgent need to develop targeted molecular agents for this disease. We screened 20 cell lines from a variety of pathological phenotypes established from different organs by RT-PCR. Paraffin-embedded tissue from 252 primary tumors was examined for PTPRZ1 expression using immunohistochemistry. shRNA mediated PTPRZ1 down-regulation was used to study impact on tyrosine phosphorylation and in vivo tumor progression in SCLC cell lines. Here we show that PTPRZ1, a member of the protein tyrosine- phosphatase receptor (PTPR) family, is highly expressed in SCLC cell lines and specifically exists in human neuroendocrine tumor (NET) tissues. We also demonstrate that binding of the ligand of PTPRZ1, pleiotrophin (PTN), activates the PTN/PTPRZ1 signaling pathway to induce tyrosine phosphorylation of calmodulin (CaM) in SCLC cells, suggesting that PTPRZ1 is a regulator of tyrosine phosphorylation in SCLC cells. Furthermore, we found that PTPRZ1 actually has an important oncogenic role in tumor progression in the murine xenograft model. PTPRZ1 was highly expressed in human NET tissues and PTPRZ1 is an oncogenic tyrosine phosphatase in SCLCs. These results imply that a new signaling pathway involving PTPRZ1 could be a feasible target for treatment of NETs

p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

Science.gov (United States)

Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

2004-06-01

The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

Science.gov (United States)

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

Technical specifications manual for the MARK-1 pulsed ionizing radiation detection system. Volume 1

Energy Technology Data Exchange (ETDEWEB)

Lawrence, R.S.; Harker, Y.D.; Jones, J.L.; Hoggan, J.M.

1993-03-01

The MARK-1 detection system was developed by the Idaho National Engineering Laboratory for the US Department of Energy Office of Arms Control and Nonproliferation. The completely portable system was designed for the detection and analysis of intense photon emissions from pulsed ionizing radiation sources. This manual presents the technical design specifications for the MARK-1 detection system and was written primarily to assist the support or service technician in the service, calibration, and repair of the system. The manual presents the general detection system theory, the MARK-1 component design specifications, the acquisition and control software, the data processing sequence, and the system calibration procedure. A second manual entitled: Volume 2: Operations Manual for the MARK-1 Pulsed Ionizing Radiation Detection System (USDOE Report WINCO-1108, September 1992) provides a general operational description of the MARK-1 detection system. The Operations Manual was written primarily to assist the field operator in system operations and analysis of the data.

Guideline-adherence and perspectives in the acute management of unstable angina - Initial results from the German chest pain unit registry.

Science.gov (United States)

Breuckmann, Frank; Hochadel, Matthias; Darius, Harald; Giannitsis, Evangelos; Münzel, Thomas; Maier, Lars S; Schmitt, Claus; Schumacher, Burghard; Heusch, Gerd; Voigtländer, Thomas; Mudra, Harald; Senges, Jochen

2015-08-01

We investigated the current management of unstable angina pectoris (UAP) in certified chest pain units (CPUs) in Germany and focused on the European Society of Cardiology (ESC) guideline-adherence in the timing of invasive strategies or choice of conservative treatment options. More specifically, we analyzed differences in clinical outcome with respect to guideline-adherence. Prospective data from 1400 UAP patients were collected. Analyses of high-risk criteria with indication for invasive management and 3-month clinical outcome data were performed. Guideline-adherence was tested for a primarily conservative strategy as well as for percutaneous coronary intervention (PCI) within management was performed in 38.2%. In UAP patients at risk, undertreatment caused by an insufficient consideration of risk criteria was obvious in 78%. Reciprocally, overtreatment in the absence of adequate risk markers was performed in 27%, whereas a guideline-conforming primarily conservative strategy was chosen in 73% of the low-risk patients. Together, the 3-month major adverse coronary and cerebrovascular events (MACCE) were low (3.6%). Nonetheless, guideline-conforming treatment was even associated with significantly lower MACCE rates (1.6% vs. 4.0%, p<0.05). The data suggest an inadequate adherence to ESC guidelines in nearly two thirds of the patients, particularly in those patients at high to intermediate risk with secondary risk factors, emphasizing the need for further attention to consistent risk profiling in the CPU and its certification process. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

An essential regulatory role of downstream of kinase-1 in the ovalbumin-induced murine model of asthma.

Directory of Open Access Journals (Sweden)

Chang-Min Lee

Full Text Available The downstream of kinase (DOK-1 is involved in the protein tyrosine kinase (PTK pathway in mast cells, but the role of DOK-1 in the pathogenesis of asthma has not been defined. In this study, we have demonstrated a novel regulatory role of DOK-1 in airway inflammation and physiologic responses in a murine model of asthma using lentiviral vector containing DOK-1 cDNA or DOK-1-specific ShRNA. The OVA-induced inflammatory cells, airway hyperresponsiveness, Th2 cytokine expression, and mucus response were significantly reduced in DOK-1 overexpressing mice compared to OVA-challenged control mice. The transgenic introduction of DOK-1 significantly stimulated the activation and expression of STAT-4 and T-bet, while impressively inhibiting the activation and expression of STAT-6 and GATA-3 in airway epithelial cells. On the other hand, DOK-1 knockdown mice enhanced STAT-6 expression and its nuclear translocation compared to OVA-challenged control mice. When viewed in combination, our studies demonstrate DOK-1 regulates allergen-induced Th2 immune responses by selective stimulation and inhibition of STAT-4 and STAT-6 signaling pathways, respectively. These studies provide a novel insight on the regulatory role of DOK-1 in allergen-induced Th2 inflammation and airway responses, which has therapeutic potential for asthma and other allergic diseases.

Specific receptor for inositol-1,4,5-trisphosphate in permeabilized rabbit neutrophils

International Nuclear Information System (INIS)

Bradford, P.G.; Spat, A.; Rubin, R.P.

1986-01-01

Neutrophil chemotaxis and degranulation are resultant, in part, from the mobilization of intracellular calcium by inositol-1,4,5-trisphosphate [(1,4,5)IP 3 ], one of the products of chemoattractant-stimulated phospholipase C activity. High specific activity (ca. 40 Ci/mmol) [ 32 P](1,4,5)IP 3 was prepared from [γ- 32 P]ATP-labeled human erythrocyte ghosts and was used in binding assays with saponin-permeabilized rabbit peritoneal neutrophils. At 4 0 C and in the presence of inhibitors of the IP 3 5-phosphomonoesterase, [ 32 P](1,4,5)IP 3 rapidly associated with a specific binding component which saturated within 60s. Nonspecific binding, taken as the residual binding in the presence of 10 μM (1,4,5)IP 3 , was 15% of the total. No specific binding was detected using intact cells. The specific binding to permeable cells was reversible (t/sup 1/2/ ∼ 60s) and could be inhibited in a dose-dependent manner by (1,4,5)IP 3 (EC 50 = 30 nM) and by other calcium mobilizing inositol phosphates [(2,4,5)IP 3 ] but not by inactive analogs [(1,4)IP 2 , (4,5)IP 2 , (1)IP]. The dose-responses of (1,4,5)IP 3 and (2,4,5)IP 3 in inhibiting [ 32 P](1,4,5)IP 3 specific binding correlated well with their abilities to release Ca 2+ from nonmitochondrial vesicular stores in the same preparation of cells, suggesting that the authors have identified the physiological receptor for (1,4,5)IP 3

Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

Directory of Open Access Journals (Sweden)

Orit Wolstein

2014-01-01

Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

Ethnomedicine Claim Directed in Silico Prediction of Anticancer ...

African Journals Online (AJOL)

2018-01-01

Jan 1, 2018 ... 0.70, MACCS fingerprint), and the top 346 compounds it identified were identical to compounds with proven anticancer activity on 60 cell lines (23). Given such performance of. CDRUG, our finding can be taken as a preliminary evidence of anticancer activity by many of the medicinal plants used for treating.

41 CFR 51-9.102-1 - Specific exemptions.

Science.gov (United States)

2010-07-01

...-General Policy § 51-9.102-1 Specific exemptions. Systems of records maintained by the Committee which have... part. An individual shall have access to all exempted records containing information about him under procedures outlined in Subpart 51-9.3 of this part. Upon request, an individual shall receive an accounting...

HSV-1 Remodels Host Telomeres to Facilitate Viral Replication

Directory of Open Access Journals (Sweden)

Zhong Deng

2014-12-01

Full Text Available Telomeres protect the ends of cellular chromosomes. We show here that infection with herpes simplex virus 1 (HSV-1 results in chromosomal structural aberrations at telomeres and the accumulation of telomere dysfunction-induced DNA damage foci (TIFs. At the molecular level, HSV-1 induces transcription of telomere repeat-containing RNA (TERRA, followed by the proteolytic degradation of the telomere protein TPP1 and loss of the telomere repeat DNA signal. The HSV-1-encoded E3 ubiquitin ligase ICP0 is required for TERRA transcription and facilitates TPP1 degradation. Small hairpin RNA (shRNA depletion of TPP1 increases viral replication, indicating that TPP1 inhibits viral replication. Viral replication protein ICP8 forms foci that coincide with telomeric proteins, and ICP8-null virus failed to degrade telomere DNA signal. These findings suggest that HSV-1 reorganizes telomeres to form ICP8-associated prereplication foci and to promote viral genomic replication.

Adenovirus Detection by the cGAS/STING/TBK1 DNA Sensing Cascade

Science.gov (United States)

Lam, Eric; Stein, Saskia

2014-01-01

Adenovirus (Ad) infection triggers a cell-specific antiviral response following exposure of viral DNA to the intracellular compartment. A variety of DNA sensors (DAI, AIM2, DDx41, RNA polymerase [Pol] III, and IFI16 [p204]) have been identified in recent years; however, the DNA sensor involved in detection of adenovirus has not been established. Cyclic GMP-AMP synthase (cGAS), a DNA sensor that produces a cyclic guanine-adenine dinucleotide (cGAMP) inducer of STING, has been examined to determine its role in generating an antiadenoviral response. Short hairpin RNA (shRNA) lentiviral vectors targeting TBK1, STING, and cGAS were established in murine MS1 endothelial and RAW 264.7 macrophage cell lines. Knockdown of TBK1, STING, and cGAS results in a dramatic reduction in the activation of the primary antiviral response marker phosphorylated interferon (IFN) response factor 3 (IRF3) following exposure to adenovirus. Furthermore, activation of secondary type I IFN signaling targets (ptyrSTAT1 and ptyrSTAT2 [ptyrSTAT1/2]) was also compromised. Consistent with compromised activation of primary and secondary response markers, transcriptional activation of IRF3-responsive genes (beta IFN [IFN-β], ISG15, ISG54) and secondary response transcripts were diminished in cells knocked down in cGAS, STING, or TBK1. These data establish cGAS as the dominant cytosolic DNA sensor responsible for detection of internalized adenovirus leading to induction of the type I interferon antiviral cascade. PMID:24198409

Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression

Energy Technology Data Exchange (ETDEWEB)

Pujuguet, Philippe; Simian, Marina; Liaw, Jane; Timpl, Rupert; Werb, Zena; Bissell, Mina J..

2000-02-01

Nidogen-1 (entactin) acts as a bridge between the extracellular matrix molecules laminin-1 and type IV collagen, and thus participates in the assembly of basement membranes. To investigate the role of nidogen-1 in regulating cell-type-specific gene expression in mammary epithelium, we designed a culture microecosystem in which each component, including epithelial cells, mesenchymal cells, lactogenic hormones and extracellular matrix, could be controlled. We found that primary and established mesenchymal and myoepithelial cells synthesized and secreted nidogen-1, whereas expression was absent in primary and established epithelial cells. In an epithelial cell line containing mesenchymal cells, nidogen-1 was produced by the mesenchymal cells but deposited between the epithelial cells. In this mixed culture, mammary epithelial cells express b-casein in the presence of lactogenic hormones. Addition of either laminin-1 plus nidogen-1, or laminin-1 alone to mammary epithelial cells induced b- casein production. We asked whether recombinant nidogen-1 alone could signal directly for b-casein. Nidogen-1 did not induce b-casein synthesis in epithelial cells, but it augmented the inductive capacity of laminin-1. These data suggest that nidogen-1 can cooperate with laminin-1 to regulate b-casein expression. Addition of full length nidogen-1 to the mixed cultures had no effect on b-casein gene expression; however, a nidogen-1 fragment containing the laminin-1 binding domain, but lacking the type IV collagen-binding domain, had a dominant negative effect on b-casein expression. These data point to a physiological role for nidogen-1 in the basement membrane-induced gene expression by epithelial cells.

Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

Science.gov (United States)

Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

2016-01-01

Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

Mouse CCDC79 (TERB1) is a meiosis-specific telomere associated protein.

Science.gov (United States)

Daniel, Katrin; Tränkner, Daniel; Wojtasz, Lukasz; Shibuya, Hiroki; Watanabe, Yoshinori; Alsheimer, Manfred; Tóth, Attila

2014-05-22

Telomeres have crucial meiosis-specific roles in the orderly reduction of chromosome numbers and in ensuring the integrity of the genome during meiosis. One such role is the attachment of telomeres to trans-nuclear envelope protein complexes that connect telomeres to motor proteins in the cytoplasm. These trans-nuclear envelope connections between telomeres and cytoplasmic motor proteins permit the active movement of telomeres and chromosomes during the first meiotic prophase. Movements of chromosomes/telomeres facilitate the meiotic recombination process, and allow high fidelity pairing of homologous chromosomes. Pairing of homologous chromosomes is a prerequisite for their correct segregation during the first meiotic division. Although inner-nuclear envelope proteins, such as SUN1 and potentially SUN2, are known to bind and recruit meiotic telomeres, these proteins are not meiosis-specific, therefore cannot solely account for telomere-nuclear envelope attachment and/or for other meiosis-specific characteristics of telomeres in mammals. We identify CCDC79, alternatively named TERB1, as a meiosis-specific protein that localizes to telomeres from leptotene to diplotene stages of the first meiotic prophase. CCDC79 and SUN1 associate with telomeres almost concurrently at the onset of prophase, indicating a possible role for CCDC79 in telomere-nuclear envelope interactions and/or telomere movements. Consistent with this scenario, CCDC79 is missing from most telomeres that fail to connect to SUN1 protein in spermatocytes lacking the meiosis-specific cohesin SMC1B. SMC1B-deficient spermatocytes display both reduced efficiency in telomere-nuclear envelope attachment and reduced stability of telomeres specifically during meiotic prophase. Importantly, CCDC79 associates with telomeres in SUN1-deficient spermatocytes, which strongly indicates that localization of CCDC79 to telomeres does not require telomere-nuclear envelope attachment. CCDC79 is a meiosis-specific telomere

Germline-specific H1 variants: the "sexy" linker histones.

