WorldWideScience

Sample records for lyon france 4-5

  1. [Étienne Destot (1864-1918): the first radioanatomist in Lyon, France].

    Science.gov (United States)

    Viard, B; Trost, O; Trouilloud, P; Salomon, C

    2014-03-01

    Destot was born in Dijon, France, in 1864. He began his education in Burgundy, then he started his preclinical curriculum in Lyon, France, from 1884. He had to leave Lyon, and spent some times in Algeria to treat a tuberculosis. He came back in Lyon as a resident in 1886. Destot worked as an assistant in the laboratory of anatomy of Leo Testut in 1880. His thesis, in 1892, analyzed mortality in the departments of surgery of the Lyon hospitals. The polemical results he presented compromised his surgical career. He went on as prosector by Leo Testut, and then became electrician-physician in 1895 (electrotherapy and galvanotherapy). Étienne Destot of Lyon, France, developed in 1895 the first radiography room ever at the Hôtel-Dieu of Lyon, France. Wilhelm Röntgen discovered the X-rays in the same year, and Destot felt his discovery could revolutionize the approach of anatomy and traumatology. He studied wrist, ankle and calcaneus fractures, and described a new anatomy: "traumatic anatomy". For example, he focused on the posterior talar surface hollow in posterior tarsus fractures. He proposed the term of "thalamus" for this articular surface; this term is nowadays widely used by the clinicians. He introduced the term of "third malleolus" to describe the posterior part of the distal extremity of the tibia. He was the first author to analyze the normal and pathological movements of the scaphoid bone and the lunatum in wrist extension.

  2. [Ragweed in France and the Rhône-Alpes region (Lyon, Bourgoin, Grenoble, Roussillon].

    Science.gov (United States)

    Thibaudon, M; Lachasse, C; Finet, F

    2003-03-01

    Ragweed in France is a rather recent pollen which causes strong allergies on the populations concerned. This pollen, mainly located in the area Rhone-Alpes, extend more and more on totality of France. Indeed, the pollinic data highlight the presence of ragweed on all the territory with very low, as for Brittany, to several hundreds grains in the area of Rhone-Alpes. So four towns of this area have followed closely the extend of this pollen during the year 2002 through five pollen-traps (2 for the town of Lyon). The trap of Lyon I (Gerland) made it possible to follow temporal the extend of ragweed from 1987 to 2002 and the increase of the number of grains as that of the number of days with a significant allergic risk. The study shows also the differences in quantity of pollens, the differences between the daily allergic risks of the five sites, as well as the differences, between the cities, of the number of days when the allergic risk is significant. It is necessary that pollen of ragweed can be followed closely because of its strong allergenic capacity, in the area of Rhone-Alpes, where the plant prevails mainly, but also on the totality of the own territory, this to supervise its evolution and the speed of proliferation of the plant.

  3. Report of the Integrative Molecular Cancer Epidemiology International Symposium, Lyon, France.

    Science.gov (United States)

    Raimondi, S

    2008-01-01

    An International Symposium on Integrative Molecular Cancer Epidemiology took place in Lyon, France, on 3-5 July 2008. The Symposium focused on aetiological and mechanistic aspects of molecular and genetic cancer epidemiology research and was divided into the following three sections: Molecular epidemiology-application of novel molecular markers to cancer epidemiology.Genomic epidemiology in the era of whole genome scan.INTEGRATIVE MOLECULAR EPIDEMIOLOGY: visions for the future.Participants included epidemiologists, geneticists, biochemical and molecular biologists, pharmacologists, pathologists and all researchers interested in this field. The Symposium provided a complete and clear overview of the present and future programmes in molecular cancer epidemiology. It also served to encourage international scientific collaboration between investigators working in this specific research field, and to stimulate transdisciplinary research with experts of other research areas. Highlights of each of the scientific presentations are summarized below.

  4. [Best practice agreement: implementation of best practice guidelines in HCL hospitals in Lyon, France].

    Science.gov (United States)

    Hédoux, S; Armoiry, X; Dode, X; Stamm, C; Chamouard, V; Pivot, C; Souquet, P-J; Aulagner, G

    2010-05-01

    Since 2004, the Hospices Civils de Lyon (HCL) hospitals are committed to comply with best practice guidelines for healthcare products that are reimbursed in addition to diagnosis related groups' (DRGs) tariffs in France, and that, even before the publication of the law concerning best practice agreement. It has been necessary to adapt national drugs best practice guidelines to every-day practice. A working group, COPIL RBU, has been created in HCL hospitals to manage the best practice guidelines locally. This group has two main activities: it conducts a scientific and regulatory information watch and follows up emerging indications at HCL. The group's best practice guidelines contain a classification of indications into three categories: approved indications (market authorization and temporary protocol of treatment), currently-assessed indications and contra-indications. Our best practice guidelines are more than a rewriting of national guidelines since they include emerging indications validated by prescribing physicians at HCL hospitals. A scientific argumentation is made for each emerging indication that is classified in our guidelines, based on the level of scientific evidence available. The practical use of our best practice guidelines is made through a best practice prescription that enables the traceability of drugs from the prescription to the administration to the patient. These prescriptions are accompanied with best practice guidelines made by medical and pharmaceutical professional groups. Audits will then be conducted to assess the indications' conformity to our guidelines and to have a better knowledge of current medical practice.

  5. Lyon brace.

    Science.gov (United States)

    de Mauroy, Jean Claude; Fender, Paule; Tato, Biagio; Lusenti, Piera; Ferracane, Gioacchino

    2008-01-01

    For the last 60 years, the impressive progress of the scoliosis surgery has hidden the development of the conservative orthopedic treatment. The stabilization of the scoliosis, which implies the safeguarding of a spine as mobile as possible, remains a valid objective. The Lyon Brace management combines 3 techniques. A reduction of the scoliosis using a plaster cast fixed on an EDF (Elongation Derotation Flexion) Cotrel's frame. It carries through a flow of the musculoligamentar structure of the concavity. A contention by Lyon Brace. Orthesis without any cervical superstructure is adjustable, symmetric, see through and active. The elongation between the two scapular and pelvic girdle leads to a disc decompression which makes easier the 3D correction of the curves. The individual moulding (custom made) is actually electronic using a "full 3D imaging" system by Orten. To every 14 types of Lenke's classification matches a specific blue print. A specific physiotherapy combining the consciousness of the deformity, suppling up of the retracted elements of the concavity, compensatory suppling up of the girdles, improvement of the vital capacity based on exhalation, reharmonisation of the static, static strengthening in order to facilitate the ability to be still in a corrected position, kyphotisation proprioceptive exercises to stimulate the maturation of the postural system. We advise the scoliotics to practice sport during the treatment period. The long term follow up confirms a global effectiveness indication of 0,89 with the rib hump declining by half. When we treat scoliotics with Cobb angle less than 45 degrees, surgical treatment can be prevented in 98% of the patients.In France 60% of the families agree with this stringent treatment which becomes easier thanks to its ambulatory realization and the excellent formation of the partners, the physiotherapists and the orthesist.

  6. OLAC, Lyon

    DEFF Research Database (Denmark)

    Dickson, Thomas

    2000-01-01

    Næsten alle designopgaver begynder med nogle skriblerier på et stykke papir. Men oftest er tegninger ikke nok, man må ty til mock-ups og modeller af forskellig art. OLAC (Outdooor Lamp Application Centre) i Lyon, Frankrig er Philips demonstrations og test center for udendørs belysning.......Næsten alle designopgaver begynder med nogle skriblerier på et stykke papir. Men oftest er tegninger ikke nok, man må ty til mock-ups og modeller af forskellig art. OLAC (Outdooor Lamp Application Centre) i Lyon, Frankrig er Philips demonstrations og test center for udendørs belysning....

  7. Deterministic modelling of the cumulative impacts of underground structures on urban groundwater flow and the definition of a potential state of urban groundwater flow: example of Lyon, France

    Science.gov (United States)

    Attard, Guillaume; Rossier, Yvan; Winiarski, Thierry; Cuvillier, Loann; Eisenlohr, Laurent

    2016-08-01

    Underground structures have been shown to have a great influence on subsoil resources in urban aquifers. A methodology to assess the actual and the potential state of the groundwater flow in an urban area is proposed. The study develops a three-dimensional modeling approach to understand the cumulative impacts of underground infrastructures on urban groundwater flow, using a case in the city of Lyon (France). All known underground structures were integrated in the numerical model. Several simulations were run: the actual state of groundwater flow, the potential state of groundwater flow (without underground structures), an intermediate state (without impervious structures), and a transient simulation of the actual state of groundwater flow. The results show that underground structures fragment groundwater flow systems leading to a modification of the aquifer regime. For the case studied, the flow systems are shown to be stable over time with a transient simulation. Structures with drainage systems are shown to have a major impact on flow systems. The barrier effect of impervious structures was negligible because of the small hydraulic gradient of the area. The study demonstrates that the definition of a potential urban groundwater flow and the depiction of urban flow systems, which involves understanding the impact of underground structures, are important issues with respect to urban underground planning.

  8. Identification, assessment and prioritization of ecotoxicological risks on the scale of a territory: Application to WWTP discharges in a geographical area located in northeast Lyon, France.

    Science.gov (United States)

    Brus, Alain; Perrodin, Yves

    2017-09-13

    The ecotoxicological risk assessment methodologies developed up to now mainly focus on local pollution and do not incorporate an evaluation and prioritization of the different risk situations present in the same territory. This article presents the different phases of formulating an innovative methodology developed to fill this gap, and its application to all the 18 WasteWater Treatment Plants (WWTP) of a geographical area located northeast of Lyon, France. The aim was also take into account emerging pollutants that are very often "forgotten" in ecotoxicological risk assessments. The results of the study show the extreme diversity of the ecotoxicity of the pollutants present in discharges, with "minimum" PNEC values in the region of a millionth of a microgram (10(-6) μg/l) and "maximum" PNEC values in the region of several tens of micrograms. They also show very considerable diversity of the flows of the receiving watercourses in the territory concerned (from several m(3)/s to 600 m(3)/s). The Risk Quotients (RQ) resulting from these 2 datasets, calculated for each WWTP and for each of the 10 pollutants most implicated in ecotoxicological risks (Diclofenac, Amoxicillin, Trimethoprim, Roxithromycin, 17β-estradiol, 17α-Ethynylestradiol, Estrone, Nonylphenol, Octylphenol, Nickel, et NH4(+)), vary from 0.000002 to 187.7 when using the median concentration values of these pollutants, and from 0.000007 to 3750 when using their maximum concentration values. Globally, they show that: (1) the risks are higher for small streams that receive WWTP discharges of average size, (2) the risks are low to very low for discharges into watercourses with high flow rates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Assessing various approaches for flash flood forecasting in the Yzeron periurban catchment (150 km2) south-east Lyon, France

    Science.gov (United States)

    Braud, Isabelle; Breil, Pascal; Javelle, Pierre; Pejakovic, Nikola; Guérin, Stéphane

    2017-04-01

    The Yzeron periurban catchment (150 km2) is prone to flash floods leading to overflow in the downstream part of the catchment. A prevention and management plan has been approved and the set-up of a flood forecasting system is planned. The present study presents a comparison of several solutions for flood forecasting in the catchment. It is based on an extensive data collection (rain gauges, radar/rain gauge reanalyses, discharge and water level data) from this experimental catchment. A set of rainfall-runoff events leading to floods (problematic and non-problematic floods) was extracted and formed the basis for the definition of a first forecasting method. It is based on data analysis and the identification of explaining factors amongst the following: rainfall amount, intensity, antecedent rainfall, initial discharge. Several statistical methods including Factorial Analysis of Mixed Data and Classification and Regression Tree were used for this purpose. They showed that several classes of problematic floods can be identified. The first one is related to wet conditions characterized with high initial discharge and antecedent rainfall. The second class is driven by rainfall amount, initial discharge and rainfall intensity. Thresholds of these variables can be identified to provide a first warning. The second forecasting method assessed in the study is the system that will be operational in France in 2017, based on the AIGA method (Javelle et al., 2016). For this purpose, 18-year discharge simulation using the hydrological model of the AIGA method, forced using radar/rain gauges reanalysis were available at 44 locations within the catchment. The dates for which quantiles of a given return period were overtopped were identified and compared with the list of problematic events. The AIGA method was found relevant in identifying the most problematic events, but the lead time needs further investigation in order to assess the usefulness for population warning. References

  10. Cafe Lyon = Cafe Lyon / Andres Labi

    Index Scriptorium Estoniae

    Labi, Andres, 1977-

    2013-01-01

    Cafe Lyon (Meistri 22, Tallinn) sisekujundusest. Autorid: Janno Roos, Andres Labi, Kristel Jakobson (Ruumilabor). Prantsuse Lütseumi direktori Lauri Leesi arvamus. Disainibüroo Ruumilabor lühitutvustus

  11. Cafe Lyon = Cafe Lyon / Andres Labi

    Index Scriptorium Estoniae

    Labi, Andres, 1977-

    2013-01-01

    Cafe Lyon (Meistri 22, Tallinn) sisekujundusest. Autorid: Janno Roos, Andres Labi, Kristel Jakobson (Ruumilabor). Prantsuse Lütseumi direktori Lauri Leesi arvamus. Disainibüroo Ruumilabor lühitutvustus

  12. Revitalization and ITS Impact on Public. Space Organization A Case Study of Manchester in UK, Lyon in France and Łódź in Poland

    Directory of Open Access Journals (Sweden)

    Jarosław Kazimierczak

    2014-05-01

    Full Text Available Process of deindustrialization of downtowns in most of well-developed Western European countries has been undertaken since 1960’s while in post-socialist countries just from last 25 years, after political and economic transitions in Central and Eastern Europe.  As far as urban structure is concerned, a new type of inner-city sites has appeared as a consequence of the collapse of industrial activities in second half of 20th century.  In vast majority of cases newly developed morhological units (e.g. run-down post-industrial have been unavailable to the public. As a reult, “classical” public space organization of European cities has been significantly changed. However, revitalization of post-industrial urban areas creates opportunities to reorganize public space according to current inhabitants and other urban space users’ needs. All transitions undertaken as a part of re-developement of brownfields sites are focused on impovements in physical and functional dimension of urban space quality to increase the standard of living condition. According to the concept of smat cities it is relaeted to “smart living” in sustainable urban environment. As a matter of fact, post-socialist cities in Central and Eastern Europe where interval of central planning was present in second half of 20th century and “classical” capitalist cites of Western Europe represent different patterns of public space transitions due to distinct historical development process of central space. In the paper a comparative study of Manchester, Lyon and Łódź is presented. The aim of the research is to indicate the reorganization of historically shaped public space structre in central space of analyzed cities after revitalization of post-industrial urban areas and new central space creation.

  13. Synthesis of magnitude and focal mechanism computations for the M ≥ 4.5 earthquakes in France for the period 1995 2000

    Science.gov (United States)

    Dufumier, Hugues

    This paper proposes a synthesis of thestudies made in terms of source parametersevaluation for the last earthquakes oflocal magnitude greater than 4.5 whichoccurred in or nearby France during thelast five years. Focal mechanisms andseismic moments have been computed for thethree most important events, largely feltby the population: St Paul de Fenouillet(February 18th 1996, ML 5.6),Annecy-Epagny (July 15th 1996, ML5.2) and St-Béat (October 4th1999, ML 4.8). These focal mechanismshave been obtained either by regionalmoment tensor inversion or from firstmotion polarities and are compared withcomplementary studies made on theseearthquakes. In addition, for the otherearthquakes of local magnitude greater than4.5 which occurred nearby French borderssince the beginning of the recording ofbroadband data by the RéNaSS(Réseau National de SurveillanceSismique, French Seismological Survey) inmid-1995, several magnitude calculationsconcerning the following earthquakes arepresented: Pamplona (25/2/1996, ML4.7), Aoste (31/03/1996, ML 4.6),Imperia (24/2/1997, ML 4.5),Barcelonette (31/10/1997, ML 4.8),Pamplona (27/10/1998, ML 4.9), andBonifacio (26/4/2000, ML 4.5). Localmagnitudes are usually higher thanthe Mb magnitudes reported by the PDE(Preliminary Determination of Epicenters),while the extension of the Msz scale toregional magnitudes and the Mw magnitudesderived from seismic moments give smallervalues. The relative importance of thevarious earthquakes in terms of surfacewave magnitude or seismic moment does notalways agree with that implied by localmagnitudes.

  14. [Hippocrates' heritage from Lyons].

    Science.gov (United States)

    Bouchet, A

    1995-01-01

    Hippocrates' influence is known in Lyons as soon as the time of the Renaissance, after the discovery of printing. Symphorien Champier and later chiefly Rabelais translated texts of the Cos master and had them edited by the first printers. Hippocrates' influence is moreover evident in Rabelais' work. In the XIXth century, surgeon major Pétrequin published the first book devoted to Hippocrates's surgery. More recently, Professor Pierre Delore has been a convinced supporter of neo-hippocratic medicine of which he developed the chief principles in his works.

  15. France.

    Science.gov (United States)

    1993-02-10

    Taxes on cigarettes in France have been increased by 15 per cent, the first of an overall rise of 30 per cent. Part of the revenue raised will help subsidise motor racing which lost its sponsors following a recent national ban on cigarette advertising. The remainder will go to the social security service.

  16. France

    Science.gov (United States)

    2002-01-01

    Every July, the world's best cyclists race more than 3500 km around France, and sometimes the surrounding countries, in the Tour de France. This image from the Moderate resolution Imaging Spectroradiometer (MODIS) shows the varied terrain which challenges the riders. The race started in western France at Futuroscope, and headed toward Brittany. In these mostly flat 'stages' (as each day's race is called) sprinting specialists usually dash for the finish out of the main pack of riders. The race then moved to the Pyrenees mountains, in southern France along the border with Spain. Climbers and the overall favorites shine in the mountains, often gaining 10 minutes or more on their rivals. Only a few days after the Pyrenees climbs the race was again in the mountains. First Mont Ventoux, an extinct volcano in Provence, and then the massive Alps, with altitudes as high as 2,645 meters, challenged the racers. Finally the race headed toward Paris and a July 23rd finish in Paris. Go Lance! To learn more about MODIS, visit the MODIS web. Image by Jacques Descloitres, MODIS Land group, NASA GSFC

  17. Programme and Abstracts. Workshop on Expert Evaluation and Control of Compound Semiconductor Materials and Technologies (1st) Held in Ecole Centrale De Lyon, France on 19 -22 May 1992. (EXAMTEC’ 92)

    Science.gov (United States)

    1992-05-22

    MADAN and V.K.TEWARY, Solar Cells, 9 (1983) 289-93. 0 Present Address : CNRS, 1 Place Aristide BRIAND, 92195 Meudon Cedex France. INFLUENCE OF THE BASE...Montpellier cedex5, France. (Fax: 67 14 37 60) 2) Institut of Semiconductor Electronics-RWTH, 5100 Aachen, Germany. 3) CLOES -SUPELEC, Universitd de Metz...LEPLEY(1), K. DMOWSKI(2) (1) CLOES /LOM, ESE, University of Metz, 2 rue E.Belin, F 57078 Metz cedex 3, FRANCE T61. 87 74 99 38 Fax 87 75 17 24 (2

  18. Via Lyon: Parcours de romans et mutations éditoriales au XVIe siècle. Partie II. La circulation des textes entre Lyon et Paris

    Directory of Open Access Journals (Sweden)

    Gaëlle Burg

    2015-07-01

    Full Text Available La première partie du dossier Via Lyon (Carte Romanze 2/2 [2014] analysait le rôle de carrefour économique et culturel de la ville de Lyon dans la constitution d’une identité éditoriale des romans publiés en France au XVIe siècle. L’étude de ces «parcours de romans» conduit à replacer, en cette seconde partie du dossier, la notion d’«étape lyonnaise» dans la dynamique qui anime les deux principaux centres d’imprimerie français de la Renaissance. L’étude des pérégrinations éditoriales, de Paris à Lyon et de Lyon à Paris, de Lancelot du Lac (G. Burg, de Valentin et Orson (M. Colombo Timelli et de Méliadus chevalier de la Croix (A. Réach-Ngô met ainsi au jour les diverses formes de circulation, d’adaptation et de réappropriation que les ateliers parisiens et lyonnais confèrent aux œuvres romanesques qui passent sous leurs presses tout au long du siècle. The first part of the file Via Lyon (Carte Romanze 2/2 [2014] analyzed the role of economic and cultural crossroad of Lyon city in the constitution of an editorial identity of novels published in France in the sixteenth century. The study of these «novels’ route» leads to situate the concept of «Lyon step» in the dynamics which animates the two major French printing centers of the Renaissance. The editorial peregrinations, from Paris to Lyon and from Lyon to Paris, of three french novels, Lancelot du Lac (G. Burg, Valentin and Orson (M. Colombo Timelli and Méliadus chevalier de la Croix (A. Réach-Ngô, shows the various forms of circulation, adaptation and reappropriation that various Parisian and Lyon workshops give to novels they print throughout the century. 

  19. [History of anatomy in Lyon].

