New bisaminoethanethiol (BAT) ligands which form two interconvertible Tc-99m complexes

International Nuclear Information System (INIS)

Oya, Shunichi; Kung, Mei-Ping; Frederick, Dana; Kung, Hank F.

1995-01-01

Most commonly used radiopharmaceuticals in diagnostic nuclear medicine are labeled with Tc-99m. This is due to its superior physical characteristics (T (1(2)) = 6 h and gamma energy 140 KeV) and convenient availability from the 99 Mo/ 99mm Tc generator. In an attempt to fine tune the properties of Tc-99m complexes, the synthesis and radiolabeling of two novel N 2 S 2 ligands, N,-2-mercaptobenzyl-N'-(1-oxo-2-mercapto-2-methyl)propyl ethylenediamine,8, and N,-2-methylthiobenzyl-N'-(1-oxo-2-mercapto-2-methyl)propyl ethylenediamine, 11, with an ionizable SH or unionizable SMe group, respectively, for the formation of complexes with Tc v O center cores, have been examined. Both ligands initially formed one apparently stable, lipophilic and neutral complex (HPLC, Rt = 7 min, reverse-phase column, acetonitrile: buffer, pH 7.0; (55(45)); V/V; partition coefficient between 1-octanol and buffer of 410 and 335, respectively) with [ 99m Tc]pertechnetate in the presence of stannous chloride. After treatment with a reducing agent, NaCNBH 3 , the initial [ 99m Tc]8 and 11 complexes were reduced; the reduced complexes were less lipophilic (shorter retention time, Rt = 5 min, on the same reversed phase HPLC). However, only the oxidized form showed sufficient stability. The reduced forms of both [ 99m Tc]8 and 11 were readily and completely converted back to the oxidized forms by a stream of air. Biodistribution studies in rats demonstrated that the [ 99m Tc]8 (oxidized form) penetrated the blood-brain barrier (0.67% dose/organ at 2 min postinjection), but washed out from the brain quickly (0.29% dose/organ at 30 min postinjection). On the contrary, [ 99m Tc]11 (oxidized form) did not show any brain uptake (0.03% dose/organ at 2 min postinjection), despite its higher lipophilicity. The disparity between these two Tc-99m complexes may be related to the relative instability of [ 99m Tc]11 (oxidized form) by the introduction of the unionizable methylated thiol group as one of the donor

Remaining Sites Verification Package for the 1607-F7, 141-M Building Septic Tank. Attachment to Waste Site Reclassification Form 2006-040

International Nuclear Information System (INIS)

Dittmer, L.M.

2006-01-01

The 1607-F7, 141-M Building Septic Tank waste site was a septic tank and drain field that received sanitary sewage from the former 141-M Building. Remedial action was performed in August and November 2005. The results of verification sampling demonstrate that residual contaminant concentrations support future unrestricted land uses that can be represented by a rural-residential scenario. These results also show that residual concentrations support unrestricted future use of shallow zone soil and that contaminant levels remaining in the soil are protective of groundwater and the Columbia River

Ti atoms in Ru0.3Ti0.7O2 mixed oxides form active and selective sites for electrochemical chlorine evolution

DEFF Research Database (Denmark)

Karlsson, Rasmus K. B.; Hansen, Heine Anton; Bligaard, Thomas

2014-01-01

affected by the presence of small amounts of Ru dopant, whereas oxygen adsorption is relatively unaffected by Ti dopants in RuO2. The calculations also indicate that coordinatively unsaturated Ti sites on Ru-doped TiO2 and on Ru0.3Ti0.7O2 could form active and selective sites for Cl2 evolution....... These results suggest a reason for why DSA shows a higher chlorine selectivity than RuO2 and propose an experimental test of the hypothesis....

New bisaminoethanethiol (BAT) ligands which form two interconvertible Tc-99m complexes

Energy Technology Data Exchange (ETDEWEB)

Oya, Shunichi; Kung, Mei-Ping; Frederick, Dana; Kung, Hank F

1995-08-01

Most commonly used radiopharmaceuticals in diagnostic nuclear medicine are labeled with Tc-99m. This is due to its superior physical characteristics (T{sub (1(2))} = 6 h and gamma energy 140 KeV) and convenient availability from the {sup 99}Mo/{sup 99mm}Tc generator. In an attempt to fine tune the properties of Tc-99m complexes, the synthesis and radiolabeling of two novel N{sub 2}S{sub 2} ligands, N,-2-mercaptobenzyl-N'-(1-oxo-2-mercapto-2-methyl)propyl ethylenediamine,8, and N,-2-methylthiobenzyl-N'-(1-oxo-2-mercapto-2-methyl)propyl ethylenediamine, 11, with an ionizable SH or unionizable SMe group, respectively, for the formation of complexes with Tc{sup v}O center cores, have been examined. Both ligands initially formed one apparently stable, lipophilic and neutral complex (HPLC, Rt = 7 min, reverse-phase column, acetonitrile: buffer, pH 7.0; (55(45)); V/V; partition coefficient between 1-octanol and buffer of 410 and 335, respectively) with [{sup 99m}Tc]pertechnetate in the presence of stannous chloride. After treatment with a reducing agent, NaCNBH{sub 3}, the initial [{sup 99m}Tc]8 and 11 complexes were reduced; the reduced complexes were less lipophilic (shorter retention time, Rt = 5 min, on the same reversed phase HPLC). However, only the oxidized form showed sufficient stability. The reduced forms of both [{sup 99m}Tc]8 and 11 were readily and completely converted back to the oxidized forms by a stream of air. Biodistribution studies in rats demonstrated that the [{sup 99m}Tc]8 (oxidized form) penetrated the blood-brain barrier (0.67% dose/organ at 2 min postinjection), but washed out from the brain quickly (0.29% dose/organ at 30 min postinjection). On the contrary, [{sup 99m}Tc]11 (oxidized form) did not show any brain uptake (0.03% dose/organ at 2 min postinjection), despite its higher lipophilicity. The disparity between these two Tc-99m complexes may be related to the relative instability of [{sup 99m}Tc]11 (oxidized form) by the introduction of the

Establishing a predictive maintenance (PdM) program at the Hanford Site

International Nuclear Information System (INIS)

Murray, W.A.; Winslow, R.G.

1994-02-01

The production reactors have been shut down for some time. But for the rest of the site, there is currently about 16,000 people engaged in a multi-billion dollar effort to safely process wastes which have been stored at the site since the 1940's. This effort also includes demolition of some older facilities and environmental restoration of much of the site. This is expected to take approximately 30 to 40 years. The concept of a site-wide predictive maintenance (PdM) program began to form in early 1993. Several informal studies showed that the stand alone predictive maintenance groups which had prevailed on site to date were less than 15% effective at trending equipment conditions and predicting failures. To improve the effectiveness of PdM within the company, an engineering analysis by Rick Winslow confirmed that utilization of software networking technology which was now available would significantly overcome many of these built in handicaps. A site-wide predictive maintenance network would make PdM technology accessible to all of the areas and facilities at the site regardless of geographical distances and company division lines. Site resident vibration experts can easily be located and provide consultations on the network. However, it was recognized that strong leadership and management skills would be required within each of the two organizations for effective implementation. To start this process, a letter of understanding and agreement between the facilities and Tank Farm divisions was drafted and endorsed by company management. The agreement assigned the primary responsibility of acquiring the network software and licensee to the Tank Farms division. The acquisition and installation of the network server would be the responsibility of the facilities division. This paper describes the rest of the network development and implementation process

Two hexagonal series of lanthanoid(III) oxide fluoride selenides.: M{sub 6}O{sub 2}F{sub 8}Se{sub 3} (M = La - Nd) and M{sub 2}OF{sub 2}Se (M = Nd, Sm, Gd - Ho)

Energy Technology Data Exchange (ETDEWEB)

Zimmermann, Dirk D.; Grossholz, Hagen; Wolf, Sarah; Schleid, Thomas [Institut fuer Anorganische Chemie, Universitaet Stuttgart (Germany); Janka, Oliver [Institut fuer Anorganische Chemie, Universitaet Stuttgart (Germany); Institut fuer Anorganische und Analytische Chemie, Westfaelische Wilhelms-Universitaet Muenster (Germany); Mueller, Alexander C. [Institut fuer Anorganische Chemie, Universitaet Stuttgart (Germany); Institut fuer Textilchemie und Chemiefasern, Denkendorf (Germany)

2015-09-15

Two hexagonal series of lanthanoid(III) oxide fluoride selenides with similar structure types can be obtained by the reaction of the components MF{sub 3}, M{sub 2}O{sub 3}, M, and Se in sealed niobium tubes at 850 C using CsI as fluxing agent. The compounds with the lighter and larger representatives (M = La - Nd) occur with the formula M{sub 6}O{sub 2}F{sub 8}Se{sub 3}, whereas with the heavier and smaller ones (M = Nd, Sm, Gd - Ho) their composition is M{sub 2}OF{sub 2}Se. For both systems single-crystal determinations were used in all cases. The compounds crystallize in the hexagonal crystal system (space group: P6{sub 3}/m) with lattice parameters of a = 1394-1331 pm and c = 403-372 pm (Z = 2 for M{sub 6}O{sub 2}F{sub 8}Se{sub 3} and Z = 6 for M{sub 2}OF{sub 2}Se). The (M1){sup 3+} cations show different square antiprismatic coordination spheres with or without an extra capping fluoride anion. All (M2){sup 3+} cations exhibit a ninefold coordination environment shaped as tricapped trigonal prism. In both structure types the Se{sup 2-} anions are sixfold coordinated as trigonal prisms of M{sup 3+} cations, being first condensed by edges to generate trimeric units and then via faces to form strands running along [001]. The light anions reside either in threefold triangular or in fourfold tetrahedral cationic coordination. For charge compensation, both structures have to contain a certain amount of oxide besides fluoride anions. Since F{sup -} and O{sup 2-} can not be distinguished by X-ray diffraction, bond-valence calculations were used to address the problem of their adjunction to the available crystallographic sites. (Copyright copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Remaining Sites Verification Package for the 100-F-26:12, 1.8-m (72-in.) Main Process Sewer Pipeline. Attachment to Waste Site Reclassification Form 2007-034

International Nuclear Information System (INIS)

Capron, J.M.

2008-01-01

The 100-F-26:12 waste site was an approximately 308-m-long, 1.8-m-diameter east-west-trending reinforced concrete pipe that joined the North Process Sewer Pipelines (100-F-26:1) and the South Process Pipelines (100-F-26:4) with the 1.8-m reactor cooling water effluent pipeline (100-F-19). In accordance with this evaluation, the verification sampling results support a reclassification of this site to Interim Closed Out. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

Machining tools in AISI M2 high-speed steel obtained by spray forming process

International Nuclear Information System (INIS)

Jesus, Edilson Rosa Barbosa de.

2004-01-01

The aim of the present work was the obtention of AISI M2 high-speed steel by spray forming technique and the material evaluation when used as machining tool. The obtained material was hot rolled at 50% and 72% reduction ratios, and from which it was manufactured inserts for machining tests. The performance of inserts made of the spray formed material was compared to inserts obtained from conventional and powder metallurgy (MP) processed materials. The spray formed material was chemical, physical, mechanical and microstructural characterised. For further characterisation, the materials were submitted to machining tests for performance evaluation under real work condition. The results of material characterisation highlight the potential of the spray forming technique, in the obtention of materials with good characteristics and properties. Under the current processing, hot rolling and heat treatments condition, the analysis of the results of the machining tests revealed a very similar behaviour among the tested materials. Proceeding a criterious analysis of the machining results tests, it was verified that the performance presented by the powder metallurgy material (MP) was slight superior, followed by conventional obtained material (MConv), which presented a insignificant advantage over the spray formed and hot rolled (72% reduction ratio) material. The worst result was encountered for the spray forming and hot rolled (50% reduction ratio) material that presented the highest wear values. (author)

Assembly of [Cu2(COO)4] and [M3(μ3-O)(COO)6] (M = Sc, Fe, Ga, and In) building blocks into porous frameworks towards ultra-high C2H2/CO2 and C2H2/CH4 separation performance.

Science.gov (United States)

Zhang, Jian-Wei; Hu, Man-Cheng; Li, Shu-Ni; Jiang, Yu-Cheng; Qu, Peng; Zhai, Quan-Guo

2018-02-20

A porous MOF platform (SNNU-65s) formed by creatively combining paddle-wheel-like [Cu 2 (COO) 4 ] and trigonal prismatic [M 3 (μ 3 -O)(COO) 6 ] building blocks was designed herein. The mixed and high-density open metal sites and the OH-functionalized pore surface promote SNNU-65s to exhibit ultra-high C 2 H 2 uptake and separation performance. Impressively, SNNU-65-Cu-Ga stands out for the highest C 2 H 2 /CO 2 (18.7) and C 2 H 2 /CH 4 (120.6) selectivity among all the reported MOFs at room temperature.

Site occupancy and magnetic properties of Al-substituted M-type strontium hexaferrite

Energy Technology Data Exchange (ETDEWEB)

Dixit, Vivek; Nandadasa, Chandani N.; Kim, Seong-Gon, E-mail: kimsg@ccs.msstate.edu [Department of Physics and Astronomy, Mississippi State University, Mississippi State, Mississippi 39762 (United States); Center for Computational Sciences, Mississippi State University, Mississippi State, Mississippi 39762 (United States); Kim, Sungho [Center for Computational Sciences, Mississippi State University, Mississippi State, Mississippi 39762 (United States); Park, Jihoon; Hong, Yang-Ki [Department of Electrical and Computer Engineering and MINT Center, The University of Alabama, Tuscaloosa, Alabama 35487 (United States); Liyanage, Laalitha S. I. [Department of Physics, University of North Texas, Denton, Texas 76203 (United States); Moitra, Amitava [Thematic Unit of Excellence on Computational Materials Science, S.N. Bose National Centre for Basic Sciences, Sector-III, Block-JD, Salt Lake, Kolkata-700098 (India)

2015-06-28

We use first-principles total-energy calculations based on density functional theory to study the site occupancy and magnetic properties of Al-substituted M-type strontium hexaferrite SrFe{sub 12−x}Al{sub x}O{sub 19} with x = 0.5 and x = 1.0. We find that the non-magnetic Al{sup 3+} ions preferentially replace Fe{sup 3+} ions at two of the majority spin sites, 2a and 12k, eliminating their positive contribution to the total magnetization causing the saturation magnetization M{sub s} to be reduced as Al concentration x is increased. Our formation probability analysis further provides the explanation for increased magnetic anisotropy field when the fraction of Al is increased. Although Al{sup 3+} ions preferentially occupy the 2a sites at a low temperature, the occupation probability of the 12k site increases with the rise of the temperature. At a typical annealing temperature (>700 °C) Al{sup 3+} ions are much more likely to occupy the 12k site than the 2a site. Although this causes the magnetocrystalline anisotropy K{sub 1} to be reduced slightly, the reduction in M{sub s} is much more significant. Their combined effect causes the anisotropy field H{sub a} to increase as the fraction of Al is increased, consistent with recent experimental measurements.

Surveillance of Site A and Plot M

International Nuclear Information System (INIS)

Golchert, N.W.

1991-05-01

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for CY 1990 are presented. The surveillance program is the ongoing remedial action that resulted from the 1976-1978 radiological characterization of the site. That study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand-pumped picnic wells. The current program consists of sample collection and analysis of air, surface and subsurface water, and bottom sediment. The results of the analyses are used to determine the migration pathway of water from the burial ground (plot M) to the hand-pumped picnic wells, establish if buries radionuclides other than hydrogen-3 have migrated, and generally characterize the radiological environment of the area. Tritiated water continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The results of the surveillance program continues to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site or those living in the vicinity. 20 refs., 7 figs., 15 tabs

Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

Science.gov (United States)

Andreeva, Irena

2018-01-01

During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

Crystal structure and thermal expansion of the low- and high-temperature forms of BaMIV(PO4)2 compounds (M=Ti, Zr, Hf and Sn)

International Nuclear Information System (INIS)

Bregiroux, D.; Popa, K.; Jardin, R.; Raison, P.E.; Wallez, G.; Quarton, M.; Brunelli, M.; Ferrero, C.; Caciuffo, R.

2009-01-01

The crystal structure of β-BaZr(PO 4 ) 2 , archetype of the high-temperature forms of BaM(PO 4 ) 2 phosphates (with M=Ti, Zr, Hf and Sn), has been solved ab initio by Rietveld analysis from synchrotron X-ray powder diffraction data. The phase transition appears as a topotactic modification of the monoclinic (S.G. C2/m) lamellar α-structure into a trigonal one (S.G. P3-barm1) through a simple mechanism involving the unfolding of the [Zr(PO 4 ) 2 ] n 2- layers. The thermal expansion is very anisotropic (e.g., -4.1 i -6 K -1 in the case of α-BaZr(PO 4 ) 2 ) and quite different in the two forms, as a consequence of symmetry. It stems from a complex combination of several mechanisms, involving bridging oxygen rocking in M-O-P linkages, and 'bond thermal expansion'. - Graphical abstract: The layered high-temperature form of BaM(PO 4 ) 2 , only expands along the c-axis.

Site preference of metal atoms in Gd_5_-_xM_xTt_4 (M = Zr, Hf; Tt = Si, Ge)

International Nuclear Information System (INIS)

Yao, Jinlei; Mozharivskyj, Yurij

2011-01-01

Zirconium and hafnium were incorporated into the Gd_5Ge_4 and Gd_5Si_4 parent compounds in order to study the metal-site occupation in the M_5X_4 magnetocaloric phases (M = metals; X = p elements) family. The Gd_5_-_xZr_xGe_4 phases adopt the orthorhombic Sm_5Ge_4-type (space group Pnma) structure for x ≤ 1.49 and the tetragonal Zr_5Si_4-type (P4_12_12) structure for x ≥ 1.77. The Gd_5_-_xHf_xSi_4 compounds crystallize in the orthorhombic Gd_5Si_4-type (Pnma) structure for x ≤ 0.41 and the Zr_5Si_4-type structure for x ≥ 0.7. In both systems, single-crystal X-ray diffraction reveals that the Zr/Hf atoms preferentially occupy the slab-surface M2 and slab-center M3 sites, both of which have a significantly larger Zr/Hf population than the slab-surface M1 site. The metal-site preference, i.e. the coloring problem on the three metal sites, is discussed considering geometric and electronic effects of the local coordination environments. The analysis of the metal-site occupation in Gd_5_-_xZr_xGe_4 and Gd_5_-_xHf_xSi_4 as well as other metal-substituted M_5X_4 systems suggests that both geometric and electronic effects can be used to explain the metal-site occupation. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Remaining Sites Verification Package for the 1607-B2 Septic System and 100-B-14:2 Sanitary Sewer System, Waste Site Reclassification Form 2006-055

Energy Technology Data Exchange (ETDEWEB)

L. M. Dittmer

2007-03-21

The 1607-B2 waste site is a former septic system associated with various 100-B facilities, including the 105-B, 108-B, 115-B/C, and 185/190-B buildings. The site was evaluated based on confirmatory results for feeder lines within the 100-B-14:2 subsite and determined to require remediation. The 1607-B2 waste site has been remediated to achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

National inventory of uranium mine sites. Version 2 - September 2007. Realised in the framework of the M.I.M.A.U.S.A. program Memory and impact of Uranium Mines: synthesis and archives

International Nuclear Information System (INIS)

2007-01-01

The M.I.M.A.U.S.A. program allows to end in a compilation and a synthesis of the available data to allow the I.R.S.N., the national and local authorities, but also the public to have a source of quality information about the history of the French uranium mining sites and the possible systems of radiological surveillance set up at the moment; To assure the perpetuity of the knowledge of these sites in spite of the stop of the concerned activities; To establish a working tool for the government services in charge of the definition of the refitting and surveillance programs; And to improve the representativeness of the national network of radiation monitoring in the environment, notably as regards the stations of measure exploited by the I.R.S.N..The M.I.M.A.U.S.A. inventory or the national inventory of the uranium mining sites in France consists of the most exhaustive possible inventory of the sites on which were practised the activities in connection with the exploration (works of recognition of significant scale, the extraction or the treatment of the uranium ore in metropolitan France. The acquired information is synthesized in the form of index cards of sites presented in this document, with in introduction, the manual of the reserved columns and the used terms. The present version follows upon a first version published in 2004. The novelties of the version 2007: a more exhaustive inventory, 30 sites were added, enriched and corrected information, more complete identification of the receiving rivers, more precise and accessible geographical localization, zoom-news on certain mining zones, a paragraph current events. The sources of information are: Areva-Nc, A.N.D.R.A., D.R.I.R.E., and A.S.N.. (N.C.)

FT-IR spectroscopic study on the hofmann-Td type complex: M(4-Phenylpyridine)2M'(CN)4 (M=Ni; M'=Cd)

International Nuclear Information System (INIS)

Parlak, C.

2005-01-01

New Hofmann-Td type complex in the form of M(4-Phenylpyridine) 2 M'(CN) 4 (M = Ni, M' = Cd) was prepared in powder form and its infrared spectra is reported in the region of 4000-200 cm-1. From the spectral findings, this compound is similar in structure to the Hofmann-Td type complexes

Identification of a novel splice variant form of the influenza A virus M2 ion channel with an antigenically distinct ectodomain.

Directory of Open Access Journals (Sweden)

Helen M Wise

Full Text Available Segment 7 of influenza A virus produces up to four mRNAs. Unspliced transcripts encode M1, spliced mRNA2 encodes the M2 ion channel, while protein products from spliced mRNAs 3 and 4 have not previously been identified. The M2 protein plays important roles in virus entry and assembly, and is a target for antiviral drugs and vaccination. Surprisingly, M2 is not essential for virus replication in a laboratory setting, although its loss attenuates the virus. To better understand how IAV might replicate without M2, we studied the reversion mechanism of an M2-null virus. Serial passage of a virus lacking the mRNA2 splice donor site identified a single nucleotide pseudoreverting mutation, which restored growth in cell culture and virulence in mice by upregulating mRNA4 synthesis rather than by reinstating mRNA2 production. We show that mRNA4 encodes a novel M2-related protein (designated M42 with an antigenically distinct ectodomain that can functionally replace M2 despite showing clear differences in intracellular localisation, being largely retained in the Golgi compartment. We also show that the expression of two distinct ion channel proteins is not unique to laboratory-adapted viruses but, most notably, was also a feature of the 1983 North American outbreak of H5N2 highly pathogenic avian influenza virus. In identifying a 14th influenza A polypeptide, our data reinforce the unexpectedly high coding capacity of the viral genome and have implications for virus evolution, as well as for understanding the role of M2 in the virus life cycle.

U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization?

Science.gov (United States)

Bustamante, Arturo Vargas

2016-01-01

For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form) is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form) is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization. PMID:27694684

Remaining Sites Verification Package for the 128-B-2, 100-B Burn Pit No.2 Waste Site. Attchment to Waste Site Reclassification Form 2005-038

International Nuclear Information System (INIS)

Carlson, R.A.

2005-01-01

The 128-B-2 waste site was a burn pit historically used for the disposal of combustible and noncombustible wastes, including paint and solvents, office waste, concrete debris, and metallic debris. This site has been remediated by removing approximately 5,627 bank cubic meters of debris, ash, and contaminated soil to the Environmental Restoration Disposal Facility. The results of verification sampling demonstrated that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also showed that residual contaminant concentrations are protective of groundwater and the Columbia River

Surveillance of Site A and Plot M, Report for 2008.

Energy Technology Data Exchange (ETDEWEB)

Golchert, N. W.

2009-05-07

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for Calendar Year 2008 are presented. Based on the results of the 1976-1978 radiological characterization of the site, a determination was made that a surveillance program be established. The characterization study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand pumped picnic wells. The current surveillance program began in 1980 and consists of sample collection and analysis of surface and subsurface water. The results of the analyses are used to (1) monitor the migration pathway of hydrogen-3 contaminated water from the burial ground (Plot M) to the hand-pumped picnic wells, (2) establish if other buried radionuclides have migrated, and (3) monitor for the presence of radioactive materials in the environment of the area. Hydrogen-3 in the Red Gate Woods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Hydrogen-3 continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site, using the picnic area, or living in the vicinity.

Surveillance of site A and plot M, report for 2007.

Energy Technology Data Exchange (ETDEWEB)

Golchert, N. W.; ESH/QA Oversight

2008-03-25

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for Calendar Year 2007 are presented. Based on the results of the 1976-1978 radiological characterization of the site, a determination was made that a surveillance program be established. The characterization study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand pumped picnic wells. The current surveillance program began in 1980 and consists of sample collection and analysis of surface and subsurface water. The results of the analyses are used to: (1) monitor the migration pathway of water from the burial ground (Plot M) to the hand-pumped picnic wells, (2) establish if other buried radionuclides have migrated, and (3) monitor the presence of radioactive materials in the environment of the area. Hydrogen-3 in the Red Gate Woods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Hydrogen-3 continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site, using the picnic area, or living in the vicinity.

Surveillance of Site A and Plot M - Report for 2006.

Energy Technology Data Exchange (ETDEWEB)

Golchert, N. W.; ESH/QA Oversight

2007-05-07

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for Calendar Year 2006 are presented. Based on the results of the 1976-1978 radiological characterization of the site, a determination was made that a surveillance program be established. The characterization study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand-pumped picnic wells. The current surveillance program began in 1980 and consists of sample collection and analysis of surface and subsurface water. The results of the analyses are used to (1) monitor the migration pathway of water from the burial ground (PlotM) to the hand pumped picnic wells, (2) establish if buried radionuclides other than hydrogen-3 have migrated, and (3) monitor the presence of radioactive and chemically hazardous materials in the environment of the area. Hydrogen-3 in the Red GateWoods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Hydrogen-3 continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site, using the picnic area, or living in the vicinity.

Surveillance of Site A and Plot M - Report for 2005.

Energy Technology Data Exchange (ETDEWEB)

Golchert, N. W.; ESH/QA Oversight

2006-04-10

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for Calendar Year 2005 are presented. Based on the results of the 1976-1978 radiological characterization of the site, a determination was made that a surveillance program be established. The characterization study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby handpumped picnic wells. The current surveillance program began in 1980 and consists of sample collection and analysis of surface and subsurface water. The results of the analyses are used to (1) monitor the migration pathway of water from the burial ground (Plot M) to the handpumped picnic wells, (2) establish if buried radionuclides other than hydrogen-3 have migrated, and (3) monitor the presence of radioactive and chemically hazardous materials in the environment of the area. Hydrogen-3 in the Red Gate Woods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Hydrogen-3 continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site, using the picnic area, or living in the vicinity.

Neutral and stereospecific Tc-99m complexes: [99mTc]N-benzyl-3,4-di-(N-2-mercaptoethyl)-amino-pyrrolidines (P-BAT)

International Nuclear Information System (INIS)

Zhuang Zhiping; Ploessl, Karl; Kung Meiping; Mu Mu; Kung, Hank F.

1999-01-01

Technetium-99m-labeled radiopharmaceuticals are currently the most commonly used agents in nuclear medicine. To prepare binding site-specific small molecules containing a Tc-99m complexing core, it is important to consider a ligand system, which selectively forms only one stereoisomer. A novel series of bisaminoethanethiol (BAT) derivatives as a model system were prepared. Stereoisomers of N-benzyl-3,4-di-(N-2-mercaptoethyl)-amino pyrrolidines (P-BAT): (3R,4R)-P-BAT (R,R-4) and (3,4)meso-P-BAT (8), the trans and meso isomer, respectively, as a chelating group were prepared successfully. The desired Tc-99m P-BAT complexes were obtained by using Sn(II)/glucoheptonate as the reducing agent for [ 99m Tc]pertechnetate. As predicted, after complexation with [ 99m Tc]Tc v O, the trans isomer, (3R,4R)-P-BAT (R,R-4), showed only one isomer; whereas the corresponding meso isomer, (3,4)meso-P-BAT (8), produced two distinctive complexes isolated readily by high performance liquid chromatography (HPLC). The [ 99m Tc](R,S)meso-P-BAT (8) isomers showed a different lipophilicity (partition coefficient [P.C.]=54.3 and 55.4 for peak A and peak B, respectively), as compared with that of the corresponding [ 99m Tc](3R,4R)-P-BAT (R,R-4), trans isomer ( P.C.=163). Results of the biodistribution study in rats of these isomers show different heart and brain uptake, suggesting that the intrinsic differences in biodistribution are due to structural and stereospecific factors. Examples in this report confirm that it is possible to design stereospecific Tc-99m complexes based on the bisaminoethanethiol (N 2 S 2 , BAT) ligand system. Consideration on stereoselectivity of site-specific agents labeled with Tc-99m is likely an essential requirement on developing binding-site specific radiopharmaceuticals

Evolution of magnetization due to asymmetric dimerization: theoretical considerations and application to aberrant oligomers formed by apoSOD1(2SH).

Science.gov (United States)

Sekhar, Ashok; Bain, Alex D; Rumfeldt, Jessica A O; Meiering, Elizabeth M; Kay, Lewis E

2016-02-17

A set of coupled differential equations is presented describing the evolution of magnetization due to an exchange reaction whereby a pair of identical monomers form an asymmetric dimer. In their most general form the equations describe a three-site exchange process that reduces to two-site exchange under certain limiting conditions that are discussed. An application to the study of sparsely populated, transiently formed sets of aberrant dimers, symmetric and asymmetric, of superoxide dismutase is presented. Fits of concentration dependent CPMG relaxation dispersion profiles provide measures of the dimer dissociation constants and both on- and off-rates. Dissociation constants on the order of 70 mM are extracted from fits of the data, with dimeric populations of ∼2% and lifetimes of ∼6 and ∼2 ms for the symmetric and asymmetric complexes, respectively. This work emphasizes the important role that NMR relaxation experiments can play in characterizing very weak molecular complexes that remain invisible to most biophysical approaches.

Surveillance of Site A and Plot M report for 1991

International Nuclear Information System (INIS)

Golchert, N.W.

1992-05-01

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for CY 1991 are presented. The surveillance program is the ongoing remedial action that resulted from the 1976--1978 radiological characterization of the site. That study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand-pumped picnic wells. The current program consists of sample collection and analysis of air, surface and subsurface water, and bottom sediment. The results of the analyses are used to (1) determine the migration pathway of water from the burial ground (Plot M) to the hand-pumped picnic wells, (2) establish if buried radionuclides other than hydrogen-3 have migrated, and (3) generally characterize the radiological environment of the area. Hydrogen-3 in the Red Gate Woods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Tritiated water continues to be detected in a number of wells, boreholes, dolomite holes, and surface stream. For many years it was the only radionclide found to have migrated in measurable quantities. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of borehole next to Plot M. The available data does not allow a firm conclusion as to whether the presence of this nuclide represents recent migration or movement that may have occurred before Plot M was capped. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site or those living in the vicinity

Surveillance of Site A and Plot M. Report for 1996

International Nuclear Information System (INIS)

Golchert, N.W.

1997-05-01

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for 1996 are presented. The surveillance program is the ongoing remedial action that resulted from the 1976-1978 radiological characterization of the site. That study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand-pumped picnic wells. The current program consists of sample collection and analysis of air, surface and subsurface water, and bottom sediment. The results of the analyses are used to (1) monitor the migration pathway of water from the burial ground (Plot M) to the hand-pumped picnic wells, (2) establish if buried radionuclides other than hydrogen-3 have migrated, and (3) generally characterize the radiological environment of the area. Hydrogen-3 in the Red Gate Woods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Tritiated water continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. For many years it was the only radionuclide found to have migrated in measurable quantities. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The available data does not allow a firm conclusion as to whether the presence of this nuclide represents recent migration or movement that may have occurred before Plot M was capped. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site, using the picnic area, or living in the vicinity

Lymphoma imaging with a new technetium-99m labelled antibody, LL2

International Nuclear Information System (INIS)

Murthy, S.; Sharkey, R.M.; Goldenberg, D.M.; Lee, R.E.; Pinsky, C.M.; Hansen, H.J.; Burger, K.; Swayne, L.C.

1992-01-01

The lesion detection capability of a new technetium-99m labelled B-cell lymphoma monoclonal antibody (MoAb) imaging agent, LL2, was evaluated in 8 patients with non-Hodgkin's lymphoma and 1 patient with chronic lymphocytic leukaemia. The MoAb kit consists of a 1-vial, 1-mg Fab' form of LL2 ready for instant labelling with technetium. The patients were injected with ∝925 MBq (25 mCi) of 99m Tc-LL2 Fab' (1 mg), and planar and single photon emission tomography (SPET) studies were performed at 3-4 h post injection and at 24 h. There was no evidence of thyroid or stomach activity up to 24 h. Uniform splenic uptake was seen in all patients. Two non-lymphoma patients were also administered with the same agent and demonstrated a similar splenic distribution; therefore, splenic targeting was not scored as tumour-specific. A total of 29 from 48 tumour sites were detected by scintigraphy, including tumours of various grades and histological types. Excluding 1 patient who had a large tumour burden of over 500 g, 29 of 33 lesions were detected. One patient was free of disease at the time of the study and had a negative scan. Another patient showed excellent targeting of gallium-negative sites in the liver and bone. The bone involvement was not known prior to the antibody study and was subsequently confirmed by a bone scan. Additional sites of MoAb localization could not be followed in this group, since most patients went on to radioimmunotherapy immediately following the 99m Tc-LL2 study. However, these initial results suggest that this new 99m Tc-labelled antibody imaging kit should be further investigated for its potential role in the staging and follow-up of lymphoma patients. (orig.)

Remaining Sites Verification Package for the 100-F-26:13, 108-F Drain Pipelines. Attchment to Waste Site Reclassification Form 2005-011

International Nuclear Information System (INIS)

Dittmer, L.M.

2008-01-01

The 100-F-26:13 waste site is the network of process sewer pipelines that received effluent from the 108-F Biological Laboratory and discharged it to the 188-F Ash Disposal Area (126-F-1 waste site). The pipelines included one 0.15-m (6-in.)-, two 0.2-m (8-in.)-, and one 0.31-m (12-in.)-diameter vitrified clay pipe segments encased in concrete. In accordance with this evaluation, the verification sampling results support a reclassification of this site to Interim Closed Out. The results of verification sampling demonstrated that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also showed that residual contaminant concentrations are protective of groundwater and the Columbia River

Fast form alpha-2-macroglobulin

DEFF Research Database (Denmark)

Biltoft, Daniel; Gram, Jørgen Brodersen; Larsen, Anette

2017-01-01

Objectives: Investigation of the blood compatibility requires a number of sensitive assays to quantify the activation of the blood protein cascades and cells induced by biomaterials. A global assay measuring the blood compatibility of biomaterials could be a valuable tool in such regard....... In this study, we investigated whether an enzyme-linked immunosorbent assay (ELISA), that specifically measures the electrophoretic "fast form" of α2-macroglobulin (F-α2M), could be a sensitive and global marker for activation of calcium dependent and in-dependent proteases in plasma exposed to biomaterials...... in vitro. Methods: A F-α2M specific monoclonal antibody was generated and applied in an ELISA setup. Using the F-α2M ELISA, we investigated activation of calcium dependent and in-dependent proteases by polyvinylchloride (n=10), polytetrafluoroethylene (n=10) and silicone (n=10) tubings as well as glass...

Crystal structure and thermal expansion of the low- and high-temperature forms of Ba MIV(PO 4) 2 compounds ( M=Ti, Zr, Hf and Sn)

Science.gov (United States)

Bregiroux, D.; Popa, K.; Jardin, R.; Raison, P. E.; Wallez, G.; Quarton, M.; Brunelli, M.; Ferrero, C.; Caciuffo, R.

2009-05-01

The crystal structure of β-BaZr(PO 4) 2, archetype of the high-temperature forms of Ba M(PO 4) 2 phosphates (with M=Ti, Zr, Hf and Sn), has been solved ab initio by Rietveld analysis from synchrotron X-ray powder diffraction data. The phase transition appears as a topotactic modification of the monoclinic (S.G. C2/m) lamellar α-structure into a trigonal one (S.G. P3¯m1) through a simple mechanism involving the unfolding of the [Zr)]n2- layers. The thermal expansion is very anisotropic (e.g., -4.1< α i<34.0×10 -6 K -1 in the case of α-BaZr(PO 4) 2) and quite different in the two forms, as a consequence of symmetry. It stems from a complex combination of several mechanisms, involving bridging oxygen rocking in M-O-P linkages, and "bond thermal expansion".

Site-Specific Covalent Conjugation of Modified mRNA by tRNA Guanine Transglycosylase.

Science.gov (United States)

Ehret, Fabian; Zhou, Cun Yu; Alexander, Seth C; Zhang, Dongyang; Devaraj, Neal K

2018-03-05

Modified mRNA (mod-mRNA) has recently been widely studied as the form of RNA useful for therapeutic applications due to its high stability and lowered immune response. Herein, we extend the scope of the recently established RNA-TAG (transglycosylation at guanosine) methodology, a novel approach for genetically encoded site-specific labeling of large mRNA transcripts, by employing mod-mRNA as substrate. As a proof of concept, we covalently attached a fluorescent probe to mCherry encoding mod-mRNA transcripts bearing 5-methylcytidine and/or pseudouridine substitutions with high labeling efficiencies. To provide a versatile labeling methodology with a wide range of possible applications, we employed a two-step strategy for functionalization of the mod-mRNA to highlight the therapeutic potential of this new methodology. We envision that this novel and facile labeling methodology of mod-RNA will have great potential in decorating both coding and noncoding therapeutic RNAs with a variety of diagnostic and functional moieties.

First principles calculations of the electronic structure and magnetic properties of Y(Fe,M)9.2 and Y(Fe,M)9.2C (M= Si, Ga, Zr)

Science.gov (United States)

Tian, Guang; Zha, Liang; Yang, Wenyun; Qiao, Guanyi; Wang, Changsheng; Yang, Yingchang; Yang, Jinbo

2018-06-01

The preferential site substitution of the Fe by Si, Ga and Zr in the Y(Fe,M)9.2 and Y(Fe,M)9.2C compounds, and the doping effects on the magnetic properties have been studied by the first-principles calculations. It is found that the doping of the Si or Zr can improve the thermodynamic stability of the 1:9 phase, while the substitution of the Fe by Ga makes it unstable. Si atom tends to enter the 3g crystal site and Zr prefers to occupy the 2e site when Y(Fe,M)9.2 and their carbides are synthesized. Although the substitution of the Fe by Si and Zr will reduce the total magnetic moments of the YFe9.2 and their carbides, the volumetric and the d-band narrowing effects caused by the doping can still modify the electron density distributions of the Fe near the Fermi level, improving the magnetic ordering temperature of the non-carbonated compound YFe9.2. The calculated magnetic ordering temperatures of Y(Fe,M)9.2C decrease with the increasing content of the doping elements M due to the stronger hybridization of the d bands in the carbides. For the rare-earth(RE) iron based intermetallics REFe9.2 with the TbCu7-type structure, it is suggested that Zr is able to stabilize the phase and enhance the magnetic ordering temperature, indicating the possible further application in the field of permanent magnets, which has not been reported before.

Chemical form of tumor-tropic 99mTc-DL-homocysteine

International Nuclear Information System (INIS)

Takeda, A.; Okada, S.

1989-01-01

Analyses of the chemical forms of 99m Tc-complexes provide important information for the development of a new tumor-tropic 99m Tc-labeled radiopharmaceutical. We attempted to determine the chemical form of 99m Tc-DL-homocysteine ( 99m Tc-Hcy) which was previously reported to be tumor-tropic. By analyzing the functional residues of Hcy in the 99m Tc-Hcy molecule, it was estimated that the sulfhydryl and amino residues participated in the chelate formation. Gel filtration analysis of 99m Tc-Hcy indicated that its molecular size was bigger than that of 99m Tc-penicillamine monomer. The analysis also indicated that 99m Tc-Hcy complex seemed to be a relatively small oligomer. Although an uncertainty remains on the valency of Tc in 99m Tc-Hcy molecule and the accurate molecular size of this complex, its putative chemical form is described. (author)

Vitrified waste form performance modeling applied to the treatment and disposal of mixed-waste sludge at the Savannah River Site

International Nuclear Information System (INIS)

Whited, A.R.; Fjeld, R.A.

1998-01-01

Vitrification, the conversion of source components into a solid amorphous glass matrix, has emerged as a viable treatment technology for low-level radioactive waste and mixed waste. To dispose of vitrified low-level waste at US Department of Energy facilities, site-specific radiological performance assessments must be conducted to demonstrate that waste glass satisfies performance objectives for environmental protection. More than 2,500 m 3 of F0006-listed low-level mixed-waste sludge stored in the Reactor Materials Department (M-Area) at the Savannah River Site (SRS) is scheduled for vitrification. This study evaluates the feasibility of on-site disposal of vitrified M-Area waste at SRS. Laboratory leaching tests that accelerate the glass corrosion process are currently the best indicators of vitrified waste form durability. A method to incorporate laboratory leaching data into performance assessments is presented. A screening-level performance assessments code is used to model trench disposal of M-Area waste glass. The allowable leach rate for vitrified M-Area waste is determined based on both a maximum radiological dose equivalent of 4 mrem/yr for the drinking water pathway and a maximum uranium concentration of 20 microg/ell in groundwater. The allowable leach rate is compared with published long-term leaching data for a wide range of waste glass compositions and test conditions. This analysis demonstrates that trench disposal of the waste glass is likely to meet applicable performance objectives if the glass is of above average durability compared with the reference set of glasses

Prediction of protein modification sites of pyrrolidone carboxylic acid using mRMR feature selection and analysis.

Directory of Open Access Journals (Sweden)

Lu-Lu Zheng

Full Text Available Pyrrolidone carboxylic acid (PCA is formed during a common post-translational modification (PTM of extracellular and multi-pass membrane proteins. In this study, we developed a new predictor to predict the modification sites of PCA based on maximum relevance minimum redundancy (mRMR and incremental feature selection (IFS. We incorporated 727 features that belonged to 7 kinds of protein properties to predict the modification sites, including sequence conservation, residual disorder, amino acid factor, secondary structure and solvent accessibility, gain/loss of amino acid during evolution, propensity of amino acid to be conserved at protein-protein interface and protein surface, and deviation of side chain carbon atom number. Among these 727 features, 244 features were selected by mRMR and IFS as the optimized features for the prediction, with which the prediction model achieved a maximum of MCC of 0.7812. Feature analysis showed that all feature types contributed to the modification process. Further site-specific feature analysis showed that the features derived from PCA's surrounding sites contributed more to the determination of PCA sites than other sites. The detailed feature analysis in this paper might provide important clues for understanding the mechanism of the PCA formation and guide relevant experimental validations.