Science.gov (United States)

Pérez-Montero, Salvador; Carbonell, Albert; Azorín, Fernando

2016-03-01

The eukaryotic genome is packed into chromatin, a nucleoprotein complex mainly formed by the interaction of DNA with the abundant basic histone proteins. The fundamental structural and functional subunit of chromatin is the nucleosome core particle, which is composed by 146 bp of DNA wrapped around an octameric protein complex formed by two copies of each core histone H2A, H2B, H3, and H4. In addition, although not an intrinsic component of the nucleosome core particle, linker histone H1 directly interacts with it in a monomeric form. Histone H1 binds nucleosomes near the exit/entry sites of linker DNA, determines nucleosome repeat length and stabilizes higher-order organization of nucleosomes into the ∼30 nm chromatin fiber. In comparison to core histones, histone H1 is less well conserved through evolution. Furthermore, histone H1 composition in metazoans is generally complex with most species containing multiple variants that play redundant as well as specific functions. In this regard, a characteristic feature is the presence of specific H1 variants that replace somatic H1s in the germline and during early embryogenesis. In this review, we summarize our current knowledge about their structural and functional properties.

A study of cellular counting to determine minimum thresholds for adequacy for liquid-based cervical cytology using a survey and counting protocol.

Science.gov (United States)

Kitchener, Henry C; Gittins, Matthew; Desai, Mina; Smith, John H F; Cook, Gary; Roberts, Chris; Turnbull, Lesley

2015-03-01

Liquid-based cytology (LBC) for cervical screening would benefit from laboratory practice guidelines that define specimen adequacy for reporting of slides. The evidence base required to define cell adequacy should incorporate both ThinPrep™ (TP; Hologic, Inc., Bedford, MA, USA) and SurePath™ (SP; BD Diagnostics, Burlington, NC, USA), the two LBC systems used in the UK cervical screening programmes. The objectives of this study were to determine (1) current practice for reporting LBC in England, Wales and Scotland, (2) a reproducible method for cell counting, (3) the cellularity of slides classified as inadequate, negative or abnormal and (4) the impact of varying cellularity on the likelihood of detecting cytological abnormalities. The study involved four separate arms to pursue each of the four objectives. (1) A questionnaire survey of laboratories was conducted. (2) A standard counting protocol was developed and used by three experienced cytopathologists to determine a reliable and reproducible cell counting method. (3) Slide sets which included a range of cytological abnormalities were each sent to three laboratories for cell counting to study the correlation between cell counts and reported cytological outcomes. (4) Dilution of LBC samples by fluid only (unmixed) or by dilution with a sample containing normal cells (mixed) was performed to study the impact on reporting of reducing either the total cell count or the relative proportion of abnormal to normal cells. The study was conducted within the cervical screening programmes in England, Wales and Scotland, using routinely obtained cervical screening samples, and in 56 participating NHS cervical cytology laboratories. The study involved only routinely obtained cervical screening samples. There was no clinical intervention. The main outcome measures were (1) reliability of counting method, (2) correlation of reported cytology grades with cellularity and (3) levels of detection of abnormal cells in

DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

Science.gov (United States)

Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

1995-09-05

Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

Gene program-specific regulation of PGC-1{alpha} activity

DEFF Research Database (Denmark)

Schmidt, Søren F; Mandrup, Susanne

2011-01-01

Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

Region-specific proteolysis differentially regulates type 1 inositol 1,4,5-trisphosphate receptor activity.

Science.gov (United States)

Wang, Liwei; Wagner, Larry E; Alzayady, Kamil J; Yule, David I

2017-07-14

The inositol 1,4,5 trisphosphate receptor (IP 3 R) is an intracellular Ca 2+ release channel expressed predominately on the membranes of the endoplasmic reticulum. IP 3 R1 can be cleaved by caspase or calpain into at least two receptor fragments. However, the functional consequences of receptor fragmentation are poorly understood. Our previous work has demonstrated that IP 3 R1 channels, formed following either enzymatic fragmentation or expression of the corresponding complementary polypeptide chains, retain tetrameric architecture and are still activated by IP 3 binding despite the loss of peptide continuity. In this study, we demonstrate that region-specific receptor fragmentation modifies channel regulation. Specifically, the agonist-evoked temporal Ca 2+ release profile and protein kinase A modulation of Ca 2+ release are markedly altered. Moreover, we also demonstrate that activation of fragmented IP 3 R1 can result in a distinct functional outcome. Our work suggests that proteolysis of IP 3 R1 may represent a novel form of modulation of IP 3 R1 channel function and increases the repertoire of Ca 2+ signals achievable through this channel. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

E-selectin ligand-1 (ESL-1) is a novel adiponectin binding protein on cell adhesion.

Science.gov (United States)

Yamamoto, Hiroyasu; Kuroda, Nana; Uekita, Hiromi; Kochi, Ikoi; Matsumoto, Akane; Niinaga, Ryu; Funahashi, Tohru; Shimomura, Iichiro; Kihara, Shinji

2016-02-05

Adiponectin (APN) is an adipocyte-derived bioactive molecule with anti-diabetic and anti-atherogenic properties. Although anti-diabetic effects are mostly mediated by the adiponectin receptors AdipoR1 and AdipoR2, the anti-atherogenic mechanisms have not been fully elucidated. In this study, we identified E-selectin ligand (ESL)-1 as a novel APN-binding protein by mass spectrometry analysis of HepG2 cell-derived immunoprecipitant with an anti-APN antibody. Cell adhesion assays using fluorescence-labelled monocyte cell line THP-1 cells and human umbilical vein endothelial cells (HUVECs) revealed that APN-pre-treated THP-1 cells had reduced binding ability to HUVECs. This APN-mediated suppressive effect on monocyte binding to endothelial cells was partially abrogated by targeting ESL-1 with shRNA in THP-1 cells. In addition, serial mutagenesis analysis disclosed that five extracellular amino acids close to the N-terminus of ESL-1 were essential for binding with APN. Our results highlight the fact that interaction between APN and ESL-1 could provide a fundamental mechanism underlying the anti-atherogenic properties of APN. Copyright © 2016 Elsevier Inc. All rights reserved.

Polyetherimide-grafted Fe3O4@SiO2 nanoparticles as theranostic agents for simultaneous VEGF siRNA delivery and magnetic resonance cell imaging

Directory of Open Access Journals (Sweden)

Li T

2015-07-01

Full Text Available Tingting Li,1 Xue Shen,1 Yin Chen,1 Chengchen Zhang,1 Jie Yan,1 Hong Yang,1 Chunhui Wu,1,2 Hongjun Zeng,1,2 Yiyao Liu1,21Department of Biophysics, School of Life Science and Technology, 2Center for Information in Biomedicine, University of Electronic Science and Technology of China, Chengdu, Sichuan, People’s Republic of ChinaAbstract: Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (shRNA to form Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites for VEGF gene silencing as well as magnetic resonance (MR imaging. The size, morphology, particle stability, magnetic properties, and gene-binding capacity and protection were determined. Low cytotoxicity and hemolyticity against human red blood cells showed the excellent biocompatibility of the multifunctional nanocomposites, and also no significant coagulation was observed. The nanocomposites maintain their superparamagnetic property at room temperature and no appreciable change in magnetism, even after PEI modification. The qualitative and quantitative analysis of cellular internalization into MCF-7 human breast cancer cells by Prussian blue staining and inductively coupled plasma atomic emission spectroscopy analysis, respectively, demonstrated that the Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could be easily internalized by MCF-7 cells, and they exhibited significant inhibition of VEGF gene expression. Furthermore, the MR cellular images showed that the superparamagnetic iron oxide core of our Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could also act as a T2-weighted contrast agent for cancer MR imaging. Our data highlight multifunctional Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites as a potential platform for simultaneous gene delivery and MR cell imaging, which are promising

The brain-specific factor FEZ1 is a determinant of neuronal susceptibility to HIV-1 infection.

LENUS (Irish Health Repository)

Haedicke, Juliane

2009-08-18

Neurons are one of the few cell types in the human body that do not support HIV type-1 (HIV-1) replication. Although the lack of key receptors is a major obstacle to infection, studies suggest that additional functions inhibit virus replication to explain the exquisite resistance of neurons to HIV-1. However, specific neuronal factors that may explain this resistance remain to be discovered. In a screen for antiviral factors using a fibroblast line chemically mutagenized and selected for resistance to retroviral infection, we recently identified induction of rat FEZ1 (fasciculation and elongation protein zeta-1), a brain-specific protein, as the cause of this resistance. When exogenously expressed in nonneuronal cell lines rat FEZ1 blocked nuclear entry of retroviral DNA. Here, we demonstrate that among human brain cells, neurons naturally express high levels of FEZ1 compared to astrocytes or microglia cells and are correspondingly less susceptible to infection with pseudotyped HIV-1 that bypasses receptor-mediated viral entry. Demonstrating that endogenous FEZ1 was functionally important in the resistance of neurons to HIV-1 infection, siRNA-mediated knockdown of endogenous FEZ1 increased the infectivity of neurons while sensitive brain cell types like microglia became more resistant upon FEZ1 overexpression. In addition, FEZ1 expression was not induced in response to IFN treatment. As such, in contrast to other widely expressed, IFN-inducible antiviral factors, FEZ1 appears to represent a unique neuron-specific determinant of cellular susceptibility to infection in a cell type that is naturally resistant to HIV-1.

Adeno-Associated Viral Vector-Mediated mTOR Inhibition by Short Hairpin RNA Suppresses Laser-Induced Choroidal Neovascularization

Directory of Open Access Journals (Sweden)

Tae Kwann Park

2017-09-01

Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy

Cellular specificity of HIV-1 replication can be controlled by LTR sequences

International Nuclear Information System (INIS)

Reed-Inderbitzin, Edward; Maury, Wendy

2003-01-01

Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry

A monoclonal antibody IMab-1 specifically recognizes IDH1{sup R132H}, the most common glioma-derived mutation

Energy Technology Data Exchange (ETDEWEB)

Kato, Yukinari, E-mail: yukinari-k@bea.hi-ho.ne.jp [Department of Pathology, Duke University Medical Center, DUMC-3156, Durham, NC 27710 (United States); The Oncology Research Center, Research Institute for Advanced Molecular Epidemiology, Yamagata University, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Jin, Genglin; Kuan, Chien-Tsun; McLendon, Roger E.; Yan, Hai; Bigner, Darell D. [Department of Pathology, Duke University Medical Center, DUMC-3156, Durham, NC 27710 (United States)

2009-12-18

IDH1 (isocitrate dehydrogenase 1) mutations have been identified as early and frequent genetic alterations in astrocytomas, oligodendrogliomas, and oligoastrocytomas as well as secondary glioblastomas. In contrast, primary glioblastomas very rarely contain IDH1 mutations, although primary and secondary glioblastomas are histologically indistinguishable. The IDH1 mutations are remarkably specific to a single codon in the conserved and functionally important Arg132 in IDH1. In gliomas, the most frequent IDH1 mutations (>90%) were G395A (R132H). In this study, we immunized mice with R132H-containing IDH1 (IDH1{sup R132H}) peptide. After cell fusion using Sendai virus envelope, the monoclonal antibodies (mAbs), which specifically reacted with IDH1{sup R132H}, were screened in ELISA. One of the mAbs, IMab-1 reacted with the IDH1{sup R132H} peptide, but not with wild type IDH1 (IDH1{sup wt}) peptide in ELISA. In Western-blot analysis, IMab-1 reacted with only the IDH1{sup R132H} protein, not IDH1{sup wt} protein or the other IDH1 mutants, indicating that IMab-1 is IDH1{sup R132H}-specific. Furthermore, IMab-1 specifically stained the IDH1{sup R132H}-expressing cells in astrocytomas in immunohistochemistry, whereas it did not react with IDH1{sup R132H}-negative primary glioblastoma sections. In conclusion, we established an anti-IDH1{sup R132H}-specific monoclonal antibody IMab-1, which should be significantly useful for diagnosis and biological evaluation of mutation-bearing gliomas.

Functional genomics identifies specific vulnerabilities in PTEN-deficient breast cancer.

Science.gov (United States)

Tang, Yew Chung; Ho, Szu-Chi; Tan, Elisabeth; Ng, Alvin Wei Tian; McPherson, John R; Goh, Germaine Yen Lin; Teh, Bin Tean; Bard, Frederic; Rozen, Steven G

2018-03-22

Phosphatase and tensin homolog (PTEN) is one of the most frequently inactivated tumor suppressors in breast cancer. While PTEN itself is not considered a druggable target, PTEN synthetic-sick or synthetic-lethal (PTEN-SSL) genes are potential drug targets in PTEN-deficient breast cancers. Therefore, with the aim of identifying potential targets for precision breast cancer therapy, we sought to discover PTEN-SSL genes present in a broad spectrum of breast cancers. To discover broad-spectrum PTEN-SSL genes in breast cancer, we used a multi-step approach that started with (1) a genome-wide short interfering RNA (siRNA) screen of ~ 21,000 genes in a pair of isogenic human mammary epithelial cell lines, followed by (2) a short hairpin RNA (shRNA) screen of ~ 1200 genes focused on hits from the first screen in a panel of 11 breast cancer cell lines; we then determined reproducibility of hits by (3) identification of overlaps between our results and reanalyzed data from 3 independent gene-essentiality screens, and finally, for selected candidate PTEN-SSL genes we (4) confirmed PTEN-SSL activity using either drug sensitivity experiments in a panel of 19 cell lines or mutual exclusivity analysis of publicly available pan-cancer somatic mutation data. The screens (steps 1 and 2) and the reproducibility analysis (step 3) identified six candidate broad-spectrum PTEN-SSL genes (PIK3CB, ADAMTS20, AP1M2, HMMR, STK11, and NUAK1). PIK3CB was previously identified as PTEN-SSL, while the other five genes represent novel PTEN-SSL candidates. Confirmation studies (step 4) provided additional evidence that NUAK1 and STK11 have PTEN-SSL patterns of activity. Consistent with PTEN-SSL status, inhibition of the NUAK1 protein kinase by the small molecule drug HTH-01-015 selectively impaired viability in multiple PTEN-deficient breast cancer cell lines, while mutations affecting STK11 and PTEN were largely mutually exclusive across large pan-cancer data sets. Six genes showed PTEN

Generating Isoform-Specific Antibodies : Lessons from Nucleocytoplasmic Glycoprotein Skp1

NARCIS (Netherlands)

West, Christopher M.; Van Der Wel, Hanke; Chinoy, Zoiesha; Boons, Geert Jan; Gauthier, Ted J.; Taylor, Carol M.; Xu, Yuechi

2015-01-01

Antibodies that discriminate protein isoforms differing by modifications at specific amino acids have revolutionized studies of their functions. Skp1 is a novel nucleocytoplasmic glycoprotein that is hydroxylated at proline-143 and then O-glycosylated by a pentasaccharide attached via a GlcNAcα1,

Rhinovirus-induced VP1-specific Antibodies are Group-specific and Associated With Severity of Respiratory Symptoms

Directory of Open Access Journals (Sweden)

Katarzyna Niespodziana

2015-01-01

Interpretation: Our results demonstrate that increases of antibodies towards the VP1 N-terminus are group-specific and associated with severity of respiratory symptoms and suggest that it may be possible to develop serological tests for identifying causative RV groups.

