WorldWideScience

Sample records for Cynodon dactylon, Cholesterol, DNA fragmentation

  1. HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

    OpenAIRE

    C. Selva Kumar

    2011-01-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

  2. AFLP analysis of Cynodon dactylon (L.) Pers. var. dactylon genetic variation.

    Science.gov (United States)

    Wu, Y Q; Taliaferro, C M; Bai, G H; Anderson, M P

    2004-08-01

    Cynodon dactylon (L.) Pers. var. dactylon (common bermudagrass) is geographically widely distributed between about lat 45 degrees N and lat 45 degrees S, penetrating to about lat 53 degrees N in Europe. The extensive variation of morphological and adaptive characteristics of the taxon is substantially documented, but information is lacking on DNA molecular variation in geographically disparate forms. Accordingly, this study was conducted to assess molecular genetic variation and genetic relatedness among 28 C. dactylon var. dactylon accessions originating from 11 countries on 4 continents (Africa, Asia, Australia, and Europe). A fluorescence-labeled amplified fragment length polymorphism (AFLP) DNA profiling method was used to detect the genetic diversity and relatedness. On the basis of 443 polymorphic AFLP fragments from 8 primer combinations, the accessions were grouped into clusters and subclusters associating with their geographic origins. Genetic similarity coefficients (SC) for the 28 accessions ranged from 0.53 to 0.98. Accessions originating from Africa, Australia, Asia, and Europe formed major groupings as indicated by cluster and principal coordinate analysis. Accessions from Australia and Asia, though separately clustered, were relatively closely related and most distantly related to accessions of European origin. African accessions formed two distant clusters and had the greatest variation in genetic relatedness relative to accessions from other geographic regions. Sampling the full extent of genetic variation in C. dactylon var. dactylon would require extensive germplasm collection in the major geographic regions of its distributional range.

  3. Evaluation of the immunomodulatory and DNA protective activities of the shoots of Cynodon dactylon.

    Science.gov (United States)

    Mangathayaru, K; Umadevi, M; Reddy, C Umamaheswara

    2009-05-04

    Fresh juice of Cyanodon dactylon known as 'durva' grass is employed in India as a rejuvenator and for wound healing. To validate the traditional use of the herb through evaluation of DNA protective activity in vitro and immunomodulatory activity in vivo. Fresh juice of the grass was prepared as indicated for use in traditional medicine and standardized for solid content. Its total phenol content was estimated by Folin-Ciocalteau method. Freshly prepared juice was investigated for its effect on doxorubicin-induced DNA damage in vitro. Its immunomodulatory activity was tested on balb/c mice by the humoral antibody response which was determined by haemagglutination antibody titer and spleen cell assay. Fresh juice of Cyanodon dactylon of 1.46% (w/w) solid content had a phenolic content of 47+/-0.33 mg/kg GAE. At doses equivalent to 50, 100 and 200mg total solids/kg body weight the juice protected human DNA against doxorubicin-induced DNA damage as demonstrated in DNA spectral studies, where the ratio of absorbance of DNA at 260 and 280 nm in samples pretreated with the juice was 1.66, 1.53 and 1.63 respectively, while it was 1.37 for DNA treated with doxorubicin only. This indicates nucleic acid purity in the Cynodon dactylon treated samples. Oral administration of the juice at 250 and 500 mg/kg in balb/c mice increased humoral antibody response upon antigen challenge, as evidenced by a dose-dependent, statistically significant increase in antibody titer in the haemagglutination antibody assay and plaque forming cell assay. The present report demonstrated the DNA protective activity and immunomodulatory property of the fresh juice of Cynodon dactylon validating the traditional use of the herb as a 'rasayana' in ayurvedic system of medicine.

  4. Accumulation and resistance to copper of two biotypes of Cynodon dactylon.

    Science.gov (United States)

    Wang, Youbao; Zhang, Li; Yao, Jing; Huang, Yongjie; Yan, Mi

    2009-04-01

    The effects of copper accumulation and resistance in two biotypes of Cynodon dactylon were studied. Results showed that at a low concentration of copper (Cynodon dactylon was generally unaffected. As copper concentration increased, negative effects on the growth of Cynodon dactylon became apparent. The critical concentration at which the plant exhibited poisoning symptoms was different for the two biotypes of Cynodon dactylon. At 500 mg/kg copper concentration in soil, the biotype from the polluted area showed significantly higher tolerance of copper than the biotype from the unpolluted area.

  5. Anticancer activity of Cynodon dactylon and Oxalis corniculata on Hep2 cell line.

    Science.gov (United States)

    Salahuddin, H; Mansoor, Q; Batool, R; Farooqi, A A; Mahmood, T; Ismail, M

    2016-04-30

    Bioactive chemicals isolated from plants have attracted considerable attention over the years and overwhelmingly increasing laboratory findings are emphasizing on tumor suppressing properties of these natural agents in genetically and chemically induced animal carcinogenesis models. We studied in vitro anticancer activity of organic extracts of Cynodon dactylon and Oxalis corniculata on Hep2 cell line and it was compared with normal human corneal epithelial cells (HCEC) by using MTT assay. Real Time PCR was conducted for p53 and PTEN genes in treated cancer cell line. DNA fragmentation assay was also carried out to note DNA damaging effects of the extracts. The minimally effective concentration of ethanolic extract of Cynodon dactylon and methanolic extract of Oxalis corniculata that was nontoxic to HCEC but toxic to Hep2 was recorded (IC50) at a concentration of 0.042mg/ml (49.48 % cell death) and 0.048mg/ml (47.93% cell death) respectively, which was comparable to the positive control. Our results indicated dose dependent increase in cell death. P53 and PTEN did not show significant increase in treated cell line. Moreover, DNA damaging effects were also not detected in treated cancer cell line. Anticancer activity of these plants on the cancer cell line showed the presence of anticancer components which should be characterized to be used as anticancer therapy.

  6. Anti-atherosclerotic effect of Cynodon dactylon extract on experimentally induced hypercholesterolemia in rats.

    Science.gov (United States)

    Pashaie, Belal; Hobbenaghi, Rahim; Malekinejad, Hassan

    2017-01-01

    Cynodon dactylon (Bermuda grass) is a perennial plant traditionally used as an herbal medicine in many countries. In the present study, anti-atherosclerotic property of ethanolic extract of C. dactylon was investigated in the experimentally induced hypercholesterolemia in rats. In this study, 36 male Wistar rats were selected and allocated into six groups (n = 6). The control group received a normal diet, sham group received a high cholesterol diet (HCD; 1.50% cholesterol and 24.00% fat) and other groups received a HCD and ethanolic extract of C. dactylon at low (100 mg kg -1 ), moderate (200 mg kg -1 ) and maximum (400 mg kg -1 ) doses via gavages. The last group received atorvastatin (10 mg kg -1 ) through gavage with a HCD. The study period for all groups was six months. At the end of this period, parameters including total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) were assessed in the blood samples. Additionally, histopathological and immunohistochemical examinations on coronary and aorta arteries sections were performed. The results showed an increase in vessels wall thickness and proliferation of smooth muscle cells in the HCD group, while these pathological changes were not seen in C. dactylon -treated groups. Treatment of HCD animals with C. dactylon positively changed lipid profile by lowering of TC, TG and LDL-C. The results indicate that C. dactylon prevents from early atherosclerotic changes in the vessels wall.

  7. Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

    2014-10-21

    Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

  8. Evaluation of Cynodon dactylon for wound healing activity.

    Science.gov (United States)

    Biswas, Tuhin Kanti; Pandit, Srikanta; Chakrabarti, Shrabana; Banerjee, Saheli; Poyra, Nandini; Seal, Tapan

    2017-02-02

    Research in the field of wound healing is very recent. The concept of wound healing is changing from day to day. Ayurveda is the richest source of plant drugs for management of wounds and Cynodon dactylon L. is one such. The plant is used as hemostatic and wound healing agent from ethnopharmacological point of view. Aim of the present study is scientific validation of the plant for wound healing activity in detail. Aqueous extract of the plant was prepared and phytochemical constituents were detected by HPLC analysis. Acute and dermatological toxicity study of the extract was performed. Pharmacological testing of 15% ointment (w/w) of the extract with respect to placebo control and standard comparator framycetin were done on full thickness punch wound in Wister rats and effects were evaluated based on parameters like wound contraction size (mm 2 ), tensile strength (g); tissue DNA, RNA, protein, hydroxyproline and histological examination. The ointment was applied on selected clinical cases of chronic and complicated wounds and efficacy was evaluated on basis of scoring on granulation, epithelialization, vascularity as well as routine hematological investigations. Significant results (pCynodon dactylon explores its potential wound healing activity in animal model and subsequent feasibility in human subjects. Phenolic acids and flavonoids present in c. dactylon supports its wound healing property for its anti-oxidative activity that are responsible for collagenesis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Assessment of antidiabetic potential of Cynodon dactylon extract in streptozotocin diabetic rats.

    Science.gov (United States)

    Singh, Santosh Kumar; Kesari, Achyut Narayan; Gupta, Rajesh Kumar; Jaiswal, Dolly; Watal, Geeta

    2007-11-01

    This study was undertaken to investigate the hypoglycemic and antidiabetic effect of single and repeated oral administration of the aqueous extract of Cynodon dactylon (Family: Poaceae) in normal and streptozotocin induced diabetic rats, respectively. The effect of repeated oral administration of aqueous extract on serum lipid profile in diabetic rats was also examined. A range of doses, viz. 250, 500 and 1000mg/kg bw of aqueous extract of Cynodon dactylon were evaluated and the dose of 500mg/kg was identified as the most effective dose. It lowers blood glucose level around 31% after 4h of administration in normal rats. The same dose of 500mg/kg produced a fall of 23% in blood glucose level within 1h during glucose tolerance test (GTT) of mild diabetic rats. This dose has almost similar effect as that of standard drug tolbutamide (250mg/kg bw). Severely diabetic rats were also treated daily with 500mg/kg bw for 14 days and a significant reduction of 59% was observed in fasting blood glucose level. A reduction in the urine sugar level and increase in body weight of severe diabetic rats were additional corroborating factors for its antidiabetic potential. Total cholesterol (TC), low density lipoprotein (LDL) and triglyceride (TG) levels were decreased by 35, 77 and 29%, respectively, in severely diabetic rats whereas, cardioprotective, high density lipoprotein (HDL) was increased by 18%. These results clearly indicate that aqueous extract of Cynodon dactylon has high antidiabetic potential along with significant hypoglycemic and hypolipidemic effects.

  10. Inhibitory effects of Cynodon dactylon L. on inflammation and oxidative stress in adjuvant treated rats.

    Science.gov (United States)

    Sindhu, G; Ratheesh, M; Shyni, G L; Helen, A

    2009-01-01

    Cynodon dactylon is one of the 10 auspicious herbs that constitute the group Dasapushpam in Ayurveda. Traditionally Cynodon dactylon L. is used against many chronic inflammatory diseases in India. The present study was carried out to evaluate the protective effect of Cynodon dactylon against rats with adjuvant- induced arthritis. Arthritis was induced by intradermal injection of complete Freund's adjuvant into the right hind paw produce inflammation of the joint. A significant increase in the levels of inflammatory mediators, myeloperoxidase, nitrite, C-reactive protein, ceruloplasmin was observed. This was associated with oxidative stress with a marked reduction in the activity of catalase, superoxide dismutase, glutathione peroxidase and the levels of glutathione, vitamins C and E and an increase in the lipid peroxidation as indicated by the higher levels of thiobarbituric acid reactive substances. Cynodon dactylon (20mg/kg/b.wt) was orally administered to arthritic rats after adjuvant injection produced a significant attenuation in the inflammatory response, oxidative stress and ameliorated the arthritic changes to near normal conditions. Hence, the results of this study clearly indicate that Cynodon dactylon extract has a promising protective role against arthritis.

  11. CYNODON DACTYLON (L.) PERS., AND ITS IMPLICATIONS

    African Journals Online (AJOL)

    Key words/phrases: Cynodon dactylon, salinity, salt glands, salt secretion ... associated with salt glands, sensitivity of secretion to temperature and metabolic inhibitors (Thomson. .... G, salt gland; Magnification = X400; scale bar = 50 n. Fig. 4. .... relative humidity causes a rapid transpiration rate in excess of absorption from ...

  12. [Genetic diversity of wild Cynodon dactylon germplasm detected by SRAP markers].

    Science.gov (United States)

    Yi, Yang-Jie; Zhang, Xin-Quan; Huang, Lin-Kai; Ling, Yao; Ma, Xiao; Liu, Wei

    2008-01-01

    Sequence-related amplified polymorphism (SRAP) molecular markers were used to detect the genetic diversity of 32 wild accessions of Cynodon dactylon collected from Sichuan, Chongqing, Guizhou and Tibet, China. The following results were obtained. (1) Fourteen primer pairs produced 132 polymorphic bands, averaged 9.4 bands per primer pair. The percentage of polymorphic bands in average was 79.8%. The Nei's genetic similarity coefficient of the tested accessions ranged from 0.591 to 0.957, and the average Nei's coefficient was 0.759. These results suggested that there was rich genetic diversity among the wild resources of Cynodon dactylon tested. (2) Thirty two wild accessions were clustered into four groups. Moreover, the accessions from the same origin frequently clustered into one group. The findings implied that a correlation among the wild resources, geographical and ecological environment. (3) Genetic differentiation between and within six eco-geographical groups of C. dactylon was estimated by Shannon's diversity index, which showed that 65.56% genetic variance existed within group, and 34.44% genetic variance was among groups. (4) Based on Nei's unbiased measures of genetic identity, UPGMA cluster analysis measures of six eco-geographical groups of Cynodon dactylon, indicated that there was a correlation between genetic differentiation and eco-geographical habits among the groups.

  13. Diversity among Cynodon accessions and taxa based on DNA amplification fingerprinting.

    Science.gov (United States)

    Assefa, S; Taliaferro, C M; Anderson, M P; de los Reyes, B G; Edwards, R M

    1999-06-01

    The genus Cynodon (Gramineae), comprised of 9 species, is geographically widely distributed and genetically diverse. Information on the amounts of molecular genetic variation among and within Cynodon taxa is needed to enhance understanding of phylogenetic relations and facilitate germplasm management and breeding improvement efforts. Genetic relatedness among 62 Cynodon accessions, representing eight species, was assessed using DNA amplification fingerprinting (DAF). Ten 8-mer oligonucleotides were used to amplify specific Cynodon genomic sequences. The DNA amplification products of individual accessions were scored for presence (1) or absence (0) of bands. Similarity matrices were developed and the accessions were grouped by cluster (UPGMA) and principal coordinate analysis. Analyses were conducted within ploidy level (2x = 18 and 4x = 36) and over ploidy levels. Each primer revealed polymorphic loci among accessions within species. Of 539 loci (bands) scored, 496 (92%) were polymorphic. Cynodon arcuatus was clearly separated from other species by numerous monomorphic bands. The strongest species similarities were between C. aethiopicus and C. arcuatus, C. transvaalensis and C. plectostachyus, and C. incompletus and C. nlemfuensis. Intraspecific variation was least for C. aethiopicus, C. arcuatus, and C. transvaalensis, and greatest for C. dactylon. Accessions of like taxonomic classification were generally clustered, except the cosmopolitan C. dactylon var. dactylon and C. dactylon var. afganicus. Within taxa, accessions differing in chromosome number clustered in all instances indicating the 2x and 4x forms to be closely related. Little, if any, relationship was found between relatedness as indicated by the DAF profiles and previous estimates of hybridization potential between the different taxa.

  14. Antiarthritic activity of Cynodon dactylon (L.) Pers.

    Science.gov (United States)

    Bhangale, Jitendra; Acharya, Sanjeev

    2014-03-01

    Cynodon dactylon (L.) (Poaceae) is traditionally used herb to treat fevers, skin diseases and rheumatic affections. The ethanolic extract of C. dactylon was found to be safe at all the dose levels (100, 200 and 400 mg/kg, orally) and there was no mortality up to the dose of 5000 mg/kg of extract when administered orally. C. dactylon showed significant antiarthritic activity against Freund's complete adjuvant induced arthritis in rats. Treatment with C. dactylon significantly reduced the mean percentage change in injected and non injected paw, ankle diameter, clinical severity and significantly increased body weight. Results were confirmed using biochemical parameters; there was a significant improvement in the levels of Hb and RBC in C. dactylon treated rats. The increased levels of WBC, ESR, C- reactive protein (CRP) and TNFalpha were significantly suppressed in C. dactylon treated rats. C. dactylon showed protective effect in arthritic joints but it has been supported by an improvement in bone lesions rather than in cartilage lesions. It can be concluded that ethanolic extract of C. dactylon at a dose of 400 mg/kg is effective in improving haematological level, CRP and reducing TNFalpha level. Phytochemical screening showed the presence of alkaloids, flavonoids and glycosides in ethanolic extract. All the above results support the traditional uses of the plant in the treatment of rheumatoid arthritis.

  15. [Responses of antioxidation system of Cynodon dactylon to recirculated landfill leachate irrigation].

    Science.gov (United States)

    Wang, Ruyi; He, Pinjing; Shao, Liming; Zhang, Bin; Li, Guojian

    2005-05-01

    With pot experiment, this paper studied the membrane lipid peroxidation and the variations of antioxidation system in Cynodon dactylon under recirculated landfill leachate irrigation. The results showed that when irrigated with low dilution ratio ( 25%), there existed an obvious negative fect on Cynodon dactylon, i.e., the chlorophyll a/b ratio decreased, while cell membrane permeability and MDA and H2O2 contents increased, which meant that the membrane lipid peroxidation was accelerated. The contents antioxidants AsA, GSH and Car also showed the similar trend, i.e., they increased with increasing leachate dilution ratio when irrigated with low dilution ratio leachate, but decreased under medium or high dilution ratio leachate irrigation. Among three test anti-oxidative enzymes, SOD and POD activities showed a similar change test antioxidants, and POD activity was more sensitive, while CAT activity was on the contrary. The contents test antioxidants and the activities of SOD and POD were negatively and significantly correlated to MDA content, indicating that they might play an important role in preventing Cynodon dactylon from cell membrane lipid peroxdation.

  16. Mosquitocidal and water purification properties of Cynodon dactylon, Aloe vera, Hemidesmus indicus and Coleus amboinicus leaf extracts.

    Science.gov (United States)

    Ethanolic extracts of Cynodon dactylon, Aloe vera, Hemidesmus indicus and Coleus amboinicus were tested for toxicity to 3rd instar Anopheles stephensi, Culex quinquefasciatus, and Aedes aegypti. Median lethal concentrations (LC50) were, respectively, 0.44%, 0.51%, 0.59% and 0.68%. Cynodon dactylon...

  17. Establishing Cynodon dactylon on mining tailings and mining ...

    African Journals Online (AJOL)

    Mining for copper and cobalt generates extensive mounds of removed topsoil and subsoil, and tailings with toxic levels of copper and cobalt. The threat of soil erosion in a high rainfall regime can be countered with rapid establishment of a sod-forming grass, such as Cynodon dactylon, that covers and binds the soil.

  18. [Influence of saltwater irrigation on the yield and quality of Cynodon dactylon under desert conditions].

    Science.gov (United States)

    Zhou, Ruilian; Dov, Paternak; Zhao, Halin

    2002-08-01

    Responses of six varieties (Suwannee, Coast cross, Tifton44, Tifton68, Tifton78 and Tifton85) of Cynodon dactylon to irrigation-water salinity were investigated in field by means of a double line source experimental design. The digestibility of the grass by goat was analyzed using the rumen gastric justice digestion method. The results showed that the six varieties grew well, and had a high yield of fresh grass when eletro-conductivity (Eci) Cynodon dactylon were not effected by saltwater irrigation.

  19. Evidence-based Critical Evaluation of Glycemic Potential of Cynodon dactylon

    Science.gov (United States)

    Singh, Santosh Kumar; Rai, Prashant Kumar; Jaiswal, Dolly

    2008-01-01

    The present study is an extension of our previous work carried out on Cynodon dactylon. This study deals with the critical evaluation of glycemic potential of ethanolic extract of defatted C. dactylon. The doses of 250, 500 and 750 mg kg−1 bw of the extract were administered orally to normal as well as Streptozotocin-induced diabetic rats to study its glycemic potential. The effect of repeated oral administration of the same doses of ethanolic extract was also studied on serum lipid profile of severely diabetic (SD) rats. The dose of 500 mg kg−1 bw was identified as the most effective dose as it lowered the blood glucose levels of normal by 42.12% and of diabetic by 43.42% during fasting blood glucose (FBG) and glucose tolerance test respectively. The SD rats were also treated daily with this identified dose of 500 mg kg−1 bw for 2 weeks and a significant reduction of 56.34% was observed in FBG level. Total cholesterol, low density lipoprotein and triglyceride levels were also decreased by 32.94, 64.06 and 48.46% respectively in SD rats whereas, cardioprotective high density lipoprotein increased by 16.45%. The reduced urine sugar level and increased body weight are additional advantages. These evidences clearly indicate that the ethanolic extract of defatted C. dactylon has high antidiabetic potential along with good hypolipidemic profile. PMID:18955211

  20. Two new stilbene trimers from Cynodon dactylon.

    Science.gov (United States)

    Li, Bi-Jun; Liu, Yao; Gu, Ai-Tong; Zhang, Qing; Chen, Lei; Wang, Shu-Mei; Wang, Feng

    2017-11-01

    Many naturally occurring oligostilbenes have drawn considerable attention because of their intricate structures and diverse bioactivities. Two new stilbene trimers, cystibenetrimerol A (1) and cystibenetrimerol B (2) were isolated from the dried grass of Cynodon dactylon (L.) Pers. The planar structures and stereo configurations of them were elucidated by spectroscopic and spectrometric methods. The isolation and structures elucidation of two new stilbene trimers suggested the ordinary grass belonging to the family Poaceae may be a rich source of stilbene oligomers.

  1. A study on the protective effect of Cynodon dactylon leaves extract in diabetic rats.

    Science.gov (United States)

    Karthik, D; Ravikumar, S

    2011-04-01

    To investigate the antidiabetic, antioxidant and hypolipidemic efficacy of Cynodon dactylon in diabetic rats. The experimental rats were randomly divided into three groups: Group I: control; Group II: Alloxan diabetic, untreated; and Group III: Alloxan diabetic treated with ethanolic extract of C. dactylon leaves (450 mg/kg·bw). Experimental diabetes was induced by alloxan in a single dose of 150 mg/kg·bw. A Significant diminution of fasting blood sugar level was observed and also significant increase in HDL and decrease (P<0.05) in cholesterol, triglyceride, LDL and VLDL were observed after 15 days of treatment. The investigation also revealed, the activities of AST, ALT, ALP, AP, LDH, and CPK (P<0.05) were decreased in the extract-supplemented group. The significant decrease in protein content and SOD, CAT, GPx, and GSH (P<0.05) activity and increase in LPO in plasma were found to be ameliorated after treatment. Our result supports the fact that administration of extract of C. dactylon leave is able to reduce hyperglycemia and hyperlipidemia risk and also reduced the oxidative stress in diabetic rats. Copyright © 2011 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

  2. Effects of Cynodon dactylon on Stress-Induced Infertility in Male Rats

    Science.gov (United States)

    Chidrawar, VR; Chitme, HR; Patel, KN; Patel, NJ; Racharla, VR; Dhoraji, NC; Vadalia, KR

    2011-01-01

    Cynodon dactylon (Family: Poaceae) is known to be a tackler in Indian mythology and is offered to Lord Ganesha. It is found everywhere, even on waste land, road side, dry places, and spreads vigorously on cultivated ground. This study was carried out with an objective to test if the constituents of this plant are useful in coping stress-induced sexual In this study, we considered immobilization stress to induce male infertility and the effect of C. dactylon in restoration of the dysfunction was evaluated by considering sexual behavioral observations, sexual performance, fructose content of the seminal vesicles, epididymal sperm concentration and histopathological examinations as parameters. Treatment of rats under stress with methanolic extract of C. dactylon has shown a promising effect in overcoming stress-induced sexual dysfunction, sexual performance, fructose content, sperm concentration and its effect on accessory sexual organs and body weight. We conclude that active constituents of C. dactylon present in methanolic extract have a potent aphrodisiac and male fertility activity. PMID:21607051

  3. Kidney stone formation and antioxidant effects of Cynodon dactylon decoction in male Wistar rats.

    Science.gov (United States)

    Golshan, Alireza; Hayatdavoudi, Parichehr; Hadjzadeh, Mousa Al-Reza; Khajavi Rad, Abolfazl; Mohamadian Roshan, Nema; Abbasnezhad, Abbasali; Mousavi, Seyed Mojtaba; Pakdel, Roghayeh; Zarei, Batool; Aghaee, Azita

    2017-01-01

    The antioxidant capacity impairs in kidney and urinary bladder of animals with stone disease. Herbal medicine can improve the antioxidant condition of renal tissue. Cynodon dactylon ( C. dactylon ) is a medicinal plant with antioxidative and diuretic properties and different preparations of this plant have shown promising effects in stone disease. Assessment of the whole plant decoction to prevent kidney stone disease as well as its antioxidant effects was the aim of this paper. Fifty male Wistar rats were randomly divided into 5 experimental groups (n=10). One group was left without treatment and four groups received ethylene glycol (1% v/v) in drinking water for 6 weeks. Three doses of Cynodon dactylon aqueous decoction (12.5, 50 and 200 mg/kg BW) were added to the drinking water of groups 3-5. Finally, water intake, 24-hour urine volume, MDA, total thiol concentration and FRAP value were measured in the serum and kidney tissues. The CaOx depositions were evaluated by hematoxylin and eosin staining. Compared to the ethylene glycol-treated group, 200 mg/kg C. dactylon , lowered stone incidents, decreased urine volume, increased FRAP/g Cr (43%) and thiol content (p<0.05) with no significant alteration of water intake, MDA decreased significantly compared to C. dactylon 12.5 (p<0.01). Kidney weight increased and body weight decreased in ethylene glycol-treated group compared to the control group (p<0.05). A minimum dose of 200 mg/kg C. dactylon reduced stone formation and simultaneously increased total antioxidant power of serum and preserved MDA content and water.

  4. The effects of cynodon dactylon on the immune response of NMRI-MICE after challenge with REV1

    Directory of Open Access Journals (Sweden)

    Behrooz Ilkhanizadeh

    2016-10-01

    Full Text Available Cynodon dactylon is used in Iranian traditional medicine as a healing agent for reducing the complications of diabetes mellitus. We proposed that Cynodon dactylon may perform its effects through moderating humoral and cellular immune responses. We aimed to determine the possible effects of hydroalcholic extract of Cynodon dactylonon humoral and cellular immune responses following the Rev1 challenge in the mouse model. 20 NMRI male mice were randomly grouped in two equal groups and immunized with Rev1[0.1 ml Rev1+0.9 PBS[. Mice in the treatment group orally received 400 mg/kg hydroalcoholic extract of Cynodon dactylon every day from the beginning of the study for 2 weeks. Blood samples were obtained from the animals 5 days after the last injection. Moreover, 48 hr before bleeding time, Rev1[0.1 ml Rev1+0.9 PBS[was injected into the left hind foot pad of mice. The levels of anti-Rev1 antibody and the specific cellular immune responses were measured by microhemagglutination test and footpad thickness, respectively. Moreover, susceptibility of macrophages respiratory burst and proliferation of immune cells were measured in order withNitroblue tetrazolium[NBT] and Microculture Tetrazolium Assay [MTT]. The concentrations of IL-1, TNFα, Il-6, and IL-10 in the serum were determined using commercially available ELISA kits. We found a significant increase in anti-Rev1 antibody levels and simultaneously a significant decrease in the level of cellular immunity[DTH] in the treatment group compared to the control group. Lymphocyte proliferation index in splenocytes was significantly increased in the treatment group. However, the level of respiratory burst in phagocytic population of splenocytes dramatically decreased in the treatment group compared to the control. A significant decrease in IL-6, TNF-α , IL-1 and increaseIl-10 serum levels were also seen in the treatment group. Cynodon dactylon extract could have an anti-inflammatory effect through

  5. [Transformation of Cu forms in Cynodon dactylon rhizosphere soil of copper tailings yard].

    Science.gov (United States)

    Wang, You-bao; Huang, Yong-jie; Zhen, Quan; Yan, Mi; Yang, Hong-fei; Liu, Deng-yi

    2007-06-01

    The study on the Cu forms in Cynodon dactylon rhizosphere soil of copper tailings yard in Tongling City, Anhui Province showed that among the test Cu forms, the amount of residual form occupied the majority, while that of exchangeable form was relatively low. Compared with non-rhizosphere soil, rhizosphere soil had a higher organic matter content but a lower pH. With the growth of C. dactylon, the contents of organically combined and exchangeable Cu in rhizosphere soil increased by 7.89% and 5%, respectively, while those of carbonate-combined and Fe-Mn oxides-combined Cu decreased. The growth of C. dactylon accelerated the transformation of Cu forms in rhizosphere soil, and decreased the rhizosphere soil Cu content through its absorption.

  6. Role of glycemic elements of Cynodon dactylon and Musa paradisiaca in diabetes management.

    Science.gov (United States)

    Rai, Prashant Kumar; Jaiswal, Dolly; Rai, Nilesh K; Pandhija, Shiwani; Rai, A K; Watal, Geeta

    2009-09-01

    The study defined the scientific evaluation of glycemic elements of extracts of Cynodon dactylon and Musa paradisiaca. A dose of 500 mg/kg body weight (bw) of C. dactylon produced maximum falls of 23.2% and 22.8% in blood glucose levels of normoglycemic rats during studies of fasting blood glucose and glucose tolerance, respectively, whereas the same dose of M. paradisiaca produced a rise of 34.9% and 18.4%. In diabetic rats during glucose tolerance tests, a fall of 27.8% and a rise of 17.5% were observed with the same dose of C. dactylon and M. paradisiaca, respectively. Laser-induced breakdown spectroscopy used for detection of glycemic elements present in both the extracts indicated that C. dactylon was rich in magnesium (Mg), whereas M. paradisiaca was rich in potassium (K) and sodium (Na), comparatively, suggesting thereby the defined roles of these elements in diabetes management.

  7. Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

    Science.gov (United States)

    Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

    2009-05-01

    Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

  8. Acute diuretic activity of aqueous Erica multiflora flowers and Cynodon dactylon rhizomes extracts in rats.

    Science.gov (United States)

    Sadki, Chrifa; Hacht, Brahim; Souliman, Amrani; Atmani, Fouad

    2010-03-24

    The aim of the present study is to evaluate the diuretic potential and effect on urinary electrolytes of aqueous Erica multiflora L. (Ericaceae) flowers and Cynodon dactylon L. (Poaceae) rhizomes extracts in rats. Different concentrations of these plants extract (0.125, 0.250, and 0.500 g/kg of body weight) or the reference drug furosemide (0.015 g/kg) were administrated orally to hydrated male Wistar rats and their urine output was measured at several interval of time after a single dose administration. Furthermore, a toxicological effect of both plants was undertaken as well. The results showed that furosemide induced significant diuresis and electrolytes excretion during the first hours. Plant extracts increased significantly urinary output and electrolytes excretion at the dose of 0.250 g/kg for Erica multiflora and 0.500 g/kg for Cynodon dactylon. This diuretic effect seems to be not related to K(+) plant content. Urinary pH remained mostly unchanged during the course of the study for both plant extracts. No lethality was observed among animals when using Erica multiflora even at the dose of 10 g/kg while Cynodon dactylon, instead, caused 50% of rat death (LD50) at 4.5 g/kg. We concluded that both aqueous herb extracts administered, particularly, at the dose of 0.500 g/kg induce significant effect on urinary output of water and electrolytes and justify their use as diuretic remedy in traditional medicine. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  9. Phyto-bioconversion of hard coal in the Cynodon dactylon/coal rhizosphere.

    Science.gov (United States)

    Igbinigie, Eric E; Mutambanengwe, Cecil C Z; Rose, Peter D

    2010-03-01

    Fundamental processes involved in the microbial degradation of coal and its derivatives have been well documented. A mutualistic interaction between plant roots and certain microorganisms to aid growth of plants such as Cynodon dactylon (Bermuda grass) on hard coal dumps has recently been suggested. In the present study coal bioconversion activity of nonmycorrhizal fungi was investigated in the C. dactylon/coal rhizosphere. Fungal growth on 2% Duff-agar, gutation formation on nitric acid treated coal and submerged culture activity in nitrogen-rich and -deficient broth formed part of the screening and selection of the fungi. The selected fungal isolates were confirmed to be found in pristine C. dactylon/coal rhizosphere. To simulate bioconversion, a fungal aliquot of this rhizosphere was used as inoculum for a Perfusate fixed bed bioreactor, packed with coal. The results demonstrate an enhanced coal bioconversion facilitated by low molecular weight organics and the bioconversion of coal may be initiated by an introduction of nitrogen moieties to the coal substrate. These findings suggest a phyto-bioconversion of hard coal involving plant and microbes occurring in the rhizosphere to promote the growth of C. dactylon. An understanding of this relationship can serve as a benchmark for coal dumps rehabilitation as well as for the industrial scale bioprocessing of hard coal.

  10. Techniques for Cynodon dactylon (L.) Pers. control suitable for use in fallow organic transition in the southeastern U.S. coastal plain

    Science.gov (United States)

    Cynodon dactylon (L.) Pers. (common bermudagrass) is a troublesome perennial grass common in the southeastern U. S. and extremely difficult to control in organic crop production systems. Research trials in a site heavily infested with C. dactylon were conducted from 2008 to 2010 to evaluate systems...

  11. Cynodon dactylon extract as a preventive and curative agent in experimentally induced nephrolithiasis.

    Science.gov (United States)

    Atmani, F; Sadki, C; Aziz, M; Mimouni, M; Hacht, B

    2009-04-01

    Cynodon dactylon (Poaceae family) decoction was used in the treatment of kidney stones. However, no scientific study was undertaken so far to demonstrate the beneficial effect of the plant. Thus, the aim of the current study is to evaluate the effect of Cynodon aqueous extract as a preventive and curative agent in experimentally induced nephrolithiasis in a rat model. Ethylene glycol (EG) was used in the experiment to induce calcium oxalate (CaOx) deposition into kidneys. In preventive protocol, Cynodon decoction was administered in the same day with EG to evaluate the ability of the extract to prevent crystal deposition. However, in curative protocol, rats were first rendered nephrolithiasic and then the extract was administered to assess the ability of the plant to eliminate the pre-existing crystal deposition. In both protocols, urinary biochemical and other variables were measured during the course of the study. Crystalluria and renal histology were examined as well. The results showed that, in both protocols, all measured variables were similar for both the rat groups. Nevertheless, urinary biochemical analysis was apparently unaffected by the extract except oxalate in preventive protocol, and calcium, sodium, and potassium in curative protocol which were significantly highly excreted in treated rats compared to untreated animals. Crystalluria was characterized mostly by the presence of large quantities of CaOx monohydrate and CaOx dihydrate particles in untreated rats. However, crystalluria was mainly dominated by the presence of CaOx dihydrate particles with reduced size. The most apparent beneficial effect of Cynodon extract was seen in kidney tissues where reduced levels of CaOx deposition have been noticed especially in medullary and papillary sections from treated rats. We concluded that C. dactylon extract has beneficial effect in preventing and eliminating CaOx deposition into kidneys. Such findings provide a scientific explanation for its use in the

  12. Karyotype asymmetry in Cynodon Rich. (Poaceae) accessions.

    Science.gov (United States)

    Chiavegatto, R B; Paula, C M P; Souza Sobrinho, F; Benites, F R G; Techio, V H

    2016-12-02

    Cynodon is a genus of plants with forage potential that has attracted the interest of breeders. These species have high morphological variability in a large number of varieties and cytotypes, hampering identification. This study aimed to determine the karyotype asymmetry index among accessions of Cynodon to discriminate between them. Karyotype symmetry was based on three estimates, which were compared. The basic number for the genus is x = 9. The results of the chromosome count and DNA quantification, respectively, were as follows: two diploid accessions (2n = 2x = 18 and 1.08 ± 0.094 to 1.17 ± 0.036 pg DNA and ± standard deviation), one triploid accession (2n = 3x = 27 and 1.63 ± 0.017 pg DNA), four tetraploid accessions (2n = 4x = 36 and 1.88 ± 0.069 to 2.10 ± 0.07 pg DNA), and one pentaploid accession (2n = 5x = 45 and 2.55 ± 0.098 pg DNA). C. incompletus var. hirsutus had the longest total length of the haploid lot (29.05 µm), with chromosomes that ranged from 1.7 to 6.2 µm in length. On the basis of the karyotype asymmetry indices, the accessions were divided into two groups: 1) C. dactylon var. dactylon, C. transvaalensis, C. dactylon var. polevansii, three accessions of Cynodon sp, and C. nlemfuensis; and 2) C. incompletus var. hirsutus. This is the first description of tetraploidy in C. transvaalensis. The karyotypic data facilitated a determination of the degree of proximity between the accessions.

  13. The beneficial effect of cynodon dactylon fractions on ethylene glycol-induced kidney calculi in rats.

    Science.gov (United States)

    Khajavi Rad, Abolfazl; Hadjzadeh, Mousa-Al-Reza; Rajaei, Ziba; Mohammadian, Nema; Valiollahi, Saleh; Sonei, Mehdi

    2011-01-01

    To assess the beneficial effect of different fractions of Cynodon dactylon (C. dactylon) on ethylene glycol-induced kidney calculi in rats. Male Wistar rats were randomly divided into control, ethylene glycol, curative, and preventive groups. The control group received tap drinking water for 35 days. Ethylene glycol, curative, and preventive groups received 1% ethylene glycol for induction of calcium oxalate (CaOx) calculus formation. Preventive and curative subjects also received different fractions of C. dactylon extract in drinking water at 12.8 mg/kg, since day 0 and day 14, respectively. After 35 days, the kidneys were removed and examined for histopathological findings and counting the CaOx deposits in 50 microscopic fields. In curative protocol, treatment of rats with C. dactylon N-butanol fraction and N-butanol phase remnant significantly reduced the number of the kidney CaOx deposits compared to ethylene glycol group. In preventive protocol, treatment of rats with C. dactylon ethyl acetate fraction significantly decreased the number of CaOx deposits compared to ethylene glycol group. Fractions of C. dactylon showed a beneficial effect on preventing and eliminating CaOx deposition in the rat kidney. These results provide a scientific rational for preventive and treatment roles of C. dactylon in human kidney stone disease.

  14. Isolation and in silico evaluation of antidiabetic molecules of Cynodon dactylon (L.).

    Science.gov (United States)

    Annapurna, Hasthi V; Apoorva, Babu; Ravichandran, Natesan; Arun, Kallur Purushothaman; Brindha, Pemaiah; Swaminathan, Sethuraman; Vijayalakshmi, Mahadevan; Nagarajan, Arumugam

    2013-02-01

    Cynodon dactylon is a potential source of metabolites such as flavanoids, alkaloids, glycosides and β-sitosterol and has been traditionally employed to treat urinary tract and other microbial infections and dysentery. The present work attempts to evaluate the activity of C. dactylon extracts for glycemic control. Aqueous extracts of C. dactylon analyzed by HPLC-ESI MS have identified the presence of apigenin, luteolin, 6-C-pentosyl-8-C-hexosyl apigenin and 6-C-hexosyl-8-C-pentosyl luteolin. Evaluation of hypoglycemic activity through an extensive in silico docking approach with PPARγ (Peroxisome Proliferator-Activated Receptor), GLUT-4 (glucose transporter-4) and SGLT2 (sodium glucose co-transporter-2) revealed that luteolin, apigenin, 6-C-pentosyl-8-C-hexosyl apigenin, 6-C-hexosyl-8-C-pentosyl luteolin interact with SGLT2. Interactions of these molecules with Gln 295 and Asp 294 residues of SGLT2 have been shown to compare well with that of the phase III drug, dapagliflozin. These residues have been proven to be responsible for sugar sensing and transport. This work establishes C. dactylon extract as a potential SGLT2 inhibitor for diabetic neuropathy thus enabling a possibility of this plant extract as a new alternative to existing diabetic approaches. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Transformation of triploid bermudagrass (Cynodon dactylon x C. transvaalensis cv. TifEagle) by means of biolistic bombardment.

    Science.gov (United States)

    Zhang, G; Lu, S; Chen, T A; Funk, C R; Meyer, W A

    2003-06-01

    A transformation system for triploid bermudagrass ( Cynodon dactylon x C. transvaalensis cv. TifEagle) was established with a biolistic bombardment delivery system. Embryogenic callus was induced from stolons and maintained on Murashige and Skoog's medium supplemented with 30 microM dicamba, 20 microM benzylaminopurine, and 100 mg/l myo-inositol. Using the hygromycin phosphotransferase ( hpt) gene as the selectable marker gene, we obtained 75 transgenic lines from 18 petri dishes bombarded. Integration of the hpt gene into genomic DNA and transcription of hpt was confirmed by Southern and Northern blot analyses, respectively. Through suspension culture screening, we obtained homogeneously transformed plants showing stable transcription of the hpt gene.

  16. Anti-chikungunya activity of luteolin and apigenin rich fraction from Cynodon dactylon

    Institute of Scientific and Technical Information of China (English)

    Krishnan Saravana Murali; Srinivasan Sivasubramanian; Savariar Vincent; Shanmugaraj Bala Murugan; Bupesh Giridaran; Sundaram Dinesh; Palani Gunasekaran; Kaveri Krishnasamy; Ramalingam Sathishkumar

    2015-01-01

    Objective:To obtain luteolin and apigenin rich fraction from the ethanolic extract ofCynodon dactylon (L.) (C. dactylon) Pers and evaluate the fraction’s cytotoxicity and anti-Chikungunya potential using Vero cells.Methods:The ethanolic extract ofC. dactylon was subjected to silica gel column chromatography to obtain anti-chikungunya virus (CHIKV) fraction. Reverse phase-HPLC and GC-MS studies were carried out to identify the major phytochemicals in the fraction using phytochemical standards. Cytotoxicity and the potential of the fraction against CHIKV were evaluatedin vitrousing Vero cells. Reduction in viral replication was assessed by reverse transcriptase-polymerase chain reaction (RT-PCR) after treating the viral infected Vero cells with the fraction.Results:Reverse Phase-HPLC and GC-MS studies confirmed the presence of flavonoids, luteolin and apigenin as major phytochemicals in the anti-CHIKV ethanolic fraction ofC. dactylon. The fraction was found to exhibit potent viral inhibitory activity (about 98%) at the concentration of 50 µg/mL as observed by reduction in cytopathic effect, and the cytotoxic concentration of the fraction was found to be 250 µg/mL. RT-PCR analyses indicated that the reduction in viral mRNA synthesis in fraction treated infected cells was much higher than the viral infected control cells.Conclusions:Luteolin and apigenin rich ethanolic fraction fromC. dactylon can be utilized as a potential therapeutic agent against CHIKV infection as the fraction does not show cytotoxicity while inhibiting the virus.

  17. DOSES DE LODO DE ESGOTO SOBRE O DESENVOLVIMENTO DA GRAMA BERMUDA (Cynodon dactylon)

    OpenAIRE

    NOBILE, Fabio Olivieri de; NUNES, Hugo Dias; NEVES, Jéssica Caroline

    2014-01-01

    Population growth occurred rapidly, resulting in cities with poor infrastructure on the sanitation sector. So, there was the introduction of sanitary treatment, causing difficulty in choosing alternatives for the proper disposal of sewage sludge, rich in essential nutrients for the plants. The experiment was conducted to determine the best dose of sewage sludge to Grass Cynodon dactylon. It was conducted in greenhouse in the University Center of Educational Foundation of Barretos-SP. The expe...

  18. Evaluation of CNS activities of aerial parts of Cynodon dactylon Pers. in mice.

    Science.gov (United States)

    Pal, Dilipkumar

    2008-01-01

    The dried extracts of aerial parts of Cynodon dactylon Pers. (Graminae) were evaluated for CNS activities in mice. The ethanol extract of aerial parts of C. dactylon (EECD) was found to cause significant depression in general behavioral profiles in mice. EECD significantly potentiated the sleeping time in mice induced by standard hypnotics viz. pentobarbitone sodium, diazepam, and meprobamate in a dose dependant manner. EECD showed significant analgesic properties as evidenced by the significant reduction in the number of writhes and stretches induced in mice by 1.2% acetic acid solution. It also potentiated analgesia induced by morphine and pethidine in mice. EECD inhibited the onset and the incidence of convulsion in a dose dependent manner against pentylenetetrazole (PTZ)-induced convulsion. The present study indicates that EECD has significant CNS depressant activities.

  19. Chemopreventive effect of Cynodon dactylon (L.) Pers. extract against DMH-induced colon carcinogenesis in experimental animals.

    Science.gov (United States)

    Albert-Baskar, Arul; Ignacimuthu, Savarimuthu

    2010-07-01

    The present study was aimed at evaluating the chemopreventive property of Cynodon dactylon. The antioxidant, antiproliferative and apoptotic potentials of the plant were investigated by 1,1-diphenyl-2-picrylhydrazyl (DPPH) assay, nitric oxide radical scavenging activity (NO(-)) and MTT assay on four cancer cell lines (COLO 320 DM, MCH-7, AGS, A549) and a normal cell line (VERO). In vivo chemopreventive property of the plant extract was studied in DMH-induced colon carcinogenesis. The methanolic extract of C. dactylon was found to be antiproliferative and antioxidative at lower concentrations and induced apoptotic cell death in COLO 320 DM cells. Treatment with methanolic extract of C. dactylon increased the levels of antioxidant enzymes and reduced the number of dysplastic crypts in DMH-induced colon of albino rats. The present investigation revealed the anticancer potential of methanolic extract of C. dactylon in COLO 320 DM cells and experimentally induced colon carcinogenesis in rats.