Initial direct comparison of 99mTc-TOC and 99mTc-TATE in identifying sites of disease in patients with proven GEP NETs.

Science.gov (United States)

Cwikla, Jaroslaw B; Mikolajczak, Renata; Pawlak, Dariusz; Buscombe, John R; Nasierowska-Guttmejer, Anna; Bator, Andrzej; Maecke, Helmut R; Walecki, Jerzy

2008-07-01

The imaging of neuroendocrine tumors has become one of the most significant areas in nuclear oncology. In an attempt to provide high-quality imaging and possible sensitivity at a reduced cost, time, and radiation dose, several (99m)Tc agents have been proposed. The aim of this initial study was to compare the tumor uptake and biodistribution of 2 new 6-hydrazinopyridine-3-carboxylic acid (HYNIC)-derivatized Tyr(3)-octreotide analogs, (99m)Tc-[HYNIC,Tyr(3)]octreotide ((99m)Tc-TOC) and (99m)Tc-[HYNIC,Tyr(3),Thr(8)]octreotide ((99m)Tc-TATE), in patients with somatostatin receptor-expressing tumors. Each of 12 patients with proven gastrointestinal pancreatic neuroendocrine tumors received a mean activity of 520 MBq of (99m)Tc-TOC and (99m)Tc-TATE. Scintigraphy with both tracers was performed 3-4 h after their injection using standard whole-body and SPECT imaging. The images were reviewed subjectively by 2 readers, who reported tumor uptake lesion by lesion. Both radiotracers demonstrated concordance between the results in 7 patients (58%). In total, 110 sites of disease were identified with (99m)Tc-TOC, compared with 115 with (99m)Tc-TATE. There was 1 case in which (99m)Tc-TOC identified sites of disease not seen on (99m)Tc-TATE imaging but 4 cases in which some sites of disease were seen with (99m)Tc-TATE and not (99m)Tc-TOC. In this initial study, both tracers seem to show similar sites of tumor, with (99m)Tc-TATE having a slight edge in the total number of lesions seen, especially in lymph node metastases.

AthMethPre: a web server for the prediction and query of mRNA m6A sites in Arabidopsis thaliana.

Science.gov (United States)

Xiang, Shunian; Yan, Zhangming; Liu, Ke; Zhang, Yaou; Sun, Zhirong

2016-10-18

N 6 -Methyladenosine (m 6 A) is the most prevalent and abundant modification in mRNA that has been linked to many key biological processes. High-throughput experiments have generated m 6 A-peaks across the transcriptome of A. thaliana, but the specific methylated sites were not assigned, which impedes the understanding of m 6 A functions in plants. Therefore, computational prediction of mRNA m 6 A sites becomes emergently important. Here, we present a method to predict the m 6 A sites for A. thaliana mRNA sequence(s). To predict the m 6 A sites of an mRNA sequence, we employed the support vector machine to build a classifier using the features of the positional flanking nucleotide sequence and position-independent k-mer nucleotide spectrum. Our method achieved good performance and was applied to a web server to provide service for the prediction of A. thaliana m 6 A sites. The server also provides a comprehensive database of predicted transcriptome-wide m 6 A sites and curated m 6 A-seq peaks from the literature for query and visualization. The AthMethPre web server is the first web server that provides a user-friendly tool for the prediction and query of A. thaliana mRNA m 6 A sites, which is freely accessible for public use at .

Luminescence enhancement of (Sr1-x Mx )2 SiO4 :Eu2+ phosphors with M (Ca2+ /Zn2+ ) partial substitution for white light-emitting diodes.

Science.gov (United States)

Wang, Yulong; Zhang, Wentao; Gao, Yang; Long, Jianping; Li, Junfeng

2017-02-01

Eu 2 + -doped Sr 2 SiO 4 phosphor with Ca 2 + /Zn 2 + substitution, (Sr 1-x M x ) 2 SiO 4 :Eu 2 + (M = Ca, Zn), was prepared using a high-temperature solid-state reaction method. The structure and luminescence properties of Ca 2 + /Zn 2 + partially substituted Sr 2 SiO 4 :Eu 2 + phosphors were investigated in detail. With Ca 2 + or Zn 2 + added to the silicate host, the crystal phase could be transformed between the α-form and the β-form of the Sr 2 SiO 4 structure. Under UV excitation at 367 nm, all samples exhibit a broad band emission from 420 to 680 nm due to the 4f 6 5d 1  → 4f 7 transition of Eu 2 + ions. The broad emission band consists of two peaks at 482 and 547 nm, which correspond to Eu 2 + ions occupying the ten-fold oxygen-coordinated Sr.(I) site and the nine-fold oxygen-coordinated Sr.(II) site, respectively. The luminescence properties, including the intensity and lifetime of Sr 2 SiO 4 :Eu 2 + phosphors, improved remarkably on Ca 2 + /Zn 2 + addition, and promote its application in white light-emitting diodes. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Electric conductivity of double fluorides in the systems M1F-Th(U)F4(M1=K, Tl) and M2F2-ThF4(M2=Ca, Sr, Ba)

International Nuclear Information System (INIS)

Murin, I.V.; Andreev, A.M.; Amelin, Yu.V.

1982-01-01

The temperature dependence of electric conductivity of some double fluorides formed in the systems M 1 F-Th(U)F 4 (M 1 =K, Tl) and M 2 F 2 -ThF 4 (M 2 =Ca, Sr, Ba) as well as UF 3 in a wide temperature range is studied. It is shown that the values of electric conductivity and activation energy of these fluorides depend on the compound structure and cation nature. The temperature electric conductivity dependence for double fluorides with the tysonite structure is close to the lanthanum fluoride dependence. Taking into account low electron electric conductivity component the conclusion is drawn that the investigated compounds can be used as solid electrolytes

Transfection of tumor-infiltrating T cells with mRNA encoding CXCR2

DEFF Research Database (Denmark)

Idorn, Manja; thor Straten, Eivind Per; Svane, Inge Marie

2016-01-01

Adoptive T-cell therapy based on the infusion of patient’s own immune cells after ex vivo culturing is among the most potent forms of personalized treatment among recent clinical developments for the treatment of cancer. However, despite high rates of successful initial clinical responses, only...... infused T cells migrating to the tumor and the clinical response, but also that only a small fraction of adoptively transferred Tcells reach the tumor site. In this chapter, we describe a protocol for transfection of TILs with mRNA encoding the chemokine receptor CXCR2 transiently redirecting...

Progress in forming bottom barriers under waste sites

International Nuclear Information System (INIS)

Carter, E.E.

1997-01-01

The paper describes an new method for the construction, verification, and maintenance of underground vaults to isolate and contain radioactive burial sites without excavation or drilling in contaminated areas. The paper begins with a discussion of previous full-scale field tests of horizontal barrier tools which utilized high pressure jetting technology. This is followed by a discussion of the TECT process, which cuts with an abrasive cable instead of high pressure jets. The new method is potentially applicable to more soil types than previous methods and can form very thick barriers. Both processes are performed from the perimeter of a site and require no penetration or disturbance of the active waste area. The paper also describes long-term verification methods to monitor barrier integrity passively

[H2en]2{La2M(SO4)6(H2O)2} (M=Co, Ni): First organically templated 3d-4f mixed metal sulfates

International Nuclear Information System (INIS)

Yuan Yanping; Wang Ruiyao; Kong Deyuan; Mao Jianggao; Clearfield, Abraham

2005-01-01

The first organically templated 3d-4f mixed metal sulfates, [H 2 en] 2 {La 2 M(SO 4 ) 6 (H 2 O) 2 } (M=Co 1, Ni 2) have been synthesized and structurally determined from non-merohedrally twinned crystals. The two compounds are isostructural and their structures feature a three-dimensional anionic network formed by the lanthanum(III) and nickel(II) ions bridged by sulfate anions. The La(III) ions in both compounds are 10-coordinated by four sulfate anions in bidentate chelating fashion, and two sulfate anions in a unidentate fashion. The transition metal(II) ion is octahedrally coordinated by six oxygens from four sulfate anions and two aqua ligands. The doubly protonated enthylenediamine cations are located at the tunnels formed by 8-membered rings (four La and four sulfate anions)

Machining tools in AISI M2 high-speed steel obtained by spray forming process; Ferramentas de usinagem em aco rapido AISI M2 obtido por conformacao por 'spray'

Energy Technology Data Exchange (ETDEWEB)

Jesus, Edilson Rosa Barbosa de. E-mail: erbjesus@usp.br

2004-07-01

The aim of the present work was the obtention of AISI M2 high-speed steel by spray forming technique and the material evaluation when used as machining tool. The obtained material was hot rolled at 50% and 72% reduction ratios, and from which it was manufactured inserts for machining tests. The performance of inserts made of the spray formed material was compared to inserts obtained from conventional and powder metallurgy (MP) processed materials. The spray formed material was chemical, physical, mechanical and microstructural characterised. For further characterisation, the materials were submitted to machining tests for performance evaluation under real work condition. The results of material characterisation highlight the potential of the spray forming technique, in the obtention of materials with good characteristics and properties. Under the current processing, hot rolling and heat treatments condition, the analysis of the results of the machining tests revealed a very similar behaviour among the tested materials. Proceeding a criterious analysis of the machining results tests, it was verified that the performance presented by the powder metallurgy material (MP) was slight superior, followed by conventional obtained material (MConv), which presented a insignificant advantage over the spray formed and hot rolled (72% reduction ratio) material. The worst result was encountered for the spray forming and hot rolled (50% reduction ratio) material that presented the highest wear values. (author)

Membrane-Dependent Effects of a Cytoplasmic Helix on the Structure and Drug Binding of the Influenza Virus M2 Protein

Science.gov (United States)

Cady, Sarah; Wang, Tuo; Hong, Mei

2011-01-01

The influenza A M2 protein forms a proton channel for virus infection and also mediates virus assembly and budding. The minimum protein length that encodes both functions contains the transmembrane (TM) domain (roughly residues 22 to 46) for the amantadine-sensitive proton-channel activity and an amphipathic cytoplasmic helix (roughly residues 45 to 62) for curvature induction and virus budding. However, structural studies involving the TM domain with or without the amphipathic helix differed on the drug-binding site. Here we use solid-state NMR spectroscopy to determine the amantadine binding site in the cytoplasmic-helix-containing M2(21–61). 13C-2H distance measurements of 13C-labeled protein and 2H-labeled amantadine showed that in DMPC bilayers, the first equivalent of drug bound S31 inside the M2(21–61) pore, similar to the behavior of M2TM in DMPC bilayers. The non-specific surface site of D44 observed in M2TM is disfavored in the longer peptide. Thus, the pharmacologically relevant drug-binding site in the fully functional M2(21–61) is S31 in the TM pore. Interestingly, when M2(21–61) was reconstituted into a virus-mimetic membrane containing 30% cholesterol, no chemical shift perturbation was observed for pore-lining residues, while M2TM in the same membrane exhibited drug-induced chemical shift changes. Reduction of the cholesterol level and the use of unsaturated phospholipids shifted the conformational equilibrium of M2TM fully to the bound state, but did not rescue drug binding to M2(21–61). These results suggest that the amphipathic helix, together with cholesterol, modulates the ability of the TM helices to bind amantadine. Thus, the M2 protein interacts with the lipid membrane and small-molecule inhibitors in a complex fashion, and a careful examination of the environmental dependence of the protein conformation is required to fully understand the structure-function relation of this protein. PMID:21661724

Site-targeted complement inhibition by a complement receptor 2-conjugated inhibitor (mTT30) ameliorates post-injury neuropathology in mouse brains.

Science.gov (United States)

Rich, Megan C; Keene, Chesleigh N; Neher, Miriam D; Johnson, Krista; Yu, Zhao-Xue; Ganivet, Antoine; Holers, V Michael; Stahel, Philip F

2016-03-23

Intracerebral complement activation after severe traumatic brain injury (TBI) leads to a cascade of neuroinflammatory pathological sequelae that propagate host-mediated secondary brain injury and adverse outcomes. There are currently no specific pharmacological agents on the market to prevent or mitigate the development of secondary cerebral insults after TBI. A novel chimeric CR2-fH compound (mTT30) provides targeted inhibition of the alternative complement pathway at the site of tissue injury. This experimental study was designed to test the neuroprotective effects of mTT30 in a mouse model of closed head injury. The administration of 500 μg mTT30 i.v. at 1 h, 4 h and 24 h after head injury attenuated complement C3 deposition in injured brains, reduced the extent of neuronal cell death, and decreased post-injury microglial activation, compared to vehicle-injected placebo controls. These data imply that site-targeted alternative pathway complement inhibition may represent a new promising therapeutic avenue for the future management of severe TBI. Copyright © 2016. Published by Elsevier Ireland Ltd.

X-ray Absorption Spectroscopy of the Zinc-Binding Sites in the Class B2 Metallo-B-lactamsase ImiS from Aeromonas veronii bv. sobria

Energy Technology Data Exchange (ETDEWEB)

Costello,A.; Sharma, N.; Yang, K.; Crowder, M.; Tierney, D.

2006-01-01

X-ray absorption spectroscopy was used to investigate the metal-binding sites of ImiS from Aeromonas veronii bv. sobria in catalytically active (1-Zn), product-inhibited (1-Zn plus imipenem), and inactive (2-Zn) forms. The first equivalent of zinc(II) was found to bind to the consensus Zn{sub 2} site. The reaction of 1-Zn ImiS with imipenem leads to a product-bound species, coordinated to Zn via a carboxylate group. The inhibitory binding site of ImiS was examined by a comparison of wild-type ImiS with 1 and 2 equiv of bound zinc. 2-Zn ImiS extended X-ray absorption fine structure data support a binding site that is distant from the active site and contains both one sulfur donor and one histidine ligand. On the basis of the amino acid sequence of ImiS and the crystal structure of CphA [Garau et al. (2005) J. Mol. Biol. 345, 785-795], we propose that the inhibitory binding site is formed by M146, found on the B2-distinct {alpha}3 helix, and H118, a canonical Zn{sub 1} ligand, proposed to help activate the nucleophilic water. The mutation of M146 to isoleucine abolishes metal inhibition. This is the first characterization of ImiS with the native metal Zn and establishes, for the first time, the location of the inhibitory metal site.

Remaining Sites Verification Package for the 126-F-2, 183-F Clearwells, Waste Site Reclassification Form 2006-017

Energy Technology Data Exchange (ETDEWEB)

R. A. Carlson

2006-05-04

The 126-F-2 site is the clearwell facility formerly used as part of the reactor cooling water treatment at the 183-F facility. During demolition operations in the 1970s, potentially contaminated debris was disposed in the eastern clearwell structure. The site has been remediated by removing all debris in the clearwell structure to the Environmental Restoration Disposal Facility. The results of radiological surveys and visual inspection of the remediated clearwell structure show neither residual contamination nor the potential for contaminant migration beyond the clearwell boundaries. The results of verification sampling at the remediation waste staging area demonstrated that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also showed that residual contaminant concentrations are protective of groundwater and the Columbia River.

Remaining Sites Verification Package for the 126-F-2, 183-F Clearwells, Waste Site Reclassification Form 2006-017

International Nuclear Information System (INIS)

Carlson, R.A.

2006-01-01

The 126-F-2 site is the clearwell facility formerly used as part of the reactor cooling water treatment at the 183-F facility. During demolition operations in the 1970s, potentially contaminated debris was disposed in the eastern clearwell structure. The site has been remediated by removing all debris in the clearwell structure to the Environmental Restoration Disposal Facility. The results of radiological surveys and visual inspection of the remediated clearwell structure show neither residual contamination nor the potential for contaminant migration beyond the clearwell boundaries. The results of verification sampling at the remediation waste staging area demonstrated that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also showed that residual contaminant concentrations are protective of groundwater and the Columbia River

Theoretical descriptions of novel triplet germylenes M1-Ge-M2-M3 (M1 = H, Li, Na, K; M2 = Be, Mg, Ca; M3 = H, F, Cl, Br).

Science.gov (United States)

Kassaee, Mohamad Zaman; Ashenagar, Samaneh

2018-02-06

In a quest to identify new ground-state triplet germylenes, the stabilities (singlet-triplet energy differences, ΔE S-T ) of 96 singlet (s) and triplet (t) M 1 -Ge-M 2 -M 3 species were compared and contrasted at the B3LYP/6-311++G**, QCISD(T)/6-311++G**, and CCSD(T)/6-311++G** levels of theory (M 1  = H, Li, Na, K; M 2  = Be, Mg, Ca; M 3  = H, F, Cl, Br). Interestingly, F-substituent triplet germylenes (M 3  = F) appear to be more stable and linear than the corresponding Cl- or Br-substituent triplet germylenes (M 3  = Cl or Br). Triplets with M 1  = K (i.e., the K-Ge-M 2 -M 3 series) seem to be more stable than the corresponding triplets with M 1  = H, Li, or Na. This can be attributed to the higher electropositivity of potassium. Triplet species with M 3  = Cl behave similarly to those with M 3  = Br. Conversely, triplets with M 3  = H show similar stabilities and linearities to those with M 3  = F. Singlet species of formulae K-Ge-Ca-Cl and K-Ge-Ca-Br form unexpected cyclic structures. Finally, the triplet germylenes M 1 -Ge-M 2 -M 3 become more stable as the electropositivities of the α-substituents (M 1 and M 2 ) and the electronegativity of the β-substituent (M 3 ) increase.

Function of site. Chapter 2

International Nuclear Information System (INIS)

1999-01-01

In Semipalatinsk test site's history there are two stages for nuclear tests. In first stage (1949-1962) when the nuclear tests have being conducted in atmosphere, and second one (1963-1989) when underground nuclear explosions have being carried out. There were 456 nuclear tests, from which 117 were both the surface and the atmospheric explosions and other underground ones. In the chapter general characteristics of atmospheric nuclear tests, conducted on Semipalatinsk test site in 1949-1962 (chronology of conducting, release energy and kinds of nuclear explosions) are presented in tabular form. Most powerful of explosion was test of hydro- nuclear (hydrogen) bomb - prototype of thermonuclear charge in 1955 with capacity 1.6 Mt. In 1990-1992 the target-oriented radioecological investigation of territory around Semipalatinsk test site was carried out. Specialists dividing all atmospheric explosions by rate local traces, forming out of test site into 4 groups: with very strong contamination, with strong contamination, with weak contamination, and with very weak contamination. To nuclear explosions with very strong contamination were attributed the four explosions carrying out in 29.08.1949, 24.09.1951, 12.08.1953, 24.08.1956. Estimations of radiological situation including external doses of radiation and environment contamination and content of radioactive substances in human body was given by 10 European experts in collaboration with Kazakstan scientists. Results of investigation show that during past period surface contamination, called by nuclear weapons' fissile products was subjected to considerable decay. External doses completely coincidence with natural background. Remains of long living radionuclides are insignificant as well, and in 1995 its approximately were equal to annual exposition doses. One of most damaged settlements is Chagan. On it territory 530 radioactive sources with doses capacity from 100 up to 400 μR/h. Scientists of Semipalatinsk defined

Comparative study of A-site order in the lead-free bismuth titanates M1/2Bi1/2TiO3 (M=Li, Na, K, Rb, Cs, Ag, Tl) from first-principles

International Nuclear Information System (INIS)

Gröting, Melanie; Albe, Karsten

2014-01-01

We investigate the possibility of enhancing chemical order in the relaxor ferroelectric Na 1/2 Bi 1/2 TiO 3 upon substitution of Na + by other monovalent cations M + using total energy calculations based on density functional theory. All chemically available monovalent cations M + , which are Li, Na, Ag, K, Tl, Rb and Cs, are considered and an analysis of the structurally relaxed structures in terms of symmetry-adapted distortion modes is given in order to quantify the chemically induced structural distortions. We demonstrate that the replacement of Na + by other monovalent cations can hardly alter the tendency of chemical order with respect to Na 1/2 Bi 1/2 TiO 3 . Only Tl 1/2 Bi 1/2 TiO 3 and Ag 1/2 Bi 1/2 TiO 3 show enhanced tendency for chemical ordering. Both heavy metals behave similar to the light alkali metals in terms of structural relaxations and relative stabilities of the ordered configurations. Although a comparison of the Goldschmidt factors of components (M TiO 3 ) − reveals for Tl a value above the upper stability limit for perovskites, the additional lone-pair effect of Tl + stabilizes the ordered structure. - Graphical abstract: Amplitudes of chemically induced distortion modes in different ordered perovskites M 1/2 Bi 1/2 TiO 3 and visualisation of atomic displacements associated with distortion mode X + 1 in the 001-ordered compounds Li 1/2 Bi 1/2 TiO 3 and Cs 1/2 Bi 1/2 TiO 3 . Due to a substantial size mismatch between bismuth (green) and caesium (dark blue), incorporation of the latter leads to enhanced displacements of oxygen atoms (red) and suppresses displacements of titanium (silver) as compared to lithium (light blue) or other smaller monovalent cations. - Highlights: • Lead-free A-site mixed bismuth titanates M 1/2 Bi 1/2 TiO 3 are studied by first-principles calculations. • Investigation of chemical ordering tendency for M=Li, Na, K, Rb, Cs, Ag, and Tl. • Group theoretical analysis of different ordered structures. • Ag and Tl

Homogeneous M2 duals

International Nuclear Information System (INIS)

Figueroa-O’Farrill, José; Ungureanu, Mara

2016-01-01

Motivated by the search for new gravity duals to M2 branes with N>4 supersymmetry — equivalently, M-theory backgrounds with Killing superalgebra osp(N|4) for N>4 — we classify (except for a small gap) homogeneous M-theory backgrounds with symmetry Lie algebra so(n)⊕so(3,2) for n=5,6,7. We find that there are no new backgrounds with n=6,7 but we do find a number of new (to us) backgrounds with n=5. All backgrounds are metrically products of the form AdS 4 ×P 7 , with P riemannian and homogeneous under the action of SO(5), or S 4 ×Q 7 with Q lorentzian and homogeneous under the action of SO(3,2). At least one of the new backgrounds is supersymmetric (albeit with only N=2) and we show that it can be constructed from a supersymmetric Freund-Rubin background via a Wick rotation. Two of the new backgrounds have only been approximated numerically.

Homogeneous M2 duals

Energy Technology Data Exchange (ETDEWEB)

Figueroa-O’Farrill, José [School of Mathematics and Maxwell Institute for Mathematical Sciences,The University of Edinburgh,James Clerk Maxwell Building, The King’s Buildings, Peter Guthrie Tait Road,Edinburgh EH9 3FD, Scotland (United Kingdom); Ungureanu, Mara [Humboldt-Universität zu Berlin, Institut für Mathematik,Unter den Linden 6, 10099 Berlin (Germany)

2016-01-25

Motivated by the search for new gravity duals to M2 branes with N>4 supersymmetry — equivalently, M-theory backgrounds with Killing superalgebra osp(N|4) for N>4 — we classify (except for a small gap) homogeneous M-theory backgrounds with symmetry Lie algebra so(n)⊕so(3,2) for n=5,6,7. We find that there are no new backgrounds with n=6,7 but we do find a number of new (to us) backgrounds with n=5. All backgrounds are metrically products of the form AdS{sub 4}×P{sup 7}, with P riemannian and homogeneous under the action of SO(5), or S{sup 4}×Q{sup 7} with Q lorentzian and homogeneous under the action of SO(3,2). At least one of the new backgrounds is supersymmetric (albeit with only N=2) and we show that it can be constructed from a supersymmetric Freund-Rubin background via a Wick rotation. Two of the new backgrounds have only been approximated numerically.

Des-Lys58-beta 2m and native beta 2m in rheumatoid arthritis serum and synovial fluid

DEFF Research Database (Denmark)

Williams, R C; Malone, C C; Nissen, Mogens Holst

1995-01-01

-Lys58-beta 2m were found in 80% of 21 SF from RA patients and in 43% of 41 SF from other subjects with various forms of inflammatory arthritis. In RA and other disorders such as gout or pseudogout, levels of Des-Lys58-beta 2m were higher in synovial fluid than in serum during an acute episode...

Interpretation of Geological Correlation Borings 1, 2, 3 in the A/M Area of the Savannah River Site, South Carolina

International Nuclear Information System (INIS)

Wyatt, D.E.; Cumbest, R.J.; Aadland, R.K.; Syms, F.H.; Stephenson, D.E.; Sherrill, J.C.

1997-06-01

The Geophysical Correlation Boring (GCB) Program was organized to provide a comprehensive correlation capability between geological core and advanced borehole geophysical data, surface high resolution reflection seismic information and, when available, borehole geochemical and cone penetrometer data. This report provides results and initial geological interpretations of borings one, two, and three (GCB-1, GCB-2, GCB-3) located within the Upper Three Runs Watershed (A/M Area) of the Savannah River Site

Architecture of the human mTORC2 core complex.

Science.gov (United States)

Stuttfeld, Edward; Aylett, Christopher Hs; Imseng, Stefan; Boehringer, Daniel; Scaiola, Alain; Sauer, Evelyn; Hall, Michael N; Maier, Timm; Ban, Nenad

2018-02-09

The mammalian target of rapamycin (mTOR) is a key protein kinase controlling cellular metabolism and growth. It is part of the two structurally and functionally distinct multiprotein complexes mTORC1 and mTORC2. Dysregulation of mTOR occurs in diabetes, cancer and neurological disease. We report the architecture of human mTORC2 at intermediate resolution, revealing a conserved binding site for accessory proteins on mTOR and explaining the structural basis for the rapamycin insensitivity of the complex. © 2018, Stuttfeld et al.

Crystal structure of the high-affinity Na+K+-ATPase-ouabain complex with Mg2+ bound in the cation binding site.

Science.gov (United States)

Laursen, Mette; Yatime, Laure; Nissen, Poul; Fedosova, Natalya U

2013-07-02

The Na(+),K(+)-ATPase maintains electrochemical gradients for Na(+) and K(+) that are critical for animal cells. Cardiotonic steroids (CTSs), widely used in the clinic and recently assigned a role as endogenous regulators of intracellular processes, are highly specific inhibitors of the Na(+),K(+)-ATPase. Here we describe a crystal structure of the phosphorylated pig kidney Na(+),K(+)-ATPase in complex with the CTS representative ouabain, extending to 3.4 Å resolution. The structure provides key details on CTS binding, revealing an extensive hydrogen bonding network formed by the β-surface of the steroid core of ouabain and the side chains of αM1, αM2, and αM6. Furthermore, the structure reveals that cation transport site II is occupied by Mg(2+), and crystallographic studies indicate that Rb(+) and Mn(2+), but not Na(+), bind to this site. Comparison with the low-affinity [K2]E2-MgF(x)-ouabain structure [Ogawa et al. (2009) Proc Natl Acad Sci USA 106(33):13742-13747) shows that the CTS binding pocket of [Mg]E2P allows deep ouabain binding with possible long-range interactions between its polarized five-membered lactone ring and the Mg(2+). K(+) binding at the same site unwinds a turn of αM4, dragging residues Ile318-Val325 toward the cation site and thereby hindering deep ouabain binding. Thus, the structural data establish a basis for the interpretation of the biochemical evidence pointing at direct K(+)-Mg(2+) competition and explain the well-known antagonistic effect of K(+) on CTS binding.

Remaining Sites Verification Package for the 1607-B2 Septic System and 100-B-14:2 Sanitary Sewer System. Attachment to Waste Site Reclassification Form 2006-055 and 2004-006

International Nuclear Information System (INIS)

Dittmer, L.M.

2007-01-01

The 1607-B2 waste site is a former septic system associated with various 100-B facilities, including the 105-B, 108-B, 115-B/C, and 185/190-B buildings. The site was evaluated based on confirmatory results for feeder lines within the 100-B-14:2 subsite and determined to require remediation. The 1607-B2 waste site has been remediated to achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

The role of the lysyl binding site of tissue-type plasminogen activator in the interaction with a forming fibrin clot

NARCIS (Netherlands)

Bakker, A.H.F.; Weening-Verhoeff, E.J.D.; Verheijen, J.H.

1995-01-01

To describe the role of the lysyl binding site in the interaction of tissue-type plasminogen activator (t-PA, FGK1K2P) with a forming fibrin clot, we performed binding experiments with domain deletion mutants GK1K2P, K2P, and the corresponding point mutants lacking the lysyl binding site in the

An allostatic mechanism for M2 pyruvate kinase as an amino-acid sensor.

Science.gov (United States)

Yuan, Meng; McNae, Iain W; Chen, Yiyuan; Blackburn, Elizabeth A; Wear, Martin A; Michels, Paul A M; Fothergill-Gilmore, Linda A; Hupp, Ted; Walkinshaw, Malcolm D

2018-05-10

We have tested the effect of all 20 proteinogenic amino acids on the activity of the M2 isoenzyme of pyruvate kinase (M2PYK) and show that within physiologically relevant concentrations, phenylalanine, alanine, tryptophan, methionine, valine, and proline act as inhibitors while histidine and serine act as activators. Size exclusion chromatography has been used to show that all amino acids, whether activators or inhibitors, stabilise the tetrameric form of M2PYK. In the absence of amino-acid ligands an apparent tetramer-monomer dissociation K d is estimated to be ~0.9 µM with a slow dissociation rate (t 1/2 ~ 15 min). X-ray structures of M2PYK complexes with alanine, phenylalanine, and tryptophan show the M2PYK locked in an inactive T-state conformation, while activators lock the M2PYK tetramer in the active R-state conformation. Amino-acid binding in the allosteric pocket triggers rigid body rotations (11°) stabilising either T or R-states. The opposing inhibitory and activating effects of the non-essential amino acids serine and alanine suggest that M2PYK could act as a rapid-response nutrient sensor to rebalance cellular metabolism. This competition at a single allosteric site between activators and inhibitors provides a novel regulatory mechanism by which M2PYK activity is finely tuned by the relative (but not absolute) concentrations of activator and inhibitor amino acids. Such 'allostatic' regulation may be important in metabolic reprogramming and influencing cell fate. ©2018 The Author(s).

Luminescence properties of red-emitting M2Si5N8:Eu2+ (M = Ca, Sr, Ba) LED conversion phosphors

NARCIS (Netherlands)

Li, Y.Q.; Steen, van J.E.J.; Krevel, van J.W.H.; Botty, G.; Delsing, A.C.A.; DiSalvo, F.J.; With, de G.; Hintzen, H.T.J.M.

2006-01-01

The influence of the type of the alkaline-earth ion and the Eu2+ concentration on the luminescence properties of Eu2+-doped M2Si5N8 (M = Ca, Sr, Ba) has been investigated. XRD analysis shows that Eu2+-doped Ca2Si5N8 forms a limited solid solution with a maximum solubility of about 7 mol% having a

Direct fabrication of 238PuO2 fuel forms

International Nuclear Information System (INIS)

Burney, G.A.; Congdon, J.W.

1982-07-01

The current process for the fabrication of 238 PuO 2 heat sources includes precipitation of small particle plutonium oxalate crystals (4 to 6 μm diameter), a calcination to PuO 2 , ball milling, cold pressing, granulation (60 to 125 μm), and granule sintering prior to hot pressing the fuel pellet. A new two-step direct-strike Pu(III) oxalate precipitation method which yields mainly large well-developed rosettes (50 to 100 μm diameter) has been demonstrated in the laboratory and in the plant. These large rosettes are formed by agglomeration of small (2 to 4 μm) crystals, and after calcining and sintering, were directly hot pressed into fuel forms, thus eliminating several of the powder conditioning steps. Conditions for direct hot pressing of the large heat-treated rosettes were determined and a full-scale General Purpose Heat Source pellet was fabricated. The pellet had the desired granule-type microstructure to provide dimensional stability at high temperature. 27 figures

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

Science.gov (United States)

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p

The Shallow Subsurface Geological Structures at the Chang'E-3 Landing Site Based on Lunar Penetrating Radar Channel-2B Data

Science.gov (United States)

Zhao, N.; Zhu, P.; Yuan, Y.; Yang, K.; Xiao, L.; Xiao, Z.

2014-12-01

The Lunar Penetrating Radar (LPR) carried by the Yutu rover of the Chinese Chang'E-3 mission has detected the shallow subsurface structures for the landing site at the northern Mare Imbrium. The antenna B of the LPR Channel-2 has collected more than 2000 traces of usable raw data. We performed calibration on the LPR data including amplitude compensation, filtering, and deconvolution. The processed results reveal that the shallow subsurface of the landing site can be divided into three major layers whose thicknesses are ~1, ~3, and 2-7 m, respectively. Variations occur on the thickness of each layer at different locations. Considering the geological background of the landing site, we interpret that the first layer is the regolith layer accumulated over ~80 Ma since the formation of the 450 m diameter Chang'E A crater. This regolith layer was formed on the basis of the ejecta deposits of Chang'E A. The second layer is the remnant continuous ejecta deposits from the Chang'E A crater, which is thicker closer to the crater rim and thinning outwardly. The Chang'E A crater formed on a paleo-regolith layer over the Eratosthenian basalts, which represents the third layer detected by the Channel 2B of the LPR.

National inventory of uranium mine sites. Version 2 - September 2007. Realised in the framework of the M.I.M.A.U.S.A. program Memory and impact of Uranium Mines: synthesis and archives; Inventaire national des sites miniers d'uranium. Version 2 - Septembre 2007. Realise dans le cadre du programme MIMAUSA Memoire et Impact des Mines d'urAniUm: Synthese et Archives

Energy Technology Data Exchange (ETDEWEB)

NONE

2007-07-01

The M.I.M.A.U.S.A. program allows to end in a compilation and a synthesis of the available data to allow the I.R.S.N., the national and local authorities, but also the public to have a source of quality information about the history of the French uranium mining sites and the possible systems of radiological surveillance set up at the moment; To assure the perpetuity of the knowledge of these sites in spite of the stop of the concerned activities; To establish a working tool for the government services in charge of the definition of the refitting and surveillance programs; And to improve the representativeness of the national network of radiation monitoring in the environment, notably as regards the stations of measure exploited by the I.R.S.N..The M.I.M.A.U.S.A. inventory or the national inventory of the uranium mining sites in France consists of the most exhaustive possible inventory of the sites on which were practised the activities in connection with the exploration (works of recognition of significant scale, the extraction or the treatment of the uranium ore in metropolitan France. The acquired information is synthesized in the form of index cards of sites presented in this document, with in introduction, the manual of the reserved columns and the used terms. The present version follows upon a first version published in 2004. The novelties of the version 2007: a more exhaustive inventory, 30 sites were added, enriched and corrected information, more complete identification of the receiving rivers, more precise and accessible geographical localization, zoom-news on certain mining zones, a paragraph current events. The sources of information are: Areva-Nc, A.N.D.R.A., D.R.I.R.E., and A.S.N.. (N.C.)

Growth kinetics of boride coatings formed at the surface AISI M2 during dehydrated paste pack boriding

Energy Technology Data Exchange (ETDEWEB)

Doñu Ruiz, M.A., E-mail: mdonur0800@alumno.ipn.mx [Universidad Politécnica del Valle de México UPVM, Grupo Ciencia e Ingeniería de Materiales, Av. Mexiquense S/N Esquina Av. Universidad Politécnica, Col Villa Esmeralda, 54910 Tultitlan (Mexico); López Perrusquia, N.; Sánchez Huerta, D. [Universidad Politécnica del Valle de México UPVM, Grupo Ciencia e Ingeniería de Materiales, Av. Mexiquense S/N Esquina Av. Universidad Politécnica, Col Villa Esmeralda, 54910 Tultitlan (Mexico); Torres San Miguel, C.R.; Urriolagoitia Calderón, G.M. [Instituto Politécnico Nacional, SEPI-ESIME, Unidad Profesional Adolfo López Mateos Zacatenco, Edificio 5, 2do. Piso, Col. Lindavista, CP 07738 México, D.F. (Mexico); Cerillo Moreno, E.A. [Universidad Politécnica del Valle de México UPVM, Grupo Ciencia e Ingeniería de Materiales, Av. Mexiquense S/N Esquina Av. Universidad Politécnica, Col Villa Esmeralda, 54910 Tultitlan (Mexico); Cortes Suarez, J.V. [Univerisdad Autónoma Metropolitana Unidad Azcapotzalco, Av. San Pablo 180 Azcapotzalco 02200, Área de Ciencia de los Materiales, México, D.F. (Mexico)

2015-12-01

The growth kinetics of the boride coatings (FeB and Fe{sub 2}B) at the surface of AISI M2 high speed steels were studied in this work. Boriding thermochemical treatment was carried out by dehydrated paste pack at three different temperatures 1173, 1223, and 1273 K and four exposure times 1, 3, 5, and 7 h, respectively. The presence of FeB and Fe{sub 2}B phases was identified by scanning electron microscopy with energy dispersive spectroscopy (SEM-EDS) and X-ray diffraction method. In order to obtain the boron diffusion coefficients at the FeB/Fe{sub 2}B boride coatings, a mathematical model based on the mass balance at the growing interfaces was proposed under certain assumptions. Likewise the parabolic growth constants and the boride incubation time were established as a function of the parameters η (T) and ε (T). The activation energy values estimated for the FeB and Fe{sub 2}B layers were 233.42 and 211.89 kJ mol{sup −1} respectively. A good agreement was obtained between the simulated values of boride layer thicknesses and the experimental results. Finally, empirical relationships of boride coating thickness as a function of boriding temperature and time are presented. - Highlights: • Formed boride coatings at the surface of AISI M2 high speed steels by new process dehydrated paste pack boriding. • The model was based on the mass balance equation at the FeB/Fe{sub 2}B and Fe{sub 2}B/Fe interfaces by considering the boride incubation time. • A good agreement was obtained between the simulated values of boride layers coatings and the experimental results.

Engineering evaluation of a formerly utilized MED/AEC site. Site A and Plot M, Palos Forest Preserve, Palos Park, Illinois

International Nuclear Information System (INIS)

1979-09-01

This engineering evaluation report (EER) addresses one of these MED/AEC sites known as Site A/Plot M, located in Palos Park, Illinois. The EER describes in technical detail a number of options for remedial action that could be taken with respect to the contamination at Site A/Plot M and presents estimates of the costs associated with these options. A companion document, Environmental Analysis Report on a Formerly Utilized MED/AEC Site, Site A and Plot M, Palos Forest Preserve, Palos Park, Illinois (ANL/ES-79), has also been prepared. It describes in detail the existing site environment and evaluates the environmental impacts of the various remedial options discussed in this report. This EER contributes to a better understanding of the mitigation or resolution of environmental problems posed by the subject MED/AEC site and serves as a basis for determining whether or not remedial actions are warranted. The knowledge derived from the evaluation of a number of remedial options should be helpful in the final disposition of other MED/AEC sites located elsewhere

The CrIIL reduction of [2Fe-2S] ferredoxins and site of attachment of CrIII using 1H NMR and site-directed mutagenesis.

Science.gov (United States)

Im, S C; Worrall, J A; Liu, G; Aliverti, A; Zanetti, G; Luchinat, C; Bertini, I; Sykes, A G

2000-04-17

The recently reported NMR solution structure of FeIIIFeIII parsley FdI has made possible 2D NOESY NMR studies to determine the point of attachment of CrIIIL in FeIIIFeIII...CrIIIL. The latter Cr-modified product was obtained by reduction of FeIIIFeIII parsley and spinach FdI forms with [Cr(15-aneN4) (H2O)2]2+ (15-aneN4 = 1,4,8,12-tetraazacyclopentadecane), referred to here as CrIIL, followed by air oxidation and chromatographic purification. From a comparison of NMR cross-peak intensities of native and Cr-modified proteins, two surface sites designated A and B, giving large paramagnetic CrIIIL broadening of a number of amino acid peaks, have been identified. The effects at site A (residues 19-22, 27, and 30) are greater than those at site B (residues 92-94 and 96), which is on the opposite side of the protein. From metal (ICP-AES) and electrospray ionization mass spectrometry (EIMS) analyses on the Cr-modified protein, attachment of a single CrIIIL only is confirmed for both parsley and spinach FdI and FdII proteins. Electrostatic interaction of the 3+ CrIIIL center covalently attached to one protein molecule (charge approximately -18) with a second (like) molecule provides an explanation for the involvement of two regions. Thus for 3-4 mM FeIIIFeIII...CrIIIL solutions used in NMR studies (CrIIIL attached at A), broadening effects due to electrostatic interactions at B on a second molecule are observed. Experiments with the Cys18Ala spinach FdI variant have confirmed that the previously suggested Cys-18 at site A is not the site of CrIIIL attachment. Line broadening at Val-22 of A gives the largest effect, and CrIIIL attachment at one or more adjacent (conserved) acidic residues in this region is indicated. The ability of CrIIL to bind in some (parsley and spinach) but not all cases (Anabaena variabilis) suggests that intramolecular H-bonding of acidic residues at A is relevant. The parsley and spinach FeIIFeIII...CrIIIL products undergo a second stage of reduction

New Layered Oxide-Fluoride Perovskites: KNaNbOF5 and KNaMO2F4 (M = Mo6+, W6+

Directory of Open Access Journals (Sweden)

Rachelle Ann F. Pinlac

2011-03-01

Full Text Available KNaNbOF5 and KNaMO2F4 (M = Mo6+, W6+, three new layered oxide-fluoride perovskites with the general formula ABB’X6, form from the combination of a second-order Jahn-Teller d0 transition metal and an alkali metal (Na+ on the B-site. Alternating layers of cation vacancies and K+ cations on the A-site complete the structure. The K+ cations are found in the A-site layer where the fluoride ions are located. The A-site is vacant in the adjacent A-site layer where the axial oxides are located. This unusual layered arrangement of unoccupied A-sites and under bonded oxygen has not been observed previously although many perovskite-related structures are known.

M-area basin closure-Savannah River Site

International Nuclear Information System (INIS)

McMullin, S.R.; Horvath, J.G.