    Science.gov (United States)

    Bouchet, A

    1978-06-01

    1. We know very little concerning the teaching of anatomy during the Middle Ages. Only two authors, who both came to live in Lyon, Lanfranc and Guy de Chauliac, wrote on the subject. On the other hand, the important development of printing in Lyon from the sixteenth century onwards, made it possible to spread the translations of classic works and most of the books on Anatomy of the Renaissance. 2. However, Lyonese Anatomy developed very slowly because hospital training was more often badly organized. The only true supporter of Anatomy has been Marc Antoine Petit, chief surgeon of the Hôtel-Dieu before the French Revolution. 3. Apart from the parallel but only transient teaching of the Royal College of Surgery, one will have to wait for the creation of an official teaching first assumed by "schools" (secondary school and preparatory school) and finally by the Faculty of Medicine created in 1877. The names of Testut and of Latarjet contributed to the reknown of the Faculty of Medicine by their anatomical studies of great value for several generations of students. 4. Recently the Faculty of Medicine has been divided into four "universities". The new buildings are larger. The "gift of corpses" has brought a remedy to the shortage of the last twenty years. Anatomical research can be pursued thanks to micro-anatomy and bio-mechanics while conventional teaching is completed by dissection.

  20. District heating in Lyons: self-monitoring and administrative control; Chauffage urbain de Lyon: autosurveillance et controle de l`Administration

    Energy Technology Data Exchange (ETDEWEB)

    Lartigue, D. [SLEC / PRODITH, 69 - Lyon (France)

    1996-12-31

    The district heat and cold system of Lyon city (France) is presented, with emphasis on the environmental performances of its boiler, burner and dust cleaning systems. Pollutant emissions are continuously monitored, controlled and regulated: the sensing and monitoring system is described together with the data acquisition and processing systems, allowing for a real time control of the plants and the whole heating system. Relations with the local administration and audits for ISO 14000 certification are also discussed

  1. [Three Copt mummies of Antinoe in Lyon].

    Science.gov (United States)

    Fischer, Louis Paul

    2006-01-01

    Three mummies--one of a woman and two of a woman and a child--are nowadays presented in the Museum of Anatomy Testut-Latarjet in Lyon. They have been brought in 1901 from Egypt to the Museum Guimet of Lyon and after a few years, they have been given to Professor Testut and studied by Louis Paul Fisher and Frederique Cantero in a thesis of medicine of Lyon (1991). They have been examined by x-rays non-invasive scanning by Professor Michel Bochut. Finally Professor Jean-Claude Goyon, chairman in the "Maison de l'Orient", proposed to date them from the end of the 5th or the beginning of the 6th century, after the designs and the ornaments of the clothes.

  2. Streptozotocin induced diabetes in lyon hypertensive rats

    Institute of Scientific and Technical Information of China (English)

    LeaEMONNOT; JeanSASSARD; MingLO

    2004-01-01

    AIM: Lyon hypertensive (LH) rats, compared to their normotensive controls (LL) exhibit an increased blood pressure (BP)associated with a marked proteinuria and a metabolic syndrom including elevated plasma lipids and insulin/glucose ratio. The aim of the present work was to determine wether a type 2 diabetes could be induced in LH rats so as to obtain a model suitable for study of the relationships between diabetes and hypertension.

  3. Virginia Tech Distinguished Lecture Series: Eric Lyon

    OpenAIRE

    Lyon, Eric

    2015-01-01

    Associate Professor - Music Technology, Composition Eric Lyon is a composer and computer music researcher. Major areas of focus include computer chamber music, spatial orchestration, and articulated noise composition. Recent compositions include "Spirits", a 43-channel electroacoustic piano composition for the ZKM Kubus,"Noise Variations" for ensemble mise-en, and “The Book of Strange Positions” for the violin duo String Noise. Subject: Distinguished Lecture Series

  4. New large-format holographic laboratory in France

    Science.gov (United States)

    Gauchet, Pascal E. P.

    1994-01-01

    A new holographic laboratory, Photonics 3D, has opened in Lyon, France. Its objectives are many fold: to encourage creative research in the field of holographic imagery, to set up an artist in residence program and to allow the production of very large holograms.

  5. Terrorism in France.

    Science.gov (United States)

    Carli, Pierre; Telion, Caroline; Baker, David

    2003-01-01

    France has experienced two waves of major terrorist bombings since 1980. In the first wave (1985-1986), eight bombings occurred in Paris, killing 13 and injuring 281. In the second wave (1995-1996), six bombings occurred in Paris and Lyon, killing 10 and injuring 262. Based on lessons learned during these events, France has developed and improved a sophisticated national system for prehospital emergency response to conventional terrorist attacks based on its national emergency medical services (EMS) system, Service d'Aide Medicale Urgente (SAMU). According to the national plan for the emergency medical response to mass-casualty events (White Plan), the major phases of EMS response are: (1) alert; (2) search and rescue; (3) triage of victims and provision of critical care to first priority victims; (4) regulated dispatch of victims to hospitals; and (5) psychological assistance. Following the 1995 Tokyo subway sarin attack, a national plan for the emergency response to chemical and biological events (PIRATOX) was implemented. In 2002, the Ministries of Health and the Interior collaborated to produce a comprehensive national plan (BIOTOX) for the emergency response to chemical, biological, radiological, and nuclear events. Key aspects of BIOTOX are the prehospital provision of specialized advance life support for toxic injuries and the protection of responders in contaminated environments. BIOTOX was successfully used during the 2003 Severe Acute Respiratory Syndrome (SARS) outbreak in France.

  6. De Paris à Lyon. Les mutations éditoriales du «Lancelot du Lac»

    Directory of Open Access Journals (Sweden)

    Gaëlle Burg

    2015-07-01

    Full Text Available Lancelot du Lac est le premier roman arthurien imprimé à la Renais­sance. Dans sa première édition parue en 1488, qui réunit deux imprimeurs (Jean Le Bourgeois à Rouen et Jean Du Pré à Paris, un découpage et un prologue inédits sont ajoutés par le remanieur. Le texte sera réédité six fois par divers imprimeurs-libraires parisiens jusqu’en 1533. L’édition de luxe d’Antoine Vérard (1494, destinée au roi Charles VIII, présente d’importantes modifications effectuées dans un but commercial. Après une longue période d’accalmie qui signe le début du déclin de la vogue des romans de chevalerie médiévaux, Benoît Rigaud publie à Lyon, sous une forme considérablement abrégée, la dernière édition connue du Lancelot au XVIe siècle (1591. Si elle ne présente que peu d’intérêt littéraire, elle apporte cependant des informations concernant les pratiques éditoriales et les goûts du  lecteur de la fin du XVIe siècle. De Paris à Lyon, entre renaissance et déclin, le parcours éditorial d’un incontournable roman arthurien.Lancelot du Lac is the editio princeps of an Arthurian romance in Renaissance France. The first edition in 1488, which brings together two printers (Jean Le Bourgeois from Rouen and Jean Du Pré from Paris, offers original arrangement and prologue added by the compositor. The text will be published six times by various printers and booksellers in Paris until 1533. The luxurious edition from Antoine Vérard (1494 dedicated to King Charles VIII provides interesting transformations in commercial purposes. After a long time without edition, showing the beginning of chivalry literature’s decline, Benoît Rigaud publish in Lyon, in a greatly abbreviated form, the last known edition of Lancelot in the XVIth century (1591. If it presents no literary interest, it provides nevertheless informations about editorial practices and reader’s tastes from the end of Renaissance France. From Paris to

  7. The Condition of the Lyon Weavers in the Letters to Louis XV and Monseigneur Poulletier (1731 and 1732

    Directory of Open Access Journals (Sweden)

    Carmelina Imbroscio

    2014-04-01

    Full Text Available On 8th May, 1731, an ordinance of Louis XV, King of France, imposed separation between the production and sale activities of the weavers of ‘gold, silver and silk’ at the famous Lyon Manufactory in which hundreds of families worked. The ordinance plunged into despair the workers (maîtres ouvriers who, up till then, for centuries, had been allowed to sell their goods freely and were now in danger of being reduced to poverty by a handful of traffickers who knew nothing about their extremely sophisticated, skilful trade, but would be enabled to capitalize on their work. They therefore addressed two petitions (the first in 1731 and the second in 1732 to the King and Monseigneur Poulletier, the King’s Superintendent and the Manufactory’s Overseer, asking for the abrogation of the ordinance and a revision of the Manufactory’s regulations. The interesting aspect of these two petitions is that they show the workers’ consciousness of their rights; indeed, their denunciation of these abuses foretells, a century before, the two important revolts of the canuts (as the Lyon textile workers were known which were to break out in 1831 and 1834.

  8. Voting Places, Lyon County Voting Places, Published in 2011, 1:2400 (1in=200ft) scale, City of Emporia/Lyon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Voting Places dataset, published at 1:2400 (1in=200ft) scale, was produced all or in part from Hardcopy Maps information as of 2011. It is described as 'Lyon...

  9. Park Facilities, Lyon County and City of Emporia Parks, Published in 2010, 1:4800 (1in=400ft) scale, City of Emporia/Lyon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Park Facilities dataset, published at 1:4800 (1in=400ft) scale, was produced all or in part from Hardcopy Maps information as of 2010. It is described as 'Lyon...

  10. Fire Stations, Lyon County Fire Stations within the Address Points Layer, Published in 2011, 1:1200 (1in=100ft) scale, City of Emporia/Lyon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Fire Stations dataset, published at 1:1200 (1in=100ft) scale, was produced all or in part from Orthoimagery information as of 2011. It is described as 'Lyon...

  11. Road and Street Centerlines, Lyon County Street Centerline, Published in 2011, 1:1200 (1in=100ft) scale, City of Emporia/Lyon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — , published at 1:1200 (1in=100ft) scale, was produced all or in part from Orthoimagery information as of 2011. It is described as 'Lyon County Street Centerline'....

  12. Water Districts, Lyon County Rural Water Districts, Published in 2010, 1:4800 (1in=400ft) scale, City of Emporia/Lyon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Water Districts dataset, published at 1:4800 (1in=400ft) scale, was produced all or in part from Hardcopy Maps information as of 2010. It is described as 'Lyon...

  13. 77 FR 51912 - Safety Zone; Tom Lyons Productions Fireworks, Long Island Sound, Sands Point, NY

    Science.gov (United States)

    2012-08-28

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Tom Lyons Productions Fireworks, Long.... 165.T01-0618 to read as follows: Sec. 165.T01-0618 Safety Zone; Tom Lyons Productions Fireworks, Long...

  14. Lyon Playfair (1818-1898) and compulsory vaccination.

    Science.gov (United States)

    Butler, A

    2006-08-01

    Lyon Playfair was born in India but brought up by his uncle in St Andrews. He studied medicine in Glasgow and Edinburgh but never practised as a doctor. Instead he worked for the chemist Thomas Graham in London and then studied for a PhD with Liebig in Germany. While serving on a government commission he became very interested in public health, particularly the control of infectious diseases. In 1883, while a member of parliament, he made a passionate speech in support of a government bill in favour of compulsory vaccination against smallpox. He was violently attacked for his speech in a pamphlet by William White, an adherent of the teachings of the Swedish mystic Emanuel Swedenborg. Playfair died in 1898 and is buried in St Andrews.

  15. [Cornea bank of Lyon: from quality diagnosis to ISO 9001 certification].

    Science.gov (United States)

    Pascal, P; Chalochet, A; Damour, O

    2001-12-01

    The tissue and cell bank of the HCL (Hospices Civils de Lyon) has, since 10 June 1999, consisted of two sections with related activities: cell culture for the Skin Substitutes Laboratory (Laboratoire des Substituts Cutanés, LSC) and preservation of corneas at 31 degrees C for the Cornea Bank. As the LSC had been ISO 9001 certified since March 1997 our aim, since merger, was to raise the Cornea Bank to the same level of quality as the LSC, so as to coincide with the renewal of the LSC certificate in February 2000. The methods we used (project, quality control, analysis and process optimization) led us to receive official certification only nine months after the merger. The procedure started with a program of quality control at the Cornea Bank from February 1999 onwards, in order to list the work and equipment required, evaluate its documentation system and what was needed to incorporate this new activity into the existing system of quality assurance at the LSC. On the 7th March 2000, the Tissue and Cell Bank of the HCL obtained an ISO 9001 certificate for its combined functions. As well as achieving our objectives and the strong points highlighted by the auditor during the renewal process, this quality assessment revealed many advantages: improvements in the conservation of corneas, economies in staff replacement and reductions in both the cost of maintaining quality, the cost of the corneas themselves, etc. The decree 'Banque' no. 99-741 of 30th August 1999, which put in place the system of authorization of tissue banks in France, demands quality control. Our application for certification which started in early 1999 had anticipated this regulation. This helped us enormously when compiling the dossier accompanying the official request and was an essential element in obtaining the favourable response of the ASSAPS on 21 June 2000.

  16. Geology and occurrence of ground water in Lyon County, Minnesota

    Science.gov (United States)

    Rodis, Harry G.

    1963-01-01

    Lyon County is in southwestern Minnesota, mostly within the drainage basin of the Minnesota River. The basement rocks in the area consist largely of Precambrian granite and quartzite. These are overlain locally by flat-lying Upper Cretaceous strata composed of thick sections of soft dark-bluish-gray shale and some thin beds of loosely consolidated sandstone. The Cretaceous strata are more than 500 feet thick near the center of the county but gradually pinch out toward the northeast and southwest against the highs of the Precambrian bedrock surface. Glacial drift overlies the Precambrian and Cretaceous rocks and forms the surface of the area. The drift consists largely of till and ranges in thickness from about 10 feet in the north and northeast to approximately 550 feet in the southwest. The most prominent surflcial glacial deposits are five southeast-trending end moraines, two of which are associated with, and parallel to, relatively extensive belts of outwash. Recent deposits averaging less than 20 feet in thickness overlie the glacial drift in stream valleys.

  17. Mechanisms of spontaneous baroreflex impairment in lyon hypertensive rats.

    Science.gov (United States)

    Lantelme, P; Cerutti, C; Lo, M; Paultre, C Z; Ducher, M

    1998-09-01

    This experiment aimed at 1) comparing the spontaneous baroreflex sensitivity (SBRS) in Lyon genetically hypertensive (LH), normotensive (LN), and low blood pressure (LL) rats and 2) assessing some aspects of the mechanisms of its impairment in LH rats. Baroreflex was studied in control animals after an early chronic converting enzyme inhibition with perindopril and after a 4-wk infusion of ANG II in perindopril-treated rats. The SBRS was determined with a previously validated method, using statistical dependence between blood pressure (BP) and heart rate values recorded in freely moving animals. LH rats exhibited high BP, cardiac hypertrophy, and decreased SBRS (LH, 1.3 +/- 0.2; LN, 2.5 +/- 0.4; LL, 2.2 +/- 0.4 beats . min-1 . mmHg-1). Perindopril prevented the development of hypertension and cardiac hypertrophy and normalized SBRS. BP rose in LH and LL rats after ANG II infusion, but only LH rats, which developed a cardiac hypertrophy, had an impaired SBRS (LH, 1.1 +/- 0.2; LN, 2.5 +/- 0.2; LL, 2.8 +/- 0.3 beats . min-1 . mmHg-1). This impairment was partially reversed by an acute ANG II blockade with losartan. These results demonstrate that high BP does not account for the decreased SBRS in LH rats. SBRS impairment could result either from cardiac hypertrophy or from the direct effect of ANG II on the baroreflex loop.

  18. Description of some rhinocerotidae teeth from the Lower Miocene from Estrepouy (France

    Directory of Open Access Journals (Sweden)

    Sanisidro, O.

    2011-12-01

    Full Text Available This paper included undescribed rhinoceros material from Estrepouy (France stored in the Université Claude Bernard, Lyon that were previously identified by Antoine et al (2000. The rhinoceros record from Estrepouy is represented by three species: Protaceratherium minutum, `Plesiaceratherium´ platyodon and Diaceratherium aurelianense.

    En este trabajo se incluyen fósiles no descritos de Estrepouy (Francia depositados en la Universidad Claude Bernard (Lyon, France, que previamente habían sido identificados por Antoine et al. (2000. El registro de rinocerontes de Estrepouy está representado por tres especies: Protaceratherium minutum, ‘Plesiaceratherium’ platyodon y Diaceratherium aurelianense.

  19. The contract facilities for gamma irradiation at Dagneux, France

    Science.gov (United States)

    Pellerin, D.; Kavanagh, M. T.

    CONSERVATOME SA have operated a facility at DAGNEUX near LYON, France since 1961. This operation is among the very first of its kind in the entire world. The process is based on gamma rays from Cobalt 60 of which there are three separate units. In addition there is a small experimental unit using Cesium 137. At present CONSERVATOME is owned by TRANSNUCLEAIRE and EPICEA as principal shareholders and so has the support of the French Atomic Energy Commission. This paper describes the larger D3 unit and reviews some of the products treated at DAGNEUX.

  20. Spatial and temporal trends in PCBs in sediment along the lower Rhone River, France

    Science.gov (United States)

    Desmet, Marc; Mourier, Brice; Mahler, Barbara J.; Van Metre, Peter C.; Roux, Gwenaelle; Persat, Henri; Lefevre, Irene; Peretti, Annie; Chapron, Emmanuel; Anaelle, Simonneau; Miege, Cecile; Babut, Marc

    2012-01-01

    Despite increasingly strict control of polychlorinated biphenyl (PCB) releases in France since the mid-1970s, PCB contamination of fish recently has emerged as a major concern in the lower Rhone River basin. We measured PCB concentrations in Rhone sediment to evaluate the effects of PCB releases from major urban and industrial areas, sediment redistribution by large floods, and regulatory controls on PCB trends from 1970 to present. Profiles of PCBs (the sum of seven indicator PCB congeners) were reconstructed from sediment cores collected from an off-river rural reference site and from three depositional areas along the Rhone upstream and downstream from the city of Lyon, France. Core chronology was determined from radionuclide profiles and flood deposits. PCB concentrations increased progressively in the downstream direction, and reached a maximum concentration in 1991 of 281 μg/kg at the most downstream site. At the rural reference site and at the upstream Rhone site, PCB concentrations peaked in the 1970s (maximum concentration of 13 and 78 μg/kg, respectively) and have decreased exponentially since then. PCB concentrations in the middle and downstream cores were elevated into the early 1990s, decreased very rapidly until 2000, and since then have remained relatively stable. Congener profiles for three time windows (1965–80, 1986–93, and 2000–08) were similar in the three sediment cores from the Rhone and different from those at the rural reference site. The results indicate that permitted discharges from a hazardous-waste treatment facility upstream from Lyon might have contributed to high concentrations into the 1980-90s, but that industrial discharges from the greater Lyon area and tributaries to the Rhone near Lyon have had a greater contribution since the 1990s. There is little indication that PCB concentration in sediments downstream from Lyon will decrease over at least the short term.

  1. Report of the Summer School of Pitch, Music & Associated Pathologies (Lyon, July 9-11, 2014)

    NARCIS (Netherlands)

    J. Pfeifer; R. Asano; V. Attina; M. d’Errico; N. El Boghdady; G. Estivalet; L. Grön; D. Guillemard; H.J. Kang; A. Luckmann; F. Mina; S. Tabibi; J. Viswanathan

    2014-01-01

    The summer school on Pitch, Music and Associated Pathologies was held for 2½ days, July 9-11, 2014, at the Valpré conference center in Lyon. Fifty-five researchers and students from universities and research institutions from 11 countries participated in it. The summer school was organized in 2 larg

  2. Report of the Summer School of Pitch, Music & Associated Pathologies (Lyon, July 9-11, 2014)

    NARCIS (Netherlands)

    Pfeifer, J.; Asano, R.; Attina, V.; d’Errico, M.; El Boghdady, N.; Estivalet, G.; Grön, L.; Guillemard, D.; Kang, H.J.; Luckmann, A.; Mina, F.; Tabibi, S.; Viswanathan, J.

    2014-01-01

    The summer school on Pitch, Music and Associated Pathologies was held for 2½ days, July 9-11, 2014, at the Valpré conference center in Lyon. Fifty-five researchers and students from universities and research institutions from 11 countries participated in it. The summer school was organized in 2 larg

  3. [Dr. Edmond Locard (1877-1966), the Sherlock Holmes of Lyons].

    Science.gov (United States)

    Maze, Michel; Stagnara, Denise; Fischer, Louis-Paul

    2007-01-01

    Doctor Edmond Locard (1877-1966), a French forensic scientist, a disciple of famous Professor Alexandre Lacassagne, created in Lyons, in 1910, the first French laboratory of technical police. During more than fourty years, he used and developed new scientific techniques (fingerprint identification, study of marks and dust...) in order to help the policemen and judges to solve the most horrible crimes.

  4. .NET 4.5 parallel extensions

    CERN Document Server

    Freeman, Bryan

    2013-01-01

    This book contains practical recipes on everything you will need to create task-based parallel programs using C#, .NET 4.5, and Visual Studio. The book is packed with illustrated code examples to create scalable programs.This book is intended to help experienced C# developers write applications that leverage the power of modern multicore processors. It provides the necessary knowledge for an experienced C# developer to work with .NET parallelism APIs. Previous experience of writing multithreaded applications is not necessary.