AMP-guided tumour-specific nanoparticle delivery via adenosine A1 receptor.

Science.gov (United States)

Dai, Tongcheng; Li, Na; Han, Fajun; Zhang, Hua; Zhang, Yuanxing; Liu, Qin

2016-03-01

Active targeting-ligands have been increasingly used to functionalize nanoparticles for tumour-specific clinical applications. Here we utilize nucleotide adenosine 5'-monophosphate (AMP) as a novel ligand to functionalize polymer-based fluorescent nanoparticles (NPs) for tumour-targeted imaging. We demonstrate that AMP-conjugated NPs (NPs-AMP) efficiently bind to and are following internalized into colon cancer cell CW-2 and breast cancer cell MDA-MB-468 in vitro. RNA interference and inhibitor assays reveal that the targeting effects mainly rely on the specific binding of AMP to adenosine A1 receptor (A1R), which is greatly up-regulated in cancer cells than in matched normal cells. More importantly, NPs-AMP specifically accumulate in the tumour site of colon and breast tumour xenografts and are further internalized into the tumour cells in vivo via tail vein injection, confirming that the high in vitro specificity of AMP can be successfully translated into the in vivo efficacy. Furthermore, NPs-AMP exhibit an active tumour-targeting behaviour in various colon and breast cancer cells, which is positively related to the up-regulation level of A1R in cancer cells, suggesting that AMP potentially suits for more extensive A1R-overexpressing cancer models. This work establishes AMP to be a novel tumour-targeting ligand and provides a promising strategy for future diagnostic or therapeutic applications. Copyright © 2016 Elsevier Ltd. All rights reserved.

MKP1 phosphatase mediates G1-specific dephosphorylation of H3Serine10P in response to DNA damage

Energy Technology Data Exchange (ETDEWEB)

Sharma, Ajit K.; Khan, Shafqat A.; Sharda, Asmita; Reddy, Divya V; Gupta, Sanjay, E-mail: sgupta@actrec.gov.in

2015-08-15

Highlights: • Reversible reduction of H3S10 phosphorylation after DNA damage is G1 phase specific. • Dynamic balance between MAP kinases, MKP1 and MSK1 regulate H3S10P during DDR. • MKP1 associates with chromatin bearing γH2AX in response to DNA damage. • Inhibition of MKP1 activity with specific inhibitor promotes radiation-induced cell death. - Abstract: Histone mark, H3S10 phosphorylation plays a dual role in a cell by maintaining relaxed chromatin for active transcription in interphase and condensed chromatin state in mitosis. The level of H3S10P has also been shown to alter on DNA damage; however, its cell cycle specific behavior and regulation during DNA damage response is largely unexplored. In the present study, we demonstrate G1 cell cycle phase specific reversible loss of H3S10P in response to IR-induced DNA damage is mediated by opposing activities of phosphatase, MKP1 and kinase, MSK1 of the MAP kinase pathway. We also show that the MKP1 recruits to the chromatin in response to DNA damage and correlates with the decrease of H3S10P, whereas MKP1 is released from chromatin during recovery phase of DDR. Furthermore, blocking of H3S10 dephosphorylation by MKP1 inhibition impairs DNA repair process and results in poor survival of WRL68 cells. Collectively, our data proposes a pathway regulating G1 cell cycle phase specific reversible reduction of H3S10P on IR induced DNA damage and also raises the possibility of combinatorial modulation of H3S10P with specific inhibitors to target the cancer cells in G1-phase of cell cycle.

Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism.

Science.gov (United States)

Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon

2012-02-01

Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies.

[Effects of transient receptor potential melastatin 8 cation channels on inflammatory reaction induced by cold temperatures in human airway epithelial cells].

Science.gov (United States)

Li, Min-chao; Perelman, Juliy M; Kolosov, Victor P; Zhou, Xiang-dong

2011-10-01

To explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) in cold-induced production of inflammatory factors in airway epithelial cells and related signal transduction mechanism. The 16HBE human airway epithelial cells were stimulated with cold temperature (18°C). In intervention experiments, cells were pretreated with TRPM8 channel antagonist BCTC, protein kinase C (PKC) specific inhibitor calphostin C and transfected with TRPM8 shRNA or control shRNA respectively, and thereafter cold stimulation was applied. Cells were divided into 6 groups: a control group (incubated at 37°C), a cold stimulation group, a cold stimulation + BCTC group, a cold stimulation + TRPM8 shRNA group, a cold stimulation + control shRNA group, a cold stimulation + calphostin C group. Western blot was performed to show the extent of knockdown in TRPM8 protein expression in the TRPM8 shRNA transfected cells. Dynamics of relative concentration of intracellular Ca(2+) in the former 5 groups were measured by calcium imaging techniques. Images were taken at one frame per 10 seconds. The levels of interleukin (IL)-6, IL-8, tumor necrosis factor (TNF)-α mRNA and protein were detected by real-time PCR and ELISA respectively. The highest relative concentration of intracellular calcium in cold stimulation group (2.36 ± 0.24) was higher than that of control group (1.01 ± 0.02) (t = 12.52, P cold stimulation group (t = 6.69 and 9.12, all P cold stimulation group[0.66 ± 0.16, 0.77 ± 0.15, 0.73 ± 0.09 and (92 ± 13) ng/L, (125 ± 22) ng/L, (88 ± 12) ng/L ] were significantly higher than those in control group [0.37 ± 0.08, 0.32 ± 0.07, 0.48 ± 0.10 and (52 ± 8) ng/L, (50 ± 9) ng/L, (61 ± 8) ng/L] (t = 3.20 - 6.26, all P cold stimulation + BCTC group [0.42 ± 0.09, 0.52 ± 0.13, 0.52 ± 0.12 and (72 ± 8) ng/L, (92 ± 14) ng/L, (68 ± 11) ng/L], cold stimulation + TRPM8 shRNA group [0.41 ± 0.10, 0.49 ± 0.08, 0.50 ± 0.08 and (60 ± 12) ng/L, (89 ± 14) ng

Dicer-independent processing of short hairpin RNAs

NARCIS (Netherlands)

Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben

2013-01-01

Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that

Differences in total and allergen specific IgE during pregnancy compared with 1 month and 1 year post partum.

Science.gov (United States)

Perry, Lee M; Ownby, Dennis R; Wegienka, Ganesa R; Peterson, Edward L; Woodcroft, Kimberly J; Joseph, Christine L; Johnson, Christine C

2009-10-01

Pregnancy alters the function of many body systems, including the immune system. However, little is known regarding the effect of pregnancy on maternal IgE levels or atopy. To determine whether pregnancy consistently influences serum levels of total or allergen specific IgE. Blood samples were obtained from 764 women during the third trimester of pregnancy and 1 month post partum. A third sample was obtained from 106 of these women 1 year post partum. Samples were analyzed for total and specific IgE to 8 regionally common allergens using a commercially available system. Sensitization was defined as an allergen specific IgE level of 0.35 kU of allergen per liter or higher to any allergen. Total IgE increased significantly post partum, both at 1 month (40.36 vs 35.37 IU/mL intrapartum; P = .001) and at 1 year (44.97 vs 37.00 IU/mL intrapartum; P = .005). Allergen specific IgE decreased significantly at 1 month for cat, dog, ragweed, timothy grass, and egg (P = .001 to P = .02) but not for dust mite, cockroach, or Alternaria (P = .15 to P = .90). Similar patterns of change in total and specific IgE were seen at 1 year. However, on average, only 3.5% of participants changed sensitization status to the individual allergens studied during the 1 year of observation. Compared with intrapartum levels, total IgE levels increased significantly at 1 month and 1 year post partum. Conversely, at the same time points, IgE levels specific for common allergens significantly declined to most but not all allergens. Few women changed their sensitization status over 1 year.

IGF-1 signaling mediated cell-specific skeletal mechano-transduction.

Science.gov (United States)

Tian, Faming; Wang, Yongmei; Bikle, Daniel D

2018-02-01

Mechanical loading preserves bone mass and stimulates bone formation, whereas skeletal unloading leads to bone loss. In addition to osteocytes, which are considered the primary sensor of mechanical load, osteoblasts, and bone specific mesenchymal stem cells also are involved. The skeletal response to mechanical signals is a complex process regulated by multiple signaling pathways including that of insulin-like growth factor-1 (IGF-1). Conditional osteocyte deletion of IGF-1 ablates the osteogenic response to mechanical loading. Similarly, osteocyte IGF-1 receptor (IGF-1R) expression is necessary for reloading-induced periosteal bone formation. Transgenic overexpression of IGF-1 in osteoblasts results in enhanced responsiveness to in vivo mechanical loading in mice, a response which is eliminated by osteoblastic conditional disruption of IGF-1 in vivo. Bone marrow derived stem cells (BMSC) from unloaded bone fail to respond to IGF-1 in vitro. IGF-1R is required for the transduction of a mechanical stimulus to downstream effectors, transduction which is lost when the IGF-1R is deleted. Although the molecular mechanisms are not yet fully elucidated, the IGF signaling pathway and its interactions with potentially interlinked signaling cascades involving integrins, the estrogen receptor, and wnt/β-catenin play an important role in regulating adaptive response of cancer bone cells to mechanical stimuli. In this review, we discuss recent advances investigating how IGF-1 and other interlinked molecules and signaling pathways regulate skeletal mechano-transduction involving different bone cells, providing an overview of the IGF-1 signaling mediated cell-specific response to mechanical stimuli. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:576-583, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.

Science.gov (United States)

Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan

2013-04-30

The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.

Identification of a Paralog-Specific Notch1 Intracellular Domain Degron

OpenAIRE

Broadus, Matthew R.; Chen, Tony W.; Neitzel, Leif R.; Ng, Victoria H.; Jodoin, Jeanne; Lee, Laura A.; Salic, Adrian; Robbins, David J.; Capobianco, Anthony J.; Patton, James G.; Huppert, Stacey S.; Lee, Ethan

2016-01-01

Upon Notch pathway activation, the receptor is cleaved to release the Notch intracellular domain (NICD), which translocates to the nucleus to activate gene transcription. Using Xenopus egg extracts, we have identified a Notch1-specific destruction signal (N1-Box). We show that mutations in the N1-Box inhibit NICD1 degradation and that the N1-Box is transferable for the promotion of degradation of heterologous proteins in Xenopus egg extracts and in cultured human cells. Mutation of the N1-Box...

Deletion of Fmr1 results in sex-specific changes in behavior.

Science.gov (United States)

Nolan, Suzanne O; Reynolds, Conner D; Smith, Gregory D; Holley, Andrew J; Escobar, Brianna; Chandler, Matthew A; Volquardsen, Megan; Jefferson, Taylor; Pandian, Ashvini; Smith, Tileena; Huebschman, Jessica; Lugo, Joaquin N

2017-10-01

In this study, we used a systemic Fmr1 knockout in order to investigate both genotype- and sex-specific differences across multiple measures of sociability, repetitive behaviors, activity levels, anxiety, and fear-related learning and memory. Fragile X syndrome is the most common monogenic cause of intellectual disability and autism. Few studies to date have examined sex differences in a mouse model of Fragile X syndrome, though clinical data support the idea of differences in both overall prevalence and phenotype between the sexes. Using wild-type and systemic homozygous Fmr1 knockout mice, we assessed a variety of behavioral paradigms in adult animals, including the open field test, elevated plus maze, nose-poke assay, accelerating rotarod, social partition task, three-chambered social task, and two different fear conditioning paradigms. Tests were ordered such that the most invasive tests were performed last in the sequence, and testing paradigms for similar behaviors were performed in separate cohorts to minimize testing effects. Our results indicate several sex-specific changes in Fmr1 knockout mice, including male-specific increases in activity levels, and female-specific increases in repetitive behaviors on both the nose-poke assay and motor coordination on the accelerating rotarod task. The results also indicated that Fmr1 deletion results in deficits in fear learning and memory across both sexes, and no changes in social behavior across two tasks. These findings highlight the importance of including female subjects in preclinical studies, as simply studying the impact of genetic mutations in males does not yield a complete picture of the phenotype. Further research should explore these marked phenotypic differences among the sexes. Moreover, given that treatment strategies are typically equivalent between the sexes, the results highlight a potential need for sex-specific therapeutics.

Multifunctional PLGA Nanobubbles as Theranostic Agents: Combining Doxorubicin and P-gp siRNA Co-Delivery Into Human Breast Cancer Cells and Ultrasound Cellular Imaging.

Science.gov (United States)

Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao

2015-12-01

Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated

Humans with chimpanzee-like major histocompatibility complex-specificities control HIV-1 infection

DEFF Research Database (Denmark)

Hoof, Ilka; Kesmir, Can; Lund, Ole

2008-01-01

and the progression rate to AIDS. Chimpanzees control HIV-1 viral replication and develop a chronic infection without progressing to AIDS. A similar course of disease is observed in human long-term non-progressors. Objective: To investigate if long-term non-progressors and chimpanzees have functional similarities...... in their MHC class I repertoire. Methods: We compared the specificity of groups of human MHC molecules associated with different levels of viremia in HIV-1 infected individuals with those of chimpanzee. Results and conclusion: We demonstrate that human MHC with control of HIV-1 viral load share binding motifs...... with chimpanzee MHC. Moreover, we find that chimpanzee and human MHC associated with low viral load are predicted to elicit broader Gag-specific immune responses than human MHC associated with high viral load, thus supporting earlier findings that Gag-specific immune responses are essential for HIV-1 control....

Programmed Death-1 expression on Epstein Barr virus specific CD8+ T cells varies by stage of infection, epitope specificity, and T-cell receptor usage.

Directory of Open Access Journals (Sweden)

Thomas C Greenough

Full Text Available BACKGROUND: Programmed Death-1 (PD-1 is an inhibitory member of the CD28 family of molecules expressed on CD8+ T cells in response to antigenic stimulation. To better understand the role of PD-1 in antiviral immunity we examined the expression of PD-1 on Epstein-Barr virus (EBV epitope-specific CD8+ T cells during acute infectious mononucleosis (AIM and convalescence. METHODOLOGY/PRINCIPAL FINDINGS: Using flow cytometry, we observed higher frequencies of EBV-specific CD8+ T cells and higher intensity of PD-1 expression on EBV-specific CD8+ T cells during AIM than during convalescence. PD-1 expression during AIM directly correlated with viral load and with the subsequent degree of CD8+ T cell contraction in convalescence. Consistent differences in PD-1 expression were observed between CD8+ T cells with specificity for two different EBV lytic antigen epitopes. Similar differences were observed in the degree to which PD-1 was upregulated on these epitope-specific CD8+ T cells following peptide stimulation in vitro. EBV epitope-specific CD8+ T cell proliferative responses to peptide stimulation were diminished during AIM regardless of PD-1 expression and were unaffected by blocking PD-1 interactions with PD-L1. Significant variability in PD-1 expression was observed on EBV epitope-specific CD8+ T cell subsets defined by V-beta usage. CONCLUSIONS/SIGNIFICANCE: These observations suggest that PD-1 expression is not only dependent on the degree of antigen presentation, but also on undefined characteristics of the responding cell that segregate with epitope specificity and V-beta usage.

Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

OpenAIRE

Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

2001-01-01

(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

Synthesis of high specific activity [1-3H]-D-glucose

International Nuclear Information System (INIS)

Saljoughian, M.; Morimoto, Hiromi; Williams, P.G.; Lee, Hakno

1991-01-01

Specifically labeled [1- 3 H]-D-glucose has been used for metabolic and mechanistic studies in erythrocytes. In vitro metabolism of the a and b anomers of the tritiated glucose was readily traced by 3 H NMR spectroscopy. Initial studies used labeled glucose obtained by catalytic exchange labeling (at 4.5-9 Ci/mmole, or 15-30% tritiated at the C-1 position), and this necessitated sample glucose concentrations of 2-4 times physiological. The availability of glucose at maximum specific activity (28.7 Ci/mmole, 100% at the C-1 position) would allow the authors to observe metabolic behavior using 1 mM levels of glucose. Accordingly, they have devised a new route for the synthesis of C-1 tritiated glucose, involving the synthesis of 4,6-O-benzylidene-D-gluconolactone followed by reduction with supertritide. Preliminary work with commercial superdeuteride is complete, and chromatographic and NMR analyses are promising. The analogous tritium reactions are currently underway, and experimental results are presented for all stages of investigation. This strategy should be generally applicable to the labeling of many reducing sugars, with the substrates 2-deoxyglucose and maltotriose being of particular interest to their research

HIV-1 Vif's Capacity To Manipulate the Cell Cycle Is Species Specific.

Science.gov (United States)

Evans, Edward L; Becker, Jordan T; Fricke, Stephanie L; Patel, Kishan; Sherer, Nathan M

2018-04-01

Cells derived from mice and other rodents exhibit profound blocks to HIV-1 virion production, reflecting species-specific incompatibilities between viral Tat and Rev proteins and essential host factors cyclin T1 (CCNT1) and exportin-1 (XPO1, also known as CRM1), respectively. To determine if mouse cell blocks other than CCNT1 and XPO1 affect HIV's postintegration stages, we studied HIV-1 NL4-3 gene expression in mouse NIH 3T3 cells modified to constitutively express HIV-1-compatible versions of CCNT1 and XPO1 (3T3.CX cells). 3T3.CX cells supported both Rev-independent and Rev-dependent viral gene expression and produced relatively robust levels of virus particles, confirming that CCNT1 and XPO1 represent the predominant blocks to these stages. Unexpectedly, however, 3T3.CX cells were remarkably resistant to virus-induced cytopathic effects observed in human cell lines, which we mapped to the viral protein Vif and its apparent species-specific capacity to induce G 2 /M cell cycle arrest. Vif was able to mediate rapid degradation of human APOBEC3G and the PPP2R5D regulatory B56 subunit of the PP2A phosphatase holoenzyme in mouse cells, thus demonstrating that Vif NL4-3 's modulation of the cell cycle can be functionally uncoupled from some of its other defined roles in CUL5-dependent protein degradation. Vif was also unable to induce G 2 /M cell cycle arrest in other nonhuman cell types, including cells derived from nonhuman primates, leading us to propose that one or more human-specific cofactors underpin Vif's ability to modulate the cell cycle. IMPORTANCE Cells derived from mice and other rodents exhibit profound blocks to HIV-1 replication, thus hindering the development of a low-cost small-animal model for studying HIV/AIDS. Here, we engineered otherwise-nonpermissive mouse cells to express HIV-1-compatible versions of two species-specific host dependency factors, cyclin T1 (CCNT1) and exportin-1 (XPO1) (3T3.CX cells). We show that 3T3.CX cells rescue HIV-1

Effect of Concentration on the Electrochemistry and Speciation of the Magnesium Aluminum Chloride Complex Electrolyte Solution.

Science.gov (United States)

See, Kimberly A; Liu, Yao-Min; Ha, Yeyoung; Barile, Christopher J; Gewirth, Andrew A

2017-10-18

Magnesium batteries offer an opportunity to use naturally abundant Mg and achieve large volumetric capacities reaching over four times that of conventional Li-based intercalation anodes. High volumetric capacity is enabled by the use of a Mg metal anode in which charge is stored via electrodeposition and stripping processes, however, electrolytes that support efficient Mg electrodeposition and stripping are few and are often prepared from highly reactive compounds. One interesting electrolyte solution that supports Mg deposition and stripping without the use of highly reactive reagents is the magnesium aluminum chloride complex (MACC) electrolyte. The MACC exhibits high Coulombic efficiencies and low deposition overpotentials following an electrolytic conditioning protocol that stabilizes species necessary for such behavior. Here, we discuss the effect of the MgCl 2 and AlCl 3 concentrations on the deposition overpotential, current density, and the conditioning process. Higher concentrations of MACC exhibit enhanced Mg electrodeposition current density and much faster conditioning. An increase in the salt concentrations causes a shift in the complex equilibria involving both cations. The conditioning process is strongly dependent on the concentration suggesting that the electrolyte is activated through a change in speciation of electrolyte complexes and is not simply due to the annihilation of electrolyte impurities. Additionally, the presence of the [Mg 2 (μ-Cl) 3 ·6THF] + in the electrolyte solution is again confirmed through careful analysis of experimental Raman spectra coupled with simulation and direct observation of the complex in sonic spray ionization mass spectrometry. Importantly, we suggest that the ∼210 cm -1 mode commonly observed in the Raman spectra of many Mg electrolytes is indicative of the C 3v symmetric [Mg 2 (μ-Cl) 3 ·6THF] + . The 210 cm -1 mode is present in many electrolytes containing MgCl 2 , so its assignment is of broad interest

Cleavage of Hyaluronan and CD44 Adhesion Molecule Regulate Astrocyte Morphology via Rac1 Signalling.

Directory of Open Access Journals (Sweden)

Anna Konopka

Full Text Available Communication of cells with their extracellular environment is crucial to fulfill their function in physiological and pathophysiological conditions. The literature data provide evidence that such a communication is also important in case of astrocytes. Mechanisms that contribute to the interaction between astrocytes and extracellular matrix (ECM proteins are still poorly understood. Hyaluronan is the main component of ECM in the brain, where its major receptor protein CD44 is expressed by a subset of astrocytes. Considering the fact that functions of astrocytes are tightly coupled with changes in their morphology (e.g.: glutamate clearance in the synaptic cleft, migration, astrogliosis, we investigated the influence of hyaluronan cleavage by hyaluronidase, knockdown of CD44 by specific shRNA and CD44 overexpression on astrocyte morphology. Our results show that hyaluronidase treatment, as well as knockdown of CD44, in astrocytes result in a "stellate"-like morphology, whereas overexpression of CD44 causes an increase in cell body size and changes the shape of astrocytes into flattened cells. Moreover, as a dynamic reorganization of the actin cytoskeleton is supposed to be responsible for morphological changes of cells, and this reorganization is controlled by small GTPases of the Rho family, we hypothesized that GTPase Rac1 acts as a downstream effector for hyaluronan and CD44 in astrocytes. We used FRET-based biosensor and a dominant negative mutant of Rac1 to investigate the involvement of Rac1 activity in hyaluronidase- and CD44-dependent morphological changes of astrocytes. Both, hyaluronidase treatment and knockdown of CD44, enhances Rac1 activity while overexpression of CD44 reduces the activity state in astrocytes. Furthermore, morphological changes were blocked by specific inhibition of Rac1 activity. These findings indicate for the first time that regulation of Rac1 activity is responsible for hyaluronidase and CD44-driven morphological

Cleavage of Hyaluronan and CD44 Adhesion Molecule Regulate Astrocyte Morphology via Rac1 Signalling.

Science.gov (United States)

Konopka, Anna; Zeug, Andre; Skupien, Anna; Kaza, Beata; Mueller, Franziska; Chwedorowicz, Agnieszka; Ponimaskin, Evgeni; Wilczynski, Grzegorz M; Dzwonek, Joanna

2016-01-01

Communication of cells with their extracellular environment is crucial to fulfill their function in physiological and pathophysiological conditions. The literature data provide evidence that such a communication is also important in case of astrocytes. Mechanisms that contribute to the interaction between astrocytes and extracellular matrix (ECM) proteins are still poorly understood. Hyaluronan is the main component of ECM in the brain, where its major receptor protein CD44 is expressed by a subset of astrocytes. Considering the fact that functions of astrocytes are tightly coupled with changes in their morphology (e.g.: glutamate clearance in the synaptic cleft, migration, astrogliosis), we investigated the influence of hyaluronan cleavage by hyaluronidase, knockdown of CD44 by specific shRNA and CD44 overexpression on astrocyte morphology. Our results show that hyaluronidase treatment, as well as knockdown of CD44, in astrocytes result in a "stellate"-like morphology, whereas overexpression of CD44 causes an increase in cell body size and changes the shape of astrocytes into flattened cells. Moreover, as a dynamic reorganization of the actin cytoskeleton is supposed to be responsible for morphological changes of cells, and this reorganization is controlled by small GTPases of the Rho family, we hypothesized that GTPase Rac1 acts as a downstream effector for hyaluronan and CD44 in astrocytes. We used FRET-based biosensor and a dominant negative mutant of Rac1 to investigate the involvement of Rac1 activity in hyaluronidase- and CD44-dependent morphological changes of astrocytes. Both, hyaluronidase treatment and knockdown of CD44, enhances Rac1 activity while overexpression of CD44 reduces the activity state in astrocytes. Furthermore, morphological changes were blocked by specific inhibition of Rac1 activity. These findings indicate for the first time that regulation of Rac1 activity is responsible for hyaluronidase and CD44-driven morphological changes of

M3 receptor is involved in the effect of penehyclidine hydrochloride reduced endothelial injury in LPS-stimulated human pulmonary microvascular endothelial cell.

Science.gov (United States)

Yuan, Qinghong; Xiao, Fei; Liu, Qiangsheng; Zheng, Fei; Shen, Shiwen; He, Qianwen; Chen, Kai; Wang, Yanlin; Zhang, Zongze; Zhan, Jia

2018-02-01

LPS has been recently shown to induce muscarinic acetylcholine 3 receptor (M 3 receptor) expression and penehyclidine hydrochloride (PHC) is an anticholinergic drug which could block the expression of M 3 receptor. PHC has been demonstrated to perform protective effect on cell injury. This study is to investigate whether the effect of PHC on microvascular endothelial injury is related to its inhibition of M 3 receptor or not. HPMVECs were treated with specific M 3 receptor shRNA or PBS, and randomly divided into LPS group (A group), LPS+PHC group (B group), LPS + M 3 shRNA group (C group) and LPS + PHC + M 3 shRNA group (D group). Cells were collected at 60 min after LPS treatment to measure levels of LDH, endothelial permeability, TNF-α and IL-6 levels, NF-κB p65 activation, I-κB protein expression, p38MAPK, and ERK1/2 activations as well as M 3 mRNA expression. PHC could decrease LDH levels, cell permeability, TNF-α and IL-6 levels, p38 MAPK, ERK1/2, NF-κB p65 activations and M 3 mRNA expressions compared with LPS group. When M 3 receptor was silence, the changes of these indices were much more obvious. These findings suggest that M 3 receptor plays an important role in LPS-induced pulmonary microvascular endothelial injury, which is regulated through NF-κB p65 and MAPK activation. And knockout of M 3 receptor could attenuate LPS-induced pulmonary microvascular endothelial injury. Regulative effects of PHC on pulmonary microvascular permeability and NF-κB p65 as well as MAPK activations are including but not limited to inhibition of M 3 receptor. Copyright © 2017 Elsevier Ltd. All rights reserved.

Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

Energy Technology Data Exchange (ETDEWEB)

Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

2006-03-31

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

Wnt signaling positively regulates endothelial cell fate specification in the Fli1a-positive progenitor population via Lef1.

Science.gov (United States)

Hübner, Kathleen; Grassme, Kathrin S; Rao, Jyoti; Wenke, Nina K; Zimmer, Cordula L; Korte, Laura; Mu Ller, Katja; Sumanas, Saulius; Greber, Boris; Herzog, Wiebke

2017-10-01

During vertebrate embryogenesis, vascular endothelial cells (ECs) and primitive erythrocytes become specified within close proximity in the posterior lateral plate mesoderm (LPM) from a common progenitor. However, the signaling cascades regulating the specification into either lineage remain largely elusive. Here, we analyze the contribution of β-catenin dependent Wnt signaling to EC and erythrocyte specification during zebrafish embryogenesis. We generated novel β-catenin dependent Wnt signaling reporters which, by using destabilized fluorophores (Venus-Pest, dGFP), specifically allow us to detect Wnt signaling responses in narrow time windows as well as in spatially restricted domains, defined by Cre recombinase expression (Tg(axin2 BAC :Venus-Pest) mu288 ; Tg(14TCF:loxP-STOP-loxP-dGFP) mu202 ). We therefore can detect β-catenin dependent Wnt signaling activity in a subset of the Fli1a-positive progenitor population. Additionally, we show that mesodermal Wnt3a-mediated signaling via the transcription factor Lef1 positively regulates EC specification (defined by kdrl expression) at the expense of primitive erythrocyte specification (defined by gata1 expression) in zebrafish embryos. Using mesoderm derived from human embryonic stem cells, we identified the same principle of Wnt signaling dependent EC specification in conjunction with auto-upregulation of LEF1. Our data indicate a novel role of β-catenin dependent Wnt signaling in regulating EC specification during vasculogenesis. Copyright © 2017. Published by Elsevier Inc.

CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection

Science.gov (United States)

Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul

2014-01-01

CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967

Effects of continuous positive airway pressure on anxiety, depression, and major cardiac and cerebro-vascular events in obstructive sleep apnea patients with and without coronary artery disease.