1991-01-01

M-Area, on the Savannah River Site, processes raw materials and manufactures fuel and target rods for reactor use. Effluent from these processes were discharged into the M-Area settling basin and Lost Lake, a natural wetland. The closure of this basin began in 1988 and included the removal and stabilization of basin fluids, excavation of all contaminated soils from affected areas and Lost Lake, and placement of all materials in the bottom of the emptied basin. These materials were covered with a RCRA style cap, employing redundant barriers of kaolin clay and geosynthetic material. Restoration of excavated uplands and wetlands is currently underway

One Gene and Two Proteins: a Leaderless mRNA Supports the Translation of a Shorter Form of the Shigella VirF Regulator

Directory of Open Access Journals (Sweden)

Maria Letizia Di Martino

2016-11-01

Full Text Available VirF, an AraC-like activator, is required to trigger a regulatory cascade that initiates the invasive program of Shigella spp., the etiological agents of bacillary dysentery in humans. VirF expression is activated upon entry into the host and depends on many environmental signals. Here, we show that the virF mRNA is translated into two proteins, the major form, VirF30 (30 kDa, and the shorter VirF21 (21 kDa, lacking the N-terminal segment. By site-specific mutagenesis and toeprint analysis, we identified the translation start sites of VirF30 and VirF21 and showed that the two different forms of VirF arise from differential translation. Interestingly, in vitro and in vivo translation experiments showed that VirF21 is also translated from a leaderless mRNA (llmRNA whose 5′ end is at position +309/+310, only 1 or 2 nucleotides upstream of the ATG84 start codon of VirF21. The llmRNA is transcribed from a gene-internal promoter, which we identified here. Functional analysis revealed that while VirF30 is responsible for activation of the virulence system, VirF21 negatively autoregulates virF expression itself. Since VirF21 modulates the intracellular VirF levels, this suggests that transcription of the llmRNA might occur when the onset of the virulence program is not required. We speculate that environmental cues, like stress conditions, may promote changes in virF mRNA transcription and preferential translation of llmRNA.

Surveillance of Site A and Plot M, Report for 2009.

Energy Technology Data Exchange (ETDEWEB)

Golchert, N. W.

2010-04-21

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for Calendar Year 2009 are presented. Based on the results of the 1976-1978 radiological characterization of the site, a determination was made that a surveillance program be established. The characterization study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand-pumped picnic wells. The current surveillance program began in 1980 and consists of sample collection and analysis of surface and subsurface water. The results of the analyses are used to monitor the migration pathway of hydrogen-3 contaminated water from the burial ground (Plot M) to the hand-pumped picnic wells and monitor for the presence of radioactive materials in the environment of the area. Hydrogen-3 in the Red Gate Woods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Hydrogen-3 continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site, using the picnic area, or living in the vicinity.

Surveillance of Site A and Plot M report for 2010.

Energy Technology Data Exchange (ETDEWEB)

Golchert, N. W. (ESQ)

2011-05-31

The results of the environmental surveillance program conducted at Site A/Plot M in the Palos Forest Preserve area for Calendar Year 2010 are presented. Based on the results of the 1976-1978 radiological characterization of the site, a determination was made that a surveillance program be established. The characterization study determined that very low levels of hydrogen-3 (as tritiated water) had migrated from the burial ground and were present in two nearby hand-pumped picnic wells. The current surveillance program began in 1980 and consists of sample collection and analysis of surface and subsurface water. The results of the analyses are used to monitor the migration pathway of hydrogen-3 contaminated water from the burial ground (Plot M) to the hand-pumped picnic wells and monitor for the presence of radioactive materials in the environment of the area. Hydrogen-3 in the Red Gate Woods picnic wells was still detected this year, but the average and maximum concentrations were significantly less than found earlier. Hydrogen-3 continues to be detected in a number of wells, boreholes, dolomite holes, and a surface stream. Analyses since 1984 have indicated the presence of low levels of strontium-90 in water from a number of boreholes next to Plot M. The results of the surveillance program continue to indicate that the radioactivity remaining at Site A/Plot M does not endanger the health or safety of the public visiting the site, using the picnic area, or living in the vicinity.

Discovery of New Coronal Lines at 2.843 and 2.853 μm

Science.gov (United States)

Samra, Jenna E.; Judge, Philip G.; DeLuca, Edward E.; Hannigan, James W.

2018-04-01

Two new emission features were observed during the 2017 August 21 total solar eclipse by a novel spectrometer, the Airborne Infrared Spectrometer (AIR-Spec), flown at 14.3 km altitude aboard the NCAR Gulfstream-V aircraft. We derive wavelengths in air of 2.8427 ± 0.00009 μm and 2.8529 ± 0.00008 μm. One of these lines belongs to the 3{{{p}}}53{{d}}{}3{{{F}}}3^\\circ \\to 3{{{p}}}53{{d}}{}3{{{F}}}4^\\circ transition in Ar-like Fe IX. This appears to be the first detection of this transition from any source. Minimization of residual wavelength differences using both measured wavelengths, together with National Institute of Standards and Technology (NIST) extreme ultraviolet wavelengths, does not clearly favor assignment to Fe IX. However, the shorter wavelength line appears more consistent with other observed features formed at similar temperatures to Fe IX. The transition occurs between two levels within the excited 3{{{p}}}53{{d}} configuration, 429,000 cm‑1 above the ground level. The line is therefore absent in photo-ionized coronal-line astrophysical sources such as the Circinus Galaxy. Data from a Fourier transform interferometer (FTIR) deployed from Wyoming show that both lines are significantly attenuated by telluric H2O, even at dry sites. We have been unable to identify the longer wavelength transition.

[sup 99m]Tc-RBC subtraction scintigraphy; Assessmet of bleeding site and rate

Energy Technology Data Exchange (ETDEWEB)

Inagaki, Syoichi; Tonami, Syuichi; Yasui, Masakazu; Kuranishi, Makoto; Sugishita, Kouki; Nakamura, Mamoru (Toyama Medical and Pharmaceutical Univ. (Japan). Hospital)

1994-03-01

Sequential abdominal scintigrams with [sup 99m]Tc-labelled red blood cells (RBC) were subtracted for observing a site of gastrointestinal bleeding and calculating the bleeding rate. This method is technically very easy and can detect the site of bleeding with the minimum rate, as low as 0.2 ml/min., in a phantom experiment. In 23 cases with final diagnosis of gastrointestinal bleeding, conventional non-subtraction scintigraphy detected only 30% (7/23), but subtraction scintigraphy detected 61% (14/23). It was concluded that subtraction scintigraphy had higher sensitivity than conventional scintigraphy for early diagnosing bleeding. A combination of non-subtraction and subtraction scintigraphy is recommended to detect a site of gastrointestinal bleeding in a clinical setting. (author).

Remaining Sites Verification Package for the 100-F-44:2, Discovery Pipeline Near 108-F Building. Attachment to Waste Site Reclassification Form 2007-006

International Nuclear Information System (INIS)

Capron, J.M.

2008-01-01

The 100-F-44:2 waste site is a steel pipeline that was discovered in a junction box during confirmatory sampling of the 100-F-26:4 pipeline from December 2004 through January 2005. The 100-F-44:2 pipeline feeds into the 100-F-26:4 subsite vitrified clay pipe (VCP) process sewer pipeline from the 108-F Biology Laboratory at the junction box. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

A Trp474Cys mutation in the alpha-subunit of beta-hexosaminidase causes a subacute encephalopathic form of G{sub M2} gangliosidosis, type 1

Energy Technology Data Exchange (ETDEWEB)

Petroulakis, E.; Cao, Z.; Salo, T. [Univ. of Manitoba, Winnipeg (Canada)] [and others

1994-09-01

Mutations in the HEXA gene that encodes the {alpha}-subunit of the heterodimeric lysosomal enzyme {beta}-hexosaminidase A, or Hex A ({alpha}{beta}), cause G{sub M2} gangliosidosis, type 1. The infantile form (Tay-Sachs disease) results when there is no residual Hex A activity, while less severe and more variable clinical phenotypes result when residual Hex A activity is present. A non-Jewish male who presented with an acute psychotic episode at age 16 was diagnosed with a subacute encephalopathic form of G{sub M2} gangliosidosis. At age 19, chronic psychosis with intermittent acute exacerbations remains the most disabling symptom in this patient and his affected brother although both exhibit some ataxia and moderately severe dysarthria. We have found a 4 bp insertion (+TATC 1278) associated with infantile Tay-Sachs disease on one allele; no previously identified mutation was found on the second allele. SSCP analysis detected a shift in exon 13 and sequencing revealed a G1422C mutation in the second allele that results in a Trp474Cys substitution. The presence of the mutation was confirmed by the loss of HaeIII and ScrFI sites in exon 13 PCR products from the subjects and their father. The mutation was introduced into the {alpha}-subunit cDNA and Hex S ({alpha}{alpha}) and Hex A ({alpha}{beta}) were transiently expressed in monkey COS-7 cells. The Trp474Cys mutant protein had approximately 5% and 12% of wild-type Hex S and Hex A activity, respectively. Western blot analysis revealed a small amount of residual mature {alpha}-subunit and a normal level of precursor protein. We conclude that the Trp474Cys mutation is the cause of the Hex A deficiency associated with a subacute (juvenile-onset) phenotype in this patient. Like other mutations in exon 13 of HEXA, it appears to affect intracellular processing. Studies of the defect in intracellular processing are in progress.

Sodium 2-mercaptoethanesulfonate monohydrate (coenzyme M sodium salt monohydrate

Directory of Open Access Journals (Sweden)

Stefan Mayr

2008-11-01

Full Text Available The 2-thioethanesulfonate anion is the smallest known coenzyme in nature (HS–CoM and plays a key role in methanogenesis by anaerobic archaea, as well as in the oxidation of alkenes by Gram-negative and Gram-positive eubacteria. The title compound, Na+·C2H5O3S2−·H2O, is the Na+ salt of HS–CoM crystallized as the monohydrate. Six O atoms form a distorted octahedral coordination geometry around the Na atom, at distances in the range 2.312 (4–2.517 (3 Å. Two O atoms of the sulfonate group, one O atom of each of three other symmetry-related sulfonate groups plus the water O atom form the coordination environment of the Na+ ion. This arrangement forms Na–O–Na layers in the crystal structure, parallel to (100.

Structural Basis for Polypyrimidine Tract Recognition by the Essential Pre-mRNA Splicing Factor U2AF65

International Nuclear Information System (INIS)

Sickmier, E.; Frato, K.; Shen, H.; Paranawithana, S.; Green, M.; Kielkopf, C.

2006-01-01

The essential pre-mRNA splicing factor, U2AF 65 , guides the early stages of splice site choice by recognizing a polypyrimidine (Py)-tract consensus sequence near the 3'-splice site. Since Py-tracts are relatively poorly conserved in higher eukaryotes, U2AF 65 is faced with the problem of specifying uridine-rich sequences, yet tolerating a variety of nucleotide substitutions found in natural Py-tracts. To better understand these apparently contradictory RNA binding characteristics, the X-ray structure of the U2AF 65 RNA binding domain bound to a Py-tract composed of seven uridines has been determined at 2.5Angstroms resolution. Specific hydrogen bonds between U2AF 65 and the uracil bases provide an explanation for polyuridine recognition. Flexible sidechains and bound water molecules form the majority of the base contacts, and potentially could rearrange when the U2AF 65 structure adapts to different Py-tract sequences. The energetic importance of conserved residues for Py-tract binding is established by analysis of site-directed mutant U2AF 65 proteins using surface plasmon resonance

Comparison of long-term stability of containment systems for residues and wastes contaminated with naturally occurring radionuclides at an arid site and two humid sites

International Nuclear Information System (INIS)

Winters, M.; Merry-Libby, P.; Hinchman, R.

1985-01-01

The long-term stability of near-surface containment systems designed for the management of radioactive wastes and residues contaminated with naturally occurring radionuclides are compared at the three different sites. The containment designs are: (1) a diked 8.9-m high mound, including a 3.2-m layered cap at a site (humid) near Lewiston, New York, (2) a 6.8-m-high mound, including a similar 3.2-m cap at a site (humid) near Oak Ridge, Tennessee, and (3) 4.8-m deep trenches with 3.0-m backfilled caps at a site (arid) near Hanford, Washington. Geological, hydrological, and biological factors affecting the long-term (1000-year) integrity of the containment systems at each site are examined, including: erosion, flooding, drought, wildfire, slope and cover failure, plant root penetration, burrowing animals, other soil-forming processes, and land-use changes. For the containment designs evaluated, releases of radon-222 at the arid site are predicted to be several orders of magnitude higher than at the two humid sites - upon initial burial and at 1000 years (after severe erosion). Transfer of wastes containing naturally occurring radionuclides from a humid to an arid environment offers little or no advantage relative to long-term stability of the containment system and has a definite disadvantage in terms of gaseous radioactive releases. 26 references, 3 figures, 4 tables

Out-of-equilibrium nanocrystalline R1-s(Fe,M)5+2s alloys (R=Sm,Pr; M=Co,Si,Ga)

International Nuclear Information System (INIS)

Bessais, L.; Djega-Mariadassou, C.

2005-01-01

The out-of-equilibrium hexagonal P6/mmm R 1-s (Fe,M) 5+2s (R=Sm,Pr and M=Co, Si or Ga) intermetallics are obtained by controlled nanocrystallization. A model is presented to explain the structure of the hexagonal phases, which stoichiometry is consistent with Sm(Fe,M) 9 and R(Fe,Ti,Co) 10 . The Curie temperatures increase versus Ga, Si, Co content. The analysis of the Moessbauer spectra leads to monotonous variation of the hyperfine parameters. The refinement of the Moessbauer spectra was performed on the basis of the correlation between Wigner-Seitz cell volumes obtained from X-ray diffraction results and isomer shifts. The abundance of each magnetic site was calculated by the multinomial distribution law. For a given substituting Co, Si, Ga content, the sequence for the isomer shift in the hexagonal cell is 2e>3g>6l. With increasing M content, the isomer shift of the 3g site remains quasi-constant. Those approaches lead to the location of Si, Ga, Co in 3g site, Ti in 6l site. (copyright 2005 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Peculiarities of the intermediate valence state of Ce in CeM2Si2 (M = Fe, Co, Ni) compounds

International Nuclear Information System (INIS)

Koterlyn, M.; Shcherba, I.; Yasnitskii, R.; Koterlyn, G.

2007-01-01

The results of thermoelectric power and the electrical resistivity measurements connected with the intermediate valence (IV) of Ce are presented for the compounds CeM 2 Si 2 (M = Fe, Co, Ni) in the temperature range of 4-800 K. It is shown that CeM 2 Si 2 are Kondo-lattices with the coherence scale T coh ∼ 60-80 K and the so-called single-site Kondo temperature T K ∼ 10 3 K. On the example of CeNi 2 Si 2 we have studied the changes in the structure of density of f states (f-DOS) near the Fermi energy caused by atomic substitutions. The results of structural, transport, magnetic, and Ce L III X-ray absorption spectra measurements in the series Ce 1-x La x Ni 2 Si 2 (0 ≤ x ≤ 0.6), Ce(Ni 1-y Cu y ) 2 Si 2 (0 ≤ y ≤ 0.6) and CeNi 2 (Si 1-z Ge z ) 2 (0 ≤ z ≤ 0.5) are presented. We found that the IV state of Ce in the CeM 2 Si 2 is an evidence of possible opening a wide pseudogap Δ ∼ kT K within the f-DOS structure slightly above the Fermi energy

Site enforcement tracking system (SETS): PRP listing by site for region 2

International Nuclear Information System (INIS)

1993-04-01

When expending Superfund monies at a CERCLA (Comprehensive Environmental Response, Compensation and Liability Act) site, EPA must conduct a search to identify parties with potential financial responsibility for remediation of uncontrolled hazardous waste sites. EPA regional Superfund Waste Management Staff issue a notice letter to the potentially responsible party (PRP). Data from the notice letter is used to form the Site Enforcement Tracking System (SETS). The data includes PRP name and address, a company contact person, the date the notice was issued, and the related CERCLA site name and identification number

Distinct kinetics and mechanisms of mZVI particles aging in saline and fresh groundwater: H2 evolution and surface passivation.

Science.gov (United States)

Xin, Jia; Tang, Fenglin; Zheng, Xilai; Shao, Haibing; Kolditz, Olaf; Lu, Xin

2016-09-01

Application of microscale zero-valent iron (mZVI) is a promising technology for in-situ contaminated groundwater remediation; however, its longevity is negatively impacted by surface passivation, especially in saline groundwater. In this study, the aging behavior of mZVI particles was investigated in three media (milli-Q water, fresh groundwater and saline groundwater) using batch experiments to evaluate their potential corrosion and passivation performance under different field conditions. The results indicated that mZVI was reactive for 0-7 days of exposure to water and then gradually lost H2-generating capacity over the next hundred days in all of the tested media. In comparison, mZVI in saline groundwater exhibited the fastest corrosion rate during the early phase (0-7 d), followed by the sharpest kinetic constant decline in the latter phases. The SEM-EDS and XPS analyses demonstrated that in the saline groundwater, a thin and compact oxide film was immediately formed on the surface and significantly shielded the iron reactive site. Nevertheless, in fresh groundwater and milli-Q water, a passive layer composed of loosely and unevenly distributed precipitates slowly formed, with abundant reactive sites available to support continuous iron corrosion. These findings provide insight into the molecular-scale mechanism that governs mZVI passivation and provide implications for long-term mZVI application in saline contaminated groundwater. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effectiveness of corporate employment web sites: How content and form influence intentions to apply

NARCIS (Netherlands)

van Birgelen, M.J.H.; Wetzels, M.G.M.; van Dolen, W.M.

2008-01-01

Purpose - Although research is emerging, the knowledge base on the evaluative determinants of the effectiveness of corporate employment web sites is still limited. This paper attempts to narrow this gap by investigating how potential job applicants' evaluations of web site content- and form-related

Photoelectron spectroscopy and density functional theory studies of (FeS)mH- (m = 2-4) cluster anions: effects of the single hydrogen.

Science.gov (United States)

Yin, Shi; Bernstein, Elliot R

2017-12-20

Single hydrogen containing iron hydrosulfide cluster anions (FeS) m H - (m = 2-4) are studied by photoelectron spectroscopy (PES) at 3.492 eV (355 nm) and 4.661 eV (266 nm) photon energies, and by Density Functional Theory (DFT) calculations. The structural properties, relative energies of different spin states and isomers, and the first calculated vertical detachment energies (VDEs) of different spin states for these (FeS) m H - (m = 2-4) cluster anions are investigated at various reasonable theory levels. Two types of structural isomers are found for these (FeS) m H - (m = 2-4) clusters: (1) the single hydrogen atom bonds to a sulfur site (SH-type); and (2) the single hydrogen atom bonds to an iron site (FeH-type). Experimental and theoretical results suggest such available different SH- and FeH-type structural isomers should be considered when evaluating the properties and behavior of these single hydrogen containing iron sulfide clusters in real chemical and biological systems. Compared to their related, respective pure iron sulfur (FeS) m - clusters, the first VDE trend of the diverse type (FeS) m H 0,1 - (m = 1-4) clusters can be understood through (1) the different electron distribution properties of their highest singly occupied molecular orbital employing natural bond orbital analysis (NBO/HSOMO), and (2) the partial charge distribution on the NBO/HSOMO localized sites of each cluster anion. Generally, the properties of the NBO/HSOMOs play the principal role with regard to the physical and chemical properties of all the anions. The change of cluster VDE from low to high is associated with the change in nature of their NBO/HSOMO from a dipole bound and valence electron mixed character, to a valence p orbital on S, to a valence d orbital on Fe, and to a valence p orbital on Fe or an Fe-Fe delocalized valence bonding orbital. For clusters having the same properties for NBO/HSOMOs, the partial charge distributions at the NBO/HSOMO localized sites additionally

A new crystal form of Aspergillus oryzae catechol oxidase and evaluation of copper site structures in coupled binuclear copper enzymes.

Science.gov (United States)

Penttinen, Leena; Rutanen, Chiara; Saloheimo, Markku; Kruus, Kristiina; Rouvinen, Juha; Hakulinen, Nina

2018-01-01

Coupled binuclear copper (CBC) enzymes have a conserved type 3 copper site that binds molecular oxygen to oxidize various mono- and diphenolic compounds. In this study, we found a new crystal form of catechol oxidase from Aspergillus oryzae (AoCO4) and solved two new structures from two different crystals at 1.8-Å and at 2.5-Å resolutions. These structures showed different copper site forms (met/deoxy and deoxy) and also differed from the copper site observed in the previously solved structure of AoCO4. We also analysed the electron density maps of all of the 56 CBC enzyme structures available in the protein data bank (PDB) and found that many of the published structures have vague copper sites. Some of the copper sites were then re-refined to find a better fit to the observed electron density. General problems in the refinement of metalloproteins and metal centres are discussed.

A new crystal form of Aspergillus oryzae catechol oxidase and evaluation of copper site structures in coupled binuclear copper enzymes.

Directory of Open Access Journals (Sweden)

Leena Penttinen

Full Text Available Coupled binuclear copper (CBC enzymes have a conserved type 3 copper site that binds molecular oxygen to oxidize various mono- and diphenolic compounds. In this study, we found a new crystal form of catechol oxidase from Aspergillus oryzae (AoCO4 and solved two new structures from two different crystals at 1.8-Å and at 2.5-Å resolutions. These structures showed different copper site forms (met/deoxy and deoxy and also differed from the copper site observed in the previously solved structure of AoCO4. We also analysed the electron density maps of all of the 56 CBC enzyme structures available in the protein data bank (PDB and found that many of the published structures have vague copper sites. Some of the copper sites were then re-refined to find a better fit to the observed electron density. General problems in the refinement of metalloproteins and metal centres are discussed.

New members of the A2 M ‧ M2″ structure family (A=Ca, Sr, Yb, La; M ‧ = In , Sn , Pb; M ″ = Si , Ge)

Science.gov (United States)

Jehle, Michael; Dürr, Ines; Fink, Saskia; Lang, Britta; Langenmaier, Michael; Steckhan, Julia; Röhr, Caroline

2015-01-01

The new mixed tetrelides Sr2PbGe2 and Yb2SnGe2, several mixed Ca/Sr (AII) germanides A2II (Sn, Pb)Ge2 and two polymorphs of La2 InSi2 represent new members of the general structure family of ternary alkaline-earth/lanthanoid main group silicides/germanides A2 M ‧ M2″ (M ‧ = In , Sn , Pb ; M ″ = Si , Ge). All compounds were synthesized from melts of the elements and their crystal structures have been determined by means of single crystal X-ray diffraction. Sr2PbGe2 (Cmmm, a=402.36(11), b=1542.3(4), c=463.27(10) pm) crystallizes with the Mn2AlB2 -type structure. In exhibiting infinite planar Ge zig-zag chains, it represents one border of the compound series. The other borderline case, where only [Ge2 ] dumbbells are left as Ge building units, is represented by the Ca/Yb tin germanides Ca2SnGe2 and Yb2SnGe2 (Mo2FeB2 -type; P4/mbm, a=748.58(13)/740.27(7), c=445.59(8)/435.26(5) pm). In between these two border structures compounds with variable Si/Ge chain lengths could be obtained by varying the averaged size of the AII cations: Ca0.45Sr1.55PbGe2 (new structure type; Pbam, a=791.64(5), b=2311.2(2), c=458.53(3) pm) contains planar six-membered chain segments [Ge6 ]. Tetrameric pieces [Ge4 ] are the conspicuous structure elements in Ca1.16Sr0.84SnGe2 and La2 InSi2 (La2InNi2 -type; Pbam, a=781.01(2)/762.01(13), b=1477.95(3)/1494.38(6), c=457.004(9)/442.1(3) pm). The tetragonal form of 'La2 In Si2‧ (exact composition: La2In1.07Si1.93, P4/mbm, a=1309.11(12), c=443.32(4) pm) also crystallizes in a new structure type, containing only [Si3 ] trimers as cutouts of the planar chains. In all structures the Si/Ge zig-zag chains/chain segments are connected by In/Sn/Pb atoms to form planar M layers, which are separated by pure A layers. Band structure calculations within the FP-LAPW DFT approach together with the Zintl formalism, extended by the presence of hypervalent bonding of the heavier M ‧ elements, give insight into the chemical bonding of this series of p

mHealth Series: mHealth project in Zhao County, rural China – Description of objectives, field site and methods

Science.gov (United States)

van Velthoven, Michelle Helena; Li, Ye; Wang, Wei; Du, Xiaozhen; Wu, Qiong; Chen, Li; Majeed, Azeem; Rudan, Igor; Zhang, Yanfeng; Car, Josip

2013-01-01

Background We set up a collaboration between researchers in China and the UK that aimed to explore the use of mHealth in China. This is the first paper in a series of papers on a large mHealth project part of this collaboration. This paper included the aims and objectives of the mHealth project, our field site, and the detailed methods of two studies. Field site The field site for this mHealth project was Zhao County, which lies 280 km south of Beijing in Hebei Province, China. Methods We described the methodology of two studies: (i) a mixed methods study exploring factors influencing sample size calculations for mHealth–based health surveys and (ii) a cross–over study determining validity of an mHealth text messaging data collection tool. The first study used mixed methods, both quantitative and qualitative, including: (i) two surveys with caregivers of young children, (ii) interviews with caregivers, village doctors and participants of the cross–over study, and (iii) researchers’ views. We combined data from caregivers, village doctors and researchers to provide an in–depth understanding of factors influencing sample size calculations for mHealth–based health surveys. The second study, a cross–over study, used a randomised cross–over study design to compare the traditional face–to–face survey method to the new text messaging survey method. We assessed data equivalence (intrarater agreement), the amount of information in responses, reasons for giving different responses, the response rate, characteristics of non–responders, and the error rate. Conclusions This paper described the objectives, field site and methods of a large mHealth project part of a collaboration between researchers in China and the UK. The mixed methods study evaluating factors that influence sample size calculations could help future studies with estimating reliable sample sizes. The cross–over study comparing face–to–face and text message survey data collection

Oxidation of cyclic amines by molybdenum(II and tungsten(II halocarbonyls, [M(CO4X2]2 (M = Mo, W; X = Cl, Br

Directory of Open Access Journals (Sweden)

H.M. Mbuvi

2013-05-01

Full Text Available The molybdenum(II and tungsten(II halocarbonyls, [M(CO4X2]2 (M = Mo, W; X = Cl, Br react with a large excess of the nitrogen bases, 1-methylpyrrolidine, 1-methylpiperidine, 1-ethylpiperidine and 2-ethylpiperidine to give aminecarbonyl complexes of the type M(CO3L3 (L= alkylamine. Excess piperidine reacts with the tungsten halocarbonyls, [W(CO4X2]2 (X = Cl, Br, to give the trans isomer of the complex, W(CO3(C5H11N3. The halogens were recovered as the amminium salts, amine, HX. The oxidized amine dimerized to form a yellow product which was recovered as an oily liquid but in very small amounts. However, in the reaction between Mo(CO4Br2 and 1-ethylpiperidine, a yellow crystalline solid, with a melting point of 224 oC was recovered in sufficient amounts for elemental analysis, melting point and spectral data. Its mass spectrum showed a molecular ion peak at m+/z = 222, a clear evidence that the oxidized amine dimerizes. The cyclic dibasic amine piperazine, C4H10N2 is not, however, oxidized by these halocarbonyls but rather it reacts by substituting some CO groups to form products of the type, M(CO3(C4H10N22X2 (M = Mo, W; X = Cl, Br. Products were characterized by elemental analysis, IR, UV, 1H NMR and mass spectrometry.

GC content around splice sites affects splicing through pre-mRNA secondary structures

Directory of Open Access Journals (Sweden)

Chen Liang

2011-01-01

Full Text Available Abstract Background Alternative splicing increases protein diversity by generating multiple transcript isoforms from a single gene through different combinations of exons or through different selections of splice sites. It has been reported that RNA secondary structures are involved in alternative splicing. Here we perform a genomic study of RNA secondary structures around splice sites in humans (Homo sapiens, mice (Mus musculus, fruit flies (Drosophila melanogaster, and nematodes (Caenorhabditis elegans to further investigate this phenomenon. Results We observe that GC content around splice sites is closely associated with the splice site usage in multiple species. RNA secondary structure is the possible explanation, because the structural stability difference among alternative splice sites, constitutive splice sites, and skipped splice sites can be explained by the GC content difference. Alternative splice sites tend to be GC-enriched and exhibit more stable RNA secondary structures in all of the considered species. In humans and mice, splice sites of first exons and long exons tend to be GC-enriched and hence form more stable structures, indicating the special role of RNA secondary structures in promoter proximal splicing events and the splicing of long exons. In addition, GC-enriched exon-intron junctions tend to be overrepresented in tissue-specific alternative splice sites, indicating the functional consequence of the GC effect. Compared with regions far from splice sites and decoy splice sites, real splice sites are GC-enriched. We also found that the GC-content effect is much stronger than the nucleotide-order effect to form stable secondary structures. Conclusion All of these results indicate that GC content is related to splice site usage and it may mediate the splicing process through RNA secondary structures.

The relevance of the M6P/IGF2R status for the tumorigenicity and invasiveness of liver and skin cancer cells

International Nuclear Information System (INIS)

Puxbaum, V.

2010-01-01

The mannose 6-phosphate/insulin-like growth factor 2 receptor (M6P/IGF2R), a multifunctional membrane-associated protein, plays a central role in targeting of lysosomal enzymes and controlling of the bioavailability of insulin-like growth factor II (IGF-II). In addition to intracellular sorting and endocytosis of M6P-containing ligands and IGF-II, the receptor also interacts with urokinase-type plasminogen activator receptor (uPAR) and plasminogen at the cell surface. M6P/IGF2R is considered a putative tumor suppressor, and its expression may modulate the invasiveness of cancer cells. Importantly, the M6P/IGF2R gene is frequently lost or mutated in a wide range of malignant tumors including hepatocellular and squamous cell carcinomas. However, the impact of the receptor on tumor invasion and metastasis is still poorly understood. FRL14 and SCC-VII cells are M6P/IGF2R deficient and thus secrete large amounts of lysosomal enzymes. Reconstitution of functional M6P/IGF2R expression restores transport of lysosomal enzymes to these compartments and drastically reduces the invasive potential of the cells. In addition, the presence of ectopic M6P/IGF2R compromises the growth of FRL14 and SCC-VII cells both in vitro and in vivo. Conversely, M6P/IGF2R knock-down in receptor-positive MIM-1-4 hepatocytes leads to increased lysosomal enzyme secretion and enhanced invasiveness. To assess the relevance of different ligand-binding sites for the biological activities of M6P/IGF2R, several mutant forms of the receptor were stably expressed in FRL14 and SCC-VII cells. Functional M6P-binding sites proved to be important for the anti-invasive potential of M6P/IGF2R, whereas the interactions of the receptor with IGF-II and uPAR/plasminogen were found to be dispensable for its biological activities. These results suggest that the M6P/IGF2R status influences the metastatic propensity of hepatocellular and squamous cell carcinomas, and that functional M6P-binding sites are crucial for the

ASSESSMENT OF RADARSAT-2 HR STEREO DATA OVER CANADIAN NORTHERN AND ARCTIC STUDY SITES

Directory of Open Access Journals (Sweden)

T. Toutin

2013-04-01

Full Text Available Digital surface models (DSMs extracted from high-resolution Radarsat-2 (R2 stereo images using a new hybrid radargrammetric modeling developed at the Canada Centre for Remote Sensing are evaluated over two Canadian northern and arctic study sites. Because the new hybrid model uses the full metadata of R2, it does not require any ground control point. The first study site in the north of Quebec is used for the scientific validation where accurate checked data (dGPS, lidas is available. The second study site in the Arctic (steep relief and glaciated surfaces is challenging for the operational evaluation of topographic mapping capabilities of R2. For the first study site, the bias and elevation linear errors with 68 percent confidence level (LE68 of R2 stero-extracted DSM compared to lidar data were computed over bare surfaces: LE90 of 3.9 m and no bias were achieved. For the second study site the comparison was performed between the R2 DEM and ICESat data. A negative 18-m bias was computed and certainly results suggests a bias in the stereo-model of R2 and thus in the metadata used in the model computation because there is few temporal variation in the data acquisition (R2 and ICESat/ LE68 of 28 m was obtained. However, the differential melting and thinning depending of the glaciers elevations and planimetric surging of glacier tongues with less accumulation of debris and moraines, a lower LE68 of around 20 m could be expected. In addition to evaluate the potential of R2 over ice bodies, which generally have low slope relief and because the errors are strongly correlated with slopes, other statistical results of elevation differences were also computed: LE68 of 15 m was obtained over ice fields with 0–5° slopes while a little more than 20-m over less than 30° slopes was achieved.

Structural characterization of M(IV)1-xLn(III)xO2-x/2 (M = Ce, Th) mixed-oxides prepared from oxalate precursors. Multi-parametric study of dissolution and microstructural evolution

International Nuclear Information System (INIS)

Horlait, D.

2011-01-01

In the framework of Gen IV program development, several physico-chemical properties of some foreseen fuels, including the chemical durability, have to be evaluated. In this aim, a study was undertaken on M(IV) 1-x Ln(III) x O 2 (M=Ce,Th) model compounds prepared from oxalate precursors. The fluorite-type structure of CeO 2 and ThO 2 remains stable up to x ≅ 0.4, the substitution of M(IV) by Ln(III) occurring simultaneously to the formation of oxygen vacancies. For higher x values, a cubic superstructure is formed as a result of oxygen vacancies ordering. The normalized dissolution rates of such solids were found to be strongly enhanced by the Ln(III) fraction. On the contrary, the nature of the M(IV) and Ln(III) elements did not modify significantly the normalized dissolution rates. The effect of temperature and acid concentration suggested the existence of surface-controlling dissolution reactions. Simultaneously, the microstructural evolution of both powdered and sintered samples revealed some important changes in the reactive surface during dissolution tests. ESEM images allowed observing the existence of preferential dissolution sites located at grains boundaries and around crystalline defects, leading to the formation of corrosion pits. In addition, the formation of gelatinous phases, acting as diffusion barriers (thus slowing down the dissolution process) was also evidenced. (author) [fr

Nonequivalence of alpha-bungarotoxin binding sites in the native nicotinic receptor molecule

International Nuclear Information System (INIS)

Conti-Tronconi, B.M.; Tang, F.; Walgrave, S.; Gallagher, W.

1990-01-01

In the native, membrane-bound form of the nicotinic acetylcholine receptor (M-AcChR) the two sites for the cholinergic antagonist alpha-bungarotoxin (alpha-BGT) have different binding properties. One site has high affinity, and the M-AcChR/alpha-BGT complexes thus formed dissociate very slowly, similar to the complexes formed with detergent-solubilized AcChR (S-AcChR). The second site has much lower affinity (KD approximately 59 +/- 35 nM) and forms quickly reversible complexes. The nondenaturing detergent Triton X-100 is known to solubilize the AcChR in a form unable, upon binding of cholinergic ligands, to open the ion channel and to become desensitized. Solubilization of the AcChR in Triton X-100 affects the binding properties of this second site and converts it to a high-affinity, slowly reversible site. Prolonged incubation of M-AcChR at 4 degrees C converts the low-affinity site to a high-affinity site similar to those observed in the presence of Triton X-100. Although the two sites have similar properties when the AcChR is solubilized in Triton X-100, their nonequivalence can be demonstrated by the effect on alpha-BGT binding of concanavalin A, which strongly reduces the association rate of one site only. The Bmax of alpha-BGT to either Triton-solubilized AcChR or M-AcChR is not affected by the presence of concanavalin A. Occupancy of the high-affinity, slowly reversible site in M-AcChR inhibits the Triton X-100 induced conversion to irreversibility of the second site. At difference with alpha-BGT, the long alpha-neurotoxin from Naja naja siamensis venom (alpha-NTX) binds with high affinity and in a very slowly reversible fashion to two sites in the M-AcChR. We confirm here that Triton-solubilized AcChR or M-AcChR binds in a very slowly reversible fashion the same amount of alpha-NTX

Blogging within a Social Networking Site as a Form of Literature Response in a Teacher Education Course

Science.gov (United States)

Hutchison, Amy; Wang, Wei

2012-01-01

The purpose of this qualitative study was to document how pre-service teachers in a children's literature course experienced blogging on a social networking site as a form of literature response. Understanding how pre-service teachers experience these tools can inform the ways we instruct them to integrate Web 2.0 tools into their teaching.…

Methods of forming single source precursors, methods of forming polymeric single source precursors, and single source precursors formed by such methods

Science.gov (United States)

Fox, Robert V.; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin; Margulieux, Kelsey R.; Holland, Andrew W.

2014-09-09

Methods of forming single source precursors (SSPs) include forming intermediate products having the empirical formula 1/2{L.sub.2N(.mu.-X).sub.2M'X.sub.2}.sub.2, and reacting MER with the intermediate products to form SSPs of the formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2, wherein L is a Lewis base, M is a Group IA atom, N is a Group IB atom, M' is a Group IIIB atom, each E is a Group VIB atom, each X is a Group VIIA atom or a nitrate group, and each R group is an alkyl, aryl, vinyl, (per)fluoro alkyl, (per)fluoro aryl, silane, or carbamato group. Methods of forming polymeric or copolymeric SSPs include reacting at least one of HE.sup.1R.sup.1E.sup.1H and MER with one or more substances having the empirical formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2 or L.sub.2N(.mu.-X).sub.2M'(X).sub.2 to form a polymeric or copolymeric SSP. New SSPs and intermediate products are formed by such methods.

Photoaffinity labeling of the lumenal K+ site of the gastric (H+ + K+)-ATPase

International Nuclear Information System (INIS)

Keeling, D.J.; Fallowfield, C.; Lawrie, K.M.; Saunders, D.; Richardson, S.; Ife, R.J.

1989-01-01

A photoaffinity label for the lumenal K+ site of the gastric (H+ + K+)-ATPase has been identified. Seven azido derivatives based upon the reversible K+ site inhibitor SCH 28080 were studied, one of which, m-ATIP (8-(3-azidophenylmethoxy)-1,2,3-trimethylimidazo[1,2-a] pyridinium iodide), was subsequently synthesized in radiolabeled form. In the absence of UV irradiation, m-ATIP inhibited K+ -stimulated ATPase activity in lyophilized gastric vesicles competitively with respect to K+, with a Ki value of 2.4 microM at pH 7.0. Irradiation of lyophilized gastric vesicles at pH 7.0 with [ 14 C]m-ATIP in the presence of 0.2 mM ATP resulted in a time-dependent inactivation of ATPase activity that was associated with an incorporation of radioactivity into a 100-kDa polypeptide representing the catalytic subunit of the (H+ + K+)-ATPase. Both inactivation and incorporation were blocked in the presence of 10 mM KCl but not with 10 mM NaCl, consistent with interaction at the K+ site. The level of incorporation required to produce complete inhibition of ATPase activity was 1.9 +/- 0.2 times the number of catalytic phosphorylation sites in the same preparation. Tryptic digestion of gastric vesicle membranes, labeled with [ 14 C]m-ATIP, failed to release the radioactivity from the membranes suggesting that the site of interaction was close to or within the membrane-spanning sections of this ion pump

In vivo tumor angiogenesis imaging with site-specific labeled 99mTc-HYNIC-VEGF

International Nuclear Information System (INIS)

Blankenberg, Francis G.; Backer, Marina V.; Patel, Vimalkumar; Backer, Joseph M.; Levashova, Zoia

2006-01-01

We recently developed a cysteine-containing peptide tag (C-tag) that allows for site-specific modification of C-tag-containing fusion proteins with a bifunctional chelator, HYNIC (hydrazine nicotinamide)-maleimide. We then constructed and expressed C-tagged vascular endothelial growth factor (VEGF) and labeled it with HYNIC. We wished to test 99m Tc-HYNIC-C-tagged VEGF ( 99m Tc-HYNIC-VEGF) for the imaging of tumor vasculature before and after antiangiogenic (low continuous dosing, metronomic) and tumoricidal (high-dose) cyclophosphamide treatment. HYNIC-maleimide was reacted with the two thiol groups of C-tagged VEGF without any effect on biologic activity in vitro. 99m Tc-HYNIC-VEGF was prepared using tin/tricine as an exchange reagent, and injected via the tail vein (200-300 μCi, 1-2 μg protein) followed by microSPECT imaging 1 h later. Sequencing analysis of HYNIC-containing peptides obtained after digestion confirmed the site-specific labeling of the two accessible thiol groups of C-tagged VEGF. Tumor vascularity was easily visualized with 99m Tc/VEGF in Balb/c mice with 4T1 murine mammary carcinoma 10 days after implantation into the left axillary fat pad in controls (12.3±5.0 tumor/bkg, n=27) along with its decrease following treatment with high (150 mg/kg q.o.d. x 4; 1.14±0.48 tumor/bkg, n=9) or low (25 mg/kg q.d. x 7; 1.03±0.18 tumor/bkg, n=9) dose cyclophosphamide. Binding specificity was confirmed by observing a 75% decrease in tumor uptake of 99m Tc/biotin-inactivated VEGF, as compared with 99m Tc-HYNIC-VEGF. 99m Tc can be loaded onto C-tagged VEGF in a site-specific fashion without reducing its bioactivity. 99m Tc-HYNIC-VEGF can be rapidly prepared for the imaging of tumor vasculature and its response to different types of chemotherapy. (orig.)

O&M report for DanWEC Hanstholm test site

DEFF Research Database (Denmark)

Grant, Christian Nereus; Tetu, Amélie

The report is prepared for the Danish Energy Agency under The Energy Technology Development and Demonstration Program (EUDP), project “Resource Assessment, Forecasts and WECs O&M strategies at DanWEC and beyond”. This report includes observation, planning and maintenance descriptions for the Dan......WEC test site (HTS) located west of the Port of Hanstholm....

Waste forms based on Cs-loaded silicotitanates

International Nuclear Information System (INIS)

Balmer, M.L.; Bunker, B.C.