  5. Spatial and temporal trends in PCBs in sediment along the lower Rhone River, France

    Energy Technology Data Exchange (ETDEWEB)

    Desmet, Marc, E-mail: marc.desmet@univ-tours.fr [EA 6293 GeHCO Universite Francois-Rabelais de Tours, Parc de Grandmont, 37200 Tours (France); Mourier, Brice, E-mail: brice.mourier@entpe.fr [Universite Lyon 1, UMR 5023 Ecologie des Hydrosystemes Naturels et Anthropises, ENTPE, CNRS, 3, Rue Maurice Audin, 69518 Vaulx-en-Velin (France); Mahler, Barbara J., E-mail: bjmahler@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Van Metre, Peter C., E-mail: pcvanmet@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Roux, Gwenaeelle, E-mail: gwenaelle.roux@entpe.fr [Universite Lyon 1, UMR 5023 Ecologie des Hydrosystemes Naturels et Anthropises, ENTPE, CNRS, 3, Rue Maurice Audin, 69518 Vaulx-en-Velin (France); Persat, Henri, E-mail: persat@biomserv.univ-lyon1.fr [Universite de Lyon, UMR 5023 Ecologie des Hydrosystemes Naturels et Anthropises, Universite Lyon 1, ENTPE, CNRS, 5 rue Raphaeel Dubois, 69221 Villeurbanne (France); Lefevre, Irene, E-mail: Irene.Lefevre@lsce.ipsl.fr [UMR 8212, LSCE, Bat. 12, avenue de la Terrasse, F-91198 Gif-sur-Yvette Cedex (France); Peretti, Annie, E-mail: royannie@gmail.com [Irstea, UR MALY, 3 bis Quai Chauveau, CP220, F-69336 Lyon (France); and others

    2012-09-01

    Despite increasingly strict control of polychlorinated biphenyl (PCB) releases in France since the mid-1970s, PCB contamination of fish recently has emerged as a major concern in the lower Rhone River basin. We measured PCB concentrations in Rhone sediment to evaluate the effects of PCB releases from major urban and industrial areas, sediment redistribution by large floods, and regulatory controls on PCB trends from 1970 to present. Profiles of PCBs (the sum of seven indicator PCB congeners) were reconstructed from sediment cores collected from an off-river rural reference site and from three depositional areas along the Rhone upstream and downstream from the city of Lyon, France. Core chronology was determined from radionuclide profiles and flood deposits. PCB concentrations increased progressively in the downstream direction, and reached a maximum concentration in 1991 of 281 {mu}g/kg at the most downstream site. At the rural reference site and at the upstream Rhone site, PCB concentrations peaked in the 1970s (maximum concentration of 13 and 78 {mu}g/kg, respectively) and have decreased exponentially since then. PCB concentrations in the middle and downstream cores were elevated into the early 1990s, decreased very rapidly until 2000, and since then have remained relatively stable. Congener profiles for three time windows (1965-80, 1986-93, and 2000-08) were similar in the three sediment cores from the Rhone and different from those at the rural reference site. The results indicate that permitted discharges from a hazardous-waste treatment facility upstream from Lyon might have contributed to high concentrations into the 1980-90s, but that industrial discharges from the greater Lyon area and tributaries to the Rhone near Lyon have had a greater contribution since the 1990s. There is little indication that PCB concentration in sediments downstream from Lyon will decrease over at least the short term. -- Highlights: Black-Right-Pointing-Pointer We reconstructed

  6. Rhétorique culinaire et invention d’un patrimoine culinaire individualisé chez des étudiants étrangers en séjour temporaire à Lyon Culinary rethorics and the invention of an individual food heritage among foreign students in Lyon

    Directory of Open Access Journals (Sweden)

    Frédérique Giraud

    2010-12-01

    Full Text Available Cet article se propose de discuter des pratiques culinaires mises en œuvre par des étudiants étrangers lors de leur séjour temporaire en France. Pour ce faire, il examine de façon précise les pratiques et les discours de quatre étudiants rencontrés lors d’une enquête ethnographique menée à Lyon, en 2006-2007 : deux étudiantes chinoises, un étudiant marocain et un étudiant italien. Deux attitudes opposées mais hybrides se font jour. La première attitude que nous avons isolée révèle un désir déclaré de s’ouvrir au maximum à de nouvelles pratiques culinaires, mais elle s’accommode de retours à des pratiques conservatrices. La seconde attitude manifeste la volonté de conserver des pratiques culinaires qui sont présentées comme celles du pays d’origine. Pourtant ces pratiques apparaissent bien plus comme des pratiques d’hybridation, de sélection, de ruptures que des pratiques fidèles à un patrimoine familial ou régional. Il apparaît que les étudiants inventent en France un patrimoine culinaire individualisé.In this paper, we will review the cooking methods used by foreign students during their temporary stay in France. To that effect, we interviewed and observed the techniques of students we met in Lyon in 2006-2007 during an ethnographic survey: two Chinese students, one Moroccan and one Italian student. Two opposite but hybrid trends prevail. The first trend we observed shows a real desire to open itself to a maximum of culinary techniques. However, these techniques are modified by the native conservative influences. The second trend shows the desire to preserve the culinary methods of their country of origin. However, these techniques appear much more as a result of cross fertilization between radical and selective techniques than traditional ones inherited from a family or from a local background. Foreign students in France are in a class by itself.

  7. Police Districts, Lyon County Law Enforcement Response Districts. This data is used by 911 call centers to dispatch law enforcement., Published in 2011, 1:1200 (1in=100ft) scale, City of Emporia/Lyon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Police Districts dataset, published at 1:1200 (1in=100ft) scale, was produced all or in part from Hardcopy Maps information as of 2011. It is described as 'Lyon...

  8. Biological restoration: A 4/5 crown

    Directory of Open Access Journals (Sweden)

    Monize Ferreira Figueiredo de Carvalho

    2013-01-01

    Full Text Available Dental caries is one of the most prevalent conditions in humans; the purpose of restorative dentistry is to recreate the anatomy of the affected tooth thus the use of fragments from natural teeth as an effective restorative method. A maxillary first premolar left was prepared for an inverted 4/5 crown due to involvement of the vestibular face, after prepared received an allogeneic collage with similar color and dimension. Follow-up after 12 months indicated a stable restoration. Clinically, the site was without signs of caries, migration of the fragment or marginal infiltration. Biological restoration is a viable alternative for reestablishing function and esthetics to damaged/decayed teeth and therefore, biological restoration as an alternative to other restorative options.

  9. A Death Involving a Fired and Deflected Bullet: A Case Report from Lyon University Institute of Forensic Science, France.

    Science.gov (United States)

    Maujean, Géraldine; Guinet, Tiphaine; Malicier, Daniel

    2016-01-01

    In case of gunshot deaths, atypical wounds can make the distinction between entrance and exit wounds harder. They may be due either to anatomical reasons or to diverse cogent ballistic arguments. The reported case pertains to a fatal hunting accident involving an expanded conical point bullet against the neck with both atypical entrance and exit wounds. Ballistic analyses including test firings allowed a better understanding of the external and internal findings. Upon premature impact with an intermediary target, the bullet experienced expansion in the formation of sharp brass petals responsible for a star-shaped entry wound. The trajectory of the deformed high energy projectile through the victim's body was then deviated by the cervical column, causing it to be tangential to the skin when exiting the body. The description of such atypical cases may benefit other experts and may assist in their investigation into similar cases.

  10. IEEE NUCLEAR SCIENCE SYMPOSIUM AND MEDICAL IMAGING CONFERENCE 15-20 OCTOBER 2000 PALAIS DES CONGRES, LYON, FRANCE

    CERN Multimedia

    2000-01-01

    The IEEE NSS & MIC will be held this year in Europe for the first time in its more than 40 year history. Some 280 oral and 400 poster presentations on radiation detectors, instrumentation and imaging will be given over the five days of the conferences. In addition there is a rich programme of keynote talks, topical workshops, short courses and an industrial exhibition with more than 50 exhibitors. SHORT COURSES Following a long and successful tradition, several tutorial short courses, delivered by known experts in the specific fields, are being offered to registered students. There are still places available to attend the courses on Solid State Detectors, Particle Identification and Detectors for Astrophysics. These intensive one-day tutorials will be given on Sunday October 15. Full details and registration information can be found on the conference web site or from the Short Courses Organiser, Fabio Sauli, CERN. A limited amount of financial support is available for motivated scholars who may not ot...

  11. «Valentin et Orson», de Paris à Lyon

    Directory of Open Access Journals (Sweden)

    Maria Colombo Timelli

    2015-07-01

    Full Text Available Valentin et Orson fut publié d’abord à Lyon (1489, 1495, puis à Paris (ca 1511-1519. Le but de cet article est double: vérifier si le passage d’un centre éditorial à l’autre a impliqué une évolution du texte; montrer l’intérêt d’une collation systématique sur plusieurs éditions, même plus tardives, afin d’établir une édition critique.Valentin et Orson was first published in Lyon (1489, 1495, then in Paris (ca 1511-1519. This article has two aims: first, to establish whether the transfer from the former to the latter editorial centre brought with some kind of evolution of the text; second, to prove how interesting a systematic collation of many editions can be, in establishing a critical edition.

  12. Välisvaatepunkt / Beauvais Lyons, Kavita Shah, Deborah Cornell ; interv. R[eet] V[arblane

    Index Scriptorium Estoniae

    Lyons, Beauvais

    2007-01-01

    Tallinna XIV graafikatriennaali auhinnažürii liige B. Lyons, india kunstnik K. Shah ja ameerika õppejõud D. Cornell vastavad küsimustele, milline koht ja tähendus on graafikal praeguses kunstis, millised olid Tallinna graafikaürituste kolm meeldejäävamat sündmust, kas "Impact'i" konverentsi pidamine graafikatriennaaliga samal ajal oli eelis või puudus

  13. Välisvaatepunkt / Beauvais Lyons, Kavita Shah, Deborah Cornell ; interv. R[eet] V[arblane

    Index Scriptorium Estoniae

    Lyons, Beauvais

    2007-01-01

    Tallinna XIV graafikatriennaali auhinnažürii liige B. Lyons, india kunstnik K. Shah ja ameerika õppejõud D. Cornell vastavad küsimustele, milline koht ja tähendus on graafikal praeguses kunstis, millised olid Tallinna graafikaürituste kolm meeldejäävamat sündmust, kas "Impact'i" konverentsi pidamine graafikatriennaaliga samal ajal oli eelis või puudus

  14. Saussure, Lyons e a partida de xadrez: comparar ou não comparar?

    Directory of Open Access Journals (Sweden)

    Matheus Rigobelo Chaud

    2013-11-01

    Full Text Available Na tradição linguística, é bem conhecida a comparação de Ferdinand de Saussure entre a língua e a partida de xadrez. John Lyons faz uma crítica um tanto quanto incisiva a esta comparação, usando, no entanto, uma abordagem questionável. Este artigo tem como objetivo revisitar o papel da comparação como ferramenta de transmissão de conhecimento, tendo como cenário dois trabalhos clássicos destes grandes nomes da Linguística. Nas obras analisadas nota-se que, enquanto Saussure faz uso extensivo de comparações, Lyons as emprega limitada e cautelosamente, evidenciando uma divergência de postura entre os autores frente a este recurso linguístico. Lyons expressa uma tendência a levar as comparações demasiadamente ao pé da letra, em lugar de explorar suas características de similaridade. Essa atitude mostra-se pouco cooperativa e falha ao deixar de reconhecer todo o potencial didático proporcionado pelas comparações.

  15. Tensile properties of V-(4-5)Cr-(4-5)Ti alloys

    Energy Technology Data Exchange (ETDEWEB)

    Chung, H.M.; Nowicki, L.; Busch, D.; Smith, D.L. [Argonne National Laboratory, Chicago, IL (United States)

    1996-04-01

    The current focus of the U.S program of research on V-base alloys is on V-(4-5)Cr(4-5)Ti that contains 500-1000 wppm Si. in this paper, we present experimental results on baseline tensile properties of two laboratory-scale heats of this alloy and of a 500-kg production heat of V-4Cr-4Ti (heat 832665) that were measured at 23-700 C. Both the production- and laboratory scale heats of the reference alloy V-4Cr-4Ti exhibited excellent tensile properties at temperatures up to {approx}650{degrees}C.

  16. Microstructural examination of V-(4-5%) Cr-(4-5%)Ti irradiated in X530

    Energy Technology Data Exchange (ETDEWEB)

    Gelles, D.S. [Pacific Northwest National Lab., Richland, WA (United States); Chung, H.M. [Argonne Natinonal Lab., IL (United States)

    1997-08-01

    Microstructural examination results are reported for two heats of V-(4-5%)Cr-(4-5%)Ti irradiated in the X530 experiment to {approximately}400{degrees}C to provide an understanding of the microstructural evolution that may be associated with degradation of mechanical properties. Fine precipitates were observed in high density intermixed with small defect clusters for all conditions examined following the irradiation. The irradiation-induced precipitation does not appear to be affected by preirradiation heat treatment at 950-1125{degrees}C. There was no evidence for a significant density of large (diameter >10 nm) dislocation loops or network dislocations.

  17. Thermophysical and mechanical properties of V-(4-5)%Cr-(4-5)%Ti alloys

    Energy Technology Data Exchange (ETDEWEB)

    Zinkle, S.J. [Oak Ridge National Lab., TN (United States)

    1998-03-01

    Solid solution V-Cr-Ti alloys exhibit a good combination of high thermal conductivity, adequate tensile strength, and low thermal expansion. The key thermophysical and mechanical properties for V-(4-5)%Cr-(4-5)%Ti alloys are summarized in this report. Some of these data are available in the ITER Materials Properties Handbook (IMPH), whereas other data have been collected from recent studies. The IMPH is updated regularly, and should be used as the reference point for design calculations whenever possible.

  18. Chapter 40: history of neurology in France.

    Science.gov (United States)

    Clarac, François; Boller, François

    2010-01-01

    The history of neurology in France is characterized by the very high degree of centralization in that country where "everything seems to happen in Paris," and yet the considerable degree of autonomous diversity in the evolution of some other medical schools such as Montpellier and Strasbourg. It could be argued that France saw the birth of clinical neurology as a separate discipline since Jean Martin Charcot at the Salpêtrière Hospital obtained a chair of diseases of the nervous system in 1892, a first in the history of the academic world. The chapter shows, however, that the work of Charcot was preceded by a long evolution in medical thinking, which culminated with the introduction of experimental medicine developed by Claude Bernard and François Magendie, and by the study of aphasia by Paul Broca and its localization of language in a specific area of the brain. Many of the great neurologists of France like Duchenne de Boulogne, Gilles de la Tourette, Joseph Babinski and Pierre Marie gravitated around Charcot while others like Charles-Edward Brown-Sequard and Jules Dejerine developed their talents independently. The history of Sainte-Anne Hospital further illustrates this independence. It also shows the relation between neurology and psychiatry with Henri Ey, Jean Delay and Pierre Deniker, who collaborated with Henri Laborit in the clinical development of chlorpromazine. Sainte Anne also saw the birth of modern neuropsychology with Henry Hécaen. Jean Talairach and his group developed human stereotaxic neurosurgery and a 3-dimensional brain atlas that is used around the world. The chapter also mentions institutions (the CNRS and INSERM) that have contributed to developments partially independently from medical schools. It concludes with a presentation of schools located outside of Paris that have played a significant role in the development of neurology. Six of the most important ones are described: Montpellier, Toulouse, Bordeaux, Strasbourg, Lyon, and

  19. Patrimoine et tourisme urbain. La valorisation de l’authenticité à Lyon et Pékin Heritage and urban tourism. Valorizing authenticity in Lyon and Beijing

    Directory of Open Access Journals (Sweden)

    Yves Bonard

    2008-10-01

    Full Text Available Le tourisme est au cœur des processus de valorisation des territoires urbains. Le patrimoine – pilier majeur de la touristification – tend à prendre un caractère marchand, en tant que produit à valoriser économiquement dans un contexte de villes en compétition. À partir de l’analyse de deux centres urbains en mutations – Lyon et Pékin –, cette recherche montre d’une part l’usage marchand du patrimoine, produit et mobilisé par les pouvoirs publics. D’autre part, ce papier questionne la notion d’authenticité – centrale dans les discours sur la mise en valeur du patrimoine. Apparaissant comme inopérante du point de vue heuristique, nous faisons l’hypothèse qu’elle détient une dimension proprement « fétiche », concourant à la perception déformée de la réalité des rapports sociaux en jeu dans la production patrimoniale.Tourism lies at the heart of urban territorial valorization. The urban heritage – itself a major pillar of urban tourism – is becoming increasingly commodified, within a context of generalized urban competition. Based on the analysis of two changing urban centers – Lyon and Beijing – this paper analyzes the commodified valorization of heritage, produced by entrepreneurial urban governments, and challenges the notion of « authenticity », itself central to discourses on the valorization of urban heritage. This concept of authenticity bears very little heuristic value, and is itself a « fetish », resulting from a deformed perception of reality under the social conditions of capitalism.

  20. Microstructural examination of irradiated V-(4-5%)Cr-(4-5%)Ti

    Energy Technology Data Exchange (ETDEWEB)

    Gelles, D.S. [Pacific Northwest National Lab., Richland, WA (United States); Rice, P.M.; Zinkle, S.J. [Oak Ridge National Lab., TN (United States); Chung, H.M. [Argonne National Lab., IL (United States)

    1998-03-01

    Microstructural examination results are reported for two heats of V-(4-5%)Cr-(4-5%)Ti irradiated in the EBR-II X530 experiment to {approximately}4 dpa at {approximately}400 C to provide an understanding of the microstructural evolution that may be associated with degradation of mechanical properties. Fine precipitates were observed in high density intermixed with small defect clusters for all conditions examined following the irradiation. The irradiation-induced precipitation does not appear to b affected by preirradiation heat treatment at 950--1125 C. There was no evidence for a significant density of large (diameter >10 nm) dislocation loops or network dislocations. Analytical investigators successfully demonstrated that the precipitates were enriched in titanium, depleted in vanadium and contained no nitrogen.

  1. France in Black Africa,

    Science.gov (United States)

    1989-01-01

    mediation role between African governments and their private creditors. 123 France in Black Africa To further complicate matters, France herself is...34La coop6ration Franco-Ivoirienne, annde 1986," Mission de Cooperation et d’Action Culturelle , Ambassade de France en C6te D’Ivoire, Abidjan, 1987, p. 8...Ministry in "La France et l’Afrique: Etude des relations Franco-Africaines politiques, finan- cires, economiques, commerciales et culturelles ," Paris, 1984

  2. [Preliminary and multidisciplinary study of three Coptic mummies of the Testut-Latarjet museum at Lyon].

    Science.gov (United States)

    Fischer, L P; Cantéro, F; Goyon, J C; Bochu, M; Allogo, J J; Sweydan, N; Morin, A; Neidhardt, J C; Bejui, J; Fessy, M H

    1995-09-01

    In 1901 Albert Gayet raked up from Antinoe three mummies exhibited to day at the Anatomy Museum of Lyon. The study of the three mummies was made in detail as to their dress, anthropometric and scannographic findings. The clothes were characteristic of coptic civilization. The radiographic date gave a life span of around 40 years. The X-ray imagery shows the remains of cerebral and visceral organs. The sexual criteria are thought to be those of two women and undetermined for the child. Later, several investigations like endoscopic autopsy, tooth microscopy and chromosomic map will be necessary.

  3. Pro WPF 4.5 in C# Windows Presentation Foundation in .NET 4.5

    CERN Document Server

    MacDonald, Matthew

    2012-01-01

    Microsoft's Windows Presentation Foundation (WPF) provides you with a development framework for building high-quality user experiences for the Windows operating system. It blends together rich content from a wide range of sources and allows you unparalleled access to the processing power of your Windows computer. Pro WPF 4.5 in C# provides a thorough, authoritative guide to how WPF really works. Packed with no-nonsense examples and practical advice you'll learn everything you need to know in order to use WPF in a professional setting. The book begins by building a firm foundation of elementary

  4. Information Meeting on credit on landed property in France

    CERN Multimedia

    Messonier; Petit

    1972-01-01

    Accession à la propriété- Mons.Comte représente ce groupe de travail au sein du comité des affaires sociales et présente les invités: Mons.Messonier, directeur départemental pour l'Ain et le Jura du Crédit Foncier Français Mons.Frelon, directeur au Crédit Foncier à Annecy Mon.Petit, directeur régional du Comptoir des Entrepreneurs à Lyon Ces 3 personnes nous communiquent des informations importantes et nouvelles dispositions. Ils parlent du regime actuel des prix et prêts à la construction en France

  5. The susceptibility of ventricular arrhythmia to aconitine in conscious Lyon hypertensive rats

    Institute of Scientific and Technical Information of China (English)

    Min LI; Jin WANG; He-hui XIE; Fu-ming SHEN; Ding-feng SU

    2007-01-01

    Aim: The present work was designed to investigate the relationship between hemodynamic parameters and the susceptibility of ventricular arrhythmia to aconitine in conscious Lyon hypertensive rats (LH). Methods: Male LH and Lyon low blood pressure rats (LL) were used. After the determination of baroreflex sensitivity (BRS), ventricular arrhythmia was induced by aconitine infusion inconscious rats. Blood pressure (BP) was recorded during the period of infusion. Results: Compared with the LL rats, the LH rats possessed significantly higher BP, blood pressure variability and lower BRS. The threshold of aconitine required for ventricular fibrillation and cardiac arrest in the LH rats were significantly lower than those in the LL rats. It was found that all the hemodynamic parameters studied were not correlated with the tl~eshold of aconitine required for arrhythmia, with the exception of BRS, which was positively related to the threshold of aconitine required for ventricular premature beat. Conclusion: The LH rats possessed greater susceptibility to aconitine-induced ventricular arrhythmias when compared to the LL rats. This greater susceptibility could not be attributed to anyone of the hemodynamic parameters alone studied in the LH rats. It is proposed that various hypertension-associated abnormalities, including the abnormal hemodynamics, may co-contribute to this vulnerability to ventricular arrhythmias.