  20. Anti-chikungunya activity of luteolin and apigenin rich fraction from Cynodon dactylon.

    Science.gov (United States)

    Murali, Krishnan Saravana; Sivasubramanian, Srinivasan; Vincent, Savariar; Murugan, Shanmugaraj Bala; Giridaran, Bupesh; Dinesh, Sundaram; Gunasekaran, Palani; Krishnasamy, Kaveri; Sathishkumar, Ramalingam

    2015-05-01

    To obtain luteolin and apigenin rich fraction from the ethanolic extract of Cynodon dactylon (L.) (C. dactylon) Pers and evaluate the fraction's cytotoxicity and anti-Chikungunya potential using Vero cells. The ethanolic extract of C. dactylon was subjected to silica gel column chromatography to obtain anti-chikungunya virus (CHIKV) fraction. Reverse phase-HPLC and GC-MS studies were carried out to identify the major phytochemicals in the fraction using phytochemical standards. Cytotoxicity and the potential of the fraction against CHIKV were evaluated in vitro using Vero cells. Reduction in viral replication was assessed by reverse transcriptase-polymerase chain reaction (RT-PCR) after treating the viral infected Vero cells with the fraction. Reverse Phase-HPLC and GC-MS studies confirmed the presence of flavonoids, luteolin and apigenin as major phytochemicals in the anti-CHIKV ethanolic fraction of C. dactylon. The fraction was found to exhibit potent viral inhibitory activity (about 98%) at the concentration of 50 µg/mL as observed by reduction in cytopathic effect, and the cytotoxic concentration of the fraction was found to be 250 µg/mL. RT-PCR analyses indicated that the reduction in viral mRNA synthesis in fraction treated infected cells was much higher than the viral infected control cells. Luteolin and apigenin rich ethanolic fraction from C. dactylon can be utilized as a potential therapeutic agent against CHIKV infection as the fraction does not show cytotoxicity while inhibiting the virus. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

  1. Relevance of Allergenic Sensitization to Cynodon dactylon and Phragmites communis: Cross-reactivity With Pooideae Grasses.

    Science.gov (United States)

    López-Matas, M A; Moya, R; Cardona, V; Valero, A; Gaig, P; Malet, A; Viñas, M; García-Moral, A; Labrador, M; Alcoceba, E; Ibero, M; Carnés, J

    The homologous group of sweet grasses belongs to the Pooideae subfamily, but grass pollen species from other subfamilies can also cause allergy, such as Cynodon dactylon (Chloridoideae) and Phragmites communis (Arundinoideae). C dactylon and P communis have not been included in the sweet grasses homologous group because of their low cross-reactivity with other grasses. The aims of this study were to investigate the profile of sensitization to C dactylon and P communis in patients sensitized to grasses and to analyze cross-reactivity between these 2 species and temperate grasses. Patients were skin prick tested with a grass mixture (GM). Specific IgE to GM, C dactylon, P communis, Cyn d 1, and Phl p 1 was measured by ImmunoCAP. A pool of sera was used for the immunoblot assays. Cross-reactivity was studied by ELISA and immunoblot inhibition. Thirty patients had sIgE to GM. Twenty-four (80%) had positive results for C dactylon, 27 (90%) for P communis, 22 (73.3%) for nCyn d 1, and 92.9% for rPhl p 1. Bands were detected in the 3 extracts by immunoblot. Inhibition of GM was not observed with C dactylon or P communis by immunoblot or ELISA inhibition. When C dactylon or P communis were used in the solid phase, GM produced almost complete inhibition. Eighty percent of patients sensitized to grasses were also sensitized to C dactylon and 90% were sensitized to P communis. Sensitization to these species seems to be induced by allergens different to those in sweet grasses.

  2. Identification and determination of flavonoids, carotenoids and chlorophyll concentration in Cynodon dactylon (L.) by HPLC analysis.

    Science.gov (United States)

    Muthukrishnan, Saradha Devi; Kaliyaperumal, Ashokkumar; Subramaniyan, Annapoorani

    2015-01-01

    Cynodon dactylon (L.) is a potent medicinal plant in the traditional and current Indian medicinal systems. The objective of this research was to find out the levels of flavonoids, carotenoids and chlorophyll b in C. dactylon leaves by high-performance liquid chromatography (HPLC) equipped with a diode array detector. HPLC analysis revealed that total carotenoid and total flavonoid concentration were 62 mg/100 g and 249.1 μg/g, respectively. The mean chlorophyll b was 85.1 mg/100 g in C. dactylon. Among the flavonoids, quercetin (164.7 μg/g) was the major flavonoid followed by kaempferol (48.2 μg/g), rutin (18.4 μg/g), catechin (12.1 μg/g) and myricetin (5.7 μg/g). Of the carotenoids, β-carotene (35.2 mg/100 g) was predominant followed by lutein (17.0 mg/100 g), violaxanthin (5.8 mg/100 g) and zeaxanthin (4.2 mg/100 g). Chlorophyll b concentration was 85.1 mg/100 g in C. dactylon. The results of this investigation should be useful information for further pharmacological studies.

  3. In Vitro Virucidal and Virustatic Properties of the Crude Extract of Cynodon dactylon against Porcine Reproductive and Respiratory Syndrome Virus

    Science.gov (United States)

    Khonghiran, Oapkun; Kunanoppadol, Suchaya; Potha, Teerapong; Chuammitri, Phongsakorn

    2014-01-01

    The in vitro virustatic and virucidal tests of the crude extract of Cynodon dactylon against infection with porcine reproductive and respiratory syndrome virus (PRRSV), a cause of major devastating pig disease, were described. Crude extract of C. dactylon was prepared for cytotoxicity on tissue-culture cells that were used to measure virustatic and virucidal activities against PRRSV. Crude extract of C. dactylon at 0.78 mg/mL showed no cytotoxicity on the cell line, and at that concentration significantly inhibited replication of PRRSV as early as 24 hours post infection (hpi). C. dactylon also inactivated PRRSV as determined by immunoperoxidase monolayer assay (IPMA) compared to the control experiments. In summary, the present study may be among the earliest studies to describe virustatic and virucidal activities of C. dactylon crude extract against PRRSV in vitro. Extracts of C. dactylon may be useful for PRRSV control and prevention on pig farms. PMID:24744959

  4. Effect of alfalfa (medicago sativa) on fermentation profile and nutritive value of switchgrass (panicum virgatum) and bermudagrass (cynodon dactylon) silages

    Science.gov (United States)

    An experiment was conducted at the University of Kentucky Spindletop Farm in Lexington, Kentucky between October and November, 2009 to evaluate the effect of different percentages of alfalfa (Medicago sativa) as mixtures in switchgrass (Panicum virgatus) and bermudagrass (Cynodon dactylon) silages. ...

  5. Fluoride sorption using Cynodon dactylon based activated carbon

    Directory of Open Access Journals (Sweden)

    Alagumuthu G.

    2011-01-01

    Full Text Available This study deals the application of Cynodon dactylon based thermally activated carbon for fluoride toxicity. The batch adsorption techniques was followed at neutral pH as the functions of contact time, adsorbent dose, adsorbate concentration, temperature and the effect of co-anions. The data indicate that the prepared adsorbent surface sites are heterogeneous in nature and that fits into a heterogeneous site-binding model. The present system followed the Redlich-Peterson isotherm as well as Langmuir adsorption isotherm model. Lagergren pseudo-first-order, pseudo-second-order, intra particle diffusion and Elovich kinetics were modeled to describe the adsorption rate of fluoride and determined as this scheme followed pseudo-second-order kinetics. The calculated enthalpy change, ΔH°, and entropy change, ΔS°, for the adsorption process are +8.725 kJ/mol and +0.033 J/mol K respectively and shows endothermic experience. Instrumental analysis of XRD, FTIR and SEM gives the idea about the fluoride binding ability of adsorbent.

  6. Disomic Inheritance and Segregation Distortion of SSR Markers in Two Populations of Cynodon dactylon (L.) Pers. var. dactylon.

    Science.gov (United States)

    Guo, Yuanwen; Wu, Yanqi; Anderson, Jeff A; Moss, Justin Q; Zhu, Lan

    2015-01-01

    Common bermudagrass [C. dactylon (L.) Pers. var. dactylon] is economically and environmentally the most important member among Cynodon species because of its extensive use for turf, forage and soil erosion control in the world. However, information regarding the inheritance within the taxon is limited. Accordingly, the objective of this study was to determine qualitative inheritance mode in common bermudagrass. Two tetraploid (2n = 4x = 36), first-generation selfed (S1) populations, 228 progenies of 'Zebra' and 273 from A12359, were analyzed for segregation with 21 and 12 simple sequence repeat (SSR) markers, respectively. It is concluded that the inheritance mode of tetraploid bermudagrass was complete or near complete disomic. It is evident that the two bermudagrass parents had an allotetraploid genome with two distinct subgenomes since 33 SSR primer pairs amplified 34 loci, each having two alleles. Severe transmission ratio distortions occurred in the Zebra population while less so in the A12359 population. The findings of disomic inheritance and segregation ratio distortion in common bermudagrass is significant in subsequent linkage map construction, quantitative trait locus mapping and marker-assisted selection in the species.

  7. Anticancer activity of Cynodon dactylon L. root extract against diethyl nitrosamine induced hepatic carcinoma.

    Science.gov (United States)

    Kowsalya, R; Kaliaperumal, Jagatheesh; Vaishnavi, M; Namasivayam, Elangovan

    2015-01-01

    Hepatocellular carcinoma is one of the most common cancers and a lethal disease. In view of the limited treatment and a grave prognosis of liver cancer, preventive control has been emphasized. The methanolic extract of roots of Cynodon dactylon was screened for its hepato-protective activity in diethyl nitrosamine (DEN) induced liver cancer in Swiss albino mice. The plant extract at a dose of 50 mg/kg was administered orally once a week, up to 30 days after DEN administration. The animals were sacrificed; blood sample and liver tissue were collected and used for enzyme assay such as, asparatate amino transferase (AST), alanine aminotransferase (ALT), catalase (CAT), glutathione peroxidase (GPx) and glutathione-S-transferase (GST). The liver marker enzymes AST and ALT produced significant results in the protective action. The antioxidant enzyme assay results concerning the improved activity of GPx, GST and CAT. These results concluded that enhanced levels of antioxidant enzyme and reduced amount of serum amino transaminase, which are suggested to be the major mechanisms of C. dactylon root extract in protecting the mice from hepatocarcinoma induced by DEN. These biochemical observations were supplemented by histopathological examination of liver sections. The methanolic extract of C. dactylon possesses significant anticancer properties.

  8. Anticancer activity of Cynodon dactylon L. root extract against diethyl nitrosamine induced hepatic carcinoma

    Directory of Open Access Journals (Sweden)

    R Kowsalya

    2015-01-01

    Full Text Available Background: Hepatocellular carcinoma is one of the most common cancers and a lethal disease. In view of the limited treatment and a grave prognosis of liver cancer, preventive control has been emphasized. Materials and Methods: The methanolic extract of roots of Cynodon dactylon was screened for its hepato-protective activity in diethyl nitrosamine (DEN induced liver cancer in Swiss albino mice. The plant extract at a dose of 50 mg/kg was administered orally once a week, up to 30 days after DEN administration. The animals were sacrificed; blood sample and liver tissue were collected and used for enzyme assay such as, asparatate amino transferase (AST, alanine aminotransferase (ALT, catalase (CAT, glutathione peroxidase (GPx and glutathione-S-transferase (GST. The liver marker enzymes AST and ALT produced signifi cant results in the protective action. Results: The antioxidant enzyme assay results concerning the improved activity of GPx, GST and CAT. These results concluded that enhanced levels of antioxidant enzyme and reduced amount of serum amino transaminase, which are suggested to be the major mechanisms of C. dactylon root extract in protecting the mice from hepatocarcinoma induced by DEN. These biochemical observations were supplemented by histopathological examination of liver sections. Conclusion: The methanolic extract of C. dactylon possesses signifi cant anticancer properties

  9. Comparative analyses of physiological responses of Cynodon dactylon accessions from Southwest China to sulfur dioxide toxicity.

    Science.gov (United States)

    Li, Xi; Wang, Ling; Li, Yiqiao; Sun, Lingxia; Cai, Shizhen; Huang, Zhuo

    2014-01-01

    Sulfur dioxide (SO2), a major air pollutant in developing countries, is highly toxic to plants. To achieve better air quality and landscape, planting appropriate grass species in severe SO2 polluted areas is very critical. Cynodon dactylon, a widely used warm season turfgrass species, has good SO2-tolerant ability. In this study, we selected 9 out of 38 C. dactylon accessions from Southwest China as representatives of high, intermediate SO2-tolerant and SO2-sensitive accessions to comparatively analyze their physiological differences in leaves under SO2 untreated and treated conditions. Our results revealed that SO2-tolerant C. dactylon accessions showed higher soluble sugar, proline, and chlorophyll a contents under both SO2 treated and untreated conditions; higher chlorophyll b and carotenoid under SO2 treated condition; lower reactive oxygen species (ROS) level, oxidative damages, and superoxide dismutase (SOD) activities under SO2 treated condition; and higher peroxidase (POD) activities under SO2 untreated condition. Further results indicated that SO2-tolerant C. dactylon accessions had higher sulfur contents under both SO2 treated and untreated conditions, consistent with higher SO activities under both SO2 treated and untreated conditions, and higher SiR activities under SO2 treated condition. Taken together, our results indicated that SO2 tolerance of C. dactylon might be largely related to soluble sugar, proline and chlorophyll a contents, and SO enzyme activity.

  10. Effects of Hydroalcoholic Extract of Cynodon Dactylon (L. Pers. on ISchemia/Reperfusion-Induced Arrhythmias

    Directory of Open Access Journals (Sweden)

    A Garjani

    2008-09-01

    Full Text Available Background and purpose of the study: Probable antiarrhythmic effects of Cynodon dactylon (L. pers. (family Poaceae against ischemia/reperfusion (I/R-induced arrhythmias were investigated in isolated rat heart. Methods: The hearts were subjected to 30min regional ischemia followed by 30min reperfusion and perfused with hydroalcoholic extract of rhizome of C. dactylon (25, 50, 100 and 200µg/ml. Results: During ischemia, the extract produced marked reduction in the number, duration and incidences of ventricular tachycardia (VT at 25 and 50µg/ml (p<0.001 and p<0.01, respectively. Total number of ischemic ventricular ectopic beats (VEBs were lowered by 25-100µg/ml (p<0.001, p<0.001 and p<0.05, respectively. At the reperfusion phase, C. dactylon (25 and 50µg/ml decreased incidence of VT from 100% (control to 13 and 33% (p<0.001 and p<0.05 respectively. Duration and number of VT and total VF incidence were also reduced at the same concentration (p<0.05 for all. Perfusion of the extract (25-100µg/ml was markedly lowered reversible VF duration from 218±99sec to 0 sec, 0 sec and 10±5sec (p<0.01, p<0.01 and p<0.05 respectively. Moreover, C. dactylon (25 and 50µg/ml decreased number of total VEBs from 349±73 to 35±17 (p<0.001 and 66±26 (p<0.01. In this study, it was also shown that perfusion of the extract produced a marked and concentration-dependent positive inotropic effect. Conclusion: The findings of this study indicate that C. dactylon produce protective effects against I/R-induced arrhythmias in isolated rat hearts probably by increase in the myocardial contractility and as a result by improvement of hemodynamic factors.

  11. CaracterÃsticas produtivas e parÃmetros bromatolÃgicos de pastagens de Tifton 85 (Cynodon spp) e Coastcross (Cynodon dactylon) e desempenho de bovinos da raÃa PurunÃ

    OpenAIRE

    Marcos Antonio Teixeira

    2014-01-01

    O objetivo deste trabalho foi avaliar o desempenho animal da raÃa Purunà e de pastagens de Tifton 85 (Cynodon spp) e Coastcross (Cynodon dactylon) com e sem irrigaÃÃo sendo o experimento realizado no municÃpio de Santa Tereza do Oeste/PR. Inicialmente, avaliou-se a produÃÃo de matÃria seca (MS) e composiÃÃo bromatolÃgica das pastagens de capim tifton 85 e coastcross sem irrigaÃÃo e com irrigaÃÃo. O delineamento experimental foi em blocos casualizados, em esquema fatorial com parcelas subd...

  12. Evaluation of off-type grasses in hybrid bermudagrass (Cynodon dactylon (L.) Pers. x C. transvaalensis Burtt-Davy) putting greens using genotyping-by-sequencing

    Science.gov (United States)

    Use of hybrid ultradwarf bermudagrasses (UDBG; Cynodon dactylon (L.) Pers. x C. transvaalensis Burtt-Davy) on golf course putting greens is increasing in the southern United States. However, off-type grasses within many putting surfaces have been observed. To explore the genetic variation among UD...

  13. Root growth of Cynodon dactylon and Eleusine indica collected from motorways at different concentrations of lead.

    Science.gov (United States)

    Wong, M H; Lau, W M

    1985-04-01

    An ecological survey was conducted on the roadside vegetation at three different sites: Tai Po, a commercial and residential area (average annual daily traffic (AADT) = 23730; and Shek O and Wu Kai Sha, recreational areas (AADT = 1590 and 20, respectively). Cynodon dactylon and Eleusine indica were the two most dominant species recorded. The Tai Po site had higher Pb contents in both soil and plant, followed by Shek O, and then Wu Kai Sha. Tillers of C. dactylon and E. indica from the three sites were subjected to a series concentrations of Pb(NO3)2. By comparing their indexes of tolerance and values of 14-day EC50 (effective concentration reducing the normal root growth by 50%), roadside populations of the two grasses collected from Tai Po and Shek O, especially the former one, were more tolerant to elevated levels of Pb compared with those collected from Wu Kai Sha.

  14. Energy analysis in Cynodon dactylon (L.) Pers hay production; Analise energetica na producao de feno de Cynodon dactylon (L.) Pers

    Energy Technology Data Exchange (ETDEWEB)

    Campos, Alessandro T. [UNIOESTE, Marechal Candido Rondon, PR (Brazil). Centro de Ciencias Agrarias]. E-mail: atcampos3@yahoo.com.br; Saglietti, Jose R.C.; Bueno, Osmar C. [UNESP, Botucatu, SP (Brazil). Facudade de Ciencias Agronomicas; Campos, Aloisio T. [EMBRAPA - Gado de leite, Juiz de Fora, MG (Brazil)

    2005-05-15

    The aim of this work was to characterize the energy consumption related to the introduction, development, hay processing and storage of Cynodon dactylon (L.) Pers allied to the analysis of the energetic efficiency. The data used in this project were collected from EMBRAPA Gado de Leite, localized in Coronel Pacheco, Minas Gerais, Brazil. The data were obtained from a seven year period of an intensive system of milk production. Energetic coefficients were used to generate the survey and several matrix components obtained from pertinent literature. The direct energy, related to the inputs, showed more efficient participation on the energetic matrix than the indirect energy and the percentages were 94.64 and 5.31, respectively. Farm tractor was the main indirect energy consumer, which is responsible for turning on all the equipment, followed by the irrigation system. The energetic efficiency presented by the whole system was 4.2, being considered positive and demonstrating that the agriculture ecosystem is sustainable. Most of the direct energy employed in this system was oil derived on fuel form. There was, however, a great consume of another oil derived energy such as fertilizer, but mainly on the nitrogen form (28.89% of the total employed energy). (author)

  15. Physiological responses of somaclonal variants of triploid bermudagrass (Cynodon transvaalensis x Cynodon dactylon) to drought stress.

    Science.gov (United States)

    Lu, Shaoyun; Chen, Chuanhao; Wang, Zhongcheng; Guo, Zhenfei; Li, Haihang

    2009-03-01

    Eight somaclonal variants with enhanced drought tolerance were isolated from regenerated plants of triploid bermudagrass (Cynodon dactylon x Cynodon transvaalensis cv., TifEagle). Three of them (10-17, 89-02, 117-08) with strong drought tolerance were selected for investigations of physiological responses to drought stress. Compared to the parent control, TifEagle, the somaclonal variants had higher relative water contents and relative growth, and lower ion leakages in the greenhouse tests, while no difference in evapotranspirational water losses and soil water contents was observed between the variants and TifEagle. The variants also had less leaf firing in the field tests under drought stress. Superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX) activities decreased gradually in responses to drought stress in all plants and exhibited negative correlations with ion leakage, indicating that the declined activities of these antioxidant enzymes were associated with drought injury in the triploid bermudagrass. However, CAT activities were significantly higher in all three variants than in TifEagle during drought stress. Two variants, 10-17 and 89-02, also had significantly higher APX activities than TifEagle before and during the first 4 days of drought treatments. These two lines also showed higher SOD activities after prolonged drought stress. Proline, total soluble sugars and sucrose were accumulated under drought stress in all plants and exhibited positive correlations with ion leakage. More proline and sugars were accumulated in TifEagle than in the variants. The results indicated that higher activities of the antioxidant enzymes in the variants during drought stress are associated with their increased drought tolerance.

  16. Cynodon dactylon and Sida acuta extracts impact on the function of the cardiovascular system in zebrafish embryos.

    Science.gov (United States)

    Kannan, Rajaretinam Rajesh; Vincent, Samuel Gnana Prakash

    2012-03-01

    The aim of the present study was to screen cardioactive herbs from Western Ghats of India. The heart beat rate (HBR) and blood flow during systole and diastole were tested in zebrafish embryos. We found that Cynodon dactylon (C. dactylon) induced increases in the HBR in zebrafish embryos with a HBR of (3.968±0.344) beats/s, which was significantly higher than that caused by betamethosone [(3.770±0.344) beats/s]. The EC50 value of C. dactylon was 3.738 µg/mL. The methanolic extract of Sida acuta (S. acuta) led to decreases in the HBR in zebrafish embryos [(1.877±0.079) beats/s], which was greater than that caused by nebivolol (positive control). The EC50 value of Sida acuta was 1.195 µg/mL. The untreated embryos had a HBR of (2.685±0.160) beats/s at 3 d post fertilization (dpf). The velocities of blood flow during the cardiac cycle were (2,291.667±72.169) µm/s for the control, (4,250±125.000) µm/s for C. dactylon and (1,083.333±72.169) µm/s for S. acuta. The LC50 values were 32.6 µg/mL for C. dactylon and 20.9 µg/mL for S. acuta. In addition, the extracts exhibited no chemical genetic effects in the drug dosage range tested. In conclusion, we developed an assay that can measure changes in cardiac function in response to herbal small molecules and determine the cardiogenic effects by microvideography.

  17. Protection of ionizing radiation-induced cytogenetic damage by hydroalcoholic extract of Cynodon dactylon in Chinese hamster lung fibroblast cells and human peripheral blood lymphocytes.

    Science.gov (United States)

    Rao, Bola Sadashiva Satish; Upadhya, Dinesh; Adiga, Satish Kumar

    2008-01-01

    The radiomodulatory potential of hydroalcoholic extract of a medicinal plant Cynodon dactylon (family: Poaceae) against radiation-induced cytogenetic damage was analyzed using Chinese hamster lung fibroblast (V79) cells and human peripheral blood lymphocytes (HPBLs) growing in vitro. Induction of micronuclei was used as an index of cytogenetic damage, evaluated in cytokinesis blocked binucleate cells. The hydroalcoholic Cynodon dactylon extract (CDE) rendered protection against the radiation-induced DNA damage, as evidenced by the significant (p<0.001) reduction in micronucleated binucleate cells (MNBNC%) after various doses of CDE treatment in V79 cells and HPBLs. The optimum dose of CDE (40 and 50 microg/ml in HPBLs and V79 cells, respectively) with the greatest reduction in micronuclei was further used in combination with various doses of gamma radiation (0.5, 1, 2, 3, and 4 Gy) exposed 1 h after CDE treatment. A linear dose-dependent MNBNC% increase in radiation alone group was observed, while 40/50 microg/ml CDE significantly resulted in the reduction of MNBNC%, compared to the respective radiation alone groups. CDE resulted in a dose-dependent increase in free radical scavenging ability against various free radicals, viz., 2, 2-diphenyl-2-picryl-hydrazyl (DPPH); 2, 2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS); superoxide anion (O2*-); hydroxyl radical (OH*) and nitric oxide radical (NO*) generated in vitro. Also, an excellent (70%) inhibition of lipid peroxidation in vitro was observed at a dose of 300 microg/ml CDE, attaining the saturation point at higher doses. The present findings demonstrated the radioprotective effect of CDE, also rendering protection against radiation-induced genomic instability and DNA damage. The observed radioprotective effect may be partly attributed to the free radical scavenging and antilipid peroxidative potential of CDE.

  18. Study on the mechanism of the bronchodilatory effects of Cynodon dactylon (Linn.) and identification of the active ingredient.

    Science.gov (United States)

    Patel, Maulik R; Bhalodia, Yagnik S; Pathak, Nimish L; Patel, Maulik S; Suthar, Kunal; Patel, Nilesh; Golwala, Dharmesh K; Jivani, Nurudin P

    2013-12-12

    In the traditional medicine, Cynodon dactylon (Linn.) is used in asthma, but scientific studies to provide evidence for medicinal uses are sparse. Thus this study was undertaken to provide evidence for medicinal use in asthma as a bronchodilator, and to identify active ingredient(s). In vivo, acetylcholine (Ach)-induced bronchospasm was conducted in guinea pig while isolated rat tracheal strip was suspended in organ bath to measure the concentration response curve using multichannel data acquisition system. The chloroform extract of Cynodon dactylon (CECD) protected against Ach-induced bronchospasm in guinea pigs, similar to atropine. In the in vitro studies, CECD relaxed carbachol (CCh) and high K+-induced contraction of rat tracheal strip, similar to atropine and verapamil respectively, suggesting antimuscarinic and calcium channel blocking (CCB) activities, which were confirmed by right ward shifting of CCh and Ca(+2) concentration response curve (CRC). The phosphodiestrase (PDE) inhibitory activity was confirmed by potentiation of isoprenaline-induced inhibitory response, similar to papaverine. Densitometry analyses led to the identification of scopoletin as an active ingredient. Effectively, it significantly inhibited high K+, and Ca(+2) induced contractile response, similar to verapamil. The phosphodiestrase (PDE) inhibitory activity was confirmed by direct evidence of potentiation of isoprenaline-induced inhibitory response, similar to papaverine. These results suggest that the bronchodilator activity of CECD is partly due to presence of scopoletin, and mediated possibly through CCB and PDE inhibition.

  19. Comportamiento de céspedes de Cynodon dactylon (L.) Pers. en Paraná, Entre Ríos, Argentina

    OpenAIRE

    Laurencena, María I; Carponi, María S; Reinoso, Patricia D; Butus, Marina; Scorciapino, Claudia; Galli, Martín; Pérez, Guillermo

    2009-01-01

    En zonas subtropicales o templadas cálidas las gramíneas estivales constituyen la base del césped pero presentan dormancia durante el invierno. Por ello es importante el conocimiento de céspedes con períodos de emergencia a implantación y vegetativo inactivo cortos, de textura fina, buen color, buen comportamiento sanitario y respuesta a fertilización. El objetivo de este trabajo fue evaluar el comportamiento en el Departamento Paraná (Entre Ríos, Argentina) de céspedes de Cynodon dactylon (b...

  20. Evaluation of In Vitro Cytotoxic and Antioxidant Activity of Datura metel Linn. and Cynodon dactylon Linn. Extracts.

    Science.gov (United States)

    Roy, Soumen; Pawar, Sandip; Chowdhary, Abhay

    2016-01-01

    To evaluate in vitro cytotoxicity and antioxidant activity of Datura metel L. and Cynodon dactylon L. extracts. The extraction of plants parts (datura seed and fruit pulp) and areal parts of durva was carried out using soxhlet and cold extraction method using solvents namely methanol and distilled water. The total phenolic content (TPC) and total flavonoid content (TFC) was determined by established methods. The in vitro cytotoxicity assay was performed in vero cell line by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay method. In vitro antioxidant activity of the extract was performed by 2, 2-diphenyl-1-picrylhydrazyl radical scavenging method. We found that the highest amount of TPC and TFC in methanolic extracts of seed (268.6 μg of gallic acid equivalence/mg of dry plant material) and fruit pulp (8.84 μg of quercetin equivalence/mg dry plant material) of D. metel, respectively prepared by Soxhlet method. The methanolic extract of C. dactylon prepared using soxhlation has shown potent free radical scavenging activity with 50% inhibitory concentration (IC50) value of 100 μg/ml. The IC50 of a methanolic cold extract of datura fruit was found to be 3 mg/ml against vero cell line. We observed that plant parts of C. dactylon and D. metel have a high antioxidant activity. Further research is needed to explore the therapeutic potential of these plant extracts. In the present study we observed a positive correlation was between the phenolic and flavanoid content of the Datura metel and cynodon doctylon (durva) extracts with the free radical scavenging activities. Both were found to have a high antioxidant activity. Abbreviations used: BHA: Butylated hydroxyanisole, BHT: Butylated hydroxytoluene, CC50: 50% cell cytotoxic concentration, CNS: Central nervous system, DPPH: 2, 2-diphenyl-1-picrylhydrazyl, IC50: 50% inhibitory concentration, MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), TFC: Total flavonoid content, TPC: Total

  1. Comparative transcriptome analysis provides new insights into erect and prostrate growth in bermudagrass (Cynodon dactylon L.).

    Science.gov (United States)

    Zhang, Bing; Xiao, Xiaolin; Zong, Junqin; Chen, Jingbo; Li, Jianjian; Guo, Hailin; Liu, Jianxiu

    2017-12-01

    Bermudagrass (Cynodon dactylon L.) is a prominent warm-season turf and forage grass species with multiple applications. In most C. dactylon cultivars and accessions, erect-growing stems (shoot) and prostrate-growing stems (stolon) often coexist. These two types of stems are both formed through tillering but grow in two directions with different tiller angles. Elucidating the mechanism of tiller angle regulation in bermudagrass could provide important clues to breed cultivars with different plant architectural features for diverse usage. In this study, we compared the stem internode transcriptome of two bermudagrass wild accessions with extremely different tiller angles and stem growth directions. A total of 2088 and 12,141 unigenes were preferentially expressed in prostrate-growing wild accession C792 and erect-growing wild accession C793, respectively. Kyoto Encyclopedia of Genes and Genomes (KEGG) Orthology-based Annotation System (KOBAS) analyses further indicated that light- and gravity-responsive genes were enriched in accession C792, whereas lignin synthesis-related genes were enriched in accession C793, which well explains the difference in lignification of vascular bundles and mechanical tissues in the two accessions. These results not only expand our understanding of the genetic control of tiller angle and stem growth direction in bermudagrass but also provide insight for future molecular breeding of C. dactylon and other turfgrass species with different plant architectures. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Responses of meristematic callus cells of two Cynodon dactylon genotypes to aluminium.

    Science.gov (United States)

    Ramgareeb, Sumita; Cooke, John A; Watt, M Paula

    2004-11-01

    Responses to Al3+ of embryogenic callus cells of an Al-sensitive (Al-S) and Al-resistant (Al-R) Cynodon dactylon genotype were evaluated with regard to Al3+ toxicity and resistance. A chemical equilibrium speciation model (MINTEQA2) was used to ensure the availability of the Al3+ ion in culture media, which was supplied as 0.08-2.3 mM Al3+ for 2-8 weeks. Increasing Al3+ concentration and exposure time had a greater negative impact on the Al-S than on the Al-R genotype, in terms of callus growth rate and frequency of non-embryogenic cells. Exposure to 0.8 mM Al3+ for 2 weeks resulted in an 88% reduction in the Al-S meristematic cell number, whereas that of the Al-R genotype remained unaffected. In addition, the Al-S cells accumulated three times more Al in the nucleus than did the Al-R cells, suggesting that Al interfered with mitosis. The Al-R cells appeared to exclude Al3+ from its cells through an increase in extracellular pH (4.34 in Al-R and 4.08 in Al-S) and by the immobilisation of Al in the cell wall (33% more in Al-R). The results showed that by studying the cellular responses to Al3+ it is possible to discriminate between the Al-S and Al-R C. dactylon genotypes.

  3. Competition between a Lawn-Forming Cynodon dactylon and a Tufted Grass Species Hyparrhenia hirta on a South-African Dystrophic Savanna.

    Science.gov (United States)

    Zwerts, J A; Prins, H H T; Bomhoff, D; Verhagen, I; Swart, J M; de Boer, W F

    2015-01-01

    South African savanna grasslands are often characterised by indigestible tufted grass species whereas lawn grasses are far more desirable in terms of herbivore sustenance. We aimed to investigate the role of nutrients and/or the disturbance (grazing, trampling) by herbivores on the formation of grazing lawns. We conducted a series of common garden experiments to test the effect of nutrients on interspecific competition between a typical lawn-forming grass species (Cynodon dactylon) and a species that is frequently found outside grazing lawns (Hyparrhenia hirta), and tested for the effect of herbivore disturbance in the form of trampling and clipping. We also performed a vegetation and herbivore survey to apply experimentally derived insights to field observations. Our results showed that interspecific competition was not affected by soil nutrient concentrations. C. dactylon did show much more resilience to disturbance than H. hirta, presumably due to the regenerative capacity of its rhizomes. Results from the field survey were in line with these findings, describing a correlation between herbivore pressure and C. dactylon abundance. We conclude that herbivore disturbance, and not soil nutrients, provide C. dactylon with a competitive advantage over H. hirta, due to vegetative regeneration from its rhizomes. This provides evidence for the importance of concentrated, high herbivore densities for the creation and maintenance of grazing lawns.

  4. Agronomic behaviour of some Cynodon dactylon ecotypes for turfgrass use in the Mediterranean climate

    Directory of Open Access Journals (Sweden)

    Roberto Viggiani

    2015-02-01

    Full Text Available In Italy, the expansion of turfgrasses is limited by the lack of suitable species for cultivation in the Mediterranean climate. With this view, Mi.Te.A.Med. (Turfgrass improvement in the Mediterranean climate research project was developed with the main purpose to find out and agronomically characterise native turfgrass species of Southern and Central Italy and to compare them with some commercial cultivars. During the first step of the research, 11 sites from 6 regions of Southern and Central Italy were identified. In these sites 24 ecotypes of Cynodon dactylon L. (Pers. were collected and their habitus, phenology plus some biometric parameters have been determined. During the two years of research both botanic and agronomic characterisation of the collected C. dactylon ecotypes and their comparison with 3 commercial cultivars (Panama, Transcontinental and Yukon was carried out. In the first year the colour loss interval was assessed. In the second year, colour index was measured by an electronic colorimeter, weekly growth rate was measured by a turfmeter, turf quality and ground cover percentage were assessed by visual estimate. Some native accessions showed behaviour similar to commercial cultivars while an ecotype from the Abruzzo region showed better results compared to the commercial cultivars for several quality indices.

  5. SSR-enriched genetic linkage maps of bermudagrass (Cynodon dactylon × transvaalensis), and their comparison with allied plant genomes.

    Science.gov (United States)

    Khanal, Sameer; Kim, Changsoo; Auckland, Susan A; Rainville, Lisa K; Adhikari, Jeevan; Schwartz, Brian M; Paterson, Andrew H

    2017-04-01

    We report SSR-enriched genetic maps of bermudagrass that: (1) reveal partial residual polysomic inheritance in the tetraploid species, and (2) provide insights into the evolution of chloridoid genomes. This study describes genetic linkage maps of two bermudagrass species, Cynodon dactylon (T89) and Cynodon transvaalensis (T574), that integrate heterologous microsatellite markers from sugarcane into frameworks built with single-dose restriction fragments (SDRFs). A maximum likelihood approach was used to construct two separate parental maps from a population of 110 F 1 progeny of a cross between the two parents. The T89 map is based on 291 loci on 34 cosegregating groups (CGs), with an average marker spacing of 12.5 cM. The T574 map is based on 125 loci on 14 CGs, with an average marker spacing of 10.7 cM. Six T89 and one T574 CG(s) deviated from disomic inheritance. Furthermore, marker segregation data and linkage phase analysis revealed partial residual polysomic inheritance in T89, suggesting that common bermudagrass is undergoing diploidization following whole genome duplication (WGD). Twenty-six T89 CGs were coalesced into 9 homo(eo)logous linkage groups (LGs), while 12 T574 CGs were assembled into 9 LGs, both putatively representing the basic chromosome complement (x = 9) of the species. Eight T89 and two T574 CGs remain unassigned. The marker composition of bermudagrass ancestral chromosomes was inferred by aligning T89 and T574 homologs, and used in comparisons to sorghum and rice genome sequences based on 108 and 91 significant blast hits, respectively. Two nested chromosome fusions (NCFs) shared by two other chloridoids (i.e., zoysiagrass and finger millet) and at least three independent translocation events were evident during chromosome number reduction from 14 in the polyploid common ancestor of Poaceae to 9 in Cynodon.

  6. Physiological integration enhanced the tolerance of Cynodon dactylon to flooding.

    Science.gov (United States)

    Li, Z J; Fan, D Y; Chen, F Q; Yuan, Q Y; Chow, W S; Xie, Z Q

    2015-03-01

    Many flooding-tolerant species are clonal plants; however, the effects of physiological integration on plant responses to flooding have received limited attention. We hypothesise that flooding can trigger changes in metabolism of carbohydrates and ROS (reactive oxygen species) in clonal plants, and that physiological integration can ameliorate the adverse effects of stress, subsequently restoring the growth of flooded ramets. In the present study, we conducted a factorial experiment combining flooding to apical ramets and stolon severing (preventing physiological integration) between apical and basal ramets of Cynodon dactylon, which is a stoloniferous perennial grass with considerable flooding tolerance. Flooding-induced responses including decreased root biomass, accumulation of soluble sugar and starch, as well as increased activity of superoxide dismutase (SOD) and ascorbate peroxidase (APX) in apical ramets. Physiological integration relieved growth inhibition, carbohydrate accumulation and induction of antioxidant enzyme activity in stressed ramets, as expected, without any observable cost in unstressed ramets. We speculate that relief of flooding stress in clonal plants may rely on oxidising power and electron acceptors transferred between ramets through physiological integration. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  7. Evaluation of Diversity Based on Morphological Variabilities and ISSR Molecular Markers in Iranian Cynodon dactylon (L.) Pers. Accessions to Select and Introduce Cold-Tolerant Genotypes.

    Science.gov (United States)

    Akbari, M; Salehi, H; Niazi, A

    2018-04-01

    The main goals of the present study were to screen Iranian common bermudagrasses to find cold-tolerant accessions and evaluate their genetic and morphological variabilities. In this study, 49 accessions were collected from 18 provinces of Iran. One foreign cultivar of common bermudagrass was used as control. Morphological variation was evaluated based on 14 morphological traits to give information about taxonomic position of Iranian common bermudagrass. Data from morphological traits were evaluated to categorize all accessions as either cold sensitive or tolerant using hierarchical clustering with Ward's method in SPSS software. Inter-Simple Sequence Repeat (ISSR) primers were employed to evaluate genetic variability of accessions. The results of our taxonomic investigation support the existence of two varieties of Cynodon dactylon in Iran: var. dactylon (hairless plant) and var. villosous (plant with hairs at leaf underside and/or upper side surfaces or exterior surfaces of sheath). All 15 primers amplified and gave clear and highly reproducible DNA fragments. In total, 152 fragments were produced, of which 144 (94.73%) being polymorphic. The polymorphic information content (PIC) values ranged from 0.700 to 0.928. The average PIC value obtained with 15 ISSR primers was 0.800, which shows that all primers were informative. Probability identity (PI) and discriminating power between all primers ranged from 0.029 to 0.185 and 0.815 to 0.971, respectively. Genetic data were converted into a binary data matrix. NTSYS software was used for data analysis. Clustering was done by the unweighted pair-group method with arithmetic averages and principle coordinate analysis, separated the accessions into six main clusters. According to both morphological and genetic diversity investigations of accessions, they can be clustered into three groups: cold sensitive, cold semi-tolerant, and cold tolerant. The most cold-tolerant accessions were: Taft, Malayear, Gorgan, Safashahr

  8. Protective role of Cynodon dactylon in ameliorating the aluminium-induced neurotoxicity in rat brain regions.

    Science.gov (United States)

    Sumathi, Thangarajan; Shobana, Chandrasekar; Kumari, Balasubramanian Rathina; Nandhini, Devarajulu Nisha

    2011-12-01

    Cynodon dactylon (Poaceae) is a creeping grass used as a traditional ayurvedic medicine in India. Aluminium-induced neurotoxicity is well known and different salts of aluminium have been reported to accelerate damage to biomolecules like lipids, proteins and nucleic acids. The objective of the present study was to investigate whether the aqueous extract of C. dactylon (AECD) could potentially prevent aluminium-induced neurotoxicity in the cerebral cortex, hippocampus and cerebellum of the rat brain. Male albino rats were administered with AlCl(3) at a dose of 4.2 mg/kg/day i.p. for 4 weeks. Experimental rats were given C. dactylon extract in two different doses of 300 mg and 750 mg/keg/day orally 1 h prior to the AlCl(3) administration for 4 weeks. At the end of the experiments, antioxidant status and activities of ATPases in cerebral cortex, hippocampus and cerebellum of rat brain were measured. Aluminium administration significantly decreased the level of GSH and the activities of SOD, GPx, GST, Na(+)/K(+) ATPase, and Mg(2+) ATPase and increased the level of lipid peroxidation (LPO) in all the brain regions when compared with control rats. Pre-treatment with AECD at a dose of 750 mg/kg b.w increased the antioxidant status and activities of membrane-bound enzymes (Na(+)/K(+) ATPase and Mg(2+) ATPase) and also decreased the level of LPO significantly, when compared with aluminium-induced rats. The results of this study indicated that AECD has potential to protect the various brain regions from aluminium-induced neurotoxicity.

  9. Anti-Helicobacter pylori metabolites from Rhizoctonia sp. Cy064, an endophytic fungus in Cynodon dactylon.

    Science.gov (United States)

    Ma, Y M; Li, Y; Liu, J Y; Song, Y C; Tan, R X

    2004-07-01

    A new benzophenone, named rhizoctonic acid (1), together with three known compounds monomethylsulochrin (2), ergosterol (3) and 3beta,5alpha,6beta-trihydroxyergosta-7,22-diene (4) were isolated through bioassay-guided fractionations from the culture of Rhizoctonia sp. (Cy064), an endophytic fungus in the leaf of Cynodon dactylon. The structure of the new acid 1 was elucidated to be 5-hydroxy-2-(2-hydroxy-6-methoxy-4-methylbenzoyl)-3-methoxybenzoic acid by a combination of spectral analyses. Furthermore, the structure of monomethylsulochrin 2 was confirmed by 13C-NMR analysis. All four metabolites were subjected to a more detailed in vitro assessment of their antibacterial action against five clinically isolated and one reference (ATCC 43504) Helicobacter pylori strains.

  10. Protective effects of hydroalcoholic extract from rhizomes of Cynodon dactylon (L.) Pers. on compensated right heart failure in rats.

    Science.gov (United States)

    Garjani, Alireza; Afrooziyan, Arash; Nazemiyeh, Hossein; Najafi, Moslem; Kharazmkia, Ali; Maleki-Dizaji, Nasrin

    2009-08-05

    The rhizomes of Cynodon dactylon are used for the treatment of heart failure in folk medicine. In the present study, we investigated the effects of hydroalcoholic extract of C. dactylon rhizomes on cardiac contractility in normal hearts and on cardiac functions in right-heart failure in rats. Right-heart failure was induced by intraperitoneal injection of monocrotaline (50 mg/kg). Two weeks later, the animals were treated orally with different doses of the extract for fifteen days. At the end of the experiments cardiac functions and markers of myocardial hypertrophy were measured. The treated rats showed very less signs of fatigue, peripheral cyanosis and dyspnea. The survival rate was high in the extract treated groups (90%). Administration of C. dactylon in monocrotaline-injected rats led to profound improvement in cardiac functions as demonstrated by decreased right ventricular end diastolic pressure (RVEDP) and elevated mean arterial pressure. RVdP/dtmax, and RVdP/dt/P as indices of myocardial contractility were also markedly (p < 0.001; using one way ANOVA) increased by the extract. The extract reduced heart and lung congestion by decreasing tissue wet/dry and wet/body weight ratios (p < 0.01). In the isolated rat hearts, the extract produced a remarkable (P < 0.001) positive inotropic effect concomitant with a parallel decrease in LVEDP. The results of this study indicated that C. dactylon exerted a strong protective effect on right heart failure, in part by positive inotropic action and improving cardiac functions.

  11. [Growth analysis on modules of Cynodon dactylon clones in Yili River Valley Plain of Xinjiang].