1995-04-01

Silicotitanate ion exchange materials are being considered for removal of radioactive Cs and Sr from tank wastes at the Hanford site. The phase evolution as a function of heat treatment temperature for several sol gel derived compositions within the Cs 2 O-SiO 2 -TiO 2 system was investigated, in order to determine if an adequate waste form can be achieved by direct thermal conversion. The Cs leach rates and Cs loss during heat treatment of select materials were measured. Some compositions which contain large amounts of Ti melt to form a glass with reasonably low aqueous leach rates. A new Cs-silicotitanate material with a structure isomorphous to pollucite was discovered. This material forms at low temperatures (700--800 C) where Cs volatility is negligible. The silicotitanate-pollucite exhibits extremely low leach rates (1.42 g/m 2 day ) at 90 C, and has been identified as a promising waste form for Cs containment

Inhibitory Effect of Flavonoids on the Efflux of -Acetyl 5-Aminosalicylic Acid Intracellularly Formed in Caco-2 Cells

Directory of Open Access Journals (Sweden)

Shin Yoshimura

2009-01-01

Full Text Available -acetyl 5-aminosalicylic acid (5-AcASA that was intracellularly formed from 5-aminosalicylic acid (5-ASA at 200 M was discharged 5.3, 7.1, and 8.1-fold higher into the apical site than into the basolateral site during 1, 2, and 4-hour incubations, respectively, in Caco-2 cells grown in Transwells. The addition of flavonols (100 M such as fisetin and quercetin with 5-ASA remarkably decreased the apically directed efflux of 5-AcASA. When 5-ASA (200 M was added to Caco-2 cells grown in tissue culture dishes, the formation of 5-AcASA decreased, and, in addition, the formed 5-AcASA was found to be accumulated within the cells in the presence of such flavonols. Thus, the decrease in 5-AcASA efflux by such flavonols was attributed not only to the inhibition of -acetyl-conjugation of 5-ASA but to the predominant cellular accumulation of 5-AcASA. Various flavonoids also had both of the effects with potencies that depend on their specific structures. The essential structure of flavonoids was an absence of a hydroxyl substitution at the C5 position on the A-ring of flavone structure for the inhibitory effect on the -acetyl-conjugation of 5-ASA, and a presence of hydroxyl substitutions at the C3 or C4 position on the B-ring of flavone structure for the promoting effect on the cellular accumulation of 5-AcASA. Both the decrease in 5-AcASA apical efflux and the increase in 5-AcASA cellular accumulation were also caused by MK571 and indomethacin, inhibitors of MRPs, but not by quinidine, cyclosporin A, P-glycoprotein inhibitors, and mitoxantrone, a BCRP substrate. These results suggest that certain flavonoids suppress the apical efflux of 5-AcASA possibly by inhibiting MRPs pumps located on apical membranes in Caco-2 cells.

1/M corrections to baryonic form factors in the quark model

International Nuclear Information System (INIS)

Cheng, H.; Tseng, B.

1996-01-01

Weak current-induced baryonic form factors at zero recoil are evaluated in the rest frame of the heavy parent baryon using the nonrelativistic quark model. Contrary to previous similar work in the literature, our quark model results do satisfy the constraints imposed by heavy quark symmetry for heavy-heavy baryon transitions at the symmetric point v·v'=1 and are in agreement with the predictions of the heavy quark effective theory for antitriplet-antitriplet heavy baryon form factors at zero recoil evaluated to order 1/m Q . Furthermore, the quark model approach has the merit that it is applicable to any heavy-heavy and heavy-light baryonic transitions at maximum q 2 . Assuming a dipole q 2 behavior, we have applied the quark model form factors to nonleptonic, semileptonic, and weak radiative decays of the heavy baryons. It is emphasized that the flavor suppression factor occurring in many heavy-light baryonic transitions, which is unfortunately overlooked in most literature, is very crucial towards an agreement between theory and experiment for the semileptonic decay Λ c →Λe + ν e . Predictions for the decay modes Λ b →J/ψΛ, Λ c →pφ, Λ b →Λγ, Ξ b →Ξγ, and for the semileptonic decays of Λ b , Ξ b, c, and Ω b are presented. copyright 1996 The American Physical Society

Cytoplasmic protein binding to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells

International Nuclear Information System (INIS)

Kwon, Y.K.; Hecht, N.B.

1991-01-01

The expression of the protamines, the predominant nuclear proteins of mammalian spermatozoa, is regulated translationally during male germ-cell development. The 3' untranslated region (UTR) of protamine 1 mRNA has been reported to control its time of translation. To understand the mechanisms controlling translation of the protamine mRNAs, we have sought to identify cis elements of the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic factors. From gel retardation assays, two sequence elements are shown to form specific RNA-protein complexes. Protein binding sites of the two complexes were determined by RNase T1 mapping, by blocking the putative binding sites with antisense oligonucleotides, and by competition assays. The sequences of these elements, located between nucleotides + 537 and + 572 in protamine 2 mRNA, are highly conserved among postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites were detected. UV-crosslinking studies revealed that a protein of about 18 kDa binds to one of the conserved sequences. These data demonstrate specific protein binding to a highly conserved 3' UTR of translationally regulated testicular mRNA

Deletions in cox2 mRNA result in loss of splicing and RNA editing and gain of novel RNA editing sites.

Directory of Open Access Journals (Sweden)

Stefanie Grüttner

Full Text Available As previously demonstrated, the maize cox2 RNA is fully edited in cauliflower mitochondria. Use of constructs with a deleted cox2 intron, however, led to a loss of RNA editing at almost all editing sites, with only a few sites still partially edited. Likewise, one deletion in exon 1 and three in exon 2 abolish RNA editing at all cox2 sites analyzed. Furthermore, intron splicing is abolished using these deletions. Mutation of a cytosine residue, which is normally edited and localized directly adjacent to the intron, to thymidine did not result in restoration of splicing, indicating that the loss of splicing was not due to loss of RNA editing. One deletion in exon 2 did not lead to loss of splicing. Instead, most editing sites were found to be edited, only three were not edited. Unexpectedly, we observed additional RNA editing events at new sites. Thus it appears that deletions in the cox2 RNA sequence can have a strong effect on RNA processing, leading to loss of splicing, loss of editing at all sites, or even to a gain of new editing sites. As these effects are not limited to the vicinity of the respective deletions, but appear to be widespread or even affect all editing sites, they may not be explained by the loss of PPR binding sites. Instead, it appears that several parts of the cox2 transcript are required for proper RNA processing. This indicates the roles of the RNA sequence and structural elements in the recognition of the editing sites.

1/mQ corrections to form factors and extraction of |Vcb|

International Nuclear Information System (INIS)

Liu, J.; Chao, K.

1997-01-01

Form factors for 0 - →0 - and 0 - →1 - mesonic transitions in the heavy quark limit and the 1/m Q corrections are analyzed model independently within the Bethe-Salpeter (BS) formalism. The analysis shows that the BS formalism has spin-flavor symmetry in the heavy quark limit and respects Luke's theorem when the 1/m Q corrections are taken into account. All form factors for B→D (*) transitions beyond the zero recoil point are estimated in a relativistic constituent quark model based on the BS formalism. Using these form factors we calculate the branching ratios for the semileptonic decays B→D (*) l + ν l and extract the Cabibbo-Kobayashi-Maskawa matrix element |V cb |. We get |V cb |=0.042±0.003 which is consistent with the current world average. copyright 1997 The American Physical Society

Structure of vanadium oxosulfato complexes in V2O5-M2S2O7-M2SO4 (M = K, Cs) melts. A high temperature spectroscopic study

DEFF Research Database (Denmark)

Boghosian, S.; Chrissanthopoulos, A.; Fehrmann, Rasmus

2002-01-01

2 atmosphere (P-SO2 = 0-1.2 atm). The data are in agreement with the V-V V-IV equilibrium: (VO)(2)O(SO4)(4)(4-)(1) + SO2(g) 2VO(SO4)(2)(2-)(1) + SO3(g). SO2 does not coordinate to the V-V complex but starts significantly to coordinate to V-IV for P-SO2 > 0.4 atm according to VO(SO4)(2)(2-)(1) + SO2......(g) VO(SO4)(2)SO22-(1). The Raman spectral features and the exploitation of the relative Raman intensities indicate that the (VO)(2)O(SO4)(4)(4-) dimeric complex unit, possessing a V-O-V bridge, is formed in the V2O5-M2S2O7 binary mixtures. The spectral changes occurring upon interaction...

Coupling of g proteins to reconstituted monomers and tetramers of the M2 muscarinic receptor.

Science.gov (United States)

Redka, Dar'ya S; Morizumi, Takefumi; Elmslie, Gwendolynne; Paranthaman, Pranavan; Shivnaraine, Rabindra V; Ellis, John; Ernst, Oliver P; Wells, James W

2014-08-29

G protein-coupled receptors can be reconstituted as monomers in nanodiscs and as tetramers in liposomes. When reconstituted with G proteins, both forms enable an allosteric interaction between agonists and guanylyl nucleotides. Both forms, therefore, are candidates for the complex that controls signaling at the level of the receptor. To identify the biologically relevant form, reconstituted monomers and tetramers of the purified M2 muscarinic receptor were compared with muscarinic receptors in sarcolemmal membranes for the effect of guanosine 5'-[β,γ-imido]triphosphate (GMP-PNP) on the inhibition of N-[(3)H]methylscopolamine by the agonist oxotremorine-M. With monomers, a stepwise increase in the concentration of GMP-PNP effected a lateral, rightward shift in the semilogarithmic binding profile (i.e. a progressive decrease in the apparent affinity of oxotremorine-M). With tetramers and receptors in sarcolemmal membranes, GMP-PNP effected a vertical, upward shift (i.e. an apparent redistribution of sites from a state of high affinity to one of low affinity with no change in affinity per se). The data were analyzed in terms of a mechanistic scheme based on a ligand-regulated equilibrium between uncoupled and G protein-coupled receptors (the "ternary complex model"). The model predicts a rightward shift in the presence of GMP-PNP and could not account for the effects at tetramers in vesicles or receptors in sarcolemmal membranes. Monomers present a special case of the model in which agonists and guanylyl nucleotides interact within a complex that is both constitutive and stable. The results favor oligomers of the M2 receptor over monomers as the biologically relevant state for coupling to G proteins. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Mass transfer of CO2 to groundwaters from a near-surface waste disposal site

International Nuclear Information System (INIS)

Caron, F.; Wilkinson, S.R.; Manni, G.; Torok, J.

1995-01-01

Gaseous 14 CO 2 originating from buried low-level radioactive wastes (LLRW) in a near-surface disposal site can be released to the environment via two major paths: gas-phase diffusion through soils to the atmosphere, and dissolution in groundwater, followed by aqueous migration. Aqueous migration would give the highest dose to an individual, especially if C-14 was converted to an organic form and ingested. Gaseous diffusion would give a lower dose, largely because of atmospheric dispersion and dilution. The objective of this study was to develop the capability to estimate which of the two paths will likely be dominant for typical near-surface disposal facilities. The main missing parameter for making this estimate was a mass-transfer coefficient (K L ) of 14 CO 2 to groundwaters, which was determined experimentally using a large sand box. The K L thus determined was approximately 10 to 20 times smaller than for an open liquid surface. This suggests that there is a potential resistance to mass transfer, probably caused by the capillary fringe. The value obtained was incorporated into a simple model of CO 2 transport around a typical near-surface disposal site. The model suggests that CO 2 transport via both gaseous release and aqueous migration paths are of similar magnitude for a repository located ∼2 m above the water table. (author). 11 refs., 2 tabs., 2 figs

Glycan microarray analysis of the carbohydrate-recognition specificity of native and recombinant forms of the lectin ArtinM.

Science.gov (United States)

Liu, Y; Cecílio, N T; Carvalho, F C; Roque-Barreira, M C; Feizi, T

2015-12-01

This article contains data related to the researc.h article entitled "Yeast-derived ArtinM shares structure, carbohydrate recognition, and biological effects with native ArtinM" by Cecílio et al. (2015) [1]. ArtinM, a D-mannose-binding lectin isolated from the seeds of Artocarpus heterophyllus, exerts immunomodulatory and regenerative activities through its Carbohydrate Recognition Domain (CRD) (Souza et al., 2013; Mariano et al., 2014 [2], [3]). The limited availability of the native lectin (n-ArtinM) led us to characterize a recombinant form of the protein, obtained by expression in Saccharomyces cerevisiae (y-ArtinM). We compared the carbohydrate-binding specificities of y-ArtinM and n-ArtinM by analyzing the binding of biotinylated preparations of the two lectin forms using a neoglycolipid (NGL)-based glycan microarray. Data showed that y-ArtinM mirrored the specificity exhibited by n-ArtinM.

Bovine nucleus caudatus acetylcholinesterase: active site determination and investigation of a dimeric form obtained by selective proteolysis

Energy Technology Data Exchange (ETDEWEB)

Landauer, P.; Ruess, K.P.; Lieflaender, M.

1984-09-01

The number of catalytic subunits of purified bovine nucleus caudatus acetylcholinesterase (E.C. 3.1.1.7) has been determined by active site labelling with (3H)diisopropyl fluorophosphate ((3H)DFP). The 10.5 S, 16 S, and 20 S forms were estimated to contain two, four, and six active sites, respectively, per molecule. A 4.8 S form, which showed a weak amphiphile-dependent activity behavior, was obtained by selective proteolytic digestion with pronase. The inability of the purified 4.8 S form to aggregate after detergent removal, and the molecular mass in the range of 130-165 kD under nondenaturating conditions, indicate that this form is a dimeric form, lacking those hydrophobic regions responsible for aggregation.

Multiyear Statistics of 2-D Shortwave Radiative Effects at Three ARM Sites

Science.gov (United States)

Varnai, Tamas

2010-01-01

This study examines the importance of horizontal photon transport effects, which are not considered in the 1-D calculations of solar radiative heating used by most atmospheric dynamical models. In particular, the paper analyzes the difference between 2-D and 1-D radiative calculations for 2-D vertical cross-sections of clouds that were observed at three sites over 2- to 3-year periods. The results show that 2-D effects increase multiyear 24-hour average total solar absorption by about 4.1 W/sq m, 1.2 W/sq m, and 0.3 W/sq m at a tropical, mid-latitude, and arctic site, respectively. However, 2-D effects are often much larger than these average values, especially for high sun and for convective clouds. The results also reveal a somewhat unexpected behavior, that horizontal photon transport often enhances solar heating even for oblique sun. These findings underscore the need for fast radiation calculation methods that can allow atmospheric dynamical simulations to consider the inherently multidimensional nature of shortwave radiative processes.

Investigation into the dehydration of selenate doped Na2M(SO4)2·2H2O (M = Mn, Fe, Co and Ni): Stabilisation of the high Na content alluaudite phases Na3M1.5(SO4)3-1.5x(SeO4)1.5x (M = Mn, Co and Ni) through selenate incorporation

Science.gov (United States)

Driscoll, L. L.; Kendrick, E.; Knight, K. S.; Wright, A. J.; Slater, P. R.

2018-02-01

In this paper we report an investigation into the phases formed on dehydration of Na2M(SO4)2-x(SeO4)x·2H2O (0 ≤ x ≤ 1; M = Mn, Fe, Co and Ni). For the Fe series, all attempts to dehydrate the samples doped with selenate resulted in amorphous products, and it is suspected that a side redox reaction involving the Fe and selenate may be occurring leading to phase decomposition and hence the lack of a crystalline product on dehydration. For M = Mn, Co, Ni, the structure observed was shown to depend upon the transition metal cation and level of selenate doping. An alluaudite phase, Na3M1.5(SO4)3-1.5x(SeO4)1.5x, was observed for the selenate doped compositions, with this phase forming as a single phase for x ≥ 0.5 M = Co, and x = 1.0 M = Ni. For M = Mn, the alluaudite structure is obtained across the series, albeit with small impurities for lower selenate content samples. Although the alluaudite-type phases Na2+2y(Mn/Co)2-y(SO4)3 have recently been reported [1,2], doping with selenate appears to increase the maximum sodium content within the structure. Moreover, the selenate doped Ni based samples reported here are the first examples of a Ni sulfate/selenate containing system exhibiting the alluaudite structure.

Remaining Sites Verification Package for the 100-C-9:2 Sanitary Sewer Pipelines, Waste Site Reclassification Form 2004-013

Energy Technology Data Exchange (ETDEWEB)

L. M. Dittmer

2007-07-11

The 100-C-9:2 sanitary sewer pipelines include the feeder pipelines associated with the 1607-B8, the 1607-B9, the 1607-B10 and the 1607-B11 septic systems. Contaminated soil and piping from the feeder lines to the septic systems were removed and disposed of. The remaining soil in the excavations has been shown to meet the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

Nanoscopic characterization of Pr2Zr2O7 at Zr sites

International Nuclear Information System (INIS)

Martinez, J.A.; Caracoche, M.C.; Rodriguez, A.M.; Rivas, P.C.; Bondioli, F.; Manfredini, T.; Ferrari, A.M.

2005-01-01

By using Perturbed Angular Correlation Spectroscopy, a suitable technique to explore internal fields at nanoscopic scale, the electric field gradients at Zr 4+ sites in the Pr 2 Zr 2 O 7 compound have been determined as a function of temperature. Three nonequivalent nanoconfigurations are present, which have been interpreted with the aid of point charge model calculations. Two of them correspond to pyrochlore - oxygen defective and perfect structures -, and the third one to the pyrochlore-related defect fluorite structure. The most abundant interaction is a disordered and fluctuating electric field gradient, which describes the oxygen defective pyrochlore. As temperature increases, its gradual and reversible transformation towards the perfect form is observed. Below 750 C the oxygen vacancies movement, which exhibits an activation energy of 0.14 eV, is assumed to be due to vacancies jumping among 48f equivalent sites. At higher temperatures the movement is interpreted as the fast diffusion of oxygen vacancies involving 48f and 8b sites, thus giving place to anionic disorder. The activation energy for this movement has been determined to be of 0.85 eV. (copyright 2005 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Probing properties of the interfacial perimeter sites in TiO x /Au/SiO 2 with 2-propanol decomposition

Energy Technology Data Exchange (ETDEWEB)

Wu, Yi Y.; Kung, Harold H. (NWU)

2017-11-01

The decomposition of 2-propanol was studied over SiO2, SiO2 with an overlayer of TiO2 (Ti/SiO2), Au/SiO2, and Au/SiO2 with an overlayer of TiO2 (Ti/[Au/SiO2]) at 170–190 °C. There was no reaction on SiO2. Propene was the only product on Ti/SiO2, and its rate of formation increased proportionally with the Ti content. Acetone was the major product (selectivity 65–99%) on all Au-containing catalysts. Its rate of formation also increased with Ti loading. In addition, small amounts of propene were also formed on Ti/[Au/SiO2] the rate of which increased with Ti loading. Characterization of the catalysts with N2 adsorption, STEM, DR-UV-vis spectroscopy, XPS, XANES and EXAFS suggested that the Ti formed an amorphous TiO2 overlayer on the catalyst. At high Ti loadings (4–5 wt.%), there were patches of thick porous TiO2 layer, and some microdomains of crystalline TiO2 could be detected. Au was present as 1–3 nm nanoparticles on all catalysts, before and after used in reaction. Only Lewis acid sites were detected based on results from pyridine adsorption, and their quantities increased with Ti loading. Based on the comparison of reaction rates, the dependence of the kinetics on 2-propanol partial pressure, the apparent activation energies, and the effect of co-feeding O2 among different catalysts, it was concluded that propene was formed on the TiO2 overlayer, acetone was formed primarily at the Au-TiO2 interfacial perimeter sites, and α-C-H bond breaking preceding acetone formation was more facile on Au at the interfacial site than other surface Au atoms. Implication of these results to the selective acetone formation in the oxidation of propane in the presence of a O2/H2 mixture was discussed.

Behavior of the monophosphate tungsten bronzes (PO2)4(WO3)2m (m = 7 and 8) in the course of electrochemical lithium insertion

International Nuclear Information System (INIS)

Martinez-de la Cruz, A.; Longoria Rodriguez, F.E.; Gonzalez, Lucy T.; Torres-Martinez, Leticia M.

2007-01-01

The electrochemical lithium insertion process has been studied in the family of monophosphate tungsten bronzes (PO 2 ) 4 (WO 3 ) 2m , where m = 7 and 8. Structural changes in the pristine oxides were followed as lithium insertion proceeded. Through potentiostatic intermittent technique the different processes which take place in the cathode during the discharge of the cell were analyzed. The nature of the bronzes Li x (PO 2 ) 4 (WO 3 ) 2m formed was determined by in situ X-ray diffraction experiments. These results have allowed establishing a correlation with the reversible/irreversible processes detected during the electrochemical lithium insertion

Glycan microarray analysis of the carbohydrate-recognition specificity of native and recombinant forms of the lectin ArtinM

Directory of Open Access Journals (Sweden)

Y. Liu

2015-12-01

Full Text Available This article contains data related to the researc.h article entitled “Yeast-derived ArtinM shares structure, carbohydrate recognition, and biological effects with native ArtinM” by Cecílio et al. (2015 [1]. ArtinM, a D-mannose-binding lectin isolated from the seeds of Artocarpus heterophyllus, exerts immunomodulatory and regenerative activities through its Carbohydrate Recognition Domain (CRD (Souza et al., 2013; Mariano et al., 2014 [2,3]. The limited availability of the native lectin (n-ArtinM led us to characterize a recombinant form of the protein, obtained by expression in Saccharomyces cerevisiae (y-ArtinM. We compared the carbohydrate-binding specificities of y-ArtinM and n-ArtinM by analyzing the binding of biotinylated preparations of the two lectin forms using a neoglycolipid (NGL-based glycan microarray. Data showed that y-ArtinM mirrored the specificity exhibited by n-ArtinM.

SITE-2, Power Plant Siting, Cost, Environment, Seismic and Meteorological Effects

International Nuclear Information System (INIS)

Frigerio, N.A.; Habegger, L.J.; King, R.F.; Hoover, L.J.; Clark, N.A.; Cobian, J.M.

1977-01-01

1 - Description of problem or function: SITE2 is designed to (1) screen candidate energy facility sites or areas within an electric utility region, based on the region's physical and socioeconomic attributes, the planned facility's characteristics, and impact assessments, and (2) evaluate the cumulative regional impacts associated with alternate energy supply options and inter-regional energy import/export practices, specifically, comparison of different energy technologies and their regional distribution in clustered or dispersed patterns. 2 - Method of solution: The SITE2 methodology is based on the quantification of three major site-related vectors. A cost vector is determined which identifies site-specific costs, such as transmission costs, cooling costs as related to water availability, and costs of specific controls needed to protect the surrounding environment. An impact vector is also computed for each potential site, using models of health and environmental impacts incurred in areas adjacent to the site. Finally, a site attribute vector is developed which reflects such characteristics as population, seismic conditions, meteorology, land use, and local ecological systems. This vector can be used to eliminate certain sites because of their inability to satisfy specific constraints. These three vectors can be displayed as density maps and combined in a simple overlay approach, similar to that developed by I. L. McHarg in reference 2, to identify candidate sites. Alternatively, the vector elements can be computationally combined into a weighted sum to obtain quantitative indicators of site suitability

SITE-2, Power Plant Siting, Cost, Environment, Seismic and Meteorological Effects

Energy Technology Data Exchange (ETDEWEB)

Frigerio, N A [Environmental Impact Studies, Argonne National Laboratory 9700 South Cass Avenue, Argonne, Illinois 60439 (United States); Habegger, L J; King, R F; Hoover, L J [Energy and Environmental Systems Division, Argonne National Laboratory 9700 South Cass Avenue, Argonne, Illinois 60439 (United States); Clark, N A [Applied Mathematics Division, Argonne National Laboratory, 9700 South Cass Avenue, Argonne, Illinois 60439 (United States); Cobian, J M [Northwestern University, Evanston, Illinois 60201 (United States)

1977-08-01

1 - Description of problem or function: SITE2 is designed to (1) screen candidate energy facility sites or areas within an electric utility region, based on the region's physical and socioeconomic attributes, the planned facility's characteristics, and impact assessments, and (2) evaluate the cumulative regional impacts associated with alternate energy supply options and inter-regional energy import/export practices, specifically, comparison of different energy technologies and their regional distribution in clustered or dispersed patterns. 2 - Method of solution: The SITE2 methodology is based on the quantification of three major site-related vectors. A cost vector is determined which identifies site-specific costs, such as transmission costs, cooling costs as related to water availability, and costs of specific controls needed to protect the surrounding environment. An impact vector is also computed for each potential site, using models of health and environmental impacts incurred in areas adjacent to the site. Finally, a site attribute vector is developed which reflects such characteristics as population, seismic conditions, meteorology, land use, and local ecological systems. This vector can be used to eliminate certain sites because of their inability to satisfy specific constraints. These three vectors can be displayed as density maps and combined in a simple overlay approach, similar to that developed by I. L. McHarg in reference 2, to identify candidate sites. Alternatively, the vector elements can be computationally combined into a weighted sum to obtain quantitative indicators of site suitability.

78 FR 13897 - Final Revision and Publication of the 2012 Form M-1, Notice

Science.gov (United States)

2013-03-01

... DEPARTMENT OF LABOR Employee Benefits Security Administration RIN 1210-AB51 Final Revision and Publication of the 2012 Form M-1, Notice AGENCY: Employee Benefits Security Administration, Department of... revisions to the Form M-1, Report for Multiple Employer Welfare Arrangements (MEWAs) and Certain Entities...

A proposal for M2-brane-anti-M2-brane action

International Nuclear Information System (INIS)

Garousi, Mohammad R.

2010-01-01

We propose a manifestly SO(8) invariant BF type Lagrangian for describing the dynamics of M2-brane-anti-M2-brane system in flat spacetime. When one of the scalars which satisfies a free-scalar equation takes a large expectation value, the M2-brane-anti-M2-brane action reduces to the tachyon DBI action of D2-brane-anti-D2-brane system in flat spacetime.

Selection of the landing site in Isidis Planitia of Mars probe Beagle 2

Science.gov (United States)

Bridges, J. C.; Seabrook, A. M.; Rothery, D. A.; Kim, J. R.; Pillinger, C. T.; Sims, M. R.; Golombek, M. P.; Duxbury, T.; Head, J. W.; Haldemann, A. F. C.; Mitchell, K. L.; Muller, J.-P.; Lewis, S. R.; Moncrieff, C.; Wright, I. P.; Grady, M. M.; Morley, J. G.

2003-01-01

This paper describes selection and characterization of the landing site for the Mars 2004 Beagle 2 mission. The site is within Isidis Planitia between 10°-12°N, 266°-274°W, centered at 11.6°N, 269.5°W. This is at low elevation (-3600 to -3900 m MOLA), is flat (MOLA RMS slope = 0.57°), radar data suggest a smoother surface at decimeter to meter scales than the Pathfinder site and it has a moderate rock abundance (2-17%, mean 11%). In addition to this, Isidis shows evidence for concentration and remobilization of volatiles. In particular, the basin contains conical landforms. We favor models involving the formation of tuff cones during magma-ice interaction. Structures identified as dykes in MOC images may be remnants of magma conduits. The pattern of bulk thermal inertia in Isidis (higher values of 500 Jm-2s-0.5K-1 around the SW-S-E margin decreasing toward the center and north) suggests that an influx of sediment spread from the Noachian areas around the southern half of the basin over the basin floor. The coarse, higher thermal inertia material was deposited closest to the sediment source. The variable state of erosion of the tuff cones suggests that they formed intermittently over a long period of time during Amazonian and possibly Hesperian epochs. Geologically recent resurfacing of Isidis has also occurred by aeolian processes, and this is shown by a deficit in impact craters duricrust.

Site of ADP-ribosylation and the RNA-binding site are situated in different domains of the elongation factor EF-2

International Nuclear Information System (INIS)

Davydova, E.K.

1987-01-01

One of the proteins participating in the process of elongation of polypeptide chains - elongation factor 2 (EF-2) - can be ADP-ribosylated at a unique amino acid residue - diphthamide. Since the ADP-ribosylation of EF-2 at dipthamide leads to a loss of affinity of the factor for RNA while the presence of RNA inhibits the ADP-ribosylation reaction, it seemed probable to the authors that diphthamide participated directly in the binding of EF-2 to DNA. The experiments presented in this article showed that this was not the case: diphthamide and the RNA-binding site are situated on different domains of EF-2. Thus, ADP-ribosylation of factor EF-2 in one domain leads to a loss of the ability to bind to RNA in the other. The authors investigated the mutual arrangement of diphthamide and the RNA-binding site on the EF-2 molecule by preparing a factor from rabbit reticulocytes and subjecting it to proteolytic digestion with elastase. The factor was incubated with elastase for 15 min at 37 0 C at an enzyme:substrate ratio of 1:100 in buffer solution containing 20 mM Tris-HCl, pH 7.6, 10 mM KCl, 1 mM MgCl 2 , and 2 mM dithiothreitol. The reaction was stopped by adding para-methylsulfonyl fluoride to 50 micro-M. The authors obtained a preparation as a result of proteolysis and applied it on a column with RNA-Sepharose and separated into two fractions: RNA-binding and without affinity for RNA. The initial preparation and its fractions were subjected to exhaustive ADP-ribosylation in the presence of diphtheria toxin and [U- 14 C] nicotinaide adenine dinucleotide ([ 14 C]NAD) (296 mCi/mmole). The samples were analyzed electrophoretically in a polyacrylamide gel gradient in the presence of sodium dodecyl sulfate. For the detection of [ 14 C] ADP-ribosylated components, the gels were dried and exposed with RM-V x-ray film

G(2) Holonomy Spaces from Invariant Three-Forms

OpenAIRE

Brandhuber, Andreas

2001-01-01

We construct several new G(2) holonomy metrics that play an important role in recent studies of geometrical transitions in compactifications of M-theory to four dimensions. In type IIA string theory these metrics correspond to D6 branes wrapped on the three-cycle of the deformed conifold and the resolved conifold with two-form RR flux on the blown-up two-sphere, which are related by a conifold transition. We also study a G(2) metric that is related in type IIA to the line bundle over S^2 x S^...

Elastin-derived peptides promote abdominal aortic aneurysm formation by modulating M1/M2 macrophage polarization1

Science.gov (United States)

Dale, Matthew A; Xiong, Wanfen; Carson, Jeffrey S; Suh, Melissa K; Karpisek, Andrew D.; Meisinger, Trevor M.; Casale, George P.; Baxter, B. Timothy

2016-01-01

Abdominal aortic aneurysm (AAA) is a dynamic vascular disease characterized by inflammatory cell invasion and extracellular matrix (ECM) degradation. Damage to elastin in the ECM results in release of elastin-derived peptides (EDPs), which are chemotactic for inflammatory cells such as monocytes. Their effect on macrophage polarization is less well known. Pro-inflammatory M1 macrophages initially are recruited to sites of injury but, if their effects are prolonged, they can lead to chronic inflammation that prevents normal tissue repair. Conversely, anti-inflammatory M2 macrophages reduce inflammation and aid in wound healing. Thus, a proper M1/M2 ratio is vital for tissue homeostasis. AAA tissue reveals a high M1/M2 ratio where pro-inflammatory cells and their associated markers dominate. In the present study, in vitro treatment of bone marrow-derived macrophages with EDPs induced M1 macrophage polarization. By using C57Bl/6 mice, antibody-mediated neutralization of EDPs reduced aortic dilation, matrix metalloproteinase activity, and pro-inflammatory cytokine expression at early and late time points after aneurysm induction. Furthermore, direct manipulation of the M1/M2 balance altered aortic dilation. Injection of M2 polarized macrophages reduced aortic dilation after aneurysm induction. EDPs promoted a pro-inflammatory environment in aortic tissue by inducing M1 polarization and neutralization of EDPs attenuated aortic dilation. The M1/M2 imbalance is vital to aneurysm formation. PMID:27183603

Observations of M dwarfs beyond 2.2 μm

International Nuclear Information System (INIS)

Berriman, G.

1987-01-01

This paper presents the first systematic spectroscopic observations of M dwarfs beyond 2.2μm. The coolest dwarfs show strong water absorption in the 3μm window, and beyond 4μm, the energy distributions of all the stars fall slightly less steeply than the Rayleigh-Jeans tail of a blackbody. Spectra between 1 and 4μm are essential in deriving accurate luminosities of M dwarfs, and possibly in deriving accurate effective temperatures too. New values reported here are not in general well explained by theoretical models of hydrogen burning stars. This is especially true for those cooler than 3000K: in the HR diagram they lie closer to brown dwarfs, in contrast to recent results based only on photometry. (author)

M2M Optimizations in Public Mobile Networks

NARCIS (Netherlands)

Norp, A.H.J.; Landais, B.

2012-01-01

Many M2M applications use public telecommunications networks to transfer data from M2M devices to an M2M server. These telecommunications networks will have to be adapted to cope with the traffic generated by the projected growth of M2M applications. In the near future, many more devices will be

Remaining Sites Verification Package for the 120-F-1 Glass Dump Waste Site. Attachment to Waste Site Reclassification Form 2008-028

International Nuclear Information System (INIS)

Capron, J.M.

2008-01-01

The 120-F-1 waste site consisted of two dumping areas located 660 m southeast of the 105-F Reactor containing laboratory equipment and bottles, demolition debris, light bulbs and tubes, small batteries, small drums, and pesticide contaminated soil. It is probable that 108-F was the source of the debris but the material may have come from other locations within the 100-F Area. In accordance with this evaluation, the verification sampling results support a reclassification of this site to Interim Closed Out. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

Evaluating the MBTI® Form M in a South African context

Directory of Open Access Journals (Sweden)

Casper J.J. van Zyl

2012-09-01

Research purpose: To investigate the reliability, validity and differential item functioning of the MBTI® Form M across groups in South Africa using Classical Test Theory (CTT and Item Response Theory (IRT methods. Motivation for the study: To add to the continual research and improvement of the MBTI® Form M through the investigation of its psychometric properties across groups in South Africa. Research design, approach and method: This study falls within the quantitative research paradigm. Classical test theory methods and Rasch analysis were used to evaluate the functioning of the MBTI Form M across gender and ethnic groups. A cross-sectional study was completed consisting of 10 705 South African respondents. Main findings: Excellent reliability was found for the instrument across groups in the sample. Good evidence for construct validity was found using exploratory factor analysis and confirmatory factor analysis. Some evidence for uniform bias was found across ethnic and gender groups and a few items reflected non-uniform DIF across gender groups only. The effect of uniform and non-uniform DIF did not appear to have major practical implications for the interpretation of the scales. Practical/managerial implications: The results provided evidence that supports the psychometric validity of the MBTI instrument in the South African context. Contribution/value-add: This study is the largest study to date regarding the psychometric functioning of the MBTI instrument in South Africa. It contributes to the evolution of the instrument in line with the legislative requirements concerning the use of psychometric tests in South Africa.

Forming artificial soils from waste materials for mine site rehabilitation

Science.gov (United States)

Yellishetty, Mohan; Wong, Vanessa; Taylor, Michael; Li, Johnson

2014-05-01

Surface mining activities often produce large volumes of solid wastes which invariably requires the removal of significant quantities of waste rock (overburden). As mines expand, larger volumes of waste rock need to be moved which also require extensive areas for their safe disposal and containment. The erosion of these dumps may result in landform instability, which in turn may result in exposure of contaminants such as trace metals, elevated sediment delivery in adjacent waterways, and the subsequent degradation of downstream water quality. The management of solid waste materials from industrial operations is also a key component for a sustainable economy. For example, in addition to overburden, coal mines produce large amounts of waste in the form of fly ash while sewage treatment plants require disposal of large amounts of compost. Similarly, paper mills produce large volumes of alkaline rejected wood chip waste which is usually disposed of in landfill. These materials, therefore, presents a challenge in their use, and re-use in the rehabilitation of mine sites and provides a number of opportunities for innovative waste disposal. The combination of solid wastes sourced from mines, which are frequently nutrient poor and acidic, with nutrient-rich composted material produced from sewage treatment and alkaline wood chip waste has the potential to lead to a soil suitable for mine rehabilitation and successful seed germination and plant growth. This paper presents findings from two pilot projects which investigated the potential of artificial soils to support plant growth for mine site rehabilitation. We found that pH increased in all the artificial soil mixtures and were able to support plant establishment. Plant growth was greatest in those soils with the greatest proportion of compost due to the higher nutrient content. These pot trials suggest that the use of different waste streams to form an artificial soil can potentially be used in mine site rehabilitation

Strange magnetic form factor of the proton at $Q^2 = 0.23$ GeV$^2$

Energy Technology Data Exchange (ETDEWEB)

Wang, Ping; Leinweber, Derek; Thomas, Anthony; Young, Ross

2009-06-01

We determine the $u$ and $d$ quark contributions to the proton magnetic form factor at finite momentum transfer by applying chiral corrections to quenched lattice data. Heavy baryon chiral perturbation theory is applied at next to leading order in the quenched, and full QCD cases for the valence sector using finite range regularization. Under the assumption of charge symmetry these values can be combined with the experimental values of the proton and neutron magnetic form factors to deduce a relatively accurate value for the strange magnetic form factor at $Q^2=0.23$ GeV$^2$, namely $G_M^s=-0.034 \\pm 0.021$ $\\mu_N$.

Methods of forming single source precursors, methods of forming polymeric single source precursors, and single source precursors and intermediate products formed by such methods

Science.gov (United States)

Fox, Robert V.; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin; Margulieux, Kelsey R.; Holland, Andrew W.

2012-12-04

Methods of forming single source precursors (SSPs) include forming intermediate products having the empirical formula 1/2{L.sub.2N(.mu.-X).sub.2M'X.sub.2}.sub.2, and reacting MER with the intermediate products to form SSPs of the formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2, wherein L is a Lewis base, M is a Group IA atom, N is a Group IB atom, M' is a Group IIIB atom, each E is a Group VIB atom, each X is a Group VIIA atom or a nitrate group, and each R group is an alkyl, aryl, vinyl, (per)fluoro alkyl, (per)fluoro aryl, silane, or carbamato group. Methods of forming polymeric or copolymeric SSPs include reacting at least one of HE.sup.1R.sup.1E.sup.1H and MER with one or more substances having the empirical formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2 or L.sub.2N(.mu.-X).sub.2M'(X).sub.2 to form a polymeric or copolymeric SSP. New SSPs and intermediate products are formed by such methods.

Remaining Sites Verification Package for the 100-F-46, 119-F Stack Sampling French Drain. Attachment to Waste Site Reclassification Form 2008-021

International Nuclear Information System (INIS)

Capron, J.M.

2008-01-01

The 100-F-46 french drain consisted of a 1.5 to 3 m long, vertically buried, gravel-filled pipe that was approximately 1 m in diameter. Also included in this waste site was a 5 cm cast-iron pipeline that drained condensate from the 119-F Stack Sampling Building into the 100-F-46 french drain. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

In Candida albicans hyphae, Sec2p is physically associated with SEC2 mRNA on secretory vesicles.

Science.gov (United States)

Caballero-Lima, David; Hautbergue, Guillaume M; Wilson, Stuart A; Sudbery, Peter E

2014-11-01

Candida albicans hyphae grow in a highly polarized fashion from their tips. This polarized growth requires the continuous delivery of secretory vesicles to the tip region. Vesicle delivery depends on Sec2p, the Guanine Exchange Factor (GEF) for the Rab GTPase Sec4p. GTP bound Sec4p is required for the transit of secretory vesicles from the trans-Golgi to sites of polarized growth. We previously showed that phosphorylation of Sec2p at residue S584 was necessary for Sec2p to support hyphal, but not yeast growth. Here we show that on secretory vesicles SEC2 mRNA is physically associated with Sec2p. Moreover, we show that the phosphorylation of S584 allows SEC2 mRNA to dissociate from Sec2p and we speculate that this is necessary for Sec2p function and/or translation. During hyphal extension, the growing tip may be separated from the nucleus by up to 15 μm. Transport of SEC2 mRNA on secretory vesicles to the tip localizes SEC2 translation to tip allowing a sufficient accumulation of this key protein at the site of polarized growth. © 2014 The Authors. Molecular Microbiology published by John Wiley & Sons Ltd.

On-site preparation of technetium-99m labeled human serum albumin for clinical application

International Nuclear Information System (INIS)

Wang Yuhfeng; Chuang Meihua; Cham Thauming; Chung Meiing; Chiu Jainnshiun

2007-01-01

Technetium-99m labeled human serum albumin (Tc-99m HSA) is an important radiopharmaceutical for clinical applications, such as cardiac function tests or protein-losing gastroenteropathy assessment. However, because of transfusion-induced infectious diseases, the safety of serum products is a serious concern. In this context, serum products acquired from patients themselves are the most ideal tracer. However, the development of rapid separation and easy clinical labeling methods is not yet well established. Under such situation, products from the same ethnic group or country are now recommended by the World Health Organization as an alternative preparation. This article describes the on-site preparation of Tc-99m HSA from locally supplied serum products. Different formulations were prepared and the labeling efficiency and stability were examined. Radio-labeling efficiencies were more than 90% in all preparation protocols, except for one that omitted the stannous solution. The most cost-effective protocol contained HSA 0.1 mg, treated with stannous fluoride 0.2 mg, and mixed with Tc-99m pertechnetate 30 mCi. A biodistribution study was performed in rats using a gamma camera immediately after intravenous administration of radiolabeled HSA. Tissue/organ uptake was obtained by measuring the radioactivity in organs after sacrificing the rats at timed intervals. The biologic half-life was about 32 min, determined from sequential venous blood collections. These data indicate that our preparation of Tc-99m HSA is useful and potentially applicable clinically. In addition, this on-site preparation provides the possibility of labeling a patient's own serum for subsequent clinical application. (author)

Methodology of site protection studies

International Nuclear Information System (INIS)

Farges, L.

1980-01-01

Preliminary studies preceding building of a nuclear facility aim at assessing the choice of a site and establishing operating and control procedures. These studies are of two types. Studies on the impact of environment on the nuclear facility to be constructed form one type and studies on the impact of nuclear facilities on the environment form the second type. A methodology giving a framework to studies of second type is presented. These studies are undertaken to choose suitable sites for nuclear facilities. After a preliminary selection of a site based on the first estimate, a detailed site study is undertaken. The procedure for this consists of five successive phases, namely, (1) an inquiry assessing the initial state of the site, (2) an initial synthesis of accumulated information for assessing the health and safety consequences of releases, (3) laboratory and field studies simulating the movement of waste products for a quantitative assessment of effects, (4) final synthesis for laying down the release limits and radiological control methods, and (5) conclusions based on comparing the data of final synthesis to the limits prescribed by regulations. These five phases are outlined. Role of periodic reassessments after the facility is in operation for same time is explained. (M.G.B.)

Characterization of bainitic/martensitic structures formed in isothermal treatments below the M

NARCIS (Netherlands)

Navarro Lopez, A.; Hidalgo Garcia, J.; Sietsma, J.; Santofimia Navarro, M.J.