Science.gov (United States)

Lee, Ming-Chung; Shen, Yu-Chih; Wang, Ji-Hung; Li, Yu-Ying; Li, Tzu-Hsien; Chang, En-Ting; Wang, Hsiu-Mei

2017-01-01

Obstructive sleep apnea (OSA) is associated with bad cardiovascular outcomes and a high prevalence of anxiety and depression. This study investigated the effects of continuous positive airway pressure (CPAP) on the severity of anxiety and depression in OSA patients with or without coronary artery disease (CAD) and on the rate of cardio- and cerebro-vascular events in those with OSA and CAD. This prospective study included patients with moderate-to-severe OSA, with or without a recent diagnosis of CAD; all were started on CPAP therapy. Patients completed the Chinese versions of the Beck Anxiety Inventory (BAI) and Beck Depression Inventory-II (BDI-II) at baseline and after 6-month follow-up. The occurrence of major adverse cardiac and cerebrovascular events (MACCE) was assessed every 3 months up to 1 year. BAI scores decreased from 8.5 ± 8.4 at baseline to 5.4 ± 6.9 at 6 months in CPAP-compliant OSA patients without CAD ( P < 0.05). BAI scores also decreased from 20.7 ± 14.9 to 16.1 ± 14.5 in CPAP-compliant OSA patients with CAD. BDI-II scores decreased in CPAP-compliant OSA patients without CAD (from 11.1 ± 10.7 at baseline to 6.6 ± 9.5 at 6 months) and in CPAP-compliant OSA patients with CAD (from 20.4 ± 14.3 to 15.9 ± 7.3). In addition, there was a large effect size (ES) of BAI and BDI in 6-month CPAP treatment of OSA patients with CAD and a large ES in those with OSA under CPAP treatment. In OSA patients with CAD, the occurrence of MACCE was significantly lower in CPAP-compliant patients than that in CPAP noncompliant patients (11% in CPAP compliant and 50% in noncompliant; P < 0.05). CPAP improved anxiety and depression in OSA patients regardless of CAD. In OSA patients with CAD, CPAP-compliant patients had a lower 1-year rate of MACCE than CPAP-noncompliant patients.

Letrozole regulates actin cytoskeleton polymerization dynamics in a SRC-1 dependent manner in the hippocampus of mice.

Science.gov (United States)

Zhao, Yangang; Yu, Yanlan; Zhang, Yuanyuan; He, Li; Qiu, Linli; Zhao, Jikai; Liu, Mengying; Zhang, Jiqiang

2017-03-01

In the hippocampus, local estrogens (E 2 ) derived from testosterone that is catalyzed by aromatase play important roles in the regulation of hippocampal neural plasticity, but the underlying mechanisms remain unclear. The actin cytoskeleton contributes greatly to hippocampal synaptic plasticity; however, whether it is regulated by local E 2 and the related mechanisms remain to be elucidated. In this study, we first examined the postnatal developmental profiles of hippocampal aromatase and specific proteins responsible for actin cytoskeleton dynamics. Then we used aromatase inhibitor letrozole (LET) to block local E 2 synthesis and examined the changes of these proteins and steroid receptor coactivator-1 (SRC-1), the predominant coactivator for steroid nuclear receptors. Finally, SRC-1 specific RNA interference was used to examine the effects of SRC-1 on the expression of these actin remodeling proteins. The results showed a V-type profile for aromatase and increased profiles for actin cytoskeleton proteins in both male and female hippocampus without obvious sex differences. LET treatment dramatically decreased the F-actin/G-actin ratio, the expression of Rictor, phospho-AKT (ser473), Profilin-1, phospho-Cofilin (Ser3), and SRC-1 in a dose-dependent manner. In vitro studies demonstrated that LET induced downregulation of these proteins could be reversed by E 2 , and E 2 induced increase of these proteins were significantly suppressed by SRC-1 shRNA interference. These results for the first time clearly demonstrated that local E 2 inhibition could induce aberrant actin polymerization; they also showed an important role of SRC-1 in the mediation of local E 2 action on hippocampal synaptic plasticity by regulation of actin cytoskeleton dynamics. Copyright © 2016 Elsevier Ltd. All rights reserved.

MUC1-specific cytotoxic T lymphocytes eradicate tumors when adoptively transferred in vivo.

Science.gov (United States)

Mukherjee, P; Ginardi, A R; Tinder, T L; Sterner, C J; Gendler, S J

2001-03-01

We have reported previously that MUC1 transgenic mice with spontaneous tumors of the pancreas (designated MET) naturally develop MHC class I-restricted, MUC1-specific CTLs as tumors progress (P. Mukherjee et al., J. Immunol., 165: 3451-3460, 2000). From these MET mice, we have isolated, expanded, and cloned naturally occurring MUC1-specific CTLs in vitro. In this report, we show that the CTL line is predominantly CD8+ T cells and expresses T-cell receptor Vbeta chains 5.1/5.2, 11, 13, and 2 and Valpha chains 2, 8.3, 3.2, and 11.1/11.2. These CTLs recognize several epitopes on the MUC1 tandem repeat with highest affinity to APGSTAPPA. The CTL clone, on the other hand, is 100% CD8+ cells and expresses a single Vbeta chain of 5.1/5.2 and Valpha2. It recognizes only the H-2Db class I-restricted epitope of MUC1, APGSTAPPA. When adoptively transferred, the CTLs were effective in eradicating MUC1-expressing injected tumor cells including mammary gland cells (C57mg) and B16 melanomas. These results suggest that MUC1-specific CTLs are capable of possibly preventing, or at least substantially delaying, MUC1-expressing tumor formation. To our knowledge, this is the first evidence that demonstrates that the naturally occurring MUC1-specific CTLs isolated from one tumor model has antitumor effects on other MUC1-expressing tumors in vivo. Therefore, our data confirm that MUC1 is an important tumor rejection antigen and can serve as a target for immunotherapy.

Application of shRNA-containing herpes simplex virus type 1 (HSV-1)-based gene therapy for HSV-2-induced genital herpes.

Science.gov (United States)

Liu, Zhihong; Xiang, Yang; Wei, Zhun; Yu, Bo; Shao, Yong; Zhang, Jie; Yang, Hong; Li, Manmei; Guan, Ming; Wan, Jun; Zhang, Wei

2013-11-01

HSV-1-based vectors have been widely used to achieve targeted delivery of genes into the nervous system. In the current study, we aim to use shRNA-containing HSV-1-based gene delivery system for the therapy of HSV-2 infection. Guinea pigs were infected intravaginally with HSV-2 and scored daily for 100 days for the severity of vaginal disease. HSV-2 shRNA-containing HSV-1 was applied intravaginally daily between 8 and 14 days after HSV-2 challenge. Delivery of HSV-2 shRNA-containing HSV-1 had no effect on the onset of disease and acute virus shedding in animals, but resulted in a significant reduction in both the cumulative recurrent lesion days and the number of days with recurrent disease. Around half of the animals in the HSV-2 shRNA group did not develop recurrent disease 100 days post HSV-2 infection. In conclusion, HSV-2 shRNA-containing HSV-1 particles are effective in reducing the recurrence of genital herpes caused by HSV-2. Copyright © 2013 Elsevier B.V. All rights reserved.

Role of Rac1 Pathway in Epithelial-to-Mesenchymal Transition and Cancer Stem-like Cell Phenotypes in Gastric Adenocarcinoma.

Science.gov (United States)

Yoon, Changhwan; Cho, Soo-Jeong; Chang, Kevin K; Park, Do Joong; Ryeom, Sandra W; Yoon, Sam S

2017-08-01

Rac1, a Rho GTPase family member, is dysregulated in a variety of tumor types including gastric adenocarcinoma, but little is known about its role in cancer stem-like cells (CSCs). Therefore, Rac1 activity and inhibition were examined in gastric adenocarcinoma cells and mouse xenograft models for epithelial-to-mesenchymal transition (EMT) and CSC phenotypes. Rac1 activity was significantly higher in spheroid-forming or CD44 + gastric adenocarcinoma CSCs compared with unselected cells. Rac1 inhibition using Rac1 shRNA or a Rac1 inhibitor (NSC23766) decreased expression of the self-renewal transcription factor, Sox-2, decreased spheroid formation by 78%-81%, and prevented tumor initiation in immunodeficient mice. Gastric adenocarcinoma CSCs had increased expression of the EMT transcription factor Slug, 4.4- to 8.3-fold greater migration, and 4.2- to 12.6-fold greater invasion than unselected cells, and these increases could be blocked completely with Rac1 inhibition. Gastric adenocarcinoma spheroid cells were resistant to 5-fluorouracil and cisplatin chemotherapy, and this chemotherapy resistance could be reversed with Rac1 shRNA or NSC23766. The PI3K/Akt pathway may be upstream of Rac1, and JNK may be downstream of Rac1. In the MKN-45 xenograft model, cisplatin inhibited tumor growth by 50%, Rac1 inhibition by 35%, and the combination by 77%. Higher Rac1 activity, in clinical specimens from gastric adenocarcinoma patients who underwent potentially curative surgery, correlated with significantly worse survival ( P = 0.017). In conclusion, Rac1 promotes the EMT program in gastric adenocarcinoma and the acquisition of a CSC state. Rac1 inhibition in gastric adenocarcinoma cells blocks EMT and CSC phenotypes, and thus may prevent metastasis and augment chemotherapy. Implications: In gastric adenocarcinoma, therapeutic targeting of the Rac1 pathway may prevent or reverse EMT and CSC phenotypes that drive tumor progression, metastasis, and chemotherapy resistance. Mol

Alteration of a recombinant protein N-glycan structure in silkworms by partial suppression of N-acetylglucosaminidase gene expression.

Science.gov (United States)

Kato, Tatsuya; Kikuta, Kotaro; Kanematsu, Ayumi; Kondo, Sachiko; Yagi, Hirokazu; Kato, Koichi; Park, Enoch Y

2017-09-01

To synthesize complex type N-glycans in silkworms, shRNAs against the fused lobe from Bombyx mori (BmFDL), which codes N-acetylglucosaminidase (GlcNAcase) in the Golgi, was expressed by recombinant B. mori nucleopolyhedrovirus (BmNPV) in silkworm larvae. Expression was under the control of the actin promoter of B. mori or the U6-2 and i.e.-2 promoters from Orgyia pseudotsugata multiple nucleopolyhedrovirus (OpMNPV). The reduction of specific GlcNAcase activity was observed in Bm5 cells and silkworm larvae using the U6-2 promoter. In silkworm larvae, the partial suppression of BmFDL gene expression was observed. When shRNA against BmFDL was expressed under the control of U6-2 promoter, the Man 3 GlcNAc(Fuc)GlcNAc structure appeared in a main N-glycans of recombinant human IgG. These results suggested that the control of BmFDL expression by its shRNA in silkworms caused the modification of its N-glycan synthetic pathway, which may lead to the alteration of N-glycans in the expressed recombinant proteins. Suppression of BmFDL gene expression by shRNA is not sufficient to synthesize complex N-glycans in silkworm larvae but can modify the N-glycan synthetic pathway.

Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.

Science.gov (United States)

Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro

2018-05-03

Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.

[Effect of ginsenoside Rg3 on Pim-3 and Bad proteins in human pancreatic cancer cell line PANC-1].

Science.gov (United States)

Jian, Jie; Hu, Zhi-Fang; Huang, Yuan

2009-05-01

Ginsenoside Rg3 is a traditional Chinese medicine monomer which possesses anticancer effects. This study was to investigate the effects of ginsenoside Rg3 on Pim-3 and phosphorylated Bad (pBad) proteins, pBad (Ser112) and pBad (Ser136) in human pancreatic cancer cell line PANC-1. PANC-1 cells were exposed to 10, 20, 40 and 80 micromol/L ginsenoside Rg3 for 24 h. A short hairpin RNA (shRNA) of Pim-3 was cloned and inserted into a eukaryotic expression vector pSilencer 3.1-H1 Neo to construct pSilencer 3.1-H1 Neo-Pim-3. pSilencer 3.1-H1 Neo-Pim-3 was then transfected into PANC-1 cells. Cell proliferation was measured by MTT assay; cell apoptosis was observed under an invert microscope and measured by flow cytometry with Annexin V/PI staining; protein expressions of Pim-3, Bad, pBad (Ser112) and pBad (Ser136) were measured by Western blot. The inhibitory rates of 10, 20, 40 and 80 micromol/L ginsenoside Rg3 on PANC-1 cells were 20.2%, 33.4%, 52.8% and 65.3%, respectively. Typical morphological changes in apoptosis were induced by ginsenoside Rg3. The apoptotic rate of PANC-1 cells was significantly higher in the ginsenoside Rg3 treatment group (80 micromol/L) than in the control group (12.2% vs. 3.3%, PPANC-1 cells. Compared with the control group, the percentages of early and total apoptotic cells were significantly increased in PANC-1 cells transfected with pim-3-shRNA [(11.5+/-3.7)% vs. (5.8+/-2.2)%,P<0.01;(20.8+/-2.6)% vs.(13.0+/-4.1)%,P<0.05], while the expressions of pim-3 and pBad (Ser112) were both decreased. The anti-tumor effect of ginsenoside Rg3 may be associated with the decrease of Pim-3 and pBad (Ser112).

Sulforaphane Suppresses Hepatitis C Virus Replication by Up-Regulating Heme Oxygenase-1 Expression through PI3K/Nrf2 Pathway.

Directory of Open Access Journals (Sweden)

Jung-Sheng Yu

Full Text Available Hepatitis C virus (HCV infection-induced oxidative stress is a major risk factor for the development of HCV-associated liver disease. Sulforaphane (SFN is an antioxidant phytocompound that acts against cellular oxidative stress and tumorigenesis. However, there is little known about its anti-viral activity. In this study, we demonstrated that SFN significantly suppressed HCV protein and RNA levels in HCV replicon cells and infectious system, with an IC50 value of 5.7 ± 0.2 μM. Moreover, combination of SFN with anti-viral drugs displayed synergistic effects in the suppression of HCV replication. In addition, we found nuclear factor erythroid 2-related factor 2 (Nrf2/HO-1 induction in response to SFN and determined the signaling pathways involved in this process, including inhibition of NS3 protease activity and induction of IFN response. In contrast, the anti-viral activities were attenuated by knockdown of HO-1 with specific inhibitor (SnPP and shRNA, suggesting that anti-HCV activity of SFN is dependent on HO-1 expression. Otherwise, SFN stimulated the phosphorylation of phosphoinositide 3-kinase (PI3K leading Nrf2-mediated HO-1 expression against HCV replication. Overall, our results indicated that HO-1 is essential in SFN-mediated anti-HCV activity and provide new insights in the molecular mechanism of SFN in HCV replication.

The role of integrin-α5 in the proliferation and odontogenic differentiation of human dental pulp stem cells.

Science.gov (United States)

Cui, Li; Xu, Shuaimei; Ma, Dandan; Gao, Jie; Liu, Ying; Yue, Jing; Wu, Buling

2014-02-01

It has been reported that integrin-α5 (ITGA5) activity is related to cell proliferation, differentiation, migration, and organ development. However, the involvement of ITGA5 in the biological functions of human dental pulp stem cells (hDPSCs) has not been explored. The aim of this study was to investigate the role of ITGA5 in the proliferation and odontogenic differentiation of hDPSCs. We knocked down ITGA5 in hDPSCs using lentivirus-mediated ITGA5 short hairpin RNA (shRNA). Changes in the proliferation in hDPSCs infected with lentiviruses expressing ITGA5-specific shRNA or negative control shRNA were examined using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and 5-ethynyl-2'-deoxyuridine labeling. Both ITGA5 knockdown cells and shMock cells were cultured in mineralization medium for 3 weeks, and the differentiation of cells was detected with alizarin red S staining. The expression of odontogenic differentiation-related molecular markers was assessed using real-time polymerase chain reaction and Western blot assays. The knockdown of ITGA5 decreased the proliferation capacity of hDPSCs. ITGA5 shRNA promoted odontogenic differentiation of hDPSCs with the enhanced formation of mineralized nodules. It also up-regulated the messenger RNA expression of multiple markers of odontogenesis and the expression of dentin sialophosphoprotein protein. These findings suggest that ITGA5 plays an important role in maintaining hDPSCs in a proliferative state. The inhibition of ITGA5 signaling promotes the odontogenic differentiation of hDPSCs. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

Energy Technology Data Exchange (ETDEWEB)

Adhikary, Suraj; Eichman, Brandt F. (Vanderbilt)

2014-10-02

DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

Neutrophil glycoprotein Mo1 is an integral membrane protein of plasma membranes and specific granules

International Nuclear Information System (INIS)

Stevenson, K.B.; Nauseef, W.M.; Clark, R.A.