    Science.gov (United States)

    Zhao, Yu; Janar; Li, Hai-Yan; Liu, Ying; Yang, Yun-Fei

    2009-04-01

    By the method of randomly digging up whole ramet tuft while maintaining natural integrity, large samples of Cynodon dactylon clones were collected from a grape orchard abandoned for 2 years without any management in the Yili River Valley Plain of Xinjiang, aimed to quantitatively analyze the growth patterns of their modules. The results showed that the average ramet number of test 30 clones reached 272.6 +/- 186. 6, among which, vegetative ramets occupied 82.3%, being 4.3 times higher than reproductive ones. The total biomass of the clones was 45.4 +/- 40.0 g, in which, rhizomes accounted for 54.4%, while the vegetative ramets, stolons, and reproductive ramets occupied 21.0%, 14.8%, and 9.4% of the total, respectively. The accumulative length of rhizomes and stolons reached 5.1 + 4.7 m and 3.3 +/- 3.4 m, while the bud number on stolons and rhizomes was 291.5 +/- 246.8 and 78.8 +/- 87.4, respectively. The bud number on stolons and rhizomes was positively correlated to the quantitative characters of vegetative ramets, reproductive ramets, stolons, and rhizomes (P < 0.01), indicating that in Yili River Valley Plain, C. dactylon clone could achieve and maintain its continuous renovation via rhizome buds.

  12. Genotypic and phenotypic evaluation of off-type grasses in hybrid bermudagrass (Cynodon dactylon (L.) Pers. x C. transvaalensis burtt-Davy) putting greens using genotyping-by-sequencing and morphological characterization

    Science.gov (United States)

    Interspecific hybrid bermudagrass (Cynodon dactylon (L.) Pers. x C. transvaalensis Burtt-Davy) is one of the most widely used grasses on golf courses, with cultivars derived from ‘Tifgreen’ or ‘Tifdwarf’ particularly used for putting greens in the southern agronomic region. Many bermudagrass cultiv...

  13. What is Cynodon radiatus Roth ex R. & S. (Poaceae)?

    NARCIS (Netherlands)

    Nowack, R.

    1992-01-01

    Roemer and Schultes (1817) described Cynodon radiatus, basing themselves on a manuscript by A.W. Roth, copying Roth's brief diagnosis and comment. It was compared to Cynodon dactylon, differing by its larger habit, the number and direction of the spikes, and the glabrous blades and sheaths. This was

  14. Lead, zinc and copper accumulation and tolerance in populations of Paspalum distichum and Cynodon dactylon

    International Nuclear Information System (INIS)

    Shu, W.S.; Ye, Z.H.; Lan, C.Y.; Zhang, Z.Q.; Wong, M.H.

    2002-01-01

    Metal-tolerant populations of the plants Paspalum distichum and Cunodon dactylon were identified. - Both Fankou and Lechang lead/zinc (Pb/Zn) mine tailings located at Guangdong Province contained high levels of total and DTPA-extractable Pb, Zn and Cu. Paspalum distichum and Cynodon dactylon were dominant species colonized naturally on the tailings. Lead, zinc and copper accumulation and tolerance of different populations of the two grasses growing on the tailings were investigated. Tillers of these populations including those from an uncontaminated area were subjected to the following concentrations: 5, 10, 20, 30 and 40 mg l -1 Pb, 2.5, 5, 10, 20 and 30 mg l -1 Zn, or 0.25, 0.50, 1 and 2 mg l -1 Cu for 14 days, respectively, then tolerance index (TI) and EC 50 (the concentrations of metals in solutions which reduce 50% of normal root growth) were calculated. The results indicated that both Lechang and Fankou populations of the two grasses showed a greater tolerance to the three metals than those growing on the uncontaminated area, which suggested that co-tolerant ecotypes have evolved in the two grasses. P. distichum collected from Fankou tailings had the highest tolerance to Cu while Lechang population the highest tolerance to Pb and Zn among the tested populations, and tolerance levels in P. distichum were related to metal concentrations in the plants. P. distichum had a better growth performance than C. dactylon when both of them were grown on the tailings sites. Tolerant populations of these species would serve as potential candidates for re-vegetation of wastelands contaminated with Pb, Zn and Cu

  15. Lead, zinc and copper accumulation and tolerance in populations of Paspalum distichum and Cynodon dactylon

    Energy Technology Data Exchange (ETDEWEB)

    Shu, W.S.; Ye, Z.H.; Lan, C.Y.; Zhang, Z.Q.; Wong, M.H

    2002-12-01

    Metal-tolerant populations of the plants Paspalum distichum and Cunodon dactylon were identified. - Both Fankou and Lechang lead/zinc (Pb/Zn) mine tailings located at Guangdong Province contained high levels of total and DTPA-extractable Pb, Zn and Cu. Paspalum distichum and Cynodon dactylon were dominant species colonized naturally on the tailings. Lead, zinc and copper accumulation and tolerance of different populations of the two grasses growing on the tailings were investigated. Tillers of these populations including those from an uncontaminated area were subjected to the following concentrations: 5, 10, 20, 30 and 40 mg l{sup -1} Pb, 2.5, 5, 10, 20 and 30 mg l{sup -1} Zn, or 0.25, 0.50, 1 and 2 mg l{sup -1} Cu for 14 days, respectively, then tolerance index (TI) and EC{sub 50} (the concentrations of metals in solutions which reduce 50% of normal root growth) were calculated. The results indicated that both Lechang and Fankou populations of the two grasses showed a greater tolerance to the three metals than those growing on the uncontaminated area, which suggested that co-tolerant ecotypes have evolved in the two grasses. P. distichum collected from Fankou tailings had the highest tolerance to Cu while Lechang population the highest tolerance to Pb and Zn among the tested populations, and tolerance levels in P. distichum were related to metal concentrations in the plants. P. distichum had a better growth performance than C. dactylon when both of them were grown on the tailings sites. Tolerant populations of these species would serve as potential candidates for re-vegetation of wastelands contaminated with Pb, Zn and Cu.

  16. Phylogenetic analysis reveals multiple introductions of Cynodon species in Australia.

    Science.gov (United States)

    Jewell, M; Frère, C H; Harris-Shultz, K; Anderson, W F; Godwin, I D; Lambrides, C J

    2012-11-01

    The distinction between native and introduced flora within isolated land masses presents unique challenges. The geological and colonisation history of Australia, the world's largest island, makes it a valuable system for studying species endemism, introduction, and phylogeny. Using this strategy we investigated Australian cosmopolitan grasses belonging to the genus Cynodon. While it is believed that seven species of Cynodon are present in Australia, no genetic analyses have investigated the origin, diversity and phylogenetic history of Cynodon within Australia. To address this gap, 147 samples (92 from across Australia and 55 representing global distribution) were sequenced for a total of 3336bp of chloroplast DNA spanning six genes. Data showed the presence of at least six putatively introduced Cynodon species (C. transvaalensis, C. incompletus, C. hirsutus, C. radiatus, C. plectostachyus and C. dactylon) in Australia and suggested multiple recent introductions. C. plectostachyus, a species often confused with C. nlemfuensis, was not previously considered to be present in Australia. Most significantly, we identified two common haplotypes that formed a monophyletic clade diverging from previously identified Cynodon species. We hypothesise that these two haplotypes may represent a previously undescribed species of Cynodon. We provide further evidence that two Australian native species, Brachyachne tenella and B. convergens belong in the genus Cynodon and, therefore, argue for the taxonomic revision of the genus Cynodon. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Radiomodulatory potential of hydroalcoholic extract of a medicinal plant Cynodon dactylon (Family: Poaceae), against radiation-induced cytogenetic damage

    International Nuclear Information System (INIS)

    Satish Rao, B.S.; Upadhya, D.; Adiga, S.K.

    2007-01-01

    The exposure of humans to ionizing radiations may be advertently by routine diagnostic and therapeutic purposes or inadvertently during natural, occupational and nuclear accident situations. Therefore, in order to overcome the deleterious biological effects of radiation several chemical agents have been studied for their radioprotective potential. The medicinal plants being one of the resources for such clinically important natural agents, used extensively in several drug discovery related research. Here the radiomodulatory potential of hydroalcoholic extract of a medicinal plant Cynodon dactylon (Family: Poaceae), against radiation-induced cytogenetic damage was analyzed using Chinese hamster fibroblast cells (V79) and human peripheral blood lymphocytes (HPBLs) growing in vitro is reported

  18. Role of sodium ion transporters and osmotic adjustments in stress alleviation of Cynodon dactylon under NaCl treatment: a parallel investigation with rice.

    Science.gov (United States)

    Roy, Swarnendu; Chakraborty, Usha

    2018-01-01

    Comparative analyses of the responses to NaCl in Cynodon dactylon and a sensitive crop species like rice could effectively unravel the salt tolerance mechanism in the former. C. dactylon, a wild perennial chloridoid grass having a wide range of ecological distribution is generally adaptable to varying degrees of salinity stress. The role of salt exclusion mechanism present exclusively in the wild grass was one of the major factors contributing to its tolerance. Salt exclusion was found to be induced at 4 days when the plants were treated with a minimum conc. of 200 mM NaCl. The structural peculiarities of the salt exuding glands were elucidated by the SEM and TEM studies, which clearly revealed the presence of a bicellular salt gland actively functioning under NaCl stress to remove the excess amount of Na + ion from the mesophyll tissues. Moreover, the intracellular effect of NaCl on the photosynthetic apparatus was found to be lower in C. dactylon in comparison to rice; at the same time, the vacuolization process increased in the former. Accumulation of osmolytes like proline and glycine betaine also increased significantly in C. dactylon with a concurrent check on the H 2 O 2 levels, electrolyte leakage and membrane lipid peroxidation. This accounted for the proper functioning of the Na + ion transporters in the salt glands and also in the vacuoles for the exudation and loading of excess salts, respectively, to maintain the osmotic balance of the protoplasm. In real-time PCR analyses, CdSOS1 expression was found to increase by 2.5- and 5-fold, respectively, and CdNHX expression increased by 1.5- and 2-fold, respectively, in plants subjected to 100 and 200 mM NaCl treatment for 72 h. Thus, the comparative analyses of the expression pattern of the plasma membrane and tonoplast Na + ion transporters, SOS1 and NHX in both the plants revealed the significant role of these two ion transporters in conferring salinity tolerance in Cynodon.

  19. Antidiabetic activity of aqueous extract and non polysaccharide fraction of Cynodon dactylon Pers.

    Science.gov (United States)

    Jarald, E E; Joshi, S B; Jain, D C

    2008-09-01

    Petroleum ether (60 degrees-80 degrees C), chloroform, acetone, ethanol, aqueous and crude hot water extracts of the whole plant of C. dactylon and the two fractions of aqueous extract were tested for antihyperglycaemic activity in glucose overloaded hyperglycemic rats and in alloxan induced diabetic model at two-dose levels, 200 and 400 mg/kg (po) respectively. The aqueous extract of C. dactylon and the non polysaccharide fraction of aqueous extract were found to exhibit significant antihyperglycaemic activity and only the non polysaccharide fraction was found to produce hypoglycemia in fasted normal rats. Treatment of diabetic rats with aqueous extract and non polysaccharide fraction of the plant decreased the elevated biochemical parameters, glucose, urea, creatinine, serum cholesterol, serum triglyceride, high density lipoprotein, low density lipoprotein, haemoglobin and glycosylated haemoglobin significantly. Comparatively, the non polysaccharide fraction of aqueous extract was found to be more effective than the aqueous extract.

  20. Dietary supplementation with Cynodon dactylon (L.) enhances innate immunity and disease resistance of Indian major carp, Catla catla (Ham.).

    Science.gov (United States)

    Kaleeswaran, B; Ilavenil, S; Ravikumar, S

    2011-12-01

    Indian major carp (Catla catla) was subjected to study the immunostimulatory effects when the grass Cynodon dactylon(L) ethanolic extract administrated as feed supplement. C. catla was fed with 0% (Control), 0.05% (group I), 0.5% (group II) and 5% (group III) extract provided for 60 days. Blood samples were collected at every 10 days of interval up to 60 days for analyzing the non-specific humoral (lysozyme activity, antiprotease activity and haemolytic complement) and cellular (production of reactive oxygen and nitrogen species, myeloperoxidase activity) immune response study. The results indicate that C. dactylon ethanolic extract administered as feed supplement significantly (P < 0.05) enhanced most of the non-specific immune parameters tested. Among the experimental diet groups, significantly increased response of non-specific immunity was seen in group III (5%). Disease resistant analysis against Aeromonas hydrophila was performed in control group and plant extract treated fish for 7, 14, 21 and 28 days. Relative percent survival rate (RPS) was observed in treated samples, which is directly proportional to concentration of the extract. Additionally, electron microscopic studies and gelatin zymography for Matrix Metalo Proteinase (MMPs) were examined in spleen at 7th and 28th days of feeding. Administration of C. dactylon mixed diet delayed the lymphocyte destruction with positive ultrastructural changes. An induced stress (A. hydrophila infection) was observed by using MMPs expression, which was reduced in the experimental diet groups than the control. All these experimental results prove that C. dactylon ethanolic extract enhances the immunity of Catla fish. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Differential metabolic responses of perennial grass Cynodon transvaalensis×Cynodon dactylon (C₄) and Poa Pratensis (C₃) to heat stress.

    Science.gov (United States)

    Du, Hongmei; Wang, Zhaolong; Yu, Wenjuan; Liu, Yimin; Huang, Bingru

    2011-03-01

    Differential metabolic responses to heat stress may be associated with variations in heat tolerance between cool-season (C₃) and warm-season (C₄) perennial grass species. The main objective of this study was to identify metabolites associated with differential heat tolerance between C₄ bermudagrass and C₃ Kentucky bluegrass by performing metabolite profile analysis using gas chromatography-mass spectrometry. Plants of Kentucky bluegrass (Poa Pratensis'Midnight') and hybrid bermudagrass (Cynodon transvaalensis x Cynodon dactylon'Tifdwarf') were grown under optimum temperature conditions (20/15 °C for Kentucky bluegrass and 30/25 °C for bermudagrass) or heat stress (35/30 °C for Kentucky bluegrass and 45/40 °C for bermudagrass). Physiological responses to heat stress were evaluated by visual rating of grass quality, measuring photochemical efficiency (variable fluorescence to maximal fluorescence) and electrolyte leakage. All of these parameters indicated that bermudagrass exhibited better heat tolerance than Kentucky bluegrass. The metabolite analysis of leaf polar extracts revealed 36 heat-responsive metabolites identified in both grass species, mainly consisting of organic acids, amino acids, sugars and sugar alcohols. Most metabolites showed higher accumulation in bermudagrass compared with Kentucky bluegrass, especially following long-term (18 days) heat stress. The differentially accumulated metabolites included seven sugars (sucrose, fructose, galactose, floridoside, melibiose, maltose and xylose), a sugar alcohol (inositol), six organic acids (malic acid, citric acid, threonic acid, galacturonic acid, isocitric acid and methyl malonic acid) and nine amino acids (Asn, Ala, Val, Thr, γ-aminobutyric acid, IIe, Gly, Lys and Met). The differential accumulation of those metabolites could be associated with the differential heat tolerance between C₃ Kentucky bluegrass and C₄ bermudagrass. Copyright © Physiologia Plantarum 2010.

  2. Monoclonal antibody-based ELISA to quantify the major allergen of Cynodon dactylon (Bermuda grass) pollen, Cyn d 1.

    Science.gov (United States)

    Duffort, O; Calabozo, B; González, R; Carpizo, J A; Barber, D; Polo, F

    2004-12-01

    Pollen of Bermuda grass (Cynodon dactylon) is an important cause of pollinosis in many areas of the world. Most patients show sensitivity to the major allergen Cyn d 1, a glycoprotein composed of a number of isoforms with a molecular mass of 31-32 kDa. The aim of this work was to develop a monoclonal antibody (mAb)-based ELISA to quantify Cyn d 1, and to assess the correlation of the allergen content with the biological activity of C. dactylon pollen extracts. After fusion of myeloma cells with spleen cells from a BALB/c mouse immunized with C. dactylon pollen extract, Cyn d 1-specific mAbs secreting hybridomas were selected, and the antibodies characterized. One of them (4.4.1) was used as the capture antibody in an ELISA method for Cyn d 1 quantitation. An anti-Cyn d 1 rabbit serum was used as the second antibody. Cyn d 1 was purified by immunoaffinity chromatography with mAb 4.4.1, characterized, and used as the standard in the assay. The identity, purity and isoallergen composition of affinity-purified Cyn d 1 was confirmed by N-terminal amino acid sequencing, SDS-PAGE, Western blot and 2D electrophoresis. The Cyn d 1 ELISA is highly specific and sensitive, with a detection limit of 0.24 ng/ml and a linear range of 1.1-9.2 ng/ml. An excellent correlation was found when the content of Cyn d 1, measured in 16 different extracts, was compared with the allergenic activity of the same extracts determined by RAST inhibition. The results prove the usefulness of the Cyn d 1 ELISA for the standardization of C. dactylon-allergen products on the basis of major allergen content. 2004 S. Karger AG, Basel.

  3. Ruminal production of methane ''in vitro'' with Coast Cross No. 1 bermuda grass (Cynodon dactylon)

    Energy Technology Data Exchange (ETDEWEB)

    Geerken, C M; Funes, F; Gonzalez, R

    1980-11-01

    1. Samples of Coast Cross No. 1 bermuda grass (Cynodon dactylon) of 3, 6, 9, 12 and 15 days of cut, irrigated and fertilized at a rate of 400 kg N/ha/year, were used to determine their bromatological composition, digestibility and methane production ''in vitro''. 2. Crude protein concentration of the pasture fell sharply from 20 to 4% and crude fibre increased from 26 to 34% as the pasture grew older. DM digestibility decreased from 58 to 44% from the 6th to the 15th week of cut. Methane production ''in vitro'' was significantly lower (P is less than 0,01), at 3 and 6 weeks, than that obtained at older ages. The differences were more marked when calculated per unit of digested DM. 3. These results could be of interest in the search of a better utilization of dietary energy for grazing animals. (Refs. 16).

  4. Depleted Uranium Toxicity, Accumulation, and Uptake in Cynodon dactylon (Bermuda) and Aristida purpurea (Purple Threeawn).

    Science.gov (United States)

    Butler, Afrachanna D; Wynter, Michelle; Medina, Victor F; Bednar, Anthony J

    2016-06-01

    Yuma Proving Grounds (YPG) in western Arizona is a testing range where Depleted uranium (DU) penetrators have been historically fired. A portion of the fired DU penetrators are being managed under controlled conditions by leaving them in place. The widespread use of DU in armor-penetrating weapons has raised environmental and human health concerns. The present study is focused on the onsite management approach and on the potential interactions with plants local to YPG. A 30 day study was conducted to assess the toxicity of DU corrosion products (e.g., schoepite and meta-schoepite) in two grass species that are native to YPG, Bermuda (Cynodon dactylon) and Purple Threeawn (Aristida purpurea). In addition, the ability for plants to uptake DU was studied. The results of this study show a much lower threshold for biomass toxicity and higher plant concentrations, particularly in the roots than shoots, compared to previous studies.

  5. [Responses of Cynodon dactylon population in hydro-fluctuation belt of Three Gorges Reservoir area to flooding-drying habitat change].

    Science.gov (United States)

    Hong, Ming; Guo, Quan-Shu; Nie, Bi-Hong; Kang, Yi; Pei, Shun-Xiang; Jin, Jiang-Qun; Wang, Xiang-Fu

    2011-11-01

    This paper studied the population density, morphological characteristics, and biomass and its allocation of Cynodon dactylon at different altitudinal sections of the hydro-fluctuation belt in Three Gorges Reservoir area, based on located observations. At the three altitudinal sections, the population density of C. dactylon was in the order of shallow water section (165-170 m elevation) > non-flooded section (above 172 m elevation) > deep water section (145-150 m elevation), the root diameter and root length were in the order of deep water section > shallow water section > non-flooded section, the total biomass, root biomass, stem biomass, leaf biomass, and stem biomass allocation ratio were in the order of the shallow water section > non-flooded section > deep water section, and the root biomass allocation ratio, leaf biomass allocation ratio, and underground biomass/aboveground biomass were in the order of deep water section > shallow water section > non-flooded section. The unique adaption strategies of C. dactylon to the flooding-drying habitat change in the shallow water section were the accelerated elongation growth and the increased stem biomass allocation, those in the deep water section were the increased node number of primary and secondary branches, increased number of the branches, and increased leaf biomass allocation, whereas the common strategies in the shallow and deep water sections were the accelerated root growth and the increased tillering and underground biomass allocation for preparing nutrition and energy for the rapid growth in terrestrial environment.

  6. Mosquitocidal and water purification properties of Cynodon dactylon, Aloe vera, Hemidesmus indicus and Coleus amboinicus leaf extracts against the mosquito vectors.

    Science.gov (United States)

    Arjunan, Nareshkumar; Murugan, Kadarkarai; Madhiyazhagan, Pari; Kovendan, Kalimuthu; Prasannakumar, Kanagarajan; Thangamani, Sundaram; Barnard, Donald R

    2012-04-01

    Ethanolic extracts of Cynodon dactylon, Aloe vera, Hemidesmus indicus and Coleus amboinicus were tested for their toxicity effect on the third-instar larvae of Anopheles stephensi, Culex quinquefasciatus and Aedes aegypti. The leaves of C. dactylon, A. vera, H. indicus and C. amboinicus were collected from natural habitats (forests) in Western Ghats, Tamil Nadu, India. A total of 250 g of fresh, mature leaves were rinsed with distilled water and dried in shade. The dried leaves were put in Soxhlet apparatus and extract prepared using 100% ethanol for 72 h at 30-40°C. Dried residues were obtained from 100 g of extract evaporated to dryness in rotary vacuum evaporator. Larvicidal properties of ethanolic leaf extracts showed that the extracts are effective as mosquito control agents. The larval mortality was observed after 24 h exposure. No mortality was observed in the control. The median lethal concentration (LC(50)) values observed for the larvicidal activities are 0.44%, 0.51%, 0.59% and 0.68% for extracts of C. dactylon, A. vera, H. indicus and C. amboinicus, respectively. The observed mortality were statistically significant at P < 0.05 level. C. dactylon showed the highest mortality rate against the three species of mosquito larvae in laboratory and field. The selected plants were shown to exhibit water purification properties. Water quality parameters such as turbidity, pH and water clarity were analyzed in the water samples (pre-treatment and post-treatment of plant extracts) taken from the different breeding sites of mosquitoes. Water colour, turbidity and pH were reduced significantly after treatment with C. dactylon (13 HU, 31.5 mg/l and 6.9), H. indicus (13.8 HU, 33 mg/l and 7.1), A. vera (16 HU, 33.8 mg/l and 7.4) and C. amboinicus (21 HU, 35 mg/l and 7.5) extracts. The study proved that the extracts of C. dactylon, A. vera, H. indicus and C. amboinicus have both mosquitocidal and water sedimentation properties.

  7. Angiogenic effect of the aqueous extract of Cynodon dactylon on human umbilical vein endothelial cells and granulation tissue in rat.

    Science.gov (United States)

    Soraya, Hamid; Moloudizargari, Milad; Aghajanshakeri, Shahin; Javaherypour, Soheil; Mokarizadeh, Aram; Hamedeyazdan, Sanaz; Esmaeli Gouvarchin Ghaleh, Hadi; Mikaili, Peyman; Garjani, Alireza

    2015-01-29

    Cynodon dactylon, a valuable medicinal plant, is widely used in Iranian folk medicine for the treatment of various cardiovascular diseases such as heart failure and atherosclerosis. Moreover, its anti-diabetic, anti-cancer and anti-microbial properties have been also reported. Concerning the critical role of angiogenesis in the incidence and progression of tumors and also its protective role in cardiovascular diseases, we investigated the effects of the aqueous extract prepared from the rhizomes of C. dactylon on vascular endothelial growth factor (VEGF) expressions in Human Umbilical Vein Endothelial Cells (HUVECs) and also on angiogenesis in carrageenan induced air-pouch model in rats. In the air-pouch model, carrageenan was injected into an air-pouch on the back of the rats and following an IV injection of carmine red dye on day 6, granulation tissue was processed for the assessment of the dye content. Furthermore, in an in vitro study, angiogenic property of the extract was assessed through its effect on VEGF expression in HUVECs. Oral administration of 400 mg/kg/day of the extract significantly increased angiogenesis (p<0.05) and markedly decreased neutrophil (p<0.05) and total leukocyte infiltration (p<0.001) into the granulation tissues. Moreover, the extract increased the expression of total VEGF in HUVECs at a concentration of (100 μl/ml). The present study showed that the aqueous extract of C. dactylon promotes angiogenesis probably through stimulating VEGF expression.

  8. Development of highly regenerable callus lines and biolistic transformation of turf-type common bermudagrass [Cynodon dactylon (L.) Pers.].

    Science.gov (United States)

    Li, L; Qu, R

    2004-01-01

    Common bermudagrass, Cynodon dactylon, is a widely used warm-season turf and forage species in the temperate and tropical regions of the world. Improvement of bermudagrass via biotechnology depends on improved tissue culture responses, especially in plant regeneration, and a successful scheme to introduce useful transgenes. When the concentration of 6-benzylaminopurine was adjusted in the culture medium, yellowish, compact calluses were observed from young inflorescence tissue culture of var. J1224. Nine long-term, highly regenerable callus lines (including a suspension-cultured line) were subsequently established, of which six were used for biolistic transformation. Five independent transgenic events, with four producing green plants, were obtained following hygromycin B selection from one callus line. Three transgenic events displayed resistance to the herbicide glufosinate, and one of these showed beta-glucuronidase activity since the co-transformation vector used in the experiments contained both the gusA and bar genes.

  9. Contrasting Changes Caused by Drought and Submergence Stresses in Bermudagrass (Cynodon dactylon)

    Science.gov (United States)

    Ye, Tiantian; Shi, Haitao; Wang, Yanping; Chan, Zhulong

    2015-01-01

    In this study, we investigated the mechanisms by which bermudagrass withstands the drought and submergence stresses through physiological, proteomic and metabolomic approaches. The results showed that significant physiological changes were observed after drought treatment, while only slight changes after submergence treatment, including compatible solute contents, ROS levels and antioxidant enzyme activities. Proteomics results showed that 81 proteins regulated by drought or submergence treatment were identified by MALDI-TOF-MS. Among them, 76 proteins were modulated by drought stress with 46 increased abundance and 30 decreased abundance. Forty-five showed abundance changes after submergence treatment with 10 increased and 35 decreased. Pathway enrichment analysis revealed that pathways of amino acid metabolism and mitochondrial electron transport/ATP synthesis were only enriched by drought treatment, while other pathways including photosynthesis, biodegradation of xenobiotics, oxidative pentose phosphate, glycolysis and redox were commonly over-represented after both drought and submergence treatments. Metabolomic analysis indicated that most of the metabolites were up-regulated by drought stress, while 34 of 40 metabolites contents exhibited down-regulation or no significant changes when exposed to submergence stress, including sugars and sugar alcohols. These data indicated that drought stress extensively promoted photosynthesis and redox metabolisms while submergence stress caused declined metabolisms and dormancy in Cynodon dactylon. Taken together, the quiescence strategy with retarded growth might allow bermudagrass to be adaptive to long-term submerged environment, while activation of photosynthesis and redox, and accumulation of compatible solutes and molecular chaperones increased bermudagrass tolerance to drought stress. PMID:26617615

  10. Analysis of natural variation in bermudagrass (Cynodon dactylon) reveals physiological responses underlying drought tolerance.

    Science.gov (United States)

    Shi, Haitao; Wang, Yanping; Cheng, Zhangmin; Ye, Tiantian; Chan, Zhulong

    2012-01-01

    Bermudagrass (Cynodon dactylon) is a widely used warm-season turfgrass and one of the most drought tolerant species. Dissecting the natural variation in drought tolerance and physiological responses will bring us powerful basis and novel insight for plant breeding. In the present study, we evaluated the natural variation of drought tolerance among nine bermudagrass varieties by measuring physiological responses after drought stress treatment through withholding water. Three groups differing in drought tolerance were identified, including two tolerant, five moderately tolerant and two susceptible varieties. Under drought stress condition, drought sensitive variety (Yukon) showed relative higher water loss, more severe cell membrane damage (EL), and more accumulation of hydrogen peroxide (H₂O₂) and malondialdehyde (MDA), while drought tolerant variety (Tifgreen) exhibited significantly higher antioxidant enzymes activities. Further results indicated that drought induced cell injury in different varieties (Yukon, SR9554 and Tifgreen) exhibited liner correlation with leaf water content (LWC), H₂O₂ content, MDA content and antioxidant enzyme activities. Additionally, Tifgreen plants had significantly higher levels of osmolytes (proline level and soluble sugars) when compared with Yukon and SR9554 under drought stress condition. Taken together, our results indicated that natural variation of drought stress tolerance in bermudagrass varieties might be largely related to the induced changes of water status, osmolyte accumulation and antioxidant defense system.

  11. Comportamiento de céspedes de Cynodon dactylon (L. Pers. en Paraná, Entre Ríos, Argentina

    Directory of Open Access Journals (Sweden)

    María I. Laurencena

    2009-01-01

    Full Text Available En zonas subtropicales o templadas cálidas las gramíneas estivales constituyen la base del césped pero presentan dormancia durante el invierno. Por ello es importante el conocimiento de céspedes con períodos de emergencia a implantación y vegetativo inactivo cortos, de textura fina, buen color, buen comportamiento sanitario y respuesta a fertilización. El objetivo de este trabajo fue evaluar el comportamiento en el Departamento Paraná (Entre Ríos, Argentina de céspedes de Cynodon dactylon (bermuda comercializados para uso ornamental y deportivo. Se evaluaron cobertura, textura, color, dormancia, rebrote y respuesta a fertilización en un ensayo en dos tratamientos: con y sin drenaje, con cuatro repeticiones. El diseño experimental fue de parcelas apareadas y las mediciones se realizaron desde marzo de 2005 a noviembre de 2006. No hubo diferencias entre las bermudas evaluadas y todas presentaron alta cobertura, textura fina, color verde medio, dormancia con bajas temperaturas y buena respuesta a la fertilización.

  12. Synthesis and characterization of silver nanoparticles using Cynodon dactylon leaves and assessment of their antibacterial activity.

    Science.gov (United States)

    Sahu, Nidhi; Soni, Deepika; Chandrashekhar, B; Sarangi, Bijaya Ketan; Satpute, Devanand; Pandey, Ram Avatar

    2013-07-01

    Many methods of synthesizing silver nanoparticles (Ag-NPs) by reducing Ag⁺ ions using aqueous/organic extracts of various plants have been reported in the past, but the methods are rather slow. In this investigation, silver nanoparticles were quickly synthesized from aqueous silver nitrate through a simple method using leaf extract of a plant--Cynodon dactylon which served as reducing agent, while sunlight acted as a catalyst. The formation of Ag-NPs was indicated by gradual change in colour and pH and confirmed by ultraviolet--visible spectroscopy. The Ag-NPs showed a surface plasmon resonance at 451 nm. Based on the decrease in pH, a possible mechanism of the synthesis of Ag-NPs involving hydroxyl (OH⁻) ions of polyphenols of the leaf extract is postulated. Ag-NPs having (111) and (200) crystal lattices were confirmed by X-ray diffraction. Scanning electron microscopy revealed the spherical nature of the Ag-NPs, while transmission electron microscopy showed that the nanoparticles were polydispersed with a size range of 8-10 nm. The synthesized Ag-NPs also demonstrated their antibacterial activity against Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus and Salmonella typhimurium.

  13. Analysis of Natural Variation in Bermudagrass (Cynodon dactylon) Reveals Physiological Responses Underlying Drought Tolerance

    Science.gov (United States)

    Cheng, Zhangmin; Ye, Tiantian; Chan, Zhulong

    2012-01-01

    Bermudagrass (Cynodon dactylon) is a widely used warm-season turfgrass and one of the most drought tolerant species. Dissecting the natural variation in drought tolerance and physiological responses will bring us powerful basis and novel insight for plant breeding. In the present study, we evaluated the natural variation of drought tolerance among nine bermudagrass varieties by measuring physiological responses after drought stress treatment through withholding water. Three groups differing in drought tolerance were identified, including two tolerant, five moderately tolerant and two susceptible varieties. Under drought stress condition, drought sensitive variety (Yukon) showed relative higher water loss, more severe cell membrane damage (EL), and more accumulation of hydrogen peroxide (H2O2) and malondialdehyde (MDA), while drought tolerant variety (Tifgreen) exhibited significantly higher antioxidant enzymes activities. Further results indicated that drought induced cell injury in different varieties (Yukon, SR9554 and Tifgreen) exhibited liner correlation with leaf water content (LWC), H2O2 content, MDA content and antioxidant enzyme activities. Additionally, Tifgreen plants had significantly higher levels of osmolytes (proline level and soluble sugars) when compared with Yukon and SR9554 under drought stress condition. Taken together, our results indicated that natural variation of drought stress tolerance in bermudagrass varieties might be largely related to the induced changes of water status, osmolyte accumulation and antioxidant defense system. PMID:23285294

  14. Secondary metabolites of Cynodon dactylon as an antagonist to angiotensin II type1 receptor: Novel in silico drug targeting approach for diabetic retinopathy

    Science.gov (United States)

    Jananie, R. K.; Priya, V.; Vijayalakshmi, K.

    2012-01-01

    Objectives: To study the ability of the secondary metabolites of Cynodon dactylon to serve as an antagonist to angiotensin II type 1 receptor (AT1); activation of this receptor plays a vital role in diabetic retinopathy (DR). Materials and Methods: In silico methods are mainly harnessed to reduce time, cost and risk associated with drug discovery. Twenty-four compounds were identified as the secondary metabolites of hydroalcoholic extract of C. dactylon using the GCMS technique. These were considered as the ligands or inhibitors that would serve as an antagonist to the AT1. The ACD/Chemsketch tool was used to generate 3D structures of the ligands. A molecular file format converter tool was used to convert the generated data to the PDB format (Protein Data Bank) and was used for docking studies. The AT1 structure was retrieved from the Swissprot data base and PDB and visualized using the Rasmol tool. Domain analysis was carried from the Pfam data base; following this, the active site of the target protein was identified using a Q-site finder tool. The ability of the ligands to bind with the active site of AT1 was studied using the Autodocking tool. The docking results were analyzed using the WebLab viewer tool. Results: Sixteen ligands showed effective binding with the target protein; diazoprogesteron, didodecyl phthalate, and 9,12-octadecadienoyl chloride (z,z) may be considered as compounds that could be used to bind with the active site sequence of AT1. Conclusions: The present study shows that the metabolites of C. dactylon could serve as a natural antagonist to AT1 that could be used to treat diabetic retinopathy. PMID:22368412

  15. Anatomical adaptations of cynodon dactylon (l.) pers., from the salt range Pakistan, to salinity stress. I. root and stem anatomy

    International Nuclear Information System (INIS)

    Hameed, M.; Ashraf, M.; Naz, N.; Al-qurainy, F.

    2010-01-01

    A naturally adapted salt tolerant population of Cynodon dactylon (L.) Pers., from highly saline soils of Uchhali Lake, the Salt Range, Pakistan was evaluated for root and stem anatomical modifications. A population from the normal (non-saline) soils of the Faisalabad region was also collected for comparison. Both populations were subjected to salt stress hydroponically. The salt treatments used were: control (0 mM salt), 50, 100, 150 and 200 mM NaCl in 0.5 strength Hoagland's nutrient solution. The Salt Range population showed specific root and stem anatomical adaptations for its better survival under harsh saline environments. Increased exodermis and sclerenchyma, endodermis, cortex and pith parenchyma in roots were critical for checking water loss and enhancing water storage capability. In stem, increased stem area (succulence), increased epidermis and sclerenchyma thicknesses (preventing water loss), increased cortex thickness (increasing water storage), and increased number and area of vascular tissue (increased water conduction) seemed to be crucial for its better survival under harsh saline environments. (author)

  16. Comparative proteomic responses of two bermudagrass (Cynodon dactylon (L). Pers.) varieties contrasting in drought stress resistance.

    Science.gov (United States)

    Shi, Haitao; Ye, Tiantian; Chan, Zhulong

    2014-09-01

    Drought (water-deficit) stress is a serious environmental problem in plant growth and cultivation. As one of widely cultivated warm-season turfgrass, bermudagrass (Cynodon dactylon (L). Pers.) exhibits drastic natural variation in the drought stress resistance in leaves and stems of different varieties. In this study, proteomic analysis was performed to identify drought-responsive proteins in both leaves and stems of two bermudagrass varieties contrasting in drought stress resistance, including drought sensitive variety (Yukon) and drought tolerant variety (Tifgreen). Through comparative proteomic analysis, 39 proteins with significantly changed abundance were identified, including 3 commonly increased and 2 decreased proteins by drought stress in leaves and stems of Yukon and Tifgreen varieties, 2 differentially regulated proteins in leaves and stems of two varieties after drought treatment, 23 proteins increased by drought stress in Yukon variety and constitutively expressed in Tifgreen variety, and other 3 differentially expressed proteins under control and drought stress conditions. Among them, proteins involved in photosynthesis (PS), glycolysis, N-metabolism, tricarboxylicacid (TCA) and redox pathways were largely enriched, which might be contributed to the natural variation of drought resistance between Yukon and Tifgreen varieties. These studies provide new insights to understand the molecular mechanism underlying bermudagrass response to drought stress. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  17. A transcriptomic analysis of bermudagrass (Cynodon dactylon) provides novel insights into the basis of low temperature tolerance.

    Science.gov (United States)

    Chen, Liang; Fan, Jibiao; Hu, Longxing; Hu, Zhengrong; Xie, Yan; Zhang, Yingzi; Lou, Yanhong; Nevo, Eviatar; Fu, Jinmin

    2015-09-11

    Cold stress is regarded as a key factor limiting widespread use for bermudagrass (Cynodon dactylon). Therefore, to improve cold tolerance for bermudagrass, it is urgent to understand molecular mechanisms of bermudagrass response to cold stress. However, our knowledge about the molecular responses of this species to cold stress is largely unknown. The objective of this study was to characterize the transcriptomic response to low temperature in bermudagrass by using RNA-Seq platform. Ten cDNA libraries were generated from RNA samples of leaves from five different treatments in the cold-resistant (R) and the cold-sensitive (S) genotypes, including 4 °C cold acclimation (CA) for 24 h and 48 h, freezing (-5 °C) treatments for 4 h with or without prior CA, and controls. When subjected to cold acclimation, global gene expressions were initiated more quickly in the R genotype than those in the S genotype. The R genotype activated gene expression more effectively in response to freezing temperature after 48 h CA than the S genotype. The differentially expressed genes were identified as low temperature sensing and signaling-related genes, functional proteins and transcription factors, many of which were specifically or predominantly expressed in the R genotype under cold treatments, implying that these genes play important roles in the enhanced cold hardiness of bermudagrass. KEGG pathway enrichment analysis for DEGs revealed that photosynthesis, nitrogen metabolism and carbon fixation pathways play key roles in bermudagrass response to cold stress. The results of this study may contribute to our understanding the molecular mechanism underlying the responses of bermudagrass to cold stress, and also provide important clues for further study and in-depth characterization of cold-resistance breeding candidate genes in bermudagrass.

  18. Real-time mapping of salt glands on the leaf surface of Cynodon dactylon L. using scanning electrochemical microscopy.

    Science.gov (United States)

    Parthasarathy, Meera; Pemaiah, Brindha; Natesan, Ravichandran; Padmavathy, Saralla R; Pachiappan, Jayaraman

    2015-02-01

    Salt glands are specialized organelles present in the leaf tissues of halophytes, which impart salt-tolerance capability to the plant species. These glands are usually identified only by their morphology using conventional staining procedures coupled with optical microscopy. In this work, we have employed scanning electrochemical microscopy to identify the salt glands not only by their morphology but also by their salt excretion behavior. Bermuda grass (Cynodon dactylon L.) species was chosen for the study as they are known to be salt-tolerant and contain salt glands on leaf surfaces. Scanning electrochemical microscopy performed in sodium chloride medium in the presence and absence of potassium ferrocyanide as redox mediator, reveals the identity of salt glands. More insight into the ion expulsion behavior of these glands was obtained by mapping lateral and vertical variations in ion concentrations using surface impedance measurements which indicated five times higher resistance over the salt glands compared to the surrounding tissues and bulk solution. The protocol could be used to understand the developmental processes in plants grown in different soil/water conditions in order to improve salt tolerance of food crops by genetic engineering and hence improve their agricultural productivity.

  19. A potent feed preservative candidate produced by Calcarisporium sp., an endophyte residing in stargrass (Cynodon dactylon).

    Science.gov (United States)

    Ji, L L; Song, Y C; Tan, R X

    2004-01-01

    The cultures of an endophytic fungus Calcarisporium sp. were screened for inhibitors on the growth of feed-associated moulds and on the aflatoxin biosynthesis to find a safe and effective feed preservative. Eight test fungi were isolated from the spoiled poultry feed. The endophytic fungus Calcarisporium sp. was separated from the Chinese coastal grass Cynodon dactylon. The antifungal action concerning the endophytic culture extract (ECE) was performed with propionic acid (PPA) as the corresponding reference. The ECE had a similar antifungal efficacy to PPA in a concentration-dependent manner. The susceptibility order of the ECE to the test fungi was found to be Fusarium sp. > Aspergillus spp. > Penicillium spp. Furthermore, the application of the ECE in pelleted-layer duck feed as a preservative was carried out at a humidity of 10, 15 and 20%. It has been discerned that mould growth and aflatoxin biosynthesis could be co-inhibited almost completely by ECE at concentrations higher than 1.0% (w/w). The LD50 of the ECE on mice was shown to be higher than 28 g kg-1. The ECE can be selected as an inhibitor to preserve poultry feed on inhibiting the growth of mould and aflatoxin biosynthesis during feed storage. The ECE may be an effective and biosafe antifungal ingredient for poultry feed and holds a potential market prospect in feed industry.

  20. Chromium resistance of dandelion (Taraxacum platypecidum Diels.) and bermudagrass (Cynodon dactylon [Linn.] Pers.) is enhanced by arbuscular mycorrhiza in Cr(VI)-contaminated soils.

    Science.gov (United States)

    Wu, Song-Lin; Chen, Bao-Dong; Sun, Yu-Qing; Ren, Bai-Hui; Zhang, Xin; Wang, You-Shan

    2014-09-01

    In a greenhouse pot experiment, dandelion (Taraxacum platypecidum Diels.) and bermudagrass (Cynodon dactylon[Linn.] Pers.), inoculated with and without arbuscular mycorrhizal fungus (AMF) Rhizophagus irregularis, were grown in chromium (Cr)-amended soils (0 mg/kg, 5 mg/kg, 10 mg/kg, and 20 mg/kg Cr[VI]) to test whether arbuscular mycorrhizal (AM) symbiosis can improve Cr tolerance in different plant species. The experimental results indicated that the dry weights of both plant species were dramatically increased by AM symbiosis. Mycorrhizal colonization increased plant P concentrations and decreased Cr concentrations and Cr translocation from roots to shoots for dandelion; in contrast, mycorrhizal colonization decreased plant Cr concentrations without improvement of P nutrition in bermudagrass. Chromium speciation analysis revealed that AM symbiosis potentially altered Cr species and bioavailability in the rhizosphere. The study confirmed the protective effects of AMF on host plants under Cr contaminations. © 2014 SETAC.

  1. Assessment of genetic diversity of Bermudagrass (Cynodon dactylon) using ISSR markers.

    Science.gov (United States)

    Farsani, Tayebeh Mohammadi; Etemadi, Nematollah; Sayed-Tabatabaei, Badraldin Ebrahim; Talebi, Majid

    2012-01-01

    Bermudagrass (Cynodon spp.) is a major turfgrass for home lawns, public parks, golf courses and sport fields and is known to have originated in the Middle East. Morphological and physiological characteristics are not sufficient to differentiate some bermudagrass genotypes because the differences between them are often subtle and subjected to environmental influences. In this study, twenty seven bermudagrass accessions and introductions, mostly from different parts of Iran, were assayed by inter-simple sequence repeat (ISSR) markers to differentiate and explore their genetic relationships. Fourteen ISSR primers amplified 389 fragments of which 313 (80.5%) were polymorphic. The average polymorphism information content (PIC) was 0.328, which shows that the majority of primers are informative. Cluster analysis using the un-weighted paired group method with arithmetic average (UPGMA) method and Jaccard's similarity coefficient (r = 0.828) grouped the accessions into six main clusters according to some degree to geographical origin, their chromosome number and some morphological characteristics. It can be concluded that there exists a wide genetic base of bermudograss in Iran and that ISSR markers are effective in determining genetic diversity and relationships among them.

  2. Comparative proteomic and metabolomic analyses reveal mechanisms of improved cold stress tolerance in bermudagrass (Cynodon dactylon (L.) Pers.) by exogenous calcium.