  6. Conference on Stochastic Analysis and Applications 2014 : in honour of Terry Lyons

    CERN Document Server

    Hambly, Ben; Zariphopoulou, Thaleia

    2014-01-01

    Articles from many of the main contributors to recent progress in stochastic analysis are included in this volume, which provides a snapshot of the current state of the area and its ongoing developments. It constitutes the proceedings of the conference on "Stochastic Analysis and Applications" held at the University of Oxford and the Oxford-Man Institute during 23-27 September, 2013. The conference honored the 60th birthday of Professor Terry Lyons FLSW FRSE FRS, Wallis Professor of Mathematics, University of Oxford. Terry Lyons is one of the leaders in the field of stochastic analysis. His introduction of the notion of rough paths has revolutionized the field, both in theory and in practice.  Stochastic Analysis is the branch of mathematics that deals with the analysis of dynamical systems affected by noise. It emerged as a core area of mathematics in the late 20th century and has subsequently developed into an important theory with a wide range of powerful and novel tools, and with impressive applications ...

  7. Towards Smarter Urban Mobility: Willingness to Pay for an Advanced Traveller Information System in Lyon

    Directory of Open Access Journals (Sweden)

    Cristina Pronello

    2017-09-01

    Full Text Available Advanced traveller information systems (ATIS are meant to assist people in their daily travel decisions as well as to prompt a shift from cars to alternative and more environmentally-friendly transport strategies. Not many comprehensive studies have been undertaken so far in order to assess the willingness to pay (WTP for ATIS, despite a development of these tools during the last two decades. This paper aims at analysing the WTP for Optymod’Lyon, a smartphone application which plans your journey travels using real-time information about all available transport modes. To this end, a quali-quantitative approach was adopted, administering a questionnaire to participants and organising focus groups before and after the test of the application. A sample of 42 people living in the metropolitan area of Lyon was involved. Results showed four clusters of participants: idealists, pragmatics, the ambiguous and opportunists. A strong majority of idealists and pragmatics were unwilling to pay, mainly for economic reasons and the availability on the market of free information. They record a lower share of trips to work and a higher share for leisure, shopping and study purposes. Those willing to pay (of which 37.8% were opportunists report a low monthly charge level (0.2–3 €/month and are mainly highly-educated car users, travelling for work.

  8. Comments on Liz Hamp-Lyons'"Ethical Test Preparation Practice: The Case of TOEFL. Polemic Gone Astray: A Corrective to Recent Criticism of TOEFL Preparation [and] the Author Responds.

    Science.gov (United States)

    Wadden, Paul; Hilke, Robert; Hamp-Lyons, Liz

    1999-01-01

    Provides a form of argumentative dialectic to Liz Hamp-Lyons's forum commentary published in an earlier issue of this journal, "Ethical Test Preparation Practice: The Case of TOEFL." Hamp-Lyons responds to the comments.(Author/VWL)

  9. Multiresistant Salmonella enterica serovar 4,[5],12:i:- in Europe: a new pandemic strain?

    Science.gov (United States)

    Hopkins, K L; Kirchner, M; Guerra, B; Granier, S A; Lucarelli, C; Porrero, M C; Jakubczak, A; Threlfall, E J; Mevius, D J

    2010-06-03

    A marked increase in the prevalence of S. enterica serovar 4,[5],12:i:- with resistance to ampicillin, streptomycin, sulphonamides and tetracyclines (R-type ASSuT) has been noted in food-borne infections and in pigs/pig meat in several European countries in the last ten years. One hundred and sixteen strains of S. enterica serovar 4,[5],12:i:- from humans, pigs and pig meat isolated in England and Wales, France, Germany, Italy, Poland, Spain and the Netherlands were further subtyped by phage typing, pulsed-field gel electrophoresis and multilocus variable number tandem repeat analysis to investigate the genetic relationship among strains. PCR was performed to identify the fljB flagellar gene and the genes encoding resistance to ampicillin, streptomycin, sulphonamides and tetracyclines. Class 1 and 2 integrase genes were also sought. Results indicate that genetically related serovar 4,[5],12:i:- strains of definitive phage types DT193 and DT120 with ampicillin, streptomycin, sulphonamide and tetracycline resistance encoded by blaTEM, strA-strB, sul2 and tet(B) have emerged in several European countries, with pigs the likely reservoir of infection. Control measures are urgently needed to reduce spread of infection to humans via the food chain and thereby prevent the possible pandemic spread of serovar 4,[5],12:i:- of R-type ASSuT as occurred with S. Typhimurium DT104 during the 1990s.

  10. "Brace Technology" Thematic Series - The Lyon approach to the conservative treatment of scoliosis

    Directory of Open Access Journals (Sweden)

    Lecante Cyril

    2011-03-01

    Full Text Available Abstract The Lyon Brace, or adjustable multi-shell brace, has been used for more than 60 years. The use and function of the Lyon Brace includes: - The utilization of one or two corrective plaster casts, which enables a true lengthening of the concave ligaments. - An oriented CAD-CAM moulding in 3D auto correction after the removal of the plaster cast. - A blueprint adapted to Lenke's classification. - A specific physiotherapy program. Background Pierre Stagnara created the Lyon Brace in 1947. The brace has the following characteristics: - It adjusts to allow for a child's growth of up to seven centimetres and for an increase in weight of up to seven kilograms. - It is 'active' in that the rigidity of the PMM (polymetacrylate of methyl structure stimulates the user to auto-correct. The active axial auto-correction decreases the pressures of the brace on the trunk. - It is decompressive in that the effect of extension between the two pelvic and scapular girdles decreases the pressure on the intervertebral disc allowing for more effective pushes in the other planes. - It is symmetrical making it both more aesthetically pleasing and easier to build. - It is stable at both shoulders and pelvic girdle, facilitating the intermediate 3D corrections. - It is transparent. The pressure of the shells on the skin can be directly controlled so "pads" are usually not necessary. Brace description Two metal bars are fixed vertically, one anterior the other posterior and all shells are attached from the bottom to the top in this order: - Two pelvic shells ensure an optimal stability of the brace. - One lumbar shell T12-L4, which can be either independent or extending, at the abdominal chondrocostal level. - One thoracic shell at the level of the thoracic convexity. - One opposite thoracic shell used as a counter push. - One shoulder balance shell on the side of the thoracic convexity. Long term follow up results This is a retrospective study of 1,338 completed

  11. Le MAC de Lyon s’ouvre à l’univers de Keith Haring

    Directory of Open Access Journals (Sweden)

    Anne Crémieux

    2008-06-01

    Full Text Available L’exposition Keith Haring au Musée d’Art Contemporain de Lyon se tient du 22 février au 29 juin 2008. Le 4 mai prochain, l’artiste américain aurait eu 50 ans. C’est à cette occasion que l’exposition a été montée. Très riche, elle se veut des plus accessibles, pédagogiques et ludiques, à l’image de l’artiste qu’elle célèbre. Tout musée d’art moderne, aussi moderne soit-il, reste un musée, c’est-à-dire un espace somme toute antithétique de l’œuvre de Keith Haring. Artiste de rue, de souterrains...

  12. France at CERN

    CERN Document Server

    2001-01-01

    From 19 to 22 June, for the 8th edition of France at CERN, 31 French companies presented their latest technology to the Laboratory. Demonstrating the latest in French technology during France at CERN. The France at CERN exhibition was inaugurated by Mr. Bernard Frois, Director of the Department Energy, Transport, Environment and Natural Resources at the Technology Directorate of the Ministry of Research. 'France is happy to be a Member of CERN, which is a successful example of the construction of scientific Europe,' he declared during the inauguration, 'this exhibition is an excellent opportunity to put fundamental research and advanced technology in contact.' Mr. Philippe Petit, French Ambassador to Switzerland, and Mr. Alexandre Defay, technical adviser of the Minister of Research, were also present to represent France and its industry. Representing CERN at the 19 June opening of the exhibition was Claude Detraz, who said, 'I hope that this exhibition will make it possible to weave stronger links between ...

  13. 41 CFR 60-4.5 - Hometown plans.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Hometown plans. 60-4.5...-CONSTRUCTION CONTRACTORS-AFFIRMATIVE ACTION REQUIREMENTS § 60-4.5 Hometown plans. (a) A contractor participating, either individually or through an association, in an approved Hometown Plan (including heavy...

  14. C4.5 programs for machine learning

    CERN Document Server

    Quinlan, J Ross

    1992-01-01

    Classifier systems play a major role in machine learning and knowledge-based systems, and Ross Quinlan's work on ID3 and C4.5 is widely acknowledged to have made some of the most significant contributions to their development. This book is a complete guide to the C4.5 system as implemented in C for the UNIX environment. It contains a comprehensive guide to the system's use , the source code (about 8,800 lines), and implementation notes. The source code and sample datasets are also available for download (see below). C4.5 starts with large sets of cases belonging to known classes. The cases,

  15. France at CERN

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    Rolf Heuer, CERN Director General, visits the exhibition "La France au CERN". The exhibition France at CERN, organized by UBIFRANCE in collaboration with CERN's GS/SEM (Site Engineering and Management) service, took place from Monday 7 to Wednesday 9 June in the Main Building. The 36 French firms taking part came to present their products and technologies related to the Organization's activities. The next exhibition will be "Netherlands at CERN" in November.

  16. Out-of-hospital cardiac arrest: the teaching of experience at the SAMU of Lyon.

    Science.gov (United States)

    Gueugniaud, P Y; Vaudelin, T; Gaussorgues, P; Petit, P

    1989-01-01

    Because of the improvement resuscitation techniques have shown since the 1960s and because of the development of the out-of-hospital medical care, a cardiac arrest is no longer synonymous with death in every case. However the cardiac arrest resuscitation is only relevant if its adverse consequences can be limited. That is mainly the neurological after-effects and the cellular anoxia. Therefore, the "Service d'Aide Medicale Urgente" (SAMU) of Lyon has been concentrating its research aiming at: (a) Shortening the duration of cardiopulmonary resuscitation to limit the cerebral anoxia. (b) Analysing and treating some of the causes responsible for the aggravation of anoxia. On the basis of several studies in Lyon, here are some suggestions: (1) The use of high doses of epinephrine that unables a better percentage of primary recoveries (47.5% vs. 39%) (P less than 0.05) and secondary recoveries (21.3% vs. 14.8%) (P less than 0.01) without modifying the qualitative survival at long term. (On the basis of: 5 mg intravenous bolus repeated every 3 min in case of asystole instead of 1 mg every 5 min as it is usually recommended). (2) The choice of a peripheral intravenous line instead of a central intravenous line each time it is possible for the administration of drugs since it is as efficient as the second one. (40.7% vs. 33.4%) (P:NS). (3) The alkalinisation of the prolonged cardiac arrest in order to keep the acid-base balance. Most of the survivors show a pH equal or superior to the normal standard. (On the basis of 1 mmol/kg of sodium bicarbonate if the cardiac arrest lasts for more than 10 min). (4) The abolition of the dextrose solution as maintaining infusion the patients who are in a "coma depasse" (brain death) after the resuscitation have an average glycemia superior to the survivors without after-effects. (19.7 vs. 14.8 mmol/l) (P less than 0.05). (5) The monitoring at once at the hospital of the intra-cranial pressure. It reveals the frequency of high pression

  17. 4,5-Diphenyl-1-methylimidazole: An Undergraduate Laboratory Experiment.

    Science.gov (United States)

    Anastas, Paul T.; And Others

    1985-01-01

    Background information and procedures used are provided for the synthesis of 4,5-diphenyl-methylimidazole. This experiment on the chemistry of heterocycles is ideally suited for beginning undergraduate organic chemistry students. (JN)

  18. Assessment of ecological concerns with alternative water sources used for wetland maintenance at Mason Valley Wildlife Management Area, Lyon County, Nevada

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Mason Valley Wildlife Management Area in Lyon County, Nevada, obtains water from the Walker River, groundwater via fish hatchery effluent and power plant cooling...

  19. Profilin binding to sub-micellar concentrations of phosphatidylinositol (4,5) bisphosphate and phosphatidylinositol (3,4,5) trisphosphate

    DEFF Research Database (Denmark)

    Moens, Pierre D J; Bagatolli, Luis A

    2007-01-01

    its interaction with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P(2)] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P(3)] (P.J. Lu, W.R. Shieh, S.G. Rhee, H.L. Yin, C.S. Chen, Lipid products of phosphoinositide 3-kinase bind human profilin with high affinity, Biochemistry 35 (1996) 14027......-14034). To date, profilin's interaction with polyphosphoinositides (PPI) has only been studied in micelles or small vesicles. Profilin binds with high affinity to small clusters of PI(4,5)P(2) molecules. In this work, we investigated the interactions of profilin with sub-micellar concentrations of PI(4,5)P(2......) and PI(3,4,5)P(3). Fluorescence anisotropy was used to determine the relevant dissociation constants for binding of sub-micellar concentrations of fluorescently labeled PPI lipids to profilin and we show that these are significantly different from those determined for profilin interaction with micelles...

  20. The Myth of the “Gagged Clam”: William Lyon Mackenzie King’s Press Relations

    Directory of Open Access Journals (Sweden)

    Mark Bourrie

    2010-01-01

    Full Text Available William Lyon Mackenzie King was the longest-serving Prime Minister of any Westminster-style democracy. He was also the only Canadian Prime Minister to work as a reporter for a daily newspaper. A solid understanding of media manipulation techniques was part of his mechanism for gaining and holding power. King attempted to ingratiate himself with Canada’s most influential journalists and publishers and maintained strong relationships with those who showed discretion in their dealings with the Prime Minister. King had no press or public relations advisor and did not hold press conferences, but he maintained strong personal relationships with key members of the then-tiny Canadian Parliamentary Press Gallery and with their employers. While most historians and journalists who devoted any effort to analyzing King’s media strategies concluded he was wary and secretive, a more careful examination of the record shows King, in fact, carefully used his control over information to quietly forge links to many elite journalists in Canada. He honed these techniques while working in the United States as a labour negotiator and media consultant for the Rockefeller family and during his years as journalist.

  1. Philanthropies croisées: a joint venture in public health at Lyon (1917-1940).

    Science.gov (United States)

    Saunier, Pierre-Yves; Tournès, Ludovic

    2009-01-01

    Since the end of the First World War the Rockefeller Foundation has spearheaded a large-scale programme in the field of education for the health professions (doctors and nurses). In several countries throughout the world, but with its efforts concentrated on Europe, it has financed schools, constructed information networks, granted research scholarships and awarded training bursaries. In so doing it has not, however, been in the business of propagating an irresistible "American model," nor has it pursued a huge undertaking in disinterested aid. Through an attempt to contextualize these programmes, to bring to light the existence of common reference points, to retrace the work with local participants and to appraise cleavages within the philanthropic apparatus, this article proposes a fine-grained reading of the role of the Rockefeller Foundation at the Faculté de Médecine (Faculty of Medicine) and the Ecole d'Infirmières et d'assistantes sociales (Training School for Nurses and Social Workers) in Lyon between 1917- and 1940. It analyses these institutions in terms of the transactions, negotiations and appropriations that highlight their joint-venture character and it identifies their varied impact.

  2. Antihypertensive effect of thymectomy in Lyon hypertensive rats. Vascular reactivity, renal histology, and sodium excretion.

    Science.gov (United States)

    Bataillard, A; Blanc-Brunat, N; Vivier, G; Medeiros, I; Zhang, B L; Touraine, J L; Sassard, J

    1996-02-01

    The aim of this study was to search for the possible mechanisms involved in the antihypertensive effect of neonatal thymectomy that we previously observed in Lyon hypertensive (LH) rats. To that end, we studied in LH and normotensive control (LN) rats the consequences of neonatal thymectomy on vascular reactivity, renal structure, and pressure-natriuresis. The increase in pressor responses to angiotensin I and phenylephrine noted in LH rats as compared to LN animals was abolished by neonatal thymectomy. Histological study showed that kidneys from LH rats exhibited arterial wall hypertrophy, segmental hyalinization of the glomeruli, and were infiltrated by mononuclear cells. All these features of kidney injury were reduced in neonatally thymectomized LH rats. Lastly, the responses of isolated perfused kidneys from LH rats to stepwise reductions in renal perfusion pressure differed from those of LN rats by decreased renal perfusion flow and natriuresis. Neonatal thymectomy tended to improve sodium excretion in parallel with a slight decrease in renal vascular resistances. It is concluded that the normalization of vascular responsiveness to vasoconstrictor factors, the alleviation of renal lesions and, to a lesser extent, the moderate improvement of pressure natriuresis may account, at least in part, for the antihypertensive effect of neonatal thymectomy in LH rats.

  3. Satellite images of the September 2013 flood event in Lyons, Colorado

    Science.gov (United States)

    Cole, Christopher J.; Friesen, Beverly A.; Wilds, Stanley; Noble, Suzanne; Warner, Harumi; Wilson, Earl M.

    2013-01-01

    The U.S. Geological Survey (USGS) Special Applications Science Center (SASC) produced an image base map showing high-resolution remotely sensed data over Lyons, Colorado—a city that was severely affected by the flood event that occurred throughout much of the Colorado Front Range in September of 2013. The 0.5-meter WorldView-2 data products were created from imagery collected by DigitalGlobe on September 13 and September 24, 2013, during and following the flood event. The images shown on this map were created to support flood response efforts, specifically for use in determining damage assessment and mitigation decisions. The raw, unprocessed imagery were orthorectified and pan-sharpened to enhance mapping accuracy and spatial resolution, and reproduced onto a cartographic base map. These maps are intended to provide a snapshot representation of post-flood ground conditions, which may be useful to decisionmakers and the general public. The SASC also provided data processing and analysis support for other Colorado flood-affected areas by creating cartographic products, geo-corrected electro-optical and radar image mosaics, and GIS water cover files for use by the Colorado National Guard, the National Park Service, the U.S. Forest Service, and the flood response community. All products for this International Charter event were uploaded to the USGS Hazards Data Distribution System (HDDS) website (http://hdds.usgs.gov/hdds2/) for distribution.

  4. [Prevalence of sleep and wakefulness disorders in high school students at the Academy of Lyon].

    Science.gov (United States)

    Patois, E; Valatx, J L; Alpérovitch, A

    1993-01-01

    We studied sleep and wakefulness disorders in high schools of the Lyon district. Data were collected by auto-questionnaire from a very large sample (11,923 boys and 13,870 girls) of high school students, between 15 and 20 years of age. Thirteen per cent of boys and 17% of girls complained of poor sleep, and the most frequent trouble was difficulty in falling asleep. The difference between the length of the sleep during school time and holidays was greater than 3 hours for 24% of the students. About 10% of students who reported habitual difficulties in falling asleep used drugs (at least once a week) which facilitate sleep. The use of sleeping pills by the family correlated with that by the subject: 5% of boys belonging to families using sleeping pills are themselves users compared to 1% in the whole sample. Students using hypnotic drugs frequently had daytime naps (14% versus 3%); their morning wakefulness was poorer and their afternoon wakefulness better than students who did not.

  5. Extraction of Cesium from the Irradiated Nuclear Waste by 4(5),4'(5')-Bis[1-hydroxyalkylbenzo]-21-crown-7

    Institute of Scientific and Technical Information of China (English)

    Ying DU; Wen Jun CHEN; Sheng Ying QIN

    2004-01-01

    4(5),4'(5')-Bis[l-hydroxyalkylbenzo]-21-crown-7 (A-C) have been synthesized by two-step reactions from dibenzo-21-crown-7 (DB21C7). Extraction of cesium cation from nitric acid solutions by A-C has been investigated in nitromethane. Under the conditions of various concentration of HNO3 or NaNO3, the extractabilities of A and B were superior to that of DB21C7.

  6. Energy statistics. France; Statistiques energetiques. France

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-04-01

    This document summarizes in a series of tables the main energy statistics of France for 2002: supplies, uses and sectoral consumption for all energies (coal, petroleum, gas, electricity, renewable energies); domestic production of primary energy (1973-2002); primary energy consumption (1973-2002); end-use energy consumption (1973-2002); general indicators (energy bill, US$ rate, prices, energy independence, GDP - 1973-2002); projections (primary energy consumption, 1973-2002); detailed data for petroleum, natural gas, electric power, and solid mineral fuels (resources, uses, prices, imports, production, domestic consumption, 1973-2002). (J.S.)

  7. Hydrogeology and ground-water-quality conditions at the Emporia- Lyon County Landfill, eastern Kansas, 1988

    Science.gov (United States)

    Myers, N.C.; Bigsby, P.R.