2017-01-01

Advanced Multiphase High Strength Steels are generally obtained by applying isothermal treatments around the martensite start temperature (M_s). Previous investigations have shown that bainitic ferrite can form from austenite in isothermal treatments below M_s, where its

A Survey on M2M Service Networks

Directory of Open Access Journals (Sweden)

Juhani Latvakoski

2014-11-01

Full Text Available The number of industrial applications relying on the Machine to Machine (M2M services exposed from physical world has been increasing in recent years. Such M2M services enable communication of devices with the core processes of companies. However, there is a big challenge related to complexity and to application-specific M2M systems called “vertical silos”. This paper focuses on reviewing the technologies of M2M service networks and discussing approaches from the perspectives of M2M information and services, M2M communication and M2M security. Finally, a discussion on technologies and approaches potentially enabling future autonomic M2M service networks are provided. According to our conclusions, it is seen that clear definition of the architectural principles is needed to solve the “vertical silo” problem and then, proceeding towards enabling autonomic capabilities for solving complexity problem appears feasible. Several areas of future research have been identified, e.g., autonomic information based services, optimization of communications with limited capability devices, real-time messaging, creation of trust and end to end security, adaptability, reliability, performance, interoperability, and maintenance.

Phase relations in the systems M2MoO4-Cr2(MoO4)3-Zr(MoO4)2 (M=Li, Na, or Rb)

International Nuclear Information System (INIS)

Bazarov, B.G.; Chimitova, O.D.; Bazarova, Ts.T.; Arkhincheeva, S.I.; Bazarova, Zh.G.

2008-01-01

Phase equilibria in the systems M 2 MoO 4 -Cr 2 (MoO 4 ) 3 -Zr(MoO 4 ) 2 (M=Li, Na, or Rb) were investigated by X-ray powder diffraction analysis, DTA, and IR spectroscopy. The subsolidus structure of the phase diagrams of the systems under study was established. Two phases are formed in the Rb 2 MoO 4 -Cr 2 (MoO 4 ) 3 -Zr(MoO 4 ) 2 system with the molar ratios of the starting components equal to 5:1:1 (S 2 ) and 1:1:1 (S 1 ). Proceeding from isostructural character of Rb 5 FeHf(MoO 4 ) 6 and S 2 , the unit cell parameters are determined for S 2 [ru

SiteChar – Methodology for a Fit-for-Purpose Assessment of CO2 Storage Sites in Europe

Directory of Open Access Journals (Sweden)

Delprat-Jannaud F.

2015-04-01

Full Text Available The FP7-funded SiteChar project examined the entire CO2 geological storage site characterisation process, from the initial feasibility studies through to the final stage of application for a CO2 storage permit based on criteria defined by the relevant European legislation. The SiteChar workflow for CO2 geological storage site characterisation provides a description of all elements of a site characterisation study, as well as guidance to streamline the site characterisation process and make sure that the output covers the aspects mentioned in the European Community (EC Storage Directive. Five potential European storage sites, representative of prospective geological contexts, were considered as test sites for the research work: a North Sea multi-store site (hydrocarbon field and aquifer offshore Scotland; an onshore aquifer in Denmark; an onshore gas field in Poland; an aquifer offshore in Norway; and an aquifer in the Southern Adriatic Sea. This portfolio combines complementary sites that allowed to encompass the different steps of the characterisation workflow. A key innovation was the development of internal ‘dry-run’ permit applications at the Danish and Scottish sites and their review by relevant regulatory authorities. This process helped to refine the site characterisation workflow, and aimed to identify remaining gaps in site-specific characterisation, needed to secure storage permits under the EC Storage Directive as implemented in ‘host’ Member States. SiteChar considered the important aspect of the public awareness and public opinions of these new technologies, in parallel to technical issues, on the onshore Polish and offshore Scottish sites. A new format to assist public opinion-forming processes was tested involving a small sample of local communities. Generic as well as site-specific information was made available to the general and local public via the internet and at information meetings. These exercises provide insight

Remedial Action Plan and Site Design for Stabilization of the Inactive Uranium Mill Tailings Site, Maybell, Colorado. Remedial action selection report: Attachment 2, Geology report, Final

Energy Technology Data Exchange (ETDEWEB)

1994-06-01

The Maybell uranium mill tailings site is 25 miles (mi) (40 kilometers [km]) west of the town of Craig, Colorado, in Moffat County, in the northwestern part of the state. The unincorporated town of Maybell is 5 road mi (8 km) southwest of the site. The designated site covers approximately 110 acres (ac) (45 hectares [ha]) and consists of a concave-shaped tailings pile and rubble from the demolition of the mill buildings buried in the former mill area. Contaminated materials at the Maybell processing site include the tailings pile, which has an average depth of 20 feet (ft) (6 meters [m]) and contains 2.8 million cubic yards (yd{sup 3}) (2.1 million cubic meters [m{sup 3}]) of tailings. The former mill processing area is on the north side of the site and contains 20,000 yd{sup 3} (15,000 m{sup 3}) of contaminated demolition debris. Off-pile contamination is present and includes areas adjacent to the tailings pile, as well as contamination dispersed by wind and surface water flow. The volume of off-pile contamination to be placed in the disposal cell is 550,000 yd{sup 3} (420,000 m{sup 3}). The total volume of contaminated materials to be disposed of as part of the remedial action is estimated to be 3.37 million yd{sup 3} (2.58 million m{sup 3}). Information presented in this Final Remedial Action Plan (RAP) and referenced in supporting documents represents the current disposal cell design features and ground water compliance strategy proposed by the US Department of Energy (DOE) for the Maybell, Colorado, tailings site. Both the disposal cell design and the ground water compliance strategy have changed from those proposed prior to the preliminary final RAP document as a result of prudent site-specific technical evaluations.

Remedial Action Plan and Site Design for Stabilization of the Inactive Uranium Mill Tailings Site, Maybell, Colorado. Remedial action selection report: Attachment 2, Geology report, Final

International Nuclear Information System (INIS)

1994-06-01

The Maybell uranium mill tailings site is 25 miles (mi) (40 kilometers [km]) west of the town of Craig, Colorado, in Moffat County, in the northwestern part of the state. The unincorporated town of Maybell is 5 road mi (8 km) southwest of the site. The designated site covers approximately 110 acres (ac) (45 hectares [ha]) and consists of a concave-shaped tailings pile and rubble from the demolition of the mill buildings buried in the former mill area. Contaminated materials at the Maybell processing site include the tailings pile, which has an average depth of 20 feet (ft) (6 meters [m]) and contains 2.8 million cubic yards (yd 3 ) (2.1 million cubic meters [m 3 ]) of tailings. The former mill processing area is on the north side of the site and contains 20,000 yd 3 (15,000 m 3 ) of contaminated demolition debris. Off-pile contamination is present and includes areas adjacent to the tailings pile, as well as contamination dispersed by wind and surface water flow. The volume of off-pile contamination to be placed in the disposal cell is 550,000 yd 3 (420,000 m 3 ). The total volume of contaminated materials to be disposed of as part of the remedial action is estimated to be 3.37 million yd 3 (2.58 million m 3 ). Information presented in this Final Remedial Action Plan (RAP) and referenced in supporting documents represents the current disposal cell design features and ground water compliance strategy proposed by the US Department of Energy (DOE) for the Maybell, Colorado, tailings site. Both the disposal cell design and the ground water compliance strategy have changed from those proposed prior to the preliminary final RAP document as a result of prudent site-specific technical evaluations

Regulation of Human Macrophage M1–M2 Polarization Balance by Hypoxia and the Triggering Receptor Expressed on Myeloid Cells-1

Directory of Open Access Journals (Sweden)

Federica Raggi

2017-09-01

Full Text Available Macrophages (Mf are a heterogeneous population of tissue-resident professional phagocytes and a major component of the leukocyte infiltrate at sites of inflammation, infection, and tumor growth. They can undergo diverse forms of activation in response to environmental factors, polarizing into specialized functional subsets. A common hallmark of the pathologic environment is represented by hypoxia. The impact of hypoxia on human Mf polarization has not been fully established. The objective of this study was to elucidate the effects of a hypoxic environment reflecting that occurring in vivo in diseased tissues on the ability of human Mf to polarize into classically activated (proinflammatory M1 and alternatively activated (anti-inflammatory M2 subsets. We present data showing that hypoxia hinders Mf polarization toward the M1 phenotype by decreasing the expression of T cell costimulatory molecules and chemokine homing receptors and the production of proinflammatory, Th1-priming cytokines typical of classical activation, while promoting their acquisition of phenotypic and secretory features of alternative activation. Furthermore, we identify the triggering receptor expressed on myeloid cells (TREM-1, a member of the Ig-like immunoregulatory receptor family, as a hypoxia-inducible gene in Mf and demonstrate that its engagement by an agonist Ab reverses the M2-polarizing effect of hypoxia imparting a M1-skewed phenotype to Mf. Finally, we provide evidence that Mf infiltrating the inflamed hypoxic joints of children affected by oligoarticular juvenile idiopatic arthritis express high surface levels of TREM-1 associated with predominant M1 polarization and suggest the potential of this molecule in driving M1 proinflammatory reprogramming in the hypoxic synovial environment.

Regulation of Human Macrophage M1–M2 Polarization Balance by Hypoxia and the Triggering Receptor Expressed on Myeloid Cells-1

Science.gov (United States)

Raggi, Federica; Pelassa, Simone; Pierobon, Daniele; Penco, Federica; Gattorno, Marco; Novelli, Francesco; Eva, Alessandra; Varesio, Luigi; Giovarelli, Mirella; Bosco, Maria Carla

2017-01-01

Macrophages (Mf) are a heterogeneous population of tissue-resident professional phagocytes and a major component of the leukocyte infiltrate at sites of inflammation, infection, and tumor growth. They can undergo diverse forms of activation in response to environmental factors, polarizing into specialized functional subsets. A common hallmark of the pathologic environment is represented by hypoxia. The impact of hypoxia on human Mf polarization has not been fully established. The objective of this study was to elucidate the effects of a hypoxic environment reflecting that occurring in vivo in diseased tissues on the ability of human Mf to polarize into classically activated (proinflammatory M1) and alternatively activated (anti-inflammatory M2) subsets. We present data showing that hypoxia hinders Mf polarization toward the M1 phenotype by decreasing the expression of T cell costimulatory molecules and chemokine homing receptors and the production of proinflammatory, Th1-priming cytokines typical of classical activation, while promoting their acquisition of phenotypic and secretory features of alternative activation. Furthermore, we identify the triggering receptor expressed on myeloid cells (TREM)-1, a member of the Ig-like immunoregulatory receptor family, as a hypoxia-inducible gene in Mf and demonstrate that its engagement by an agonist Ab reverses the M2-polarizing effect of hypoxia imparting a M1-skewed phenotype to Mf. Finally, we provide evidence that Mf infiltrating the inflamed hypoxic joints of children affected by oligoarticular juvenile idiopatic arthritis express high surface levels of TREM-1 associated with predominant M1 polarization and suggest the potential of this molecule in driving M1 proinflammatory reprogramming in the hypoxic synovial environment. PMID:28936211

mHealth Series: mHealth project in Zhao County, rural China – Description of objectives, field site and methods

Directory of Open Access Journals (Sweden)

Michelle Helena van Velthoven

2013-12-01

Full Text Available We set up a collaboration between researchers in China and the UK that aimed to explore the use of mHealth in China. This is the first paper in a series of papers on a large mHealth project part of this collaboration. This paper included the aims and objectives of the mHealth project, our field site, and the detailed methods of two studies.

Adoptive transfer of M2 macrophages reduces neuropathic pain via opioid peptides.

Science.gov (United States)

Pannell, Maria; Labuz, Dominika; Celik, Melih Ö; Keye, Jacqueline; Batra, Arvind; Siegmund, Britta; Machelska, Halina

2016-10-07

During the inflammation which occurs following nerve damage, macrophages are recruited to the site of injury. Phenotypic diversity is a hallmark of the macrophage lineage and includes pro-inflammatory M1 and anti-inflammatory M2 populations. Our aim in this study was to investigate the ability of polarized M0, M1, and M2 macrophages to secrete opioid peptides and to examine their relative contribution to the modulation of neuropathic pain. Mouse bone marrow-derived cells were cultured as unstimulated M0 macrophages or were stimulated into an M1 phenotype using lipopolysaccharide and interferon-γ or into an M2 phenotype using interleukin-4. The macrophage phenotypes were verified using flow cytometry for surface marker analysis and cytokine bead array for cytokine profile assessment. Opioid peptide levels were measured by radioimmunoassay and enzyme immunoassay. As a model of neuropathic pain, a chronic constriction injury (CCI) of the sciatic nerve was employed. Polarized M0, M1, and M2 macrophages (5 × 10 5 cells) were injected perineurally twice, on days 14 and 15 following CCI or sham surgery. Mechanical and heat sensitivity were measured using the von Frey and Hargreaves tests, respectively. To track the injected macrophages, we also transferred fluorescently stained polarized cells and analyzed the surface marker profile of endogenous and injected cells in the nerves ex vivo. Compared to M0 and M1 cells, M2 macrophages contained and released higher amounts of opioid peptides, including Met-enkephalin, dynorphin A (1-17), and β-endorphin. M2 cells transferred perineurally at the nerve injury site reduced mechanical, but not heat hypersensitivity following the second injection. The analgesic effect was reversed by the perineurally applied opioid receptor antagonist naloxone methiodide. M2 cells did not affect sensitivity following sham surgery. Neither M0 nor M1 cells altered mechanical and heat sensitivity in CCI or sham-operated animals. Tracing the

Thermal modelling. Preliminary site description Simpevarp subarea - version 1.2

International Nuclear Information System (INIS)

Sundberg, Jan; Back, Paer-Erik; Bengtsson, Anna; Laendell, Maerta

2005-08-01

This report presents the thermal site descriptive model for the Simpevarp subarea, version 1.2. The main objective of this report is to present the thermal modelling work where data has been identified, quality controlled, evaluated and summarised in order to make an upscaling to lithological domain level possible. The thermal conductivity at possible canister scale has been modelled for four different lithological domains (RSMA01 (Aevroe granite), RSMB01 (Fine-grained dioritoid), RSMC01 (mixture of Aevroe granite and Quartz monzodiorite), and RSMD01 (Quartz monzodiorite)). A main modelling approach has been used to determine the mean value of the thermal conductivity. Three alternative/complementary approaches have been used to evaluate the spatial variability of the thermal conductivity at domain level. The thermal modelling approaches are based on the lithological model for the Simpevarp subarea, version 1.2 together with rock type models constituted from measured and calculated (from mineral composition) thermal conductivities. For one rock type, the Aevroe granite (501044), density loggings within the specific rock type has also been used in the domain modelling in order to consider the spatial variability within the Aevroe granite. This has been possible due to the presented relationship between density and thermal conductivity, valid for the Aevroe granite. Results indicate that the mean of thermal conductivity is expected to exhibit only a small variation between the different domains, from 2.62 W/(m.K) to 2.80 W/(m.K). The standard deviation varies according to the scale considered and for the canister scale it is expected to range from 0.20 to 0.28 W/(m.K). Consequently, the lower confidence limit (95% confidence) for the canister scale is within the range 2.04-2.35 W/(m.K) for the different domains. The temperature dependence is rather small with a decrease in thermal conductivity of 1.1-3.4% per 100 deg C increase in temperature for the dominating rock

Human papillomavirus type 16 E2 and E6 are RNA-binding proteins and inhibit in vitro splicing of pre-mRNAs with suboptimal splice sites

International Nuclear Information System (INIS)

Bodaghi, Sohrab; Jia Rong; Zheng Zhiming

2009-01-01

Human papillomavirus type 16 (HPV16) genome expresses six regulatory proteins (E1, E2, E4, E5, E6, and E7) which regulate viral DNA replication, gene expression, and cell function. We expressed HPV16 E2, E4, E6, and E7 from bacteria as GST fusion proteins and examined their possible functions in RNA splicing. Both HPV16 E2, a viral transactivator protein, and E6, a viral oncoprotein, inhibited splicing of pre-mRNAs containing an intron with suboptimal splice sites, whereas HPV5 E2 did not. The N-terminal half and the hinge region of HPV16 E2 as well as the N-terminal and central portions of HPV16 E6 are responsible for the suppression. HPV16 E2 interacts with pre-mRNAs through its C-terminal DNA-binding domain. HPV16 E6 binds pre-mRNAs via nuclear localization signal (NLS3) in its C-terminal half. Low-risk HPV6 E6, a cytoplasmic protein, does not bind RNA. Notably, both HPV16 E2 and E6 selectively bind to the intron region of pre-mRNAs and interact with a subset of cellular SR proteins. Together, these findings suggest that HPV16 E2 and E6 are RNA binding proteins and might play roles in posttranscriptional regulation during virus infection

M1 and M2 Monocytes in Rheumatoid Arthritis: A Contribution of Imbalance of M1/M2 Monocytes to Osteoclastogenesis

Directory of Open Access Journals (Sweden)

Shoichi Fukui

2018-01-01

Full Text Available ObjectivesWe investigated the relationships among M1 monocytes, M2 monocytes, osteoclast (OC differentiation ability, and clinical characteristics in patients with rheumatoid arthritis (RA.MethodsPeripheral blood mononuclear cells (PBMCs were isolated from RA patients and healthy donors, and we then investigated the number of M1 monocytes or M2 monocytes by fluorescence-activated cell sorting. We also obtained and cultured CD14-positive cells from PBMCs from RA patients and healthy donors to investigate OC differentiation in vitro.ResultsForty RA patients and 20 healthy donors were included. Twenty-two patients (55% were anticitrullinated protein antibody (ACPA positive. The median M1/M2 ratio was 0.59 (0.31–1.11, interquartile range. There were no significant differences between the RA patients and healthy donors. There was a positive correlation between the M1/M2 ratio and the differentiated OC number in vitro in RA patients (ρ = 0.81, p < 0.001. The ACPA-positive patients had significantly higher M1/M2 ratios in vivo (p = 0.028 and significantly greater numbers of OCs in vitro (p = 0.005 than the ACPA-negative patients. Multivariable regression analysis revealed that the M1/M2 ratio was the sole significant contribution factor to in vitro osteoclastogenesis. RA patients with M1/M2 ratios >1 (having relatively more M1 monocytes had higher C-reactive protein and erythrocyte sedimentation rates than RA patients with M1/M2 ratios ≤1. M1-dominant monocytes in vitro produced higher concentrations of interleukin-6 upon stimulation with lipopolysaccharide than M2 monocytes.ConclusionM1/M2 monocytes imbalance strongly contributes to osteoclastogenesis of RA patients. Our findings cast M1 and M2 monocyte subsets in a new light as a new target of treatments for RA to prevent progression of osteoclastic bone destruction.

Crystal structure of the high-affinity Na+,K+-ATPase–ouabain complex with Mg2+ bound in the cation binding site

DEFF Research Database (Denmark)

Laursen, Mette; Yatime, Laure; Nissen, Poul

2013-01-01

of ouabain and the side chains of αM1, αM2, and αM6. Furthermore, the structure reveals that cation transport site II is occupied by Mg2+, and crystallographic studies indicate that Rb+ and Mn2+, but not Na+, bind to this site. Comparison with the low-affinity [K2]E2–MgFx–ouabain structure [Ogawa et al...

A conformation-specific interhelical salt bridge in the K+ binding site of gastric H,K-ATPase.

NARCIS (Netherlands)

Koenderink, J.B.; Swarts, H.G.P.; Willems, P.H.G.M.; Krieger, E.; Pont, J.J.H.H.M. de

2004-01-01

Homology modeling of gastric H,K-ATPase based on the E2 model of sarcoplasmic reticulum Ca2+-ATPase (Toyoshima, C., and Nomura, H. (2002) Nature 392, 835-839) revealed the presence of a single high-affinity binding site for K+ and an E2 form-specific salt bridge between Glu820 (M6) and Lys791 (M5).

Endothelin: Visualization of mRNAs by in situ hybridization provides evidence for local action

International Nuclear Information System (INIS)

MacCumber, M.W.; Ross, C.A.; Glaser, B.M.; Snyder, S.H.

1989-01-01

Endothelin (ET) is a recently identified vasoactive peptide with three isoforms for which three genes have been cloned. The cellular sites of synthesis of this peptide have not yet been identified in vivo. Using Northern blot analysis, we have detected two forms of ET mRNA in rat tissues: a 3.7-kilobase form in the kidney, eye, and brain, a 2.5-kilobase form in the intestine, and both forms in the lung. We have localized these forms of ET mRNA in several rat tissues using in situ hybridization. In the 19-day rat fetus, ET mRNA is highest in the lung, intestine, and meninges. At high resolution, ET mRNA is localized in the lung to respiratory epithelial cells of bronchioles and apparently in blood vessels. In adult tissues, ET mRNA is present throughout the lung, in the renal medulla vasa recta, and in the iris of the eye. ET mRNA is synthesized in close proximity to ET binding sites in many organs (e.g., lung, kidney, intestine, and eye), suggesting a local action of this peptide. However, in other areas (e.g., heart and renal cortex), ET binding sites are present in the absence of ET mRNA, suggesting an action of ET from the bloodstream or from neurons. Northern blot analysis of ET mRNA in microvascular endothelial cells in culture indicates that ET is synthesized in small blood vessels and regulated similarly to its regulation in large vessels. Our results provide evidence that ET, like other regulatory peptides, may serve in several tissues as a neuromodulator or local hormone

The Type 3 copper site is intact but labile in Type 2-depleted laccase

DEFF Research Database (Denmark)

Frank, P; Farver, O; Pecht, I

1983-01-01

We report results of experiments designed to characterize the Type 1 and Type 3 copper sites in Rhus laccase depleted of Type 2 copper (T2D). Use of the Lowry method for determining protein concentration yielded the value 5620 +/- 570 M-1 cm-1 for the extinction of the 615-nm absorption band...... as intensity perturbations at 280 and 615 nm. Comparison of difference spectra show that this 330-nm band derives from a Type 3 copper-bound peroxide and not from a reoxidized Type 3 site. Dioxygen reoxidation of ascorbate-reduced T2D laccase produced new difference bands at 330 nm (delta epsilon = 770 M-1 cm...

SUB-MILLIMETER TELESCOPE CO (2-1) OBSERVATIONS OF NEARBY STAR-FORMING GALAXIES

Energy Technology Data Exchange (ETDEWEB)

Jiang, Xue-Jian; Gu, Qiusheng [School of Astronomy and Space Science, Nanjing University, Nanjing 210093 (China); Wang, Zhong [Harvard-Smithsonian Center for Astrophysics, MS 66, 60 Garden Street, Cambridge, MA 02138 (United States); Wang, Junzhi [Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China); Zhang, Zhi-Yu, E-mail: xjjiang@nju.edu.cn [The UK Astronomy Technology Centre, Royal Observatory Edinburgh, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom)

2015-01-20

We present CO J = 2-1 observations toward 32 nearby gas-rich star-forming galaxies selected from the ALFALFA and Wide-field Infrared Survey Explorer (WISE) catalogs, using the Sub-millimeter Telescope (SMT). Our sample is selected to be dominated by intermediate-M {sub *} galaxies. The scaling relations between molecular gas, atomic gas, and galactic properties (stellar mass, NUV – r, and WISE color W3 – W2) are examined and discussed. Our results show the following. (1) In the galaxies with stellar mass M {sub *} ≤10{sup 10} M {sub ☉}, the H I fraction (f {sub H} {sub I} ≡ M {sub H} {sub I}/M {sub *}) is significantly higher than that of more massive galaxies, while the H{sub 2} gas fraction (f{sub H{sub 2}} ≡ M{sub H{sub 2}}/M {sub *}) remains nearly unchanged. (2) Compared to f{sub H{sub 2}}, f {sub H} {sub I} correlates better with both M {sub *} and NUV – r. (3) A new parameter, WISE color W3 – W2 (12-4.6 μm), is introduced, which is similar to NUV – r in tracing star formation activity, and we find that W3 – W2 has a tighter anti-correlation with log f{sub H{sub 2}} than the anti-correlation of (NUV – r)-f {sub H} {sub I}, (NUV – r)-f{sub H{sub 2}}, and (W3 – W2)-f {sub H} {sub I}. This indicates that W3 – W2 can trace the H{sub 2} fraction in galaxies. For the gas ratio M{sub H{sub 2}}/M {sub H} {sub I} , only in the intermediate-M {sub *} galaxies it appears to depend on M {sub *} and NUV – r. We find a tight correlation between the molecular gas mass M{sub H{sub 2}} and 12 μm (W3) luminosities (L {sub 12} {sub μm}), and the slope is close to unity (1.03 ± 0.06) for the SMT sample. This correlation may reflect that the cold gas and dust are well mixed on a global galactic scale. Using the all-sky 12 μm (W3) data available in WISE, this correlation can be used to estimate CO flux for molecular gas observations and can even predict H{sub 2} mass for star-forming galaxies.

Forms and rates of release of Cs-137 in 2 peat soils

International Nuclear Information System (INIS)

Livens, F.R.; Howe, M.T.; Hemingway, J.D.; Goulding, K.W.T.; Howard, B.J.; IACR Rothamsted, Harpenden; Liverpool Univ.; Institute of Terrestrial Ecology, Grange-on-Sands

1996-01-01

Cation exchange resin saturated with H+ and Ca2+ was used to extract Cs-137 from peat soil at two sites in Britain affected by Cs-137 deposition following the Chernobyl accident. The technique identified three classes of Cs-137, similar to those observed for K+ in soils: ''Fast'', ''Intermediate'' and ''Slow''. These classes are probably related to the selectivity for Cs-137 of the cation exchange sites on the organic matter and the clay minerals, and to the structure of the soil. With one exception, most Cs-137 was in the ''Slow'' form and was only very slowly released to the resins, if at all. However, there was enough Cs-137 in the ''Fast'' and ''Intermediate'' forms to contaminate pasture and thus grazing animals for some years. Based on the resin technique, it is estimated that contamination will persist for several decades in uplands contaminated at these activity concentrations. (Author)

Unprecedented multiplicity of Ig transmembrane and secretory mRNA forms in the cartilaginous fish.

Science.gov (United States)

Rumfelt, Lynn L; Diaz, Marilyn; Lohr, Rebecca L; Mochon, Evonne; Flajnik, Martin F

2004-07-15

In most jawed vertebrates including cartilaginous fish, membrane-bound IgM is expressed as a five Ig superfamily (Igsf)-domain H chain attached to a transmembrane (Tm) region. Heretofore, bony fish IgM was the one exception with IgM mRNA spliced to produce a four-domain Tm H chain. We now demonstrate that the Tm and secretory (Sec) mRNAs of the novel cartilaginous fish Ig isotypes, IgW and IgNAR, are present in multiple forms, most likely generated by alternative splicing. In the nurse shark, Ginglymostoma cirratum, and horn shark, Heterodontus francisci, alternative splicing of Tm exons to the second or the fourth constant (C(H)) exons produces two distinct IgW Tm cDNAs. Although the seven-domain IgW Sec cDNA form contains a canonical secretory tail shared with IgM, IgNAR, and IgA, we report a three-domain cDNA form of shark IgW (IgW(short)) having an unusual Sec tail, which is orthologous to skate IgX(short) cDNA. The IgW and IgW(short) Sec transcripts are restricted in their tissue distribution and expression levels vary among individual sharks, with all forms expressed early in ontogeny. IgNAR mRNA is alternatively spliced to produce a truncated four-domain Tm cDNA and a second Tm cDNA is expressed identical in Igsf domains as the Sec form. PBL is enriched in the Tm cDNA of these Igs. These molecular data suggest that cartilaginous fish have augmented their humoral immune repertoire by diversifying the sizes of their Ig isotypes. Furthermore, these Tm cDNAs are prototypical and the truncated variants may translate as more stable protein at the cell surface.

Safety analysis report for packaging: the ORNL DOT specification 6M - special form package

Energy Technology Data Exchange (ETDEWEB)

Schaich, R.W.

1982-07-01

The ORNL DOT Specification 6M - Special Form Package was fabricated at the Oak Ridge Nation al Laboratory (ORNL) for the transport of Type B solid non-fissile radioactive materials in special form. The package was evaluated on the basis of tests performed by the Dow Chemical Company, Rocky Flats Division, on the DOT-6M container and special form tests performed on a variety of stainless steel capsules at ORNL by Operations Division personnel. The results of these evaluations demonstrate that the package is in compliance with the applicable regulations for the transport of Type B quantities in special form of non-fissile radioactive materials.

Safety analysis report for packaging: the ORNL DOT specification 6M - special form package

International Nuclear Information System (INIS)

Schaich, R.W.

1982-07-01

The ORNL DOT Specification 6M - Special Form Package was fabricated at the Oak Ridge Nation al Laboratory (ORNL) for the transport of Type B solid non-fissile radioactive materials in special form. The package was evaluated on the basis of tests performed by the Dow Chemical Company, Rocky Flats Division, on the DOT-6M container and special form tests performed on a variety of stainless steel capsules at ORNL by Operations Division personnel. The results of these evaluations demonstrate that the package is in compliance with the applicable regulations for the transport of Type B quantities in special form of non-fissile radioactive materials

Emergence of interest groups on hazardous waste siting: How do they form and survive

International Nuclear Information System (INIS)

Williams, R.G.; Payne, B.A.

1986-01-01

The disposal and siting of hazardous and radioactive wastes has created numerous problems for decision-makers in the field of waste management. The social/political problems have proven to be some of the most difficult to solve. Public knowledge of the presence of hazardous and radioactive waste sites has grown considerably in recent years. Over the same period, the process of choosing new disposal sites has attracted a great deal of publicity. In many cases, when existing sites are discovered or when a community is being considered for a new disposal site, organized groups emerge in the community to support or oppose the proposed actions and the decision-makers responsible. Emergent groups are a form of organized collective action in response to a particular situation or event, such as the siting or discovery of a hazardous waste disposal site. Sociological methods and theory can provide insight on the patterns common to these groups, their emergence, and their survival or decline. The questions addressed in this paper are: what are the variables that lead to the formation of such groups, and what conditions or group actions contribute to their growth and survival?

One Gene and Two Proteins: a Leaderless mRNA Supports the Translation of a Shorter Form of the Shigella VirF Regulator.

Science.gov (United States)

Di Martino, Maria Letizia; Romilly, Cédric; Wagner, E Gerhart H; Colonna, Bianca; Prosseda, Gianni

2016-11-08

VirF, an AraC-like activator, is required to trigger a regulatory cascade that initiates the invasive program of Shigella spp., the etiological agents of bacillary dysentery in humans. VirF expression is activated upon entry into the host and depends on many environmental signals. Here, we show that the virF mRNA is translated into two proteins, the major form, VirF 30 (30 kDa), and the shorter VirF 21 (21 kDa), lacking the N-terminal segment. By site-specific mutagenesis and toeprint analysis, we identified the translation start sites of VirF 30 and VirF 21 and showed that the two different forms of VirF arise from differential translation. Interestingly, in vitro and in vivo translation experiments showed that VirF 21 is also translated from a leaderless mRNA (llmRNA) whose 5' end is at position +309/+310, only 1 or 2 nucleotides upstream of the ATG84 start codon of VirF 21 The llmRNA is transcribed from a gene-internal promoter, which we identified here. Functional analysis revealed that while VirF 30 is responsible for activation of the virulence system, VirF 21 negatively autoregulates virF expression itself. Since VirF 21 modulates the intracellular VirF levels, this suggests that transcription of the llmRNA might occur when the onset of the virulence program is not required. We speculate that environmental cues, like stress conditions, may promote changes in virF mRNA transcription and preferential translation of llmRNA. Shigella spp. are a major cause of dysentery in humans. In bacteria of this genus, the activation of the invasive program involves a multitude of signals that act on all layers of the gene regulatory hierarchy. By controlling the essential genes for host cell invasion, VirF is the key regulator of the switch from the noninvasive to the invasive phenotype. Here, we show that the Shigella virF gene encodes two proteins of different sizes, VirF 30 and VirF 21 , that are functionally distinct. The major form, VirF 30 , activates the genes

FoxP3 mRNA splice forms in synovial CD4+ T cells in rheumatoid arthritis and psoriatic arthritis

DEFF Research Database (Denmark)

Ryder, L Rebekka; Bartels, Else Marie; Woetmann, Anders

2012-01-01

Our aim was to elucidate the relative amount of the different splice forms of FoxP3 mRNA in CD4+ T cells in peripheral blood (PB) compared to synovial fluid (SF) in RA and PsA patients. FoxP3 mRNA was measured using a quantitative real-time PCR method. CD4+ T cells were isolated from 17 paired...... samples of PB and SF from RA and PsA patients, and PB from 10 controls. FoxP3fl and FoxP3Δ2 mRNA was significantly increased (6.7 and 2.1-fold, respectively) in PB CD4+ T cells from RA patients compared to controls. FoxP3fl and Δ2 mRNA in SF CD4+ T cells was increased compared to controls in sero......-negative RA and PsA, but not in sero-positive RA patients, who had a high FoxP3 expression in both PB and SF. The FoxP3Δ2Δ7 mRNA was barely detectable in patient samples, and not at all in healthy individuals. We provide evidence of an increased expression of FoxP3 splice forms in synovial CD4+ T cells from...

Generation of Cu–In alloy surfaces from CuInO2 as selective catalytic sites for CO2 electroreduction

KAUST Repository

Jedidi, Abdesslem

2015-08-11

The lack of availability of efficient, selective and stable electrocatalysts is a major hindrance for scalable CO2 reduction processes. Herein, we report the generation of Cu–In alloy surfaces for electrochemical reduction of CO2 from mixed metal oxides of CuInO2 as the starting material. The material successfully generates selective active sites to form CO from CO2 electroreduction at mild overpotentials. Density functional theory (DFT) indicates that the site occupation of the inert In occurs more on the specific sites of Cu. In addition, while In atoms do not preferentially adsorb H or CO, Cu atoms, which neighbor the In atoms, alters the preference of their adsorption. This preference for site occupation and altered adsorption may account for the improved selectivity over that observed for Cu metal. This study demonstrates an example of a scalable synthesis method of bimetallic surfaces utilized with the mixed oxide precursor having the diversity of metal choice, which may drastically alter the electrocatalytic performance, as presented herein.

Generation of Cu–In alloy surfaces from CuInO2 as selective catalytic sites for CO2 electroreduction

KAUST Repository

Jedidi, Abdesslem; Rasul, Shahid; Masih, Dilshad; Cavallo, Luigi; Takanabe, Kazuhiro

2015-01-01

The lack of availability of efficient, selective and stable electrocatalysts is a major hindrance for scalable CO2 reduction processes. Herein, we report the generation of Cu–In alloy surfaces for electrochemical reduction of CO2 from mixed metal oxides of CuInO2 as the starting material. The material successfully generates selective active sites to form CO from CO2 electroreduction at mild overpotentials. Density functional theory (DFT) indicates that the site occupation of the inert In occurs more on the specific sites of Cu. In addition, while In atoms do not preferentially adsorb H or CO, Cu atoms, which neighbor the In atoms, alters the preference of their adsorption. This preference for site occupation and altered adsorption may account for the improved selectivity over that observed for Cu metal. This study demonstrates an example of a scalable synthesis method of bimetallic surfaces utilized with the mixed oxide precursor having the diversity of metal choice, which may drastically alter the electrocatalytic performance, as presented herein.

Order-disorder transition and electrical conductivity of the brownmillerite solid-solutions system Ba2(In, M)2O5 (M=Ga, Al)

International Nuclear Information System (INIS)

Yamamura, Hiroshi; Hamazaki, Hirohumi; Kakinuma, Katsuyoshi; Mori, Toshiyuki; Haneda, Hajime

1999-01-01

The brownmillerite solid-solution systems Ba 2 (In 1-x M x ) 2 O 5 (M=Ga, Al) were investigated by means of high-temperature X-ray diffraction (XRD), dilatometry, and electrical-conductivity measurements. XRD showed that the Ba 2 (In 1-x Ga x ) 2 O 5 system had orthorhombic symmetry in the composition range 0.0≤x≤0.2 and cubic symmetry in the range 0.3≤x. The Al system also changed to cubic symmetry from orthorhombic symmetry in the range 0.2≤x. While the orthorhombic phase showed an order-disorder transition in the electrical conductivity measurements, the transition temperature decreased with increasing the M content. The order-disorder transition temperature and the crystal-structure transition temperature were very different. Such a transition was not observed in the cubic phases, and their electrical conductivity were fairly low compared to those of the disordered cubic phase after the transition due to the heating process. These phenomena are discussed in terms of disordering of the tetrahedral site in the brownmillerite structure, which is occupied by the smaller Ga 3+ or Al 3+ rather than ny In 3+

Verification of geomechanical integrity and prediction of long-term mineral trapping for the Ketzin CO2 storage pilot site

Science.gov (United States)

Kempka, Thomas; De Lucia, Marco; Kühn, Michael

2014-05-01

.1 %, respectively. We verified the mechanical integrity of the storage system during site operation and predicted the trapping mechanisms for the Ketzin pilot site based on a time-dependent integration of relevant processes for a time period of 16,000 years. Supported by our coupled modelling results, we conclude that CO2 storage at the Ketzin site is safe and reliable on the pilot scale. References [1] Martens, S., Kempka, T., Liebscher, A., Lüth, S., Möller, F., Myrttinen, A., Norden, B., Schmidt-Hattenberger, C., Zimmer, M., Kühn, M. Europe's longest-operating on-shore CO2 storage site at Ketzin, Germany: a progress report after three years of injection. Environmental Earth Sciences 2012 67(2): 323-334. [2] Kempka, T., Kühn, M. Numerical simulations of CO2 arrival times and reservoir pressure coincide with observations from the Ketzin pilot site, Germany. Environmental Earth Sciences 2013 70(8): 3675-3685. [3] Kempka, T., Klein, E., De Lucia, M., Tillner, E., Kühn, M. Assessment of Long-term CO2 Trapping Mechanisms at the Ketzin Pilot Site (Germany) by Coupled Numerical Modelling. Energy Procedia 2013 37: 5419-5426. [4] Klein, E., De Lucia, M., Kempka, T., Kühn, M. Evaluation of long-term mineral trapping at the Ketzin pilot site for CO2 storage: An integrative approach using geochemical modelling and reservoir simulation. International Journal of Greenhouse Gas Control 2013 19: 720-730.

Lithological and structural bedrock model of the Haestholmen study site, Loviisa, SE Finland

International Nuclear Information System (INIS)

Front, K.; Paulamaeki, S.; Ahokas, H.; Anttila, P.

1999-10-01

The Haestholmen study site is located within the anorogenic Wiborg rapakivi granite batholith, 1640 1630 Ma in age. The bedrock consists of various rapakivi granites, which can be divided into three groups or lithological units: (1) wiborgite and pyterlite, (2) porphyritic rapakivi granite, and (3) even-grained or weakly porphyritic rapakivi granite, pyterlite being the dominant rock type. The evengrained and weakly porphyritic rapakivi granite has been interpreted to form a younger intrusive unit with a thickness of ca. 500 m, dipping approx. 20 deg to the NNW-NNE. Surface fractures form a distinct orthogonal system, with three perpendicular fracture directions: fractures dipping steeply (dip >75 deg) to the NE-SW and NW-SE plus subhorizontal (dip -3 m 2 /s to 1*10 -7 m 2 /s, the average being 1-10 -5 m 2 /s. (orig.)

Genetic analysis of attTn7, the transposon Tn7 attachment site in Escherichia coli, using a novel M13-based transduction assay.

Science.gov (United States)

Qadri, M I; Flores, C C; Davis, A J; Lichtenstein, C P

1989-05-05

The large (14 kb; kb = 10(3) bases) bacterial transposon, Tn7 (encoding resistance to trimethoprim and streptomycin/spectinomycin), has unusual properties. Like other elements, Tn7 transposes with low efficiency and low target-site specificity, but Tn7 also transposes, with high frequency in a unique orientation, to a preferred "attachment" site, called attTn7, in the Escherichia coli chromosome and similarly into plasmids containing attTn7. We developed a novel bacteriophage M13-based assay system to measure the transposition frequency of Tn7 to M13mp phage vectors containing attTn7 on a cloned 1 kb fragment of chromosomal DNA. Phage harvested from a Tn7 donor strain were used to infect recipient bacteria with selection for trimethoprim resistance. Transposition frequency, expressed as the number of trimethoprim-resistant colonies per plaque-forming unit, was found to be approximately 10(-4) to M13mp::attTn7, in contrast to 10(-10) to M13mp recombinants with approximately 1 kb insertions of other, "generic brand", DNA. By deletion analysis of M13mp::attTn7, we show that attTn7 is contained within a 64 base-pair region; sequences adjacent to the actual insertion site and encoding the carboxy terminus of the glmS gene are required. This assay also provided evidence for transposition immunity conferred by the right end of Tn7.

Seismic monitoring at the Decatur, Ill., CO2 sequestration demonstration site

Science.gov (United States)

Kaven, Joern; Hickman, Stephen H.; McGarr, Arthur F.; Walter, Steve R.; Ellsworth, William L.

2014-01-01

The viability of carbon capture and storage (CCS) to reduce emissions of greenhouse gases depends on the ability to safely sequester large quantities of CO2 over geologic time scales. One concern with CCS is the potential of induced seismicity. We report on ongoing seismic monitoring by the U.S. Geological Survey (USGS) at a CCS demonstration site in Decatur, IL, in an effort to understand the potential hazards posed by injection-induced seismicity associated with geologic CO2 sequestration. At Decatur, super-critical CO2 is injected at 2.1 km depth into the 550-m-thick Mt. Simon Sandstone, which directly overlies granitic basement. The primary sealing cap rock is the Eau Claire Shale, a 100- to 150-m-thick unit at a depth of roughly 1.5 km. The USGS seismic network consists of 12 stations, three of which have surface accelerometers and three-component borehole geophones. We derived a one-dimensional velocity models from a vertical seismic profile acquired by Archer-Daniels-Midland (ADM) and the Illinois State Geological Survey (ISGS) to a depth of 2.2 km, tied into shallow acoustic logs from our borehole stations and assuming a 6 km/sec P-wave velocity for granite below 2.2 km. We further assume a constant ratio of P- to S-wave velocities of 1.83, as derived from velocity model inversions. We use this velocity model to locate seismic events, all of which are within the footprint of our network. So far magnitudes of locatable events range from Mw = -1.52 to 1.07. We further improved the hypocentral precision of microseismic events when travel times and waveforms are sufficiently similar by employing double-difference relocation techniques, with relative location errors less than 80 m horizontally and 100 m vertically. We observe tend to group in three distinct clusters: ∼0.4 to 1.0 km NE, 1.6 to 2.4 km N, and ∼1.8 to 2.6 km WNW from the injection well. The first cluster of microseismicity forms a roughly linear trend, which may represent a pre-existing geologic

A Casting Form from the Muranka Unfortified Site on the Usa River

Directory of Open Access Journals (Sweden)

Stashenkov Dmitry A.