    Science.gov (United States)

    Shi, Haitao; Ye, Tiantian; Zhong, Bao; Liu, Xun; Chan, Zhulong

    2014-11-01

    As an important second messenger, calcium is involved in plant cold stress response, including chilling (Cynodon dactylon (L.) Pers.). Physiological analyses showed that CaCl2 treatment alleviated the reactive oxygen species (ROS) burst and cell damage triggered by chilling stress, via activating antioxidant enzymes, non-enzymatic glutathione antioxidant pool, while EGTA treatment had the opposite effects. Additionally, comparative proteomic analysis identified 51 differentially expressed proteins that were enriched in redox, tricarboxylicacid cycle, glycolysis, photosynthesis, oxidative pentose phosphate pathway, and amino acid metabolisms. Consistently, 42 metabolites including amino acids, organic acids, sugars, and sugar alcohols were regulated by CaCl2 treatment under control and cold stress conditions, further confirming the common modulation of CaCl2 treatment in carbon metabolites and amino acid metabolism. Taken together, this study reported first evidence of the essential and protective roles of endogenous and exogenous calcium in bermudagrass response to cold stress, partially via activation of the antioxidants and modulation of several differentially expressed proteins and metabolic homeostasis in the process of cold acclimation. © 2014 Institute of Botany, Chinese Academy of Sciences.

  3. Indole-diterpenes and ergot alkaloids in Cynodon dactylon (Bermuda grass) infected with Claviceps cynodontis from an outbreak of tremors in cattle.

    Science.gov (United States)

    Uhlig, Silvio; Botha, Christo J; Vrålstad, Trude; Rolén, Elin; Miles, Christopher O

    2009-12-09

    Tremorgenic syndromes in mammals are commonly associated with indole-diterpenoid alkaloids of fungal origin. Cattle are sometimes affected by tremors (also called "staggers") when they graze on toxic grass pastures, and Bermuda grass ( Cynodon dactylon , kweek) has been known to be associated with tremors for several decades. This study reports the identification of paspalitrems and paspaline-like indole-diterpenes in the seedheads of Claviceps cynodontis -infected Bermuda grass collected from a pasture that had caused a staggers syndrome in cattle in South Africa and thereby links the condition to specific mycotoxins. The highest concentration (about 150 mg/kg) was found for paspalitrem B. Ergonovine and ergine (lysergic acid amide), together with their C-8 epimers, were found to co-occur with the indole-diterpenes at concentrations of about 10 microg/kg. The indole-diterpene profile of the extract from the ergotized Bermuda grass was similar to that of Claviceps paspali sclerotia. However, the C. paspali sclerotia contained in addition agroclavine and elymoclavine. This is the first study linking tremors associated with grazing of Bermuda grass to specific tremorgenic indole-diterpenoid mycotoxins.

  4. First record of Atherigona reversura Villeneuve (Diptera: Muscidae feeding on Bermudagrass (Cynodon dactylon cv. Jiggs, Poaceae in Brazil: morphological and molecular tools for identification

    Directory of Open Access Journals (Sweden)

    Leandro do Prado Ribeiro

    2016-07-01

    Full Text Available Bermudagrass (Cynodon dactylon cv. Jiggs is an important food source for dairy cattle in the semi-intensive milk production systems most often used in southern Brazil. Although many insect pests are associated with feed grasses, we report here the first occurrence of the fly Atherigona (Atherigona reversura Villeneuve, 1936 (Diptera: Muscidae feeding on bermudagrass in Brazil. This potential pest was observed in April 2015 in three localities (Abelardo Luz, Palmitos, and Videira in western Santa Catarina, in southern Brazil. The infested plants had senescent and necrotic terminal leaves that reduced plant growth. New growth had to sprout new tillers from basal nodes, which resulted in a reduced plant growth rate. We also provide a morphological identification key (with figures for A. (Atherigona reversura and A. (Acritochaeta orientalis Schiner, 1868. A molecular identification based on COI is also provided to better differentiate species. Keywords: COI gene, Insect pest, Pastures, Plant–insect interaction

  5. Avaliação da densidade de uma pastagem de coastcross-1 (Cynodon dactylon (L. Pers em níveis residuais de matéria seca sob pastejo Density evaluation of a coastcross-1 (Cynodon dactylon (L. Pers pasture under grazing in different levels of dry matter residue

    Directory of Open Access Journals (Sweden)

    Marcia Regina Coelho

    2000-05-01

    Full Text Available O experimento foi realizado no Câmpus do Arenito - UEM, em Cidade Gaúcha, no período de outubro de 1997 a março de 1998, com o objetivo de avaliar na pastagem de coastcross -1 (Cynodon dactylon (L. Pers, em quatro níveis de resíduo de matéria seca (RMS: 1.978, 2.130, 2.545 e 3.857 kg de MS/ha, com lotação contínua e carga animal variável, as densidades e participação dos componentes botânicos. O delineamento experimental utilizado foi inteiramente casualizado, com duas repetições. As avaliações da densidade de forragem, participação dos componentes botânicos e a relação folha/colmo foram estudados nos estratos inferiores (0 - 10 cm e superiores (10 - 20 cm da pastagem, em função dos níveis RMS. A densidade da pastagem (g de MS/m3 nos estratos inferior e superior teve uma relação positiva com os níveis de RMS e negativa em relação ao tempo (dias do experimento. A percentagem de material morto (MM foi superior no estrato inferior em relação à percentagem de colmos verdes (CV e de folhas verdes (FV. No estrato superior o MM e CV tiveram a maior participação, porém FV, aumentou à medida que se elevaram os níveis de RMS.This experiment was carried out in Arenito Research Center-UEM, in Cidade Gaúcha-PR, from October/1997 to March /1998, to evaluate in coastcross-1 (Cynodon dactylon (L. Pers grazing, in four levels of dry matter residue (DMR: 1,978; 2,130; 2,545; 3,857 kg of DM/ha, with a continuous allotment system and variable number of allotments, the densities and participation of botanical component. A completely randomized design with two replications was used. Forage density, participation of botanical components and leaf/stem ratio were evaluated in inferior strata (0-10 cm and superior ones (10-20 cm of the pasture, according to the levels of DMR. The pasture density (g of DM/m3 in superior and inferior strata had a positive relation with the DMR levels and negative when associated to the period (days

  6. Estimativa do consumo de matéria seca de vacas em lactação em pastejo rotativo em capim coastcross (Cynodon dactylon, (L. Pers cv. coast-cross Estimative of the dry matter intake of lactating cows in intensive grazing coastcross grass [Cynodon dactylon (L. Pers cv. coastcross

    Directory of Open Access Journals (Sweden)

    Luiz Januário Magalhães Aroeira

    2000-05-01

    Full Text Available O experimento teve como objetivo estimar o consumo total de MS de vacas das raças gir e girolanda, em pastagem de capim coastcross [Cynodon dactylon (L. Pers cv. coastcross]. Foram utilizadas oito vacas gir e oito girolanda com 30 a 90 dias de lactação. Foi utilizada uma área de cinco hectares (ha, dividida em 10 piquetes de um hectare, e a pastagem manejada em pastejo rotacionado, com três dias de ocupação e 27 dias de descanso e taxa de lotação de 1,6 animais/ha no final da seca e 3,2 animais/ha nas demais épocas experimentais. Para a estimativa do consumo, foi utilizado o marcador cromo mordente. O delineamento experimental foi o de blocos casualizados com dois tratamentos (gir e girolanda, oito repetições e quatro blocos (épocas. O consumo total médio foi de 7,68kg de MS/animal/dia para a raça girolanda e 5,71kg de MS/animal/dia para a raça gir, correspondentes a 1,58% e 1,38% do peso vivo, respectivamente. Os consumos médios de capim coastcross estimados foram de 2,70kg e 4,68kg de MS/animal/dia para a raça gir e girolanda, correspondendo a 0,66 e 1,16% de PV, respectivamente.The objective of this experiment was to estimate the total dry matter intake of gir and girolanda breed cows kept in coastcross pasture [Cynodon dactylon (L. Pers cv. coastcross]. Eight gir and eight girolanda cows were used, all between 30 and 90 days of lactation period. The pasture (five ha was divided in 10 paddocks, grazed for three days with 27 days of resting period with stocking rate of 1.6 cows/ha at the end of the dry season and 3.2 cows/ha in the other experimental periods. Chromic mordant marker was used to estimate dry matter intake. The experimental design was a randomized complete block with two treatments (gir and girolanda, eight replications and four blocks (seasons. The total mean dry matter intake for girolanda cows was of 7.68 kg DM/cow/day and 5.71 kg DM/cow/day for gir cows, corresponding to 1.58% and 1.38% live weight

  7. Efecto de la liberación controlada de nitrógeno sobre la fermentación y la degradabilidad in situ de Cynodon dactylon

    Directory of Open Access Journals (Sweden)

    Álvaro Ojeda

    2012-12-01

    Full Text Available Objetivo. Evaluar el efecto de una fuente no proteica de liberación controlada de nitrógeno (NnpLC sobre algunos parámetros de la fermentación ruminal y degradabilidad in situ de Cynodon dactylon. Materiales y métodos. 4 vacas fistuladas al rumen alimentadas con una dieta base de heno de Cynodon dactylon (4.8% proteína cruda y 78.4% fibra detergente neutra, 1 kg de melaza de caña y 55 g de mezcla mineral (tratamiento Control, y tratamientos experimentales con adición a la dieta base de 150 g urea (Urea, sustitución de Urea por NnpLC a razón de 50% del aporte de nitrógeno (Urea/ NnpLC y 183 g NnpLC (NnpLC. En un Cuadrado Latino 4x4 y períodos de 17 días, se registró consumo del día 7 al 14. El día 15 fueron tomadas muestras seriadas de contenido ruminal para evaluar pH, nitrógeno amoniacal (N-NH3 y ácidos grasos volátiles. La degradabilidad de la materia orgánica (DMO48 y fibra detergente neutro (DFND48 a las 48 h fueron medidas con bolsas de nylon. Resultados. No hubo diferencias (p>0.05 en consumo de materia seca (8.2±0.35 kgMS/animal/día, pH (6.1±0.21, DMO48 (52.2±6.2% y DFND48 (30.1±2.8%; aunque hubo diferencias (p<0.01 en valores medios de N-NH3 (19.1, 166.7, 181.6 y 281.8 mg/L; respectivamente. NnpLC incrementó (p<0.05 el ácido propiónico (27.3%, redujo el T1/2 (13.2% y optimizó la relación P:E (22.0± 0.76. Conclusiones. El uso de una fuente NnpLC generó un perfil de ácidos grasos volátiles con patrón gluconeogénico, optimizó la concentración de N-NH3 y mejoró la relación P:E, por lo que debe considerarse una alternativa para manipular el medio ambiente ruminal de vacunos alimentados con recursos fibrosos.

  8. Isolation, Characterization, and RP-HPLC Estimation of P-Coumaric Acid from Methanolic Extract of Durva Grass (Cynodon dactylon Linn. (Pers.

    Directory of Open Access Journals (Sweden)

    Ramadoss Karthikeyan

    2015-01-01

    Full Text Available P-coumaric acid is a nonflavonoid phenolic acid and is a major constituent of the species Cynodon dactylon Linn. (Pers.. In this study isolation of P-coumaric acid was achieved by preparative TLC and the compound thus isolated was characterised by UV, mass, and H1 NMR spectral analysis. An isocratic RP-HPLC method was developed for the estimation of P-coumaric acid from methanolic extracts of durva grass. The chromatographic separations were achieved by RP-C18 column (250 mm × 4.6 mm, 5 μ, Shimadzu LC-20AT Prominence liquid chromatograph, and a mobile phase composed of water : methanol : glacial acetic acid (65 : 34 : 1 v/v. The flow rate was 1.0 mL/min and the analyses of column effluents were performed using UV-visible detector at 310 nm. Retention time of P-coumaric acid was found to be 6.617 min. This method has obeyed linearity over the concentration range of 2–10 μg/mL and the regression coefficient obtained from linearity plot for P-coumaric acid was found to be 0.999. RP-HPLC method was validated in pursuance of ICH guidelines.

  9. Isolation, Characterization, and RP-HPLC Estimation of P-Coumaric Acid from Methanolic Extract of Durva Grass (Cynodon dactylon Linn.) (Pers.)

    Science.gov (United States)

    Karthikeyan, Ramadoss; Devadasu, Chapala; Srinivasa Babu, Puttagunta

    2015-01-01

    P-coumaric acid is a nonflavonoid phenolic acid and is a major constituent of the species Cynodon dactylon Linn. (Pers.). In this study isolation of P-coumaric acid was achieved by preparative TLC and the compound thus isolated was characterised by UV, mass, and H1 NMR spectral analysis. An isocratic RP-HPLC method was developed for the estimation of P-coumaric acid from methanolic extracts of durva grass. The chromatographic separations were achieved by RP-C18 column (250 mm × 4.6 mm, 5 μ), Shimadzu LC-20AT Prominence liquid chromatograph, and a mobile phase composed of water : methanol : glacial acetic acid (65 : 34 : 1 v/v). The flow rate was 1.0 mL/min and the analyses of column effluents were performed using UV-visible detector at 310 nm. Retention time of P-coumaric acid was found to be 6.617 min. This method has obeyed linearity over the concentration range of 2–10 μg/mL and the regression coefficient obtained from linearity plot for P-coumaric acid was found to be 0.999. RP-HPLC method was validated in pursuance of ICH guidelines. PMID:25788944

  10. Aspergillus fumigatus CY018, an endophytic fungus in Cynodon dactylon as a versatile producer of new and bioactive metabolites.

    Science.gov (United States)

    Liu, J Y; Song, Y C; Zhang, Z; Wang, L; Guo, Z J; Zou, W X; Tan, R X

    2004-11-09

    Aspergillus fumigatus CY018 was recognized as an endophytic fungus for the first time in the leaf of Cynodon dactylon. By bioassay-guided fractionation, the EtOAc extract of a solid-matrix steady culture of this fungus afforded two new metabolites, named asperfumoid (1) and asperfumin (2), together with six known bioactive compounds including monomethylsulochrin, fumigaclavine C, fumitremorgin C, physcion, helvolic acid and 5alpha,8alpha-epidioxy-ergosta-6,22-diene-3beta-ol as well as other four known compounds ergosta-4,22-diene-3beta-ol, ergosterol, cyclo(Ala-Leu) and cyclo(Ala-Ile). Through detailed spectroscopic analyses including HRESI-MS, homo- and hetero-nuclear correlation NMR experiments (HMQC, COSY, NOESY and HMBC), the structures of asperfumoid and asperfumin were established to be spiro-(3-hydroxyl-2,6-dimethoxyl-2,5-diene-4-cyclohexone-(1,3')-5'-methoxyl-7'-methyl-(1'H, 2'H, 4'H)-quinoline-2',4'-dione) and 5-hydroxyl-2-(6-hydroxyl-2-methoxyl-4-methylbenzoyl)-3,6-dimethoxyl-benzoic methyl ester, respectively. All of the 12 isolates were subjected to in vitro bioactive assays against three human pathogenic fungi Candida albicans, Tricophyton rubrum and Aspergillus niger. As a result, asperfumoid, fumigaclavine C, fumitremorgin C, physcion and helvolic acid were shown to inhibit C. albicans with MICs of 75.0, 31.5, 62.5, 125.0 and 31.5 microg/mL, respectively.

  11. Growth performance and stomatal behavior in relation to ecotypic adaptations in cynodon dactylon (L.) pers

    International Nuclear Information System (INIS)

    Tufail, A.; Ahmad, F.; Hameed, M.; Ahmad, R.

    2017-01-01

    Evolution has great ecological significance in terms of plant morphological and stomatal characteristics that must have been genetically fixed during the long evolutionary period. Impact of environmental conditions on growth and stomatal features of twelve ecotypes of Cynodon dactylon that were collected from ecologically different habitats in the Punjab, Pakistan were evaluated. The collected ecotypes Derawar Fort-saline desert (DF-SD), Muzaffar garh-River bank (M-RB), Khabbeki Lake-hyper saline (KL-HS), Ucchali Lake-hyper saline (UL-HS), Kalar Kahar Lake-saline (KKL-S), Treemu-saline wetland (T-SW), Sahianwala-saline wetland (S-SW), Sahianwala-hyper saline (S-HS), Pakka Anna-hyper saline (PA-HS), Pakka Anna-reclaimed field (PA-RF), Botanic Garden-non saline (BG-NS) and Gatwala-saline semiarid (G-SSA) were grown in controlled environments at University of Agriculture, Faisalabad till their acclimatization to evaluate genetically fixed characteristics. After 6-month growth in soil, the plants were transferred to half-strength Hoagland's nutrient medium. There was a huge variation in all morphological characteristics recorded during the investigation, which were due to environmental heterogeniety to which these ecotypes were originally adapted. An exclusive feature of the DF-SD ecotypes is the long and numerous roots, and tillering capacity that surpassed all other ecotypes. Leaves per plant were also exceptionally high that may improve the photosymthetic efficiency of the plant. It showed a good potential of overall growth and biomass production. The robust growth was also recorded in the KKL-S ecotypes, and this can be related to the complete dominance of these two ecotypes in their respective habitats. Small stomata were recorded in the three ecotypes (DF-SD, KL-HS and PA-HS), which are of great ecological significance. Stomatal shape, however, is different in different ecotypes, but its contribution towards stress tolerance is still to be investigated. (author)

  12. Ergot fungus Claviceps cynodontis found on Bermuda grass (Cynodon dactylon) in the Americas

    Czech Academy of Sciences Publication Activity Database

    Pažoutová, Sylvie; Odvody, G.; Frederickson, D.E.

    2005-01-01

    Roč. 27, - (2005), s. 1-6 ISSN 0706-0661 Institutional research plan: CEZ:AV0Z5020903 Keywords : claviceps cynodon tis * ergot * bermuda grass Subject RIV: EE - Microbiology, Virology Impact factor: 1.066, year: 2005

  13. Performance of holsteins cows in pasture of Cynodon dactylon cv. Coast-cross supplemented with concentrate Desempenho de vacas da raça Holandesa em pastagem de Cynodon dactylon cv. Coast-cross suplementada com concentrado

    Directory of Open Access Journals (Sweden)

    Rodrigo Carvalho Cardoso

    2009-12-01

    Full Text Available The work was developed in the experimental station of Embrapa Gado de Leite (Dairy Cattle Embrapa, in Coronel Pacheco, in Zona da Mata Region of Minas Gerais, with the purpose of evaluating the productive performance of Holstein cows kept on 'Coast-cross' (Cynodon dactylon (L. Pears pasture, fertilized, strategically irrigated and where the cows were daily supplemented with 3 or 6 kg of concentrate/cow/day. The data were collected during three years (October/2000 to October/2003, involving 108 lactations. An experimental randomized block design with two replicate areas per treatment was adopted, with nine animals per area and eighteen animals per treatment being utilized, with fixed stocking rate of five cows/ha. The system of grazing, under rotated stocking, with one day occupation of the enclosures (piquetes and 25 and 35 days rest in the rainy and dry seasons, respectively was used. The pasture was irrigated in the months of lowest rainfall and fertilized with NPK broadcast at six applications/year. The availability of dry matter of the pasture was 7,280 kg/ha and 6,167 kg/ha in early grazing, with the post-grazing waste stubble of 4,885 kg/ha and 3,994 kg/ha, in the rainy (Spring/Summer and dry (Fall/Winter seasons, respectively. During part of the experimental period, a few morphogenic characteristics of the pasture were evaluated, recording availability of 83.9; 125.6 and 89.5 kg of DM of leaf blades/ha/day, on spring, summer and fall, respectively. The daily averages of milk production per cow were 15.57 and 18.80 kg/ day with 3.5% of fat and per area 77.80 and 94.00 kg/ha, when 3 or 6 kg of concentrate/cow/day were fed, respectively. It was concluded that supplemented and managed 'Coast-cross' pasture adequately enables high milk production per animal and per area, as quantitatively and qualitatively adequate for milk production.O trabalho foi desenvolvido na base física da Embrapa Gado de Leite, em Coronel Pacheco, na Zona da Mata de

  14. Factors Influencing Dislodgeable 2, 4-D Plant Residues from Hybrid Bermudagrass (Cynodon dactylon L. x C. transvaalensis) Athletic Fields.

    Science.gov (United States)

    Jeffries, Matthew D; Gannon, Travis W; Brosnan, James T; Ahmed, Khalied A; Breeden, Gregory K

    2016-01-01

    Research to date has confirmed 2,4-D residues may dislodge from turfgrass; however, experiments have not been conducted on hybrid bermudagrass (Cynodon dactylon L. x C. transvaalensis), the most common athletic field turfgrass in subtropical climates. More specifically, previous research has not investigated the effect of post-application irrigation on dislodgeable 2,4-D residues from hybrid bermudagrass and across turfgrass species, research has been nondescript regarding sample time within a d (TWD) or conducted in the afternoon when the turfgrass canopy is dry, possibly underestimating potential for dislodgement. The effect of irrigation and TWD on 2,4-D dislodgeability was investigated. Dislodgeable 2,4-D amine was reduced > 300% following irrigation. From 2 to 7 d after treatment (DAT), ≤ 0.5% of applied 2,4-D was dislodged from irrigated turfgrass, while ≤ 2.3% of applied 2,4-D was dislodged when not irrigated. 2,4-D dislodgeability decreased as TWD increased. Dislodgeable 2,4-D residues declined to < 0.1% of the applied at 1 DAT- 13:00, and increased to 1 to 3% of the applied 2 DAT- 5:00, suggesting 2,4-D re-suspended on treated turfgrass vegetation overnight. In conclusion, irrigating treated turfgrass reduced dislodgeable 2,4-D. 2,4-D dislodgeability increased as TWD decreased, which was attributed to non-precipitation climatic conditions favoring turfgrass canopy wetness. This research will improve turfgrass management practices and research designed to minimize human 2,4-D exposure.

  15. Comparative and Mixture Effect of Cynodon Dactylon, ElectroMagnetic Field and Insulin on Diabetic Mouse.

    Science.gov (United States)

    Nafisi, Saeid; Nezhady, Mohammad Ali Mohammad; Asghari, Mohammad Hossein

    2012-12-01

    New investigations are in progress to find some alternative treatments for diabetes mellitus. Herbs are some of the interesting medications in this regard. Cynodon dactylon (C.d) is a potential plant to be considered as a new medication. On the other hand, the effect of the Electromagnetic Field (EMF) on bio organisms is becoming clearer. In this study, the effect of C.d, EMF and insulin have been investigated on the diabetic mouse. Diabetes was induced by a combination of ketamine (60 mg/Kg) and xylazine (10 mg/Kg) which induces a sustained hyperglycemia. Mice were divided into 12 groups: 1) control, 2) normal saline, 3 and 4) 50mg/Kg C.d, 5 and 6) 100 mg/Kg C.d, 7) insulin, 8) insulin and C.d, 9) EMF (110 KHz, 700±20 mG), 10) insulin and EMF, 11) EMF plus C.d and 12) insulin plus C.d and EMF. Blood glucose level was measured after 5 and 60 minutes in C.d administrated groups, and 5 minutes in the other groups by a glucometer set. The data were analyzed by ANOVA and different means were compared by Tukey and Bonferroni tests (p<0.05). According to results, both dosages of C.d had significant lowering effect on blood glucose level. The first dose was more effective than the second, and its impact was just like insulin. The 6(th), 9(th) and 10(th) groups were significant, also. However, they did not show a higher effect than insulin or C.d. The application of EMF had a significant effect compared to the second group, but it did not reduce the glucose level to the normal range. The effect of the 8th group was very impressive and the mean glucose levels in this group were lower than the control group. Considering the data, C.d is a good alternative medication for diabetes mellitus.

  16. Role of aqueous extract of Cynodon dactylon in prevention of carbofuran- induced oxidative stress and acetylcholinesterase inhibition in rat brain.

    Science.gov (United States)

    Rai, D K; Sharma, R K; Rai, P K; Watal, G; Sharma, B

    2011-02-12

    The present study was designed to investigate the ameliorating effect of aqueous extract of C. dactylon on carbofuran induced oxidative stress (OS) and alterations in the activity of acetylcholinesterase (AChE) in the brain of rats. Vitamin C was used as a positive control. Wistar rats were administered with single sub-acute oral dose (1.6 mgkg-1 b.wt.) of carbofuran for 24 h. The OS parameters such as lipid peroxidation (LPO) and the activities of antioxidant enzymes including super oxide dismutase (SOD), catalase (CAT) and glutathione-S-transferase (GST), and that of AChE were studied in brain. Carbofuran treatment significantly increased the activities of SOD and CAT by 75 and 60%, respectively. It also induced the level of LPO by 113%. In contrast, the activities of GST and AChE were recorded to be diminished by 25 and 33%, respectively. Pretreatment of the rats with aqueous extract of C. dactylon (oral; 500mgkg-1) restored SOD activity completely but CAT activity only partially (7%). Carbofuran induced LPO was moderated by 95% in the brain of C. dactylon treated rats. The observed changes in OS parameters in C. dactylon treated group were comparable to that observed in vitamin C (200 mg-kg-1 b. wt.) treated group. Surprisingly, C. dactylon treatment significantly recovered the activity of AChE to a similar level as observed in the brain of control group. In contrast vitamin C treatment did not cause significant change in the activity of AChE in carbofuran treated group. There were no noticeable changes in the aforementioned study parameters in the brain of rats receiving C. dactylon and vitamin C, only. The results suggest that the study is extremely important in the context of development of new anticholinestesterase and antioxidant antidotes against carbofuran from C. dactylon.

  17. Desenvolvimento e migração de larvas infectantes de ciatostomíneos (Nematoda: Cyathostominae em gramínea coast cross (Cynodon dactylon em clima tropical, na Baixada Fluminense, RJ, Brasil Development and migration of cyathostome infective larvae (Nematoda: Cyathostominae in bermuda grass (Cynodon dactylon in tropical climate, in Baixada Fluminense, RJ, Brazil

    Directory of Open Access Journals (Sweden)

    Melissa C. M. do Couto

    2009-06-01

    Full Text Available Esse estudo foi realizado no período de julho de 2003 a novembro de 2004, para avaliar o desenvolvimento, a sobrevivência, a migração das larvas infectantes em gramínea "coast cross" (Cynodon dactylon e o horário de maior disponibilidade, em condições de clima tropical, na Baixada Fluminense, RJ, Brasil. De julho de 2003 a setembro de 2004, massas fecais de equinos naturalmente infectados foram depositadas mensalmente sobre a gramínea. Sete dias após, amostras de fezes e gramínea foram coletadas semanalmente em diferentes horários (8, 13 e 17 horas, pesadas e processadas pela técnica de Baermann. O desenvolvimento, a sobrevivência e a migração das larvas infectantes nas fezes e na gramínea foram observados durante todo o período. A sobrevivência das L3 foi de até 15 semanas nas fezes e 12 semanas na gramínea no período seco e de nove e oito semanas, respectivamente, para o período chuvoso. No período chuvoso, maior número de L3 foi recuperado nas fezes e, no período seco, na gramínea. Condições climáticas influenciaram diretamente o número larvas infectantes. Pela análise multivariada, ficou demonstrado uma forte relação entre o tempo e o número de L3 nas fezes, sendo esta relação menos acentuada para a gramínea. Não se observou diferença significativa entre os horários de coleta.A study following the development and migration of Cyathostominae infective larvae was conducted from July 2003 to November 2004 in tropical climate, Baixada Fluminense, RJ, Brazil. Samples of naturally infected feces were placed on 12 m² plot each month on a cyathostomin-free "Bermuda grass" pasture (Cynodon dactylon. After Seven days, samples of feces and grass were collected every week at 8 a.m, 1 and 5 p.m., weighed and processed by Baermann technique. Higher survival of L3 was found at dry season, 15 and 12 weeks on feces and sward respectively, at rainy season the survival was smaller. The multivariable analysis of main

  18. Development and characterization of genomic SSR markers in Cynodon transvaalensis Burtt-Davy.

    Science.gov (United States)

    Tan, Chengcheng; Wu, Yanqi; Taliaferro, Charles M; Bell, Greg E; Martin, Dennis L; Smith, Mike W

    2014-08-01

    Simple sequence repeat (SSR) markers are a major molecular tool for genetic and genomic research that have been extensively developed and used in major crops. However, few are available in African bermudagrass (Cynodon transvaalensis Burtt-Davy), an economically important warm-season turfgrass species. African bermudagrass is mainly used for hybridizations with common bermudagrass [C. dactylon var. dactylon (L.) Pers.] in the development of superior interspecific hybrid turfgrass cultivars. Accordingly, the major objective of this study was to develop and characterize a large set of SSR markers. Genomic DNA of C. transvaalensis '4200TN 24-2' from an Oklahoma State University (OSU) turf nursery was extracted for construction of four SSR genomic libraries enriched with [CA](n), [GA](n), [AAG](n), and [AAT](n) as core repeat motifs. A total of 3,064 clones were sequenced at the OSU core facility. The sequences were categorized into singletons and contiguous sequences to exclude redundancy. From the two sequence categories, 1,795 SSR loci were identified. After excluding duplicate SSRs by comparison with previously developed SSR markers using a nucleotide basic local alignment tool, 1,426 unique primer pairs (PPs) were designed. Out of the 1,426 designed PPs, 981 (68.8 %) amplified alleles of the expected size in the donor DNA. Polymorphisms of the SSR PPs tested in eight C. transvaalensis plants were 93 % polymorphic with 544 markers effective in all genotypes. Inheritance of the SSRs was examined in six F(1) progeny of African parents 'T577' × 'Uganda', indicating 917 markers amplified heritable alleles. The SSR markers developed in the study are the first large set of co-dominant markers in African bermudagrass and should be highly valuable for molecular and traditional breeding research.

  19. VALIDAÇÃO DE TÉCNICAS EXPERIMENTAIS PARA AVALIAÇÃO DE CARACTERÍSTICAS AGRONÔMICAS E ECOLÓGICAS DE PASTAGENS DE CYNODON DACTYLON CV. 'COASTCROSS-1

    Directory of Open Access Journals (Sweden)

    Carnevalli Roberta Aparecida

    1999-01-01

    Full Text Available Este trabalho consiste na avaliação de uma pastagem tropical Cynodon dactylon, enfocando, principalmente necessidade de adaptação, aferição da precisão e transferência de metodologias comumente utilizadas para plantas de clima temperado. Neste estudo, pôde-se avaliar produção de forragem, composição botânica, crescimento por perfilho e senescência foliar (fluxo e renovação de tecidos e dinâmica populacional de perfilhos (morte, sobrevivência e aparecimento de perfilhos, relacionada com a densidade de perfilhos (números de perfilhos/m2, possibilitando a detecção de falhas e imprecisões nestes métodos quando transferidos de forma direta de comunidades de plantas de clima temperado para plantas de clima tropical. Foram geradas, ainda, equações de calibração, ou seja, relação entre altura e massa de forragem do pasto, as quais sofreram modificações ao longo do ano devido a mudanças, principalmente, na estrutura do pasto.

  20. Fermentation characteristics and nutritive value of low moisture silage made from mature bermudagrass (C. dactylon) and switchgrass (P. virgatum) in mixture with alfalfa (M. sativa) or treated with urea and plantain (Musa AAB

    Science.gov (United States)

    Two experiments were conducted at the University of Kentucky Spindletop Farm in Lexington, Kentucky between October and November, 2009 to evaluate the effect of different percentages of alfalfa (Medicago sativa) as mixtures in switchgrass (Panicum virgatus) and bermudagrass (Cynodon dactylon) silage...

  1. Genetic diversity and population structure of Chinese natural bermudagrass [Cynodon dactylon (L.) Pers.] germplasm based on SRAP markers.

    Science.gov (United States)

    Zheng, Yiqi; Xu, Shaojun; Liu, Jing; Zhao, Yan; Liu, Jianxiu

    2017-01-01

    Bermudagrass [Cynodon dactylon (L.) Pers.], an important turfgrass used in public parks, home lawns, golf courses and sports fields, is widely distributed in China. In the present study, sequence-related amplified polymorphism (SRAP) markers were used to assess genetic diversity and population structure among 157 indigenous bermudagrass genotypes from 20 provinces in China. The application of 26 SRAP primer pairs produced 340 bands, of which 328 (96.58%) were polymorphic. The polymorphic information content (PIC) ranged from 0.36 to 0.49 with a mean of 0.44. Genetic distance coefficients among accessions ranged from 0.04 to 0.61, with an average of 0.32. The results of STRUCTURE analysis suggested that 157 bermudagrass accessions can be grouped into three subpopulations. Moreover, according to clustering based on the unweighted pair-group method of arithmetic averages (UPGMA), accessions were divided into three major clusters. The UPGMA dendrogram revealed that accessions from identical or adjacent areas were generally, but not entirely, clustered into the same cluster. Comparison of the UPGMA dendrogram and the Bayesian STRUCTURE analysis showed general agreement between the population subdivisions and the genetic relationships among accessions. Principal coordinate analysis (PCoA) with SRAP markers revealed a similar grouping of accessions to the UPGMA dendrogram and STRUCTUE analysis. Analysis of molecular variance (AMOVA) indicated that 18% of total molecular variance was attributed to diversity among subpopulations, while 82% of variance was associated with differences within subpopulations. Our study represents the most comprehensive investigation of the genetic diversity and population structure of bermudagrass in China to date, and provides valuable information for the germplasm collection, genetic improvement, and systematic utilization of bermudagrass.

  2. Complete chloroplast genome sequence of common bermudagrass (Cynodon dactylon (L.) Pers.) and comparative analysis within the family Poaceae.

    Science.gov (United States)

    Huang, Ya-Yi; Cho, Shu-Ting; Haryono, Mindia; Kuo, Chih-Horng

    2017-01-01

    Common bermudagrass (Cynodon dactylon (L.) Pers.) belongs to the subfamily Chloridoideae of the Poaceae family, one of the most important plant families ecologically and economically. This grass has a long connection with human culture but its systematics is relatively understudied. In this study, we sequenced and investigated the chloroplast genome of common bermudagrass, which is 134,297 bp in length with two single copy regions (LSC: 79,732 bp; SSC: 12,521 bp) and a pair of inverted repeat (IR) regions (21,022 bp). The annotation contains a total of 128 predicted genes, including 82 protein-coding, 38 tRNA, and 8 rRNA genes. Additionally, our in silico analyses identified 10 sets of repeats longer than 20 bp and predicted the presence of 36 RNA editing sites. Overall, the chloroplast genome of common bermudagrass resembles those from other Poaceae lineages. Compared to most angiosperms, the accD gene and the introns of both clpP and rpoC1 genes are missing. Additionally, the ycf1, ycf2, ycf15, and ycf68 genes are pseudogenized and two genome rearrangements exist. Our phylogenetic analysis based on 47 chloroplast protein-coding genes supported the placement of common bermudagrass within Chloridoideae. Our phylogenetic character mapping based on the parsimony principle further indicated that the loss of the accD gene and clpP introns, the pseudogenization of four ycf genes, and the two rearrangements occurred only once after the most recent common ancestor of the Poaceae diverged from other monocots, which could explain the unusual long branch leading to the Poaceae when phylogeny is inferred based on chloroplast sequences.

  3. FOOD PREFERENCE DATA BY FAECAL ANALYSIS FOR AFRICAN ...

    African Journals Online (AJOL)

    tends to break into many smaU fragments which are particularly easy to identify; the mean. R ep rod u ... and both Cynodon dactylon (at least in some growth forms) and C. ..... A preliminary investigation into the feeding habits of the waterbuck.

  4. 7 CFR 201.17 - Noxious-weed seeds in the District of Columbia.

    Science.gov (United States)

    2010-01-01

    ...), Canada thistle (Cirsium arvense), field bindweed (Convolvulus arvensis), bermudagrass (Cynodon dactylon), giant bermudagrass (Cynodon dactylon var. aridus), annual bluegrass (Poa annua), and wild garlic or wild...

  5. RNA-seq for gene identification and transcript profiling in relation to root growth of bermudagrass (Cynodon dactylon) under salinity stress.

    Science.gov (United States)

    Hu, Longxing; Li, Huiying; Chen, Liang; Lou, Yanhong; Amombo, Erick; Fu, Jinmin

    2015-08-04

    Soil salinity is one of the most significant abiotic stresses affecting plant shoots and roots growth. The adjustment of root architecture to spatio-temporal heterogeneity in salinity is particularly critical for plant growth and survival. Bermudagrass (Cynodon dactylon) is a widely used turf and forage perennial grass with a high degree of salinity tolerance. Salinity appears to stimulate the growth of roots and decrease their mortality in tolerant bermudagrass. To estimate a broad spectrum of genes related to root elongation affected by salt stress and the molecular mechanisms that control the positive response of root architecture to salinity, we analyzed the transcriptome of bermudagrass root tips in response to salinity. RNA-sequencing was performed in root tips of two bermudagrass genotypes contrasting in salt tolerance. A total of 237,850,130 high quality clean reads were generated and 250,359 transcripts were assembled with an average length of 1115 bp. Totally, 103,324 unigenes obtained with 53,765 unigenes (52 %) successfully annotated in databases. Bioinformatics analysis indicated that major transcription factor (TF) families linked to stress responses and growth regulation (MYB, bHLH, WRKY) were differentially expressed in root tips of bermudagrass under salinity. In addition, genes related to cell wall loosening and stiffening (xyloglucan endotransglucosylase/hydrolases, peroxidases) were identified. RNA-seq analysis identified candidate genes encoding TFs involved in the regulation of lignin synthesis, reactive oxygen species (ROS) homeostasis controlled by peroxidases, and the regulation of phytohormone signaling that promote cell wall loosening and therefore root growth under salinity.

  6. Elucidating polyploidization of bermudagrasses as assessed by organelle and nuclear DNA markers.

    Science.gov (United States)

    Gulsen, Osman; Ceylan, Ahmet

    2011-12-01

    Clarification of relationships among ploidy series of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to elucidate polyploidization among Cynodon accessions with different ploidy series collected from Turkey based on chloroplast and nuclear DNA. Forty Cynodon accessions including 7 diploids, 3 triploids, 10 tetraploids, 11 pentaploids, and 9 hexaploids were analyzed using chloroplast DNA restriction fragment-length polymorphism (cpDNA RFLP), chloroplast DNA simple sequence repeat (cpDNA SSR), and nuclear DNA markers based on neighbor-joining (NJ) and principle component analyses (PCA). All three-marker systems with two statistical algorithms clustered the diploids apart from the other ploidy levels. Assuming autopolyploidy, spontaneous polyploidization followed by rapid diversification among the higher ploidy levels than the diploids is likely in Cynodon's evolution. Few tetraploid and hexaploid accessions were clustered with or closely to the group of diploids, supporting the hypothesis above. Eleven haplotypes as estimated by cpDNA RFLP and SSR markers were detected. This study indicated that the diploids had different organelle genome from the rest of the ploidy series and provided valuable insight into relationships among ploidy series of Cynodon accessions based on cp and nuclear DNAs.

  7. Inhibiton of Yellow Nutsedge (Cyperus esculentus L. and Bermudagrass (Cynodon dactylon (L. Pers by a Mulch Derived from Rye (Secale cereale L. in grapevines Inhibición del Crecimiento de Chufa (Cyperus esculentus L. y Pasto Bermuda (Cynodon dactylon (L. Pers. con mulch Vegetal Proveniente de Centeno (Secale cereale L. en Vides

    Directory of Open Access Journals (Sweden)

    Juan Ormeño-Núñez

    2008-09-01

    Full Text Available Two field trials (Los Andes 1998-1999 and Santiago 2004-2005 were carried out to determine growth inhibition of yellow nutsedge (Cyperus esculentus L. and bermudagrass (Cynodon dactylon (L. Pers., growing on the plantation row, by mulch derived from a rye (Secale cereale L. cover crop established between grapevine (Vitis vinifera L. rows on overhead (cv. Flame Seedless and vertical (cv. Cabernet Sauvignon training. Spring mowing of the rye sown in the fall allowed for developing a thick and long lasting mulch along the grape rows. Nutsedge and bermudagrass control was 81 and 82%, respectively, and was more effective than conventional chemical (in the row + mechanical (between rows control. Glyphosate at 2% for nutsedge and 1% for bermudagrass control, applied twice (October and December, was insufficient to control either perennial weed adequately. Total broadleaved and grass/sedge weed control was 67.3 and 43.0% more effective with the rye mulch than with conventional treatments at Los Andes and Santiago, respectively. Perennial weed control levels could be explained as the new foliage of yellow nutsedge and bermudagrass was particularly susceptible to the shading provided by the rye mulch assembled prior to mid spring shoot emergence, and this effect remained active up until the beginning of autumn. The subsequent rye foliage mowing at the vegetative stage fully expressed the allelopathic effect produced by this local rye cultivar. The use of rye cover crop management and mulch could be applied as an effective weed control technique in conventional, as well as organic deciduous tree orchards.En dos ensayos de campo (Los Andes 1998-1999 y Santiago 2004-2005 se determinó el efecto inhibitorio sobre chufa (Cyperus esculentus L. y pasto bermuda (Cynodon dactylon (L. Pers. de residuos de centeno (Secale cereale L. establecido en otoño entre las hileras de vides (Vitis vinifera L. en parronal (cv. Flame Seedless y espaldera (cv. Cabernet Sauvignon

  8. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  9. Predição da composição química de bermudas (Cynodon spp. pela espectroscopia de reflectância no infravermelho proximal Prediction of chemical composition of Cynodon spp. by near infrared reflectance spectroscopy

    Directory of Open Access Journals (Sweden)

    Roberto Serena Fontaneli

    2004-08-01

    Full Text Available Diversos cultivares de Cynodon dactylon têm sido cultivados no Rio Grande do Sul para alimentação do rebanho leiteiro, na forma de pastejo ou feno. A rápida determinação do valor nutritivo dessas forrageiras pode ser útil para seu manejo e para o planejamento da dieta dos animais. Este trabalho teve como objetivo desenvolver curvas de calibração para análise do valor nutritivo de quatro cultivares de Cynodon (Tifton 68, Tifton 85, Florakirk, Coastcross, utilizando o método de reflectância no infravermelho proximal (NIRS. Foram utilizadas 129 amostras de forragem verde, coletadas e analisadas entre 1998 e 2001. Os coeficientes de determinação para proteína bruta, fibra insolúvel em detergente neutro, fibra insolúvel em detergente ácido, matéria seca, cálcio, fósforo, potássio e magnésio foram, respectivamente: 0,98; 0,97; 0,99; 1; 0,92; 0,97; 0,99 e 0,72%. Os erros-padrão de calibração foram de 0,38; 0,60; 0,35; 0,14; 0,02; 0,01; 0,05 e 0,01%, respectivamente. As equações obtidas foram consideradas de excelente resolução para todos os parâmetros estimados, o que indica a acurácia do método para a espécie avaliada.Many Cynodon dactylon cultivars have been cultivated in Rio Grande do Sul state to be used as pasture or hay to feed dairy cattle. Quick determination of the nutritional value of these forages would be valuable for management and diet planning. This work had the objective to develop calibration curves for analysis of the nutritional value of four Cynodon cultivars (Tifton 68, Tifton 85, Florakirk, Coastcross, using near infrared reflectance spectroscopy (NIRS. A total of 129 fresh samples of green pasture were collected and analyzed from 1998 to 2001. The determination coefficients for crude protein, neutral detergent fiber, acid detergent fiber, dry matter, calcium, phosphorus, potash and magnesium were, respectively, .98, .97, .99, 1, .92, .97, .99 and .72%. The calibration standard error for the same

  10. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  11. The Use of Plant Growth Regulators to Improve the Traffic Tolerance and Repair of Overseeded Bermudagrass

    OpenAIRE

    Marshall, Christopher Scott

    2007-01-01

    An active football season during the fall acclimation period tests the traffic tolerance of bermudagrass. Exogenous applications of synthetic cytokinins or cytokinin-enhancing plant growth regulators (PGRs), such as trinexapac-ethyl, may improve the traffic tolerance of "Patriot" and "Tifsport" hybrid berudagrasses (Cynodon dactylon var. dactylon x Cynodon transvaalensis). This study was designed to mimic the agronomic practices and traffic stresses experienced at Virginia Tech's Worsham Fiel...

  12. Evaluation of the grass mixture (Faestuca Rubra, Cynodon Dactylon, Lolium Multiflorum and Pennisetum sp.) as Sb phyto-stabilizer in tailings and Sb-rich soils.

    Science.gov (United States)

    Aurora Armienta, M.; Beltrán-Villavicencio, Margarita; Ruiz-Villalobos, Carlos E.; Labastida, Israel; Ceniceros, Nora; Cruz, Olivia; Aguayo, Alejandra

    2017-04-01

    Green house experiments were carried out to evaluate the growth and Sb assimilation of a grass assemblage: Faestuca Rubra, Cynodon Dactylon, Lolium Multiflorum and Pennisetum sp, in tailings and Sb-rich soils. Tailings and soil samples were obtained at the Mexican historical mining zone of Zimapán, Central México. More than 6 tailings impoundments are located at the town outskirts and constitute a contamination source from windblown and waterborne deposit on soils, besides acid mine drainage. Four substrates were used in the experiments: 100% tailings, 20% tailings + 80% soil, 50% tailings + 50% soil , and a soil sample far from tailings as a background. Concentrations of Sb ranged from 310 mg/kg to 413 mg/kg in tailings. A pH of 7.43, 1.27% organic matter, and high concentrations of N, K and P indicated adequate conditions for plant growth. The grass assemblage was raised during 21 days as indicated by OECD (Organisation for Economic Co-operation and Development) Guideline 208 Terrestrial Plant Test: Seedling Emergence and Seedling Growth Test. The highest Sb concentrations were measured in plants grown on tailings with 139 mg/kg in the aerial part and 883 mg/kg in roots. Concentrations of Sb decreased as the proportion of tailings diminished with 22.1 mg/kg in the aerial part and 10 mg/kg in roots corresponding to the plants grown in the 20 % tailings + 80% soil . Bioaccumulation (BAC) and bioconcentration factors (BF) of plants grown on tailings (BAC= 0.42, BCF=3.93) indicated their suitability as a phyto-stabilization option. The grass mixture may be thus applied to control windblown particulate tailings taking advantage to their tolerance to high Sb levels.