    1990-01-01

    Hydrogeology and water-quality conditions at the Emporia-Lyon County Landfill, eastern Kansas, were investigated from April 1988 through April 1989. Potentiometric-surface maps indicated groundwater movement from the northeast and northwest towards the landfill and then south through the landfill to the Cottonwood River. The maps indicate that during periods of low groundwater levels, groundwater flows northward in the north-west part of the landfill, which may have been induced by water withdrawal from wells north of the landfill or by water ponded in waste lagoons south and west of the landfill. Chemical analysis of water samples from monitoring wells upgradient and downgradient of the landfill indicate calcium bicarbonate to be the dominant water type. No inorganic or organic chemical concentrations exceeded Kansas or Federal primary drinking-water standards. Kansas secondary drinking-water standards were equaled or exceeded, however, in water from some or all wells for total hardness, dissolved solids, iron, and manganese. Water from one upgradient well contained larger concentrations of dissolved oxygen and nitrate, and smaller concentrations of bicarbonate, alkalinity, ammonia, arsenic, iron, and manganese as compared to all other monitoring wells. Results of this investigation indicate that groundwater quality downgradient of well MW-2 has increased concentrations of some inorganic and organic compounds. Due to the industrial nature of the area and the changing directions of groundwater flow, it is not clear what the source of these compounds might be. Long-term monitoring, additional wells, and access to nearby waste lagoons and waste-lagoon monitoring wells would help define the sources of increased inorganic and organic compounds. (USGS)

  8. Renoprotection persists after cessation of treatment with very low doses of perindopril in Lyon hypertensive rats

    Institute of Scientific and Technical Information of China (English)

    Eleanor J EGAN; Frédérique DIJOUD; Sophie GILIBERT; Jean SASSARD

    2008-01-01

    Aim: The possibility that angiotensin-converting enzyme inhibitors can protect hypertensive kidneys independently of any blood pressure (BP) decrease remains a matter of controversy. The present study investigates this theory in Lyon genetically-hypertensive (LH) rats. Methods: Male rats were used in the present study and were untreated (controls) or orally received 0.4, 0.1, 0.04, and 0.01 mg·kg-1·d-1 doses of perindopril from 3 to 17 weeks of age. At 16 and 23 weeks of age (ie during treatment and 6 weeks after its cessation), systolic BP (SBP) was measured by plethysmography, and urine was collected to measure the urinary protein (Uprot) and N-acetyl-seryl-aspartyl-lysyl-proline-to-creatinine (Cr) concentrations. The kidneys were dissected for a semiquantitative histologi-cal analysis. Results: S BP was significantly lowered (-18±2% and -11%±1% from controls at 16 and 23 weeks, respectively) with a 0.4 mg·kg-1·d-1 dose of perindopril. Lower doses did not affect SBP. Uprot/Cr decreased, and Ac-SDKP/Cr increased with all the doses of perindopril used. Uprot/Cr remained lower at 23 weeks in the rats treated with 0.1 mg·kg-1·d-1 and smaller doses. The ratio of Up-rot/Cr was closely (r=0.6) related to the histological lesions score. Conclusion: In LH rats, low doses of perindopril induce renoprotection which is independent of SBP decrease and persists after withdrawal of treatment.

  9. A New Deal for Southeastern Archaeology, by Edwin A. Lyon, The University of Alabama Press

    Directory of Open Access Journals (Sweden)

    Gordon R. Willey

    1996-05-01

    Full Text Available In the 1950s, the Era of the Great Depression, archaeology in the United States enjoyed an enormous boost, both in the substance of its findings on the Precolumbian past and in the development of its methods and proce­dures. Edwin A. Lyon has laid out the story of all this in a book that is a major contribution to the history of the archaeological discipline in this country. The context of this story is in the American South, most specifically the Southeastern United States, or the 'Old South', that part of the country that was the heart of the Confederacy; and it is important to remember that the South has had a history significantly separate and distinct from that of the rest of the nation. This separateness, rooted in its plantation economy and the associated institution of slavery, was further fostered by the Civil War and its aftermath of hardships. These hardships lasted until the 1930s and the economic depression when they began to be ameliorated by the Rooseveltian political and socioeconomic measures known collectively as the 'New Deal'. The policies of the New Deal began those transformations which continued through World War II and beyond. Crucial to these transformations were the building of power dams and rural electrification, soil erosion control and agricultural modernization, and a host of public building programs. All of this went forward with Federal Relief employment. Less tangible but nonetheless important benefits were in the cultural sphere: the arts, drama, writing. history - and of particular importance to us here. archaeology.

  10. 15 CFR 4.5 - Responsibility for responding to requests.

    Science.gov (United States)

    2010-01-01

    ... GOVERNMENT INFORMATION Freedom of Information Act § 4.5 Responsibility for responding to requests. (a) In... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Responsibility for responding to... records, or the component to which the Departmental Freedom of Information Officer assigns lead...

  11. Regulation of inositol 1,4,5-trisphosphate receptor expression

    NARCIS (Netherlands)

    Deelman, Leo Edwin

    1999-01-01

    This thesis describes the regulation of the inositol 1,4,5-triphosphate receptor (InsP3R). The mechanisms of InsP3R regulation were investigated after cloning of the promoters of the human and rat InsP3R-1 gene and visualization of subcellular distribution of InsP3R-3 by immunoelectron microscopy (c

  12. Heat treatment effects on tensile properties of V-(4-5) wt.% Cr-(4-5) wt.% Ti alloys

    Energy Technology Data Exchange (ETDEWEB)

    Natesan, K.; Soppet, W.K. [Argonne National Lab., IL (United States)

    1997-08-01

    Effects of thermomechanical treatments on microstructures and mechanical properties are of interest for long term application of V-Cr-Ti alloys in fusion reactor systems. Influence of thermal annealing at 1050{degrees}C on stress/strain behavior, maximum engineering strength, and uniform and total elongation were evaluated. The results show that multiple annealing has minimal effect on the tensile properties of V-(4-5)Cr-(4-5)Ti alloys tested at room temperature and at 500{degrees}C.

  13. Urban Sociology in France.

    Science.gov (United States)

    Amiot, Michel

    1986-01-01

    Divides the history of urban sociology in France into three periods: (1) functionalism, which lasted from 1910 until the 1960s, (2) neo-Marxist socioeconomics lasting from 1968 until 1979, and (3) anthropological approach which is still dominant. Reviews theoretical perspectives and research characteristic of each period. (JDH)

  14. VISAS FOR FRANCE

    CERN Multimedia

    Relations with the Host States Service

    2002-01-01

    1. Definition of a visa A visa is an administrative document required by the nationals of certain countries to cross a border. The visas referred to in this article ('consular visas') are issued to people who do not live in France (not to be confused with 'exit and/or re-entry visas' issued to people living in France; cf. communiqué of 26 May 1998, ref. CERN/DSU-DO/RH/8283). 2. Types of visa The numerous types of visa include, in particular: short-stay visas, which allow their holders to enter France for a continuous or non-continuous period not exceeding three months in any six; long-stay visas, which are required by those applying for a residence document (Carte spéciale issued by the French Ministry of Foreign Affairs or Carte de séjour issued by a Préfecture). 3. Visa requirement 3.1 General rule In France, the requirement to obtain a visa varies, in particular, according to nationality and the length of stay. To put it simply, three different situations can...

  15. International Relations in France

    DEFF Research Database (Denmark)

    Breitenbauch, Henrik Ø.

    Why is the French International Relations (IR) discipline different from the transnational-American discipline? By analysing argument structures in research articles across time, this book shows how the discipline in France is caught between the American character of the discipline and the French...

  16. Traveling in France.

    Science.gov (United States)

    Philyaw, Henry; And Others

    This minicourse guide for teachers of French is intended to help motivate and prepare students for travel in France. Activities are outlined in eleven related areas, including (1) planning for the trip, (2) currency, (3) going through customs, (4) tipping, (5) shopping, (6) guided tours, (7) touring on your own, (8) social life and entertainment,…

  17. The Lyon Stock Exchange: A Struggle for Survival (1866-1914)

    OpenAIRE

    Ducros, Jérémy; Riva, Angelo

    2014-01-01

    In this paper, we look back at the XIX century France to shed light on effect of competition in the stock exchange industry. During the XIX century the Paris financial centre plays a central role in the French financial markets. Nevertheless, six organized regional exchanges do exist along all the second half of the century. A recent literature started to study the complex functioning of the Paris financial centre as well as the interaction between its two components, the official Paris Bours...

  18. Fire Hydrants, Lyon County Rural Water District (may not be current) and City of Emporia Fire Hydrant locations. We are working on GPSing the city locations., Published in 2011, 1:1200 (1in=100ft) scale, City of Emporia/Lyon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Fire Hydrants dataset, published at 1:1200 (1in=100ft) scale, was produced all or in part from Hardcopy Maps information as of 2011. It is described as 'Lyon...

  19. [Research of keratinophiles in the soil and their effects on human cutaneous pathology in the Lyons area].

    Science.gov (United States)

    Coudert, J; Michel-Brun, J; Mojon, M; Pichot, J

    1979-01-01

    Between 1967 and 1977, the systematic research of keratinophiles of the ground in a radius of 30--50 km around Lyon, has shown the ubiquitarian predominance of Microsporum nanum, which is probably the most ancient occupant of the ground. The most intensive areas of human and animal occupation in the Rhodanian tract show the predominance of Microsporum gypseum, which is scarcely found in man. Sporadic localizations, tightly limites, bound to cirulcation axes and international gathering, let us detect Microsporum cookei, Trichophyton verrucosum, Trichophyton mentagrophytes, Chrysosporium keratinophilum, and Keratinomyces ajelloi. However, in the last years, a progressive extension of recently imported kinds and a decrease in native kinds appears to have occurred.

  20. John Lyons, Lenguaje, significado y contexto. Trad. de Santiago Alcoba, Barcelona-Buenos Aires, Paidós, 1983

    OpenAIRE

    Hett Chauvet, Denise

    2013-01-01

    Actualmente existe en Lingüística la tendencia a considerar las lenguas como simples conjuntos de oraciones dotadas de un significado puramente descriptivo; esto, para Lyons, constituye una concepción altamente restrictiva de lo que es una lengua y de lo que puede ser el significado. Para el, el significado social y el significado expresivo son componentes igualmente importantes, y por ello incluye en la Semántica Lingüística gran parte de lo que muchos han estudiado bajo el rubro de "Pragmát...

  1. Phosphorylation of inositol 1,4,5-trisphosphate analogues by 3-kinase and dephosphorylation of inositol 1,3,4,5-tetrakisphosphate analogues by 5-phosphatase

    NARCIS (Netherlands)

    Dijken, Peter van; Lammers, Aleida A.; Ozaki, Shoichiro; Potter, Barry V.L.; Erneux, Christophe; Haastert, Peter J.M. van

    1994-01-01

    A series of P-32-labeled D-myo-inositol 1,3,4,5-tetrakisphosphate [Ins(1,3,4,5)P-4] analogues was enzymically prepared from the corresponding D-myo-inositol 1,4,5-trisphosphate [Ins(1,4,5)P-3] analogues using recombinant rat brain Ins(1,4,5)P-3 3-kinase and [gamma-P-32]ATP. Ins(1,4,5)P-3 analogues

  2. [Primary care in France].

    Science.gov (United States)

    Sánchez-Sagrado, T

    2016-01-01

    The poor planning of health care professionals in Spain has led to an exodus of doctors leaving the country. France is one of the chosen countries for Spanish doctors to develop their professional career. The French health care system belongs to the Bismarck model. In this model, health care system is financed jointly by workers and employers through payroll deduction. The right to health care is linked to the job, and provision of services is done by sickness-funds controlled by the Government. Primary care in France is quite different from Spanish primary care. General practitioners are independent workers who have the right to set up a practice anywhere in France. This lack of regulation has generated a great problem of "medical desertification" with problems of health care access and inequalities in health. French doctors do not want to work in rural areas or outside cities because "they are not value for money". Medical salary is linked to professional activity. The role of doctors is to give punctual care. Team work team does not exist, and coordination between primary and secondary care is lacking. Access to diagnostic tests, hospitals and specialists is unlimited. Duplicity of services, adverse events and inefficiencies are the norm. Patients can freely choose their doctor, and they have a co-payment for visits and hospital care settings. Two years training is required to become a general practitioner. After that, continuing medical education is compulsory, but it is not regulated. Although the French medical Health System was named by the WHO in 2000 as the best health care system in the world, is it not that good. While primary care in Spain has room for improvement, there is a long way for France to be like Spain. Copyright © 2015 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

  3. Enterovirus Migration Patterns between France and Tunisia.

    Science.gov (United States)

    Othman, Ines; Mirand, Audrey; Slama, Ichrak; Mastouri, Maha; Peigue-Lafeuille, Hélène; Aouni, Mahjoub; Bailly, Jean-Luc

    2015-01-01

    The enterovirus (EV) types echovirus (E-) 5, E-9, and E-18, and coxsackievirus (CV-) A9 are infrequently reported in human diseases and their epidemiologic features are poorly defined. Virus transmission patterns between countries have been estimated with phylogenetic data derived from the 1D/VP1 and 3CD gene sequences of a sample of 74 strains obtained in France (2000-2012) and Tunisia (2011-2013) and from the publicly available sequences. The EV types (E-5, E-9, and E-18) exhibited a lower worldwide genetic diversity (respective number of genogroups: 4, 5, and 3) in comparison to CV-A9 (n = 10). The phylogenetic trees estimated with both 1D/VP1 and 3CD sequence data showed variations in the number of co-circulating lineages over the last 20 years among the four EV types. Despite the low number of genogroups in E-18, the virus exhibited the highest number of recombinant 3CD lineages (n = 10) versus 4 (E-5) to 8 (E-9). The phylogenies provided evidence of multiple transportation events between France and Tunisia involving E-5, E-9, E-18, and CV-A9 strains. Virus spread events between France and 17 other countries in five continents had high probabilities of occurrence as those between Tunisia and two European countries other than France. All transportation events were supported by BF values > 10. Inferring the source of virus transmission from phylogenetic data may provide insights into the patterns of sporadic and epidemic diseases caused by EVs.

  4. Taxation in France

    CERN Multimedia

    HR Department

    2016-01-01

    Information regarding income tax in France. Request for additional information: social security number and personal details.   Some members of the personnel living in France have received a letter from the French tax authorities accompanied by a form, to be returned by 31 March 2016 at the latest, asking them to indicate their social security number and to confirm their personal details. As employed members of the CERN personnel are members of the Organization’s own health insurance scheme and do not participate in the French social security system, we recommend that you tick the box indicating that you do not have a social security number. We also advise you to specify in writing that, as an employed member of the CERN personnel, you do not participate in the French social security system especially by virtue of the 1970 agreement on social security between France and CERN: “Je ne suis pas soumis(e), en tant que fonctionnaire du CERN, à la sécurit&...

  5. Outbreak of Achromobacter xylosoxidans and Ochrobactrum anthropi Infections after Prostate Biopsies, France, 2014.

    Science.gov (United States)

    Haviari, Skerdi; Cassier, Pierre; Dananché, Cédric; Hulin, Monique; Dauwalder, Olivier; Rouvière, Olivier; Bertrand, Xavier; Perraud, Michel; Bénet, Thomas; Vanhems, Philippe

    2016-08-01

    We report an outbreak of healthcare-associated prostatitis involving rare environmental pathogens in immunocompetent patients undergoing transrectal prostate biopsies at Hôpital Édouard Herriot (Lyon, France) during August 13-October 10, 2014. Despite a fluoroquinolone-based prophylaxis, 5 patients were infected with Achromobacter xylosoxidans and 3 with Ochrobactrum anthropi, which has not been reported as pathogenic in nonimmunocompromised persons. All patients recovered fully. Analysis of the outbreak included case investigation, case-control study, biopsy procedure review, microbiologic testing of environmental and clinical samples, and retrospective review of hospital records for 4 years before the outbreak. The cases resulted from asepsis errors during preparation of materials for the biopsies. A low-level outbreak involving environmental bacteria was likely present for years, masked by antimicrobial drug prophylaxis and a low number of cases. Healthcare personnel should promptly report unusual pathogens in immunocompetent patients to infection control units, and guidelines should explicitly mention asepsis during materials preparation.

  6. The science of education in Lyon: Initiative between state and local history teaching, the registry of scientific positivity on a spiritualist tradition (1884-1945

    Directory of Open Access Journals (Sweden)

    Frédéric MOLE

    2016-10-01

    Full Text Available The paper aims to articulate the political and administrative cadre who chairs the university system of science education in the city of Lyon, and the performance of the leading intellectuals actors involved in its construction: Thamin, Chabot, Bourjade. We analyze here the conditions of the continuing education of science education in Lyon after 1920, while it disappeared in most of French universities. Why science education, Lyon, it not affected by the disenchantment of the political project that, in times of reform Ferry, had chaired its institutionalization? The paths of these three professors, its roots in an explicit spiritualism, his interest in child psychology, the depoliticization of his views have led them to develop intellectual and institutional strategies to promote a favorable pedagogical culture capable of responding to both the university theoretical requirements, and worry anchored in professional fields.

  7. Thermal conductivity of Cu–4.5 Ti alloy

    Indian Academy of Sciences (India)

    S Nagarjuna

    2004-02-01

    The thermal conductivity (TC) of peak aged Cu–4.5 wt% Ti alloy was measured at different temperatures and studied its variation with temperature. It was found that TC increased with increasing temperature. Phonon and electronic components of thermal conductivity were computed from the results. The alloy exhibits an electronic thermal conductivity of 46.45 W/m.K at room temperature. The phonon thermal conductivity decreased with increasing temperature from 17.6 at 0 K to 1.75 W/m.K at 298 K, which agrees with literature that the phonon component of thermal conductivity is insignificant at room temperature.

  8. International Union of Physiological Sciences Commission on Gravitational Physiology, Annual Meeting, 11th, Lyons, France, Sept. 25-27, 1989, Proceedings

    Science.gov (United States)

    Reynolds, Orr E. (Editor)

    1990-01-01

    Topics discussed include recent space flight results in gravitational physiology, cardiovascular changes, current concepts in gravitational physiology, musculoskeletal changes, gravity and the cardiovascular system, hypergravic conditions, and head-down tilt. Papers are presented on the effect of space flight on the ultrastructure of the rat cerebellar and hemisphere cortex, a comparative study of cardiovascular responses in primates exposed to tilt test and lower body positive pressure, catecholamines during short- and long-term head-down bedrest, and effects of a 40-day tail-suspension on rat weight-bearing bones. Attention is also given to otolith versus vertical semicircular canal input in the inhibition of horizontal postrotatory nystagmus, cardiovascular responses to sustained acceleration, effects of high sustained hypergravity on plasma catecholamines, and the carotid baroreceptor cardiac-vagal reflex responses during 10 days of head-down tilt.

  9. Beginning ASP.NET 4.5 in C#

    CERN Document Server

    MacDonald, Matthew

    2012-01-01

    This book is the most comprehensive and up to date introduction to ASP.NET ever written. Focussing solely on C#, with no code samples duplicated in other languages, award winning author Matthew MacDonald introduces you to the very latest thinking and best practices for the ASP.NET 4.5 technology.Assuming no prior coding experience, you'll be taught everything you need to know from the ground up.  Starting from first principals, you'll learn the skills you need to be an effective ASP.NET developer who is ready to progress to more sophisticated projects and professional work. You'll be taught ho

  10. Beginning ASP.NET 4.5 in VB

    CERN Document Server

    MacDonald, Matthew

    2012-01-01

    This book is the most comprehensive and up to date introduction to ASP.NET ever written. Focusing solely on Visual Basic, with no code samples duplicated in other languages, award winning author Matthew MacDonald introduces you to the very latest thinking and best practices for the ASP.NET 4.5 technology.Assuming no prior coding experience, you'll be taught everything you need to know from the ground up.  Starting from first principals, you'll learn the skills you need to be an effective ASP.NET developer who is ready to progress to more sophisticated projects and professional work.You'll be t

  11. N,N′-Dicyclohexylnaphthalene-1,8;4:5-dicarboximide

    Directory of Open Access Journals (Sweden)

    Manju Rajeswaran

    2008-09-01

    Full Text Available The title compound, C26H26N2O4, synthesized by the reaction of naphthalene-1,4,5,8-tetracarboxylic acid anhydride and cyclohexylamine, exhibits good n-type semiconducting properties. Accordingly, thin-film transistor devices comprising this compound show n-type behavior with high field-effect electron moblity ca 6 cm2/Vs [Shukla, Nelson, Freeman, Rajeswaran, Ahearn, Meyer & Carey(2008. Chem. Mater. Submitted]. The asymmetric unit comprises one-quarter of the centrosymmetric molecule in which all but two methylene C atoms of the cyclohexane ring lie on a mirror plane; the point-group symmetry is 2/m. The naphthalenediimide unit is strictly planar, and the cyclohexane rings adopt chair conformations with the diimide unit in an equatorial position on each ring.

  12. Implementing and Evaluating Variable Soil Thickness in the Community Land Model, Version 4.5 (CLM4.5)

    Energy Technology Data Exchange (ETDEWEB)

    Brunke, Michael A.; Broxton, Patrick; Pelletier, Jon; Gochis, David; Hazenberg, Pieter; Lawrence, David M.; Leung, L. Ruby; Niu, Guo-Yue; Troch, Peter A.; Zeng, Xubin

    2016-05-01

    One of the recognized weaknesses of land surface models as used in weather and climate models is the assumption of constant soil thickness due to the lack of global estimates of bedrock depth. Using a 30 arcsecond global dataset for the thickness of relatively porous, unconsolidated sediments over bedrock, spatial variation in soil thickness is included here in version 4.5 of the Community Land Model (CLM4.5). The number of soil layers for each grid cell is determined from the average soil depth for each 0.9° latitude x 1.25° longitude grid cell. Including variable soil thickness affects the simulations most in regions with shallow bedrock corresponding predominantly to areas of mountainous terrain. The greatest changes are to baseflow, with the annual minimum generally occurring earlier, while smaller changes are seen in surface fluxes like latent heat flux and surface runoff in which only the annual cycle amplitude is increased. These changes are tied to soil moisture changes which are most substantial in locations with shallow bedrock. Total water storage (TWS) anomalies do not change much over most river basins around the globe, since most basins contain mostly deep soils. However, it was found that TWS anomalies substantially differ for a river basin with more mountainous terrain. Additionally, the annual cycle in soil temperature are affected by including realistic soil thicknesses due to changes to heat capacity and thermal conductivity.