2012-03-01

Full Text Available A new find from Muranka unfortified settlement, one of major Golden Horde period sites in the Middle Volga river region is published. It is a double-sided stone mould intended for casting jewelry. Each side of the form was used for casting individual jewelry items: women's hair, head and costume decorations. The head ornaments include two temple rings and earrings shaped as question marks. One more decorative element, styled as a bird’s figure could be either part of some complex piece or an individual product. The other side of the form was used for casting two product varieties: belt buckles and pendants. The mould is of high-quality workmanship. The exact analogy of this rare find is not yet known.

DEVELOPMENT, QUALIFICATION, AND DISPOSAL OF AN ALTERNATIVE IMMOBILIZED LOW-ACTIVITY WASTE FORM AT THE HANFORD SITE

International Nuclear Information System (INIS)

Sams, T.L.; Edge, J.A.; Swanberg, D.J.; Robbins, R.A.

2011-01-01

Demonstrating that a waste form produced by a given immobilization process is chemically and physically durable as well as compliant with disposal facility acceptance criteria is critical to the success of a waste treatment program, and must be pursued in conjunction with the maturation of the waste processing technology. Testing of waste forms produced using differing scales of processing units and classes of feeds (simulants versus actual waste) is the crux of the waste form qualification process. Testing is typically focused on leachability of constituents of concern (COCs), as well as chemical and physical durability of the waste form. A principal challenge regarding testing immobilized low-activity waste (ILAW) forms is the absence of a standard test suite or set of mandatory parameters against which waste forms may be tested, compared, and qualified for acceptance in existing and proposed nuclear waste disposal sites at Hanford and across the Department of Energy (DOE) complex. A coherent and widely applicable compliance strategy to support characterization and disposal of new waste forms is essential to enhance and accelerate the remediation of DOE tank waste. This paper provides a background summary of important entities, regulations, and considerations for nuclear waste form qualification and disposal. Against this backdrop, this paper describes a strategy for meeting and demonstrating compliance with disposal requirements emphasizing the River Protection Project (RPP) Integrated Disposal Facility (IDF) at the Hanford Site and the fluidized bed steam reforming (FBSR) mineralized low-activity waste (LAW) product stream.

2-[125I]iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

International Nuclear Information System (INIS)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-01-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for [3H]melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-[125I]iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-[125I]Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-[125I]iodomelatonin is rapid, stable, saturable, and reversible. Saturation studies demonstrated that 2-[125I]iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-[125I]iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive)

Clinical relevance of the breakpoint sites within the M-BCR in 50 patients from Argentina with chronic myeloid leukemia.

Science.gov (United States)

Giere, I A; Larripa, I B

1996-08-01

Fifty patients from Argentina with chronic myeloid leukemia (CML) were studied in order to characterize the breakpoint site within the major breakpoint cluster region (M-BCR) and its relationship with the duration of the chronic phase (CP). The DNA digestion with the restriction enzymes: Bgl II, BAM HI and Hind III and hybridization with the 1.2Kb Hind III-Bgl II bcr probe showed that 56% of cases had the breakpoint in 5'M-bcr region and the remaining 44% in 3'M-bcr region. The duration of chronic phase from diagnosis to the onset of the blast crisis (BC) was correlated with the location of the breakpoint within the M-bcr and no statistical differences were observed between the 5' and the 3' groups. These data indicate that the breakpoint site within the bcr gene is not a prognostic indicator of the duration of CP of the disease.

Scavenging of Tc(V) formed by I.T. in 95mTcO4- solutions

International Nuclear Information System (INIS)

Ianoz, E.; Colin, M.; Kosinski, M.

1988-01-01

The chemical effects of the I.T. of 95m Tc in 95m TcO 4 - have been studied in chelating ligand solutions. At high pH and at high concentration of 1,4,8,11-tetraazacyclotetradecane and 1,4-dithia-8, 11-diazacyclotetradecane, the retention of 95g Tc is about 20% and the unretained 95g Tc appears preponderantly (ca. 73%) as [TcO 2 L] + complexes. In glucoheptonate solution, the 95g Tc retention remains practically the same (22%) but the unretained 95g Tc is found in high proportion (73%) as [TcObis(glucoheptonate)] - . The added ligands are very good scavengers for 95g Tc(V). A comparison is made between 95g Tc species formed by the I.T. in 95m TcO 4 - and 99m Tc species resulting from the chemical reduction of 99m TcO 4 - . (orig.)

Thermal modelling. Preliminary site description Simpevarp subarea - version 1.2

Energy Technology Data Exchange (ETDEWEB)

Sundberg, Jan; Back, Paer-Erik; Bengtsson, Anna; Laendell, Maerta [Geo Innova AB, Linkoeping (Sweden)

2005-08-15

This report presents the thermal site descriptive model for the Simpevarp subarea, version 1.2. The main objective of this report is to present the thermal modelling work where data has been identified, quality controlled, evaluated and summarised in order to make an upscaling to lithological domain level possible. The thermal conductivity at possible canister scale has been modelled for four different lithological domains (RSMA01 (Aevroe granite), RSMB01 (Fine-grained dioritoid), RSMC01 (mixture of Aevroe granite and Quartz monzodiorite), and RSMD01 (Quartz monzodiorite)). A main modelling approach has been used to determine the mean value of the thermal conductivity. Three alternative/complementary approaches have been used to evaluate the spatial variability of the thermal conductivity at domain level. The thermal modelling approaches are based on the lithological model for the Simpevarp subarea, version 1.2 together with rock type models constituted from measured and calculated (from mineral composition) thermal conductivities. For one rock type, the Aevroe granite (501044), density loggings within the specific rock type has also been used in the domain modelling in order to consider the spatial variability within the Aevroe granite. This has been possible due to the presented relationship between density and thermal conductivity, valid for the Aevroe granite. Results indicate that the mean of thermal conductivity is expected to exhibit only a small variation between the different domains, from 2.62 W/(m.K) to 2.80 W/(m.K). The standard deviation varies according to the scale considered and for the canister scale it is expected to range from 0.20 to 0.28 W/(m.K). Consequently, the lower confidence limit (95% confidence) for the canister scale is within the range 2.04-2.35 W/(m.K) for the different domains. The temperature dependence is rather small with a decrease in thermal conductivity of 1.1-3.4% per 100 deg C increase in temperature for the dominating rock

Formation of the distributed NiSiGe nanocrystals nonvolatile memory formed by rapidly annealing in N2 and O2 ambient

International Nuclear Information System (INIS)

Hu, Chih-Wei; Chang, Ting-Chang; Tu, Chun-Hao; Chiang, Cheng-Neng; Lin, Chao-Cheng; Chen, Min-Chen; Chang, Chun-Yen; Sze, Simon M.; Tseng, Tseung-Yuen

2010-01-01

In this work, electrical characteristics of the Ge-incorporated Nickel silicide (NiSiGe) nanocrystals memory device formed by the rapidly thermal annealing in N 2 and O 2 ambient have been studied. The trapping layer was deposited by co-sputtering the NiSi 2 and Ge, simultaneously. Transmission electron microscope results indicate that the NiSiGe nanocrystals were formed obviously in both the samples. The memory devices show obvious charge-storage ability under capacitance-voltage measurement. However, it is found that the NiSiGe nanocrystals device formed by annealing in N 2 ambient has smaller memory window and better retention characteristics than in O 2 ambient. Then, related material analyses were used to confirm that the oxidized Ge elements affect the charge-storage sites and the electrical performance of the NCs memory.

Expression of Each Cistron in the gal Operon Can Be Regulated by Transcription Termination and Generation of a galK-Specific mRNA, mK2

Science.gov (United States)

Wang, Xun; Ji, Sang Chun; Yun, Sang Hoon; Jeon, Heung Jin; Kim, Si Wouk

2014-01-01

The gal operon of Escherichia coli has 4 cistrons, galE, galT, galK, and galM. In our previous report (H. J. Lee, H. J. Jeon, S. C. Ji, S. H. Yun, H. M. Lim, J. Mol. Biol. 378:318–327, 2008), we identified 6 different mRNA species, mE1, mE2, mT1, mK1, mK2, and mM1, in the gal operon and mapped these mRNAs. The mRNA map suggests a gradient of gene expression known as natural polarity. In this study, we investigated how the mRNAs are generated to understand the cause of natural polarity. Results indicated that mE1, mT1, mK1, and mM1, whose 3′ ends are located at the end of each cistron, are generated by transcription termination. Since each transcription termination is operating with a certain frequency and those 4 mRNAs have 5′ ends at the transcription initiation site(s), these transcription terminations are the basic cause of natural polarity. Transcription terminations at galE-galT and galT-galK junctions, making mE1 and mT1, are Rho dependent. However, the terminations to make mK1 and mM1 are partially Rho dependent. The 5′ ends of mK2 are generated by an endonucleolytic cleavage of a pre-mK2 by RNase P, and the 3′ ends are generated by Rho termination 260 nucleotides before the end of the operon. The 5′ portion of pre-mK2 is likely to become mE2. These results also suggested that galK expression could be regulated through mK2 production independent from natural polarity. PMID:24794565

Structural and magnetic properties of Ni0.8M0.2Fe2O4 (M = Cu, Co) nano-crystalline ferrites

Science.gov (United States)

Vijaya Babu, K.; Satyanarayana, G.; Sailaja, B.; Santosh Kumar, G. V.; Jalaiah, K.; Ravi, M.

2018-06-01

Nano-crystalline nickel ferrites are interesting materials due to their large physical and magnetic properties. In the present work, two kinds of spinel ferrites Ni0.8M0.2Fe2O4 (M = Cu, Co) are synthesized by using sol-gel auto-combustion method and the results are compared with NiFe2O4. The structural properties of synthesized ferrites are determined by using X-ray powder diffraction; scanning electron microscope and Fourier transform infrared spectroscopy. The cation distribution obtained from X-ray diffraction show that cobalt/copper occupies only tetrahedral site in spinel lattice. The lattice constant increases with the substitution of cobalt/copper. The structural parameters like bond lengths, tetrahedral and octahedral edges have been varied with the substitution. The microstructural study is carried out by using SEM technique and the average grain size is increased with nickel ferrite. The initial permeability (μi) is improving with the substitution. The observed g-value from ESR is approximately equal to standard value.

`Six of the best`: intramuscular uptake of {sup 99m}Tc HDP revisited in sites of i.m. Administrations for pain relief medication

Energy Technology Data Exchange (ETDEWEB)

Richards, P.A.C. [Launceston General Hospital, TAS (Australia). Department of Nuclear Medicine

1998-03-01

Full text: It is not uncommon at sites of intramuscular (i.m.) administration for pain relieving drugs, that intravenously administered {sup 99T}c-HDP for skeletal imaging will localize at some sites. It is important, however, if such sites overlie bone that the possibility of including such areas in the diagnosis is of concern, and under such circumstances either planar or SPECT imaging will differentiate the site from bone or tissue uptake. There have been many situations reported where such localisation can occur, but it is generally believed that in the majority of cases this is entirely due to the presence of local microcalcification. The study was conducted to elucidate whether there was any relationship between physical trauma, osmolality, drug, dose, volume or repetitiveness of administrations in the extra-skeletal localizations of {sup 99m}Tc-HDP in patients presenting for whole body bone scans. It is concluded that physical trauma plays a significant role in the localisation of {sup 99m}Tc-HDP as cell Iysis leads to the formation of ``dense bodies`` in the mitochondria. These bodies occur when excess calcium combines with phosphate ions under circumstances of cellular disorganisation and trauma.

Site populations analysis of the Sm2(Co,Fe)17 alloys using Moessbauer spectroscopy

International Nuclear Information System (INIS)

Nagamine, L.C.C.M.

1990-01-01

Moessbauer measurements were carried out at room temperature for Sm 2 (Co 1-x Fe x ) 17 alloys with x=0,1 to 0,6 and Sm 2 (Co 0.9-v Fe v Cu 0.08 Zr 0.02 ) 8.35 , with v=0.23 to 0.27. All samples were characterized by x-ray diffraction. They showed rhombohedral structure of Th 2 Zn 17 type (R 3-bar m), where Fe atoms occupy four crystallographic sites. All spectra showed magnetic splitting and a high complexity resulting from the superposition of four Fe sites. Hyperfine parameters and site populations were obtained by least-squares fitting of the spectra. (author)

New compounds bearing [M(S_2O_7)_3]"2"- anions (M = Si, Ge, Sn): Syntheses and characterization of A_2[Si(S_2O_7)_3] (A = Na, K, Rb), A_2[Ge(S_2O_7)_3] (A = Li, Na, K, Rb, Cs), A_2[Sn(S_2O_7)_3] (A = Na, K), and the unique germanate Hg_2[Ge(S_2O_7)_3]Cl_2 with cationic "1_∞[HgCl_2_/_2]"+ chains

International Nuclear Information System (INIS)

Logemann, Christian; Witt, Julia; Wickleder, Mathias S.; Gunzelmann, Daniel; Senker, Juergen

2012-01-01

The reaction of the group 14 tetrachlorides MCl_4 (M = Si, Ge, Sn) with oleum (65 % SO_3) at elevated temperatures led to the unique anionic complexes [M(S_2O_7)_3]"2"- that show the central M atoms in coordination of three chelating S_2O_7"2"- groups. The mean distances M-O within the complexes increase from 175 pm (M = Si) via 186 pm (M = Ge) up to 200 pm (M = Sn). The charge balance for the [M(S_2O_7)_3]"2"- anions is achieved by alkaline metal ions A"+ (A = Li, Na, K, Rb, Cs) which were implemented in the syntheses in form of their sulfates. The size of the A"+ ions, i.e. their coordination requirement causes the crystallographic differences in the crystal structures, while the structure of the complex [M(S_2O_7)_3]"2"- anions remains essentially unaffected. Furthermore, we were able to characterize the unique germanate Hg_2[Ge(S_2O_7)_3]Cl_2 which forms when HgCl_2 is added as a source for the counter cation. The Hg"2"+ and the Cl"- ions form infinite cationic chains according to "1_∞[HgCl_2_/_2]"+ which take care for the charge compensation. For selected examples of the compounds the thermal behavior has been monitored by means of thermal analyses and X-ray powder diffraction. For A being an alkaline metal the decomposition product is a mixture of the sulfates A_2SO_4 and the dioxides MO_2, whereas Hg_2[Ge(S_2O_7)_3]Cl_2 shows a more complicated decomposition. The tris-(disulfato)-silicate Na_2[Si(S_2O_7)_3] has additionally been examined by solid state "2"9Si and "2"3Na NMR spectroscopic measurements. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Rictor/mTORC2 facilitates central regulation of energy and glucose homeostasis

OpenAIRE

Kocalis, Heidi E.; Hagan, Scott L.; George, Leena; Turney, Maxine K.; Siuta, Michael A.; Laryea, Gloria N.; Morris, Lindsey C.; Muglia, Louis J.; Printz, Richard L.; Stanwood, Gregg D.; Niswender, Kevin D.

2014-01-01

Insulin signaling in the central nervous system (CNS) regulates energy balance and peripheral glucose homeostasis. Rictor is a key regulatory/structural subunit of the mTORC2 complex and is required for hydrophobic motif site phosphorylation of Akt at serine 473. To examine the contribution of neuronal Rictor/mTORC2 signaling to CNS regulation of energy and glucose homeostasis, we utilized Cre-LoxP technology to generate mice lacking Rictor in all neurons, or in either POMC or AgRP expressing...

Construction of a high affinity zinc binding site in the metabotropic glutamate receptor mGluR1

DEFF Research Database (Denmark)

Jensen, Anders A.; Sheppard, P O; Jensen, L B

2001-01-01

a molecular model of the ATD of mGluR1 based on a weak amino acid sequence similarity with a bacterial periplasmic binding protein. The ATD consists of two globular lobes, which are speculated to contract from an "open" to a "closed" conformation following agonist binding. In the present study, we have...... created a Zn(2+) binding site in mGluR1b by mutating the residue Lys(260) to a histidine. Zinc acts as a noncompetitive antagonist of agonist-induced IP accumulation on the K260H mutant with an IC(50) value of 2 microm. Alanine mutations of three potential "zinc coligands" in proximity to the introduced...

Remaining Sites Verification Package for the 100-C-9:2 Sanitary Sewer Pipelines. Attachment to Waste Site Reclassification Form 2004-013

International Nuclear Information System (INIS)

Dittmer, L.M.

2007-01-01

The 100-C-9:2 sanitary sewer pipelines include the feeder pipelines associated with the 1607-B8, the 1607-B9, the 1607-B10 and the 1607-B11 septic systems. Contaminated soil and piping from the feeder lines to the septic systems were removed and disposed of. The remaining soil in the excavations has been shown to meet the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

Remaining Sites Verification Package for the 100-B-21:2 Subsite (100-B/C Discovery Pipeline DS-100BC-002). Attachment Waste Site Reclassification Form 2008-003

International Nuclear Information System (INIS)

Capron, J.M.

2008-01-01

The 100-B-21:2 waste site consists of the immediate area of the DS-100BC-02 pipeline. In accordance with this evaluation, the confirmatory and verification sampling results support a reclassification of this site to Interim Closed Out. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

Project M: Scale Model of Lunar Landing Site of Apollo 17

Science.gov (United States)

O'Brien, Hollie; Crain, Timothy P.

2010-01-01

The basis of the project was creating a scale model representation of the Apollo 17 lunar landing site. Vital components included surface slope characteristics, crater sizes and locations, prominent rocks, and lighting conditions. The model was made for Project M support when evaluating approach and terminal descent as well as when planning surface operations with respect to the terrain. The project had five main mi lestones during the length of the project. The first was examining the best method to use to re-create the Apollo 17 landing site and then reviewing research fmdings with Dr. Tim Crain and EO staff which occurred on June 25, 2010 at a meeting. The second step was formulating a construction plan, budget, and schedule and then presenting the plan for authority to proceed which occurred on July 6,2010. The third part was building a prototype to test materials and building processes which were completed by July 13, 2010. Next was assembling the landing site model and presenting a mid-term construction status report on July 29, 2010. The fifth and final milestone was demonstrating the model and presenting an exit pitch which happened on August 4, 2010. The project was very technical: it needed a lot of research about moon topography, lighting conditions and angles of the sun on the moon, Apollo 17, and Autonomous Landing and Hazard Avoidance Technology (ALHAT), before starting the actual building process. This required using Spreadsheets, searching internet sources and conducting personal meetings with project representatives. This information assisted the interns in deciding the scale of the model with respect to cracks, craters and rocks and their relative sizes as the objects mentioned could interfere with any of the Lunar Landers: Apollo, Project M and future Landers. The project concluded with the completion of a three dimensional scale model of the Apollo 17 Lunar landing site. This model assists Project M members because they can now visualize

The fragment ion C13H9O2 m/z 197 in the mass spectra of 2-(2'-R-phenyl)benzoic acids

International Nuclear Information System (INIS)

Gills, R.G.; Porter, Q.N.

1990-01-01

In the electron impact mass spectrum of 2-( ' -R-phenyl)benzoic acids where R = H, NO 2 , OCH 3 , COOH, or Br, and abundant fragment ion m/z 197 is formed by an ipso substitution in which R is expelled as a radical. The structure of the ion m/z 197 has been shown by collision-activated dissociation to be identical with that of the protonated molecule formed by methane chemical ionization of 6H-dibenzo[b,d]pyran-6-one. 11 refs., 1 fig., ills

Internal mobility of reactive-site-hydrolyzed recombinant Cucurbita maxima trypsin inhibitor-V characterized by NMR spectroscopy: evidence for differential stabilization of newly formed C- and N-termini.

Science.gov (United States)

Liu, J; Prakash, O; Huang, Y; Wen, L; Wen, J J; Huang, J K; Krishnamoorthi, R

1996-09-24

The solution structure and internal dynamics of the reactive-site (Lys44-Asp45 peptide bond) hydrolyzed form of recombinant Cucurbita maxima trypsin inhibitor-V (rCMTI-V*) were characterized by the application of two-dimensional 1H-15N NMR methods to the uniformly 15N-labeled protein. The 1H-15N chemical shift correlation spectra of rCMTI-V* were assigned, and the chemical shift data were compared with those available for rCMTI-V [Liu, J., Prakash, O., Cai, M., Gong, Y., Huang, Y., Wen, L., Wen, J. J., Huang, J.-K., & Krishnamoorthi, R. (1996) Biochemistry 35, 1516-1524] and CMTI-V* [Cai, M., Gong, Y., Prakash, O., & Krishnamoorthi, R. (1995) Biochemistry 34, 12087-12094] for which three-dimensional solution structures have been determined. It was deduced that the solution structure of rCMTI-V* was almost the same as that of CMTI-V*. 15N spin-lattice and spin-spin relaxation rate constants (R1 and R2, respectively) and ¿1H¿-15N steady-state heteronuclear Overhauser effects were measured for the peptide NH units and arginine and tryptophan N epsilon H groups in rCMTI-V*, and the model-free parameters [Lipari, G., & Szabo, A. (1982) J. Am. Chem. Soc. 104, 4546-4559, 4559-4570] were computed. Most of the backbone of rCMTI-V* is found to be highly constrained (S2 = 0.85), including the N-terminal residues 3-6 (S2 = 0.77). Residues 39-44, forming the C-terminal fragment of the binding loop, exhibit increased mobility (S2 = 0.51); however, the N-terminal segment (residues 46-48) retains rigidity as in the intact form (S2 = 0.83). The S2 values, 0.78 and 0.59, respectively, of Arg50 and Arg52 side chain NHs provide evidence not only for the conservation of the Arg hydrogen-bonds with the binding loop segments but also for the difference in strength between them. This is consistent with the earlier observation made from a study of rCMTI-V at two different pHs and its R50 and R52 mutants [Cai, M., Huang, Y., Prakash, O., Wen, L., Dunkelbarger, S. P., Huang, J.-K., Liu, J

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Unique edge-sharing sulfate-transition metal coordination in Na2M(SO4)2 (M=Ni and Co)

International Nuclear Information System (INIS)

Fry, Allyson M.; Sweeney, Owen T.; Adam Phelan, W.; Drichko, Natalia; Siegler, Maxime A.; McQueen, Tyrel M.

2015-01-01

Two compounds, Na 2 Ni(SO 4 ) 2 and Na 2 Co(SO 4 ) 2 , were synthesized and their structure and properties were characterized. They adopt a structure that contains a bidentate coordination of sulfate to the transition metal center, which was determined via single crystal X-ray diffraction combined with model refinements to both laboratory X-ray and time-of-flight neutron powder diffraction data. The compounds were both found to crystallize in the C2/c space group with Z=24 and a unit cell of a=23.3461(3) Å, b=10.3004(1) Å, c=17.4115(2) Å, β=98.8659(9)°, and V=4136.99(8) Å 3 for the cobalt analog and a=23.2253(1) Å, b=10.26155(6) Å, c=17.3353(1) Å, β=99.0376(5)°, and V=4080.20(5) Å 3 for the nickel analog. Magnetization measurements show that the transition metal centers have negligible interactions with neighboring sites. Infrared and Raman spectroscopies were used to further probe the unique sulfate-transition metal coordination, and confirm the bidentate binding motif. The resulting pseudo-trigonal bipyramidal coordination produces vivid violet, Na 2 Co(SO 4 ) 2 , and yellow, Na 2 Ni(SO 4 ) 2 , colors that were probed by diffuse reflectance. - Graphical abstract: Two blue distorted transition metal octahedra (oxygen in red) bridged by two sulfate tetrahedra are shown here. Each bridging sulfate tetrahedra shares an edge with one octahedron and a corner with the other. All of the remaining corners of the octahedra are corner sharing with four tetrahedra forming a polyhedral network. - Highlights: • Structure of Na2Ni(SO4)2 and Na2Co(SO4)2 is determined. • Unique sulfate-transition metal binding observed in the new structure. • Combined diffraction and spectroscopic techniques were used. • Magnetization measurements show negligible interactions between sites

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

Science.gov (United States)

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Surveillance of Site A and Plot M report for 1989

International Nuclear Information System (INIS)

Golchert, N.W.

1990-04-01

The results of the environmental monitoring program conducted at Site A/Plot M in the Palos Park Forest Preserve area for CY 1989 are presented. The monitoring program is the ongoing remedial action that resulted from the 1976--1978 radiological characterization of the site. That study had determined that very low levels of hydrogen-3 migrated from the burial ground and was present in two nearby hand-pumped picnic wells. The current program consists of sample collection and analysis of air, surface and subsurface water, and bottom sediment. The results of the analyses are used to determine the migration pathway of water from the burial ground to the hand-pumped picnic wells, establish if buried radionuclides other than hydrogen-3 have migrated, and generally characterize the radiological environment of the area. 16 refs., 6 figs., 15 tabs

THE NUMBER DENSITY AND MASS DENSITY OF STAR-FORMING AND QUIESCENT GALAXIES AT 0.4 ≤ z ≤ 2.2

International Nuclear Information System (INIS)

Brammer, Gabriel B.; Whitaker, K. E.; Van Dokkum, P. G.; Lee, K.-S.; Muzzin, A.; Marchesini, D.; Franx, M.; Kriek, M.; Labbe, I.; Quadri, R. F.; Williams, R.; Rudnick, G.

2011-01-01

We study the buildup of the bimodal galaxy population using the NEWFIRM Medium-Band Survey, which provides excellent redshifts and well-sampled spectral energy distributions of ∼27, 000 galaxies with K 3 x 10 10 M sun increases by a factor of ∼10 from z ∼ 2 to the present day, whereas the mass density in star-forming galaxies is flat or decreases over the same time period. Modest mass growth by a factor of ∼2 of individual quiescent galaxies can explain roughly half of the strong density evolution at masses >10 11 M sun , due to the steepness of the exponential tail of the mass function. The rest of the density evolution of massive, quiescent galaxies is likely due to transformation (e.g., quenching) of the massive star-forming population, a conclusion which is consistent with the density evolution we observe for the star-forming galaxies themselves, which is flat or decreasing with cosmic time. Modest mass growth does not explain the evolution of less massive quiescent galaxies (∼10 10.5 M sun ), which show a similarly steep increase in their number densities. The less massive quiescent galaxies are therefore continuously formed by transforming galaxies from the star-forming population.

6. Investigation of R2M17 compounds

International Nuclear Information System (INIS)

Elemans, J.B.A.A.; Buschow, K.H.J.

1975-01-01

A discussion is presented of the different crystallographic forms that arise in the parent RM 5 (R rare earth including yttrium or thorium; M = Fe, Co or Ni) with CaCu 5 structure in which every third R is replaced by a pair of M. This results in the stoichiometric composition R 2 M 17 . Metallographic studies of well annealed and quenched specimens of CeFesub(x), HoFesub(x) and TmFesub(x) with x varying from 8 to 9.5 showed that only those with x = 8.5 consisted of one phase. Similar experiments with ThNisub(x) and YNisub(x), x varying from 6.5 to 8.5 revealed that in these cases, single phases were obtained with x = 7.5

Hydrogen peroxide (H2O2) irreversibly inactivates creatine kinase from Pelodiscus sinensis by targeting the active site cysteine.

Science.gov (United States)

Wang, Wei; Lee, Jinhyuk; Hao, Hao; Park, Yong-Doo; Qian, Guo-Ying

2017-12-01

Creatine kinase (EC 2.7.3.2, CK) plays an important role in cellular energy metabolism and homeostasis by catalysing the transfer of phosphate between ATP and creatine phosphate. In this study, we investigated the effects of H 2 O 2 on PSCKM (muscle type creatine kinase from Pelodiscus sinensis) by the integrating method between enzyme kinetics and docking simulations. We found that H 2 O 2 strongly inactivated PSCKM (IC 50 =0.25mM) in a first-order kinetic process, and targeted the active site cysteine directly. A conformational study showed that H 2 O 2 did not induce the tertiary structural changes in PSCKM with no extensive exposure of hydrophobic surfaces. Sequential docking simulations between PSCKM and H 2 O 2 indicated that H 2 O 2 interacts with the ADP binding region of the active site, consistent with experimental results that demonstrated H 2 O 2 -induced inactivation. Our study demonstrates the effect of H 2 O 2 on PSCKM enzymatic function and unfolding, and provides important insight into the changes undergone by this central metabolic enzyme in ectothermic animals in response to the environment. Copyright © 2017 Elsevier B.V. All rights reserved.

Operational experience with CMS Tier-2 sites

International Nuclear Information System (INIS)

Gonzalez Caballero, I

2010-01-01

In the CMS computing model, more than one third of the computing resources are located at Tier-2 sites, which are distributed across the countries in the collaboration. These sites are the primary platform for user analyses; they host datasets that are created at Tier-1 sites, and users from all CMS institutes submit analysis jobs that run on those data through grid interfaces. They are also the primary resource for the production of large simulation samples for general use in the experiment. As a result, Tier-2 sites have an interesting mix of organized experiment-controlled activities and chaotic user-controlled activities. CMS currently operates about 40 Tier-2 sites in 22 countries, making the sites a far-flung computational and social network. We describe our operational experience with the sites, touching on our achievements, the lessons learned, and the challenges for the future.

Detailed profile of m=2 islands with TVTS on JFT-2M

International Nuclear Information System (INIS)

Yamauchi, T.; Grek, B.; Hoshino, K.; Le Blanc, B.; Johnson, D.; Felt, J.; Shiina, T.; Kurita, G.; Ishige, Y.; Kozawa, H.

1996-01-01

The detailed electron temperature profile (spatial resolution: 0.86 cm) of a low density JFT-2M plasma is measured with the TV Thomson scattering system (TVTS). Flat profiles showing the electron temperature shapes of m=2/n=1 islands are presented, which are in contrast to that without islands. On the other hand, the m=2/n=1 islands are effectively suppressed with local ECRH heating. (orig.)

Sliding charge density wave in the monophosphate tungsten bronze (PO2)4(WO3)2m with alternate stacking of m=4 and m=6 WO3 layers

International Nuclear Information System (INIS)

Foury-Leylekian, P.; Sandre, E.; Ravy, S.; Pouget, J.-P.; Elkaim, E.; Roussel, P.; Groult, D.; Labbe, Ph.

2002-01-01

The monophosphate tungsten bronzes (PO 2 ) 4 (WO 3 ) 2m form family of two-dimensional metals which exhibit charge density wave (CDW) instabilities. These materials are generally built by the regular stacking of (a,b) layers in which chains made of segments of m WO 6 octahedra directed along the a and a±b directions are delimited. Their electronic structure thus originates from quasi-one-dimensional (1D) bands located on these chains. As a consequence their Fermi surface (FS) exhibits large flat portions whose nesting gives rise to successive CDW instabilities. Here we present a structural study of the CDW instability of the (PO 2 ) 4 (WO 3 ) 10 member formed by the alternate stacking of layers built with segments of m=4 and m=6 WO 6 octahedra. Its ab initio electronic structure calculation shows that the FS of this member exhibits large flat portions which can be extremely well nested. Its best nesting wave vector accounts for the modulation wave vector stabilized by the CDW transition which occurs at 156 K. Because of the regular stacking of layers of different m values the FS is slightly split. The unusual thermal dependence of the x-ray satellite intensity provides evidence that the two types of layers become modulated at different temperature. This also leads to a slight thermal sliding of the CDW-nesting modulation wave vector, which can be accounted for within the framework of a Landau-Ginzburg theory. In addition, the observation of a global hysteresis in the thermal cycling of the satellite intensity, as well as the degradation of the interlayer order upon cooling, suggest the formation of a disordered lattice of dilute solitons. Such solitons allow to accommodate the charge transferred between the two types of layer. Finally the relevance of local charge transfers, at intergrowth defects, for example, to create pinned discommensurations that break the CDW coherence is emphasized in this whole family of bronzes

[Identification of C(2)M interacting proteins by yeast two-hybrid screening].

Science.gov (United States)

Yue, Shan-shan; Xia, Lai-xin

2015-11-01

The synaptonemal complex (SC) is a huge structure which assembles between the homologous chromosomes during meiotic prophase I. Drosophila germ cell-specific nucleoprotein C(2)M clustering at chromosomes can induce SC formation. To further study the molecular function and mechanism of C(2)M in meiosis, we constructed a bait vector for C(2)M and used the yeast two-hybrid system to identify C(2)M interacting proteins. Forty interacting proteins were obtained, including many DNA and histone binding proteins, ATP synthases and transcription factors. Gene silencing assays in Drosophila showed that two genes, wech and Psf1, may delay the disappearance of SC. These results indicate that Wech and Psf1 may form a complex with C(2)M to participate in the formation or stabilization of the SC complex.

Cyclic AMP is a key regulator of M1 to M2a phenotypic conversion of microglia in the presence of Th2 cytokines.

Science.gov (United States)

Ghosh, Mousumi; Xu, Yong; Pearse, Damien D

2016-01-13

Microglia and macrophages play a central role in neuroinflammation. Pro-inflammatory cytokines trigger their conversion to a classically activated (M1) phenotype, sustaining inflammation and producing a cytotoxic environment. Conversely, anti-inflammatory cytokines polarize the cells towards an alternatively activated (M2), tissue reparative phenotype. Elucidation of the signal transduction pathways involved in M1 to M2 phenotypic conversion may provide insight into how the innate immune response can be harnessed during distinct phases of disease or injury to mediate neuroprotection and neurorepair. Microglial cells (cell line and primary) were subjected to combined cyclic adenosine monophosphate (cyclic AMP) and IL-4, or either alone, in the presence of pro-inflammatory mediators, lipopolysaccharide (LPS), or tumor necrosis factor-α (TNF-α). Their effects on the expression of characteristic markers for M1 and M2 microglia were assessed. Similarly, the M1 and M2 phenotypes of microglia and macrophages within the lesion site were then evaluated following a contusive spinal cord injury (SCI) to the thoracic (T8) spinal cord of rats and mice when the agents were administered systemically. It was demonstrated that cyclic AMP functions synergistically with IL-4 to promote M1 to M2 conversion of microglia in culture. The combination of cyclic AMP and IL-4, but neither alone, induced an Arg-1(+)/iNOS(-)cell phenotype with concomitant expression of other M2-specific markers including TG2 and RELM-α. M2-converted microglia showed ameliorated production of pro-inflammatory cytokines (TNF-α and IP-10) and reactive oxygen species, with no alteration in phagocytic properties. M2a conversion required protein kinase A (PKA), but not the exchange protein directly activated by cyclic AMP (EPAC). Systemic delivery of cyclic AMP and IL-4 after experimental SCI also promoted a significant M1 to M2a phenotypic change in microglia and macrophage population dynamics in the lesion

EPA True NO2 ground site measurements – multiple sites, TCEQ ground site measurements of meteorological and air pollution parameters – multiple sites ,GeoTASO NO2 Vertical Column

Data.gov (United States)

U.S. Environmental Protection Agency — EPA True NO2 ground site measurements – multiple sites - http://www-air.larc.nasa.gov/cgi-bin/ArcView/discover-aq.tx-2013; TCEQ ground site measurements of...

The cation-deficient Ruddlesden-Popper oxysulfide Y2Ti2O5S2 as a layered sulfide: topotactic potassium intercalation to form KY2Ti2O5S2.

Science.gov (United States)

Rutt, Oliver J; Hill, Timothy L; Gál, Zoltán A; Hayward, Michael A; Clarke, Simon J

2003-12-01

Potassium intercalation into the cation-deficient n = 2 Ruddlesden-Popper oxysulfide Y(2)Ti(2)O(5)S(2) to form KY(2)Ti(2)O(5)S(2) has been carried out by reaction of the oxysulfide with potassium vapor in sealed metal tubes at 400 degrees C, potassium naphthalide in THF at 50 degrees C, or potassium in liquid ammonia at temperatures as low as -78 degrees C. Insertion of potassium is topotactic, and although a site 12-coordinate by oxide ions is vacant in the perovskite-type oxide slabs of the structure, potassium is too large to enter this site via the 4-coordinate window, and instead enters the rock-salt-type sulfide layers of the structure which necessitates a 30% increase in the lattice parameter c normal to the layers. In contrast with one of the sodium intercalates of Y(2)Ti(2)O(5)S(2) (beta-NaY(2)Ti(2)O(5)S(2)) in which sodium occupies a tetrahedral site in the sulfide layers, potassium favors an 8-coordinate site which necessitates a relative translation of adjacent oxide slabs. KY(2)Ti(2)O(5)S(2) is tetragonal: P4/mmm, a = 3.71563(4) A, c = 14.8682(2) A (at 298 K), Z = 1. Although the resistivity (3.4(1) x 10(3) Omega cm) is larger than would be expected for a metal, temperature independent paramagnetism dominates the magnetic susceptibility, and the material is electronically very similar to the analogous sodium intercalate beta-NaY(2)Ti(2)O(5)S(2) which features reduced-titanium-containing oxide layers of very similar geometry and electron count.

Phase diagrams of systems of Sr2V2O7-M2V2O7 and of Ba2V2O7-M2V2O7 (M=Ca,Cd)

International Nuclear Information System (INIS)

Fotiev, A.A.; Zhuravlev, V.D.; Zhukov, V.P.

1982-01-01

Using the methods of X-ray phase and differential thermal anlyses phase equilibria in the systems Sr 2 V 2 O 7 -M 2 V 2 O 7 and Ba 2 V 2 O 7 -M 2 V 2 O 7 , where M--Ca, Cd, are studied, their phase diagrams being built. New double pyrovanadates Mosub(0.5)Srsub(1.5)Vsub(2)Osub(7) and MBaV 2 O 7 are found [ru

Durability of an La2Zr2O7 waste form in water

International Nuclear Information System (INIS)

Hayakawa, I.; Kamizono, H.

1993-01-01

The effects of time, temperature and pH on the leaching rates of a La 2 Zr 2 O 7 waste form were studied. The leaching rates of each constituent measured in deionized water and an alkaline solution (pH = 10) were less than about 10 -5 g m -2 d -1 at 90 0 C and were smaller than those in an acid solution (pH = 1) by one order of magnitude. It was found that the leaching rate of zirconium obtained after immersion for 34 days decreases with increasing temperature in an acid solution. This exceptional phenomenon is attributed to the formation and decomposition of zirconium complexes with CO 3 2- ligands. (author)

Development and evaluation of intelligent machine tools based on knowledge evolution in M2M environment

International Nuclear Information System (INIS)

Kim, Dong Hoon; Song, Jun Yeob; Lee, Jong Hyun; Cha, Suk Keun

2009-01-01

In the near future, the foreseen improvement in machine tools will be in the form of a knowledge evolution-based intelligent device. The goal of this study is to develop intelligent machine tools having knowledge-evolution capability in Machine to Machine (M2M) wired and wireless environment. The knowledge evolution-based intelligent machine tools are expected to be capable of gathering knowledge autonomously, producing knowledge, understanding knowledge, applying reasoning to knowledge, making new decisions, dialoguing with other machines, etc. The concept of the knowledge-evolution intelligent machine originated from the process of machine control operation by the sense, dialogue and decision of a human expert. The structure of knowledge evolution in M2M and the scheme for a dialogue agent among agent-based modules such as a sensory agent, a dialogue agent and an expert system (decision support agent) are presented in this paper, and work-offset compensation from thermal change and recommendation of cutting condition are performed on-line for knowledge-evolution verification

Isolation and crystallization of functionally competent Escherichia coli peptide deformylase forms containing either iron or nickel in the active site.

Science.gov (United States)

Groche, D; Becker, A; Schlichting, I; Kabsch, W; Schultz, S; Wagner, A F

1998-05-19

Three metallo forms of peptide deformylase (PDF, EC 3.5.1.31) of Escherichia coli were prepared and crystallized (space group C2, diffraction limit 1.9 A) for initiating the X-ray structure determination of the metal center in correlation with the catalytic functionality of this enzyme. The native Fe2+ containing enzyme species was directly isolated from overproducing bacteria by using catalase as a buffer additive, which stabilizes the catalytic activity against oxidative destruction. The Ni2+ containing form, which is oxygen-insensitive, was obtained by metal exchange with free Ni2+ and found to be catalytically equally effective (kcat/KM = 10(5) M-1 s-1 for N-formyl-Met-Ala). The Zn2+ form, prepared from the apoenzyme or by displacement of bound Ni2+ by free Zn2+, proved virtually inactive.

Properties of M1-M2-Si-Al-O-N glasses (M1 = La or Nd, M2 = Y or Er)

Energy Technology Data Exchange (ETDEWEB)

Pomeroy, M.J.; Nestor, E.; Hampshire, S. [Limerick Univ. (Ireland). Materials and Surface Science Inst.; Ramesh, R. [Littelfuse Ireland, Dundalk, Co. Louth (Ireland)

2002-07-01

Mixed lanthanide cation oxynitride glasses have been prepared in the M1 - M2 - Si-Al-O-N systems where M1 = La or Nd and M2 = Y or Er. The densities ({rho}), Young's moduli (E), microhardnesses (H{sub v}), glass transition temperatures (T{sub g}), dilatometric softening temperatures (T{sub dil}) and coefficients of thermal expansion (CTE) of 13 glasses were determined. The molar volume values (MV) calculated from density data, E, H{sub v}, T{sub g}, T{sub dil} and CTE values were all found to vary linearly with the effective cation field strength arising from the M1 and M2 modifier cations. Least squares intercept and slope values are presented which correlate each property to effective cation field strength together with error values which arise from glass and specimen preparation and measurement inconsistencies. These linear correlations clearly indicate that the overall glass structure remains the same for each of the thirteen glasses with only the modifier cation(s) having any influence. This influence appears to be a cross-linking effect, the strength of which increases as the effective cation field strength of the M1, M2 modifiers increases. (orig.)

Towards Horizontal Architecture for Autonomic M2M Service Networks

Directory of Open Access Journals (Sweden)

Juhani Latvakoski

2014-05-01

Full Text Available Today, increasing number of industrial application cases rely on the Machine to Machine (M2M services exposed from physical devices. Such M2M services enable interaction of physical world with the core processes of company information systems. However, there are grand challenges related to complexity and “vertical silos” limiting the M2M market scale and interoperability. It is here expected that horizontal approach for the system architecture is required for solving these challenges. Therefore, a set of architectural principles and key enablers for the horizontal architecture have been specified in this work. A selected set of key enablers called as autonomic M2M manager, M2M service capabilities, M2M messaging system, M2M gateways towards energy constrained M2M asset devices and creation of trust to enable end-to-end security for M2M applications have been developed. The developed key enablers have been evaluated separately in different scenarios dealing with smart metering, car sharing and electric bike experiments. The evaluation results shows that the provided architectural principles, and developed key enablers establish a solid ground for future research and seem to enable communication between objects and applications, which are not initially been designed to communicate together. The aim as the next step in this research is to create a combined experimental system to evaluate the system interoperability and performance in a more detailed manner.