  13. Genotypic and phenotypic evaluation of off-type grasses in hybrid Bermudagrass [Cynodon dactylon (L.) Pers. x C. transvaalensis Burtt-Davy] putting greens using genotyping-by-sequencing and morphological characterization.

    Science.gov (United States)

    Reasor, Eric H; Brosnan, James T; Staton, Margaret E; Lane, Thomas; Trigiano, Robert N; Wadl, Phillip A; Conner, Joann A; Schwartz, Brian M

    2018-01-01

    Interspecific hybrid bermudagrass [ Cynodon dactylon (L.) Pers. x C. transvaalensis Burtt-Davy] is one of the most widely used grasses on golf courses, with cultivars derived from 'Tifgreen' or 'Tifdwarf' particularly used for putting greens. Many bermudagrass cultivars established for putting greens can be genetically unstable and lead to the occurrence of undesirable off-type grasses that vary in phenotype. The objective of this research was to genetically and phenotypically differentiate off-type grasses and hybrid cultivars. Beginning in 2013, off-type and desirable hybrid bermudagrass samples were collected from golf course putting greens in the southeastern United States and genetically and phenotypically characterized using genotyping-by-sequencing and morphology. Genotyping-by-sequencing determined that 11% (5) of off-type and desirable samples from putting greens were genetically divergent from standard cultivars such as Champion, MiniVerde, Tifdwarf, TifEagle, and Tifgreen. In addition, genotyping-by-sequencing was unable to genetically distinguish all standard cultivars from one another due to their similar origin and clonal propagation; however, over 90,000 potentially informative nucleotide variants were identified among the triploid hybrid cultivars. Although few genetic differences were found in this research, samples harvested from golf course putting greens had variable morphology and were clustered into three distinct phenotypic groups. The majority of off-type grasses in hybrid bermudagrass putting greens were genetically similar with variable morphological traits. Off-type grasses within golf course putting greens have the potential to compromise putting surface functionality and aesthetics.

  14. Fate of heavy metals in vertical subsurface flow constructed wetlands treating secondary treated petroleum refinery wastewater in Kaduna, Nigeria.

    Science.gov (United States)

    Mustapha, Hassana Ibrahim; van Bruggen, J J A; Lens, P N L

    2018-01-02

    This study examined the performance of pilot-scale vertical subsurface flow constructed wetlands (VSF-CWs) planted with three indigenous plants, i.e. Typha latifolia, Cyperus alternifolius, and Cynodon dactylon, in removing heavy metals from secondary treated refinery wastewater under tropical conditions. The T. latifolia-planted VSF-CW had the best heavy metal removal performance, followed by the Cyperus alternifolius-planted VSF-CW and then the Cynodon dactylon-planted VSF-CW. The data indicated that Cu, Cr, Zn, Pb, Cd, and Fe were accumulated in the plants at all the three VSF-CWs. However, the accumulation of the heavy metals in the plants accounted for only a rather small fraction (0.09-16%) of the overall heavy metal removal by the wetlands. The plant roots accumulated the highest amount of heavy metals, followed by the leaves, and then the stem. Cr and Fe were mainly retained in the roots of T. latifolia, Cyperus alternifolius, and Cynodon dactylon (TF < 1), meaning that Cr and Fe were only partially transported to the leaves of these plants. This study showed that VSF-CWs planted with T. latifolia, Cyperus Alternifolius, and Cynodon dactylon can be used for the large-scale removal of heavy metals from secondary refinery wastewater.

  15. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  16. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Polyploidy creates higher diversity among Cynodon accessions as assessed by molecular markers.

    Science.gov (United States)

    Gulsen, Osman; Sever-Mutlu, Songul; Mutlu, Nedim; Tuna, Metin; Karaguzel, Osman; Shearman, Robert C; Riordan, Terrance P; Heng-Moss, Tiffany M

    2009-05-01

    Developing a better understanding of associations among ploidy level, geographic distribution, and genetic diversity of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to: (1) determine ploidy analysis of Cynodon accessions collected from Turkey, (2) investigate associations between ploidy level and diversity, (3) determine whether geographic and ploidy distribution are related to nuclear genome variation, and (4) correlate among four nuclear molecular marker systems for Cynodon accessions' genetic analyses. One hundred and eighty-two Cynodon accessions collected in Turkey from an area south of the Taurus Mountains along the Mediterranean cost and ten known genotypes were genotyped using sequence related amplified polymorphism (SRAP), peroxidase gene polymorphism (POGP), inter-simple sequence repeat (ISSR), and random amplified polymorphic DNA (RAPD). The diploids, triploids, tetraploids, pentaploids, and hexaploids revealed by flow cytometry had a linear present band frequency of 0.36, 0.47, 0.49, 0.52, and 0.54, respectively. Regression analysis explained that quadratic relationship between ploidy level and band frequency was the most explanatory (r = 0.62, P Cynodon accessions' genetic structure can aid to enhance breeding programs and broaden genetic base of commercial cultivars.

  18. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  19. The genetic and phenotypic variability of interspecific hybrid bermudagrasses (Cynodon dactylon (L.) Pers. × C. transvaalensis Burtt-Davy) used on golf course putting greens.

    Science.gov (United States)

    Reasor, Eric H; Brosnan, James T; Trigiano, Robert N; Elsner, J Earl; Henry, Gerald M; Schwartz, Brian M

    2016-10-01

    Some interspecific hybrid bermudagrass cultivars used on golf course putting greens are genetically unstable, which has caused phenotypically different off-type grasses to occur in production nurseries and putting surfaces. Management practices to reduce the occurrence of off-type grasses in putting green surfaces and the effect they can have on putting quality and performance need to be researched until genetically stable cultivars are developed. Golf course putting green surfaces in subtropical and tropical climates are typically planted with an interspecific hybrid bermudagrass (Cynodon dactylon (L.) Pers. × C. transvaalensis Burtt-Davy), because of the superior putting quality and performance of these cultivars. 'Tifgreen' was one of the first interspecific hybrids developed for putting green use in lieu of common bermudagrass. However, off-type grasses began appearing in established Tifgreen stands soon after commercial release. Off-type grasses are those with different morphology and performance when compared to the surrounding, desirable cultivar. Off-types have the potential to decrease surface uniformity, which negatively affects putting surface quality. However, several unique off-types from Tifgreen have been selected as commercial cultivars, the first being 'Tifdwarf'; then 'Floradwarf', 'MS-Supreme', 'Pee Dee-102', and 'TL-2', identified later. The cultivars 'Champion Dwarf', 'P-18', 'RJT', and 'Emerald Dwarf' were subsequently selected as off-types in Tifdwarf. The naturally occurring off-types and cultivars that have been identified within the Tifgreen family have widely differing phenotypes; however, they are reported to be genetically similar, supporting the hypothesis that their occurrence is a result of somatic mutations. Genetic instability in currently available commercial cultivars is likely to lead to the continued presence of off-types in production nurseries and putting greens. Additional research is needed to understand the nature of

  20. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  1. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  2. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  3. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  4. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  5. Biomass yield from an urban landscape

    Science.gov (United States)

    Utilizing biomass from urban landscapes could significantly contribute to the nation’s renewable energy needs. In 2007, an experiment was begun to evaluate the biomass production from a bermudagrass, Cynodon dactylon var. dactylon (L.) Pers., lawn in Woodward, Oklahoma and to estimate the potential...

  6. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  7. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  8. Effect of medicinal plants on the crystallization of cholesterol

    Science.gov (United States)

    Saraswathi, N. T.; Gnanam, F. D.

    1997-08-01

    One of the least desirable calcifications in the human body is the mineral deposition in atherosclerosis plaques. These plaques principally consist of lipids such as cholesterol, cholesteryl esters, phospholipids and triglycerides. Chemical analysis of advanced plaques have shown the presence of considerable amounts of free cholesterol identified as cholesterol monohydrate crystals. Cholesterol has been crystallized in vitro. The extracts of some of the Indian medicinal plants detailed below were used as additives to study their effect on the crystallization behaviour of cholesterol. It has been found that many of the herbs have inhibitory effect on the crystallization such as nucleation, crystal size and habit modification. The inhibitory effect of the plants are graded as Commiphora mughul > Aegle marmeleos > Cynoden dactylon > Musa paradisiaca > Polygala javana > Alphinia officinarum > Solanum trilobatum > Enicostemma lyssopifolium.

  9. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  10. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  11. Effect of a pre-freezing treatment with cholesterol-loaded cyclodextrins on boar sperm longevity, capacitation dynamics, ability to adhere to porcine oviductal epithelial cells in vitro and DNA fragmentation dynamics.

    Science.gov (United States)

    Tomás, C; Blanch, E; Fazeli, A; Mocé, E

    2013-01-01

    The aim of this work was to examine how a pre-freezing treatment with cholesterol-loaded cyclodextrins (CLC) affects boar sperm longevity, capacitation dynamics, ability to bind to a porcine telomerase-immortalised oviductal epithelial cell line (TERT-OPEC) in vitro and DNA integrity dynamics after freeze-thawing. Although the samples treated with CLC exhibited lower sperm quality than the control samples (P0.05) after long-term incubation (26h at 37 or 16°C). Additionally, the CLC-treated spermatozoa underwent similar capacitation and DNA fragmentation dynamics as the control spermatozoa (P>0.05). However, CLC-treated spermatozoa were better able to bind to TERT-OPEC in vitro (POPEC in vitro, which could have an effect on the establishment of the sperm reservoir in the ampullary--isthmic junction in vivo. Additionally, frozen-thawed spermatozoa can be stored at 16°C for at least 6h without a significant observable decline in sperm quality, which could be beneficial for the transport of thawed diluted doses of spermatozoa from the laboratory to the farm.

  12. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  13. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  14. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. PENDUGAAN DAYA TAMPUNG RUSA LIAR (Cervus timorensis DI PADANG RUMPUT MAR TAMAN NASIONAL WASUR MERAUKE

    Directory of Open Access Journals (Sweden)

    Bambang Tjahyono Hariadi

    2014-06-01

    Full Text Available The objective of this experiment was to know carrying capacity of rusa deer (Cervus timorensisi at Mar, Wasur National Park Merauke district. The data collected were spesies of grasses, production each species and carrying capacity. The results showed species of grasses were Cynadon dactylon, Imperata cylindrica and Phragmites karka. Mar was dominated by Cynadon dactylon. The production of Cynodon dactylon was 2.183 kg/ha. The carryng capacity of rusa deer was 0.5 ha/head/year.

  16. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  17. Efeitos da lasalocida sódica e proporção volumoso/concentrados sobre a degradabilidade in situ do farelo de soja e do feno Coast Cross [Cynodon dactylon (L. Pers.] em vacas secas

    Directory of Open Access Journals (Sweden)

    Paulo Henrique Mazza Rodrigues

    2000-01-01

    Full Text Available Foram estudados os efeitos da lasalocida sódica e de diferentes proporções volumoso:concentrados sobre a degradabilidade da fibra (FDN e FDA e PB através de experimento em Quadrado Latino 4 x 4, utilizando-se quatro fêmeas bovinas dotadas de cânulas ruminais, pesando em média 500 kg de peso vivo. Os tratamentos foram dispostos em arranjo fatorial 2 x 2 com 40% ou 70% de volumoso na dieta (39% ou 59% de FDN e zero ou 200 mg de lasalocida/animal/dia. Utilizaram-se subperíodos de 21 dias, sendo os 16 primeiros destinados à adaptação dos animais à dieta, composta de feno de Coast Cross (Cynodon dactylon e mistura de concentrados. O ensaio de degradabilidade in situ pela técnica dos sacos de náilon foi realizado do 17º ao 21º dia, incubando-se o farelo de soja durante 0, 1,5, 3, 6, 12, 24 e 48 horas e o feno por 0, 6, 12, 24, 48, 72 e 96 horas. Interação foi observada entre lasalocida e a proporção volumoso:concentrados da dieta sobre a degradabilidade efetiva da FDN e FDA do feno (p < 0,05. Na ausência de lasalocida, menor proporção de volumoso diminuiu a degradabilidade da FDN e FDA em 12,0% e 12,7%, respectivamente, enquanto na sua presença as diminuições foram de 7,0% e 4,9%. Nenhum dos tratamentos alterou significativamente a degradabilidade efetiva da PB do farelo de soja.

  18. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  19. Heterogeneity of Soil and Vegetation in the Urban Habitats of New Industrial Cities in the Desert Landscape of Egypt

    Directory of Open Access Journals (Sweden)

    Monier Abd EL-GHANI

    2015-03-01

    Full Text Available The relationship between vegetation and soil supporting the habitats in 4 new industrial cities were assessed. Five main habitats were distinguished from inner city toward outskirts: lawns, home gardens, public gardens, waste lands and desert outskirts. After application of Twinspan, 26 vegetation groups were identified in the 5 recognized habitats, demonstrating that some groups are chatracteristic of a certain city, e.g. Asphodelus aestivus - Deverra tortuosa - Thymelaea hirsuta group was confined to the desert habitat of Burg El-Arab city; Thymelaea hirsuta - Linaria albifrons and Atriplex halimus - Atriplex lindleyi subsp. inflata - Suaeda vermiculata - Typha domingensis groups were found in the waste lands of Burg El-Arab city; Conyza bonariensis - Cynodon dactylon - Sonchus oleraceus group in the home garden habitat of 10th Ranadan city; Cynodon dactylon group in the lawns of Burg El-Arab city; Bassia indica - Plantago major group in the public gardens of Burg El-Arab city; Oxalis corniculata - Plantago lagopus group in the public gardens of 10th Ramadan city; Sonchus oleraceus - Cynodon dactylon and Dactyloctenium aegyptium - Leptochloa fusca - Phragmites australis groups in the public gardens of 6th October city. Silt, clay, organic matter, carbonates and carbon contents showed significant diffrences among the 5 habitats.

  20. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  1. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  2. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  4. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  5. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  6. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  7. Differentiating Fragmentation Pathways of Cholesterol by Two-Dimensional Fourier Transform Ion Cyclotron Resonance Mass Spectrometry.

    Science.gov (United States)

    van Agthoven, Maria A; Barrow, Mark P; Chiron, Lionel; Coutouly, Marie-Aude; Kilgour, David; Wootton, Christopher A; Wei, Juan; Soulby, Andrew; Delsuc, Marc-André; Rolando, Christian; O'Connor, Peter B

    2015-12-01

    Two-dimensional Fourier transform ion cyclotron resonance mass spectrometry is a data-independent analytical method that records the fragmentation patterns of all the compounds in a sample. This study shows the implementation of atmospheric pressure photoionization with two-dimensional (2D) Fourier transform ion cyclotron resonance mass spectrometry. In the resulting 2D mass spectrum, the fragmentation patterns of the radical and protonated species from cholesterol are differentiated. This study shows the use of fragment ion lines, precursor ion lines, and neutral loss lines in the 2D mass spectrum to determine fragmentation mechanisms of known compounds and to gain information on unknown ion species in the spectrum. In concert with high resolution mass spectrometry, 2D Fourier transform ion cyclotron resonance mass spectrometry can be a useful tool for the structural analysis of small molecules. Graphical Abstract ᅟ.

  8. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  9. Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1.

    Science.gov (United States)

    Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D

    2010-10-01

    Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.

  10. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  11. Role of cholesterol on the transfection barriers of cationic lipid/DNA complexes

    Science.gov (United States)

    Pozzi, Daniela; Cardarelli, Francesco; Salomone, Fabrizio; Marchini, Cristina; Amenitsch, Heinz; Barbera, Giorgia La; Caracciolo, Giulio

    2014-08-01

    Most lipid formulations need cholesterol for efficient transfection, but the precise motivation remains unclear. Here, we have investigated the effect of cholesterol on the transfection efficiency (TE) of cationic liposomes made of 1,2-dioleoyl-3-trimethylammonium-propane and dioleoylphosphocholine in Chinese hamster ovary cells. The transfection mechanisms of cholesterol-containing lipoplexes have been investigated by TE, synchrotron small angle X-ray scattering, and laser scanning confocal microscopy experiments. We prove that cholesterol-containing lipoplexes enter the cells using different endocytosis pathways. Formulations with high cholesterol content efficiently escape from endosomes and exhibit a lamellar-nonlamellar phase transition in mixture with biomembrane mimicking lipid formulations. This might explain both the DNA release ability and the high transfection efficiency. These studies highlight the enrichment in cholesterol as a decisive factor for transfection and will contribute to the rational design of lipid nanocarriers with superior TE.

  12. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  13. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  14. Synthesis, characterization and antimicrobial studies of bio silica ...

    Indian Academy of Sciences (India)

    2018-05-16

    May 16, 2018 ... Cynodon dactylon; green approach; silica nanoparticles; characterization; antimicrobial studies. 1. .... The obtained powder was well-ground with a mortar and ..... Inhalation of SiCl4 fumes irritates nose, throat and lungs.

  15. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    Science.gov (United States)

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  16. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  17. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  18. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  19. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  20. Physiological and Growth Responses of Six Turfgrass Species Relative to Salinity Tolerance

    Directory of Open Access Journals (Sweden)

    Md. Kamal Uddin

    2012-01-01

    Full Text Available The demand for salinity-tolerant turfgrasses is increasing due to augmented use of effluent or low-quality water (sea water for turf irrigation and the growing turfgrass industry in coastal areas. Experimental plants, grown in plastic pots filled with a mixture of river sand and KOSASR peat (9 : 1, were irrigated with sea water at different dilutions imparting salinity levels of 0, 8, 16, 24, 32, 40, or 48 dS m-1. Salinity tolerance was evaluated on the basis of leaf firing, shoot and root growth reduction, proline content, and relative water content. Paspalum vaginatum was found to be most salt tolerant followed by Zoysia japonica and Zoysia matrella, while Digitaria didactyla, Cynodon dactylon “Tifdwarf,” and Cynodon dactylon “Satiri” were moderately tolerant. The results indicate the importance of turfgrass varietal selection for saline environments.

  1. Fragmentation of sperm DNA using the TUNEL method.

    Science.gov (United States)

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  2. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  3. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Science.gov (United States)

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  4. Environmental Assessment for the Proposed Construction of a Gas Station, Car-Care Center, Shoppette and Class Six, and Taco John’s Restaurant at Keesler Air Force Base, Biloxi, Harrison County, Mississippi

    Science.gov (United States)

    2003-01-01

    Groundcover on base consists primarily of Bermuda grass ( Cynodon dactylon), centipede grass (Eremochloa ophiluroides), and St. Augustine grass...notification to allow adequate lime fori eview. COASTAL PROGRAM COMPLIANCE (Coastal ari • activities only) : ( ) The activity has been reviewed and

  5. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  6. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  7. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  8. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  9. Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection

    Energy Technology Data Exchange (ETDEWEB)

    Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad, E-mail: amtamadon@gmail.com [Shiraz University of Medical Sciences, Department of Pharmaceutics, School of Pharmacy (Iran, Islamic Republic of)

    2016-05-15

    Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and {sup 1}H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol{sub 40 %}) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.

  10. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  11. Large herbivores that strive mightily but eat and drink as friends

    NARCIS (Netherlands)

    Boer, de W.F.; Prins, H.H.T.

    1990-01-01

    Grazing in patches of Cynodon dactylon and of Sporobolus spicatus by four large herbivores, and the interaction between these sedentary herbivores was studied in Lake Manyara National Park, northern Tanzania. The herbivores were the African buffalo, Syncerus caffer; the African elephan, Loxodonta

  12. Nitrogen and Winter Cover Crop Effects on Spring and Summer Nutrient Uptake

    Science.gov (United States)

    Fertilization of bermudagrass [Cynodon dactylon (L.) Pers.] with swine-lagoon effluent in summer, April to September, does not match the period of productivity of the winter annual cover crops, annual ryegrass (Lolium multiflorum L.), cereal rye (Secale cereale), and berseem clover (Trifolium alexan...

  13. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  14. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  15. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  16. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Science.gov (United States)

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  17. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  18. China Report, Agriculture, Hubei Agricultural Geography

    Science.gov (United States)

    1984-03-14

    lime - stone is distributed fairly widely, the karst topography is fairly well developed with numerous hollowed out caves, underground streams, box...suitable for cattle fodder. This includes pasture grasses such as wild oats, verbena, dog’s tooth grass [ Cynodon dactylon], paspalum, agropyron, digitaria

  19. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  20. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  1. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  3. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  4. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  5. Phytoremediation of high phosphorus soil by annual ryegrass and common bermudagrass harvest

    Science.gov (United States)

    Removal of soil phosphorus (P) in crop harvest is a remediation option for soils high in P. This four-year field-plot study determined P uptake by annual ryegrass (ARG, Lolium multiflorum Lam.) and common bermudagrass (CB, Cynodon dactylon (L.) Pers.) from Ruston soil (fine-loamy, siliceous, thermic...

  6. Chemical composition, intake by sheep, and in situ disappearance in cannulated cows of bermudagrass hayed at two moisture concentrations and treated with a non-viable lactobacillus-lactic acid preservative

    Science.gov (United States)

    Bermudagrass [Cynodon dactylon (L.) Pers.] is commonly used for grazing and haying in the southern USA, but hay curing can be challenging due to frequent rainfall events during spring and early summer. An existing stand of ‘Greenfield’ bermudagrass was divided into 12 plots using a randomized comple...

  7. Use of FGD gypsum on a bermudagrass pasture in the Appalachian Plateau Region

    Science.gov (United States)

    Addition of industrial by-products from coal fired power plants (FGD gypsum and FGD gypsum + fly ash) are thought to increase plant production. Thus, a study was conducted to evaluate the effects of industrial by-products as a soil amendment on bermudagrass (Cynodon dactylon L.) yield. The study was...

  8. Growth of bermudagrass with white clover or nitrogen fertilizer

    Science.gov (United States)

    White clover (Trifolium repens) var ‘Durana’ was oversown into established bermudagrass (Cynodon dactylon) in 2009. Soil analysis indicated potassium (K) was low and potash at 112 and 336 kg/ha was added as main plots. Nitrogen as ammonium nitrate or an ammonium sulfate/urea blend was added as 0, 34...

  9. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  10. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  11. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  12. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  13. Evaluation of Antibacterial Activity of Some Traditionally Used Medicinal Plants against Human Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Bishnu P. Marasini

    2015-01-01

    Full Text Available The worldwide increase of multidrug resistance in both community- and health-care associated bacterial infections has impaired the current antimicrobial therapy, warranting the search for other alternatives. We aimed to find the in vitro antibacterial activity of ethanolic extracts of 16 different traditionally used medicinal plants of Nepal against 13 clinical and 2 reference bacterial species using microbroth dilution method. The evaluated plants species were found to exert a range of in vitro growth inhibitory action against the tested bacterial species, and Cynodon dactylon was found to exhibit moderate inhibitory action against 13 bacterial species including methicillin-resistant Staphylococcus aureus, imipenem-resistant Pseudomonas aeruginosa, multidrug-resistant Salmonella typhi, and S. typhimurium. The minimum inhibitory concentration (MIC values of tested ethanolic extracts were found from 31 to >25,000 μg/mL. Notably, ethanolic extracts of Cinnamomum camphora, Curculigo orchioides, and Curcuma longa exhibited the highest antibacterial activity against S. pyogenes with a MIC of 49, 49, and 195 μg/mL, respectively; whereas chloroform fraction of Cynodon dactylon exhibited best antibacterial activity against S. aureus with a MIC of 31 μg/mL. Among all, C. dactylon, C. camphora, C. orchioides, and C. longa plant extracts displayed a potential antibacterial activity of MIC < 100 μg/mL.

  14. Author Details

    African Journals Online (AJOL)

    Granger, J.E.. Vol 32, No 3 (2015) - Articles Establishing Cynodon dactylon on mining tailings and mining-impacted soil of a copper–cobalt mine in the Democratic Republic of the Congo Abstract. ISSN: 1022-0119. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...

  15. PEMANFAATAN SERESAH DAUN BAMBU (Dendrocalamus asper SEBAGAI BIOHERBISIDA PENGENDALI GULMA YANG RAMAH LINGKUNGAN

    Directory of Open Access Journals (Sweden)

    Lutfy Ditya Cahyanti

    2015-12-01

    Full Text Available Uncontrolled weed growth in the early stages of crop establishment, can decrease final crop yield. Phytochemical compounds from bamboo’s (Dendrocalamus sasper leaves known as flavonoids, phenolic and coumarin that inhibit the growth and development of weeds. The objective of this study was to utilizing bamboo’s leaves litter as bioherbicide for sustainable agricultural system. Weedy area used for observation of the effectiveness solution of bamboo’s leaves litter as bioherbicide is 1 m², first area for solution of bamboo’s leaves litter 10%, the second area for solution of bamboo’s leaves litter 5% and third plot only distilled water as a control treatment. Weeds SDR observations was done before spraying and 7 days after spraying bamboo’s leaves litter. The selected plot is a plot with diverse species of weeds. Observations SDR weeds to determine the level of effectiveness of a solution of bamboo’s leaf litter, was conducted used quadrant plots Weed species that dominated on our plot are Mikania micrantha, Eleusine indica, Cyperus rotundus, Cynodon stolon, Cynodon dactylon, Axonopus compressus dan Sanchus arvensis. Solution of bamboo’s leaves litter as bioherbicide are only capable controlled bermuda grass (Cynodon dactylon, both at a dose of 5 % and 10 %. For other species, solution of bamboo’s leaves litter did not work at

  16. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Conservation of soil, water and nutrients in surface runoff using riparian plant species.

    Science.gov (United States)

    Srivastava, Prabodh; Singh, Shipra

    2012-01-01

    Three riparian plant species viz. Cynodon dactylon (L.) Pers., Saccharum bengalensis Retz. and Parthenium hysterophorus L. were selected from the riparian zone of Kali river at Aligarh to conduct the surface runoff experiment to compare their conservation efficiencies for soil, water and nutrients (phosphorus and nitrogen). Experimental plots were prepared on artificial slopes in botanical garden and on natural slopes on study site. Selected riparian plant species showed the range of conservation values for soil and water from 47.11 to 95.22% and 44.06 to 72.50%, respectively on artificial slope and from 44.53 to 95.33% and 48.36 to 73.15%, respectively on natural slope. Conservation values for phosphorus and nitrogen ranged from 40.83 to 88.89% and 59.78 to 82.22%, respectively on artificial slope and from 50.01 to 90.16% and 68.07 to 85.62%, respectively on natural slope. It was observed that Cynodon dactylon was the most efficient riparian species in conservation of soil, water and nutrients in surface runoff.

  18. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Science.gov (United States)

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  19. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  20. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  1. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  2. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  3. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  4. Genetic relationships of bermudagrass (Cynodon dactylon var ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... 1Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing 210014, China. 2Key Laboratory ... cultivars developed in China, Australia and the USA by sequence-related amplified polymorphism. (SRAP) markers. ..... nursery, which might give rise to cross-contamination. The GSC of ...

  5. Cloning and expression of a novel lysophospholipase which structurally resembles lecithin cholesterol acyltransferase.

    Science.gov (United States)

    Taniyama, Y; Shibata, S; Kita, S; Horikoshi, K; Fuse, H; Shirafuji, H; Sumino, Y; Fujino, M

    1999-04-02

    Lecithin cholesterol acyltransferase (LCAT) is the key enzyme in the esterification of plasma cholesterol and in the reverse cholesterol transport on high-density lipoprotein (HDL). We have found a novel LCAT-related gene among differentially expressed cDNA fragments between two types of foam cells derived from THP-1 cells, which are different in cholesterol efflux ability, using a subtractive PCR technique. The deduced 412-amino-acid sequence has 49% amino acid sequence similarity with human LCAT. In contrast to the liver-specific expression of LCAT, mRNA expression of the gene was observed mainly in peripheral tissues including kidney, placenta, pancreas, testis, spleen, heart, and skeletal muscle. The protein exists in human plasma and is probably associated with HDL. Moreover, we discovered that the recombinant protein hydrolyzed lysophosphatidylcholine (lysoPC), a proatherogenic lipid, to glycerophosphorylcholine and a free fatty acid. We have therefore named this novel enzyme LCAT-like lysophospholipase (LLPL), through which a new catabolic pathway for lysoPC on lipoproteins could be elucidated. Copyright 1999 Academic Press.

  6. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  7. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  8. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  9. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Science.gov (United States)

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  10. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  11. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  12. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  13. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  14. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  15. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  16. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  17. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  18. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  19. Efficacy of Aqueous and Methanol Extracts of Some Medicinal Plants for Potential Antibacterial Activity

    OpenAIRE

    PAREKH, Jigna; JADEJA, Darshana; CHANDA, Sumitra

    2014-01-01

    Twelve medicinal plants were screened, namely Abrus precatorius L., Caesalpinia pulcherrima Swartz., Cardiospermum halicacabum L., Casuarina equisetifolia L., Cynodon dactylon (L.) Pers., Delonix regia L., Euphorbia hirta L., Euphorbia tirucalli L., Ficus benghalensis L., Gmelina asiatica L., Santalum album L., and Tecomella undulata (Sm.) Seem, for potential antibacterial activity against 5 medically important bacterial strains, namely Bacillus subtilis ATCC6633, Staphylococcus epidermidis A...

  20. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  1. Increased DNA methylation of scavenger receptor class B type I contributes to inhibitory effects of prenatal caffeine ingestion on cholesterol uptake and steroidogenesis in fetal adrenals

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Dong-Mei; He, Zheng; Ma, Liang-Peng; Wang, Lin-Long [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Ping, Jie, E-mail: pingjie@whu.edu.cn [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Diseases, Wuhan 430071 (China); Research Center of Food and Drug Evaluation, Wuhan University, Wuhan 430071 (China); Wang, Hui [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Diseases, Wuhan 430071 (China); Research Center of Food and Drug Evaluation, Wuhan University, Wuhan 430071 (China)

    2015-06-01

    Steroid hormones synthesized from cholesterol in the fetal adrenal are crucial for fetal development. We have observed the inhibited fetal adrenal corticosterone synthesis and increased intrauterine growth retardation (IUGR) rate in rats under prenatal caffeine ingestion. The aim of this study is to evaluate the effects of prenatal caffeine ingestion on cholesterol supply in fetal adrenal steroidogenesis in rats and explore the underlying epigenetic mechanisms. Pregnant Wistar rats were treated with 60 mg/kg·d caffeine from gestational day (GD) 7 to GD17. Histological changes of fetal adrenals and increased IUGR rates were observed in the caffeine group. There were significantly decreased steroid hormone contents and cholesterol supply in caffeine-treated fetal adrenals. Data from the gene expression array suggested that prenatal caffeine ingestion caused increased expression of genes related to DNA methylation and decreased expression of genes related to cholesterol uptake. The following conjoint analysis of DNA methylation array with these differentially expressed genes suggested that scavenger receptor class B type I (SR-BI) may play an important role in caffeine-induced cholesterol supply deficiency. Moreover, real-time RT-PCR and immunohistochemical detection certified the inhibitory effects of caffeine on both mRNA expression and protein expression of SR-BI in the fetal adrenal. And the increased DNA methylation frequency in the proximal promoter of SR-BI was confirmed by bisulfite-sequencing PCR. In conclusion, prenatal caffeine ingestion can induce DNA hypermethylation of the SR-BI promoter in the rat fetal adrenal. These effects may lead to decreased SR-BI expression and cholesterol uptake, which inhibits steroidogenesis in the fetal adrenal. - Highlights: • Prenatal caffeine ingestion inhibits steroid hormone production in the fetal adrenal. • Prenatal caffeine ingestion inhibits cholesterol uptake in the fetal adrenal. • Prenatal caffeine

  2. Increased DNA methylation of scavenger receptor class B type I contributes to inhibitory effects of prenatal caffeine ingestion on cholesterol uptake and steroidogenesis in fetal adrenals

    International Nuclear Information System (INIS)

    Wu, Dong-Mei; He, Zheng; Ma, Liang-Peng; Wang, Lin-Long; Ping, Jie; Wang, Hui

    2015-01-01

    Steroid hormones synthesized from cholesterol in the fetal adrenal are crucial for fetal development. We have observed the inhibited fetal adrenal corticosterone synthesis and increased intrauterine growth retardation (IUGR) rate in rats under prenatal caffeine ingestion. The aim of this study is to evaluate the effects of prenatal caffeine ingestion on cholesterol supply in fetal adrenal steroidogenesis in rats and explore the underlying epigenetic mechanisms. Pregnant Wistar rats were treated with 60 mg/kg·d caffeine from gestational day (GD) 7 to GD17. Histological changes of fetal adrenals and increased IUGR rates were observed in the caffeine group. There were significantly decreased steroid hormone contents and cholesterol supply in caffeine-treated fetal adrenals. Data from the gene expression array suggested that prenatal caffeine ingestion caused increased expression of genes related to DNA methylation and decreased expression of genes related to cholesterol uptake. The following conjoint analysis of DNA methylation array with these differentially expressed genes suggested that scavenger receptor class B type I (SR-BI) may play an important role in caffeine-induced cholesterol supply deficiency. Moreover, real-time RT-PCR and immunohistochemical detection certified the inhibitory effects of caffeine on both mRNA expression and protein expression of SR-BI in the fetal adrenal. And the increased DNA methylation frequency in the proximal promoter of SR-BI was confirmed by bisulfite-sequencing PCR. In conclusion, prenatal caffeine ingestion can induce DNA hypermethylation of the SR-BI promoter in the rat fetal adrenal. These effects may lead to decreased SR-BI expression and cholesterol uptake, which inhibits steroidogenesis in the fetal adrenal. - Highlights: • Prenatal caffeine ingestion inhibits steroid hormone production in the fetal adrenal. • Prenatal caffeine ingestion inhibits cholesterol uptake in the fetal adrenal. • Prenatal caffeine

  3. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Directory of Open Access Journals (Sweden)

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  4. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  5. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  6. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  7. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  8. Physiological Response to Salinity Stress by Primed Seedsof Three Species of Lawn

    Directory of Open Access Journals (Sweden)

    SH. Sedaghathoor

    2015-03-01

    Full Text Available Salinity is one of the most important ecological stresses which have undesirable effects on seed germination. This study was carried out to evaluate the germination of three species of lawn (Poa pratensis, Lolium perenne, Cynodon dactylon seeds under salinity stress. The effect of different treatments (Gibberellins 50 mgl-1, 2% CaCl2 and hydroprimig in 24 hours was evaluated on total germination, mean daily germination, maximum and mean germination percent in three species of lawn, under four levels of salinity (0, 3, 6, 9 dS/m. Priming factor (Gibberellins and water was more effective than salinity on the seed germination. Among lawn types, Lolium perenne and Cynodon dactylon indicated greater seed germination percentage and germination rate. The least rate and percentage of germination belonged to Poa pratensis. Among priming treatments, gibberellins had the greatest effect on germination, followed by hydropriming. However, interaction effects of "Lolium × CaCl2" were greater than other treatments on the mean daily germination and germination value. Based on the results, seed priming specially Gibberellins could be an appropriate substrate to improve seed germination in lawns, when grown under salinity.

  9. Embryo sac development in some representatives of the tribe Cynodonteae (Poaceae

    Directory of Open Access Journals (Sweden)

    A. Strydom

    1994-10-01

    Full Text Available Chloris virgata Sw., Cynodon dactylon (L. Pers., Harpochloa falx (L. f. Kuntze, and Tragus berteronianus Schult. have a Polygonum type of embryo sac development. Unreduced embryo sacs were found in Eustachys paspaloides (Vahl Lanza & Mattei,  Harpochloa falx, and  Rendlia altera (Rendle Chiov. Both facultative and obligate apomixis were observed. The Hieracium type of embryo sac development was observed in the aposporic specimens.

  10. Embryo sac development in some representatives of the tribe Cynodonteae (Poaceae)

    OpenAIRE

    A. Strydom; J. J. Spies

    1994-01-01

    Chloris virgata Sw., Cynodon dactylon (L.) Pers., Harpochloa falx (L. f.) Kuntze, and Tragus berteronianus Schult. have a Polygonum type of embryo sac development. Unreduced embryo sacs were found in Eustachys paspaloides (Vahl) Lanza & Mattei,  Harpochloa falx, and  Rendlia altera (Rendle) Chiov. Both facultative and obligate apomixis were observed. The Hieracium type of embryo sac development was observed in the aposporic specimens.

  11. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Science.gov (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  12. Grape juice concentrate prevents oxidative DNA damage in peripheral blood cells of rats subjected to a high-cholesterol diet.

    Science.gov (United States)

    Aguiar, Odair; Gollücke, Andréa Pittelli Boiago; de Moraes, Bárbara Bueno; Pasquini, Gabriela; Catharino, Rodrigo Ramos; Riccio, Maria Francesca; Ihara, Silvia Saiuli Miki; Ribeiro, Daniel Araki

    2011-03-01

    The goal of the present study was to investigate whether subchronic treatment with grape juice concentrate is able to protect liver and peripheral blood cells against cholesterol-induced injury in rats. The effects of the grape juice concentrate treatment on histopathological changes, immunohistochemistry for cyclo-oxygenase-2 (COX-2), and basal and oxidative DNA damage induced by H2O2 using a single-cell gel (comet) assay were evaluated. Male Wistar rats (n 18) were divided into three groups: group 1--negative control; group 2--cholesterol at 1 % (w/w) in their diet, treated for 5 weeks; group 3--cholesterol at 1 % in their chow, treated for 5 weeks, and grape juice concentrate at 222 mg/d in their drinking-water in the final week only. The results indicated that the treatment with grape juice concentrate did not show remarkable differences regarding liver tissue in group 3 compared with group 2. However, grape juice concentrate was able to decrease oxidative DNA damage induced by H2O2 in peripheral blood cells, as depicted by the tail moment results. COX-2 expression in the liver did not show statistically significant differences (P>0·05) between groups. Taken together, the present results suggest that the administration of subchronic grape juice concentrate prevents oxidative DNA damage in peripheral blood cells.

  13. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  14. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  15. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  16. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  17. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  18. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  19. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  20. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  1. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  2. Introducing inducible fluorescent split cholesterol oxidase to mammalian cells.

    Science.gov (United States)

    Chernov, Konstantin G; Neuvonen, Maarit; Brock, Ivonne; Ikonen, Elina; Verkhusha, Vladislav V

    2017-05-26

    Cholesterol oxidase (COase) is a bacterial enzyme catalyzing the first step in the biodegradation of cholesterol. COase is an important biotechnological tool for clinical diagnostics and production of steroid drugs and insecticides. It is also used for tracking intracellular cholesterol; however, its utility is limited by the lack of an efficient temporal control of its activity. To overcome this we have developed a regulatable fragment complementation system for COase cloned from Chromobacterium sp. The enzyme was split into two moieties that were fused to FKBP (FK506-binding protein) and FRB (rapamycin-binding domain) pair and split GFP fragments. The addition of rapamycin reconstituted a fluorescent enzyme, termed split GFP-COase, the fluorescence level of which correlated with its oxidation activity. A rapid decrease of cellular cholesterol induced by intracellular expression of the split GFP-COase promoted the dissociation of a cholesterol biosensor D4H from the plasma membrane. The process was reversible as upon rapamycin removal, the split GFP-COase fluorescence was lost, and cellular cholesterol levels returned to normal. These data demonstrate that the split GFP-COase provides a novel tool to manipulate cholesterol in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  4. Publication Index and Retrieval System.

    Science.gov (United States)

    1980-04-01

    is 60 percent solids (depending on the site) using lime dosages discussed in terms of the dredged material properties deter of 7 to 10 percent of the...grass ( Cynodon dactylon var alecia) Com- Station Environmental laboratory, December 19 18 1echn ponents of the habitat development site, consisting of the...Waterways Sound, are summarized. The sediments were fertilized and Experiment Station, Environmental Laboratory. August 1978 limed and planted with

  5. Hilly grasses and leaves: a promising unconventional feed resource for livestock.

    OpenAIRE

    Hossain M.E.; Karim M.H.; Ahmed M.I.; Sultana S.A.

    2016-01-01

    The study was undertaken to find out the chemical composition of different hilly grasses and leaves available in Bandarban areas of Bangladesh. Total 10 different hilly grasses and leaves such as Bottle gourd leaf (Lagenaria siceraria), Castor bean leaf (Ricinus communis), Cogon grass (Imperata cylindrica), Dhol kolmi (Ipomoea carnea), Giant reed leaf (Arundo donax), Hilly grass (Cynodon dactylon), Pithraj leaf (Aphanamixis polystachya), Sal leaf (Shorea robusta), Shegun leaf (Tectona grandis...

  6. Diversity of alkane hydroxylase genes on the rhizoplane of grasses planted in petroleum-contaminated soils

    OpenAIRE

    Tsuboi, Shun; Yamamura, Shigeki; Nakajima-Kambe, Toshiaki; Iwasaki, Kazuhiro

    2015-01-01

    The study investigated the diversity and genotypic features of alkane hydroxylase genes on rhizoplanes of grasses planted in artificial petroleum-contaminated soils to acquire new insights into the bacterial communities responsible for petroleum degradation in phytoremediation. Four types of grass (Cynodon dactylon, two phenotypes of Zoysia japonica, and Z. matrella) were used. The concentrations of total petroleum hydrocarbon effectively decreased in the grass-planted systems compared with t...

  7. Integrated management of bermudagrass (Cynodon dactylon) in sugarcane

    Science.gov (United States)

    Bermudagrass is a difficult perennial weed to manage in Louisiana sugarcane. Research was conducted to compare interrow tillage practice, postharvest residue management, and herbicide placement on bermudagrass proliferation and sugarcane yield. Tillage frequencies included conventional (four tillage...

  8. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  9. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  10. Abundance of food plant species and food habits of Rhinoceros unicorns Linn. in Pobitora Wildlife Sanctuary, Assam, India

    Directory of Open Access Journals (Sweden)

    P. Konwar

    2009-09-01

    Full Text Available Food habits and abundance of food plant species of Rhinoceros unicornis in Pobitora Wildlife Sanctuary were studied from January 1999 through December 2001. Totally 32 numbers of Rhino food plants were identified, of which 15 were grasses, four shrubs, five aquatic hydrophytes and eight tree species (21 terrestrial and 11 aquatic. During the dry season, the Rhino feeds on almost 90% food items from Hemarthria compressa, Arundo donax, Phragmites karka, Cerex rubro-brumee etc. The other short grasses such as Cynodon dactylon, Andropogon ssp., Cenchrus ciliaris, Chrysopogon aciculatus and tender and young shoots and twigs of Schelristechya fuesche, Saccharum spontaneum, Lagerstroemia flosreginae etc. are consumed in limited portions. The rhino consumes 11 cultivated crops and vegetables, viz., Ricinus communis, Oryza sativa, Solanum melongena, Lycopersicon esculentum, Solanum tuberosum, Brassica nigra, Luffa cylindrica, Luffa acutangula, Cucurbita moschata, Cucumis sativus and Ipomoea batatas etc. Highest density of food plant species observed in the study area were Cynodon dactylon (167.5/m2, Hemarthria compressa (73.75/m2, Vetiveria zizanioides (56/m2, Saccharum ravannae (51.5/m2, Pharagmites karka (50.75/m2, Leersia hexandra (46.75/m2, Brachiarea pseudointerrupta (40/m2 and Eichhornia crassipes (35/m2.

  11. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Directory of Open Access Journals (Sweden)

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  12. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Science.gov (United States)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  13. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  14. The regiochemical distribution of positive charges along cholesterol polyamine carbamates plays significant roles in modulating DNA binding affinity and lipofection.

    Science.gov (United States)

    Geall, A J; Eaton, M A; Baker, T; Catterall, C; Blagbrough, I S

    1999-10-15

    We have quantified the effects of the regiochemical distribution of positive charges along the polyamine moiety in lipopolyamines for DNA molecular recognition. High affinity binding leads to charge neutralisation, DNA condensation and ultimately to lipofection. Binding affinities for calf thymus DNA were determined using an ethidium bromide displacement assay and condensation was detected by changes in turbidity using light scattering. The in vitro transfection competence of cholesterol polyamine carbamates was measured in CHO cells. In the design of DNA condensing and transfecting agents for non-viral gene therapy, the interrelationship of ammonium ions, not just their number, must be considered.

  15. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Science.gov (United States)

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  16. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  17. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Science.gov (United States)

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  18. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  19. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  20. Effect of two phyto hormone producer rhizobacteria on the bermuda grass growth response and tolerance to phenanthrene

    International Nuclear Information System (INIS)

    Guerrero-Zuniga, A.; Rojas-Contreras, A.; Rodriguez-Dorantes, A.; Montes-Villafan, S.

    2009-01-01

    Plant growth-promoting rhizobacteria (PGPR) are free-living bacteria that have the ability to relieve environmental stress in plants, increasing the plant growth potential. Of importance to phytoremediation, PGPR stimulate plant root development and enhance root growth.This study evaluated the growth response and the tolerance to phenanthrene of Bermuda grass: Cynodon dactylon inoculated with two phytohormone producer rhizobacteria: strains II and III, isolated from a contaminated soil with petroleum hydrocarbons. (Author)

  1. Effect of two phyto hormone producer rhizobacteria on the bermuda grass growth response and tolerance to phenanthrene

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero-Zuniga, A.; Rojas-Contreras, A.; Rodriguez-Dorantes, A.; Montes-Villafan, S.