1987-01-01

The glucoprotein Mo1 has previously been demonstrated to be on the cell surface and in the specific granule fraction of neutrophils and to be translocated to the cell surface during degranulation. It is not known, however, whether Mo1 is an integral membrane protein or a soluble, intragranular constituent loosely associated with the specific granule membrane. Purified neutrophils were disrupted by nitrogen cavitation and separated on Percoll density gradients into four fractions enriched for azurophilic granules, specific granules, plasma membrane, and cytosol, respectively. The glycoproteins in these fractions were labeled with 3 H-borohydride reduction, extracted with Triton X-114, and immunoprecipitated with 60.3, an anti-Mo1 monoclonal antibody. Mo1 was detected only in the specific granule and plasma membrane fractions and partitioned exclusively into the detergent-rich fraction consistent with Mo1 being an integral membrane protein. In addition, treatment of specific granule membranes with a high salt, high urea buffer to remove adsorbed or peripheral proteins failed to dissociate Mo1. These data support the hypothesis that Mo1 is an integral membrane protein of plasma and specific granule membranes in human neutrophils

Effects of PKM2 Gene Silencing on the Proliferation and Apoptosis of Colorectal Cancer LS-147T and SW620 Cells

Directory of Open Access Journals (Sweden)

Ran Ao

2017-07-01

Full Text Available Background/Aims: This paper aims to explore the effects of pyruvate kinase (PK M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC LS-147T and SW620 cells. Methods: CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative real-time polymerase chain reaction (qRT-PCR and then assigned into the blank (no transfection, PKM2-shRNA (transfection with shRNA and empty plasmid (transfection with empty plasmid groups. Immunofluorescence was applied to detect PKM2 protein expression. qRT-PCR and Western blotting were conducted to assess mRNA and protein expression of PKM2, p53 and p21. The cell counting kit-8 (CCK-8 assay was used to assess cell proliferation. Flow cytometry was used to assess the cell cycle and apoptosis rate, and a senescence-associated β-galactosidase staining kit was used to assess cell senescence. Results: PKM2 exhibited high mRNA expression among CRC LS-147T and SW620 cells with remarkable protein expression noted in the cytoplasm and nucleus. The PKM2-shRNA group exhibited reduced PKM2 mRNA and protein expression, whereas p53 and p21 expression was increased compared with the blank and empty plasmid groups. Cell proliferation in PKM2-shRNA cells decreased significantly compared with the blank group and empty plasmid groups. The PKM2-shRNA group exhibited more cells in the G1 phase and fewer cells in the G2/M phase compared with the blank and empty plasmid groups. In addition, the PKM2-shRNA group exhibited significantly increased apoptosis rates and β-galactosidase activity compared with the blank and empty plasmid groups. Conclusion: Our study demonstrates that PKM2 gene silencing suppresses proliferation and promotes apoptosis in LS-147T and SW620 cells.

Dyslexia risk variant rs600753 is linked with dyslexia-specific differential allelic expression of DYX1C1

Directory of Open Access Journals (Sweden)

Bent Müller

2018-02-01

Full Text Available Abstract An increasing number of genetic variants involved in dyslexia development were discovered during the last years, yet little is known about the molecular functional mechanisms of these SNPs. In this study we investigated whether dyslexia candidate SNPs have a direct, disease-specific effect on local expression levels of the assumed target gene by using a differential allelic expression assay. In total, 12 SNPs previously associated with dyslexia and related phenotypes were suitable for analysis. Transcripts corresponding to four SNPs were sufficiently expressed in 28 cell lines originating from controls and a family affected by dyslexia. We observed a significant effect of rs600753 on expression levels of DYX1C1 in forward and reverse sequencing approaches. The expression level of the rs600753 risk allele was increased in the respective seven cell lines from members of the dyslexia family which might be due to a disturbed transcription factor binding sites. When considering our results in the context of neuroanatomical dyslexia-specific findings, we speculate that this mechanism may be part of the pathomechanisms underlying the dyslexia-specific brain phenotype. Our results suggest that allele-specific DYX1C1 expression levels depend on genetic variants of rs600753 and contribute to dyslexia. However, these results are preliminary and need replication.

Structural Characterization of the Hemagglutinin Receptor Specificity from the 2009 H1N1 Influenza Pandemic

Energy Technology Data Exchange (ETDEWEB)

Xu, Rui; McBride, Ryan; Nycholat, Corwin M.; Paulson, James C.; Wilson, Ian A. (Scripps)

2012-02-13

Influenza virus hemagglutinin (HA) is the viral envelope protein that mediates viral attachment to host cells and elicits membrane fusion. The HA receptor-binding specificity is a key determinant for the host range and transmissibility of influenza viruses. In human pandemics of the 20th century, the HA normally has acquired specificity for human-like receptors before widespread infection. Crystal structures of the H1 HA from the 2009 human pandemic (A/California/04/2009 [CA04]) in complex with human and avian receptor analogs reveal conserved recognition of the terminal sialic acid of the glycan ligands. However, favorable interactions beyond the sialic acid are found only for {alpha}2-6-linked glycans and are mediated by Asp190 and Asp225, which hydrogen bond with Gal-2 and GlcNAc-3. For {alpha}2-3-linked glycan receptors, no specific interactions beyond the terminal sialic acid are observed. Our structural and glycan microarray analyses, in the context of other high-resolution HA structures with {alpha}2-6- and {alpha}2-3-linked glycans, now elucidate the structural basis of receptor-binding specificity for H1 HAs in human and avian viruses and provide a structural explanation for the preference for {alpha}2-6 siaylated glycan receptors for the 2009 pandemic swine flu virus.

[Percutaneous coronary intervention of unprotected left main coronary compared with coronary artery bypass grafting; 3 years of experience in the National Institute of Cardiology, Mexico].

Science.gov (United States)

López-Aguilar, Carlos; Abundes-Velasco, Arturo; Eid-Lidt, Guering; Piña-Reyna, Yigal; Gaspar-Hernández, Jorge

The best revascularisation method of the unprotected left main artery is a current and evolving topic. A total of 2439 percutaneous coronary interventions (PCI) were registered during a 3-year period. The study included all the patients with PCI of the unprotected left main coronary (n=48) and matched with patients who underwent coronary artery bypass graft (CABG) (n=50). Major adverse cerebral and cardiac events (MACCE) were assessed within the hospital and in outpatients during a 16 month follow up. The cardiovascular risk was greater in the PCI group; logEuroSCORE 16±21 vs. 5±6, P=.001; clinical Syntax 77±74 vs 53±39, P=.04. On admission, the PCI group of patients had a higher frequency of ST segment elevation myocardial infarction (STEMI) and cardiogenic shock. The MACCE were similar in both groups (14% vs. 18%, P=.64). STEMI was less frequent in the PCI group (0% vs. 10%, P=.03). Cardiovascular events were lower in the PCI group (2.3% vs. 18%, P=.01), and there was a decrease in general and cardiac mortality (2.3% vs. 12%, P=.08 y 2.3% vs. 8%, P=.24), on excluding the patients with cardiogenic shock as a presentation. MACCE were similar in both groups in the out-patient phase (15% vs. 12%, P=.46). Survival without MACCE, general and cardiac death were comparable between groups (log rank, P=.38, P=.44 and P=.16, respectively). Even though the clinical and peri-procedural risk profile of the PCI patients were higher, the in-hospital and out-hospital efficacy and safety were comparable with CABG. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

Tissue-specific regulation of BMP signaling by Drosophila N-glycanase 1.

Science.gov (United States)

Galeone, Antonio; Han, Seung Yeop; Huang, Chengcheng; Hosomi, Akira; Suzuki, Tadashi; Jafar-Nejad, Hamed

2017-08-04

Mutations in the human N- glycanase 1 ( NGLY1 ) cause a rare, multisystem congenital disorder with global developmental delay. However, the mechanisms by which NGLY1 and its homologs regulate embryonic development are not known. Here we show that Drosophila Pngl encodes an N -glycanase and exhibits a high degree of functional conservation with human NGLY1. Loss of Pngl results in developmental midgut defects reminiscent of midgut-specific loss of BMP signaling. Pngl mutant larvae also exhibit a severe midgut clearance defect, which cannot be fully explained by impaired BMP signaling. Genetic experiments indicate that Pngl is primarily required in the mesoderm during Drosophila development. Loss of Pngl results in a severe decrease in the level of Dpp homodimers and abolishes BMP autoregulation in the visceral mesoderm mediated by Dpp and Tkv homodimers. Thus, our studies uncover a novel mechanism for the tissue-specific regulation of an evolutionarily conserved signaling pathway by an N -glycanase enzyme.

The Atg1-Tor pathway regulates yolk catabolism in Drosophila embryos.

Science.gov (United States)

Kuhn, Hallie; Sopko, Richelle; Coughlin, Margaret; Perrimon, Norbert; Mitchison, Tim

2015-11-15

Yolk provides an important source of nutrients during the early development of oviparous organisms. It is composed mainly of vitellogenin proteins packed into membrane-bound compartments called yolk platelets. Catabolism of yolk is initiated by acidification of the yolk platelet, leading to the activation of Cathepsin-like proteinases, but it is unknown how this process is triggered. Yolk catabolism initiates at cellularization in Drosophila melanogaster embryos. Using maternal shRNA technology we found that yolk catabolism depends on the Tor pathway and on the autophagy-initiating kinase Atg1. Whereas Atg1 was required for a burst of spatially regulated autophagy during late cellularization, autophagy was not required for initiating yolk catabolism. We propose that the conserved Tor metabolic sensing pathway regulates yolk catabolism, similar to Tor-dependent metabolic regulation on the lysosome. © 2015. Published by The Company of Biologists Ltd.

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

Science.gov (United States)

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

[Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

Science.gov (United States)

Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

2018-01-01

Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

The PP1 binding code: a molecular-lego strategy that governs specificity.

Science.gov (United States)

Heroes, Ewald; Lesage, Bart; Görnemann, Janina; Beullens, Monique; Van Meervelt, Luc; Bollen, Mathieu

2013-01-01

Ser/Thr protein phosphatase 1 (PP1) is a single-domain hub protein with nearly 200 validated interactors in vertebrates. PP1-interacting proteins (PIPs) are ubiquitously expressed but show an exceptional diversity in brain, testis and white blood cells. The binding of PIPs is mainly mediated by short motifs that dock to surface grooves of PP1. Although PIPs often contain variants of the same PP1 binding motifs, they differ in the number and combination of docking sites. This molecular-lego strategy for binding to PP1 creates holoenzymes with unique properties. The PP1 binding code can be described as specific, universal, degenerate, nonexclusive and dynamic. PIPs control associated PP1 by interference with substrate recruitment or access to the active site. In addition, some PIPs have a subcellular targeting domain that promotes dephosphorylation by increasing the local concentration of PP1. The diversity of the PP1 interactome and the properties of the PP1 binding code account for the exquisite specificity of PP1 in vivo. © 2012 The Authors Journal compilation © 2012 FEBS.

Marine aerosol distribution and variability over the pristine Southern Indian Ocean

Science.gov (United States)

Mallet, Paul-Étienne; Pujol, Olivier; Brioude, Jérôme; Evan, Stéphanie; Jensen, Andrew

2018-06-01

This paper presents an 8-year (2005-2012 inclusive) study of the marine aerosol distribution and variability over the Southern Indian Ocean, precisely in the area { 10 °S - 40 °S ; 50 °E - 110 °E } which has been identified as one of the most pristine regions of the globe. A large dataset consisting of satellite data (POLDER, CALIOP), AERONET measurements at Saint-Denis (French Réunion Island) and model reanalysis (MACC), has been used. In spite of a positive bias of about 0.05 between the AOD (aerosol optical depth) given by POLDER and MACC on one hand and the AOD measured by AERONET on the other, consistent results for aerosol distribution and variability over the area considered have been obtained. First, aerosols are mainly confined below 2km asl (above sea level) and are dominated by sea salt, especially in the center of the area of interest, with AOD ≤ 0 . 1. This zone is the most pristine and is associated with the position of the Mascarene anticyclone. There, the direct radiative effect is assessed around - 9 Wm-2 at the top of the atmosphere and probability density functions of the AOD s are leptokurtic lognormal functions without any significant seasonal variation. It is also suggested that the Madden-Jullian oscillation impacts sea salt emissions in the northern part of the area considered by modifying the state of the ocean surface. Finally, this area is surrounded in the northeast and the southwest by seasonal Australian and South African intrusions (AOD > 0.1) ; throughout the year, the ITCZ seems to limit continental contaminations from Asia. Due to the long period of time considered (almost a decade), this paper completes and strengthens results of studies based on observations performed during previous specific field campaigns.

Characterization and enzyme-conjugation of a specific anti-L1 nanobody.

Science.gov (United States)

Minaeian, Sara; Rahbarizadeh, Fatemeh; Zarkesh Esfahani, Sayyed Hamid; Ahmadvand, Davoud

2012-01-01

Persistent infection of the human papillomaviruses (HPV) has been shown to result in cervical cancer and intraepithelial neoplasia. Early detection and screening programs are essential strategies against cervical cancer. A nanobody is the smallest antigen-binding fragment known and is derived from a camelid heavy-chain antibody. This tiny protein shows high solubility and stability. It can be produced cost-effectively with high yield production. In this study, we enriched a nanobody library against the L1 protein of HPV. Several colons were selected from this enriched library using monoclonal phage-enzyme linked immunosorbent assay (phage-ELISA) and analyzed for identification of nanobody genes. The expression of nanobody fragments was performed in Rosetta gami2. The C74 nanobody that showed strong binding to the L1 protein of HPV16 was selected, purified, and characterized by Western blotting and ELISA. The selected nanobody was tested for sensitivity, specificity, and affinity. A nanobody conjugated to horseradish peroxidase (HRP) was selected and used for detection of L1 protein of HPV16. This study demonstrates that the C74-HRP, due to its specificity and good binding affinity for a specific viral antigen, is a potential diagnostic tool that can be used as a promising reagent for the new generation of HPV diagnosis approaches.