FTIR spectroscopic study on the Hofmann -Td- type clathrates: Ni(benzoic acid)2M(CN)4.aniline (M=Zn, Cd, Hg)

International Nuclear Information System (INIS)

Kesan, G.; Kartal, Z.

2010-01-01

The Hofmann-Td-type clathrates formulated as Ni(L) 2 M(CN) 4 .nG where L is a bidentate or a pair of unidentate ligand molecule, M is Zn, Cd or Hg, G is a guest molecule and n is the number of guest molecule. The host lattice of the Hofmann-Td-type clathrates is formed from endless chains of -Ni-L-L-Ni-L-L-Ni- and M(CN) 4 ions arranged between the consecutive crossing -Ni-L-L-Ni-L-L-Ni- chains with the O-ends bound to the Ni metal atoms. These polymeric layers are held in parallel by Van der Walls interaction between ligand molecules. This structure provides α-type cavity. In this study, Ni(Benzoic Acid ) 2M(CN) 4 .Aniline (M = Zn, Cd, Hg) is obtained for the first time by means of chemical methods in powder form and their infrared spectra are reported in range of (4000-400) cm - 1. The spectral data suggest that the new clathrates are similar in structure to the Hofmann-type clathrates.

The DSeis Project: Drilling into Seismogenic zones of M2.0 to M5.5 earthquakes in South African gold mines

Science.gov (United States)

Yabe, Y.; Ogasawara, H.; Ito, T.; van Aswegen, G.; Durrheim, R. J.; Cichowicz, A.; Onstott, T. C.; Kieft, T. L.; Boettcher, M. S.; Wiemer, S.; Ziegler, M.; Shapiro, S. A.; Gupta, H. K.; Dight, P.

2017-12-01

The DSeis project under ICDP consists of drilling in three mines; MK, TT and C4 mines. Common scientific targets among them are the stress state and the microstructure in the seismogenic zone. In addition to these targets, specific targets in individual mines are detailed below. A M5.5 earthquake occurred beneath the MK mine on 5 August 2014. The hypocenter of this event was 5km depth from the surface. In contrast to the normal faulting of induced earthquakes in mining horizons (planned to evaluate how much is a ratio of microseismicity associated with creation of new fractures. In the C4 mine, there was the site of a previous project, in which the microseismicity monitoring and the stress measurement by the CCBO technique were carried out. A M2.8 earthquake occurred 1 year after the CCBO and its hypocenter was only 100m away from the CCBO site. Due to little mining activity in the source region, the stress state just after the M2.8 event should be preserved. We will measure the stress again. Damage zones that evolved quasi-statically were seen by the microseismicity monitoring. Drilling into these zones would provide a clue to see a difference between faults evolved dynamically and quasi-statically.

A stringy origin of M2 brane Chern-Simons theories

International Nuclear Information System (INIS)

Aganagic, Mina

2010-01-01

We show that string duality relates M-theory on a local Calabi-Yau fourfold singularity X 4 to type IIA string theory on a Calabi-Yau threefold X 3 fibered over a real line, with RR 2-form fluxes turned on. The RR flux encodes how the M-theory circle is fibered over the IIA geometry. The theories on N D2 branes probing X 3 are the well-known quiver theories with N=2 supersymmetry in three dimensions. We show that turning on fluxes, and fibering the X 3 over a direction transverse to the branes, corresponds to turning on N=2 Chern-Simons couplings. String duality implies that, in the strong coupling limit, the N D2 branes on X 3 in this background become N M2 branes on X 4 . This provides a string theory derivation for the recently conjectured description of the M2 brane theories on Calabi-Yau fourfolds in terms of N=2 quiver Chern-Simons theories. We also provide a new N=2 Chern-Simons theory dual to AdS 4 xQ 1,1,1 . Type IIA/M-theory duality also relates IIA string theory on X 3 with only the RR fluxes turned on, to M-theory on a G 2 holonomy manifold. We show that this implies that the N M2 branes probing the G 2 manifold are described by the quiver Chern-Simons theory originating from the D2 branes probing X 3 , except that now Chern-Simons terms preserve only N=1 supersymmetry in three dimensions.

48 CFR 49.602-2 - Inventory forms.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Inventory forms. 49.602-2... TERMINATION OF CONTRACTS Contract Termination Forms and Formats 49.602-2 Inventory forms. Standard Form (SF) 1428, Inventory Disposal Schedule, and SF 1429, Inventory Disposal Schedule—Continuation Sheet, shall...

The rate of charge tunneling is insensitive to polar terminal groups in self-assembled monolayers in Ag(TS)S(CH2)(n)M(CH2)(m)T//Ga2O3/EGaIn junctions.

Science.gov (United States)

Yoon, Hyo Jae; Bowers, Carleen M; Baghbanzadeh, Mostafa; Whitesides, George M

2014-01-08

This paper describes a physical-organic study of the effect of uncharged, polar, functional groups on the rate of charge transport by tunneling across self-assembled monolayer (SAM)-based large-area junctions of the form Ag(TS)S(CH2)(n)M(CH2)(m)T//Ga2O3/EGaIn. Here Ag(TS) is a template-stripped silver substrate, -M- and -T are "middle" and "terminal" functional groups, and EGaIn is eutectic gallium-indium alloy. Twelve uncharged polar groups (-T = CN, CO2CH3, CF3, OCH3, N(CH3)2, CON(CH3)2, SCH3, SO2CH3, Br, P(O)(OEt)2, NHCOCH3, OSi(OCH3)3), having permanent dipole moments in the range 0.5 < μ < 4.5, were incorporated into the SAM. A comparison of the electrical characteristics of these junctions with those of junctions formed from n-alkanethiolates led to the conclusion that the rates of charge tunneling are insensitive to the replacement of terminal alkyl groups with the terminal polar groups in this set. The current densities measured in this work suggest that the tunneling decay parameter and injection current for SAMs terminated in nonpolar n-alkyl groups, and polar groups selected from common polar organic groups, are statistically indistinguishable.

33 CFR 138.40 - Forms.

Science.gov (United States)

2010-07-01

...) § 138.40 Forms. All forms referred to in this subpart may be obtained from NPFC by requesting them in writing at the address given in § 138.45(a) or by clicking on the Forms link at the NPFC E-COFR Web site... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Forms. 138.40 Section 138.40...

48 CFR 253.208-2 - DD Form 448-2, Acceptance of MIPR.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false DD Form 448-2, Acceptance... REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS FORMS Prescription of Forms 253.208-2 DD Form 448-2, Acceptance of MIPR. Follow the procedures at PGI 253.208-2 for use of DD Form 448-2. [71 FR 39005...

Activation of the Arabidopsis membrane-bound transcription factor bZIP28 is mediated by site-2 protease, but not site-1 protease.

Science.gov (United States)

Iwata, Yuji; Ashida, Makoto; Hasegawa, Chisa; Tabara, Kazuki; Mishiba, Kei-Ichiro; Koizumi, Nozomu

2017-08-01

The unfolded protein response (UPR) is a homeostatic cellular response conserved in eukaryotic cells to alleviate the accumulation of unfolded proteins in the endoplasmic reticulum (ER). Arabidopsis bZIP28 is a membrane-bound transcription factor activated by proteolytic cleavage in response to ER stress, thereby releasing its cytosolic portion containing the bZIP domain from the membrane to translocate into the nucleus where it induces the transcription of genes encoding ER-resident molecular chaperones and folding enzymes. It has been widely recognized that the proteolytic activation of bZIP28 is mediated by the sequential cleavage of site-1 protease (S1P) and site-2 protease (S2P). In the present study we provide evidence that bZIP28 protein is cleaved by S2P, but not by S1P. We demonstrated that wild-type and s1p mutant plants produce the active, nuclear form of bZIP28 in response to the ER stress inducer tunicamycin. In contrast, tunicamycin-treated s2p mutants do not accumulate the active, nuclear form of bZIP28. Consistent with these observations, s2p mutants, but not s1p mutants, exhibited a defective transcriptional response of ER stress-responsive genes and significantly higher sensitivity to tunicamycin. Interestingly, s2p mutants accumulate two membrane-bound bZIP28 fragments with a shorter ER lumen-facing C-terminal domain. Importantly, the predicted cleavage sites are located far from the canonical S1P recognition motif previously described. We propose that ER stress-induced proteolytic activation of bZIP28 is mediated by the sequential actions of as-yet-unidentified protease(s) and S2P, and does not require S1P. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Remaining Sites Verification Package for the 100-B-26 Spillway. Attachment to Waste Site Reclassification Form 2006-052

International Nuclear Information System (INIS)

Dittmer, L.M.

2006-01-01

The 100-B-26 Spillway waste site is a spillway that served as an emergency discharge point for the 132-C-2 outfall in the event that the 100-B-15 river effluent pipelines were blocked, damaged, or undergoing maintenance. The selected action involved demonstrating through confirmatory sampling that cleanup goals have been met and proposing a reclassification of this site to No Action. The results of the confirmatory sampling demonstrate that residual contaminant concentrations remaining in the soil beneath the riprap are more protective of groundwater and the Columbia River than the risk they would pose if the site was remediated

Carbides crystalline structure of AISI M2 high-speed steel

International Nuclear Information System (INIS)

Serna, M.M.; Galego, E.; Rossi, J.L.

2005-01-01

The aim of this study was to identify the crystallographic structure of the extracted carbides of AISI M2 steel spray formed The structure determination of these carbides. The structure determination of these carbides is a very hard work. Since these structures were formed by atom migration it is not possible to reproduce them by a controlled process with a determined chemical composition. The solution of this problem is to obtain the carbide by chemical extraction from the steel. (Author)

Remaining Sites Verification Package for the 128-B-3 Burn Pit Site, Waste Site Reclassification Form 2006-058

Energy Technology Data Exchange (ETDEWEB)

L. M. Dittmer

2006-11-17

The 128-B-3 waste site is a former burn and disposal site for the 100-B/C Area, located adjacent to the Columbia River. The 128-B-3 waste site has been remediated to meet the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling demonstrated that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results of sampling at upland areas of the site also showed that residual contaminant concentrations are protective of groundwater and the Columbia River.

Measurements of the Electric Form Factor of the Neutron at Q2=0.45 and 1.13 (GeV/c)2

International Nuclear Information System (INIS)

Shigeyuki Tajima

2003-01-01

Precise measurements of the electric form factor of the neutron, Gn E, over a wide range of the square of the four-momentum transfer, Q2, are important for understanding nucleon and nuclear electromagnetic structure. In the non-relativistic limit, the electric and magnetic form factors are related to the charge and magnetization distribution inside a nucleon, respectively. The measured values of the form factors also serve as an important test for nucleon models. Among the four nucleon form factors, the electric form factor of the neutron, Gn E, is the most difficult one to measure and therefore has been very poorly known especially in the region Q2 > 1 (GeV/c)2 due to the lack of a free neutron target and the small value of Gn E. The Jefferson Laboratory E93-038 collaboration measured the ratio of the electric to magnetic form factor of the neutron, g = Gn E/Gn M, at three acceptance-averaged Q2 values of 0.45, 1.13 and 1.45 (GeV/c)2 using the quasi-elastic 2H(∼e, e0∼n)1H reaction. In our experiment, an electron was scattered quasielastically from a neutron in a liquid-deuterium target, and the electron was detected in an electron spectrometer in coincidence with the neutron which was detected in a neutron polarimeter. The polarimeter was used to analyze the polarization of the recoil neutrons by measuring the np elastic scattering asymmetry. The experiment was performed in Hall-C at Thomas Jefferson National Accelerator Facility during the period from September 2000 to April 2001. The value of g was determined from the measured ratio of the sideways and longitudinal components of the neutron polarization vector. The values for Gn E were computed from our measured values of g = Gn E/Gn M using the Gn M values obtained from a fit to the world data. The E93-038 collaboration reported the first measurements of Gn E using polarization techniques at Q2 greater than 1 (GeV/c)2. Furthermore, our measurements of Gn E at the two higher Q2 values of 1.13 and 1.45 (Ge

M/sub r/ 25,000 heparin-binding protein from guinea pig brain is a high molecular weight form of basic fibroblast growth factor

International Nuclear Information System (INIS)

Moscatelli, D.; Joseph-Silverstein, J.; Manejias, R.; Rifkin, D.B.

1987-01-01

A M/sub r/ 25,000 form of basic fibroblast growth factor (bFGF) has been isolated from guinea pig grain along with the typical M/sub r/ 18,000 form. Both forms were purified to homogeneity by a combination of heparin-affinity chromatography and ion-exchange chromatography on an FPLC Mono S column. The M/sub r/ 25,000 form, like the M/sub r/ 18,000 form was not eluted from the heparin-affinity column with 0.95 M NaCl, but was eluted with 2 M NaCl. The M/sub r/ 25,000 guinea pig protein stimulated plasminogen activator production by cultured bovine capillary endothelial cells in a dose-dependent manner at concentration of 0.1-10 ngml, the same range that was effective for guinea pig and human M/sub r/ 18,000 bFGFs. The binding of human 125 I-labeled bFGF to baby hamster kidney cells is inhibited equally by the M/sub r/ 25,000 guinea pig protein and the M/sub r/ 18,000 guinea pig and human bFGFs. Polyclonal antibodies raised against human bFGF recognize both the M/sub r/ 25,000 and 18,000 guinea pig proteins in an immunoblot analysis. In a radioimmunoassay, both the M/sub r/ 25,000 and M/sub r/ 18,000 guinea pig proteins compete equally well with iodinated human bFGF for binding to the anti-human bFGF antibodies. When treated with low concentrations of trypsin, the M/sub r/ 25,000 guinea pig bFGF was converted to a M/sub r/ 18,000 protein. These results show that the two molecules are closely related and suggest that the M/sub r/ 25,000 protein shares substantial homology with the M/sub r/ 18,000 bFGF

Improved integration of ultra-thin high-k dielectrics in few-layer MoS2 FET by remote forming gas plasma pretreatment

Science.gov (United States)

Wang, Xiao; Zhang, Tian-Bao; Yang, Wen; Zhu, Hao; Chen, Lin; Sun, Qing-Qing; Zhang, David Wei

2017-01-01

The effective and high-quality integration of high-k dielectrics on two-dimensional (2D) crystals is essential to the device structure engineering and performance improvement of field-effect transistor (FET) based on the 2D semiconductors. We report a 2D MoS2 transistor with ultra-thin Al2O3 top-gate dielectric (6.1 nm) and extremely low leakage current. Remote forming gas plasma pretreatment was carried out prior to the atomic layer deposition, providing nucleation sites with the physically adsorbed ions on the MoS2 surface. The top gate MoS2 FET exhibited excellent electrical performance, including high on/off current ratio over 109, subthreshold swing of 85 mV/decade and field-effect mobility of 45.03 cm2/V s. Top gate leakage current less than 0.08 pA/μm2 at 4 MV/cm has been obtained, which is the smallest compared with the reported top-gated MoS2 transistors. Such an optimized integration of high-k dielectric in 2D semiconductor FET with enhanced performance is very attractive, and it paves the way towards the realization of more advanced 2D nanoelectronic devices and integrated circuits.

26 CFR 31.6051-2 - Information returns on Form W-3 and Internal Revenue Service copies of Forms W-2.

Science.gov (United States)

2010-04-01

... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Information returns on Form W-3 and Internal Revenue Service copies of Forms W-2. 31.6051-2 Section 31.6051-2 Internal Revenue INTERNAL REVENUE SERVICE... returns on Form W-3 and Internal Revenue Service copies of Forms W-2. (a) In general. Every employer who...

U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization? Comment on "Decentralisation of Health Services in Fiji: A Decision Space Analysis".

Science.gov (United States)

Bustamante, Arturo Vargas

2016-06-07

For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form) is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form) is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization. © 2016 by Kerman University of Medical Sciences.

Increased immunogenicity and protective efficacy of influenza M2e fused to a tetramerizing protein

DEFF Research Database (Denmark)

Andersson, Anne-Marie Carola; Håkansson, Kjell Ove; Jensen, Benjamin Anderschou Holbech

2012-01-01

by diverse influenza A viruses, a vaccine (M2e-NSP4) was constructed linking M2e (in its consensus sequence) to the rotavirus fragment NSP4(98-135); due to its coiled-coil region this fragment is known to form tetramers in aqueous solution and in this manner we hoped to mimick the natural configuration of M2...

Naturally occurring BRCA2 alternative mRNA splicing events in clinically relevant samples

DEFF Research Database (Denmark)

Fackenthal, James D; Yoshimatsu, Toshio; Zhang, Bifeng

2016-01-01

patterns and thereby disrupt gene function. mRNA analyses are therefore among the tests used to interpret the clinical significance of some genetic variants. However, these could be confounded by the appearance of naturally occurring alternative transcripts unrelated to germline sequence variation...... to characterise the spectrum of naturally occurring BRCA2 mRNA alternate-splicing events. METHODS: mRNA was prepared from several blood and breast tissue-derived cells and cell lines by contributing ENIGMA laboratories. cDNA representing BRCA2 alternate splice sites was amplified and visualised using capillary...... or agarose gel electrophoresis, followed by sequencing. RESULTS: We demonstrate the existence of 24 different BRCA2 mRNA alternate-splicing events in lymphoblastoid cell lines and both breast cancer and non-cancerous breast cell lines. CONCLUSIONS: These naturally occurring alternate-splicing events...

Thermoelectric Performance of the MXenes M2CO2 (M = Ti, Zr, or Hf)

KAUST Repository

Gandi, Appala; Alshareef, Husam N.; Schwingenschlö gl, Udo

2016-01-01

MXenes, M2CO2, where M = Ti, Zr, or Hf, in order to evaluate the effect of the metal M on the thermoelectric performance. The lattice contribution to the thermal conductivity, obtained from the phonon life times, is found to be lowest in Ti2CO2

Rac2 controls tumor growth, metastasis and M1-M2 macrophage differentiation in vivo.

Directory of Open Access Journals (Sweden)

Shweta Joshi

Full Text Available Although it is well-established that the macrophage M1 to M2 transition plays a role in tumor progression, the molecular basis for this process remains incompletely understood. Herein, we demonstrate that the small GTPase, Rac2 controls macrophage M1 to M2 differentiation and the metastatic phenotype in vivo. Using a genetic approach, combined with syngeneic and orthotopic tumor models we demonstrate that Rac2-/- mice display a marked defect in tumor growth, angiogenesis and metastasis. Microarray, RT-PCR and metabolomic analysis on bone marrow derived macrophages isolated from the Rac2-/- mice identify an important role for Rac2 in M2 macrophage differentiation. Furthermore, we define a novel molecular mechanism by which signals transmitted from the extracellular matrix via the α4β1 integrin and MCSF receptor lead to the activation of Rac2 and potentially regulate macrophage M2 differentiation. Collectively, our findings demonstrate a macrophage autonomous process by which the Rac2 GTPase is activated downstream of the α4β1 integrin and the MCSF receptor to control tumor growth, metastasis and macrophage differentiation into the M2 phenotype. Finally, using gene expression and metabolomic data from our Rac2-/- model, and information related to M1-M2 macrophage differentiation curated from the literature we executed a systems biologic analysis of hierarchical protein-protein interaction networks in an effort to develop an iterative interactome map which will predict additional mechanisms by which Rac2 may coordinately control macrophage M1 to M2 differentiation and metastasis.

Effect of structural packing on the luminescence properties in tungsten bronze compounds M{sub 2}KNb{sub 5}O{sub 15} (M=Ca, Sr, Ba)

Energy Technology Data Exchange (ETDEWEB)

Yin Xin; Shi Liu [State Key Laboratory of High Performance Ceramics and Superfine Microstructures and CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050 (China); Wei Ang, E-mail: iamawei@njupt.edu.cn [Key Laboratory for Organic Electronics and Information Displays, 9 Wenyuan Road, Nanjing 210046 (China); Wan Dongyun; Wang Yaoming [State Key Laboratory of High Performance Ceramics and Superfine Microstructures and CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050 (China); Huang Fuqiang, E-mail: huangfq@mail.sic.ac.cn [State Key Laboratory of High Performance Ceramics and Superfine Microstructures and CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050 (China); College of Chemistry and Molecular Engineering, Peking University, Beijing 100871 (China)

2012-08-15

Tungsten bronze compounds M{sub 2}KNb{sub 5}O{sub 15} (M=Ca, Sr, Ba) were successfully synthesized, and the luminescence properties were investigated. Among the three compounds, Ca{sub 2}KNb{sub 5}O{sub 15} showed an obviously broad band of host luminescence at 460 nm with exciting at 269 nm. By doping Eu{sup 3+} into the M sites, Ca{sub 2}KNb{sub 5}O{sub 15}:Eu{sup 3+} displayed strong red emission from Eu{sup 3+} ions characteristic transitions, nearly four times higher than Sr{sub 2}KNb{sub 5}O{sub 15}:Eu{sup 3+} and seven times higher than Ba{sub 2}KNb{sub 5}O{sub 15}:Eu{sup 3+}. Crystal packing factor (PF) was introduced to account for this luminescence difference, lower PF being correlated to higher luminescence intensity for perovskite-related structure. Both the as-prepared compounds and the literature examples were proved to fit this correlation. This can be explained through the influence of the structural packing on the environment distortion and crystal field splitting of the doping site. - Graphical abstract: Tungsten bronze compounds M{sub 2}KNb{sub 5}O{sub 15} (M=Ca, Sr, Ba) show the dependence of luminescence properties on structural packing, among which Ca{sub 2}KNb{sub 5}O{sub 15} has the superior luminescence. Highlights: Black-Right-Pointing-Pointer Tungsten bronze compounds were synthesized by solid state reaction. Black-Right-Pointing-Pointer Ca{sub 2}KNb{sub 5}O{sub 15} displayed remarkably blue host luminescence. Black-Right-Pointing-Pointer Ca{sub 2}KNb{sub 5}O{sub 15}:Eu{sup 3+} showed more intense red emission than M{sub 2}KNb{sub 5}O{sub 15}:Eu{sup 3+} (M=Sr, Ba). Black-Right-Pointing-Pointer The relationship between crystal packing factor and luminescence was obtained.

Crystal structure of the cyclo-tetraphosphates pentahydrates: M/sup II/Ag/sub 2/P/sub 4/O/sub 12/. 5H/sub 2/O (M/sup II/=Co,Ni)

Energy Technology Data Exchange (ETDEWEB)

Soua, M.; Jouini, A.; Dabbabi, M.

1989-03-15

M/sub r/=680.84, monoclinic, P2/sub 1//n, a=15.712 (3), b=7.263 (1), c=12.619 (3) A, ..beta..=91.85 (1)/sup 0/, V=1439.3 A/sup 3/, Z=4, D/sub x/=3.141, D/sub m/=3.162 Mg m/sup -3/, lambda(MoK..cap alpha..)=0.7107 A, ..mu..=2.237 mm/sup -1/, F(000)=1308, room temperature, R=0.042 for 3551 independent reflexions. The Co atoms are octahedrally surrounded by two water molecules and four O atoms, forming infinite linear chains parallel to the c axis with a period (CoH/sub 2/O)/sub 2/P/sub 4/O/sub 12/vertical stroke/sup 2-/.Co(2)O/sub 6/ shares the O(E31), O(E41), O(W2) face with Ag(2)O/sub 6/ which is linked to Ag(1)O/sub 6/ by the corner O(E42). Co(1)O/sub 6/ is linked to Ag(1)O/sub 6/ by the edge O(E11)-O(E21). Indeed, polyhedra of associated cations form another infinite chain parallel with the a axis: CoO/sub 6/ octahedra are at the intersection of these two perpendicular infinite chains.

17 CFR 249.507 - Form 7-M, consent to service of process by an individual nonresident broker-dealer.

Science.gov (United States)

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form 7-M, consent to service of process by an individual nonresident broker-dealer. 249.507 Section 249.507 Commodity and... Forms for Statements Made in Connection With Exempt Tender Offers § 249.507 Form 7-M, consent to service...

17 CFR 249.509 - Form 9-M, consent to service of process by a partnership nonresident broker-dealer.

Science.gov (United States)

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form 9-M, consent to service of process by a partnership nonresident broker-dealer. 249.509 Section 249.509 Commodity and... Forms for Statements Made in Connection With Exempt Tender Offers § 249.509 Form 9-M, consent to service...

Aggregation and Trunking of M2M Traffic via D2D Connections

DEFF Research Database (Denmark)

Rigazzi, Giovanni; Kiilerich Pratas, Nuno; Popovski, Petar

2015-01-01

Machine-to-Machine (M2M) communications is one of the key enablers of the Internet of Things (IoT). Billions of devices are expected to be deployed in the near future for novel M2M applications demanding ubiquitous access and global connectivity. In order to cope with the massive number of machines......, there is a need for new techniques to coordinate the access and allocate the resources. Although the majority of the proposed solutions are focused on the adaptation of the traditional cellular networks to the M2M traffic patterns, novel approaches based on the direct communication among nearby devices may...... represent an effective way to avoid access congestion and cell overload. In this paper, we propose a new strategy inspired by the classical Trunked Radio Systems (TRS), exploiting the Device-to-Device (D2D) connectivity between cellular users and Machine-Type Devices (MTDs). The aggregation of the locally...

The M2 Channel

DEFF Research Database (Denmark)

Santner, Paul

Drug resistance of Influenza A against antivirals is an increasing problem. No effective Influenza A drugs targeting the crucial viral protein, the proton transporter M2 are available anymore due to widespread resistance. Thanks to research efforts elucidating M2 protein structure, function and i...... resistance escape routes from drug inhibition. We thereby were hopefully able to provide a platform for the large-scale evaluation of M2 channel activity, inhibitors and resistance....

An ir study of M(1-propanethiol)2Ni(CN)4.G (M=Cd,Ni and G=benzene) clathrates

International Nuclear Information System (INIS)

Kartal, Z.; Tuerkoz, D.; Bahceli, S.

2004-01-01

Two Hofmann-propanethiol-type clathrates of the for M(1-propanethiol) 2 Ni(CN) 4 .G (M=Cd or Ni; G = benzene) have been prepared in the powder form. The 1-propanethiol (1-PT) molecules provide the cavities in which the quest benzene molecules in clathrate structure ar accommodated. The infrared investigations of the obtained clathrates indicate that these compounds are similar in structure to the other Hofmann-type clathrates (Authors)

Greenhouse gas exchange of rewetted bog peat extraction sites and a Sphagnum cultivation site in northwest Germany

Science.gov (United States)

Beyer, C.; Höper, H.

2015-04-01

During the last decades an increasing area of drained peatlands has been rewetted. Especially in Germany, rewetting is the principal treatment on cutover sites when peat extraction is finished. The objectives are bog restoration and the reduction of greenhouse gas (GHG) emissions. The first sites were rewetted in the 1980s. Thus, there is a good opportunity to study long-term effects of rewetting on greenhouse gas exchange, which has not been done so far on temperate cutover peatlands. Moreover, Sphagnum cultivating may become a new way to use cutover peatlands and agriculturally used peatlands as it permits the economical use of bogs under wet conditions. The climate impact of such measures has not been studied yet. We conducted a field study on the exchange of carbon dioxide, methane and nitrous oxide at three rewetted sites with a gradient from dry to wet conditions and at a Sphagnum cultivation site in NW Germany over the course of more than 2 years. Gas fluxes were measured using transparent and opaque closed chambers. The ecosystem respiration (CO2) and the net ecosystem exchange (CO2) were modelled at a high temporal resolution. Measured and modelled values fit very well together. Annually cumulated gas flux rates, net ecosystem carbon balances (NECB) and global warming potential (GWP) balances were determined. The annual net ecosystem exchange (CO2) varied strongly at the rewetted sites (from -201.7 ± 126.8 to 29.7± 112.7g CO2-C m-2 a-1) due to differing weather conditions, water levels and vegetation. The Sphagnum cultivation site was a sink of CO2 (-118.8 ± 48.1 and -78.6 ± 39.8 g CO2-C m-2 a-1). The annual CH4 balances ranged between 16.2 ± 2.2 and 24.2 ± 5.0g CH4-C m-2 a-1 at two inundated sites, while one rewetted site with a comparatively low water level and the Sphagnum farming site show CH4 fluxes close to 0. The net N2O fluxes were low and not significantly different between the four sites. The annual NECB was between -185.5 ± 126.9 and 49

Greenhouse gas emissions from rewetted bog peat extraction sites and a Sphagnum cultivation site in Northwest Germany

Science.gov (United States)

Beyer, C.; Höper, H.

2014-03-01

During the last three decades, an increasing area of drained peatlands was rewetted. This was done with the objective to convert these sites from sources back to sinks or, at least, to much smaller sources of greenhouse gases (GHG). However, available data is still scarce, especially on the long-term climatic effects of rewetting of temperate bogs. Moreover, first field trials are established for Sphagnum cultivating (paludiculture) on wet bog sites and an assessment of the climate impact of such measures has not been studied yet. We conducted a field study on the exchange of carbon dioxide, methane and nitrous oxide at three rewetted sites with a gradient from dry to wet conditions and at a Sphagnum cultivation site in NW Germany over more than two years. Gas fluxes were measured using transparent and opaque closed chambers. The ecosystem respiration (CO2) and the net ecosystem exchange (CO2) were modelled in high time resolution using automatically monitored climate data. Measured and modelled values fit very well together (R2 between 0.88 and 0.98). Annually cumulated gas flux rates, net ecosystem carbon balances (NECB) and global warming potential (GWP) balances were determined. The annual net ecosystem exchange (CO2) varied strongly at the rewetted sites (from -201.7 ± 126.8 to 29.7 ± 112.7 g CO2-C m-2 a-1) due to different weather conditions, water level and vegetation. The Sphagnum cultivation site was a sink of CO2 (-118.8 ± 48.1 and -78.6 ± 39.8 g CO2-C m-2 a-1). The yearly CH4 balances ranged between 16.2 ± 2.2 and 24.2 ± 5.0 g CH4-C m-2 a-1 at two inundated sites, while one rewetted site with a comparatively low water level and the Sphagnum farming site show CH4 fluxes close to zero. The net N2O fluxes were low and not significantly different between the four sites. The annual NECB at the rewetted sites was between -183.8 ± 126.9 and 51.6 ± 112.8 g CO2-C m-2 a-1 and at the Sphagnum cultivating site -114.1 ± 48.1 and -75.3 ± 39.8 g CO2-C m-2 a-1

Housekeeping Closure Report for Corrective Action Unit 463: Areas 2, 3, 9, and 25 Housekeeping Waste Sites, Nevada Test Site, Nevada

International Nuclear Information System (INIS)

1999-01-01

The Federal Facility Agreement and Consent Order was entered into by the State of Nevada, U.S. Department of Energy, and U.S. Department of Defense to identify sites of potential historical contamination and implement corrective actions based on public health and environmental considerations. The facilities subject to this agreement include the Nevada Test Site (NTS), parts of the Tonopah Test Range, parts of the Nellis Air Force Range, the Central Nevada Test Area, and the Project Shoal Area. Corrective Action Sites (CASs) are areas potentially requiring corrective actions and may include solid waste management units, individual disposal, or release sites. Based on geography, technical similarity, agency responsibility, or other appropriate reasons, CASs are grouped together into Corrective Action Units (CAUs) for the purposes of determining corrective actions. This report contains the Closure Verification Forms for cleanup activities that were performed at 13 CASs within CAU 463 on the NTS. The Housekeeping Closure Verification Form for each CAS provides the location, directions to the site, general description, and photographs of the site before and after cleanup activities. Housekeeping activities at these sites included removal of debris (e.g., wooden pallets, metal, glass, and trash) and other material. In addition, these forms confirm prior removal of other contaminated materials such as metal drums or buckets, transformers, lead bricks, batteries, and gas cylinders. Based on these activities, no further action is required at these CASs

Data-driven discovery of energy materials: efficient BaM2Si3O10 : Eu2+ (M = Sc, Lu) phosphors for application in solid state white lighting.

Science.gov (United States)

Brgoch, Jakoah; Hasz, Kathryn; Denault, Kristin A; Borg, Christopher K H; Mikhailovsky, Alexander A; Seshadri, Ram

2014-01-01

In developing phosphors for application in solid state lighting, it is advantageous to target structures from databases with highly condensed polyhedral networks that produce rigid host compounds. Rigidity limits channels for non-radiative decay that will decrease the luminescence quantum yield. BaM(2)Si(3)O(10) (M = Sc, Lu) follows this design criterion and is studied here as an efficient Eu(2+)-based phosphor. M = Sc(3+) and Lu(3+) compounds with Eu(2+) substitution were prepared and characterized using synchrotron X-ray powder diffraction and photoluminescence spectroscopy. Substitution with Eu(2+) according to Ba(1-x)Eu(x)Sc(2)Si(3)O(10) and Ba(1-x)Eu(x)Lu(2)Si(3)O(10) results in UV-to-blue and UV-to-blue-green phosphors, respectively. Interestingly, substitution with Eu(2+) in the Lu(3+) containing material produces two emission peaks at low temperature and with 365 nm excitation, as allowed by the two substitution sites. The photoluminescence of the Sc(3+) compound is robust at high temperature, decreasing by only 25% of its room temperature intensity at 503 K, while the Lu-analogue suffers a large drop (75%) from its room temperature intensity. The decrease in emission intensity is explained as stemming from charge transfer quenching due to the short distances separating the luminescent centers on the Lu(3+) substitution site. The correlation between structure and optical response in these two compounds indicates that even though the structures are three-dimensionally connected, high symmetry is required to prevent structural distortions that could impact photoluminescence.

12 CFR 569.2 - Form of proxies.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Form of proxies. 569.2 Section 569.2 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY PROXIES § 569.2 Form of proxies. Every form of proxy shall conform to the following requirements: (a) The proxy shall be revocable at will by...

Macroencapsulated and elemental lead mixed waste sites report

International Nuclear Information System (INIS)

Kalia, A.; Jacobson, R.

1996-09-01

The purpose of this study was to compile a list of the Macroencapsulated (MACRO) and Elemental Lead (EL) Mixed Wastes sites that will be treated and require disposal at the Nevada Test Site within the next five to ten years. The five sites selected were: Hanford Site, Richland, Washington; Idaho National Engineering Laboratory (INEL), Idaho Falls, Idaho; Oak Ridge National Laboratory (ORNL), Oak Ridge, Tennessee; Rocky Flats Environmental Technology (RF), Golden, Colorado; and Savannah River (SRS), Charleston, South Carolina. A summary of total lead mixed waste forms at the five selected DOE sites is described in Table E-1. This table provides a summary of total waste and grand total of the current inventory and five-year projected generation of lead mixed waste for each site. This report provides conclusions and recommendations for further investigations. The major conclusions are: (1) the quantity of lead mixed current inventory waste is 500.1 m 3 located at the INEL, and (2) the five sites contain several other waste types contaminated with mercury, organics, heavy metal solids, and mixed sludges

A short comparison between mT2 and mCT

International Nuclear Information System (INIS)

Serna, Mario

2008-01-01

We compare m T2 with m CT ; both are kinematic variables designed to find relationships between masses of pair-produced new states with symmetric decay chains. We find that for massless visible particles m CT equals m T2 in a particular limit. We identify advantages and disadvantages to the use of each variable. Tovey's paper on m CT also introduced a powerful concept of extracting mass information from an analysis at intermediate stages of a symmetric decay chain. We suggest that m T2 is a better tool for performing this analysis than m CT due to m T2 's better properties under initial state radiation.

Spaceborne Potential for Examining Taiga-Tundra Ecotone Form and Vulnerability

Science.gov (United States)

Montesano, Paul M.; Sun, Guoqing; Dubayah, Ralph O.; Ranson, K. Jon

2016-01-01

In the taiga-tundra ecotone (TTE), site-dependent forest structure characteristics can influence the subtle and heterogeneous structural changes that occur across the broad circumpolar extent. Such changes may be related to ecotone form, described by the horizontal and vertical patterns of forest structure (e.g., tree cover, density and height) within TTE forest patches, driven by local site conditions, and linked to ecotone dynamics. The unique circumstance of subtle, variable and widespread vegetation change warrants the application of spaceborne data including high-resolution (less than 5m) spaceborne imagery (HRSI) across broad scales for examining TTE form and predicting dynamics. This study analyzes forest structure at the patch-scale in the TTE to provide a means to examine both vertical and horizontal components of ecotone form. We demonstrate the potential of spaceborne data for integrating forest height and density to assess TTE form at the scale of forest patches across the circumpolar biome by (1) mapping forest patches in study sites along the TTE in northern Siberia with a multi-resolution suite of spaceborne data, and (2) examining the uncertainty of forest patch height from this suite of data across sites of primarily diffuse TTE forms. Results demonstrate the opportunities for improving patch-scale spaceborne estimates of forest height, the vertical component of TTE form, with HRSI. The distribution of relative maximum height uncertainty based on prediction intervals is centered at approximately 40%, constraining the use of height for discerning differences in forest patches. We discuss this uncertainty in light of a conceptual model of general ecotone forms, and highlight how the uncertainty of spaceborne estimates of height can contribute to the uncertainty in identifying TTE forms. A focus on reducing the uncertainty of height estimates in forest patches may improve depiction of TTE form, which may help explain variable forest responses in the

Dosimetric assessments of exposure to tritium of employees of the 2M Process company, and of those of customer and partner companies who intervened on the Saint-Maur-des-Fosses (94) and Bondoufle (91) sites; Evaluations dosimetriques de l'exposition au tritium des salaries de l'entreprise 2M Process et de ceux de leurs entreprises clientes et partenaires etant intervenues sur les sites de Saint-Maur-des-Fosses (94) et de Bondoufle (91)

Energy Technology Data Exchange (ETDEWEB)

NONE

2010-07-01

This document briefly reports observations and analyses made on two sites belonging to the 2M Process Company. These observations and analyses are notably based on urinary analyses which revealed a contamination of employees by tritium on one of these sites. Exposure scenarios were elaborated, and received doses were estimated for employees, visitors belonging to other companies, and with respect to the identified period of the scenario

A conformation-specific interhelical salt bridge in the K+ binding site of gastric H,K-ATPase

NARCIS (Netherlands)

Koenderink, J.B.; Swarts, H.G.P.; Willems, P.H.G.M.; Krieger, E.; Pont, J.J.H.H.M. de

2004-01-01

Homology modeling of gastric H, K-ATPase based on the E-2 model of sarcoplasmic reticulum Ca2+-ATPase (Toyoshima, C., and Nomura, H. (2002) Nature 392, 835-839) revealed the presence of a single high-affinity binding site for K+ and an E-2 form-specific salt bridge between Glu(820) (M6) and Lys(791)

A C-terminal, cysteine-rich site in poliovirus 2C(ATPase) is required for morphogenesis.

Science.gov (United States)

Wang, Chunling; Ma, Hsin-Chieh; Wimmer, Eckard; Jiang, Ping; Paul, Aniko V

2014-06-01

The morphogenesis of viruses belonging to the genus Enterovirus in the family Picornaviridae is still poorly understood despite decades-long investigations. However, we recently provided evidence that 2C(ATPase) gives specificity to poliovirus encapsidation through an interaction with capsid protein VP3. The polypeptide 2C(ATPase) is a highly conserved non-structural protein of enteroviruses with important roles in RNA replication, encapsidation and uncoating. We have identified a site (K279/R280) near the C terminus of the polypeptide that is required for morphogenesis. The aim of the current project was to search for additional functional sites near the C terminus of the 2C(ATPase) polypeptide, with particular interest in those that are required for encapsidation. We selected for analysis a cysteine-rich site of the polypeptide and constructed four mutants in which cysteines or a histidine was changed to an alanine. The RNA transcripts were transfected into HeLa cells yielding two lethal, one temperature-sensitive and one quasi-infectious mutants. All four mutants exhibited normal protein translation in vitro and three of them possessed severe RNA replication defects. The quasi-infectious mutant (C286A) yielded variants with a pseudo-reversion at the original site (A286D), but some also contained one additional mutation: A138V or M293V. The temperature-sensitive mutant (C272A/H273A) exhibited an encapsidation and possibly also an uncoating defect at 37 °C. Variants of this mutant revealed suppressor mutations at three different sites in the 2C(ATPase) polypeptide: A138V, M293V and K295R. We concluded that the cysteine-rich site near the C terminus of 2C(ATPase) is involved in encapsidation, possibly through an interaction with an upstream segment located between boxes A and B of the nucleotide-binding domain. © 2014 The Authors.

Report ETSI M2M-14bis JTC March 2011 meeting

NARCIS (Netherlands)

Keesmaat, N.W.

2011-01-01

The ETSI Technical Committee (TC) M2M focuses on the development of a generic M2M architecture and underlying protocols suitable for a wide range of M2M environments. Whereas in the past effort has been put in the development of several use cases, the focus of this M2M 14bis meeting – held in Sophia

Electric field gradient at nuclei on orthorhombic sites in CaF2 and SrCl2 : comparison with electronic zero-field splitting

NARCIS (Netherlands)

Ormondt, van D.; Andriessen, J.; Dam, J.A.M.; Ast, van M.A.; Hartog, den H.W.; Bijvank, E.J.

1979-01-01

The electric field gradients (EFG) Vzz and Vxx-Vyy at the nucleus of 157Gd3+ have been determined, using ENDOR, for CaF2:Gd3+M+(M+=Li,K+) and SrCl2:Gd3+Na+. The results are compared with the electronic zero-field splitting parameters of Gd3+, B20 and B22 for the same sites. A simple relation between

Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5' but not the 3' splice site inhibit intron processing in Nicotiana plumbaginifolia.

Science.gov (United States)

Liu, H X; Goodall, G J; Kole, R; Filipowicz, W

1995-01-16

We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.

Magnetic form factor of NpAs2: a crystal field wave function for 5f electrons

International Nuclear Information System (INIS)

Amoretti, G.; Blaise, A.; Bonnet, M.; Boucherle, J.X.; Delapalme, A.; Fournier, J.M.; Vigneron, F.