  13. Michel Tozzi (2012). Nouvelles pratiques philosophiques.Lyon : Chroniques sociales, 343 p.

    OpenAIRE

    Roger, Monjo

    2013-01-01

    Avec cette nouvelle publication, Michel Tozzi nous offre un véritable synthèse, un panorama aussi exhaustif que possible, détaillé et précis, des « nouvelles pratiques philosophiques », ces pratiques de la philosophie qui n’ont cessé de se développer, en France et ailleurs, depuis le début des années 90, dans le cadre scolaire (de la maternelle au lycée) mais aussi hors de l’école (maison de retraite, hôpital, prison, médiathèques, etc.) et sous des formes non scolaires (comme le « café philo...

  14. The France energy situation; La situation energetique de la France

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    This analysis of the french energy situation provides information and key data on some key facts about the energy in France, the France energy supply and demand, the major principles of energy policy, the challenges of french energy policy and the DGEMP (general directorate for energy and raw materials). (A.L.B.)

  15. Battle of France WWII

    Science.gov (United States)

    Gadhath, Arpitha Rao

    The purpose of this thesis is to build an interactive Geographical Information System (GIS) tool, relating to the series of events that occurred during the Battle of France World War II. The tool gives us an insight about the countries involved in the battle, their allies and their strategies. This tool was created to use it as a one stop source of information regarding all the important battles that took place, which lead to the fall of France. The tool brings together the maps of all the countries involved. Integrated with each map is the data relevant to that map. The data for each country includes the place of attack, the strategies used during the attack, and the kind of warfare. The tool also makes use of HTML files to give all the information, along with the images from the time of the war and a footage which explains everything about the particular battle. The tool was build using JAVA, along with the use of MOJO (Map Objects Java Objects) to develop Maps of each of the countries. MOJO is developed by ESRI (Environmental Science Research Institute) which makes it easier to add data to the maps. It also makes highlighting important information easier making use of pop-up windows, charts and infographics. HTML files were designed making use of the open-source template developed by Bootstrap. The tool is built in such a way that the interface is simple and easy for the user to use and understand.

  16. France at CERN

    CERN Multimedia

    GS Department

    2010-01-01

    Industrial Exhibition Administration Building Bldg 61 Tuesday 8 June: 9 a.m. – 5.30 p.m. Wednesday 9 June: 9 a.m. – 4 p.m. “FRANCE AT CERN” – INDUSTRIAL EXHIBITION Thirty-six French companies are presenting their latest technological advances during the industrial exhibition "France at CERN", featuring products and technologies specifically related to the activities of the CERN facility. Presenting their know-how in electric vehicles, PSA - PEUGEOT/CITROEN are sponsoring the event. Seminars will be hold in the Main Building’s conference rooms: R&D innovation strategy in Pôle Nucléaire Bourgogne (08/06/2010 – 13h) MU by Peugeot (08/06/2010 – 14h) Citroën (08/06/2010 – 15h) « Elément 14 » : a unique design engineer community for sharing Electronic Engineering Solutions (09/06/2010 – 11h) Individual B2B meetin...

  17. Stimulation of the faecal excretion of 2,4,5,2',4',5'-hexachlorobiphenyl in rats by squalane.

    Science.gov (United States)

    Richter, E; Schäfer, S G; Fichtl, B

    1983-06-01

    Faecal excretion of 2,4,5,2',4',5'-hexachlorobiphenyl (6-CB) was followed for 19 weeks in rats fed a control diet, or a squalane-supplemented diet, for up to 17 weeks. In 3 d after a single oral dose of 8 mg/kg of 6-CB, 20% dose was excreted in faeces as unchanged 6-CB, which probably represents that not-absorbed. From day 4 to 133 only an additional 2-4% dose was excreted in faeces by control animals. Addition of 8% squalane to the diet 2, 6 and 15 weeks after dosing resulted in a five-fold increase of daily 6-CB excretion in faeces independent of the time of beginning the treatment. Total excretion of 6-CB in faeces from day 4 to 133 was 3.6, 6-7 and 9.3% dose after 4, 13 and 17 weeks of squalane treatment, respectively. No adverse effects of long-term squalane treatment on body-weight gain, feed efficiency and organ weights were observed. Plasma cholesterol and triglycerides were significantly lowered. Independent of the duration of treatment, the livers of rats fed the squalane-supplemented diet contained 40-50 micrograms/g squalane. Within the limits of detection no squalane could be found in lungs, kidneys, abdominal fat, spleen and blood. It is concluded that 6-CB elimination can be enhanced by oral treatment with squalane even a long time after uptake of the poison. As there was no alteration in the tissue distribution of 6-CB, the 6-CB excreted after squalane treatment probably originates from all tissues.

  18. Reduction of 4(5)-Methylimidazole Using Cookie Model Systems.

    Science.gov (United States)

    Jung, Min-Chul; Kim, Mina K; Lee, Kwang-Geun

    2017-09-11

    The objective of this study was to determine the reduction of 4(5)-methylimidazole (4-MI) under various baking conditions. For 4-MI analysis, an analytical method using gas chromatography-mass spectrometry was developed. The developed method was validated with linearity (r(2) > 0.999), recovery (101% to 103%, 3 levels), and precision (1.5% to 4.3%, 3 levels). Limits of detection and quantification were 18.5 and 56.0 μg/kg, respectively. This method was used to monitor the level of 4-MI in 11 commercial cookies, which ranged from 71.5 to 1254.8 μg/kg. Time and temperature were modified in the cookie model system to reduce 4-MI. The largest reduction in 4-MI (56%) was achieved by baking at 140 °C for 8 min; however the cookies baked at this condition were not well accepted by consumers. With combination of consumer liking test result, baking cookies at 140 °C for 16 min is optimal for 4-MI reduction (28% reduction), while it has minimal impact on consumer acceptance. A strong correlation (r(2) = 0.9981) was found between caramel colorant and 4-MI in the cookie model system. © 2017 Institute of Food Technologists®.

  19. Activities report for 1994-1995; Institut de Physique Nucleaire de Lyon - Rapport d`activite 1994-1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-31

    Here is the progress report for the Institute of Nuclear Physics of Lyon.We find physics at Lep, R and D for CMS at LHC( Higgs boson search in the L3 collaboration, quark b physics in Delphi at Lep 100,electromagnetic calorimetry for CMS-RD18 program, CMS experiment at LHC: MSGC development), hadronic and nuclear matter(heavy ions in CMS, multifragmentation threshold, spectroscopy of superdeformed nuclei with EUROGAM), astro-particles(gamma and neutron radioactive background measurements, bolometric measurement, scintillating crystal characterization for dark matter detection, the Virgo optics), ions/clusters-matter, physico-chemical transformation by ion-solid interaction are some examples of studies realized during these two years. (N.C.).

  20. [AIDS mortality in France].

    Science.gov (United States)

    Hatton, F; Maguin, P; Nicaud, V; Renaud, G

    1986-01-01

    A study about mortality by AIDS had been undertaken since July 1st 1983, in the Service of Information on Medical causes of Death (INSERM SC8), which is in charge of developing mortality statistics in France. From July 1st 1983 to September 30th 1985, 243 deaths due to AIDS were recorded. Only the cases where this diagnosis was clearly mentioned were selected; more than 90% were notified by hospitals and mainly by highly specialized services. The number of deaths, which was low and varied rather irregularly at the beginning, then increased by successive stages. The first year, during which a tenth of deaths was recorded every three months, was followed by a great increase, doubling, then tripling the initial numbers. Lastly, a second and sudden rise occurred during the third trimester of 1985, the trimestrial number of deaths due to AIDS reaching 80.

  1. FRANCE AT CERN

    CERN Multimedia

    2001-01-01

    From 19 to 22 June 2001 Administration Building Bldg 60/61 - ground and 1st floor 09.00 hrs - 17.30 hrs Thirty-one companies will present their latest technology at the 'France at CERN' exhibition. The French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: cryogenics and vacuum technology, superconductivity, measurement, detection, regulation, control and testing, electrical and electronic equipment, mechanics. The exhibition is organised by the French Committee for Trade Events Abroad. There follows : the list of exhibitors, the list of lectures which will be given at the exhibition. A detailed programme will be available in due course at : your Divisional secretariat, the reception information desk, Building 33, the exhibition. LIST OF EXHIBITORS Air Liquide Air Liquide Alcatel Vacuum Technology Alstom Industrie S.A. Alstom Magnets & Superconductors/Jeumont Industrie ATI Electronique Atos S.A. Axon' Cable S.A...

  2. FRANCE AT CERN

    CERN Multimedia

    C.-L. Jullien-Woringer/SPL-DI

    2001-01-01

    From 19 to 22 June 2001 Administration Building Bldg 60/61 - ground and 1st floor 09.00 hrs - 17.30 hrs Thirty companies will present their latest technology at the 'France at CERN' exhibition. The French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: cryogenics and vacuum technology, superconductivity, measurement, detection, regulation, control and testing, electrical and electronic equipment, mechanics. The exhibition is organised by the French Committee for Trade Events Abroad. There follows : the list of exhibitors, the list of lectures which will be given at the exhibition. A detailed programme will be available in due course at : your Divisional secretariat, the reception information desk, Building 33, the exhibition. LIST OF EXHIBITORS Air Liquide Alcatel Vacuum Technology Alstom Industrie S.A. Alstom Magnets & Superconductors/Jeumont Industrie ATI Electronique Atos S.A. Axon' Cable S.A. Cedrat Recher...

  3. [Measles in France].

    Science.gov (United States)

    Antona, Denise; Baudon, Claire; Freymuth, François; Lamy, Mathieu; Maine, Catherine; Parent du Chatelet, Isabelle; Lévy-Bruhl, Daniel

    2012-11-01

    From January 2008 to May 2012, over 22,000 cases of measles were reported in France. The highest incidence rate was observed in children below one year of age. Over 50% of cases were reported in young adults. Almost 5,000 patients were hospitalised including 1,023 with severe pneumonia, 27 with encephalitis and/or myelitis : 10 died. This situation is linked to insufficient and heterogeneous vaccination coverage with pockets of susceptible people allowing virus circulation. Although the vaccine coverage in children has now improved for both doses, the issue of convincing young susceptible adults to catch up for measles vaccination remains critical, if the elimination target is to be met, and in order to protect the most vulnerable population unable to benefit from this vaccination (children below 1 year, immunodeficient people, pregnant women).

  4. FRANCE AT CERN

    CERN Multimedia

    2001-01-01

    From 19 to 22 June 2001 Administration Building Bldg 60/61 - ground and 1st floor 09.00 hrs - 17.30 hrs Thirty-one companies will present their latest technology at the 'France at CERN' exhibition. The French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: cryogenics and vacuum technology, superconductivity, measurement, detection, regulation, control and testing, electrical and electronic equipment, mechanics. The exhibition is organised by the French Committee for Trade Events Abroad. There follows : the list of exhibitors, the list of lectures which will be given at the exhibition. A detailed programme will be available in due course at : your Divisional secretariat, the reception information desk, Building 33, the exhibition. LIST OF EXHIBITORS Air Liquide Air Liquide Alcatel Vacuum Technology Alstom Industrie S.A. Alstom Magnets & Superconductors/Jeumont Industrie ATI Electronique Atos S.A. Axon' Cable S.A...

  5. France at CERN

    CERN Multimedia

    2003-01-01

    From 23 to 25 September 2003 Administration Building Bldg 60/61 - ground and 1st floor 09.30 hrs - 17.30 hrs Twenty five companies will present their latest technology at the "France at CERN" exhibition. The French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: electrical engineering, electronics, computer data processing, mechanical engineering, vacuum & low temperatures technologies, particles detectors and civil engineering. The exhibition is organised by UBIFRANCE, the French Committee for Trade Events Abroad. There follows : - the list of exhibitors. A detailed programme will be available in due course at : - your Divisional secretariat, - the reception information desk, Building 33, - the exhibition. A web page is available under the following link: http://www.lafranceaucern.com LIST OF EXHIBITORS 1 Air Liquide 14 Nicomatic 2 ATI Electronique 15 Photonis 3 ATIM 16 Positronic industries SAS 4 ATOS 17 Quantel 5 AXON 18 Ra...

  6. France at CERN

    CERN Multimedia

    2003-01-01

    From 23 to 25 September 2003 Administration Building Bldg 60/61 - ground and 1st floor 09.30 hrs - 17.30 hrs Twenty five companies will present their latest technology at the "France at CERN" exhibition. The French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: electrical engineering, electronics, computer data processing, mechanical engineering, vacuum & low temperatures technologies, particles detectors and civil engineering. The exhibition is organised by UBIFRANCE, the French Committee for Trade Events Abroad. There follows : - the list of exhibitors. A detailed programme will be available in due course at : - your Divisional secretariat, - the reception information desk, Building 33, - the exhibition. A web page is available under the following link: http://www.lafranceaucern.com LIST OF EXHIBITORS 1 Air Liquide14 Nicomatic 2 ATI Electronique15 Photonis 3 ATIM16 Positronic industries SAS 4 ATOS17 Qu...

  7. France at CERN

    CERN Multimedia

    2003-01-01

    From 22 to 25 September 2003 Administration Building Bldg 60/61 - ground and 1st floor 09.30 hrs - 17.30 hrs Twenty five companies will present their latest technology at the "France at CERN" exhibition. The French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: electrical engineering, electronics, computer data processing, mechanical engineering, vacuum & low temperatures technologies, particles detectors and civil engineering. The exhibition is organised by UBIFRANCE, the French Committee for Trade Events Abroad. Please find below: - the list of exhibitors. A detailed programme will be available in due course at : - your Divisional secretariat, - the reception information desk, Building 33, - the exhibition. LIST OF EXHIBITORS 1 Air Liquide14 Nicomatic 2 ATI Electronique15 Photonis 3 ATIM16 Positronic industries SAS 4 ATOS17 Quantel 5 AXON18 Radiospares 6 Cedrat Technologies19 Rexor 7 CIAT20 SDS Service &...

  8. France at CERN

    CERN Multimedia

    2005-01-01

    From 04 to 06 october 2005 Administration Building Bldg 60/61 - ground and 1st floor 09:00 - 17:30   Thirty-two companies will present their latest technology at the "France at CERN" exhibition. French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: mechanical engineering, electrical engineering, electronics, data processing, various supplies, civil engineering and buildings, and vacuum and low temperature technology. The exhibition is organised by UBIFRANCE, the French Committee for Trade Events Abroad.  You will find below : the list of exhibitors.   A detailed programme will be available in due course at : your Departmental secretariat, the reception information desk, Building 33, the exhibition itself.   A detailed list of the firms involved is already available under the following FI link: http://fi-dep.web.cern.ch/fi-dep/structure/memberstates/exhibitions_visits.htm     LIST OF EXHIBITORS AIR LIQUIDE DTA ALSTO...

  9. France at CERN

    CERN Multimedia

    2005-01-01

    From 04 to 06 october 2005 Administration Building Bldg 60/61 - ground and 1st floor 09:00 - 17:30   Thirty-two companies will present their latest technology at the "France at CERN" exhibition. French industry will exhibit products and technologies which are related to the field of particle physics. The main subjects are: mechanical engineering, electrical engineering, electronics, data processing, various supplies, civil engineering and buildings, and vacuum and low temperature technology. The exhibition is organised by UBIFRANCE, the French Committee for Trade Events Abroad.  You will find below : the list of exhibitors.   A detailed programme will be available in due course at : your Departmental secretariat, the reception information desk, Building 33, the exhibition itself.   A detailed list of the firms involved is already available under the following FI link: http://fi-dep.web.cern.ch/fi-dep/structure/memberstates/exhibitions_visits.htm     LIST OF EXHIBITORS AIR LIQUIDE DTA ALSTOM...

  10. Ca(2+) induces PI(4,5)P2 clusters on lipid bilayers at physiological PI(4,5)P2 and Ca(2+) concentrations.

    Science.gov (United States)

    Sarmento, Maria J; Coutinho, Ana; Fedorov, Aleksander; Prieto, Manuel; Fernandes, Fabio

    2014-03-01

    Calcium has been shown to induce clustering of PI(4,5)P2 at high and non-physiological concentrations of both the divalent ion and the phosphatidylinositol, or on supported lipid monolayers. In lipid bilayers at physiological conditions, clusters are not detected through microscopic techniques. Here, we aimed to determine through spectroscopic methodologies if calcium plays a role in PI(4,5)P2 lateral distribution on lipid bilayers under physiological conditions. Using several different approaches which included information on fluorescence quantum yield, polarization, spectra and diffusion properties of a fluorescent derivative of PI(4,5)P2 (TopFluor(TF)-PI(4,5)P2), we show that Ca(2+) promotes PI(4,5)P2 clustering in lipid bilayers at physiological concentrations of both Ca(2+) and PI(4,5)P2. Fluorescence depolarization data of TF-PI(4,5)P2 in the presence of calcium suggests that under physiological concentrations of PI(4,5)P2 and calcium, the average cluster size comprises ~15 PI(4,5)P2 molecules. The presence of Ca(2+)-induced PI(4,5)P2 clusters is supported by FCS data. Additionally, calcium mediated PI(4,5)P2 clustering was more pronounced in liquid ordered (lo) membranes, and the PI(4,5)P2-Ca(2+) clusters presented an increased affinity for lo domains. In this way, PI(4,5)P2 could function as a lipid calcium sensor and the increased efficiency of calcium-mediated PI(4,5)P2 clustering on lo domains might provide targeted nucleation sites for PI(4,5)P2 clusters upon calcium stimulus.

  11. Synthesis and characterization of new 3-(4,5-dihydro-5-arylisoxazol-3-yl-4-hydroxyquinolin-2(1H-ones and 3-(4-styrylisoxazolo[4,5-c]quinolin-4(5H-one derivatives

    Directory of Open Access Journals (Sweden)

    S. Sarveswari

    2016-09-01

    Full Text Available The 4-hydroxy-3-(3-arylacryloylquinolin-2(1H-ones were synthesized from 3-acetyl-4-hydroxyquinolin-2(1H-one by microwave assisted synthesis, which in turn converted into their corresponding 3-(4,5-dihydro-5-arylisoxazol-3-yl-4-hydroxyquinolin-2(1H-ones and 3-(4-styrylisoxazolo[4,5-c]quinolin-4(5H-one derivatives.

  12. Interconnection France-England; Interconnexion France-Angleterre

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    These documents defines the interconnection France-England rules for the 2000 MW DC submarine cable directly linking the transmission networks of England and Wales and France. Rights to use Interconnector capacity from 1 April 2001 are to be offered through competitive tenders and auctions, full details of which are set out in the Rules. The contract and a guide to the application form are provided. (A.L.B.)

  13. [Nurse anesthetist in France].

    Science.gov (United States)

    Mizuno, Ju; Yann, Douchy; De Almeida, Sylvie; Deckert, Christine; Gauss, Tobias; Bonneville, Claire Tae; Merckx, Paul; Mantz, Jean

    2006-12-01

    We present the system of nurse anesthetist (Infirmier Anesthésiste Diplômé d'Etat: IADE) in France to the community of Japanese anesthesiologists. This French system with 70 years' history is older than the Japan Society of Anesthesiologists itself. There are 7000 nurse anesthetists in France now and the number of nurse anesthetists increases by 450-500 each year. Training to become a nurse anesthetist requires at least two years' experience as a general nurse and the general nurse must pass an examination after two years' special training in an anesthetistic nurse school to acquire the national certification. The nurse anesthetist's profession is regulated by French law. They work in a team with certified anesthesiologists. They can perform many kinds of anesthetic tasks including tracheal intubation and insertion of arterial catheter under the responsibility and supervision of certified anesthesiologists. The nurse anesthetists are not allowed to perform spinal, epidural, conduction and local anesthesia, although they can maintain these anesthesia and control these methods, e.g., by injecting local anesthetic agents through epidural catheter, following a specified prescription. The nurse anesthetists are not allowed to insert central venous and pulmonary artery catheters, although they can manage them. They are allowed to administer inhalation anesthetic agents, and inject venous anesthetic agents, muscle relaxants, their antagonists, and opioids by their own initiatives, but the decision for the use of catecholamine and emergency drugs is reserved to certified anesthesiologists. The nurse anesthetists perform other tasks preparing and checking anesthetic agents and equipment such as anesthetic machine, monitor, and defibrillator everyday, and sometimes use autologous blood recovery systems. The relationship between the certified anesthesiologist and the nurse anesthetist is marked by mutual respect, confidence and cooperation at each step of the anesthetic

  14. Income Tax in France

    CERN Multimedia

    HR Department

    2009-01-01

    Memorandum from the HR and FP Departments and the Legal Service concerning the annual internal taxation certificate and the declaration of income for 2008 You are reminded that each year the Organization levies an internal tax on the financial and family benefits it pays to the members of the personnel (see Chapter V, Section 2 of the Staff Rules and Regulations) and that members of the personnel are thus exempt from external taxation on salaries and emoluments paid by CERN. This memorandum is intended to provide members of the personnel residing in France with information on how salaries and emoluments paid by CERN should be indicated in the 2008 income declaration form. For any other income, they are invited to comply with the instructions attached to the form. I - Annual internal taxation certificate for 2008 The annual certificate of internal taxation for 2008, issued by the FP Department, has been available since 1st March 2009 (see Bulletin No. 11-12/2009). It is int...