Synthesis of high specific activity tritium labelled 1S,2S-(-)-trans-2-isothiocyanato-N-methyl-N-(2-(1-pyrrolidinyl)-cyclohexyl)benzene acetamide, a specific irreversible ligand for kappa opioid receptors

Energy Technology Data Exchange (ETDEWEB)

Costa, B.R. de; Thurkauf, A.; Rothman, R.R. (National Inst. of Mental Health, Bethesda, MD (USA)); Jacobson, A.E.; Rice, K.C. (National Inst. of Digestive Diabetes, and Kidney Diseases, Bethesda, MD (USA))

1990-11-01

Optically pure tritium labeled 1S,2S-(-)-trans-2-isothiocyanato-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl )benzeneacetamide, an affinity ligand specific for the kappa opioid receptor was synthesized from optically pure 1S,2S-(-)-trans-2-amino-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl)benzeneacetamide via the sequence of dibromination (57%) followed by catalytic tritiation of the dibromide. The resulting tritium labelled aniline (14% yield, specific activity 31.2 Ci/mmol) was transformed to the title compound in 13.3% yield and 99+% radiochemical purity by treatment with thiophosgene. (author).

Central nervous system-specific knockout of steroidogenic factor 1 results in increased anxiety-like behavior.

Science.gov (United States)

Zhao, Liping; Kim, Ki Woo; Ikeda, Yayoi; Anderson, Kimberly K; Beck, Laurel; Chase, Stephanie; Tobet, Stuart A; Parker, Keith L

2008-06-01

Steroidogenic factor 1 (SF-1) plays key roles in adrenal and gonadal development, expression of pituitary gonadotropins, and development of the ventromedial hypothalamic nucleus (VMH). If kept alive by adrenal transplants, global knockout (KO) mice lacking SF-1 exhibit delayed-onset obesity and decreased locomotor activity. To define specific roles of SF-1 in the VMH, we used the Cre-loxP system to inactivate SF-1 in a central nervous system (CNS)-specific manner. These mice largely recapitulated the VMH structural defect seen in mice lacking SF-1 in all tissues. In multiple behavioral tests, mice with CNS-specific KO of SF-1 had significantly more anxiety-like behavior than wild-type littermates. The CNS-specific SF-1 KO mice had diminished expression or altered distribution in the mediobasal hypothalamus of several genes whose expression has been linked to stress and anxiety-like behavior, including brain-derived neurotrophic factor, the type 2 receptor for CRH (Crhr2), and Ucn 3. Moreover, transfection and EMSAs support a direct role of SF-1 in Crhr2 regulation. These findings reveal important roles of SF-1 in the hypothalamic expression of key regulators of anxiety-like behavior, providing a plausible molecular basis for the behavioral effect of CNS-specific KO of this nuclear receptor.

Radiological Effluent Technical Specifications (RETS) implementation: Zion Generating Station Units 1 and 2

International Nuclear Information System (INIS)

Serrano, W.; Akers, D.W.; Duce, S.W.; Mandler, J.W.; Simpson, F.B.; Young, T.E.

1985-06-01

A review of the Radiological Effluent Technical Specifications (RETS) of the Zion Generating Station Units 1 and 2 was performed. The principal review guidelines used were NUREG-0133, ''Preparation of Radiological Effluent Technical Specifications for Nuclear Power Plants,'' and Draft 7 of NUREG-0472, Revision 3, ''Radiological Effluent Technical Specifications for Pressurized Water Reactors.'' Draft submittals were discussed with the Licensee by both EG and G and the NRC staff until all items requiring changes to the Technical Specifications were resolved. The Licensee then submitted final proposed RETS to the NRC which were evaluated and found to be in compliance with the NRC review guidelines. The proposed Offsite Dose Calculation Manual was reviewed and generally found to be consistent with the NRC review guidelines. 35 refs., 2 figs., 1 tab

Trimester-specific reference intervals for haemoglobin A(1c) (HbA(1c)) in pregnancy.

LENUS (Irish Health Repository)

O'Connor, Catherine

2011-11-26

Abstract Background: Diabetes in pregnancy imposes additional risks to both mother and infant. These increased risks are considered to be primarily related to glycaemic control which is monitored by means of glycated haemoglobin (HbA(1c)). The correlation of HbA(1c) with clinical outcomes emphasises the need to measure HbA(1c) accurately, precisely and for correct interpretation, comparison to appropriately defined reference intervals. Since July 2010, the HbA(1c) assay in Irish laboratories is fully metrologically traceable to the IFCC standard. The objective was to establish trimester-specific reference intervals in pregnancy for IFCC standardised HbA(1c) in non-diabetic Caucasian women. Methods: The authors recruited 311 non-diabetic Caucasian pregnant (n=246) and non-pregnant women (n=65). A selective screening based on risk factors for gestational diabetes was employed. All subjects had a random plasma glucose <7.7 mmol\\/L and normal haemoglobin level. Pregnancy trimester was defined as trimester 1 (T1, n=40) up to 12 weeks +6 days, trimester 2 (T2, n=106) 13-27 weeks +6 days, trimester 3 (T3, n=100) >28 weeks to term. Results: The normal HbA(1c) reference interval for Caucasian non-pregnant women was 29-37 mmol\\/mol (Diabetes Control and Complications Trial; DCCT: 4.8%-5.5%), T1: 24-36 mmol\\/mol (DCCT: 4.3%-5.4%), T2: 25-35 mmol\\/mol (DCCT: 4.4%-5.4%) and T3: 28-39 mmol\\/mol (DCCT: 4.7%-5.7%). HbA(1c) was significantly decreased in trimesters 1 and 2 compared to non-pregnant women. Conclusions: HbA(1c) trimester-specific reference intervals are required to better inform the management of pregnancies complicated by diabetes.

Glucagon-like peptide-1 is specifically involved in sweet taste transmission.

Science.gov (United States)

Takai, Shingo; Yasumatsu, Keiko; Inoue, Mayuko; Iwata, Shusuke; Yoshida, Ryusuke; Shigemura, Noriatsu; Yanagawa, Yuchio; Drucker, Daniel J; Margolskee, Robert F; Ninomiya, Yuzo

2015-06-01

Five fundamental taste qualities (sweet, bitter, salty, sour, umami) are sensed by dedicated taste cells (TCs) that relay quality information to gustatory nerve fibers. In peripheral taste signaling pathways, ATP has been identified as a functional neurotransmitter, but it remains to be determined how specificity of different taste qualities is maintained across synapses. Recent studies demonstrated that some gut peptides are released from taste buds by prolonged application of particular taste stimuli, suggesting their potential involvement in taste information coding. In this study, we focused on the function of glucagon-like peptide-1 (GLP-1) in initial responses to taste stimulation. GLP-1 receptor (GLP-1R) null mice had reduced neural and behavioral responses specifically to sweet compounds compared to wild-type (WT) mice. Some sweet responsive TCs expressed GLP-1 and its receptors were expressed in gustatory neurons. GLP-1 was released immediately from taste bud cells in response to sweet compounds but not to other taste stimuli. Intravenous administration of GLP-1 elicited transient responses in a subset of sweet-sensitive gustatory nerve fibers but did not affect other types of fibers, and this response was suppressed by pre-administration of the GLP-1R antagonist Exendin-4(3-39). Thus GLP-1 may be involved in normal sweet taste signal transmission in mice. © FASEB.

A role for Insulin-like growth factor 2 in specification of the fast skeletal muscle fibre

Directory of Open Access Journals (Sweden)

Ting Tao

2007-06-01

Full Text Available Abstract Background Fibre type specification is a poorly understood process beginning in embryogenesis in which skeletal muscle myotubes switch myosin-type to establish fast, slow and mixed fibre muscle groups with distinct function. Growth factors are required to establish slow fibres; it is unknown how fast twitch fibres are specified. Igf-2 is an embryonically expressed growth factor with established in vitro roles in skeletal muscle. Its localisation and role in embryonic muscle differentiation had not been established. Results Between E11.5 and E15.5 fast Myosin (FMyHC localises to secondary myotubes evenly distributed throughout the embryonic musculature and gradually increasing in number so that by E15.5 around half contain FMyHC. The Igf-2 pattern closely correlates with FMyHC from E13.5 and peaks at E15.5 when over 90% of FMyHC+ myotubes also contain Igf-2. Igf-2 lags FMyHC and it is absent from muscle myotubes until E13.5. Igf-2 strongly down-regulates by E17.5. A striking feature of the FMyHC pattern is its increased heterogeneity and attenuation in many fibres from E15.5 to day one after birth (P1. Transgenic mice (MIG which express Igf-2 in all of their myotubes, have increased FMyHC staining, a higher proportion of FMyHC+ myotubes and loose their FMyHC staining heterogeneity. In Igf-2 deficient mice (MatDi FMyHC+ myotubes are reduced to 60% of WT by E15.5. In vitro, MIG induces a 50% excess of FMyHC+ and a 30% reduction of SMHyC+ myotubes in C2 cells which can be reversed by Igf-2-targeted ShRNA resulting in 50% reduction of FMyHC. Total number of myotubes was not affected. Conclusion In WT embryos the appearance of Igf-2 in embryonic myotubes lags FMyHC, but by E15.5 around 45% of secondary myotubes contain both proteins. Forced expression of Igf-2 into all myotubes causes an excess, and absence of Igf-2 suppresses, the FMyHC+ myotube component in both embryonic muscle and differentiated myoblasts. Igf-2 is thus required, not for

Fascin-1 knock-down of human glioma cells reduces their microvilli/filopodia while improving their susceptibility to lymphocyte-mediated cytotoxicity

Science.gov (United States)

Hoa, Neil T; Ge, Lisheng; Erickson, Kate L; Kruse, Carol A; Cornforth, Andrew N; Kuznetsov, Yurii; McPherson, Alex; Martini, Filippo; Jadus, Martin R

2015-01-01

Cancer cells derived from Glioblastoma multiforme possess membranous protrusions allowing these cells to infiltrate surrounding tissue, while resisting lymphocyte cytotoxicity. Microvilli and filopodia are supported by actin filaments cross-linked by fascin. Fascin-1 was genetically silenced within human U251 glioma cells; these knock-down glioma cells lost their microvilli/filopodia. The doubling time of these fascin-1 knock-down cells was doubled that of shRNA control U251 cells. Fascin-1 knock-down cells lost their transmigratory ability responding to interleukin-6 or insulin-like growth factor-1. Fascin-1 silenced U251 cells were more easily killed by cytolytic lymphocytes. Fascin-1 knock-down provides unique opportunities to augment glioma immunotherapy by simultaneously targeting several key glioma functions: like cell transmigration, cell division and resisting immune responses. PMID:25901196

The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

International Nuclear Information System (INIS)

Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

2015-01-01

The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype

The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

Energy Technology Data Exchange (ETDEWEB)

Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

2015-05-01

The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.

Liver-Specific Deletion of Protein-Tyrosine Phosphatase 1B (PTP1B) Improves Metabolic Syndrome and Attenuates Diet-Induced Endoplasmic Reticulum Stress

Science.gov (United States)

Delibegovic, Mirela; Zimmer, Derek; Kauffman, Caitlin; Rak, Kimberly; Hong, Eun-Gyoung; Cho, You-Ree; Kim, Jason K.; Kahn, Barbara B.; Neel, Benjamin G.; Bence, Kendra K.

2009-01-01

OBJECTIVE—The protein tyrosine phosphatase PTP1B is a negative regulator of insulin signaling; consequently, mice deficient in PTP1B are hypersensitive to insulin. Because PTP1B−/− mice have diminished fat stores, the extent to which PTP1B directly regulates glucose homeostasis is unclear. Previously, we showed that brain-specific PTP1B−/− mice are protected against high-fat diet–induced obesity and glucose intolerance, whereas muscle-specific PTP1B−/− mice have increased insulin sensitivity independent of changes in adiposity. Here we studied the role of liver PTP1B in glucose homeostasis and lipid metabolism. RESEARCH DESIGN AND METHODS—We analyzed body mass/adiposity, insulin sensitivity, glucose tolerance, and lipid metabolism in liver-specific PTP1B−/− and PTP1Bfl/fl control mice, fed a chow or high-fat diet. RESULTS—Compared with normal littermates, liver-specific PTP1B−/− mice exhibit improved glucose homeostasis and lipid profiles, independent of changes in adiposity. Liver-specific PTP1B−/− mice have increased hepatic insulin signaling, decreased expression of gluconeogenic genes PEPCK and G-6-Pase, enhanced insulin-induced suppression of hepatic glucose production, and improved glucose tolerance. Liver-specific PTP1B−/− mice exhibit decreased triglyceride and cholesterol levels and diminished expression of lipogenic genes SREBPs, FAS, and ACC. Liver-specific PTP1B deletion also protects against high-fat diet–induced endoplasmic reticulum stress response in vivo, as evidenced by decreased phosphorylation of p38MAPK, JNK, PERK, and eIF2α and lower expression of the transcription factors C/EBP homologous protein and spliced X box-binding protein 1. CONCLUSIONS—Liver PTP1B plays an important role in glucose and lipid metabolism, independent of alterations in adiposity. Inhibition of PTP1B in peripheral tissues may be useful for the treatment of metabolic syndrome and reduction of cardiovascular risk in addition to

Overexpression of cell cycle regulator CDCA3 promotes oral cancer progression by enhancing cell proliferation with prevention of G1 phase arrest

International Nuclear Information System (INIS)

Uchida, Fumihiko; Uzawa, Katsuhiro; Kasamatsu, Atsushi; Takatori, Hiroaki; Sakamoto, Yosuke; Ogawara, Katsunori; Shiiba, Masashi; Tanzawa, Hideki; Bukawa, Hiroki

2012-01-01

Cell division cycle associated 3 (CDCA3), part of the Skp1-cullin-F-box (SCF) ubiquitin ligase, refers to a trigger of mitotic entry and mediates destruction of the mitosis inhibitory kinase. Little is known about the relevance of CDCA3 to human malignancy including oral squamous cell carcinoma (OSCC). We aimed to characterize the expression state and function of CDCA3 in OSCC. We evaluated CDCA3 mRNA and protein expression in both OSCC-derived cell lines and primary OSCCs and performed functional analyses of CDCA3 in OSCC-derived cells using the shRNA system. The CDCA3 expression at both the mRNA and protein levels was frequently up-regulated in all cell lines examined and primary tumors (mRNA, 51/69, 74 %; protein, 79/95, 83 %) compared to normal controls (p < 0.001). In contrast, no significant level of CDCA3 protein expression was seen in oral premalignant lesions (OPLs) (n = 20) compared with the expression in OSCCs. Among the clinical variables analyzed, the CDCA3 expression status was closely related to tumor size (p < 0.05). In addition, suppression of CDCA3 expression with shRNA significantly (p < 0.05) inhibited cellular proliferation compared with the control cells by arresting cell-cycle progression at the G1 phase. Further, there was up-regulation of the cyclin-dependent kinase inhibitors (p21 Cip1 , p27 Kip1 , p15 INK4B , and p16 INK4A ) in the knockdown cells. The current results showed that overexpression of CDCA3 occurs frequently during oral carcinogenesis and this overexpression might be associated closely with progression of OSCCs by preventing the arrest of cell-cycle progression at the G1 phase via decreased expression of the cyclin-dependent kinase inhibitors

[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

Science.gov (United States)

Yu, Yanping; Zhang, Song; Kong, Weijia

2010-09-01

To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

Identification of the Specific Interactors of the Human Lariat RNA Debranching Enzyme 1 Protein

Directory of Open Access Journals (Sweden)

So Masaki

2015-02-01

Full Text Available In eukaryotes, pre-mRNA splicing is an essential step for gene expression. We have been analyzing post-splicing intron turnover steps in higher eukaryotes. Here, we report protein interaction between human Debranching enzyme 1 (hDbr1 and several factors found in the Intron Large (IL complex, which is an intermediate complex of the intron degradation pathway. The hDbr1 protein specifically interacts with xeroderma pigmentosum, complementeation group A (XPA-binding protein 2 (Xab2. We also attempted to identify specific interactors of hDbr1. Co-immunoprecipitation experiments followed by mass spectrometry analysis identified a novel protein as one of the specific interactors of hDbr1. This protein is well conserved among many species and shows the highest similarity to yeast Drn1, so it is designated as human Dbr1 associated ribonuclease 1 (hDrn1. hDrn1 directly interacts with hDbr1 through protein–protein interaction. Furthermore, hDrn1 shuttles between the nucleus and the cytoplasm, as hDbr1 protein does. These findings suggest that hDrn1 has roles in both the nucleus and the cytoplasm, which are highly likely to involve hDbr1.