1982-10-01

Neptunium magnetic form factor measurements in the ferromagnetic phase of NpAs 2 (T = 4.2 K, H = 4.6 T) are analysed under different assumptions: Np 3 + , Np 4 + or Np 5 + , with a free ion wave-function (Russel-Saunders and intermediate coupling scheme) or with a Crystal Field Wave function for 5f electrons: sub(m)sup(μ)asub(m)asub(m)/J,m>. The experimental results are compatible with either a 3+ or 4+ state

Results from exploratory drill hole UE2ce, Northwest Yucca Flat, Nevada Test Site, near the NASH Event

International Nuclear Information System (INIS)

Pawloski, G.A.

1982-01-01

Exploratory drill hole UE2ce was drilled in January 1977 to determine geologic and geophysical characteristics of this site. This report presents geophysical logs, lithology, geologic structure, water table measurements, and physical properties for this drill hole. The data are then extrapolated to the NASH site, an event in U2ce, 55.6 m due north of UE2ce

Homoleptic diphosphacyclobutadiene complexes [M(η(4)-P2C2R2)2]x- (M = Fe, Co; x = 0, 1).

Science.gov (United States)

Wolf, Robert; Ehlers, Andreas W; Khusniyarov, Marat M; Hartl, František; de Bruin, Bas; Long, Gary J; Grandjean, Fernande; Schappacher, Falko M; Pöttgen, Rainer; Slootweg, J Chris; Lutz, Martin; Spek, Anthony L; Lammertsma, Koop

2010-12-27

The preparation and comprehensive characterization of a series of homoleptic sandwich complexes containing diphosphacyclobutadiene ligands are reported. Compounds [K([18]crown-6)(thf)(2)][Fe(η(4)-P(2)C(2)tBu(2))(2)] (K1), [K([18]crown-6)(thf)(2)][Co(η(4)-P(2)C(2)tBu(2))(2)] (K2), and [K([18]crown-6)(thf)(2)][Co(η(4)-P(2)C(2)Ad(2))(2)] (K3, Ad = adamantyl) were obtained from reactions of [K([18]crown-6)(thf)(2)][M(η(4)-C(14)H(10))(2)] (M = Fe, Co) with tBuC[triple bond]P (1, 2), or with AdC[triple bond]P (3). Neutral sandwiches [M(η(4)-P(2)C(2)tBu(2))(2)] (4: M = Fe 5: M = Co) were obtained by oxidizing 1 and 2 with [Cp(2)Fe]PF(6). Cyclic voltammetry and spectro-electrochemistry indicate that the two [M(η(4)-P(2)C(2)tBu(2))(2)](-)/[M(η(4)-P(2)C(2)tBu(2))(2)] moieties can be reversibly interconverted by one electron oxidation and reduction, respectively. Complexes 1-5 were characterized by multinuclear NMR, EPR (1 and 5), UV/Vis, and Mössbauer spectroscopies (1 and 4), mass spectrometry (4 and 5), and microanalysis (1-3). The molecular structures of 1-5 were determined by using X-ray crystallography. Essentially D(2d)-symmetric structures were found for all five complexes, which show the two 1,3-diphosphacyclobutadiene rings in a staggered orientation. Density functional theory calculations revealed the importance of covalent metal-ligand π bonding in 1-5. Possible oxidation state assignments for the metal ions are discussed.

HCV E2 glycoprotein: mutagenesis of N-linked glycosylation sites and its effects on E2 expression and processing

International Nuclear Information System (INIS)

Slater-Handshy, Tiffany; Droll, Deborah A.; Fan Xiaofeng; Di Bisceglie, Adrian M.; Chambers, Thomas J.

2004-01-01

An expression system for analysis of the synthesis and processing of the E2 glycoprotein of a hepatitis C virus (HCV) genotype 1a strain was developed in transiently transfected cells. E2 proteins representing the entire length of the protein, including the transmembrane segment (E2) as well as two truncated versions (E2 660 and E2 715 ), were characterized for acquisition of N-linked glycans and transport to the media of transfected cells. To investigate the utilization of the 10 potential N-linked glycosylation sites on this E2 protein, a series of mutations consisting of single or multiple (two, three, four or eight) ablations of asparagine residues in the background of the E2 660 construct were analyzed. E2 660 proteins harboring single or multiple site mutations were produced at levels similar to that of wild-type protein, but secretion of the single mutants was mildly diminished, and elimination of two or more sites dramatically reduced delivery of the protein to the media. Similar results were obtained in Huh-7 cells with respect to intracellular synthesis and secretion of the mutant proteins. Analysis of oligosaccharide composition using endoglycosidase digestion revealed that all of the glycan residues on the intracellular forms of E2 660 , E2 715 , and E2 contained N-linked glycans modified into high-mannose carbohydrates, in contrast to the secreted forms, which were endo H resistant. The parental E2 660 protein could be readily detected in Huh-7 cells using anti-polyhistidine or antibody to recombinant E2. In contrast, E2 660 lacking the eight N-linked glycans was expressed but not detectable with anti-E2 antibody, and proteins lacking four glycans exhibited reduced reactivity. These experiments provide direct evidence that the presence of multiple N-linked glycans is required for the proper folding of the E2 protein in the ER and secretory pathway as well as for formation of its antigenic structure

Principles of water oxidation and O2-based hydrocarbon transformation by multinuclear catalytic sites

Energy Technology Data Exchange (ETDEWEB)

Musaev, Djamaladdin G [Chemistry, Emory University; Hill, Craig L [Chemistry, Emory University; Morokuma, Keiji [Chemistry, Emory University

2014-10-28

centers in the active site form another part of considerable interest of our grant because species with such sites [including methane monooxygenase (MMO) and more] are some of the most effective oxygenase catalysts known. Our team conducted the following research on γ-M2-Keggin complexes: (a) investigated stability of the trimer [{Fe3(OH)3(H2O)2}3(γ-SiW10O36)3]15-, 4, in water, and developed the chemistry and catalysis of the di-iron centered POM, [γ(1,2)-SiW10{Fe(OH)}2O38]6-, 5, in organic solvents (Figure 2). We also study the thermodynamic and structural stability of γ-M2-Keggin in aqueous media for different M’s (d-electron metals). We have defined two structural classes of POMs with proximally bound d-electron metal centers. We refer to these structural isomers of the {γ-M2SiW10} family of POMs as “in-pocket” and “out-of pocket”. We have elucidated the factors controlling the structure and stability of the V, Fe, Ru, Tc, Mo and Rh derivatives of [(SiO4)M2(OH)2W10O32]4- using a range of computational tools. We have: (a) demonstrated that heteroatom X in these polyanions may function as an “internal switch” for defining the ground electronic states and, consequently, the reactivity of the γ-M2-Keggin POM complexes; (b) elucidated reactivity of divacant lacunary species and polyperoxotungstates (PPTs), {Xn+O4[WO(O2)2]4}n-, which could be degradation products of γ-M2-Keggin complexes in aqueous media; (c) elucidated the role of the POM ligand in stabilization of {Ru2} and {(Ru-oxo)2} fragments in the reactant and product of the reaction of {γ-[(Xn+O4)Ru2(OH)2W10O32]}(8-n)- (where X = Si4+, P5+ and S6+) with O2, and (d) the mechanisms of olefin epoxidation catalyzed by these di-d-transition metal substituted and divacant lacunary γ-M2-Keggin complexes. III. Complementing the efforts presented above was the development of less time-consuming but reasonably accurate computational methods allowing one to explore more deeply large catalytic systems. We

First principles study of structural, electronic and optical properties of polymorphic forms of Rb 2Te

Science.gov (United States)

Alay-e-Abbas, S. M.; Shaukat, A.

2011-05-01

First-principles density functional theory calculations have been performed for structural, electronic and optical properties of three polymorphic forms of rubidium telluride. Our calculations show that the sequence of pressure induced phase transitions for Rb 2Te is Fm3¯m → Pnma → P6 3/mmc which is governed by the coordination numbers of the anions. From our calculated low transition pressure value for the Fm3¯m phase to the Pnma phase transition of Rb 2Te, the experimentally observed meta-stability of Fm3¯m phase at ambient conditions seems reasonable. The electronic band structure has been calculated for all the three phases and the change in the energy band gap is discussed for the transitioning phases. The energy band gaps obtained for the three phases of Rb 2Te decrease on going from the meta-stable phase to the high-pressure phases. Total and partial density of states for the polymorphs of Rb 2Te has been computed to elucidate the contribution of various atomic states on the electronic band structure. Furthermore, optical properties for all the polymorphic forms have been presented in form of the complex dielectric function.

Spin Crossover in Fe(II)-M(II) Cyanoheterobimetallic Frameworks (M = Ni, Pd, Pt) with 2-Substituted Pyrazines.

Science.gov (United States)

Kucheriv, Olesia I; Shylin, Sergii I; Ksenofontov, Vadim; Dechert, Sebastian; Haukka, Matti; Fritsky, Igor O; Gural'skiy, Il'ya A

2016-05-16

Discovery of spin-crossover (SCO) behavior in the family of Fe(II)-based Hofmann clathrates has led to a "new rush" in the field of bistable molecular materials. To date this class of SCO complexes is represented by several dozens of individual compounds, and areas of their potential application steadily increase. Starting from Fe(2+), square planar tetracyanometalates M(II)(CN)4(2-) (M(II) = Ni, Pd, Pt) and 2-substituted pyrazines Xpz (X = Cl, Me, I) as coligands we obtained a series of nine new Hofmann clathrate-like coordination frameworks. X-ray diffraction reveals that in these complexes Fe(II) ion has a pseudo-octahedral coordination environment supported by four μ4-tetracyanometallates forming its equatorial coordination environment. Depending on the nature of X and M, axial positions are occupied by two 2X-pyrazines (X = Cl and M(II) = Ni (1), Pd (2), Pt (3); X = Me and M(II) = Ni (4), Pd (5)) or one 2X-pyrazine and one water molecule (X = I and M(II) = Ni (7), Pd (8), Pt (9)), or, alternatively, two distinct Fe(II) positions with either two pyrazines or two water molecules (X = Me and M(II) = Pt (6)) are observed. Temperature behavior of magnetic susceptibility indicates that all compounds bearing FeN6 units (1-6) display cooperative spin transition, while Fe(II) ions in N5O or N4O2 surrounding are high spin (HS). Structural changes in the nearest Fe(II) environment upon low-spin (LS) to HS transition, which include ca. 10% Fe-N distance increase, lead to the cell expansion. Mössbauer spectroscopy is used to characterize the spin state of all HS, LS, and intermediate phases of 1-9 (see abstract figure). Effects of a pyrazine substituent and M(II) nature on the hyperfine parameters in both spin states are established.

How to characterize a potential site for CO2 storage with sparse data coverage - a Danish onshore site case

International Nuclear Information System (INIS)

Nielsen, Carsten Moller; Frykman, Peter; Dalhoff, Finn

2015-01-01

The paper demonstrates how a potential site for CO 2 storage can be evaluated up to a sufficient level of characterization for compiling a storage permit application, even if the site is only sparsely explored. The focus of the paper is on a risk driven characterization procedure. In the initial state of a site characterization process with sparse data coverage, the regional geological and stratigraphic understanding of the area of interest can help strengthen a first model construction for predictive modeling. Static and dynamic modeling in combination with a comprehensive risk assessment can guide the different elements needed to be evaluated for fulfilling a permit application. Several essential parameters must be evaluated; the storage capacity for the site must be acceptable for the project life of the operation, the trap configuration must be efficient to secure long term containment, the injectivity must be sufficient to secure a longstanding stable operation and finally a satisfactory and operational measuring strategy must be designed. The characterization procedure is demonstrated for a deep onshore aquifer in the northern part of Denmark, the Vedsted site. The site is an anticlinal structural closure in an Upper Triassic - Lower Jurassic sandstone formation at 1 800-1 900 m depth. (authors)

Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 2. Assessing Charge Site Location and Isotope Scrambling

Science.gov (United States)

Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C.; Valentine, Stephen J.

2016-03-01

Ion mobility spectrometry (IMS) coupled with gas-phase hydrogen deuterium exchange (HDX)-mass spectrometry (MS) and molecular dynamic simulations (MDS) has been used for structural investigation of anions produced by electrospraying a sample containing a synthetic peptide having the sequence KKDDDDDIIKIIK. In these experiments the potential of the analytical method for locating charge sites on ions as well as for utilizing collision-induced dissociation (CID) to reveal the degree of deuterium uptake within specific amino acid residues has been assessed. For diffuse (i.e., more elongated) [M - 2H]2- ions, decreased deuterium content along with MDS data suggest that the D4 and D6 residues are charge sites, whereas for the more diffuse [M - 3H]3- ions, the data suggest that the D4, D7, and the C-terminus are deprotonated. Fragmentation of mobility-selected, diffuse [M - 2H]2- ions to determine deuterium uptake at individual amino acid residues reveals a degree of deuterium retention at incorporation sites. Although the diffuse [M - 3H]3- ions may show more HD scrambling, it is not possible to clearly distinguish HD scrambling from the expected deuterium uptake based on a hydrogen accessibility model. The capability of the IMS-HDX-MS/MS approach to provide relevant details about ion structure is discussed. Additionally, the ability to extend the approach for locating protonation sites on positively-charged ions is presented.

Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2.

Directory of Open Access Journals (Sweden)

Nandhitha Subramanian

Full Text Available The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10.

Mannan-binding protein forms complexes with alpha-2-macroglobulin. A protein model for the interaction

DEFF Research Database (Denmark)

Storgaard, P; Holm Nielsen, E; Skriver, E

1995-01-01

We report that alpha-2-macroglobulin (alpha 2M) can form complexes with a high molecular weight porcine mannan-binding protein (pMBP-28). The alpha 2M/pMBP-28 complexes was isolated by PEG-precipitation and affinity chromatography on mannan-Sepharose, protein A-Sepharose and anti-IgM Sepharose......-PAGE, which reacted with antibodies against alpha 2M and pMBP-28, respectively, in Western blotting. Furthermore, alpha 2M/pMBP-28 complexes were demonstrated by electron microscopy. Fractionation of pMBP-containing D-mannose eluate from mannan-Sepharose on Superose 6 showed two protein peaks which reacted...... with anti-C1 s antibodies in ELISA, one of about 650-800 kDa, which in addition contained pMBP-28 and anti-alpha 2M reactive material, the other with an M(r) of 100-150 kDa. The latter peak revealed rhomboid molecules (7 x 15 nm) in the electron microscope and a 67 kDa band in SDS-PAGE under reducing...

Site-specific epsilon-NH2 monoacylation of pancreatic phospholipase A2. 2. Transformation of soluble phospholipase A2 into a highly penetrating "membrane-bound" form.

Science.gov (United States)

Van der Wiele, F C; Atsma, W; Roelofsen, B; van Linde, M; Van Binsbergen, J; Radvanyi, F; Raykova, D; Slotboom, A J; De Haas, G H

1988-03-08

Long-chain lecithins present in bilayer structures like vesicles or membranes are only very poor substrates for pancreatic phospholipases A2. This is probably due to the fact that pancreatic phospholipases A2 cannot penetrate into the densely packed bilayer structures. To improve the weak penetrating properties of pancreatic phospholipases A2, we prepared and characterized a number of pancreatic phospholipase A2 mutants that have various long acyl chains linked covalently to Lys116 in porcine and to Lys10 in bovine phospholipase A2 [Van der Wiele, F.C., Atsma, W., Dijkman, R., Schreurs, A.M.M., Slotboom, A.J., & De Haas, G.H. (1988) Biochemistry (preceding paper in this issue)]. When monomolecular surface layers of L- and D-didecanoyllecithin were used, it was found that the introduction of caprinic, lauric, palmitic, and oleic acid at Lys116 in the porcine enzyme increases its penetrating power from 13 to about 17, 20, 32, and 22 dyn/cm, respectively, before long lag periods were obtained. Incorporation of a palmitoyl moiety at Lys10 in the bovine enzyme shifted the penetrating power from 11 to about 25 dyn/cm. Only the best penetrating mutant, viz., porcine phospholipase A2 having a palmitoyl moiety at Lys116, was able to cause complete leakage of 6-carboxyfluorescein entrapped in small unilamellar vesicles of egg lecithin under nonhydrolytic conditions. Similarly, only this latter palmitoylphospholipase A2 completely hydrolyzed all lecithin in the outer monolayer of the human erythrocyte at a rate much faster than Naja naja phospholipase A2, the most powerful penetrating snake venom enzyme presently known.

Remaining Sites Verification Package for the 100-F-31, 144-F Sanitary Sewer System, Waste Site Reclassification Form 2006-033

Energy Technology Data Exchange (ETDEWEB)

L. M. Dittmer

2006-08-24

The 100-F-31 waste site is a former septic system that supported the inhalation laboratories, also referred to as the 144-F Particle Exposure Laboratory (132-F-2 waste site), which housed animals exposed to particulate material. The 100-F-31 waste site has been remediated to achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

STABILITY OF CO2 ATMOSPHERES ON DESICCATED M DWARF EXOPLANETS

International Nuclear Information System (INIS)

Gao, Peter; Hu, Renyu; Li, Cheng; Yung, Yuk L.; Robinson, Tyler D.

2015-01-01

We investigate the chemical stability of CO 2 -dominated atmospheres of desiccated M dwarf terrestrial exoplanets using a one-dimensional photochemical model. Around Sun-like stars, CO 2 photolysis by Far-UV (FUV) radiation is balanced by recombination reactions that depend on water abundance. Planets orbiting M dwarf stars experience more FUV radiation, and could be depleted in water due to M dwarfs’ prolonged, high-luminosity pre-main sequences. We show that, for water-depleted M dwarf terrestrial planets, a catalytic cycle relying on H 2 O 2 photolysis can maintain a CO 2 atmosphere. However, this cycle breaks down for atmospheric hydrogen mixing ratios <1 ppm, resulting in ∼40% of the atmospheric CO 2 being converted to CO and O 2 on a timescale of 1 Myr. The increased O 2 abundance leads to high O 3 concentrations, the photolysis of which forms another CO 2 -regenerating catalytic cycle. For atmospheres with <0.1 ppm hydrogen, CO 2 is produced directly from the recombination of CO and O. These catalytic cycles place an upper limit of ∼50% on the amount of CO 2 that can be destroyed via photolysis, which is enough to generate Earth-like abundances of (abiotic) O 2 and O 3 . The conditions that lead to such high oxygen levels could be widespread on planets in the habitable zones of M dwarfs. Discrimination between biological and abiotic O 2 and O 3 in this case can perhaps be accomplished by noting the lack of water features in the reflectance and emission spectra of these planets, which necessitates observations at wavelengths longer than 0.95 μm

Remaining Sites Verification Package for 132-D-3, 1608-D Effluent Pumping Station. Attchment to Waste Site Reclassification Form 2005-033

International Nuclear Information System (INIS)

Carlson, R.A.

2006-01-01

Decommissioning and demolition of the 132-D-3 site, 1608-D Effluent Pumping Station was performed in 1986. Decommissioning included removal of equipment, water, and sludge for disposal as radioactive waste. The at- and below-grade structure was demolished to at least 1 m below grade and the resulting rubble buried in situ. The area was backfilled to grade with at least 1 m of clean fill and contoured to the surrounding terrain. Residual concentrations support future land uses that can be represented by a rural-residential scenario and pose no threat to groundwater or the Columbia River based on RESRAD modeling

Chemostratigraphy at DSDP Sites 386 (Bermuda Rise) and 144 (Demerara Rise), Implications for Euxinic Conditions During OAE-2

Science.gov (United States)

Horst, P. A.; Maurrasse, F. J.; Sinninghe-Damsté, J. S.; Sandler, A.

2008-05-01

). Biomarker data indicate that during OAE 2 similar paleoceanographic conditions prevailed at both DSDP Sites, 144 on the Demerara Rise and 386 on the Bermuda Rise. A. Forster, H. Sturt, P.A. Meyers, et al., in preliminary shipboard results from Sites 1257 and 1258, Leg 207, J. Erbacher, D.C. Mosher, M.J. Malone, et al., Proc. ODP, Init.Repts.207,1-22 [Online]: http://wwwodp.tamu.edu/publications/207_IR/VOLUME/ CHAPTERS/IR207_10.PDF. [Cited 2006-02-09] M.M.M. Kuypers, et al., Paleoceanography, 17, 4, 1051-1063 (2002) B.R.T. Simoneit, in Initial Reports of the Deep Sea Drilling Project, Vol. 43, Tucholke, B.E., Vogt, P.R., et al., 1979, Eds, Washington (U.S. Government Printing Office), pp. 643-650 (1979) B.R.T. Simoneit and D.H.Stuermer, in Cretaceous Oceans, S.O. Schlanger and M.B. Cita, Eds, Academic Press, New York, pp. 145-163 (1982)

Modulation of mdm2 pre-mRNA splicing by 9-aminoacridine-PNA (peptide nucleic acid conjugates targeting intron-exon junctions

Directory of Open Access Journals (Sweden)

Nielsen Peter E

2010-06-01

Full Text Available Abstract Background Modulation of pre-mRNA splicing by antisense molecules is a promising mechanism of action for gene therapeutic drugs. In this study, we have examined the potential of peptide nucleic acid (PNA 9-aminoacridine conjugates to modulate the pre-mRNA splicing of the mdm2 human cancer gene in JAR cells. Methods We screened 10 different 15 mer PNAs targeting intron2 at both the 5' - and the 3'-splice site for their effects on the splicing of mdm2 using RT-PCR analysis. We also tested a PNA (2512 targeting the 3'-splice site of intron3 with a complementarity of 4 bases to intron3 and 11 bases to exon4 for its splicing modulation effect. This PNA2512 was further tested for the effects on the mdm2 protein level as well as for inhibition of cell growth in combination with the DNA damaging agent camptothecin (CPT. Results We show that several of these PNAs effectively inhibit the splicing thereby producing a larger mRNA still containing intron2, while skipping of exon3 was not observed by any of these PNAs. The most effective PNA (PNA2406 targeting the 3'-splice site of intron2 had a complementarity of 4 bases to intron2 and 11 bases to exon3. PNA (2512 targeting the 3'-splice site of intron3 induced both splicing inhibition (intron3 skipping and skipping of exon4. Furthermore, treatment of JAR cells with this PNA resulted in a reduction in the level of MDM2 protein and a concomitant increase in the level of tumor suppressor p53. In addition, a combination of this PNA with CPT inhibited cell growth more than CPT alone. Conclusion We have identified several PNAs targeting the 5'- or 3'-splice sites in intron2 or the 3'-splice site of intron3 of mdm2 pre-mRNA which can inhibit splicing. Antisense targeting of splice junctions of mdm2 pre-mRNA may be a powerful method to evaluate the cellular function of MDM2 splice variants as well as a promising approach for discovery of mdm2 targeted anticancer drugs.

Microstructural Investigations of Al2O3 Scale Formed on FeCrAl Steel during High Temperature Oxidation in SO2

International Nuclear Information System (INIS)

Homa, M.; Zurek, Z.; Morgiel, B.; Zieba, P.; Wojewoda, J.

2008-01-01

The results of microstructure observations of the Al 2 O 3 scale formed on a Fe-Cr-Al steel during high temperature oxidation in the SO 2 atmosphere are presented. Morphology of the scale has been studied by SEM and TEM techniques. Phase and chemical compositions have been studied by EDX and XRD techniques. The alumina oxide is a primary component of the scale. TEM observations showed that the scale was multilayer. The entire surface of the scale is covered with 'whiskers, which look like very thin platelets and have random orientation. The cross section of a sample shows, that the 'whiskers' are approximately 2 μm high, however the compact scale layer on which they reside is 0.2 μm thick. The scale layer was composed mainly of small equiaxial grains and a residual amount of small columnar grains. EDX analysis of the scale surface showed that the any sulfides were found in the formed outer and thin inner scale layer. A phase analysis of the scale formed revealed that it is composed mainly of the θ-Al 2 O 3 phase and a residual amount of α-Al 2 O 3

U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization?; Comment on “Decentralisation of Health Services in Fiji: A Decision Space Analysis”

Directory of Open Access Journals (Sweden)

Arturo Vargas Bustamante

2016-09-01

Full Text Available For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization.

2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.

Science.gov (United States)

Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D

2018-03-01

Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.

Rupture directivity and local site effects: the M7.3 Honduras earthquake of May 23, 2009

Science.gov (United States)

Shulman, D.; Mooney, W. D.

2009-12-01

On May 28, 2009, at 2:24 AM local time, a M 7.3 earthquake struck off the coast of Honduras on the Motagua-Swan Fault System (MSFS), part of the boundary between the North America and Caribbean plates. This plate boundary has an average slip rate of 20 mm/year. This left-lateral earthquake had an average slip of 1.5 m on a 100-km-long near-vertical fault plane (Hayes and Ji, 2009). The hypocenter depth is estimated at 10 km. The main shock caused 130 structures, including homes and office buildings, to collapse or suffer significant damage in northern Honduras. Seven deaths were reported. Due to a lack of recordings in the area, the available documentation of the local effects of this earthquake are the USGS "Did you feel it?" responses and the data collected during our field seismic intensity investigation. We conducted a field investigation in Honduras between May 30 and June 6, 2009, focused on areas with local reports of damage, including the cities of La Ceiba, El Progresso, San Pedro Sula, Puerto Cortes in northern Honduras and the island of Roatan in the Caribbean Sea. The damage ascertained at these five sites shows that the severity of damage did not decrease with distance from the epicenter as predicted by standard attenuation relations. Instead, a concentration of damage was observed in El Progresso, approximately 75 km directly south from the SW end of the rupture and 160 km from the epicenter. The island of Roatan, just 30 km from the epicenter, was graded as VI on the Modified Mercalli Intensity scale while, El Progresso was graded as VIII (one unit higher than “Did you feel it?”). These intensity anomalies can be explained by two factors: (1) SW-directed rupture propagation and proximity to a localized 3.0m slip pulse (asperity) that occurred near the SW end of the fault (Hayes and Ji, 2009) that focused energy toward the city of El Progress on the mainland and; (2) local site effects, particularly the Precambrian schists and gneisses on the

Wireless Device-to-Device (D2D) Links for Machine-to-Machine (M2M) Communication

DEFF Research Database (Denmark)

Pratas, Nuno; Popovski, Petar

2017-01-01

Device-to-Device (D2D) communications will play an important role in the fifth generation (5G) cellular networks, by increasing the spatial reuse of spectrum resources and enabling communication links with low latency. D2D is composed of two fundamental building blocks: proximity discovery...... and direct communication between nearby users. Another emerging trend in wireless cellular systems is Machine-to-Machine (M2M) communications, often characterized by fixed, low transmission rates. In this chapter we motivate the synergy between D2D and M2M, and present technologies that enable M2M-via-D2D...

Application of a qPCR assay in the investigation of susceptibility to malaria infection of the M and S molecular forms of An. gambiae s.s. in Cameroon.

Directory of Open Access Journals (Sweden)

Anne Boissière

Full Text Available Plasmodium falciparum is the causative agent of malaria, a disease that kills almost one million persons each year, mainly in sub-Saharan Africa. P. falciparum is transmitted to the human host by the bite of an Anopheles female mosquito, and Anopheles gambiae sensus stricto is the most tremendous malaria vector in Africa, widespread throughout the afro-tropical belt. An. gambiae s.s. is subdivided into two distinct molecular forms, namely M and S forms. The two molecular forms are morphologically identical but they are distinct genetically, and differ by their distribution and their ecological preferences. The epidemiological importance of the two molecular forms in malaria transmission has been poorly investigated so far and gave distinct results in different areas. We have developed a real-time quantitative PCR (qPCR assay, and used it to detect P. falciparum at the oocyst stage in wild An. gambiae s.s. mosquitoes experimentally infected with natural isolates of parasites. Mosquitoes were collected at immature stages in sympatric and allopatric breeding sites and further infected at the adult stage. We next measured the infection prevalence and intensity in female mosquitoes using the qPCR assay and correlated the infection success with the mosquito molecular forms. Our results revealed different prevalence of infection between the M and S molecular forms of An. gambiae s.s. in Cameroon, for both sympatric and allopatric populations of mosquitoes. However, no difference in the infection intensity was observed. Thus, the distribution of the molecular forms of An. gambiae s.s. may impact on the malaria epidemiology, and it will be important to monitor the efficiency of malaria control interventions on the two M and S forms.

Identification of the translational start site of codon-optimized mCherry in Mycobacterium tuberculosis

OpenAIRE

Carroll, Paul; Muwanguzi-Karugaba, Julian; Melief, Eduard; Files, Megan; Parish, Tanya

2014-01-01

Background Fluorescent proteins are used widely as reporter genes in many organisms. We previously codon-optimized mCherry for Mycobacterium tuberculosis and generated expression constructs with high level expression in mycobacteria with multiple uses in vitro and in vivo. However, little is known about the expression of fluorescent proteins in mycobacteria and the translational start codon for mCherry has not been experimentally determined. Results We determined the translational start site ...

A distributed approach for secure M2M communications

OpenAIRE

BEN SAIED , Yosra; OLIVEREAU , Alexis; LAURENT , Maryline

2012-01-01

International audience; A key establishment solution for heterogeneous Machine to Machine (M2M) communications is proposed. Decentralization in M2M environment leads to situations where highly resource-constrained nodes have to establish end-to-end secured contexts with powerful remote servers, which would normally be impossible because of the technological gap between these classes of devices. This paper proposes a novel collaborative session key exchange method, wherein a highly resource-co...

Structural determination of new solid solutions [Y2-x Mx ][Sn2-x Mx ]O7-3x/2 (M = Mg or Zn by Rietveld method

Directory of Open Access Journals (Sweden)

Mohamed Douma

2010-12-01

Full Text Available New [Y2-x Mx][Sn2-x Mx]O7-3x/2 (0 ≤x≤ 0.30 for M = Mg and 0 ≤x≤ 0.36 for M = Zn solid solutions with the pyrochlore structure were synthesized via high-temperature solid-state reaction method. Powder X-ray diffraction (PXRD patterns and Fourier transform infrared (FT-IR spectra showed that these materials are new non-stoichiometric solid solutions with the pyrochlore type structure. The structural parameters for the solids obtained were successfully determined by Rietveld refinement based on the analysis of the PXRD diagrams. Lattice parameter (a of these solid solutions decreases when x increases in both series. All samples obtained have the pyrochlore structure Fd-3m, no. 227 (origin at center -3m with M2+ (M = Mg2+ or Zn2+ cations in Y3+ and Sn4+ sites, thus creating vacancies in the anionic sublattice.

Vandellos 1 NPP partial site release after level 2 decommissioning, using Marssim

Energy Technology Data Exchange (ETDEWEB)

Medinilla, G.; Sanchez, M.; Peinador, M. [Initec-Westinghouse, Madrid (Spain); Lopez, M.T. [ENRESA, Madrid (Spain)

2008-07-01

The Vandellos 1 nuclear power plant is a french technology 480 MWe graphite gas cooled reactor, located in the spanish mediterranean coast, in the province of Tarragona. It started commercial operations in 1972 and that was definitively shutdown after a turbine fire in 1989, being decommissioned by ENRESA to reach IAEA level 2 in 2005, starting a dormancy period that will last around 20 years before the final phase of the decommissioning is executed to reach the ''greenfield'' state. For the plant remaining structures during this dormancy period the site needs not to keep its original size of approx. 130000 m{sup 2}, so ENRESA took the decision of starting a partial site release process of almost a half of the site aiming to exclude that part from regulatory control, applying US MARSSIM methodology. Main activities included: - Site radiological characterization - Derived concentration guideline limits calculation - Definition and classification of survey units Development and testing of scanning devices and procedures - Pilot application of full process to two survey units A summary of the scope and results of these activities is presented in this paper. (authors)

The Electric Form Factor of the Neutron via Recoil Polarimetry to Q2 1.47 (GeV/c)2

International Nuclear Information System (INIS)

Bradley Plaster; Richard Madey; Andrei Semenov; Simon Taylor; Aram Aghalaryan; Erick Crouse; Glen MacLachlan; Shigeyuki Tajima; William Tireman; Chenyu Yan; Abdellah Ahmidouch; Brian Anderson; Hartmuth Arenhovel; Razmik Asaturyan; O. Baker; Alan Baldwin; Paul Brewer; Roger Carlini; Michael Christy; Steve Churchwell; Leon Cole; Samuel Danagoulian; Donal Day; Mostafa Elaasar; Rolf Ent; Manouchehr Farkhondeh; Howard Fenker; John Finn; Liping Gan; Kenneth Garrow; Calvin Howell; Paul Gueye; Bitao Hu; Mark Jones; James Kelly; Cynthia Keppel; Mahbubul Khandaker; Wooyoung Kim; Stanley Kowalski; Allison Lung; David Mack; D. Manley; Pete Markowitz; Tilmann Reichelt; Joerg Reinhold; Julie Roche; Yoshinori Sato; Irina Semenova; Wonick Seo; Neven Simicevic; Gregory Smith; Samuel Stepanyan; Vardan Tadevosyan; Liguang Tang; Paul Ulmer; William Vulcan; John Watson; Steven Wells; Frank Wesselmann; Stephen Wood; Chen Yan; Seunghoon Yang; Lulin Yuan; Wei-Ming Zhang; Hong Guo Zhu; Xiaofeng Zhu

2003-01-01

The Jefferson Laboratory E93-038 collaboration conducted measurements of the ratio of the electric form factor to the magnetic form factor of the neutron, G n E/G n M, via recoil polarimetry from the quasielastic 2 H((rvec e),e/(rvec n)) 1 H reaction at three values of Q 2 [viz., 0.45, 1.15, and 1.47 (GeV/c) 2 ] in Hall C of the Thomas Jefferson National Accelerator Facility. The preliminary results for G n E at Q 2 = 0.45 and 1.15 (GeV/c) 2 are consistent with the Galster parameterization; however, the preliminary result for G n E at Q 2 = 1.47 (GeV/c) 2 lies slightly above the Galster parameterization

Construction of Δm2--sin2 2θ plots

International Nuclear Information System (INIS)

Snyder, R.

1991-01-01

In the two-flavor approximation, the probability for a neutrino to oscillate from one flavor to the other is given by Ρ νa → νb = sin 2 2θ sin 2 (1.27 Δm 2 L/E ν ) where θ is the mixing angle, Δm 2 = |m νa 2 - m νb 2 | is measured in (eV/c 2 ) 2 , L, the distance from the source, is measured in km, and E, the beam energy, is measured in GeV. If either Δm 2 or sin 2 2Θ is zero, there is no oscillation. They might also have small, non-zero values, causing the oscillations to be so small as to be unobservable in a particular experiment. They may also have values which allow us to determine the probability of oscillation, but so far no compelling evidence for oscillation exists. The universal method of portraying what region of parameter space is explored by a neutrino oscillation experiment is to mark off an area on a Δm 2 vs. sin 2 2θ plot. Typically, a line is graphed, with the claim that if the experiment finds not evidence of oscillation, one can, for example, be 90% certain that Δm 2 and sin 2 2θ lie within the region below and to the left of the line. Since these plots are so widely used, it is useful to understand the process by which they are created

Utility of Lithium in Rare-Earth Metal Reduction Reactions to Form Nontraditional Ln2+ Complexes and Unusual [Li(2.2.2-cryptand)]1+ Cations.

Science.gov (United States)

Huh, Daniel N; Darago, Lucy E; Ziller, Joseph W; Evans, William J

2018-02-19

The utility of lithium compared to other alkali metals in generating Ln 2+ rare-earth metal complexes via reduction of Ln 3+ precursors in reactions abbreviated as LnA 3 /M (Ln = rare-earth metal; A = anionic ligand; M = alkali metal) is described. Lithium reduction of Cp' 3 Ln (Cp' = C 5 H 4 SiMe 3 ; Ln = Y, Tb, Dy, Ho) under Ar in the presence of 2.2.2-cryptand (crypt) forms new examples of crystallographically characterizable Ln 2+ complexes of these metals, [Li(crypt)][Cp' 3 Ln]. In each complex, lithium is found in an N 2 O 4 donor atom coordination geometry that is unusual for the cryptand ligand. Magnetic susceptibility data on these new examples of nontraditional divalent lanthanide complexes are consistent with 4f n 5d 1 electronic configurations. The Dy and Ho complexes have exceptionally high single-ion magnetic moments, 11.35 and 11.67 μ B , respectively. Lithium reduction of Cp' 3 Y under N 2 at -35 °C forms the Y 2+ complex (Cp' 3 Y) 1- , which reduces dinitrogen upon warming to room temperature to generate the (N 2 ) 2- complex [Cp' 2 Y(THF)] 2 (μ-η 2 :η 2 -N 2 ). These results provide insight on the factors that lead to reduced dinitrogen complexes and/or stable divalent lanthanide complexes as a function of the specific reducing agent and conditions.

Electromagnetic form factors for nucleons and pions at positive and negative q2 in the model of quark-gluon strings

International Nuclear Information System (INIS)

Kaidalov, A.B.; Kondratyuk, L.A.; Tchekin, D.V.

2000-01-01

The electromagnetic form factors for pions and nucleons are considered within the model of quark-gluon strings, where the momentum-transfer dependence of hadronic form factors is determined by the intercepts of the corresponding Regge trajectories and by the Sudakov form factor. Analytic expressions found for form factors in the timelike region admit an analytic continuation to the spacelike region. The resulting form factors for pions and nucleons comply well with experimental data both for positive and for negative values of the squared momentum transfer q 2 . It is shown that the distinctions between the absolute values of the pion and nucleon form factors F π (q 2 ), G m (q 2 ), and F 2 (q 2 ) at positive values of q 2 and those at negative values of this variable are associated with the analytic properties of the double-logarithmic term in the exponent of the Sudakov form factor. The spin structure of the amplitudes for quark transitions into hadrons that is proposed in the present study makes it possible to describe fairly well available experimental data on the Pauli form factor F 2 and on the ratio G e /G m

A Survey on M2M Systems for mHealth: A Wireless Communications Perspective

Directory of Open Access Journals (Sweden)

Elli Kartsakli

2014-09-01

Full Text Available In the new era of connectivity, marked by the explosive number of wireless electronic devices and the need for smart and pervasive applications, Machine-to-Machine (M2M communications are an emerging technology that enables the seamless device interconnection without the need of human interaction. The use of M2M technology can bring to life a wide range of mHealth applications, with considerable benefits for both patients and healthcare providers. Many technological challenges have to be met, however, to ensure the widespread adoption of mHealth solutions in the future. In this context, we aim to provide a comprehensive survey on M2M systems for mHealth applications from a wireless communication perspective. An end-to-end holistic approach is adopted, focusing on different communication aspects of the M2M architecture. Hence, we first provide a systematic review ofWireless Body Area Networks (WBANs, which constitute the enabling technology at the patient’s side, and then discuss end-to-end solutions that involve the design and implementation of practical mHealth applications. We close the survey by identifying challenges and open research issues, thus paving the way for future research opportunities.

Oxide fluoride sulfides of the lanthanoids with the formula M{sub 6}O{sub 2}F{sub 8}S{sub 3} (M = La-Nd, Sm, Gd); Oxidfluoridsulfide der Lanthanoide vom Formeltyp M{sub 6}O{sub 2}F{sub 8}S{sub 3} (M = La-Nd, Sm, Gd)

Energy Technology Data Exchange (ETDEWEB)

Grossholz, Hagen; Zimmermann, Dirk D.; Janka, Oliver; Schleid, Thomas [Stuttgart Univ. (Germany). Inst. fuer Anorganische Chemie

2013-07-15

The lanthanoid(III) oxide fluoride sulfides M{sub 6}O{sub 2}F{sub 8}S{sub 3} (M = La-Nd, Sm, Gd) can be obtained by reacting the rare-earth metals, their trifluorides and sesquioxides with elemental sulfur in appropriate molar ratios at 850 C flux-assisted by NaCl in gas-tightly sealed niobium or tantalum ampoules. All compounds are colorless, except for those containing M = Pr with green, M = Nd with lilac and M = Sm with yellow color. They form transparent single crystals as needles or rods. The M{sub 6}O{sub 2}F{sub 8}S{sub 3} representatives crystallize in a hexagonal structure (space group: P6{sub 3}/m; a {approx} 1382-1326, c {approx} 398-376 pm, c/a {approx} 0.288-0.284; Z = 2) with two different crystallographic M{sup 3+} positions. The (M2){sup 3+} cations reside in ninefold coordination of anions arranged as tricapped trigonal prisms formed by three F{sup -}, four mixed-occupied O{sup 2-}/F{sup -} and two S{sup 2-} anions, resembling the unique M{sup 3+} coordination sphere of the M{sub 3}OF{sub 5}S-type oxide fluoride sulfides. The (M1){sup 3+} cations are surrounded by square antiprisms built of four O{sup 2-}/F{sup -} and S{sup 2-} anions each, which are capped by one F{sup -} anion each, again resulting in a ninefold coordination similar to that of the A-MFS-type fluoride sulfides. While the crystallographically unique S{sup 2-} anions have six cationic neighbors arranged in trigonal prisms, there are four different light-anion positions. Two of them, representing only fluoride anions, are situated in a triangular environment of cations ((F1){sup -}: planar, (F2){sup -}: non-planar). The mixed-occupied light-anion positions (F3){sup -}/(O3){sup 2-} and (F4){sup -}/(O4){sup 2-} exhibit tetrahedral coordination spheres with a ratio F{sup -}: O{sup 2-} = 2:1. The M{sub 6}O{sub 2}F{sub 8}S{sub 3} arrangement is characterized by an empty hexagonal channel structure created by (F1){sup -} anions with a potential of accommodating alkali-metal cations like Na

M2- and M5-branes in E11 current algebra formulation of M-theory

Science.gov (United States)

Shiba, Shotaro; Sugawara, Hirotaka

2018-03-01

Equations of motion for M2- and M5-branes are written down in the E11 current algebra formulation of M-theory. These branes correspond to currents of the second and the fifth rank antisymmetric tensors in the E11 representation, whereas the electric and magnetic fields (coupled to M2- and M5-branes) correspond to currents of the third and the sixth rank antisymmetric tensors, respectively. We show that these equations of motion have solutions in terms of the coordinates on M2- and M5-branes. We also discuss the geometric equations, and show that there are static solutions when M2- or M5-brane exists alone and also when M5-brane wraps around M2-brane. This situation is realized because our Einstein-like equation contains an extra term which can be interpreted as gravitational energy contributing to the curvature, thus avoiding the usual intersection rule.