  15. Income tax in France

    CERN Multimedia

    HR Department

    2009-01-01

    Memorandum from the HR and FP Departments and the Legal Service concerning the annual internal taxation certificate and the declaration of income for 2008 You are reminded that each year the Organization levies an internal tax on the financial and family benefits it pays to the members of the personnel (see Chapter V, Section 2 of the Staff Rules and Regulations) and that members of the personnel are thus exempt from external taxation on salaries and emoluments paid by CERN. This memorandum is intended to provide members of the personnel residing in France with information on how salaries and emoluments paid by CERN should be indicated in the 2008 income declaration form. For any other income, they are invited to comply with the instructions attached to the form. I - Annual internal taxation certificate for 2008 The annual certificate of internal taxation for 2008, issued by the FP Department, has been available since 1st March 2009 (see Bulletin No. 11-12/2009). It is int...

  16. The "Casa" of Sevres, France.

    Science.gov (United States)

    Waltuch, Margot

    1996-01-01

    Discusses the author's teaching experiences during the 1930s at "La Maison des Enfants," a Montessori school in Sevres, France. Provides photographs and descriptions of the school day, outdoor activities, gardening, cooking and eating, practical activities, and creative activities. (MDM)

  17. Phosphorylation of the rat Ins(1,4,5)P₃ receptor at T930 within the coupling domain decreases its affinity to Ins(1,4,5)P₃.

    Science.gov (United States)

    Haun, Shirley; Sun, Lu; Hubrack, Satanay; Yule, David; Machaca, Khaled

    2012-01-01

    The Ins(1,4,5)P 3 receptor acts as a central hub for Ca ( 2+) signaling by integrating multiple signaling modalities into Ca ( 2+) release from intracellular stores downstream of G-protein and tyrosine kinase-coupled receptor stimulation. As such, the Ins(1,4,5)P 3 receptor plays fundamental roles in cellular physiology. The regulation of the Ins(1,4,5)P 3 receptor is complex and involves protein-protein interactions, post-translational modifications, allosteric modulation, and regulation of its sub-cellular distribution. Phosphorylation has been implicated in the sensitization of Ins(1,4,5)P 3-dependent Ca ( 2+) release observed during oocyte maturation. Here we investigate the role of phosphorylation at T-930, a residue phosphorylated specifically during meiosis. We show that a phosphomimetic mutation at T-930 of the rat Ins(1,4,5)P 3 receptor results in decreased Ins(1,4,5)P 3-dependent Ca ( 2+) release and lowers the Ins(1,4,5)P 3 binding affinity of the receptor. These data, coupled to the sensitization of Ins(1,4,5)P 3-dependent Ca ( 2+) release during meiosis, argue that phosphorylation within the coupling domain of the Ins(1,4,5)P 3 receptor acts in a combinatorial fashion to regulate Ins(1,4,5)P 3 receptor function.

  18. France Welcome Chinese Business Delegation

    Institute of Scientific and Technical Information of China (English)

    Guo Yan

    2009-01-01

    @@ According to the Press Communiqu(e) between China and France issued on 1st April,both sides decided to conduct high-level contact and strategic dialogue at a proper time to enhance bilateral cooperation in various fields and promote a harmonious and steady growth in Sino-France relations.Since then,the high officials from both countries experienced a frequent meet period.

  19. Tour of France by foot

    CERN Multimedia

    Papini

    1982-01-01

    Monsieur Papini(nom juste?) et sa femme, tous les deux journalistes, découvrent avec leur 2 enfants, agés de 16 mois et 3 ans, ainsi qu'avec un âne, la vie nomade en parcourant la France pendant un an et demie à pied: comment être un nomade en France? Sa femme a écrit deux ouvrages concernant ce voyage.

  20. Total Synthesis of Two 4, 5-Dioxo-seco-eudesmane Sesquiterpenes

    Institute of Scientific and Technical Information of China (English)

    Li Jing FANG; Chen Xi ZHANG; Jin Chun CHEN; Guo Jun ZHENG; Yu Lin LI

    2005-01-01

    A facile synthetic route to two seco-eudesmane, 4, 5-dioxo-10-epi-4, 5-seco-γeudesmane (1) and 4, 5-dioxo-10-epi-4, 5-seco-γ-eudesmol (2) from (+)-dihydrocarvone has been described. Avoiding expensive reagents, this highly economic method especially suits for the synthesis of 4, 5-seco-eudesman-type and ophianon-type sesquiterpenes with a double bond at position 11 and 12.

  1. L’Histoire en christianisme. Hommage à Jean Comby, Textes réunis par Jacques Gadille et Daniel Moulinet, Lyon, Profac, 2002, 115 p.

    OpenAIRE

    2011-01-01

    Jean Comby a été professeur à la Faculté de théologie de Lyon ; il est l’auteur de Pour lire l’histoire de l’Église (Paris, Cerf), qui vient de connaître en septembre 2003 une nouvelle édition en un seul volume. Ses collègues théologiens et historiens, universitaires à Lyon, ont consacré une matinée, en 2001, à la relecture et à la mise en valeur de son œuvre, en sa présence : c’est l’objet de ce petit ouvrage. On y trouve donc de précieuses indications biographiques, et la liste de ses publi...

  2. Molecular determinants of phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) binding to transient receptor potential V1 (TRPV1) channels.

    Science.gov (United States)

    Poblete, Horacio; Oyarzún, Ingrid; Olivero, Pablo; Comer, Jeffrey; Zuñiga, Matías; Sepulveda, Romina V; Báez-Nieto, David; González Leon, Carlos; González-Nilo, Fernando; Latorre, Ramón

    2015-01-23

    Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) has been recognized as an important activator of certain transient receptor potential (TRP) channels. More specifically, TRPV1 is a pain receptor activated by a wide range of stimuli. However, whether or not PI(4,5)P2 is a TRPV1 agonist remains open to debate. Utilizing a combined approach of mutagenesis and molecular modeling, we identified a PI(4,5)P2 binding site located between the TRP box and the S4-S5 linker. At this site, PI(4,5)P2 interacts with the amino acid residues Arg-575 and Arg-579 in the S4-S5 linker and with Lys-694 in the TRP box. We confirmed that PI(4,5)P2 behaves as a channel agonist and found that Arg-575, Arg-579, and Lys-694 mutations to alanine reduce PI(4,5)P2 binding affinity. Additionally, in silico mutations R575A, R579A, and K694A showed that the reduction in binding affinity results from the delocalization of PI(4,5)P2 in the binding pocket. Molecular dynamics simulations indicate that PI(4,5)P2 binding induces conformational rearrangements of the structure formed by S6 and the TRP domain, which cause an opening of the lower TRPV1 channel gate.

  3. Synthesis and muscarinic receptor pharmacology of a series of 4,5,6,7-tetrahydroisothiazolo[4,5-c]pyridine bioisosteres of arecoline

    DEFF Research Database (Denmark)

    Pedersen, H; Bräuner-Osborne, H; Ball, R G;

    1999-01-01

    A series of O- and ring-alkylated derivatives of 4,5,6,7-tetrahydroisothiazolo[4,5-c]pyridin-3-ol was synthesized via treatment of appropriately substituted 4-benzylamino-1,2,5,6-tetrahydropyridine-3-carboxamides with hydrogen sulfide and subsequent ring closure by oxidation with bromine. The mus......A series of O- and ring-alkylated derivatives of 4,5,6,7-tetrahydroisothiazolo[4,5-c]pyridin-3-ol was synthesized via treatment of appropriately substituted 4-benzylamino-1,2,5,6-tetrahydropyridine-3-carboxamides with hydrogen sulfide and subsequent ring closure by oxidation with bromine...

  4. 吴稚晖和里昂中法大学%Wu Zhihui and The University of Lyon

    Institute of Scientific and Technical Information of China (English)

    陈清茹

    2015-01-01

    Wu Zhihui was the first to propose the establishment of University in China outside .Each link in the Sino French university he founded ,Lyon ,enrollment management in both pay great efforts ,more have the deepest hopes ,but because he was lazy nature and economic problems ,suffered as a result of students siege and opposition ,eventually had to disappoint‐ment .%吴稚晖作为第一任里昂中法大学的校长,在大学的创办、招生、管理等各个环节都付出了极大心血。但是,由于受到学潮、经济以及外方制约等因素的影响,教育事业一再受挫。吴稚晖虽然承认他办学失败,但他对学校和学生却未失去信心。

  5. Ion channel regulation by phosphoinositides analyzed with VSPs-PI(4,5)P2 affinity, phosphoinositide selectivity, and PI(4,5)P2 pool accessibility.

    Science.gov (United States)

    Rjasanow, Alexandra; Leitner, Michael G; Thallmair, Veronika; Halaszovich, Christian R; Oliver, Dominik

    2015-01-01

    The activity of many proteins depends on the phosphoinositide (PI) content of the membrane. E.g., dynamic changes of the concentration of PI(4,5)P2 are cellular signals that regulate ion channels. The susceptibility of a channel to such dynamics depends on its affinity for PI(4,5)P2. Yet, measuring affinities for endogenous PIs has not been possible directly, but has relied largely on the response to soluble analogs, which may not quantitatively reflect binding to native lipids. Voltage-sensitive phosphatases (VSPs) turn over PI(4,5)P2 to PI(4)P when activated by depolarization. In combination with voltage-clamp electrophysiology VSPs are useful tools for rapid and reversible depletion of PI(4,5)P2. Because cellular PI(4,5)P2 is resynthesized rapidly, steady state PI(4,5)P2 changes with the degree of VSP activation and thus depends on membrane potential. Here we show that titration of endogenous PI(4,5)P2 with Ci-VSP allows for the quantification of relative PI(4,5)P2 affinities of ion channels. The sensitivity of inward rectifier and voltage-gated K(+) channels to Ci-VSP allowed for comparison of PI(4,5)P2 affinities within and across channel subfamilies and detected changes of affinity in mutant channels. The results also reveal that VSPs are useful only for PI effectors with high binding specificity among PI isoforms, because PI(4,5)P2 depletion occurs at constant overall PI level. Thus, Kir6.2, a channel activated by PI(4,5)P2 and PI(4)P was insensitive to VSP. Surprisingly, despite comparable PI(4,5)P2 affinity as determined by Ci-VSP, the Kv7 and Kir channel families strongly differed in their sensitivity to receptor-mediated depletion of PI(4,5)P2. While Kv7 members were highly sensitive to activation of PLC by Gq-coupled receptors, Kir channels were insensitive even when PI(4,5)P2 affinity was lowered by mutation. We hypothesize that different channels may be associated with distinct pools of PI(4,5)P2 that differ in their accessibility to PLC and VSPs.

  6. Ion channel regulation by phosphoinositides analyzed with VSPs – PI(4,5P2 affinity, phosphoinositide selectivity, and PI(4,5P2 pool accessibility

    Directory of Open Access Journals (Sweden)

    Alexandra eRjasanow

    2015-06-01

    Full Text Available The activity of many proteins depends on the phosphoinositide (PI content of the membrane. E.g., dynamic changes of the concentration of PI(4,5P2 are cellular signals that regulate ion channels. The susceptibility of a channel to such dynamics depends on its affinity for PI(4,5P2. Yet, measuring affinities for endogenous PIs has not been possible directly, but has relied largely on the response to soluble analogs, which may not quantitatively reflect binding to native lipids.Voltage-sensitive phosphatases (VSPs turn over PI(4,5P2 to PI(4P when activated by depolarization. In combination with voltage-clamp electrophysiology VSPs are useful tools for rapid and reversible depletion of PI(4,5P2. Because cellular PI(4,5P2 is resynthesized rapidly, steady state PI(4,5P2 changes with the degree of VSP activation and thus depends on membrane potential.Here we show that titration of endogenous PI(4,5P2 with Ci-VSP allows for the quantification of relative PI(4,5P2 affinities of ion channels. The sensitivity of inward rectifier and voltage-gated K+ channels to Ci-VSP allowed for comparison of PI(4,5P2 affinities within and across channel subfamilies and detected changes of affinity in mutant channels. The results also reveal that VSPs are useful only for PI effectors with high binding specificity among PI isoforms, because PI(4,5P2 depletion occurs at constant overall PI level. Thus, Kir6.2, a channel activated by PI(4,5P2 and PI(4P was insensitive to VSP.Surprisingly, despite comparable PI(4,5P2 affinity as determined by Ci-VSP, the Kv7 and Kir channel families strongly differed in their sensitivity to receptor-mediated depletion of PI(4,5P2. While Kv7 members were highly sensitive to activation of PLC by Gq-coupled receptors, Kir channels were insensitive even when PI(4,5P2 affinity was lowered by mutation. We hypothesize that different channels may be associated with distinct pools of PI(4,5P2 that differ in their accessibility to PLC and VSPs.

  7. Amberlyst A-15: Reusable catalyst for the synthesis of 2,4,5-trisubstituted and 1,2,4,5-tetrasubstituted-1-imidazoles under MW irradiation

    Indian Academy of Sciences (India)

    Shivaji S Pandit; Swapnil K Bhalerao; Uddhav S Aher; Gorakshanath L Adhav; Vikram U Pandit

    2011-07-01

    One-pot multi-component condensation of benzyl, aldehydes, ammonium acetate and primary amines were used for synthesis of 2,4,5-trisubstituted and 1,2,4,5-tetrasubstituted-1-imidazole derivatives underMWradiation using amberlyst A-15 as a catalysts. This catalyst has several advantages (simple work-up, low cost and reusability).

  8. FOREIGN DRIVING LICENCES IN FRANCE

    CERN Multimedia

    Service des relations avec les Pays Hôtes

    2000-01-01

    1. PERSONS RESIDING IN FRANCE1.1 National driving licences from countries belonging to the EEAa) ValidityCurrent national driving licences issued by a country belonging to the European Economic Area (here inafter called EEA) are, in principle, valid in France. N.B. : The countries belonging to the EEA are Austria, Belgium, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Italy, Liechtenstein, Luxembourg, Netherlands, Norway, Portugal, Spain, Sweden and the United Kingdom.b)\tRegistrationTo ensure that all the conditions of validity in France have been met, holders of driving licences issued by a country belonging to the EEA, who reside in France (i.e. hold a residence permit issued by a Préfecture, or a carte spéciale issued by the French Ministry of Foreign Affairs, which is equivalent to a residence permit), can have their licences registered with the Préfecture of the department where they live (for Ain, call 04 74 32 30 00, for Haute Savoie call 04 50 33 ...

  9. France: High and stable fertility

    Directory of Open Access Journals (Sweden)

    Clémentine Rossier

    2008-07-01

    Full Text Available The current total fertility rate in France is around 1.9 children per woman. This is a relatively high level by current European standards and makes France an outlier, despite the fact that its other demographic trends, especially conjugal behaviour, and social and economic trends are not very different from other Western European countries. France can serve as a counterfactual test case for some of the hypotheses advanced to explain the current low level of fertility in most European countries (delay in fertility, decline in marriage, increased birth control, greater economic uncertainty. France's fertility level can be partly explained by its active family policy introduced after the Second World War, and adapted in the 1980s to accommodate women's entry into the labour force. This policy is the result of a battle, fuelled by pro-natalism, between the conservative supporters of family values and the promoters of state-supported individual equality. French family policy thus encompasses a wide range of measures based on varying ideological backgrounds, and it is difficult to classify in comparison to the more precisely focused family policies of other European welfare states. The active family policy seems to have created especially positive attitudes towards two- or three child families in France.

  10. Revisão dos critérios de Sokolow-Lyon-Rappaport e cornell para hipertrofia do ventrículo esquerdo Revision of the Sokolow-Lyon-Rappaport and cornell voltage criteria for left ventricular hypertrophy

    Directory of Open Access Journals (Sweden)

    Sérgio Lamêgo Rodrigues

    2008-01-01

    Full Text Available FUNDAMENTO: A hipertrofia do ventrículo esquerdo (HVE detectada pela eletrocardiografia é um forte preditor de morbidade e mortalidade cardiovasculares. OBJETIVO: Analisar o desempenho dos critérios de Sokolow-Lyon-Rappaport (SLR e de Cornell, em amostra populacional, em relação ao diagnóstico de HVE à ecocardiografia. MÉTODOS: Entre os 682 participantes da segunda fase do Projeto MONICA-OMS/Vitória, 641 foram avaliados por meio de eletrocardiografia e ecocardiografia. O subgrupo de indivíduos saudáveis (n = 269 foi usado para gerar valores de referência da massa do ventrículo esquerdo (MVE. As sensibilidades e especificidades dos critérios eletrocardiográficos foram determinadas pela curva ROC (receptor-operator characteristics em relação ao diagnóstico de HVE definido pelo critério ecocardiográfico interno (MVE > 48 g/m2,7 e 46 g/m2,7 para homens e mulheres, respectivamente. RESULTADOS: A prevalência de HVE à ecocardiografia foi de 23,7% na amostra global, em que havia 49% de hipertensos. O critério de Cornell apresentou melhor associação com a MVE estimada pela ecocardiografia (r = 0,37; p BACKGROUND: Electrocardiographically-detected left ventricular hypertrophy (LVH is a strong predictor of cardiovascular morbidity and mortality. OBJECTIVE: To assess the performance of the Sokolow-Lyon-Rappaport (SLR and Cornell voltage criteria in a population sample regarding the diagnosis of LVH on echocardiogram (ECHO. METHODS: A total of 641 out of the 682 participants of the second phase of the MONICA-Vitória project were assessed using electrocardiogram and echocardiogram. A subgroup of healthy individuals (n=269 was used to generate reference values of LV mass (LVM. Sensitivities and specificities of the electrocardiographic criteria were determined by the ROC (receptor-operator characteristics curve in relation to the diagnosis of LVH, as defined by the internal echocardiographic criterion (LVM > 48 and 46 g/m2.7 for males

  11. Beginning of Viniculture in France

    Science.gov (United States)

    McGovern, Patrick E.; Luley, Benjamin P.; Rovira, Nuria; Mirzoian, Armen; Callahan, Michael P.; Smith, Karen F.; Hall, Gretchen R.; Davidson, Theodore; Henkin, Joshua M.

    2013-01-01

    Chemical analyses of ancient organic compounds absorbed into the pottery fabrics of imported Etruscan amphoras (ca. 500-475 B.C.) and into a limestone pressing platform (ca. 425-400 B.C.) at the ancient coastal port site of Lattara in southern France provide the earliest biomolecular archaeological evidence for grape wine and viniculture from this country, which is crucial to the later history of wine in Europe and the rest of the world. The data support the hypothesis that export of wine by ship from Etruria in central Italy to southern Mediterranean France fueled an ever-growing market and interest in wine there, which, in turn, as evidenced by the winepress, led to transplantation of the Eurasian grapevine and the beginning of a Celtic industry in France. Herbal and pine resin additives to the Etruscan wine point to the medicinal role of wine in antiquity, as well as a means of preserving it during marine transport.

  12. New Phase Between China and France

    Institute of Scientific and Technical Information of China (English)

    Guo Yan

    2009-01-01

    @@ In recent years,the economic cooperation between China and France has developed rapidly.In despite of the bilateral relationship was fluctuating last year,two countries kept on making their efforts to improve the relation.The 15th China-France Economic Seminar was held on April 8 and 9,in Beijing.The theme of this seminar is "Challenges and Opportunities:Beginning New Cooperation between China and France",after a statement concerning "France fully recognizes 'the importance and sensitivity of the Tibet issue' and that France refuses to support any form of Tibet independence"issued by China and France on April 1.

  13. Stepfamilies in Denmark and France

    DEFF Research Database (Denmark)

    Toulemon, Laurent; Knudsen, Lisbeth B.

    2006-01-01

    In both Denmark and France, the past decades have shown profound changes in the patterns of fertility as well as in family formation and family dissolution, with no related decline in overall fertility. Using very large data sets (380,000 respondents in the French survey, 1.3 million women...... in Danish Register data), we built synthetic indexes to show the frequency of stepfamilies in both countries. It is more frequent in Denmark than in France. We then analyse fertility of stepfamilies, compared to couples without any child born before the union, with controlling for age, duration of union...

  14. Stepfamilies in Denmark and France

    DEFF Research Database (Denmark)

    Toulemon, Laurent; Knudsen, Lisbeth B.

    2006-01-01

    In both Denmark and France, the past decades have shown profound changes in the patterns of fertility as well as in family formation and family dissolution, with no related decline in overall fertility. Using very large data sets (380,000 respondents in the French survey, 1.3 million women...... in Danish Register data), we built synthetic indexes to show the frequency of stepfamilies in both countries. It is more frequent in Denmark than in France. We then analyse fertility of stepfamilies, compared to couples without any child born before the union, with controlling for age, duration of union...

  15. Interconnection France-Italy; Interconnexion France-Italie

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    These documents presents the rules, defined by RTE, of the attribution of electric power transportation capacity between France and Italy. The contract form and the general principles are given in annexes. A guide to the application form is provided. (A.L.B.)

  16. Control of diverse subcellular processes by a single multi-functional lipid phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2].

    Science.gov (United States)

    Kolay, Sourav; Basu, Urbashi; Raghu, Padinjat

    2016-06-15

    Phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] is a multi-functional lipid that regulates several essential subcellular processes in eukaryotic cells. In addition to its well-established function as a substrate for receptor-activated signalling at the plasma membrane (PM), it is now recognized that distinct PI(4,5)P2 pools are present at other organelle membranes. However, a long-standing question that remains unresolved is the mechanism by which a single lipid species, with an invariant functional head group, delivers numerous functions without loss of fidelity. In the present review, we summarize studies that have examined the molecular processes that shape the repertoire of PI(4,5)P2 pools in diverse eukaryotes. Collectively, these studies indicate a conserved role for lipid kinase isoforms in generating functionally distinct pools of PI(4,5)P2 in diverse metazoan species. The sophistication underlying the regulation of multiple functions by PI(4,5)P2 is also shaped by mechanisms that regulate its availability to enzymes involved in its metabolism as well as molecular processes that control its diffusion at nanoscales in the PM. Collectively, these mechanisms ensure the specificity of PI(4,5)P2 mediated signalling at eukaryotic membranes.