Transcription factor Runx2 knockdown regulates colon cancer transplantation tumor growth in vitro: an experimental study

Directory of Open Access Journals (Sweden)

Bin Xu1

2017-05-01

Full Text Available Objective: To study the effect of transcription factor Runx2 knockdown on colon cancer transplantation tumor growth in vitro. Methods: Colon cancer cell lines HT29 were cultured and transfected with negative control (NC - shRNA plasmids and Runx2-shRNA plasmids respectively, the colon cancer cells transfected with shRNA were subcutaneously injected into C57 nude mice, and they were included in NC group and Runx2 knockdown group respectively. 1 week, 2 weeks and 3 weeks after model establishment, serum was collected to determine the contents of tumor markers, and tumor lesions were collected to determine proliferation and apoptosis gene expression. Results: CCSA-2, CEA and CA19-9 levels in serum as well as Rac1, Wnt3a, PLD2 and FAM96B protein expression in transplantation tumor lesions of Runx2 knockdown group were significantly lower than those of NC group while MS4A12, ASPP2 and Fas protein expression in transplantation tumor lesions of Runx2 knockdown group were significantly higher than those of NC group. Conclusion: Transcription factor Runx2 knockdown could inhibit the colon cancer transplantation tumor growth in vitro.

Nodal-dependent mesendoderm specification requires the combinatorial activities of FoxH1 and Eomesodermin.

Directory of Open Access Journals (Sweden)

Christopher E Slagle

2011-05-01

Full Text Available Vertebrate mesendoderm specification requires the Nodal signaling pathway and its transcriptional effector FoxH1. However, loss of FoxH1 in several species does not reliably cause the full range of loss-of-Nodal phenotypes, indicating that Nodal signals through additional transcription factors during early development. We investigated the FoxH1-dependent and -independent roles of Nodal signaling during mesendoderm patterning using a novel recessive zebrafish FoxH1 mutation called midway, which produces a C-terminally truncated FoxH1 protein lacking the Smad-interaction domain but retaining DNA-binding capability. Using a combination of gel shift assays, Nodal overexpression experiments, and genetic epistasis analyses, we demonstrate that midway more accurately represents a complete loss of FoxH1-dependent Nodal signaling than the existing zebrafish FoxH1 mutant schmalspur. Maternal-zygotic midway mutants lack notochords, in agreement with FoxH1 loss in other organisms, but retain near wild-type expression of markers of endoderm and various nonaxial mesoderm fates, including paraxial and intermediate mesoderm and blood precursors. We found that the activity of the T-box transcription factor Eomesodermin accounts for specification of these tissues in midway embryos. Inhibition of Eomesodermin in midway mutants severely reduces the specification of these tissues and effectively phenocopies the defects seen upon complete loss of Nodal signaling. Our results indicate that the specific combinations of transcription factors available for signal transduction play critical and separable roles in determining Nodal pathway output during mesendoderm patterning. Our findings also offer novel insights into the co-evolution of the Nodal signaling pathway, the notochord specification program, and the chordate branch of the deuterostome family of animals.

Study of Structure-active Relationship for Inhibitors of HIV-1 Integrase LEDGF/p75 Interaction by Machine Learning Methods.

Science.gov (United States)

Li, Yang; Wu, Yanbin; Yan, Aixia

2017-07-01

HIV-1 integrase (IN) is a promising target for anti-AIDS therapy, and LEDGF/p75 is proved to enhance the HIV-1 integrase strand transfer activity in vitro. Blocking the interaction between IN and LEDGF/p75 is an effective way to inhibit HIV replication infection. In this work, 274 LEDGF/p75-IN inhibitors were collected as the dataset. Support Vector Machine (SVM), Decision Tree (DT), Function Tree (FT) and Random Forest (RF) were applied to build several computational models for predicting whether a compound is an active or weakly active LEDGF/p75-IN inhibitor. Each compound is represented by MACCS fingerprints and CORINA Symphony descriptors. The prediction accuracies for the test sets of all the models are over 70 %. The best model Model 3B built by FT obtained a prediction accuracy and a Matthews Correlation Coefficient (MCC) of 81.08 % and 0.62 on test set, respectively. We found that the hydrogen bond and hydrophobic interactions are important for the bioactivity of an inhibitor. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Technical specifications manual for the MARK-1 pulsed ionizing radiation detection system

International Nuclear Information System (INIS)

Lawrence, R.S.; Harker, Y.D.; Jones, J.L.; Hoggan, J.M.

1993-03-01

The MARK-1 detection system was developed by the Idaho National Engineering Laboratory for the US Department of Energy Office of Arms Control and Nonproliferation. The completely portable system was designed for the detection and analysis of intense photon emissions from pulsed ionizing radiation sources. This manual presents the technical design specifications for the MARK-1 detection system and was written primarily to assist the support or service technician in the service, calibration, and repair of the system. The manual presents the general detection system theory, the MARK-1 component design specifications, the acquisition and control software, the data processing sequence, and the system calibration procedure. A second manual entitled: Volume 2: Operations Manual for the MARK-1 Pulsed Ionizing Radiation Detection System (USDOE Report WINCO-1108, September 1992) provides a general operational description of the MARK-1 detection system. The Operations Manual was written primarily to assist the field operator in system operations and analysis of the data

Generation of induced pluripotent stem cells from peripheral blood CD34+ hematopoietic progenitors of a 31 year old healthy woman

Directory of Open Access Journals (Sweden)

Amornrat Tangprasittipap

2017-04-01

Full Text Available The MUi019-A human induced pluripotent stem cell line was generated from peripheral blood CD34+ hematopoietic progenitors of a healthy woman using a non-integrative reprogramming method. Episomal vectors carrying reprogramming factors OCT4, SOX2, KLF4, L-MYC, LIN28, and shRNA of TP53 and EBNA-1 were delivered using electroporation. The iPSC line can be used as a control in studying disease mechanisms. Furthermore, gene editing approaches can be used to introduce specific mutations into the MUi019-A to model disease while the cell type affected by the disease is inaccessible.

Identification of NY-BR-1-specific CD4(+) T cell epitopes using HLA-transgenic mice.

Science.gov (United States)

Gardyan, Adriane; Osen, Wolfram; Zörnig, Inka; Podola, Lilli; Agarwal, Maria; Aulmann, Sebastian; Ruggiero, Eliana; Schmidt, Manfred; Halama, Niels; Leuchs, Barbara; von Kalle, Christof; Beckhove, Philipp; Schneeweiss, Andreas; Jäger, Dirk; Eichmüller, Stefan B

2015-06-01

Breast cancer represents the second most common cancer type worldwide and has remained the leading cause of cancer-related deaths among women. The differentiation antigen NY-BR-1 appears overexpressed in invasive mammary carcinomas compared to healthy breast tissue, thus representing a promising target antigen for T cell based tumor immunotherapy approaches. Since efficient immune attack of tumors depends on the activity of tumor antigen-specific CD4(+) effector T cells, NY-BR-1 was screened for the presence of HLA-restricted CD4(+) T cell epitopes that could be included in immunological treatment approaches. Upon NY-BR-1-specific DNA immunization of HLA-transgenic mice and functional ex vivo analysis, a panel of NY-BR-1-derived library peptides was determined that specifically stimulated IFNγ secretion among splenocytes of immunized mice. Following in silico analyses, four candidate epitopes were determined which were successfully used for peptide immunization to establish NY-BR-1-specific, HLA-DRB1*0301- or HLA-DRB1*0401-restricted CD4(+) T cell lines from splenocytes of peptide immunized HLA-transgenic mice. Notably, all four CD4(+) T cell lines recognized human HLA-DR-matched dendritic cells (DC) pulsed with lysates of NY-BR-1 expressing human tumor cells, demonstrating natural processing of these epitopes also within the human system. Finally, CD4(+) T cells specific for all four CD4(+) T cell epitopes were detectable among PBMC of breast cancer patients, showing that CD4(+) T cell responses against the new epitopes are not deleted nor inactivated by self-tolerance mechanisms. Our results present the first NY-BR-1-specific HLA-DRB1*0301- and HLA-DRB1*0401-restricted T cell epitopes that could be exploited for therapeutic intervention against breast cancer. © 2014 UICC.

Technical specifications: Seabrook Station, Unit 1 (Docket No. 50-443)

International Nuclear Information System (INIS)

1990-03-01

The Seabrook Station, Unit 1 Technical Specifications were prepared by the US Nuclear Regulatory Commission to set forth the limits, operating conditions, and other requirements applicable to a nuclear reactor facility as set forth in Section 50.36 of 10 CFR Part 50 for the protection of the health and safety of the public

Potential for novel MUC1 glycopeptide-specific antibody in passive cancer immunotherapy

DEFF Research Database (Denmark)

Madsen, Caroline B; Wandall, Hans H; Pedersen, Anders Elm

2013-01-01

MUC1 is an important target for antibodies in passive cancer immunotherapy. Antibodies against mucin glycans or mucin peptide backbone alone may give rise to cross reactivity with normal tissues. Therefore, attempts to identify antibodies against cancer-specific MUC1 glycopeptide epitopes havebeen...

Blockade of the SNARE protein syntaxin 1 inhibits glioblastoma tumor growth.

Directory of Open Access Journals (Sweden)

Fausto Ulloa

Full Text Available Glioblastoma (GBM is the most prevalent adult brain tumor, with virtually no cure, and with a median overall survival of 15 months from diagnosis despite of the treatment. SNARE proteins mediate membrane fusion events in cells and are essential for many cellular processes including exocytosis and neurotransmission, intracellular trafficking and cell migration. Here we show that the blockade of the SNARE protein Syntaxin 1 (Stx1 function impairs GBM cell proliferation. We show that Stx1 loss-of-function in GBM cells, through ShRNA lentiviral transduction, a Stx1 dominant negative and botulinum toxins, dramatically reduces the growth of GBM after grafting U373 cells into the brain of immune compromised mice. Interestingly, Stx1 role on GBM progression may not be restricted just to cell proliferation since the blockade of Stx1 also reduces in vitro GBM cell invasiveness suggesting a role in several processes relevant for tumor progression. Altogether, our findings indicate that the blockade of SNARE proteins may represent a novel therapeutic tool against GBM.

Synthesis of glycolic acid-1-14C of high specific activity

International Nuclear Information System (INIS)

Ramamurthy, T.V.; Viswanathan, K.V.

1987-01-01

A simple procedure is described which efficiently converts traces of 14 C labelled cyanide present as a dilute solution into glycolic acid-1- 14 C with more than 85% radiochemical recovery and of high specific activity. (author)

Interaction between NBS1 and the mTOR/Rictor/SIN1 complex through specific domains.

Directory of Open Access Journals (Sweden)

Jian-Qiu Wang

Full Text Available Nijmegen breakage syndrome (NBS is a chromosomal-instability syndrome. The NBS gene product, NBS1 (p95 or nibrin, is a part of the Mre11-Rad50-NBS1 complex. SIN1 is a component of the mTOR/Rictor/SIN1 complex mediating the activation of Akt. Here we show that NBS1 interacted with mTOR, Rictor, and SIN1. The specific domains of mTOR, Rictor, or SIN1 interacted with the internal domain (a.a. 221-402 of NBS1. Sucrose density gradient showed that NBS1 was located in the same fractions as the mTOR/Rictor/SIN1 complex. Knockdown of NBS1 decreased the levels of phosphorylated Akt and its downstream targets. Ionizing radiation (IR increased the NBS1 levels and activated Akt activity. These results demonstrate that NBS1 interacts with the mTOR/Rictor/SIN1 complex through the a.a. 221-402 domain and contributes to the activation of Akt activity.

Akt1 is essential for postnatal mammary gland development, function, and the expression of Btn1a1.

Directory of Open Access Journals (Sweden)

Jessica LaRocca

Full Text Available Akt1, a serine-threonine protein kinase member of the PKB/Akt gene family, plays critical roles in the regulation of multiple cellular processes, and has previously been implicated in lactation and breast cancer development. In this study, we utilized Akt1+/+ and Akt1-/- C57/Bl6 female mice to assess the role that Akt1 plays in normal mammary gland postnatal development and function. We examined postnatal morphology at multiple time points, and analyzed gene and protein expression changes that persist into adulthood. Akt1 deficiency resulted in several mammary gland developmental defects, including ductal outgrowth and defective terminal end bud formation. Adult Akt1-/- mammary gland composition remained altered, exhibiting fewer alveolar buds coupled with increased epithelial cell apoptosis. Microarray analysis revealed that Akt1 deficiency altered expression of genes involved in numerous biological processes in the mammary gland, including organismal development, cell death, and tissue morphology. Of particular importance, a significant decrease in expression of Btn1a1, a gene involved in milk lipid secretion, was observed in Akt1-/- mammary glands. Additionally, pseudopregnant Akt1-/- females failed to induce Btn1a1 expression in response to hormonal stimulation compared to their wild-type counterparts. Retroviral-mediated shRNA knockdown of Akt1 and Btn1a1 in MCF-7 human breast epithelial further illustrated the importance of Akt1 in mammary epithelial cell proliferation, as well as in the regulation of Btn1a1 and subsequent expression of ß-casein, a gene that encodes for milk protein. Overall these findings provide mechanistic insight into the role of Akt1 in mammary morphogenesis and function.