    2009-07-01

    Plant growth-promoting rhizobacteria (PGPR) are free-living bacteria that have the ability to relieve environmental stress in plants, increasing the plant growth potential. Of importance to phytoremediation, PGPR stimulate plant root development and enhance root growth.This study evaluated the growth response and the tolerance to phenanthrene of Bermuda grass: Cynodon dactylon inoculated with two phytohormone producer rhizobacteria: strains II and III, isolated from a contaminated soil with petroleum hydrocarbons. (Author)

  2. Roughage digestion evaluation in horses with total feces collection and mobile nylon bags

    OpenAIRE

    Rodrigues, Liziana Maria; Almeida, Fernando Queiroz de; Pereira, Marcos Barreto; Miranda, Ana Cláudia Tavares; Guimarães, Andresa; Andrade, Agnaldo Machado de

    2012-01-01

    This study aimed to evaluate the nutrient digestibility of roughages in horses with total feces collection and mobile bags. Two trials were carried out simultaneously. The first trial evaluated the digestibility of nutrients of coastcross hay (Cynodon dactylon cv. coastcross) with total feces collection. The second trial assessed the digestibility of nutrients of alfalfa hay (Medicago sativa), peanut (Arachis pintoi) and coastcross hay with mobile bags. This trial was conducted with gastric i...

  3. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  4. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  5. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    International Nuclear Information System (INIS)

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  6. EFEITO DA SUPLEMENTAÇÃO PROTÉICA SOBRE OS PARÂMETROS CLÍNICOS E PARASITOLÓGICOS DE OVINOS MANTIDOS EM PASTAGEM DE TIFTON 85 EFFECT OF PROTEIN SUPPLEMENTATION ON THE CLINICAL AND PARASITOLOGICAL PARAMETERS OF LAMBS UNDER PASTURE OF TIFTON 85

    Directory of Open Access Journals (Sweden)

    Daniel Maia Nogueira

    2009-12-01

    Full Text Available

    A suplementação proteica pode ser uma importante ferramenta para os sistemas de produção de ovinos em pastagens tropicais. Objetivou-se com este trabalho avaliar os parâmetros clínicos e parasitológicos de ovinos mantidos em pastagem de Tifton 85 (Cynodon dactylon irrigada, recebendo suplementos com diferentes fontes proteicas. Foram utilizados 28 ovinos castrados e mestiços, distribuídos homogeneamente em quatro tratamentos. Além do controle não suplementado, os tratamentos avaliados foram: farelo de soja, ureia e torta de algodão. Realizou-se a vermifugação dos animais de acordo com o método Famacha©. Não houve diferença significativa (P>0,05 entre os tratamentos para o consumo de matéria seca total, ganho médio diário e ganho de peso total. Foi observado maior consumo de forragem (P<0,05 para os animais mantidos exclusivamente em pastagem. Estes animais também apresentaram maior contagem de ovos por grama de fezes (OPG (P<0,05 em comparação aos suplementados com ureia ou com torta de algodão. Não houve diferença significativa (P>0,05 para os diferentes tons de coloração da conjuntiva nem para o número de animais vermifugados. Observou-se uma prevalência de 72,0% a 83,0% de larvas de Trichostrongylus sp. As diferentes suplementações proteicas não influenciaram as características clínicas nem produtivas dos animais.

    PALAVRAS-CHAVES: Cynodon dactylon, endoparasitas, Famacha©, farelo de soja, torta de algodão, ureia.
    The protein supplementation may be an important tool for sheep production systems in tropical grazing. This work aimed to evaluate parasitological and clinical aspects of lambs under irrigated pasture of Tifton 85 (Cynodon dactylon and receiving supplementation from different protein sources. Twenty-eight, castrated and crossbreed lambs, were used as animal testers and allocated into four treatments. Besides the control with exclusively use of pasture

  7. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  8. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  9. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  10. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Science.gov (United States)

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  11. Distribution of parthenium weed in peshawar valley, khyber pakhtunkhwa- pakistan

    International Nuclear Information System (INIS)

    Khan, H.; Marwat, K.B.; Hassan, M.G.; Khan, M.A.; Hashim, S.

    2014-01-01

    Parthenium hysterophorus L. is a weed of national significance in Pakistan. Although infesting many districts of Khyber Pakhtunkhwa province, but more affected districts are Swabi, Mardan, Charsadda and Peshawar where it is highly invasive and invaded most of the open spaces roadsides, etc and threatening the local biodiversity. Field survey of four districts of the Peshawar valley, Khyber Pakhtunkhwa viz. Swabi, Mardan, Charsadda and Peshawar were carried out during May-June, 2009-2010 to study the distribution and invasion of parthenium weed. Twenty five locations were sampled from each district. Data regarding absolute and relative density, frequency, relative frequency, importance valve %, average importance value, constancy classes and importance value constancy index of parthenium weed and other weeds of the area were recorded by using (1x1 m2) quadrate. The mean data across the surveyed districts reveals that the flora is predominated by parthenium weed with the highest relative density of 42.68% among all species. It was followed by Cannabis sativa, Cynodon dactylon and Cyperus rotundus, with relative densities of 15.17, 13.49 and 5.96, respectively. At different locations, it was observed that parthenium weed is competing with Cannabis sativa which is not so aggressive and problematic weed. While in some areas parthenium weed has already replaced Cannabis sativa. Mean distribution data showed that parthenium weed infestation was abundant and almost not uniform in all districts, however highest relative frequency of 26.14% was recorded for parthenium weed followed by Cannabis sativa, Cynodon dactylon and Cyperus rotundus having relative frequency of 15.17, 13.49 and 9.14, respectively. Rumex crispus and Xanthium strumarium infatuated the smallest relative frequency at most of the locations studied thereby indicating them as insignificant among the weed flora of the study area. Importance value data revealed that P. hysterophorus, Cannabis sativa, Cynodon

  12. Distribution of parthenium weed in peshawar valley, khyber pakhtunkhwa- pakistan

    Energy Technology Data Exchange (ETDEWEB)

    Khan, H.; Marwat, K. B.; Hassan, M. G.; Khan, M. A.; Hashim, S. [The University of Agriculture, Peshawar (Pakistan). Dept. of Weed Sciences

    2014-01-15

    Parthenium hysterophorus L. is a weed of national significance in Pakistan. Although infesting many districts of Khyber Pakhtunkhwa province, but more affected districts are Swabi, Mardan, Charsadda and Peshawar where it is highly invasive and invaded most of the open spaces roadsides, etc and threatening the local biodiversity. Field survey of four districts of the Peshawar valley, Khyber Pakhtunkhwa viz. Swabi, Mardan, Charsadda and Peshawar were carried out during May-June, 2009-2010 to study the distribution and invasion of parthenium weed. Twenty five locations were sampled from each district. Data regarding absolute and relative density, frequency, relative frequency, importance valve %, average importance value, constancy classes and importance value constancy index of parthenium weed and other weeds of the area were recorded by using (1x1 m2) quadrate. The mean data across the surveyed districts reveals that the flora is predominated by parthenium weed with the highest relative density of 42.68% among all species. It was followed by Cannabis sativa, Cynodon dactylon and Cyperus rotundus, with relative densities of 15.17, 13.49 and 5.96, respectively. At different locations, it was observed that parthenium weed is competing with Cannabis sativa which is not so aggressive and problematic weed. While in some areas parthenium weed has already replaced Cannabis sativa. Mean distribution data showed that parthenium weed infestation was abundant and almost not uniform in all districts, however highest relative frequency of 26.14% was recorded for parthenium weed followed by Cannabis sativa, Cynodon dactylon and Cyperus rotundus having relative frequency of 15.17, 13.49 and 9.14, respectively. Rumex crispus and Xanthium strumarium infatuated the smallest relative frequency at most of the locations studied thereby indicating them as insignificant among the weed flora of the study area. Importance value data revealed that P. hysterophorus, Cannabis sativa, Cynodon

  13. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Science.gov (United States)

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  14. The winter diet of elephant in Eastern Cape Subtropical Thicket, Addo Elephant National Park

    OpenAIRE

    R.G.T. Paley; G.I.H. Kerley

    1998-01-01

    Direct observational methods were used to establish the winter diet of elephants in Eastern Cape Subtropical Thicket in the Addo Elephant National Park, thereby determining which plant species were most at risk from elephant herbivory. A total of 70 species were identified as food plants for elephants, with the grass Cynodon dactylon and the succulents Portulacaria afra and Platythyra haeckeliana dominating, both in terms of frequency of feeding events and volume consumed. In view of the fact...

  15. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  16. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  17. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  18. Comparação entre dois métodos analíticos para determinação da lignina de algumas gramíneas forrageiras Comparison between two analytical methods for determining lignin concentration of some grass forages

    Directory of Open Access Journals (Sweden)

    Romualdo Shigueo Fukushima

    1999-06-01

    Full Text Available Foram comparados dois métodos analíticos para a determinação da lignina (lignina em detergente ácido - LDA e lignina permanganato de potássio - LPer bem como para averiguar a possível relação dos teores desse componente com a digestibilidade da fibra dos seguintes fenos: andropogon (Andropogon gayanus; aveia (Avena sativa; e dois tipos de coast-cross (Cynodon dactylon, um bem fenado e outro de baixa qualidade. Os valores de LDA e LPer foram diferentes (p This work was carried out aiming to compare lignin concentration of some grass forages through two analytical methods (acid detergent lignin - ADL and permanganate lignin - PerL as well to verify a possible relationship of lignin concentration with fiber digestion of the following grass hays: andropogon (Andropogon gayanus; oats (Avena sativa; a good quality and another of poor quality coast-cross (Cynodon dactylon. Acid detergent and permanganate lignin values were different (p <= 0.05 among the hays, however PerL concentrations were consistently lower than ADL values. There were differences (p <= 0.05 among the digestibility of neutral and acid detergent fiber fractions, however a clear relationship between these values with lignin concentration could not be assessed. The data suggested that lignin concentration, taken individually, is not the only factor to explain a given value of digestibility.

  19. Threats to rainfed and canal irrigated agro-ecosystems of the Punjab, Pakistan by weed infestation

    International Nuclear Information System (INIS)

    Hussain, M.; Ahmed, M.S.A.; Hameed, M.; Aqeel, M.

    2012-01-01

    To record the weed flora infesting the rainfed and canal irrigated arable fields in the Punjab province, three districts viz. Chakwal, Jhelum and Rawalpindi in rainfed agro-ecosystem, while three districts in canal irrigated wheat fields i.e., Sahiwal, Qasoor and Gujrat were surveyed comprehensively to examine weed spectra. Weeds occurring in various localities largely varied with the variation in the mode of irrigation i.e., Barani areas and Canal irrigated area. In Rainfed (Barani) areas Fumeria parviflora and Asphodelus tenuifolius were noted frequently while their representation was very rare or even absent in canal irrigated areas. Carthamus oxayacantha was also observed at some sites there. The only weeds growing infrequently were hardy grasses like Cynodon dactylon and Cyperus rotundus. None of the weed could cross the limits of occasional frequency level. Nevertheless, in canal irrigated areas Convolvulus arvensis, Anagalus arvensis, Chenopodium sp., Melilotus alba, Lepidium sativum, Lathyrus aphaca, Medicago denticulata, Rumex dentatus and Cynodon dactylon were frequently observed. Phalaris minor and Avena fatua formed very dense stands in many areas. Carthamus oxayacantha, Poa annua, Sonchus asper and Vicia sativa were recorded infrequently. The farmers of Sahiwal and Qasoor districts seem well informed about the importance and use of weedicides as a result the spectrum of weeds growing there was quite low and none of them could establish dense stands. (author)

  20. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  1. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Science.gov (United States)

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  2. Cynodon dactylon (L) Pers (Poaceae) root extract induces apoptotic ...

    African Journals Online (AJOL)

    has also been used for the treatment of weak vision, urinary tract infection, .... with an alternating 12 h dark/light cycle in ... detected by Western blot analysis as described previously .... the cyclin signaling pathways, induced apoptotic cell death ...

  3. Desidratação de cultivares de Cynodon spp. durante o processo de fenação Dehydration of Cynodon grass cultivars during haymaking

    Directory of Open Access Journals (Sweden)

    Geane Dias Gonçalves

    2001-05-01

    Full Text Available O experimento teve por objetivo avaliar a desidratação de cultivares de Cynodon spp. (Poaceae durante o processo de fenação. Foram realizadas amostragens nos tempos zero (momento do corte, 3, 6, 21, 24, 27 e 30 horas após o corte, a fim de se determinar a curva de desidratação e os teores de proteína bruta (PB da planta inteira e das frações folhas e colmos. Determinou-se também a espessura dos colmos de cada cultivar. Utilizou-se o delineamento experimental em blocos completamente casualizados em esquema fatorial 3x7 (cultivares x tempos de amostragens, com três repetições. A velocidade de perda de água foi semelhante para os cultivares avaliados, tanto para a planta como para as frações colmos e folhas. Não houve efeito para os teores de PB com o avanço nos tempos de secagem. Porém, houve diferença para a relação L/C, onde o Tifton 85 apresentou maior valor. Já para o diâmetro do colmo, o Tifton 44 foi superior em relação aos demais cultivares.Dehydration of cultivars of the genus Cynodon (Poaceae and the possible variations of chemical composition of forages during the haymaking process were evaluated. Three cultivars of Cynodon, Tifton 85, Coast cross and Tifton 44 were used, in plots of 15 m2, with three randomized blocks. Samples at 0 (cutting time, 3, 6, 21, 24, 27 and 30 hours after cutting were taken to determine the dehydration curve of whole plant, leaves and stem. Speed in water loss in plant, leaves and stem segments was similar in all cultivars. Drying did not affect CP taxes. There was, however, a difference for the leaves/stem relationship in which Tifton 85 had the highest value. Tifton 44 was higher in the other cultivars with regard to stem diameter.

  4. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  5. Phytostabilisation of copper-contaminated soil in Katanga: an experiment with three native grasses and two amendments.

    OpenAIRE

    Ngoy Shutcha; Mpundu Mubemba; Michel-Pierre Faucon; Michel Ngongo Luhembwe; Marjolein Visser; G Colinet; Pierre Jacques Meerts

    2010-01-01

    This study evaluates the feasibility of using the grass species Rendlia altera, Monocymbium ceresiiforme, Cynodon dactylon, and amendments (compost and lime) for the phytostabilisation of soils contaminated by Cu in the province of Katanga (Democratic Republic of Congo). Species were grown on control and Cu-contaminated plots (artificially contaminated with 2,500 mg kg-1 Cu) unamended (NA), amended with 4.5 kg compost m-2 or 0.2 kg lime m-2. R. altera was also grown on contaminated plots amen...

  6. Expression of CdDHN4, a Novel YSK2-Type Dehydrin Gene from Bermudagrass, Responses to Drought Stress through the ABA-Dependent Signal Pathway

    OpenAIRE

    Lv, Aimin; Fan, Nana; Xie, Jianping; Yuan, Shili; An, Yuan; Zhou, Peng

    2017-01-01

    Dehydrin improves plant resistance to many abiotic stresses. In this study, the expression profiles of a dehydrin gene, CdDHN4, were estimated under various stresses and abscisic acid (ABA) treatments in two bermudagrasses (Cynodon dactylon L.): Tifway (drought-tolerant) and C299 (drought-sensitive). The expression of CdDHN4 was up-regulated by high temperatures, low temperatures, drought, salt and ABA. The sensitivity of CdDHN4 to ABA and the expression of CdDHN4 under drought conditions wer...

  7. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  8. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  9. Molecular detection of ‘Candidatus Phytoplasma australasia’ and ‘Ca. P. cynodontis’ in Iraq

    Directory of Open Access Journals (Sweden)

    Alkuwaiti Nawres Abdulelah Sadeq

    2017-10-01

    Full Text Available The association of phytoplasma was investigated in symptomatic tomato (Solanum lycopersicum L., eggplant (Solanum melongen L., mallow (Malva spp. and Bermuda grass (Cynodon dactylon L. plants exhibiting witches’ broom and white leaf diseases, respectively. Total DNA was extracted from tomato (n=3, eggplant (n=2, mallow (n=2 and Bermuda grass (n=8 samples. Direct polymerase chain reaction (PCR was performed using P1/P7 primer set, then PCR products were sequenced. Sequences obtained from tomato, eggplant and mallow shared 99% maximum nucleotide identity with phytoplasma belonging to subgroup 16SrII-D, and resulted therefore ‘Candidatus Phytoplasma australasia’-related. Sequences obtained from Bermuda grass showed 100% maximum nucleotide identity to 16SrXIV-A subgroup and were ‘Ca. P. cynodontis’-related. The study presents the first molecular confirmation and sequence data of presence of ‘Ca. P. australasia’ and ‘Ca. P. cynodontis’ in Iraq.

  10. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  11. [Nutrient Characteristics and Nitrogen Forms of Rhizosphere Soils Under Four Typical Plants in the Littoral Zone of TGR].

    Science.gov (United States)

    Wang, Xiao-feng; Yuan, Xing-zhong; Liu, Hong; Zhang, Lei; Yu, Jian-jun; Yue, Jun-sheng

    2015-10-01

    The Three Gorges Reservoir (TGR), which is the largest water conservancy project ever built in tne world, produced a drawdown area of about 348.93 km2 because of water level control. The biological geochemical cycle of the soil in the drawdown zone has been changed as the result of long-term winter flooding and summer drought and vegetation covering. The loss of soil nitrogen in the drawdown zone poses a threat to the water environmental in TGR. Pengxi river, is an important anabranch, which has the largest drawdown area has been selected in the present study. The four typical vegetation, contained Cynodon dactylon, Cyperus rotundus, Anthium sibiricum and Zea mays L. as the control, were studied to measure nutrient characteristics and nitrogen forms of rhizosphere and non-rhizosphere soils in three distribution areas with different soil types (paddy soil, purple soil and fluvo-aquic soils). The variables measured included organic matter (OM), total nitrogen (TN), total phosphorus (TP), total potassium (TK), hydrolysis N, available P and available K, pH, ion-exchangeable N (IEE-N), weak acid extractable N (CF-N) , iron-manganese oxides N (IMOF-N), organic matter sulfide N (OSF-N), added up four N forms for total transferable N (TF-N) and TN minus TF-N for non-transferable N (NTF-N). The results showed: (1) pH of rhizosphere soil was generally lower than that of non-rhizosphere soil under different vegetation in different type soils because the possible organic acid and H+ released form plant roots and cation absorption differences, and the OM, TP, TN and hydrolysis N of rhizosphere soil were generally higher than those of non-rhizosphere soil, and that the enrichment ratio (ER) of all the four nutrient indicators showed Cyperus rotundus > Cynodon dactylon > Zea mays L. > Anthium sibiricum. Available P showed enrichment in the rhizosphere of three natural vegetations but lose under corn, and available K, TK showed different ER in different conditions. (2) IEF-N CF

  12. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  13. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  14. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  15. Genetic diversity among Korean bermudagrass (Cynodon spp.) ecotypes characterized by morphological, cytological and molecular approaches.

    Science.gov (United States)

    Kang, Si-Yong; Lee, Geung-Joo; Lim, Ki Byung; Lee, Hye Jung; Park, In Sook; Chung, Sung Jin; Kim, Jin-Baek; Kim, Dong Sub; Rhee, Hye Kyung

    2008-04-30

    The genus Cynodon comprises ten species. The objective of this study was to evaluate the genetic diversity of Korean bermudagrasses at the morphological, cytological and molecular levels. Morphological parameters, the nuclear DNA content and ploidy levels were observed in 43 bermudagrass ecotypes. AFLP markers were evaluated to define the genetic diversity, and chromosome counts were made to confirm the inferred cytotypes. Nuclear DNA contents were in the ranges 1.42-1.56, 1.94-2.19, 2.54, and 2.77-2.85 pg/2C for the triploid, tetraploid, pentaploid, and hexaploid accessions, respectively. The inferred cytotypes were triploid (2n = 3x = 27), tetraploid (2n = 4x = 36), pentaploid (2n = 5x = 45), and hexaploid (2n = 6x = 54), but the majority of the collections were tetraploid (81%). Mitotic chromosome counts verified the corresponding ploidy levels. The fast growing fine-textured ecotypes had lower ploidy levels, while the pentaploids and hexaploids were coarse types. The genetic similarity ranged from 0.42 to 0.94 with an average of 0.64. UPGMA cluster analysis and principle coordinate analysis separated the ecotypes into 6 distinct groups. The genetic similarity suggests natural hybridization between the different cytotypes, which could be useful resources for future breeding and genetic studies.

  16. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Science.gov (United States)

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  17. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Science.gov (United States)

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  18. Current Views on Genetics and Epigenetics of Cholesterol Gallstone Disease

    Directory of Open Access Journals (Sweden)

    Agostino Di Ciaula

    2013-01-01

    Full Text Available Cholesterol gallstone disease, one of the commonest digestive diseases in western countries, is induced by an imbalance in cholesterol metabolism, which involves intestinal absorption, hepatic biosynthesis, and biliary output of cholesterol, and its conversion to bile acids. Several components of the metabolic syndrome (e.g., obesity, type 2 diabetes, dyslipidemia, and hyperinsulinemia are also well-known risk factors for gallstones, suggesting the existence of interplay between common pathophysiological pathways influenced by insulin resistance, genetic, epigenetic, and environmental factors. Cholesterol gallstones may be enhanced, at least in part, by the abnormal expression of a set of the genes that affect cholesterol homeostasis and lead to insulin resistance. Additionally, epigenetic mechanisms (mainly DNA methylation, histone acetylation/deacetylation, and noncoding microRNAs may modify gene expression in the absence of an altered DNA sequence, in response to different lithogenic environmental stimuli, such as diet, lifestyle, pollutants, also occurring in utero before birth. In this review, we will comment on various steps of the pathogenesis of cholesterol gallstones and interaction between environmental and genetic factors. The epigenomic approach may offer new options for therapy of gallstones and better possibilities for primary prevention in subjects at risk.

  19. Cholesterol is essential for mitosis progression and its deficiency induces polyploid cell formation

    International Nuclear Information System (INIS)

    Fernandez, Carlos; Lobo, Maria del Val T.; Gomez-Coronado, Diego; Lasuncion, Miguel A.

    2004-01-01

    As an essential component of mammalian cell membranes, cells require cholesterol for proliferation, which is either obtained from plasma lipoproteins or synthesized intracellularly from acetyl-CoA. In addition to cholesterol, other non-sterol mevalonate derivatives are necessary for DNA synthesis, such as the phosphorylated forms of isopentane, farnesol, geranylgeraniol, and dolichol. The aim of the present study was to elucidate the role of cholesterol in mitosis. For this, human leukemia cells (HL-60) were incubated in a cholesterol-free medium and treated with SKF 104976, which inhibits cholesterol biosynthesis by blocking sterol 14α-demethylase, and the expression of relevant cyclins in the different phases of the cell cycle was analyzed by flow cytometry. Prolonged cholesterol starvation induced the inhibition of cytokinesis and the formation of polyploid cells, which were multinucleated and had mitotic aberrations. Supplementing the medium with cholesterol completely abolished these effects, demonstrating they were specifically due to cholesterol deficiency. This is the first evidence that cholesterol is essential for mitosis completion and that, in the absence of cholesterol, the cells fail to undergo cytokinesis, entered G1 phase at higher DNA ploidy (tetraploidy), and then progressed through S (rereplication) into G2, generating polyploid cells

  20. Transferability of SSR and RGA markers developed in Cynodon spp. to Zoysia spp.

    Science.gov (United States)

    Bermudagrass (Cynodon spp.) and zoysiagrass (Zoysia spp.), which are both used as warm-season turfgrasses in the United States, are members of subfamily Chloridoideae and are reported to be at least 55% genetically similar. To assess if molecular tools between the two species can be interchanged, 93...

  1. Relative variations of gut microbiota in disordered cholesterol metabolism caused by high-cholesterol diet and host genetics.

    Science.gov (United States)

    Bo, Tao; Shao, Shanshan; Wu, Dongming; Niu, Shaona; Zhao, Jiajun; Gao, Ling

    2017-08-01

    Recent studies performed provide mechanistic insight into effects of the microbiota on cholesterol metabolism, but less focus was given to how cholesterol impacts the gut microbiota. In this study, ApoE -/- Sprague Dawley (SD) rats and their wild-type counterparts (n = 12) were, respectively, allocated for two dietary condition groups (normal chow and high-cholesterol diet). Total 16S rDNA of fecal samples were extracted and sequenced by high-throughput sequencing to determine differences in microbiome composition. Data were collected and performed diversity analysis and phylogenetic analysis. The influence of cholesterol on gut microbiota was discussed by using cholesterol dietary treatment as exogenous cholesterol disorder factor and genetic modification as endogenous metabolic disorder factor. Relative microbial variations were compared to illustrate the causality and correlation of cholesterol and gut microbiota. It turned out comparing to genetically modified rats, exogenous cholesterol intake may play more effective role in changing gut microbiota profile, although the serum cholesterol level of genetically modified rats was even higher. Relative abundance of some representative species showed that the discrepancies due to dietary variation were more obvious, whereas some low abundance species changed because of genetic disorders. Our results partially demonstrated that gut microbiota are relatively more sensitive to dietary variation. Nevertheless, considering the important effect of bacteria in cholesterol metabolism, the influence to gut flora by "genetically caused cholesterol disorder" cannot be overlooked. Manipulation of gut microbiota might be an effective target for preventing cholesterol-related metabolic disorders. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  2. Changes in Soil Enzyme Activities and Microbial Biomass after Revegetation in the Three Gorges Reservoir, China

    Directory of Open Access Journals (Sweden)

    Qingshui Ren

    2018-05-01

    Full Text Available Soil enzymes and microbes are central to the decomposition of plant and microbial detritus, and play important roles in carbon, nitrogen, and phosphorus biogeochemistry cycling at the ecosystem level. In the present study, we characterized the soil enzyme activity and microbial biomass in revegetated (with Taxodium distichum (L. Rich. and Cynodon dactylon (L. Pers. versus unplanted soil in the riparian zone of the Three Gorges Dam Reservoir (TGDR, in order to quantify the effect of revegetation on the edaphic microenvironment after water flooding in situ. After revegetation, the soil physical and chemical properties in revegetated soil showed significant differences to those in unplanted soil. The microbial biomass carbon and phosphorus in soils of T. distichum were significantly higher than those in C. dactylon and unplanted soils, respectively. The microbial biomass nitrogen in revegetated T. distichum and C. dactylon soils was significantly increased by 273% and 203%, respectively. The enzyme activities of T. distichum and C. dactylon soils displayed no significant difference between each other, but exhibited a great increase compared to those of the unplanted soil. Elements ratio (except C/N (S did not vary significantly between T. distichum and C. dactylon soils; meanwhile, a strong community-level elemental homeostasis in the revegetated soils was found. The correlation analyses demonstrated that only microbial biomass carbon and phosphorus had a significantly positive relationship with soil enzyme activities. After revegetation, both soil enzyme activities and microbial biomasses were relatively stable in the T. distichum and C. dactylon soils, with the wooded soil being more superior. The higher enzyme activities and microbial biomasses demonstrate the C, N, and P cycling and the maintenance of soil quality in the riparian zone of the TGDR.

  3. Impact of solid waste burning air pollution on some physio-anatomical characteristics of some plants

    International Nuclear Information System (INIS)

    Laghari, S.K.; Zaidi, M.A.

    2015-01-01

    Present study evaluated the effect of solid waste burning pollution on carbohydrate, stomata and chlorophyll contents of seven different plant species. Leaf samples of Artemisia maritima L., Fraxinus excelsior L., Amaranthus viridis L., Cynodon dactylon L., Chenopodium album L., Robinia pseudoacacia L., and Sophora mollis (Royle) Baker, growing in the (1m, 500m and 1000m distance) vicinity of burning points at residential colony, University of Baluchistan Quetta were collected. Results revealed that the carbohydrate, chlorophyll a and b and total chlorophyll contents in the leaves of selected plant species were found to be significantly low at 1m distance, but as the distance from the source of pollution increased (500m and 1000m) these contents increased accordingly. Generally the percentage of completely and partially clogged stomata was found higher near the pollution source (1m distance). The percentage of open stomata in all investigated plant species was noticed lower near the pollution source (1m distance), while with the increase of distance (500m-1000m) the percentage of open stomata increased accordingly. As regard to carbohydrate and chlorophyll contents, the Artemisia maritima L., were found most sensitive to air pollution in all four directions at 1m distances as compared to the other species. While plant species, Cynodon dactylon L. showed more resistant to air pollution effect as regard to carbohydrate contents and high percentage of open stomata at 1m distances with respect to other species. (author)

  4. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  5. Cholesterol-induced conformational changes in the sterol-sensing domain of the Scap protein suggest feedback mechanism to control cholesterol synthesis.

    Science.gov (United States)

    Gao, Yansong; Zhou, Yulian; Goldstein, Joseph L; Brown, Michael S; Radhakrishnan, Arun

    2017-05-26

    Scap is a polytopic protein of endoplasmic reticulum (ER) membranes that transports sterol regulatory element-binding proteins to the Golgi complex for proteolytic activation. Cholesterol accumulation in ER membranes prevents Scap transport and decreases cholesterol synthesis. Previously, we provided evidence that cholesterol inhibition is initiated when cholesterol binds to loop 1 of Scap, which projects into the ER lumen. Within cells, this binding causes loop 1 to dissociate from loop 7, another luminal Scap loop. However, we have been unable to demonstrate this dissociation when we added cholesterol to isolated complexes of loops 1 and 7. We therefore speculated that the dissociation requires a conformational change in the intervening polytopic sequence separating loops 1 and 7. Here we demonstrate such a change using a protease protection assay in sealed membrane vesicles. In the absence of cholesterol, trypsin or proteinase K cleaved cytosolic loop 4, generating a protected fragment that we visualized with a monoclonal antibody against loop 1. When cholesterol was added to these membranes, cleavage in loop 4 was abolished. Because loop 4 is part of the so-called sterol-sensing domain separating loops 1 and 7, these results support the hypothesis that cholesterol binding to loop 1 alters the conformation of the sterol-sensing domain. They also suggest that this conformational change helps transmit the cholesterol signal from loop 1 to loop 7, thereby allowing separation of the loops and facilitating the feedback inhibition of cholesterol synthesis. These insights suggest a new structural model for cholesterol-mediated regulation of Scap activity. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Phytosociological Survey on the Central Coastal Lowlands of Eastern Saudi Arabia

    International Nuclear Information System (INIS)

    Farghali, Kotb Amer; Zareh, Moumn Mustafa

    2005-01-01

    The vegetation composition of the central coastal low lands of Eastern Saudi Arabia was analyzed. The appearance and distribution of the studied plant groupings were affected by atmospheric, by edaphic conditions as well as topography. Eighty seven species belonging to (33) families of flowering plants were recorded in the following seven plant communities which are dominated and co-dominated by (Zygophyllum qatarense), (Lasiurus scindicus and Lycium shawii), (Alhagi graecorum and Cynodon dactylon), (Phoenix dactelifera and Tamarix aphylla),(Aeluropuslagopoides and Sporobolous ioclados), ( Halocnemum strobilacium and Arthrocenemum macrostachyum) and (Avicennia marina). (author)

  7. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  8. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

    Science.gov (United States)

    Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

    2016-01-01

    DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  9. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

    Directory of Open Access Journals (Sweden)

    Sara Sadeghi

    2016-01-01

    Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  10. The response of the prostate to circulating cholesterol: activating transcription factor 3 (ATF3 as a prominent node in a cholesterol-sensing network.

    Directory of Open Access Journals (Sweden)

    Jayoung Kim

    Full Text Available Elevated circulating cholesterol is a systemic risk factor for cardiovascular disease and metabolic syndrome, however the manner in which the normal prostate responds to variations in cholesterol levels is poorly understood. In this study we addressed the molecular and cellular effects of elevated and suppressed levels of circulating cholesterol on the normal prostate. Integrated bioinformatic analysis was performed using DNA microarray data from two experimental formats: (1 ventral prostate from male mice with chronically elevated circulating cholesterol and (2 human prostate cells exposed acutely to cholesterol depletion. A cholesterol-sensitive gene expression network was constructed from these data and the transcription factor ATF3 was identified as a prominent node in the network. Validation experiments confirmed that elevated cholesterol reduced ATF3 expression and enhanced proliferation of prostate cells, while cholesterol depletion increased ATF3 levels and inhibited proliferation. Cholesterol reduction in vivo alleviated dense lymphomononuclear infiltrates in the periprostatic adipose tissue, which were closely associated with nerve tracts and blood vessels. These findings open new perspectives on the role of cholesterol in prostate health, and provide a novel role for ATF3, and associated proteins within a large signaling network, as a cholesterol-sensing mechanism.

  11. Cholesterol tethered bioresponsive polycation as a candidate for gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Ying [Second Affiliated Hospital, Medical College, Zhejiang University, Hangzhou 310009 (China); Wang Youxiang, E-mail: yx_wang@zju.edu.cn [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Macromolecular Synthesis and Functionalization, Ministry of Education, Zhejiang University, Hangzhou 310027 (China); Hu Qiaoling; Shen Jiacong [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Macromolecular Synthesis and Functionalization, Ministry of Education, Zhejiang University, Hangzhou 310027 (China)

    2009-04-30

    The efficient unpacking of viral protein shell gave the inspiration for the synthesized vectors. In this research, novel cholesterol tethered bioresponsive polyethylenimine (PEI) was specially designed via disulfide-containing cross-linker. The cholesterol lipid had proved to increase the permeability of gene vector through cell membrane. The acid-base titration indicated that the synthesized polycation possessed efficient proton sponge effect, which was suggested to increase endosomal release of pDNA complexes into the cytoplasm. The cholesterol tethered polycation could effectively induce DNA condensation and form spherical particles with diameter about 200 nm at N/P ratio of 10. At glutathione concentration of 3 mM, the polyplexes were unpacked due to the bioresponsive cleavage of the disulfide bonds. The in-vitro experiment indicated that the polyplexes showed efficient transfection efficiency to HEK293T cells. All the results indicated that the bioresponsive polycation could be served as an effective trigger to control the release of DNA at the intracellular environment. The novel bioresponsive polycation might have great potential in non-viral gene delivery research and application.

  12. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  13. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  15. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  16. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  17. Oxysterol Restraint of Cholesterol Synthesis Prevents AIM2 Inflammasome Activation.

    Science.gov (United States)

    Dang, Eric V; McDonald, Jeffrey G; Russell, David W; Cyster, Jason G

    2017-11-16

    Type I interferon restrains interleukin-1β (IL-1β)-driven inflammation in macrophages by upregulating cholesterol-25-hydroxylase (Ch25h) and repressing SREBP transcription factors. However, the molecular links between lipid metabolism and IL-1β production remain obscure. Here, we demonstrate that production of 25-hydroxycholesterol (25-HC) by macrophages is required to prevent inflammasome activation by the DNA sensor protein absent in melanoma 2 (AIM2). We find that in response to bacterial infection or lipopolysaccharide (LPS) stimulation, macrophages upregulate Ch25h to maintain repression of SREBP2 activation and cholesterol synthesis. Increasing macrophage cholesterol content is sufficient to trigger IL-1β release in a crystal-independent but AIM2-dependent manner. Ch25h deficiency results in cholesterol-dependent reduced mitochondrial respiratory capacity and release of mitochondrial DNA into the cytosol. AIM2 deficiency rescues the increased inflammasome activity observed in Ch25h -/- . Therefore, activated macrophages utilize 25-HC in an anti-inflammatory circuit that maintains mitochondrial integrity and prevents spurious AIM2 inflammasome activation. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

    Science.gov (United States)

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

    2017-09-01

    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  19. Scar-less multi-part DNA assembly design automation

    Science.gov (United States)

    Hillson, Nathan J.

    2016-06-07

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

  20. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    Science.gov (United States)

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  1. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  2. Evaluation of Warm Season Turfgrass under Different Irrigation Regimes in Arid Region

    Directory of Open Access Journals (Sweden)

    Abdullah Mohd Hassan ALSHEHHI

    2010-09-01

    Full Text Available Turfgrasses play a very important role in enhancing quality of life in modern urban living. Water quantity is the most important challenge worldwide in establishing and maintaining quality turf. The present study was aimed to test the performance of three warm season turfgrasses under four water levels for plantation in arid zones. Pits (48 measuring 1m length x 1m width x 0.6 m depth were planted with four replications of Common Bermuda grass (Cynodon dactylon, Tifway Bermuda grass (Cynodon dactylon x transvaalensis and Seashore Paspalum grass (Paspalum vaginatum in complete randomized design (CRD. Irrigation was done daily with 15 l/plot during the first 4 weeks (establishment period and four irrigation levels (5, 10, and 15, 20 l/lot were maintained in the following 8 weeks (treatment period. Physical parameters (canopy temperatures, ambient temperature, leaf area, shoot production and relative water content were measured once in two week as well as the visual quality (shoot color, shoot density and shoot uniformity was assessed, however, chlorophyll analysis was done in the end of the study. It was found that temperature has significant effect on performance of turfgrasses. Canopy temperature was higher than ambient temperature in the three turfgrasses but it has different level in each variety. Five liter of water per day per square meter gave acceptable turf quality when ambient temperature ranged from 20 to 33�C. Seashore paspalum performed best followed by Tifway Bermuda grass and common Bermuda grass respectively.

  3. Assessment of Caesium -137 accumulation from soil to autochthonous weeds

    International Nuclear Information System (INIS)

    Sreenivasa Chari, M.; Karuna Sagar, G.; Manjaiah, K.M.

    2017-01-01

    A study was conducted at Nuclear Research Laboratory (NRL), IARI, New Delhi to obtain radio cesium ( 137 Cs) Soil-to-plant transfer factors of autochthonous weeds at low level of contamination, where contamination is a legacy of experimental activities. Studied area is sporadically covered with autochthonous weeds mainly with Amaranthus viridis, Cynodon dactylon, Cassia auriculata, Brachiaria mutica, Parthenium hysterophorus, Bohervia diffusa and some taxonomically unidentified weeds. Extractability as well as bioavailability of 137 Cs was quantified by sequential extraction. In the representative plant and soil samples, 137 Cs activity was measured directly with the 2.5” × 2.5” NaI (TI) well type detector installed in 15 cm thick lead shield and single channel gamma analyzer. Transfer factors of grassy weeds were 0.143 to 0.310 (1.43 × 10 -2 to 3.1 × 10 -2 ), for broad leaved weeds 0.103 to 0.133 (1.03 × 10 -2 to 1.33 × 10 -2 ). Increase in the activity levels increased the transfer factors of weeds. Irrespective of activity levels higher transfer factors were observed in roots ranging from 0.13 to 0.28 (1. 3 × 10 -1 to 2.8 × 10 -1 ). At both the levels (40 and 80 µci) Cynodon dactylon recorded higher root and shoot transfer factor of 2.99 and 0.29 respectively, when compared to other weeds. Significantly lower transfer factors were observed in Parthenium hysterophorus. Geochemical partitioning shown that the reducible phase (56%) is the largest sink for 137 Cs in the studied soils

  4. Produção de massa seca e composição química de cinco cultivares de Cynodon = Dry matter production and chemical composition of five Cynodon cultivars

    Directory of Open Access Journals (Sweden)

    Luís Roberto de Andrade Rodrigues

    2006-07-01

    Full Text Available O experimento foi conduzido na Faculdade de Ciências Agrárias e Veterinárias, Unesp, Jaboticabal, Estado de São Paulo. Os tratamentos consistiram na avaliação de 5 cultivares de Cynodon, em 11 idades de corte, para estudo da característica crescimento e 5 idades para a avaliação da composição química. O delineamento experimental foi ointeiramente casualizado em parcelas subdivididas, com 3 repetições, considerando-se, nas parcelas, as cultivares (C e, nas subparcelas, as idades de corte (I. Foram avaliados a produção de massa seca (PMS, a relação folha/colmo, os teores de proteína bruta (PB, defibra em detergente neutro (FDN e de fibra em detergente ácido (FDA, nas folhas, nos colmos e na planta inteira. A PMS aumentou dos 14 aos 84 dias (PThe experiment was carried out at the Faculty of Ciências Agrárias e Veterinárias, Unesp, Jaboticabal, São Paulo State. The treatments aimed to evaluate five Cynodon cultivars at eleven cutting ages to study the characteristics of growing, and at five cutting ages toevaluate the chemical composition. A random design with split plot was adopted, with three replications, considering cultivars as plot and cutting age as subplots. The following variables were studied: dry matter (DM production, leaf/stem ratio and the contents of crude protein (CP, neutral detergent fiber (NDF and acid detergent fiber (ADF, in green leaf, stem and total plant. The highest DM production was from 14 to 84 days (P<0.01, and did not differ among cultivars. The leaf/stem ratio differ (P<0.01 among cultivars (C and decreased with plant age (I showing interaction C x I. The CP contents of the total plant were superior to the stem and inferior to the leaf. The NDF and ADF contents were similar among cultivars. The Cynodon cultivars would be better managed during 28 days of plant growth.

  5. Avaliação da ingestão súbita de melão com alto teor de açúcar sobre a saúde ruminal em ovinos não adaptados

    OpenAIRE

    Francisco Leonardo Costa de Oliveira

    2013-01-01

    O presente trabalho avaliou a possibilidade de duas diferentes quantidades de melão, com alto teor de açúcares, em causar acidose ruminal em ovinos não adaptados. Foram utilizados 12 ovinos mestiços Santa Inês, machos, providos de cânula ruminal, com 25 kg de P.V. e 8 m de idade, que nunca receberam rações concentradas, frutas ou raízes, anteriormente. Os animais foram mantidos em baias coletivas com dieta basal composta de volumoso (feno de capim Cynodon dactylon - Coast cross) na base de 2,...

  6. Factorial's composition of Lake Abha, Southwestern Saudi Arabia

    International Nuclear Information System (INIS)

    El-Beheiry, M.A.H

    2007-01-01

    The study analyzes the vegetation along Lake Abha in Southwestern Saudi Arabia. A total of 42 plant species were recorded. The annuals decrease and the biennials and perennials increase along the moisture gradient form the terraces to the free-water zone. Six vegetation clusters were identified. The most important are clusters which were identified by the presence of the following species: Phragmites australis, Juncus punctorius, Typha domingensis, Cyperus rotundus, Datura innoxia, Cynodon dactylon, Cornulaca monacantha and Potamogeton nododsus. Each of these communities has been analyzed by classification and ordination techniques and its habitat described and discussed. (author)

  7. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  8. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

    1986-01-01

    A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  9. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  10. Cell proliferation in the atherosclerotic plaques of cholesterol-fed rabbits

    International Nuclear Information System (INIS)

    Cavallero, C.; Tondo, U. di; Mingazinni, P.L.; Nicosia, R.; Pericoli, M.N.; Sarti, P.; Spagnoli, L.G.; Villaschi, S.

    1976-01-01

    Tritiated thymidine radioautography was employed to study the effect of cortisol and other glucocorticoids on cellular proliferation in the aorta and pulmonary artery of rabbits with cholesterol atherosclerosis. Labelled cell counts showed that glucocorticoids, even after one day and at a relatively low dose, decrease sharply the deoxyribonucleic acid synthesis in the intimal plaques. The hormonal influence on [ 3 H] thymidine uptake seems to be a dose-dependent process. The relative potency of these steroids in inhibiting DNA synthesis in the plaques parallels closely their anti-inflammatory effectiveness. Conversely mineralocorticoids, including aldosterone and deoxycorticosterone, increase the rate of DNA synthesis in the plaques. It is concluded that the anti-atherogenic effect of glucocorticoids on cholesterol-fed rabbits may be due, at least partly, to the inhibitory effect of these steroids on the DNA synthesis of the cellular components of the intimal plaques

  11. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  12. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  13. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  14. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  15. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  16. The influence of saponins on cell membrane cholesterol.

    Science.gov (United States)

    Böttger, Stefan; Melzig, Matthias F

    2013-11-15

    We studied the influence of structurally different saponins on the cholesterol content of cellular membranes. Therefore a cell culture model using ECV-304 urinary bladder carcinoma cells was developed. To measure the cholesterol content we used radiolabeled (3)H-cholesterol which is chemically and physiologically identical to natural cholesterol. The cells were pre-incubated with (3)H-cholesterol and after a medium change, they were treated with saponins to assess a saponin-induced cholesterol liberation from the cell membrane. In another experiment the cells were pre-incubated with saponins and after a medium change, they were treated with (3)H-cholesterol to assess a saponin-induced inhibition of cholesterol uptake into the cell membrane. Furthermore, the membrane toxicity of all applied saponins was analyzed using extracellular LDH quantification and the general cytotoxicity was analyzed using a colorimetric MTT-assay and DNA quantification. Our results revealed a correlation between membrane toxicity and general cytotoxicity. We also compared the results from the experiments on the saponin-induced cholesterol liberation as well as the saponin-induced inhibition of cholesterol uptake with the membrane toxicity. A significant reduction in the cell membrane cholesterol content was noted for those saponins who showed membrane toxicity (IC50 saponins either liberated (3)H-cholesterol from intact cell membranes or blocked the integration of supplemented (3)H-cholesterol into the cell membrane. Saponins with little influence on the cell membrane (IC50 >100 μM) insignificantly altered the cell membrane cholesterol content. The results suggested that the general cytotoxicity of saponins is mainly dependent on their membrane toxicity and that the membrane toxicity might be caused by the loss of cholesterol from the cell membrane. We also analyzed the influence of a significantly membrane toxic saponin on the cholesterol content of intracellular membranes such as those

  17. Comprehensive preimplantation genetic screening and sperm deoxyribonucleic acid fragmentation from three males carrying balanced chromosome rearrangements.

    Science.gov (United States)

    Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima

    2015-09-01

    To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.

  18. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  19. Molecular Cloning, Characterization, and Expression of Cuc m 2, a Major Allergen in Cucumis melo

    Directory of Open Access Journals (Sweden)

    Mojtaba Sankian

    2013-05-01

    Full Text Available Background: Several studies reported the clinical features of IgE-mediated hypersensitivity after ingestion of melon. Melon allergy is a common IgE-mediated fruit allergy in Iran. This prompted us to investigate immunochemical and molecular properties of the major allergen in melon fruit, to compare the IgE-binding capacity of the natural protein with the recombinant allergen, and to determine cross-reactivity of the major allergen with closely-related allergens from other plants displaying clinical cross-reactivity with melon. Methods: Identification and molecular characterization of the major melon allergen were performed using IgE immunoblotting, allergen-specific ELISA, affinity-based purifications, cross-inhibition assays, cloning, and expression of the allergen in Escherichia coli. Results: Melon profilin was identified and isolated as a major IgE-binding component and designated as Cuc m 2. Sequencing corresponding cDNA revealed an open reading frame of 363 bp coding for 131 amino acid residues and two fragments of 171 bp and 383 bps for the 5’and 3’ UTRs, respectively. Significant cross-reactivity was found between melon profilin and Cynodon dactylon, tomato, peach, and grape profilins in cross-inhibition assays. Although the highest degree of amino acid identity was revealed with watermelon profilin, there was no significant cross-reactivity between melon and watermelon profilins. Conclusion: Melon profilin is the major IgE-binding component in melon extract, and the recombinant and natural forms exhibited similar IgE-binding capacities. A part of the fruit-fruit and pollen-fruit cross-reactions could be explained by the presence of this conserved protein; however, sequence homology provides insufficient information to predict IgE cross-reactivity of profilins.

  20. Fragmentation of chromatin with 125I radioactive disintegrations

    International Nuclear Information System (INIS)

    Turner, G.N.; Nobis, P.; Dewey, W.C.

    1976-01-01

    The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated

  1. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  2. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    International Nuclear Information System (INIS)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

    2016-01-01

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  3. Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.

    Science.gov (United States)

    Wang, J W; Wu, J H; Huang, W Y; Tan, R X

    2006-03-01

    The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.

  4. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  5. Phytoremediation of some tropical soils contaminated with petroleum crude oil

    International Nuclear Information System (INIS)

    Oyibo, Charles

    2013-12-01

    This study was undertaken in three phases to identify (phase 1), screen (phase 11) and evaluate (phase 111) plants for their phytoremediation potential. In Phase 1, 15 plant species made up of grasses and legumes namely: Paspalum. vaginatum, Cynodon.dactylon, Pueraria. phaseoloides, Centrosema. pubescens, Panicum. maximum, Schrankia. leptocarpa, Eclipta. alba (Linn.), Cyperus. haspen (Linn.), Melastromastrum. capitatum, Acreceras. zizanoides Dandy, Pteridum aquilinum (Linn), Ludwigia.decurrens Walt,Setaria longiseta P.Beauv., Physalis angulata (Linn.), and Desmodium scorpiurus Desv.were identified on sites previously polluted by crude oil spills in the Niger Delta Area of Nigeria. The first 6 species were used in phase 11 while the first four species were earmarked (rolled over) for phase 111. Responses to Questionnaire indicated that majority of residents in the selected sites/communities had lived in these areas for 10 or more years had mainly JHS/SHS education; were self employed – mainly farmers and fishers although most were unemployed in the public sector. Adverse effects of the operations of oil companies particularly oil spillage on the environment and local residents include: loss of vegetation and farmlands, soil and water body contamination, weak social and cultural institutions (disrespect by youth for elders and institutions), militancy and hostage taking among youth from the area. In phase 11, seeds of legumes among the six selected species were collected from Accra, Aburi environs and Kusi in the Eastern region of Ghana; they were scarified, cultured in growth medium and the seedlings which emerged from them were transplanted into experimental pots, each containing 2000g of either Alajo or Toje soil series. One week after transplanting, each pot was simulated with a corresponding serial crude oil concentration of 0% (control) 1 % (24ml), 3% (83ml), 5.5% (130ml) and 8% (189ml) or 10% (237ml) in three replicates. These concentrations were arrived at

  6. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  7. Accumulation of low density lipoprotein associated cholesterol in calcifying vesicle fractions correlates with intimal thickening in thoracic aortas of juvenile rabbits fed a supplemental cholesterol diet

    Directory of Open Access Journals (Sweden)

    Culley Nathan C

    2006-10-01

    Full Text Available Abstract Background It has been shown that calcifying vesicles play an important role in aortic calcification and that cholesterol content in the isolated vesicle fraction is increased when rabbits are fed supplemental cholesterol diets. Whether lipoprotein-associated cholesterols and other lipids are also increased in the vesicle fraction and whether the increase correlates with atherosclerosis remain unknown. Results Fourteen juvenile male rabbits fed an atherogenic diet containing 0.5% cholesterol and 2% peanut oil for 3 months developed varying degrees of hypercholesterolemia and intimal thickening in the ascending thoracic aorta. The correlation between these two parameters was insignificant, and likely attributable to the use of small numbers of rabbits in this study. Despite this lack of correlation, we demonstrate that the accumulation of cholesterol in calcifying vesicle fractions obtained from the collagenase-digested aorta fragments correlates well with intimal thickening (r2 = 0.98, p Conclusion When limited numbers of rabbits are used, LDL-C accumulation in calcifying vesicle fractions is a better biomarker for atherosclerosis than LDL-C levels in the serum. The close association of LDL-C with calcifying vesicles may play an important role in atherosclerosis and calcification.

  8. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  9. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  10. Attractiveness of botanical infusions to ovipositing Culex quinquefasciatus, Cx. nigripalpus, and Cx. erraticus in San Antonio, Texas.

    Science.gov (United States)

    McPhatter, Lee P; Debboun, Mustapha

    2009-12-01

    Field experiments were conducted on the Fort Sam Houston Military Reservation, San Antonio, TX, in fall 2008 to observe the attractiveness of selected botanical infusions to ovipositing female mosquitoes. The following infusions were tested in Centers for Disease Control and Prevention gravid traps: Bermuda grass (Cynodon dactylon), oak leaf (Quercus virginiana), acacia leaf (Acacia schaffneri), rabbit chow (alfalfa pellets), and algae (Spirogyra sp.). Four (Bermuda, acacia, oak, and algae) of the 5 infusions were effective in collecting Culex quinquefasciatus, Cx. nigripalpus, and Cx. erraticus. Of the 4 infusions, Bermuda collected the greatest number of the mosquitoes sampled. Female Aedes albopictus mosquitoes were collected in moderate numbers during this study.

  11. Ordination Study of Vegetation Analysis Around Wetland Area: A Case Study of Mangla Dam, Azad Kashmir, Pakistan

    International Nuclear Information System (INIS)

    Urooj, R.; Ahmad, S. S.; Ahmad, M. N.; Ahmad, H.; Nawaz, M.

    2016-01-01

    Present study was conducted at Mangla Dam for vegetation ordinal classification by applying multivariate analysis in order to find relationship between vegetation and their edaphic factors. Samples of soil and herbaceous vegetation were randomly collected by using 1*1 square meter quadrats. Total 37 plant species belonging to 17 families were identified. Canonical Correspondence Analysis as direct ordination technique was applied by using CANOCO software. Results of analytical tests revealed that concentration of micro and macro nutrients along electrical conductivity and pH in different soil samples were varying to a greater level in study area while Cynodon dactylon showed higher abundance over broad range of all edaphic factors concentration. (author)

  12. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  13. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  14. Synchronization of DNA array replication kinetics

    Science.gov (United States)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  15. Characterization of gene expression associated with drought avoidance and tolerance traits in a perennial grass species.

    Directory of Open Access Journals (Sweden)

    Peng Zhou

    Full Text Available To understand molecular mechanisms of perennial grass adaptation to drought stress, genes associated with drought avoidance or tolerance traits were identified and their expression patterns were characterized in C4 hybrid bermudagrass [Cynodon dactylon (L. Pers.×C. transvaalensis Burtt Davy, cv. Tifway] and common bermudagrass (C. dactylon, cv. C299. Plants of drought-tolerant 'Tifway' and drought-sensitive 'C299' were exposed to drought for 5 d (mild stress and 10 d (severe stress by withholding irrigation in a growth chamber. 'Tifway' maintained significantly lower electrolyte leakage and higher relative water content than 'C299' at both 5 and 10 d of drought stress. Four cDNA libraries via suppression subtractive hybridization analysis were constructed and identified 277 drought-responsive genes in the two genotypes at 5 and 10 d of drought stress, which were mainly classified into the functional categories of stress defense, metabolism, osmoregulation, membrane system, signal and regulator, structural protein, protein synthesis and degradation, and energy metabolism. Quantitative-PCR analysis confirmed the expression of 36 drought up-regulated genes that were more highly expressed in drought-tolerant 'Tifway' than drought-sensitive 'C299', including those for drought avoidance traits, such as cuticle wax formation (CER1 and sterol desaturase, for drought tolerance traits, such as dehydration-protective proteins (dehydrins, HVA-22-like protein and oxidative stress defense (superoxide dismutase, dehydroascorbate reductase, 2-Cys peroxiredoxins, and for stress signaling (EREBP-4 like protein and WRKY transcription factor. The results suggest that the expression of genes for stress signaling, cuticle wax accumulation, antioxidant defense, and dehydration-protective protein accumulation could be critically important for warm-season perennial grass adaptation to long-term drought stress.

  16. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  18. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

    OpenAIRE

    Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

    2014-01-01

    Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

  19. Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

    Science.gov (United States)

    Treulen, F; Uribe, P; Boguen, R; Villegas, J V

    2016-02-01

    Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

  20. MLN64 induces mitochondrial dysfunction associated with increased mitochondrial cholesterol content

    Directory of Open Access Journals (Sweden)

    Elisa Balboa

    2017-08-01

    Full Text Available MLN64 is a late endosomal cholesterol-binding membrane protein that has been implicated in cholesterol transport from endosomal membranes to the plasma membrane and/or mitochondria, in toxin-induced resistance, and in mitochondrial dysfunction. Down-regulation of MLN64 in Niemann-Pick C1 deficient cells decreased mitochondrial cholesterol content, suggesting that MLN64 functions independently of NPC1. However, the role of MLN64 in the maintenance of endosomal cholesterol flow and intracellular cholesterol homeostasis remains unclear. We have previously described that hepatic MLN64 overexpression increases liver cholesterol content and induces liver damage. Here, we studied the function of MLN64 in normal and NPC1-deficient cells and we evaluated whether MLN64 overexpressing cells exhibit alterations in mitochondrial function. We used recombinant-adenovirus-mediated MLN64 gene transfer to overexpress MLN64 in mouse liver and hepatic cells; and RNA interference to down-regulate MLN64 in NPC1-deficient cells. In MLN64-overexpressing cells, we found increased mitochondrial cholesterol content and decreased glutathione (GSH levels and ATPase activity. Furthermore, we found decreased mitochondrial membrane potential and mitochondrial fragmentation and increased mitochondrial superoxide levels in MLN64-overexpressing cells and in NPC1-deficient cells. Consequently, MLN64 expression was increased in NPC1-deficient cells and reduction of its expression restore mitochondrial membrane potential and mitochondrial superoxide levels. Our findings suggest that MLN64 overexpression induces an increase in mitochondrial cholesterol content and consequently a decrease in mitochondrial GSH content leading to mitochondrial dysfunction. In addition, we demonstrate that MLN64 expression is increased in NPC cells and plays a key role in cholesterol transport into the mitochondria.

  1. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  2. Dietary and biliary cholesterol absorption in rats. Effect of dietary cholesterol level and cholesterol saturation of bile

    International Nuclear Information System (INIS)

    Wilson, M.D.

    1985-01-01

    The principal objective of this research was to determine if cholesterol introduced into the duodenum of rats in a micellar form as occurs with bile, is absorbed more efficiently than cholesterol presented in a nonmicellar form, as occurs with dietary cholesterol. Cholesterol absorption was measured during the constant intraduodenal infusion of liquid diets ([ 14 C] cholesterol) and artificial biles ([ 3 H] cholesterol) in thoracic lymph duct cannulated rats. Percentage absorption was calculated by dividing the rate of appearance of radiolabeled cholesterol in lymph by its rate of infusion when lymph cholesterol specific activity was constant. Results provide strong evidence that under certain conditions biliary cholesterol is more efficiently absorbed than is dietary cholesterol, and that this differential must be considered when evaluating the influence of diet or drug therapy on cholesterol absorption

  3. Produção e qualidade de pastagens de Coastcross-1 e milheto utilizadas com vacas leiteiras Production and quality of Coastcross-1 and pearl millet pastures utilized with dairy cows

    Directory of Open Access Journals (Sweden)

    Luciene Fernanda Barros Scaravelli

    2007-06-01

    Full Text Available O uso de pastagens do gênero Cynodon, em propriedades leiteiras do Rio Grande do Sul, tem crescido, especialmente na última década. O objetivo deste trabalho foi comparar a dinâmica, a produção de matéria seca, a qualidade e a composição botânica de pastagens de Coastcross-1 (Cynodon dactylon x C. nlemfluensis e milheto (Pennisetum americanum cv. Comum, sob sistema de pastejo rotacionado, com vacas em lactação da raça Holandês. Avaliaram-se a massa de forragem no pré-pastejo (MFPP, a taxa de acúmulo diário de matéria seca (TAD, a produção total de forragem (PTF e a composição botânica das pastagens. Para o milheto e a Coastcross-1, foram avaliados os componentes estruturais: lâmina foliar (LF, colmo + bainha (CB, outras espécies (OE e material morto (MM. Na entrada e saída dos animais da pastagem, foram colhidas amostras por simulação de pastejo para determinação dos teores de proteína bruta (PB e fibra em detergente neutro (FDN. Não houve diferença significativa (P>0,05 para MFPP, TAD, PTF e PB. O milheto apresentou maior disponibilidade de lâminas foliares (PThe use of pastures of the genus Cynodon has increased, for the last decade especially in dairy properties of Rio Grande do Sul. This research aims to compare the dynamic, dry matter production, quality and botanical composition of Coastcross-1 (Cynodon dactylon x C. nlemfluensis and pearl millet (Pennisetum americanum cv. Comum pastures. The pastures were utilized by lactating Holstein dairy cows under rotational stocking system. Pregraze dry matter availability (DMA, daily dry matter accumulation rate (DMR, total dry matter production (TDM were evaluated. For the botanical composition, the structural components: leaf blade (LB, stem + sheat (SS, dead material (DMT of pastures and other species (OS were evaluated. Before and after grazing, samples were collected by hand-plucking in order to determine the crude protein concentration (CP and neutral

  4. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  5. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  6. EcoTurf - a case study: genetic variation and agronomic potential of bermudagrass (Cynodon spp.) germplasm collected from Australian biodiversity

    Science.gov (United States)

    Australian Cynodon germplasm has not been comprehensively exploited for bermudagrass improvement. In this paper we will describe ‘EcoTurf’ a four year (2007-2011) project to develop water and nutrient use efficient bermudagrasses from Australian biodiversity. We describe the sampling strategies of A...

  7. In vitro and in vivo effects of polyethylene glycol (PEG)-modified lipid in DOTAP/cholesterol-mediated gene transfection

    DEFF Research Database (Denmark)

    Gjetting, Torben; Arildsen, Nicolai Skovbjerg; Christensen, Camilla Laulund

    2010-01-01

    DOTAP/cholesterol-based lipoplexes are successfully used for delivery of plasmid DNA in vivo especially to the lungs, although low systemic stability and circulation have been reported. To achieve the aim of discovering the best method for systemic delivery of DNA to disseminated tumors we evalua...... evaluated the potential of formulating DOTAP/cholesterol lipoplexes with a polyethylene glycol (PEG)-modified lipid, giving the benefit of the shielding and stabilizing properties of PEG in the bloodstream....

  8. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Science.gov (United States)

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  9. MILD CHOLESTEROL DEPLETION REDUCES AMYLOID-β PRODUCTION BY IMPAIRING APP TRAFFICKING TO THE CELL SURFACE

    Science.gov (United States)

    Guardia-Laguarta, Cristina; Coma, Mireia; Pera, Marta; Clarimón, Jordi; Sereno, Lidia; Agulló, José M.; Molina-Porcel, Laura; Gallardo, Eduard; Deng, Amy; Berezovska, Oksana; Hyman, Bradley T.; Blesa, Rafael; Gómez-Isla, Teresa; Lleó, Alberto

    2009-01-01

    It has been suggested that cellular cholesterol levels can modulate the metabolism of the amyloid precursor protein (APP) but the underlying mechanism remains controversial. In the current study, we investigate in detail the relationship between cholesterol reduction, APP processing and γ-secretase function in cell culture studies. We found that mild membrane cholesterol reduction led to a decrease in Aβ40 and Aβ42 in different cell types. We did not detect changes in APP intracellular domain or Notch intracellular domain generation. Western blot analyses showed a cholesterol-dependent decrease in the APP C-terminal fragments and cell surface APP. Finally, we applied a fluorescence resonance energy transfer (FRET)-based technique to study APP-Presenilin 1 (PS1) interactions and lipid rafts in intact cells. Our data indicate that cholesterol depletion reduces association of APP into lipid rafts and disrupts APP-PS1 interaction. Taken together, our results suggest that mild membrane cholesterol reduction impacts the cleavage of APP upstream of γ-secretase and appears to be mediated by changes in APP trafficking and partitioning into lipid rafts. PMID:19457132

  10. What's Cholesterol?

    Science.gov (United States)

    ... LDL. Most cholesterol is LDL (low-density lipoprotein) cholesterol. LDL cholesterol is more likely to clog blood vessels because ... Here's a way to remember the difference: the LDL cholesterol is the bad kind, so call it "lousy" ...

  11. Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

    DEFF Research Database (Denmark)

    Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

    1988-01-01

    Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

  12. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  13. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  14. Desempenho e características de carcaça de cordeiros Suffolk alimentados com diferentes volumosos Performance and carcass traits of Suffolk lambs fed with different roughages

    Directory of Open Access Journals (Sweden)

    Eduardo Antonio da Cunha

    2001-08-01

    Full Text Available Cordeiros da raça Suffolk, desmamados aos 60 dias e confinados, foram alimentados com silagem de milho, silagem de sorgo granífero ou feno de Coast cross (Cynodon dactylon L. Pears e ração concentrada (3,5% do peso vivo, com o objetivo de avaliar seu desempenho, a proporção dos componentes-não-carcaça e o rendimento e características das suas carcaças. Foi utilizado um delineamento completamente casualizado em esquema fatorial (três alimentos volumosos e dois sexos. Os animais alimentados com silagem de milho ou de sorgo mostraram maior (P0,05 pelo tipo de alimento, contudo, os animais alimentados com silagem de milho apresentaram carcaças com maior (P0,05 na proporção de músculos (60,0 e 60,7%. A silagem de sorgo pode substituir a silagem de milho para cordeiros confinados, contudo o uso do feno de gramínea reduz o seu desempenho.Suffolk lambs, weaned at 60 days, were raised in slatted floor pens and fed corn silage, sorghum silage or Coast cross hay (Cynodon dactylon L. Pears plus concentrate ration (3,5% of live weight to evaluate their performance, proportion of non-carcass components and carcass dressing and traits. A completely randomized design in a factorial arrangement (tree roughage feed X two sexes was used. Lambs fed corn silage or sorghum silage showed greater (P0.05 between feeds, although, lambs fed corn silage showed greater (P0.05 in proportion of muscle (60.0 and 60.7%. Sorghum silage can replace corn silage for feedlot lambs, but grass hay feeding worsens their performance.

  15. Substituição do milho por farelo de palma forrageira em dietas de ovinos em crescimento: desempenho Replacement of corn by forage cactus meal in growing lambs diets: performance

    Directory of Open Access Journals (Sweden)

    Robson Magno Liberal Véras

    2005-02-01

    Full Text Available Objetivou-se, com este trabalho, avaliar quatro níveis de substituição do milho (0; 33; 67 e 100% pelo farelo de palma forrageira sobre o desempenho de ovinos em crescimento terminados em confinamento. Vinte carneiros mestiços Santa Inês foram distribuídos em delineamento em blocos ao acaso, com quatro tratamentos (níveis de substituição do milho pelo farelo de palma e cinco repetições. Além do milho e/ou farelo de palma, os animais receberam feno de Tifton (Cynodon dactylon, como volumoso, farelo de soja, calcário e sal mineral. O ganho de peso e a conversão alimentar diminuíram, enquanto os consumos de FDN e de FDA aumentaram linearmente com a substituição. Os consumos de matéria seca, de proteína bruta, de matéria orgânica e de carboidratos totais e o rendimento de carcaça não foram influenciados pela substituição do milho pelo farelo de palma.The objective of this work was to evaluate four corn replacement levels (0, 33, 67 and 100% by forage cactus meal on performance of feedlot growing lambs. Twenty crossbred lambs were allotted to a completely randomized block design with four treatments (replacement of corn by forage cactus meal and five replications. Besides corn and/or forage cactus meal, the animals were fed Tifton hay (Cynodon dactylon, as forage, soybean meal, limestone and mineral salt. Weight gain and feed:gain ratio decreased and intakes of NDF and ADF increased linearly with corn replacement. The intakes of dry matter, crude protein, organic matter and total carbohydrates and carcass yield were not affected by replacement of corn by forage cactus meal.

  16. Screening of salt-tolerance potential of some native forage grasses from the eastern part of Terai-Duar grasslands in India

    Directory of Open Access Journals (Sweden)

    Swarnendu Roy

    2017-09-01

    Full Text Available The salt tolerance of 12 native forage grasses from the eastern part of Terai-Duar grasslands was assessed using a rapid method of leaf disc senescence bioassay. Samples of these grasses were grown in untreated water as well as 100 and 200 mM NaCl solutions for periods of 3, 6 and 9 days. Discs of fresh leaf were then placed in untreated water as well as in 100 and 200 mM NaCl solutions for 96 hours. Quantitative effects were measured as the effects on chlorophyll concentration in leaves in response to exposure to the varying solutions. From these results, the salt sensitivity index (SSI of the individual grasses was determined. The SSI values indicated that Imperata cylindrica, Digitaria ciliaris and Cynodon dactylon were most salt-tolerant of all grasses tested. Further characterization of the grasses was done by observing the changes in 6 biomarkers for salinity tolerance: relative water content, total sugar concentration, proline concentration, electrolyte leakage, membrane lipid peroxidation and H2O2 concentration following exposure to 100 and 200 mM NaCl concentrations for 3, 6 and 9 days. Finally, hierarchical cluster analysis using the software CLUSTER 3.0 was used to represent the inter-relations among the physiological parameters and to group the grasses on the basis of their salinity tolerance. The overall results indicated that Imperata cylindrica, Eragrostis amabilis, Cynodon dactylon and Digitaria ciliaris were potentially salt-tolerant grasses and should be planted on saline areas to verify our results. On the other hand, Axonopus compressus, Chrysopogon aciculatus, Oplismenus burmanni and Thysanolaena latifolia were found to be highly salt-sensitive and would be unsuitable for use in saline areas. 

  17. Efeito da adição de soro de leite sobre a digestibilidade aparente e os parâmetros sanguíneos de vacas secas Effect of whey addition on apparent digestibility and blood parameters of dry cows

    Directory of Open Access Journals (Sweden)

    F.M. David

    2010-10-01

    Full Text Available Avaliou-se o efeito da adição de soro de leite líquido à dieta sobre os parâmetros sanguíneos e sobre a digestibilidade aparente da matéria seca (DAMS, da proteína bruta (DAPB, da fibra em detergente neutro (DAFDN e da fibra em detergente ácido (DAFDA em 12 vacas Girolando, secas, que receberam feno de coastcross (Cynodon dactylon, suplementado com sal proteinado, e zero (controle, 15, 30 ou 45 litros de soro de leite/dia. A adição de soro na dieta afetou a DAMS e a DAPB (PThe effect of liquid whey addition in the diet on blood parameters and on the apparent digestibility of dry matter (ADDM, crude protein (ADCP, neutral detergent fiber (ADNDF, and acid detergent fiber (ADADF was evaluated in 12 dry Gir cows, receiving coastcross (Cynodon dactylon hay supplemented with protein salt and zero (control, 15, 30, or 45 liters of whey per day. The inclusion of the whey in the diet affected the ADDM and ADCP (P<0.01 and had no effect on ADNDF and ADADF. As high the volume of whey inclusion, higher the ADDM and ADCP values. The average values of glucose in blood plasma - 59.3, 64.0, 66.6, and 69.2mg/dL - varied (P<0.01 among treatments, adjusting themselves to positive linear dL regressions. The whey inclusion diminished (P<0.01 blood urea values - 22.83, 20.17, 17.5, and 15.67. The whey improved the efficiency of utilization of nitrogen compounds in the rumen and can be used to complement protein supplements with high levels of urea.

  18. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  19. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  20. Pharmacokinetics and Toxicity in Rats and Monkeys of coDbait: A Therapeutic Double-stranded DNA Oligonucleotide Conjugated to Cholesterol

    Directory of Open Access Journals (Sweden)

    Anne Schlegel

    2012-01-01

    Full Text Available Increased DNA repair activity in cancer cells is one of their primary mechanisms of resistance to current radio- and chemotherapies. The molecule coDbait is the first candidate in a new class of drugs that target the double-strand DNA break repair pathways with the aim of overcoming these resistances. coDbait is a 32-base pair (bp double-stranded DNA molecule with a cholesterol moiety covalently attached to its 5′-end to facilitate its cellular uptake. We report here the preclinical pharmacokinetic and toxicology studies of subcutaneous coDbait administration in rodents and monkeys. Maximum plasma concentration occurred between 2 to 4 hours in rats and at 4 hours in monkeys. Increase in mean AUC0–24h was linear with dose reaching 0.5 mg·h/ml for the highest dose injected (32 mg for both rats and monkeys. No sex-related differences in maximum concentration (Cmax nor AUC0–24h were observed. We extrapolated these pharmacokinetic results to humans as the subcutaneous route has been selected for evaluation in clinical trials. Tri-weekly administration of coDbait (from 8 to 32 mg per dose for 4 weeks was overall well tolerated in rats and monkeys as no morbidity/mortality nor changes in clinical chemistry and histopathology parameters considered to be adverse effects have been observed.

  1. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  2. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

  3. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  4. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  5. Oxidative Stress, DNA Damage and DNA Repair in Female Patients with Diabetes Mellitus Type 2.

    Directory of Open Access Journals (Sweden)

    Annemarie Grindel

    Full Text Available Diabetes mellitus type 2 (T2DM is associated with oxidative stress which in turn can lead to DNA damage. The aim of the present study was to analyze oxidative stress, DNA damage and DNA repair in regard to hyperglycemic state and diabetes duration.Female T2DM patients (n = 146 were enrolled in the MIKRODIAB study and allocated in two groups regarding their glycated hemoglobin (HbA1c level (HbA1c≤7.5%, n = 74; HbA1c>7.5%, n = 72. In addition, tertiles according to diabetes duration (DD were created (DDI = 6.94±3.1 y, n = 49; DDII = 13.35±1.1 y, n = 48; DDIII = 22.90±7.3 y, n = 49. Oxidative stress parameters, including ferric reducing ability potential, malondialdehyde, oxidized and reduced glutathione, reduced thiols, oxidized LDL and F2-Isoprostane as well as the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase were measured. Damage to DNA was analyzed in peripheral blood mononuclear cells and whole blood with single cell gel electrophoresis. DNA base excision repair capacity was tested with the modified comet repair assay. Additionally, mRNA expressions of nine genes related to base excision repair were analyzed in a subset of 46 matched individuals.No significant differences in oxidative stress parameters, antioxidant enzyme activities, damage to DNA and base excision repair capacity, neither between a HbA1c cut off />7.5%, nor between diabetes duration was found. A significant up-regulation in mRNA expression was found for APEX1, LIG3 and XRCC1 in patients with >7.5% HbA1c. Additionally, we observed higher total cholesterol, LDL-cholesterol, LDL/HDL-cholesterol, triglycerides, Framingham risk score, systolic blood pressure, BMI and lower HDL-cholesterol in the hyperglycemic group.BMI, blood pressure and blood lipid status were worse in hyperglycemic individuals. However, no major disparities regarding oxidative stress, damage to DNA and DNA repair were present which might be due to good medical

  6. Mixed arbuscular mycorrhizal (AM) fungal application to improve growth and arsenic accumulation of Pteris vittata (As hyperaccumulator) grown in As-contaminated soil.

    Science.gov (United States)

    Leung, H M; Leung, A O W; Ye, Z H; Cheung, K C; Yung, K K L

    2013-08-01

    A greenhouse pot experiment was conducted to study the effects of three types of single inoculum [indigenous mycorrhizas (IM) isolated from As mine, Glomus mosseae (GM) and Glomus intraradices (GI)] and two types of mixed inoculum (mixed with IM and either GM or GI) on the growth response of Pteris vittata (hyperaccumulator) and Cynodon dactylon (non-hyperaccumulator) at three levels of As concentrations (0, 100 and 200mgkg(-1)). Both mycorrhizal plants exhibited significantly higher biomass, and N and P accumulation in its tissue than the control. Among the mycorrhizal inoculum, the mixed inoculum IM/GM promoted substantially higher mycorrhizal colonization and arsenate reductase activity in P. vittata than C. dactylon, among all As levels. The portion of Paris arbuscular mycorrhizal structure (observed in colonized roots) together with the highest As translocation factor of 10.2 in P. vittata inoculated with IM/GM was also noted. It was deduced that IM/GM inoculum may be the best choice for field inoculation at any contaminated lands as the inoculum exhibited better adaptation to variable environmental conditions and hence benefited the host plants. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  7. Interactions of mycorrhizal fungi with Pteris vittata (As hyperaccumulator) in As-contaminated soils

    International Nuclear Information System (INIS)

    Leung, H.M.; Ye, Z.H.; Wong, M.H.

    2006-01-01

    A greenhouse trial was conducted to investigate the role of arbuscular mycorrhizas (AM) in aiding arsenic (As) uptake and tolerance by Pteris vittata (As hyperaccumulator) and Cynodon dactylon (a multi-metal root accumulator). Plants inoculated with lived and killed native mycorrhizas isolated from an As mine site were grown in a sterile and slightly acidic soil. The infectious percentage of mycorrhizas (0 mg/kg As: 26.4%, 50 mg/kg As: 30.3%, 100 mg/kg As: 40.6%) and the average biomass of shoots in infected P. vittata increased (0 mg/kg As: 2.45 g/pot, 50 mg/kg As: 2.48 g/pot, 100 mg/kg As: 10.9 g/pot) according to the increase of As levels when compared to control. The indigenous mycorrhizas enhanced As accumulation (0 mg/kg As: 3.70 mg/kg, 50 mg/kg As: 58.3 mg/kg; 100 mg/kg As: 88.1 mg/kg) in the As mine populations of P. vittata and also sustained its growth by aiding P absorption. For C. dactylon, As was mainly accumulated in mycorrhizal roots and translocation to shoots was inhibited. - Indigenous mycorrhizal fungi play an important role in As tolerance

  8. Interactions of mycorrhizal fungi with Pteris vittata (As hyperaccumulator) in As-contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Leung, H.M. [Croucher Institute for Environmental Sciences, and Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong Kong (China); Ye, Z.H. [Croucher Institute for Environmental Sciences, and Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong Kong (China); School of Life Sciences, Zhongshan University, Guangzhou 510275 (China); Wong, M.H. [Croucher Institute for Environmental Sciences, and Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong Kong (China)]. E-mail: mhwong@hkbu.edu.hk

    2006-01-15

    A greenhouse trial was conducted to investigate the role of arbuscular mycorrhizas (AM) in aiding arsenic (As) uptake and tolerance by Pteris vittata (As hyperaccumulator) and Cynodon dactylon (a multi-metal root accumulator). Plants inoculated with lived and killed native mycorrhizas isolated from an As mine site were grown in a sterile and slightly acidic soil. The infectious percentage of mycorrhizas (0 mg/kg As: 26.4%, 50 mg/kg As: 30.3%, 100 mg/kg As: 40.6%) and the average biomass of shoots in infected P. vittata increased (0 mg/kg As: 2.45 g/pot, 50 mg/kg As: 2.48 g/pot, 100 mg/kg As: 10.9 g/pot) according to the increase of As levels when compared to control. The indigenous mycorrhizas enhanced As accumulation (0 mg/kg As: 3.70 mg/kg, 50 mg/kg As: 58.3 mg/kg; 100 mg/kg As: 88.1 mg/kg) in the As mine populations of P. vittata and also sustained its growth by aiding P absorption. For C. dactylon, As was mainly accumulated in mycorrhizal roots and translocation to shoots was inhibited. - Indigenous mycorrhizal fungi play an important role in As tolerance.

  9. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Science.gov (United States)

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  10. Comparaison du Pangola (Digitaria decumbens) et du Stargrass (Cynodon nlemfluensis) exploités par des ovins

    OpenAIRE

    Boval, Maryline

    1989-01-01

    A la Martinique l'utilisation comparée de Digitaria decumbens (Dd) et de Cynodon nlemfuensis (Cn) par des brebis allaitantes a été étudiée pendant une période d'observation de 6 mois. Le cheptel est à un taux élevé de 1 600 kg de poids vif par hectare et par an, obtenu par une fertilisation de 450 kg/ha/an en azote.

  11. What Is Cholesterol?

    Science.gov (United States)

    ... of Cholesterol There are two main types of cholesterol: LDL and HDL. The cholesterol blood test tells how much of each kind you have. Most cholesterol is LDL (low-density lipoprotein) cholesterol. This type is most ...

  12. Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

    Directory of Open Access Journals (Sweden)

    A. Yu. Popova

    2015-01-01

    Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

  13. Reference intervals for serum total cholesterol, HDL cholesterol and ...

    African Journals Online (AJOL)

    Reference intervals of total cholesterol, HDL cholesterol and non-HDL cholesterol concentrations were determined on 309 blood donors from an urban and peri-urban population of Botswana. Using non-parametric methods to establish 2.5th and 97.5th percentiles of the distribution, the intervals were: total cholesterol 2.16 ...

  14. Application of DNA fingerprints for cell-line individualization.

    OpenAIRE

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-01-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

  15. Nitrogen and carbohydrate fractions in exclusive Tifton 85 and in pasture oversown with annual winter forage species - 10.4025/actascianimsci.v34i1.11428

    Directory of Open Access Journals (Sweden)

    Ana Claudia Ruggieri

    2011-11-01

    Full Text Available The experiment was undertaken at the Faculty of Agrarian and Veterinary Sciences (FCAV Jaboticabal, São Paulo State, Brazil, during winter-spring-summer of 2001-2002, to determine the fractionation of nitrogen and carbohydrates in Tifton 85 (Cynodon dactylon Vanderyst x Cynodon nlemfuensis (L. Pers, exclusively or oversown with winter annual forage species. Treatments comprised bristle oat (Avena strigosa Schreb, yellow oat (Avena byzantina C. Koch, triticale (X Triticosecale Wittmack, bristle oat + yellow oat, bristle oat + triticale, yellow oat + triticale, bristle oat + yellow oat + triticale seeded in Tifton 85 and sole crop (control. Experimental design was composed of completely randomized blocks with three replications. Fodder was cut 20 cm high (presence of winter forage and 10 cm high (Tifton 85 pasture. Crude protein, total carbohydrate and the fractions of nitrogen compounds and carbohydrates were determined. Decrease was reported in the levels of chemical compounds in winter forage species and in Tifton 85 during the evaluation periods. The content of nitrogen compounds and carbohydrates varied widely during the evaluation period according to the morphological characteristics of grass species and botanical composition of pastures.

  16. Effects of petroleum and metal contaminated soil on plants and earthworms: Survival and bioaccumulation

    International Nuclear Information System (INIS)

    Tatem, H.E.; Simmers, J.W.; Skogerboe, J.G.; Lee, C.R.

    1993-01-01

    Earthworms, Eisenia foetida, and bermudagrass, Cynodon dactylon, were used in the laboratory to test the toxicity of contaminated sediment taken from a small fresh water lake in North Carolina. This work was part of an investigation to determine the potential effects of upland disposal of this sediment. The contaminated sediment contained As, Cr, Cu, Pb, Hg, Ni, Zn and petroleum hydrocarbons at concentrations much greater than nearby soils. Test cylinders were planted with bermudagrass; earthworms were added 30 days later. Both species were harvested at 60 days, weighed and submitted for chemical analyses. Cynodon was affected by the contaminated sediment but grew well in the mixtures of sediment and upland soil. Similar results were obtained with the Eisenia. These species did not accumulate hydrocarbons from the sediment with the possible exception of pyrene. The metals Cd, Pb, and Zn were elevated in plants exposed to the contaminated sediment. Earthworms exposed to this sediment accumulated Pb to concentrations greater than animals exposed to the manure control. This work demonstrated that a contaminated freshwater sediment was not toxic to plants or earthworms and that most petroleum hydrocarbons were not accumulated. The only metal that may be of some concern was Pb

  17. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  18. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    Science.gov (United States)

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  19. Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki

    Directory of Open Access Journals (Sweden)

    Silvia W. Lestari

    2015-12-01

    Full Text Available Prediksi fertilitas laki-laki dapat dilakukan dengan analisis semen. Analisis semen konvensionalmerupakan pemeriksaan sederhana dan tidak mahal, tetapi memiliki variabilitas yang tinggi.Integritas DNA spermatozoa penting untuk transmisi informasi genetik. Fragmentasi DNAspermatozoa sebagai akibat gangguan spermatogenesis, maturasi spermatozoa, stres oksidatifdan infeksi, dapat menyebabkan infertilitas laki-laki, gangguan perkembangan embrio dan abortusberulang. Hubungan fragmentasi DNA spermatozoa dengan luaran teknologi reproduksi berbantu(TRB mengarahkan fragmentasi DNA spermatozoa sebagai pemeriksaan infertilitas laki-laki. Dariberbagai metode fragmentasi DNA spermatozoa yang umum dilakukan, sperm chromatin dispersion(SCD merupakan metode pemeriksaan fragmentasi DNA spermatozoa yang sederhana, akuratdan tidak mahal, sehingga dapat dilaksanakan di laboratorium andrologi. Selain menghasilkandiagnosis yang lebih baik, pemeriksaan fragmentasi DNA spermatozoa juga menggambarkanprognosis infertilitas termasuk luaran program TRB. Kata kunci: infertilitas laki-laki, fragmentasi DNA spermatozoa, SCD   Sperm DNA Fragmentation: Etiology, Detection and Implicationto Male Infertility Abstract The prediction of male fertility is determined by semen analysis. The conventional semenanalysis is simple and inexpensive but prone to variability. The integrity of sperm DNA is essentialfor the transmission of genetic information. Fragmentation of sperm DNA as result of disruptionin spermatogenesis and sperm maturation, oxidative stress, and infection may lead to maleinfertility, abnormal embryonic development and recurrent abortion. The association betweensperm DNA fragmentation and diminished reproductive outcomes has led to the introduction ofsperm DNA fragmentation testing on the clinical assessment of male infertility. Of all the spermDNA fragmentation tests, sperm chromatin dispersion (SCD test is quite simple, accurate, andinexpensive to be conducted on

  20. Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

    International Nuclear Information System (INIS)

    Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

    1982-01-01

    The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

  1. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  2. The cholesterol space of the rat; L'espace cholesterol du rat

    Energy Technology Data Exchange (ETDEWEB)

    Chevallier, F [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1959-07-01

    The experiments consisted in feeding daily to rats the same mass of radioactive cholesterol, over variable time intervals. From the evolution of the specific radioactivity of cholesterol carbon-14 in the organs as a function of time, information relative to the transport of cholesterol in the organism may be obtained. 1) The cholesterol space, defined as the group of molecules capable of being transferred from the organs into the serum and vice versa, represents at the most 50 per cent of the total cholesterol of the adult rat. 2) The incessant interchange between the tissual and the serum cholesterol renews entirely or for the most part the cholesterol molecules contained in the following organs: spleen, heart, adipose tissue, suprarenal glands, lungs, bone marrow, liver, erythrocytes. For a second group of organs: skin, testicles, kidneys, colon, bones, muscles, only a fraction of their cholesterol is renewable by this process. No transfer can be detected at the level of the brain. 3) The relative speeds of the various means of appearance (absorption, synthesis) and disappearance (excretion, transformation) of the cholesterol from its space are such that a stationary isotopic state is established around the eighth day, when the animal absorbs 5 milligrams of radioactive cholesterol daily. (author) [French] Les experiences ont consiste a faire ingerer quotidiennement une meme masse de cholesterol radioactif a des rats, durant des laps de temps variables. L'evolution de la radioactivite specifique du carbone-14 du cholesterol des organes en fonction du temps permet d'obtenir des renseignements relatifs au transport du cholesterol dans l'organisme. 1) L'espace cholesterol defini comme l'ensemble des molecules susceptibles d'etre transferees des organes dans le serum, et vice-versa, represente au plus 50 pour cent du cholesterol total du rat adulte. 2) Le va et vient incessant entre le cholesterol tissulaire et le cholesterol serique renouvelle en totalite ou en

  3. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  4. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  5. AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

    Science.gov (United States)

    Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

    2017-11-14

    Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

  6. Visualization of DNA in highly processed botanical materials.

    Science.gov (United States)

    Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

    2018-04-15

    DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

    Science.gov (United States)

    Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

    2016-12-01

    The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

  8. Freeze Tolerance of Seed-Producing Turf Bermudagrasses.

    Science.gov (United States)

    Anderson, Jeffrey A.; Taliaferro, Charles M.

    2002-01-01

    Bermudagrass, Cynodon dactylon (L.) Pers., suffers periodic severe winter-kill throughout much of its area of use in the contiguous USA. A research goal is to increase freeze tolerance in cultivars to lessen the risk of such damage. An identified research need is for Cynodon germplasm resources to be characterized for freeze tolerance and hybridization potential. Accordingly, the objective of this research was to characterize the relative freeze tolerance of selected fertile bermudagrass plants. Nine tetraploid (2n = 4x = 36) C. dactylon and two triploid (2n = 3x = 27) hybrid (C. dactylon x C. transvaalensis Burtt Davy) clonal plants (standards) were evaluated in two experiments. Plants were propagated clonally and established in Cone-tainers (Ray Leach Cone-tainer Nursery, Canby, OR) for about 10 wk. Acclimation took place for 4 wk in controlled environment chambers at 8/2 degrees C (day/night) temperatures with a 10-h photoperiod. Following acclimation, Cone-tainers were placed into a freeze chamber and cooled rapidly to -2 degrees C, induced to freeze with ice chips, then held overnight at -2 degrees C. The freeze chamber was then programmed to cool linearly at 1 degrees C per hour. For each cultivar, three Cone-tainers were removed at each test temperature. Following thawing, Cone-tainers were transferred to a greenhouse and regrowth was evaluated visually. Nonlinear regression was used to estimate T(mid), which corresponded to the midpoint of the sigmoidal response curve of survival vs temperature. Within experiment one, Tifgreen (T(mid) = -7.2 degrees C) was significantly less cold hardy than Quickstand (-9.0 degrees C), A-12204 (-9.2 degrees C), Midiron (-9.9 degrees C), and A-12195 (-10.5 degrees C). A-12195 was significantly hardier than all genotypes except Midiron. In the second experiment, Arizona Common (-6.6 degrees C), Tifgreen (-7.1 degrees C), and A-12205 (-7.1 degrees C) were less hardy than A-9959 (-8.7 degrees C), A-12156 (-8.9 degrees C), A

  9. Evaluation of larvicidal activity of medicinal plant extracts against three mosquito vectors.

    Science.gov (United States)

    Bagavan, A; Rahuman, A Abdul

    2011-01-01

    To evaluate the mosquito larvicidal activity of plant extracts. The hexane, chloroform, ethyl acetate, acetone, and methanol leaf, flower and seed extracts of Abrus precatorius (A. precatorius), Croton bonplandianum (C. bonplandianum), Cynodon dactylon (C. dactylon), Musa paradisiaca (M. paradisiaca) and Syzygium aromaticum (S. aromaticum) were tested against fourth instar larvae of Anopheles vagus (An. vagus), Armigeres subalbatus (Ar. subalbatus) and Culex vishnui (Cx. vishnui). The highest larval mortality was found in seed ethyl acetate extracts of A. precatorius and leaf extracts of C. bonplandianum, flower chloroform and methanol extracts of M. paradisiaca, and flower bud hexane extract of S. aromaticum against An. vagus with LC(50) values of 19.31, 39.96, 35.18, 79.90 and 85.90 μg/mL; leaf ethyl acetate and methanol extracts of C. dactylon, flower methanol extract of M. paradisiaca, flower bud methanol extract of S. aromaticum against Ar. subalbatus with LC(50) values of 21.67, 32.62, 48.90 and 78.28 μg/mL, and seed methanol of A. precatorius, flower methanol extract of M. paradisiaca, flower bud hexane extract of S. aromaticum against Cx. vishnui with LC(50) values of 136.84, 103.36 and 149.56 μg/mL, respectively. These results suggest that the effective plant crude extracts have the potential to be used as an ideal ecofriendly approach for the control of disease vectors. This study provides the first report on the larvicidal activity of crude solvent extracts of different mosquitoes. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  10. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  11. The Position of Aβ22-40 and Aβ1-42 in Anionic Lipid Membranes Containing Cholesterol.

    Science.gov (United States)

    Barrett, Matthew A; Alsop, Richard J; Hauß, Thomas; Rheinstädter, Maikel C

    2015-11-30

    Amyloid-β peptides interact with cell membranes in the human brain and are associated with neurodegenerative diseases, such as Alzheimer's disease. An emerging explanation of the molecular mechanism, which results in neurodegeneration, places the cause of neurotoxicity of the amyloid- peptides on their potentially negative interaction with neuronal membranes. It is known that amyloid-β peptides interact with the membrane, modifying the membrane's structural and dynamic properties. We present a series of X-ray diffraction experiments on anionic model lipid membranes containing various amounts of cholesterol. These experiments provide experimental evidence for an interaction of both the full length amyloid-β1-42 peptide, and the peptide fragment amyloid-β22-40 with anionic bilayer containing cholesterol. The location of the amyloid-β peptides was determined from these experiments, with the full length peptide embedding into the membrane, and the peptide fragment occupying 2 positions-on the membrane surface and embedded into the membrane core.

  12. Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease

    International Nuclear Information System (INIS)

    Hentosh, P.; Henner, W.D.; Reynolds, R.J.

    1985-01-01

    DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation

  13. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  14. Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

    NARCIS (Netherlands)

    Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

    1991-01-01

    Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from

  15. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  16. Bacterial DNA in water and dialysate: detection and significance for patient outcomes.

    Science.gov (United States)

    Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K

    2009-01-01

    The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.

  17. Membrane-Assisted Growth of DNA Origami Nanostructure Arrays

    Science.gov (United States)

    2015-01-01

    Biological membranes fulfill many important tasks within living organisms. In addition to separating cellular volumes, membranes confine the space available to membrane-associated proteins to two dimensions (2D), which greatly increases their probability to interact with each other and assemble into multiprotein complexes. We here employed two DNA origami structures functionalized with cholesterol moieties as membrane anchors—a three-layered rectangular block and a Y-shaped DNA structure—to mimic membrane-assisted assembly into hierarchical superstructures on supported lipid bilayers and small unilamellar vesicles. As designed, the DNA constructs adhered to the lipid bilayers mediated by the cholesterol anchors and diffused freely in 2D with diffusion coefficients depending on their size and number of cholesterol modifications. Different sets of multimerization oligonucleotides added to bilayer-bound origami block structures induced the growth of either linear polymers or two-dimensional lattices on the membrane. Y-shaped DNA origami structures associated into triskelion homotrimers and further assembled into weakly ordered arrays of hexagons and pentagons, which resembled the geometry of clathrin-coated pits. Our results demonstrate the potential to realize artificial self-assembling systems that mimic the hierarchical formation of polyhedral lattices on cytoplasmic membranes. PMID:25734977

  18. Membrane-assisted growth of DNA origami nanostructure arrays.

    Science.gov (United States)

    Kocabey, Samet; Kempter, Susanne; List, Jonathan; Xing, Yongzheng; Bae, Wooli; Schiffels, Daniel; Shih, William M; Simmel, Friedrich C; Liedl, Tim

    2015-01-01

    Biological membranes fulfill many important tasks within living organisms. In addition to separating cellular volumes, membranes confine the space available to membrane-associated proteins to two dimensions (2D), which greatly increases their probability to interact with each other and assemble into multiprotein complexes. We here employed two DNA origami structures functionalized with cholesterol moieties as membrane anchors--a three-layered rectangular block and a Y-shaped DNA structure--to mimic membrane-assisted assembly into hierarchical superstructures on supported lipid bilayers and small unilamellar vesicles. As designed, the DNA constructs adhered to the lipid bilayers mediated by the cholesterol anchors and diffused freely in 2D with diffusion coefficients depending on their size and number of cholesterol modifications. Different sets of multimerization oligonucleotides added to bilayer-bound origami block structures induced the growth of either linear polymers or two-dimensional lattices on the membrane. Y-shaped DNA origami structures associated into triskelion homotrimers and further assembled into weakly ordered arrays of hexagons and pentagons, which resembled the geometry of clathrin-coated pits. Our results demonstrate the potential to realize artificial self-assembling systems that mimic the hierarchical formation of polyhedral lattices on cytoplasmic membranes.

  19. Weed Hosts of Meloidogyne arenaria and M. incognita Common in Tobacco Fields in South Carolina.

    Science.gov (United States)

    Tedford, E C; Fortnum, B A

    1988-10-01

    Thirty-two weed species common in South Carolina and one cultivar of tobacco were evaluated as hosts of Meloidogyne arenaria race 2 and M. incognita race 3 in the greenhouse. Egg mass production and galling differed (P Eleusine indica, Sorghum halepense, Setaria viridis, Digitaria sanguinalis, and Datura stramonium were poor hosts for M. arenaria. Amaranthus palmeri, Amaranthus hybridus, Chenopodium album, Euphorbia maculata, Setaria lutescens, Vicia villosa, Sida spinosa, Rumex crispus, and Portulaca oleracea were moderate hosts and Ipomoea hederacea var. integriuscula, Xanthium strumarium, Cyperus esculentus, Cynodon dactylon, Paspalum notatum, Eleusine indica, Setaria viridis, and Rumex acetosella were poor hosts for M. incognita. None of the above were good hosts for M. incognita. Tobacco 'PD4' supported large numbers of both nematode species.

  20. Elevated uptake of Th and U by netted chain fern (Woodwardia areolata)

    International Nuclear Information System (INIS)

    Knox, A.S.; Kaplan, D.I.; Hinton, T.G.

    2008-01-01

    We assessed the ability of netted chain fern (Woodwardia areolata) to uptake U and Th from wetland soils on the U.S. Department of Energy's Savannah River Site in South Carolina. Netted chain fern had the highest Th and U concentrations of all plants collected from the wetland. Ferns grown in contaminated soil (329 mg x kg -1 Th, 44 mg x kg -1 U) in a greenhouse contained 6.4 mg x kg -1 Th and 5.3 mg x kg -1 U compared with 0.13 mg x kg -1 Th and 0.035 mg x kg -1 U in Bermuda grass (Cynodon dactylon). Netted chain fern has potential for the phytoremediation of soils contaminated with Th and U. (author)

  1. Cholesterol testing and results

    Science.gov (United States)

    ... your cholesterol is in this normal range. LDL (Bad) Cholesterol LDL cholesterol is sometimes called "bad" cholesterol. ... to 3.3 mmol/l) are desired. VLDL (Bad) Cholesterol VLDL contains the highest amount of triglycerides. ...

  2. Cholesterol Facts and Statistics

    Science.gov (United States)

    ... Managing High Cholesterol Cholesterol-lowering Medicine High Cholesterol Statistics and Maps High Cholesterol Facts High Cholesterol Maps ... Deo R, et al. Heart disease and stroke statistics—2017 update: a report from the American Heart ...

  3. DNA based radiological dosimetry technology

    International Nuclear Information System (INIS)

    Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

    2008-01-01

    Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

  4. The Drosophila DHR96 nuclear receptor binds cholesterol and regulates cholesterol homeostasis

    OpenAIRE

    Horner, Michael A.; Pardee, Keith; Liu, Suya; King-Jones, Kirst; Lajoie, Gilles; Edwards, Aled; Krause, Henry M.; Thummel, Carl S.

    2009-01-01

    Cholesterol homeostasis is required to maintain normal cellular function and avoid the deleterious effects of hypercholesterolemia. Here we show that the Drosophila DHR96 nuclear receptor binds cholesterol and is required for the coordinate transcriptional response of genes that are regulated by cholesterol and involved in cholesterol uptake, trafficking, and storage. DHR96 mutants die when grown on low levels of cholesterol and accumulate excess cholesterol when maintained on a high-choleste...

  5. DNA polymerase beta participates in mitochondrial DNA repair

    DEFF Research Database (Denmark)

    Sykora, P; Kanno, S; Akbari, M

    2017-01-01

    We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

  6. Relationship between plasma cholesterol levels and cholesterol esterification in isolated human mononuclear cells

    International Nuclear Information System (INIS)

    Dallongeville, J.; Davignon, J.; Lussier-Cacan, S.

    1990-01-01

    The authors studied the relationship between plasma lipoprotein concentrations and cholesterol esterification in freshly isolated human mononuclear cells from 27 normolipidemic and 32 hyperlipidemic individuals. Cells were either incubated for 5 hours with radiolabeled oleate immediately after isolation or were preincubated for 18 hours in the presence of exogenous cholesterol, and then incubated with [ 14 C]sodium-oleate-albumin complex. In the absence of exogenous cholesterol, control and hypercholesterolemic subjects had similarly low values of intracellular cholesterol esterification. In the presence of exogenous cholesterol, both hypertriglyceridemic and hypercholesterolemic subjects had higher cholesterol esterification than controls. There was a significant correlation between the rate of cholesterol esterification and plasma total cholesterol. These results suggest that plasma cholesterol levels may regulate mononuclear cell intra-cellular cholesterol esterification in humans

  7. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  8. Expression of CdDHN4, a Novel YSK2-Type Dehydrin Gene from Bermudagrass, Responses to Drought Stress through the ABA-Dependent Signal Pathway.

    Science.gov (United States)

    Lv, Aimin; Fan, Nana; Xie, Jianping; Yuan, Shili; An, Yuan; Zhou, Peng

    2017-01-01

    Dehydrin improves plant resistance to many abiotic stresses. In this study, the expression profiles of a dehydrin gene, CdDHN4 , were estimated under various stresses and abscisic acid (ABA) treatments in two bermudagrasses ( Cynodon dactylon L.): Tifway (drought-tolerant) and C299 (drought-sensitive). The expression of CdDHN4 was up-regulated by high temperatures, low temperatures, drought, salt and ABA. The sensitivity of CdDHN4 to ABA and the expression of CdDHN4 under drought conditions were higher in Tifway than in C299. A 1239-bp fragment, CdDHN4-P, the partial upstream sequence of the CdDHN4 gene, was cloned by genomic walking from Tifway. Bioinformatic analysis showed that the CdDHN4-P sequence possessed features typical of a plant promoter and contained many typical cis elements, including a transcription initiation site, a TATA-box, an ABRE, an MBS, a MYC, an LTRE, a TATC-box and a GT1-motif. Transient expression in tobacco leaves demonstrated that the promoter CdDHN4-P can be activated by ABA, drought and cold. These results indicate that CdDHN4 is regulated by an ABA-dependent signal pathway and that the high sensitivity of CdDHN4 to ABA might be an important mechanism enhancing the drought tolerance of bermudagrass.

  9. Expression of CdDHN4, a Novel YSK2-Type Dehydrin Gene from Bermudagrass, Responses to Drought Stress through the ABA-Dependent Signal Pathway

    Directory of Open Access Journals (Sweden)

    Aimin Lv

    2017-05-01

    Full Text Available Dehydrin improves plant resistance to many abiotic stresses. In this study, the expression profiles of a dehydrin gene, CdDHN4, were estimated under various stresses and abscisic acid (ABA treatments in two bermudagrasses (Cynodon dactylon L.: Tifway (drought-tolerant and C299 (drought-sensitive. The expression of CdDHN4 was up-regulated by high temperatures, low temperatures, drought, salt and ABA. The sensitivity of CdDHN4 to ABA and the expression of CdDHN4 under drought conditions were higher in Tifway than in C299. A 1239-bp fragment, CdDHN4-P, the partial upstream sequence of the CdDHN4 gene, was cloned by genomic walking from Tifway. Bioinformatic analysis showed that the CdDHN4-P sequence possessed features typical of a plant promoter and contained many typical cis elements, including a transcription initiation site, a TATA-box, an ABRE, an MBS, a MYC, an LTRE, a TATC-box and a GT1-motif. Transient expression in tobacco leaves demonstrated that the promoter CdDHN4-P can be activated by ABA, drought and cold. These results indicate that CdDHN4 is regulated by an ABA-dependent signal pathway and that the high sensitivity of CdDHN4 to ABA might be an important mechanism enhancing the drought tolerance of bermudagrass.

  10. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  11. Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

    Directory of Open Access Journals (Sweden)

    Nguyen-Hieu Tung

    2012-09-01

    Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

  12. Sequence analysis of mitochondrial DNA hypervariable region III of ...

    African Journals Online (AJOL)

    The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

  13. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Science.gov (United States)

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  14. Cholesterol Depletion from a Ceramide/Cholesterol Mixed Monolayer: A Brewster Angle Microscope Study

    KAUST Repository

    Mandal, Pritam; Noutsi, Bakiza Kamal; Chaieb, Saharoui

    2016-01-01

    to deplete cholesterol (Chol) from biomembranes. Here, we focus on the depletion of cholesterol from a C16 ceramide/cholesterol (C16-Cer/Chol) mixed monolayer using MβCD. While the removal of cholesterol by MβCD depends on the cholesterol concentration

  15. High blood cholesterol levels

    Science.gov (United States)

    Cholesterol - high; Lipid disorders; Hyperlipoproteinemia; Hyperlipidemia; Dyslipidemia; Hypercholesterolemia ... There are many types of cholesterol. The ones talked about most are: ... lipoprotein (HDL) cholesterol -- often called "good" cholesterol ...

  16. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  17. Weed vegetation ecology of arable land in Salalah, Southern Oman.

    Science.gov (United States)

    El-Sheikh, Mohamed A

    2013-07-01

    This paper applies multivariate statistical methods to a data set of weed relevés from arable fields in two different habitat types of coastal and mountainous escarpments in Southern Oman. The objectives were to test the effect of environmental gradients, crop plants and time on weed species composition, to rank the importance of these particular factors, and to describe the patterns of species composition and diversity associated with these factors. Through the application of TWINSPAN, DCA and CCA programs on data relating to 102 species recorded in 28 plots and farms distributed in the study area, six plant communities were identified: I- Dichanthium micranthum, II- Cynodon dactylon-D. micranthum, III- Convolvulus arvensis, IV- C. dactylon-Sonchus oleraceus, V- Amaranthus viridis and VI- Suaeda aegyptiaca-Achyranthes aspera. The ordination process (CCA) provided a sequence of plant communities and species diversity that correlated with some anthropogenic factors, physiographic variables and crop types. Therefore, length of time since farm construction, disturbance levels and altitude are the most important factors related to the occurrence of the species. The perennial species correlated with the more degraded mountain areas of new farm stands, whereas most of the annuals correlated with old lowland and less disturbed farms.

  18. Effet du mélange du fluazifop et du bentazon sur les adventices et quelques cultures légumineuses

    Directory of Open Access Journals (Sweden)

    Ngouajio, M.

    1993-01-01

    Full Text Available Effect of fluazifop and bentazon tank-mixed on weeds and selected legume crops. Field trials were conducted in Dschang, Cameroon, during the dry season (1991 and the rainy season (1992 to evaluate weed control and crop susceptibility to fluazifop-P (250 g ai/ha and fluazifop-P (250 g ai/ha plus bentazon (750 g ai/ha. Different legume crops included : peanuts, soybeans, cowpea, and common beans varieties white, red, maringue, multicolor and earth-color. Plots treated with fluazifop resulted in 91 and 98 % control of Setaria barbata and Cynodon dactylon, respectively. When tank-mixed with bentazon, fluazifop activity dropped to 38 and 88 % for the control of S. barbata and C. dactylon, respectively. Broadleaf weeds (Mimosa pudica and Ageratum conyzoides were more effectively controlled with the mixture of both herbicides. Significant crop injury (22-67 % was observed during the dry season trial on all varieties with the herbicides combination. This resulted in significant stand reduction with the most susceptible crop being cowpea (52 % stand reduction. Yield reduction was observed when cowpea was treated with fluazifop plus bentazon (47 kg/ha compared to 145 kg/ha for fluazifop usedalone or 138.5 kg/ha for the control.

  19. Phytostabilisation of copper-contaminated soil in Katanga: an experiment with three native grasses and two amendments.

    Science.gov (United States)

    Shutcha, Mylor Ngoy; Mubemba, Michel Mpundu; Faucon, Michel-Pierre; Luhembwe, Michel Ngongo; Visser, Marjolein; Colinet, Gilles; Meerts, Pierre

    2010-08-01

    This study evaluates the feasibility of using the grass species Rendlia altera, Monocymbium ceresiiforme, Cynodon dactylon, and amendments (compost and lime) for the phytostabilisation of soils contaminated by Cu in the province of Katanga (Democratic Republic of Congo). Species were grown on control and Cu-contaminated plots (artificially contaminated with 2,500 mg kg(-1) Cu) unamended (NA), amended with 4.5 kg compost m(-2) or 0.2 kg lime m(-2). R. altera was also grown on contaminated plots amended with 22.5 kg compost m(-2) or 1 kg lime m(-2). Plant survival, growth, and reproduction were monitored for two years. Cu-concentration in leaves of R. altera and M. ceresiiforme were analysed. pH and extractable Cu (0.01 M CaCl2) in soil were analysed in April 2007 and 2008. Results showed that R. altera seems to be the best candidate because of its highest survival on NA, followed by M. ceresiiforme, while liming was necessary to ensure survival of C. dactylon. Lime increased plant reproduction and reduced Cu accumulation in leaves compared to compost. However, higher survival and number of spikes of R. altera obtained in experiment 2 with 22.5 kg compost m(-2) suggest that lime x compost interactions should be investigated in further studies.

  20. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1984-01-01

    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  1. Cholesterol Depletion from a Ceramide/Cholesterol Mixed Monolayer: A Brewster Angle Microscope Study

    KAUST Repository

    Mandal, Pritam

    2016-06-01

    Cholesterol is crucial to the mechanical properties of cell membranes that are important to cells’ behavior. Its depletion from the cell membranes could be dramatic. Among cyclodextrins (CDs), methyl beta cyclodextrin (MβCD) is the most efficient to deplete cholesterol (Chol) from biomembranes. Here, we focus on the depletion of cholesterol from a C16 ceramide/cholesterol (C16-Cer/Chol) mixed monolayer using MβCD. While the removal of cholesterol by MβCD depends on the cholesterol concentration in most mixed lipid monolayers, it does not depend very much on the concentration of cholesterol in C16-Cer/Chol monolayers. The surface pressure decay during depletion were described by a stretched exponential that suggested that the cholesterol molecules are unable to diffuse laterally and behave like static traps for the MβCD molecules. Cholesterol depletion causes morphology changes of domains but these disrupted monolayers domains seem to reform even when cholesterol level was low.

  2. Cholesterol IQ Quiz

    Science.gov (United States)

    ... Artery Disease Venous Thromboembolism Aortic Aneurysm More Cholesterol IQ Quiz Updated:Jul 5,2017 Begin the quiz ... What Your Cholesterol Levels Mean Common Misconceptions Cholesterol IQ Quiz • HDL, LDL, and Triglycerides • Causes of High ...

  3. The contribution of cholesterol and epigenetic changes to the pathophysiology of breast cancer.

    Science.gov (United States)

    Munir, Maliha T; Ponce, Christopher; Powell, Catherine A; Tarafdar, Kaiser; Yanagita, Teru; Choudhury, Mahua; Gollahon, Lauren S; Rahman, Shaikh M

    2018-05-04

    Breast cancer is one of the most commonly diagnosed cancers in women. Accumulating evidence suggests that cholesterol plays an important role in the development of breast cancer. Even though the mechanistic link between these two factors is not well understood, one possibility is that dysregulated cholesterol metabolism may affect lipid raft and membrane fluidity and can promote tumor development. Current studies have shown oxysterol 27-hydroxycholesterol (27-HC) as a critical regulator of cholesterol and breast cancer pathogenesis. This is supported by the significantly higher expression of CYP27A1 (cytochrome P450, family 27, subfamily A, polypeptide 1) in breast cancers. This enzyme is responsible for 27-HC synthesis from cholesterol. It has been shown that 27-HC can not only increase the proliferation of estrogen receptor (ER)-positive breast cancer cells but also stimulate tumor growth and metastasis in several breast cancer models. This phenomenon is surprising since 27-HC and other oxysterols generally reduce intracellular cholesterol levels by activating the liver X receptors (LXRs). Resolving this paradox will elucidate molecular pathways by which cholesterol, ER, and LXR are connected to breast cancer. These findings will also provide the rationale for evaluating pharmaceutical approaches that manipulate cholesterol or 27-HC synthesis in order to mitigate the impact of cholesterol on breast cancer pathophysiology. In addition to cholesterol, epigenetic changes including non-coding RNAs, and microRNAs, DNA methylation, and histone modifications, have all been shown to control tumorigenesis. The purpose of this review is to discuss the link between altered cholesterol metabolism and epigenetic modification during breast cancer progression. Copyright © 2018. Published by Elsevier Ltd.

  4. Plasma cholesterol and endogenous cholesterol synthesis during refeeding in anorexia nervosa.

    Science.gov (United States)

    Feillet, F; Feillet-Coudray, C; Bard, J M; Parra, H J; Favre, E; Kabuth, B; Fruchart, J C; Vidailhet, M

    2000-04-01

    Normal or high levels of cholesterol have been measured in patients with anorexia nervosa (AN). Given that cholesterol intake in AN is usually very low, the reasons for this anomaly are not clearly understood. We studied lipid and lipoprotein profiles and endogenous cholesterol synthesis, estimated by serum lathosterol, in a population of 14 girls with AN, before and during a period of 30 days refeeding. The initial body mass index (BMI) of the patients was 13.41+/-1.62 kg/m(2). No changes were observed during refeeding in endocrine parameters (ACTH, cortisol and estradiol). At Day 0 the lipids data measured here showed normal levels of triglycerides, and total cholesterol at the upper limits of the normal range (5.44+/-1 mmol/l). At this time, total and LDL cholesterol were negatively correlated with transthyretin and BMI. Serum lathosterol (a precursor in cholesterol synthesis pathway) increased significantly (5.99+/-1.75 (Day 0) vs. 8.39+/-2.96 (Day 30); P=0.02) while there was a significant decrease in apo B (0.79+/-0.33 (Day 0) vs. 0. 60+/-0.17 g/l (Day 30), P=0.02) with refeeding. Thus, patients with initial high cholesterol levels have the worst nutritional status and high cholesterol levels are not related to a de novo synthesis. This profile returns to normal with refeeding. An increase of cellular cholesterol uptake may be responsible for this apparently paradoxical evolution with increase of cholesterol synthesis and decrease of apo B during renutrition.

  5. Cholesterol metabolism and serum non-cholesterol sterols: summary of 13 plant stanol ester interventions.

    Science.gov (United States)

    Hallikainen, Maarit; Simonen, Piia; Gylling, Helena

    2014-04-27

    The efficacy and safety of plant stanols added to food products as serum cholesterol lowering agents have been demonstrated convincingly, but their effects on cholesterol metabolism and on serum non-cholesterol sterols is less evaluated. The aim of this study was to assess the validity of serum non-cholesterol sterols and squalene as bioindices of cholesterol synthesis and absorption, and to examine how the individual serum non-cholesterol sterols respond to consumption of plant stanols. We collected all randomized, controlled plant stanol ester (STAEST) interventions in which serum cholestanol, plant sterols campesterol and sitosterol, and at least two serum cholesterol precursors had been analysed. According to these criteria, there was a total of 13 studies (total 868 subjects without lipid-lowering medication; plant stanol doses varied from 0.8 to 8.8 g/d added in esterified form; the duration of the studies varied from 4 to 52 weeks). Serum non-cholesterol sterols were assayed with gas-liquid chromatography, cholesterol synthesis with the sterol balance technique, and fractional cholesterol absorption with the dual continuous isotope feeding method. The results demonstrated that during the control and the STAEST periods, the serum plant sterol/cholesterol- and the cholestanol/cholesterol-ratios reflected fractional cholesterol absorption, and the precursor sterol/cholesterol-ratios reflected cholesterol synthesis. Plant sterol levels were dose-dependently reduced by STAEST so that 2 g of plant stanols reduced serum campesterol/cholesterol-ratio on average by 32%. Serum cholestanol/cholesterol-ratio was reduced less frequently than those of the plant sterols by STAEST, and the cholesterol precursor sterol ratios did not change consistently in the individual studies emphasizing the importance of monitoring more than one surrogate serum marker. Serum non-cholesterol sterols are valid markers of cholesterol absorption and synthesis even during cholesterol

  6. LDL: The "Bad" Cholesterol

    Science.gov (United States)

    ... There are two main types of cholesterol: LDL (bad) cholesterol and HDL (good) cholesterol: LDL stands for low-density lipoproteins. It is called the "bad" cholesterol because a high LDL level leads to ...

  7. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  8. Home-Use Tests - Cholesterol

    Science.gov (United States)

    ... Medical Procedures In Vitro Diagnostics Home Use Tests Cholesterol Share Tweet Linkedin Pin it More sharing options ... a home-use test kit to measure total cholesterol. What cholesterol is: Cholesterol is a fat (lipid) ...

  9. Application of pooled genotyping to scan candidate regions for association with HDL cholesterol levels

    Directory of Open Access Journals (Sweden)

    Hinds David A

    2004-11-01

    Full Text Available Abstract Association studies are used to identify genetic determinants of complex human traits of medical interest. With the large number of validated single nucleotide polymorphisms (SNPs currently available, two limiting factors in association studies are genotyping capability and costs. Pooled DNA genotyping has been proposed as an efficient means of screening SNPs for allele frequency differences in case-control studies and for prioritising them for subsequent individual genotyping analysis. Here, we apply quantitative pooled genotyping followed by individual genotyping and replication to identify associations with human serum high-density lipoprotein (HDL cholesterol levels. The DNA from individuals with low and high HDL cholesterol levels was pooled separately, each pool was amplified by polymerase chain reaction in triplicate and each amplified product was separately hybridised to a high-density oligonucleotide array. Allele frequency differences between case and control groups with low and high HDL cholesterol levels were estimated for 7,283 SNPs distributed across 71 candidate gene regions spanning a total of 17.1 megabases. A novel method was developed to take advantage of independently derived haplotype map information to improve the pooled estimates of allele frequency differences. A subset of SNPs with the largest estimated allele frequency differences between low and high HDL cholesterol groups was chosen for individual genotyping in the study population, as well as in a separate replication population. Four SNPs in a single haplotype block within the cholesteryl ester transfer protein (CETP gene interval were significantly associated with HDL cholesterol levels in both populations. Our study is among the first to demonstrate the application of pooled genotyping followed by confirmation with individual genotyping to identify genetic determinants of a complex trait.

  10. Investigation of DNA double strand breaks induced by α particle and 7Li ions

    International Nuclear Information System (INIS)

    Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

    2006-01-01

    α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

  11. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  12. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  13. Cut-and-Paste of DNA Using an Artificial Restriction DNA Cutter

    Directory of Open Access Journals (Sweden)

    Makoto Komiyama

    2013-02-01

    Full Text Available DNA manipulations using a completely chemistry-based DNA cutter (ARCUT have been reviewed. This cutter, recently developed by the authors, is composed of Ce(IV/EDTA complex and two strands of pseudo-complementary peptide nucleic acid. The site-selective scission proceeds via hydrolysis of targeted phosphodiester linkages, so that the resultant scission fragments can be easily ligated with other fragments by using DNA ligase. Importantly, scission-site and site-specificity of the cutter are freely tuned in terms of the Watson–Crick rule. Thus, when one should like to manipulate DNA according to the need, he or she does not have to think about (1 whether appropriate “restriction enzyme sites” exist near the manipulation site and (2 whether the site-specificity of the restriction enzymes, if any, are sufficient to cut only the aimed position without chopping the DNA at non-targeted sites. Even the human genome can be manipulated, since ARCUT can cut the genome at only one predetermined site. Furthermore, the cutter is useful to promote homologous recombination in human cells, converting a site to desired sequence. The ARCUT-based DNA manipulation should be promising for versatile applications.

  14. Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

    Science.gov (United States)

    Jorgez, Carolina J; Bischoff, Farideh Z

    2009-01-01

    Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

  15. A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.

    Science.gov (United States)

    Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang

    2005-12-01

    The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

  16. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  18. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Perfil de consulta en niños alérgicos provenientes de familias de bajos ingresos Profile of consultation of allergic children from low income families

    Directory of Open Access Journals (Sweden)

    Alain Raimundo Rodríguez-Orozco

    2007-09-01

    Full Text Available Las enfermedades alérgicas son una de las principales causas de atención médica en la infancia y su impacto se acentúa más en las familias de bajos ingresos. En un estudio descriptivo analítico se caracterizó el perfil de consulta del niño alérgico proveniente de familias mexicanas de bajos recursos económicos. Las enfermedades alérgicas predominaron en el sexo masculino y la edad escolar; el 71 % de los enfermos provenía de localidades urbanas. El asma fue el diagnóstico más frecuente (64 %, seguido de la rinitis alérgica (30 %, dermatitis atópica (6 % y urticaria (3 %. Las reactividades encontradas con más frecuencia en la prueba cutánea fueron Dermatofagoides farinae (77 %, Dermatofagoides pteronyssinus (60 %, Phleum pratense (20 %, gato (17 %, perro (14 % y Cynodon dactylon (11 %. El alto grado de disfunción familiar y la poca adhesión a tratamientos prolongados posibilitan la perpetuidad de los síntomas y el pronóstico incierto en este grupo de niños.Allergic diseases are one of the main causes for seeing the doctor in childhood and their impact is more acute in low income families. An analytical descriptive study characterized the profile of medical consultation of the allergic child from Mexican low income families. Allergic diseases prevailed in males and at school age, and 71 % of the sick children lived in urban settings. Asthma was the most frequent diagnosis (64 % followed by allergic rhinitis (30%, atopic dermatitis (6 % and urticaria (3 %. The most commom reactivity rates in the cutaneous test were Dermatofagoides farinae (77 %, Dermatofagoides pteronyssinus (60 %, Phleum pratense (20 %, cat (17 %, dog (14 % and Cynodon dactylon (11 %. The high level of family dysfunction and low adhesion to long therapies make it possible the persistence of symptoms and the uncertain prognosis in this group of children.

  20. Perennial grasses for recovery of the aggregation capacity of a reconstructed soil in a coal mining area in southern Brazil

    Directory of Open Access Journals (Sweden)

    Lizete Stumpf

    2014-02-01

    Full Text Available The construction of a soil after surface coal mining involves heavy machinery traffic during the topographic regeneration of the area, resulting in compaction of the relocated soil layers. This leads to problems with water infiltration and redistribution along the new profile, causing water erosion and consequently hampering the revegetation of the reconstructed soil. The planting of species useful in the process of soil decompaction is a promising strategy for the recovery of the soil structural quality. This study investigated the influence of different perennial grasses on the recovery of reconstructed soil aggregation in a coal mining area of the Companhia Riograndense de Mineração, located in Candiota-RS, which were planted in September/October 2007. The treatments consisted of planting: T1- Cynodon dactylon cv vaquero; T2 - Urochloa brizantha; T3 - Panicum maximun; T4 - Urochloa humidicola; T5 - Hemarthria altissima; T6 - Cynodon dactylon cv tifton 85. Bare reconstructed soil, adjacent to the experimental area, was used as control treatment (T7 and natural soil adjacent to the mining area covered with native vegetation was used as reference area (T8. Disturbed and undisturbed soil samples were collected in October/2009 (layers 0.00-0.05 and 0.10-0.15 m to determine the percentage of macro- and microaggregates, mean weight diameter (MWD of aggregates, organic matter content, bulk density, and macro- and microporosity. The lower values of macroaggregates and MWD in the surface than in the subsurface layer of the reconstructed soil resulted from the high degree of compaction caused by the traffic of heavy machinery on the clay material. After 24 months, all experimental grass treatments showed improvements in soil aggregation compared to the bare reconstructed soil (control, mainly in the 0.00-0.05 m layer, particularly in the two Urochloa treatments (T2 and T4 and Hemarthria altissima (T5. However, the great differences between the

  1. Cholesterol Transport Revisited : A New Turbo Mechanism to Drive Cholesterol Excretion

    NARCIS (Netherlands)

    de Boer, Jan Freark; Kuipers, Folkert; Groen, Albert K.

    A fine-tuned balance between cholesterol uptake and excretion by the body is pivotal to maintain health and to remain free from the deleterious consequences of cholesterol accumulation such as cardiovascular disease. The pathways involved in intracellular and extracellular cholesterol transport are

  2. Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

    Science.gov (United States)

    Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

    2017-01-01

    Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

  3. Cholesterol (image)

    Science.gov (United States)

    Cholesterol is a soft, waxy substance that is present in all parts of the body including the ... and obtained from animal products in the diet. Cholesterol is manufactured in the liver and is needed ...

  4. Cholesterol efflux is differentially regulated in neurons and astrocytes: implications for brain cholesterol homeostasis

    Science.gov (United States)

    Chen, Jing; Zhang, Xiaolu; Kusumo, Handojo; Costa, Lucio G.; Guizzetti, Marina

    2012-01-01

    Disruption of cholesterol homeostasis in the central nervous system (CNS) has been associated with neurological, neurodegenerative, and neurodevelopmental disorders. The CNS is a closed system with regard to cholesterol homeostasis, as cholesterol-delivering lipoproteins from the periphery cannot pass the blood-brain-barrier and enter the brain. Different cell types in the brain have different functions in the regulation of cholesterol homeostasis, with astrocytes producing and releasing apolipoprotein E and lipoproteins, and neurons metabolizing cholesterol to 24(S)-hydroxycholesterol. We present evidence that astrocytes and neurons adopt different mechanisms also in regulating cholesterol efflux. We found that in astrocytes cholesterol efflux is induced by both lipid-free apolipoproteins and lipoproteins, while cholesterol removal from neurons is triggered only by lipoproteins. The main pathway by which apolipoproteins induce cholesterol efflux is through ABCA1. By upregulating ABCA1 levels and by inhibiting its activity and silencing its expression, we show that ABCA1 is involved in cholesterol efflux from astrocytes but not from neurons. Furthermore, our results suggest that ABCG1 is involved in cholesterol efflux to apolipoproteins and lipoproteins from astrocytes but not from neurons, while ABCG4, whose expression is much higher in neurons than astrocytes, is involved in cholesterol efflux from neurons but not astrocytes. These results indicate that different mechanisms regulate cholesterol efflux from neurons and astrocytes, reflecting the different roles that these cell types play in brain cholesterol homeostasis. These results are important in understanding cellular targets of therapeutic drugs under development for the treatments of conditions associated with altered cholesterol homeostasis in the CNS. PMID:23010475

  5. Origin of DNA in human serum and usefulness of serum as a material for DNA typing.

    Science.gov (United States)

    Takayama, T; Yamada, S; Watanabe, Y; Hirata, K; Nagai, A; Nakamura, I; Bunai, Y; Ohya, I

    2001-06-01

    The aims of this study were to clarify the origin of DNA in human serum and to investigate whether serum is a material available for DNA typing in routine forensic practice. Blood was donated from 10 healthy adult volunteers and stored for up to 8 days, at 4 degrees C and at room temperature. The serum DNA concentration at zero time was in the range of 5.6 to 21.8 ng/ml with a mean of 12.2+/-1.6 ng/ml. The concentrations increased with storage time. On agarose gel electrophoresis, all serum samples showed ladder patterns and the size of each band was an integer multiple of approximately 180 bp considered to be characteristic of apoptosis. DNA typing from DNA released by apoptosis was possible. Exact DNA typing of D1S80, HLA DQA1, PM, CSF1PO, TPOX, TH01 and vWA was possible for each sample. These results indicate that serum contains fragmented DNA derived from apoptosis of leukocytes, especially neutrophils, and that fragmented DNA is an appropriate material for DNA typing.

  6. Cholesterol Test

    Science.gov (United States)

    ... artery disease. Other names for a cholesterol test: Lipid profile, Lipid panel What is it used for? If you ... Clinic [Internet]. Mayo Foundation for Medical Education and Research; c1998-2017.Cholesterol Test: Overview; 2016 Jan 12 [ ...

  7. Endogenous cholesterol synthesis, fecal steroid excretion and serum lanosterol in subjects with high or low response of serum cholesterol to dietary cholesterol

    NARCIS (Netherlands)

    Beynen, A.C.; Katan, M.B.; Gent, van C.M.

    1986-01-01

    In this study we addressed the question whether hypo- and hyper-responders to dietary cholesterol differ with regard to the flexibility of endogenous cholesterol synthesis after changes in cholesterol intake. Whole-body cholesterol synthesis was measured as faecal excretion of neutral steroids and

  8. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    Science.gov (United States)

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  9. The winter diet of elephant in Eastern Cape Subtropical Thicket, Addo Elephant National Park

    Directory of Open Access Journals (Sweden)

    R.G.T. Paley

    1998-07-01

    Full Text Available Direct observational methods were used to establish the winter diet of elephants in Eastern Cape Subtropical Thicket in the Addo Elephant National Park, thereby determining which plant species were most at risk from elephant herbivory. A total of 70 species were identified as food plants for elephants, with the grass Cynodon dactylon and the succulents Portulacaria afra and Platythyra haeckeliana dominating, both in terms of frequency of feeding events and volume consumed. In view of the fact that elephants represent 78 of the herbivore biomass in the park, it appears likely that elephant feeding restricts the availability of forage for other browsers. Due to the limited time frame of this study, further research is needed to provide a comprehensive record of the elephant diet for all seasons of the year.

  10. Intestinal cholesterol transport: Measuring cholesterol absorption and its reverse

    NARCIS (Netherlands)

    Jakulj, L.

    2013-01-01

    Intestinal cholesterol transport might serve as an attractive future target for cardiovascular disease reduction, provided that underlying molecular mechanisms are more extensively elucidated, combined with improved techniques to measure changes in cholesterol fluxes and their possible

  11. Diffusion mediated coagulation and fragmentation based study of domain formation in lipid bilayer membrane

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Laxminarsimha V., E-mail: laxman@iitk.ac.in [Mechanics and Applied Mathematics Group, Department of Mechanical Engineering, Indian Institute of Technology Kanpur, Kanpur 208016 (India); Roy, Subhradeep [Department of Biomedical Engineering and Mechanics (MC 0219), Virginia Tech, 495 Old Turner Street, Blacksburg, VA 24061 (United States); Das, Sovan Lal [Mechanics and Applied Mathematics Group, Department of Mechanical Engineering, Indian Institute of Technology Kanpur, Kanpur 208016 (India)

    2017-01-15

    We estimate the equilibrium size distribution of cholesterol rich micro-domains on a lipid bilayer by solving Smoluchowski equation for coagulation and fragmentation. Towards this aim, we first derive the coagulation kernels based on the diffusion behaviour of domains moving in a two dimensional membrane sheet, as this represents the reality better. We incorporate three different diffusion scenarios of domain diffusion into our coagulation kernel. Subsequently, we investigate the influence of the parameters in our model on the coagulation and fragmentation behaviour. The observed behaviours of the coagulation and fragmentation kernels are also manifested in the equilibrium domain size distribution and its first moment. Finally, considering the liquid domains diffusing in a supported lipid bilayer, we fit the equilibrium domain size distribution to a benchmark solution.

  12. The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

    Directory of Open Access Journals (Sweden)

    Tatsuya Ishikawa

    2017-06-01

    Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

  13. Biogenesis of plasma membrane cholesterol

    International Nuclear Information System (INIS)

    Lange, Y.

    1986-01-01

    A striking feature of the molecular organization of eukaryotic cells is the singular enrichment of their plasma membranes in sterols. The authors studies are directed at elucidating the mechanisms underlying this inhomogeneous disposition. Cholesterol oxidase catalyzes the oxidation of plasma membrane cholesterol in intact cells, leaving intracellular cholesterol pools untouched. With this technique, the plasma membrane was shown to contain 95% of the unesterified cholesterol of cultured human fibroblasts. Cholesterol synthesized from [ 3 H] acetate moved to the plasma membrane with a half-time of 1 h at 37 0 C. They used equilibrium gradient centrifugation of homogenates of biosynthetically labeled, cholesterol oxidase treated cells to examine the distribution of newly synthesized sterols among intracellular pools. Surprisingly, lanosterol, a major precursor of cholesterol, and intracellular cholesterol both peaked at much lower buoyant density than did 3-hydroxy-3-methylglutaryl-CoA reductase. This suggests that cholesterol biosynthesis is not taken to completion in the endoplasmic reticulum. The cholesterol in the buoyant fraction eventually moved to the plasma membrane. Digitonin treatment increased the density of the newly synthesized cholesterol fractions, indicating that nascent cholesterol in transit is associated with cholesterol-rich membranes. The authors are testing the hypothesis that the pathway of cholesterol biosynthesis is spatially organized in various intracellular membranes such that the sequence of biosynthetic steps both concentrates the sterol and conveys it to the plasma membrane

  14. On some surprising statistical properties of a DNA fingerprinting technique called AFLP

    NARCIS (Netherlands)

    Gort, G.

    2010-01-01

    AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

  15. Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

    Science.gov (United States)

    Srinivasan, Krishnamoorthy; Sharma, Shyam S

    2011-11-20

    Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Multiple tag labeling method for DNA sequencing

    Science.gov (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  17. IN VITRO FERMENTATION EFFICIENCY OF MIXTURES OF Cynodon nlemfuensis, Leucaena leucocephala AND TWO ENERGY SOURCES (MAIZE OR SUGAR CANE MOLASSES

    Directory of Open Access Journals (Sweden)

    Juan Martin Estrada-Liévano

    2009-07-01

    Full Text Available The in vitro fermentation efficiency of Cynodon nlemfuensis forage (star grass and Leucaena leucocephala foliage (leucaena and two energy sources (i.e. maize and sugar cane molasses mixture was evaluated. Mixture samples (1 g DM were incubated for 24 h. All the mixtures were added with 500 mg of polyetilenglycol (PEG. Adding molasses to star grass increased dry matter true digestibility and carbohydrate fermentation (P

  18. [Trans-intestinal cholesterol excretion (TICE): a new route for cholesterol excretion].

    Science.gov (United States)

    Blanchard, Claire; Moreau, François; Cariou, Bertrand; Le May, Cédric

    2014-10-01

    The small intestine plays a crucial role in dietary and biliary cholesterol absorption, as well as its lymphatic secretion as chylomicrons (lipoprotein exogenous way). Recently, a new metabolic pathway called TICE (trans-intestinal excretion of cholesterol) that plays a central role in cholesterol metabolism has emerged. TICE is an inducible way, complementary to the hepatobiliary pathway, allowing the elimination of the plasma cholesterol directly into the intestine lumen through the enterocytes. This pathway is poorly characterized but several molecular actors of TICE have been recently identified. Although it is a matter of debate, two independent studies suggest that TICE is involved in the anti-atherogenic reverse cholesterol transport pathway. Thus, TICE is an innovative drug target to reduce -cardiovascular diseases. © 2014 médecine/sciences – Inserm.

  19. Effect of Cisplatin on the Flexibility of Linear DNA

    International Nuclear Information System (INIS)

    Ji Chao; Zhang Ling-Yun; Hou Xi-Miao; Dou Shuo-Xing; Wang Peng-Ye

    2011-01-01

    With the aid of an atomic force microscope (AFM), we study the interaction between linear DNA fragment and cisplatin. For different cisplatin concentrations, the AFM used to observe the conformation of DNA has a gradual change. The contour length, the end-to-end distance and the local bend angles of the linear DNA fragment can be accurately measured. The persistence length of DNA interacting with cisplatin is decreased with the increasing cisplatin concentration. Furthermore, it is demonstrated that the local bend angles of DNA chains are increased by the binding interaction of cisplatin. (cross-disciplinary physics and related areas of science and technology)

  20. Monoclonal antibody to the rat glucocorticoid receptor. Relationship between the immunoreactive and DNA-binding domain

    International Nuclear Information System (INIS)

    Eisen, L.P.; Reichman, M.E.; Thompson, E.B.; Gametchu, B.; Harrison, R.W.; Eisen, H.J.

    1985-01-01

    The region of the glucocorticoid receptor that reacted with a monoclonal antibody (BUGR-1) was identified. In order to identify the immunoreactive region, the rat liver glucocorticoid receptor was subjected to limited proteolysis; immunoreactive fragments were identified by Western blotting. The monoclonal antibody reacted with both the undigested Mr approximately 97,000 receptor subunit and a Mr approximately 45,000 fragment containing the steroid-binding and DNA-binding domains. Digestion by trypsin also produced two steroid-binding fragments of Mr approximately 27,000 and 31,000 which did not react with the antibody and an immunoreactive Mr approximately 16,000 fragment. This Mr approximately 16,000 fragment was shown to bind to DNA-cellulose, indicating that it contained a DNA-binding domain of the receptor. The undigested receptor must have steroid associated with it to undergo activation to a DNA-binding form. However, the Mr approximately 16,000 immunoreactive fragment binds to DNA-cellulose even if it is obtained by digestion of the steroid-free holoreceptor which does not itself bind to DNA