  17. Cluster analysis of social and environment inequalities of infant mortality. A spatial study in small areas revealed by local disease mapping in France.

    Science.gov (United States)

    Padilla, Cindy M; Deguen, Severine; Lalloue, Benoit; Blanchard, Olivier; Beaugard, Charles; Troude, Florence; Navier, Denis Zmirou; Vieira, Verónica M

    2013-06-01

    Mapping spatial distributions of disease occurrence can serve as a useful tool for identifying exposures of public health concern. Infant mortality is an important indicator of the health status of a population. Recent literature suggests that neighborhood deprivation status can modify the effect of air pollution on preterm delivery, a known risk factor for infant mortality. We investigated the effect of neighborhood social deprivation on the association between exposure to ambient air NO2 and infant mortality in the Lille and Lyon metropolitan areas, north and center of France, respectively, between 2002 and 2009. We conducted an ecological study using a neighborhood deprivation index estimated at the French census block from the 2006 census data. Infant mortality data were collected from local councils and geocoded using the address of residence. We generated maps using generalized additive models, smoothing on longitude and latitude while adjusting for covariates. We used permutation tests to examine the overall importance of location in the model and identify areas of increased and decreased risk. The average death rate was 4.2‰ and 4.6‰ live births for the Lille and Lyon metropolitan areas during the period. We found evidence of statistically significant precise clusters of elevated infant mortality for Lille and an east-west gradient of infant mortality risk for Lyon. Exposure to NO2 did not explain the spatial relationship. The Lille MA, socioeconomic deprivation index explained the spatial variation observed. These techniques provide evidence of clusters of significantly elevated infant mortality risk in relation with the neighborhood socioeconomic status. This method could be used for public policy management to determine priority areas for interventions. Moreover, taking into account the relationship between social and environmental exposure may help identify areas with cumulative inequalities.

  18. Cluster analysis of social and environment inequalities of infant mortality. A spatial study in small areas revealed by local disease mapping in France

    Science.gov (United States)

    Padilla, Cindy M.; Deguen, Severine; Lalloue, Benoit; Blanchard, Olivier; Beaugard, Charles; Troude, Florence; Navier, Denis Zmirou; Vieira, Verónica M.

    2014-01-01

    Mapping spatial distributions of disease occurrence can serve as a useful tool for identifying exposures of public health concern. Infant mortality is an important indicator of the health status of a population. Recent literature suggests that neighborhood deprivation status can modify the effect of air pollution on preterm delivery, a known risk factor for infant mortality. We investigated the effect of neighborhood social deprivation on the association between exposure to ambient air NO2 and infant mortality in the Lille and Lyon metropolitan areas, north and center of France, respectively, between 2002 and 2009. We conducted an ecological study using a neighborhood deprivation index estimated at the French census block from the 2006 census data. Infant mortality data were collected from local councils and geocoded using the address of residence. We generated maps using generalized additive models, smoothing on longitude and latitude while adjusting for covariates. We used permutation tests to examine the overall importance of location in the model and identify areas of increased and decreased risk. The average death rate was 4.2‰ and 4.6‰ live births for the Lille and Lyon metropolitan areas during the period. We found evidence of statistically significant precise clusters of elevated infant mortality for Lille and an east-west gradient of infant mortality risk for Lyon. Exposure to NO2 did not explain the spatial relationship. The Lille MA, socioeconomic deprivation index explained the spatial variation observed. These techniques provide evidence of clusters of significantly elevated infant mortality risk in relation with the neighborhood socioeconomic status. This method could be used for public policy management to determine priority areas for interventions. Moreover, taking into account the relationship between social and environmental exposure may help identify areas with cumulative inequalities. PMID:23563257

  19. Les premières sauvegardes de mosaïques antiques en France

    Directory of Open Access Journals (Sweden)

    Capucine Lemaître

    2012-04-01

    Full Text Available Au lendemain de la Révolution, l’histoire de la restauration des mosaïques émerge en France avec la notion de patrimoine et le sentiment d’un héritage commun à tous les citoyens. De plus, il prend aussi sa source dans l’engouement suscité par les découvertes archéologiques italiennes. La diffusion des connaissances et des techniques s’effectue ainsi par le biais d’échanges et de publications que partagent les antiquaires et les milieux de l’érudition qui commencent à s’intéresser aux vestiges conservés sur le territoire français et tentent d’en assurer la sauvegarde. L'étude des travaux de deux érudits, Pierre Schneyder qui fut le premier directeur du musée de Vienne (Isère et François Artaud qui réunit la première collection française de mosaïques antiques au Palais des Arts de Lyon, permet de mettre en avant le rôle d’élites locales qui durent faire face à de multiples contraintes techniques, économiques et institutionnelles, mais qui furent aussi les initiateurs des premières réflexions menées sur la restauration de ce patrimoine archéologique.The restoration of mosaics begins in France with the notion of patrimony and the feeling of a common heritage to all citizens after the Revolution. But it also springs up in the fancy for italian archeological discoveries. The spreading of knowledge and techniques is carried out through oral exchanges and publications between antique dealers and erudition circles who are going to begin to be interested in vestiges on the french territory and try to ensure their safeguard. The study of two scholars'works, Pierre Schneyder who was the first manager of the Vienne museum in Isere and François Artaud who got together the first french collection of antique mosaics in the Palais des Arts in Lyon allows us to put forward the part of local elites who had to face numerous technical, economical and institutional restraints but who were, despite everything, the

  20. Pharmacological Characterization of Inositol 1,4,5-tris Phosphate Receptors in Human Platelet Membranes

    Directory of Open Access Journals (Sweden)

    Yogesh Dwivedi

    2009-01-01

    Full Text Available The phosphatidylinositol (PI hydrolysis signaling system has been shown to be altered in platelets of depressed and schizophrenic subjects. Inositol (1,4,5 trisphosphate (Ins(1,4,5P3, an integral component of the PI signaling system, mobilizes Ca2+ by activating Ins(1,4,5P3 receptors. To eventually investigate the role of Ins(1,4,5P3 receptors in depression and other mental disorders, we characterized [H3]Ins(1,4,5P3 binding sites in crude platelet membranes prepared from small amounts of blood obtained from healthy human control subjects. We found a single, saturable binding site for [H3]Ins(1,4,5P3 to crude platelet membranes, which is time dependent and modulated by pH, inositol phosphates, and heparin. Since cyclic adenosine monophosphate (cAMP and Ca2+ have been shown to be important modulators in Ins(1,4,5P3 receptors, in the present study we also determined the effects of various concentrations of CaCI2 and forskolin on Ins(1,4,5P3 binding to platelet membranes. CaCI2 modulated [3H]Ins(1,4,5P3 binding sites in a biphasic manner: at lower concentrations it inhibited [3H]Ins(1,4,5P3 binding, whereas at higher concentrations, it stimulated [3H]Ins(1,4,5P3 binding. On the other hand, forskolin inhibited [3H]Ins(1,4,5P3 binding. Our results thus suggest that the pharmacological characteristics of [3H]Ins(1,4,5P3 binding to crude platelet membranes are similar to that of Ins(1,4,5P3 receptors; and that both Ca2+ and cAMP modulate [3H]Ins(1,4,5P3 binding in crude platelet membranes.

  1. Hurricane Frances Poster (September 5, 2004)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Hurricane Frances poster. Multi-spectral image from NOAA-17 shows Hurricane Frances over central Florida on September 5, 2004. Poster dimension is approximately...

  2. Education in France: Number 41.

    Science.gov (United States)

    French Embassy, New York, NY. French Cultural Services.

    The history and modernization of the French nursery and elementary schools are the focal points of this review of educational trends in France. One major section discussed the "Ecole Maternelle", kindergarten, nursery schools, the "Jardin d'Enfants", and new math. Another section treats: (1) "Les Ecoles Primaires",…

  3. Pyemotes ventricosus Dermatitis, Southeastern France

    OpenAIRE

    Del Giudice, Pascal; Blanc-Amrane, V?ronique; Bahadoran, Philippe; Caumes, Eric; Marty, Pierre; Lazar, Maril?na; Boissy, Christian; Desruelles, Fran?ois; Izri, Arezki; Ortonne, Jean-Paul; Counillon, Evelyne; Chosidow, Olivier; Delaunay, Pascal

    2008-01-01

    We investigated 42 patients who had unusual pruritic dermatitis associated with a specific clinical sign (comet sign) in 23 houses in southeastern France from May through September 2007. Pyemotes ventricosus, a parasite of the furniture beetle Anobium punctatum, was the cause of this condition.

  4. Pyemotes ventricosus dermatitis, southeastern France.

    Science.gov (United States)

    Del Giudice, Pascal; Blanc-Amrane, Véronique; Bahadoran, Philippe; Caumes, Eric; Marty, Pierre; Lazar, Mariléna; Boissy, Christian; Desruelles, François; Izri, Arezki; Ortonne, Jean-Paul; Counillon, Evelyne; Chosidow, Olivier; Delaunay, Pascal

    2008-11-01

    We investigated 42 patients who had unusual pruritic dermatitis associated with a specific clinical sign (comet sign) in 23 houses in southeastern France from May through September 2007. Pyemotes ventricosus, a parasite of the furniture beetle Anobium punctatum, was the cause of this condition.

  5. Education in France: Number 41.

    Science.gov (United States)

    French Embassy, New York, NY. French Cultural Services.

    The history and modernization of the French nursery and elementary schools are the focal points of this review of educational trends in France. One major section discussed the "Ecole Maternelle", kindergarten, nursery schools, the "Jardin d'Enfants", and new math. Another section treats: (1) "Les Ecoles Primaires", (2) village schools, (3) the…

  6. [Nurse home visits in France].

    Science.gov (United States)

    Monguillon, Dominique; Gracia, Pierre-Benjamin

    2011-10-01

    Nurse home visits in France. More and more nurses carry out home visits, either as freelance nurses or employees of a nurse home visits service, a home hospital care structure or a nursing care centre. These home visits are both demanded by patients and encouraged by the health authorities. As a consequence, the service is expanding every year.

  7. Education in France: Number 41.

    Science.gov (United States)

    French Embassy, New York, NY. French Cultural Services.

    The history and modernization of the French nursery and elementary schools are the focal points of this review of educational trends in France. One major section discussed the "Ecole Maternelle", kindergarten, nursery schools, the "Jardin d'Enfants", and new math. Another section treats: (1) "Les Ecoles Primaires",…

  8. n-3 polyunsaturated fatty acids suppress CD4(+) T cell proliferation by altering phosphatidylinositol-(4,5)-bisphosphate [PI(4,5)P2] organization.

    Science.gov (United States)

    Hou, Tim Y; Barhoumi, Rola; Fan, Yang-Yi; Rivera, Gonzalo M; Hannoush, Rami N; McMurray, David N; Chapkin, Robert S

    2016-01-01

    The mechanisms by which n-3 polyunsaturated fatty acids (n-3 PUFA), abundant in fish oil, exert their anti-inflammatory effects have not been rigorously defined. We have previously demonstrated that n-3 PUFA decrease the amount of phosphatidylinositol-(4,5)-bisphosphate, [PI(4,5)P2], in CD4(+) T cells, leading to suppressed actin remodeling upon activation. Since discrete pools of PI(4,5)P2 exist in the plasma membrane, we determined whether n-3 PUFA modulate spatial organization of PI(4,5)P2 relative to raft and non-raft domains. We used Förster resonance energy transfer (FRET) to demonstrate that lipid raft mesodomains in the plasma membrane of CD4(+) T cells enriched in n-3 PUFA display increased co-clustering of Lck(N10) and LAT(ΔCP), markers of lipid rafts. CD4(+) T cells enriched in n-3 PUFA also exhibited a depleted plasma membrane non-raft PI(4,5)P2 pool as detected by decreased co-clustering of Src(N15), a non-raft marker, and PH(PLC-δ), a PI(4,5)P2 reporter. Incubation with exogenous PI(4,5)P2 rescued the effects on the non-raft PI(4,5)P2 pool, and reversed the suppression of T cell proliferation in CD4(+) T cells enriched with n-3 PUFA. Furthermore, CD4(+) T cells isolated from mice fed a 4% docosahexaenoic acid (DHA)-enriched diet exhibited a decrease in the non-raft pool of PI(4,5)P2, and exogenous PI(4,5)P2 reversed the suppression of T cell proliferation. Finally, these effects were not due to changes to post-translational lipidation, since n-3 PUFA did not alter the palmitoylation status of signaling proteins. These data demonstrate that n-3 PUFA suppress T cell proliferation by altering plasma membrane topography and the spatial organization of PI(4,5)P2.

  9. 1H-Imidazol-4(5H)-ones and thiazol-4(5H)-ones as emerging pronucleophiles in asymmetric catalysis

    Science.gov (United States)

    Mielgo, Antonia

    2016-01-01

    Summary Asymmetric catalysis represents a very powerful tool for the synthesis of enantiopure compounds. In this context the main focus has been directed not only to the search for new efficient chiral catalysts, but also to the development of efficient pronucleophiles. This review highlights the utility and first examples of 1H-imidazol-4(5H)-ones and thiazol-4(5H)-ones as pronucleophiles in catalytic asymmetric reactions. PMID:27340482

  10. 1H-Imidazol-4(5H)-ones and thiazol-4(5H)-ones as emerging pronucleophiles in asymmetric catalysis.

    Science.gov (United States)

    Mielgo, Antonia; Palomo, Claudio

    2016-01-01

    Asymmetric catalysis represents a very powerful tool for the synthesis of enantiopure compounds. In this context the main focus has been directed not only to the search for new efficient chiral catalysts, but also to the development of efficient pronucleophiles. This review highlights the utility and first examples of 1H-imidazol-4(5H)-ones and thiazol-4(5H)-ones as pronucleophiles in catalytic asymmetric reactions.

  11. 2035: a no nuclear France; 2035: une France sans nucleaire

    Energy Technology Data Exchange (ETDEWEB)

    Dupin, L.; Chandes, C.; James, O.; Moragues, M.

    2011-06-15

    The authors propose a prospective scenario: the newly elected French president decides of a 20-year program to give up nuclear energy production. First, the Fessenheim and Gravelines reactors are closed. The others are to be closed by 2035. Investments are decided for offshore wind energy production, methanation projects, housing thermal insulation. Employees of the nuclear energy sector are taken into account. The authors describe the situation in 2020: energy supply problems, 5 more years of lifetime awarded to some nuclear power stations, decision to build only positive energy buildings, mandatory housing renovation, job creation, decision to develop carbon capture and storage projects. In 2025: the dismantling of nuclear reactors is going on and its cost is assessed, always more electrical vehicles, drastic cost reduction for lithium batteries. In 2035: renewable energies represent the half of the energy mix, the dismantling activity is a success for Areva. In parallel, current figures are given for energy consumption per year and per person in France and Germany, for energy French exports and imports, for electricity cost associated with the different energy sources, for the energy mix in France, for the number of jobs in the nuclear sector. In an interview, a member of the CEA comments the Italian, German and Swiss decisions to give up nuclear energy, the possibilities of its replacement by renewable energies, and the challenges associated with such a decision in France

  12. Nicolas Andry de Bois-Regard (Lyon 1658-Paris 1742): the inventor of the word "orthopaedics" and the father of parasitology.

    Science.gov (United States)

    Kohler, Remi

    2010-08-01

    This is an historical essay about Nicolas Andry, a French medical doctor (Lyon 1658-Paris 1742) who wrote in 1741 the famous book called "L'orthopedie", which was soon after translated into English (1742) "Orthopaedia or the art of correcting and preventing deformities in children". His life and works are detailed as the containment of the book composed of two volumes and many engravings (the crooked tree has become the symbol of numerous orthopaedic societies around the world). A discussion of semantics (ORTHO-PEDIE) and evolution of the meaning of this word is also discussed.

  13. Bedrock Geologic Map of New Hampshire, a Digital Representation of Lyons and Others 1997 Map and Ancillary Files

    Science.gov (United States)

    Bennett, Derek S.; Lyons, John B.; Wittkop, Chad A.; Dicken, Connie L.

    2006-01-01

    The New Hampshire Geological Survey collects data and performs research on the land, mineral, and water resources of the State, and disseminates the findings of such research to the public through maps, reports, and other publications. The Bedrock Geologic Map of New Hampshire, by John B. Lyons, Wallace A. Bothner, Robert H. Moench, and James B. Thompson, was published in paper format by the U.S. Geological Survey (USGS) in 1997. The online version of this CD contains digital datasets of the State map that are intended to assist the professional geologist, land-use planners, water resource professionals, and engineers and to inform the interested layperson. In addition to the bedrock geology, the datasets include geopolitical and hydrologic information, such as political boundaries, quadrangle boundaries, hydrologic units, and water-well data. A more thorough explanation for each of these datasets may be found in the accompanying metadata files. The data are spatially referenced and may be used in a geographic information system (GIS). ArcExplorer, the Environmental Systems Research Institute's (ESRI) free GIS data viewer, is available at http://www.esri.com/software/arcexplorer. ArcExplorer provides basic functions that are needed to harness the power and versatility of the spatial datasets. Additional information on the viewer and other ESRI products may be found on the ArcExplorer website. Although extensive review and revisions of the data have been performed by the USGS and the New Hampshire Geological Survey, these data represent interpretations made by professional geologists using the best available data, and are intended to provide general geologic information. Use of these data at scales larger than 1:250,000 will not provide greater accuracy. The data are not intended to replace site-specific or specific-use investigations. The U.S. Geological Survey, New Hampshire Geological Survey, and State of New Hampshire make no representation or warranty

  14. [End of life in France].

    Science.gov (United States)

    Vacheron, André

    2013-01-01

    Two major changes in end-of-life management have occured in recent decades: first, because of the increase in life expectancy and the resulting aging of the population, most deaths now involve old or very old people; second, more than two-thirds of deaths occur in a hospital or an institution. Our fellow citizens are afraid of suffering and death. They wish for a peaceful death, as rapid as possible and, in recent surveys, say they favour euthanasia. Yet euthanasia is illegal in France and in most other Western countries (with the exception of the Benelux nations). Palliative care ensures dignity in death, without anxiety of suffering, and is expanding rapidly in France. Léonetti's law of 22 April 2005 ensures the protection of the weakest, who should never be considered unworthy of life, yet is poorly known to the public and even to physicians. It now needs to be applied in practice.

  15. "Franklin: Science, Politics and France"

    Science.gov (United States)

    McClellan, James E., III

    2003-04-01

    This presentation traces Benjamin Franklin's career as a "civic scientist" in Old-Regime France. It outlines the initial - and not always positive - reception of Franklin's work on electricity by the community of French scientists in the 1750s. It sketches Franklin's subsequent elevation into the pantheon of French Enlightenment heros, and it details his work as a "civic scientist" while American envoy to France in the 1770s and 1780s, notably his service on the government-sponsored commissions that repudiated the scientific and medical claims of Franz Anton Mesmer. This presentation concludes by examining a few features of Franklin's career that are not completely congruent with our notion of what a "civic scientist" might be, a contrast that is intended to illuminate both Franklin and the concept of "civic scientist."

  16. Crystal structure of 4,5-bis-(3,4,5-tri-meth-oxy-phen-yl)-2H-1,2,3-triazole methanol monosolvate.

    Science.gov (United States)

    Madadi, Nikhil Reddy; Penthala, Narsimha Reddy; Bommagani, Shobanbabu; Parkin, Sean; Crooks, Peter A

    2014-10-01

    The title compound, C20H23N3O6·CH3OH, was synthesized by [3 + 2] cyclo-addition of (Z)-2,3-bis-(3,4,5-tri-meth-oxy-phen-yl)acrylo-nitrile with sodium azide and ammonium chloride in DMF/water. The central nitro-gen of the triazole ring is protonated. The dihedral angles between the triazole ring and the 3,4,5-tri-meth-oxy-phenyl ring planes are 34.31 (4) and 45.03 (5)°, while that between the 3,4,5-tri-meth-oxy-phenyl rings is 51.87 (5)°. In the crystal, the mol-ecules, along with two methanol solvent mol-ecules are linked into an R (4) 4(10) centrosymmetric dimer by N-H⋯O and O-H⋯N hydrogen bonds.

  17. Mickaël Bertrand (dir., La déportation pour motif d’homosexualité en France. Débats d’histoire et enjeux de mémoire, Dijon, Mémoire active, 2011, 176 p.

    Directory of Open Access Journals (Sweden)

    Isabelle Ernot

    2011-11-01

    Full Text Available Issu d’un colloque organisé à Dijon en 2007 sous l’impulsion de Mickaël Bertrand, l’ouvrage constitue une mise au point sur la question de la déportation pour motif d’homosexualité en France durant la Seconde Guerre mondiale. Cette rencontre scientifique s’inscrit dans le sillage de deux autres organisées à Lyon en 2005 et Angers en 2006. L’ouvrage présente quatre contributions dues à Mickaël Bertrand, Florence Tamagne, Arnaud Boulligny, Marc Boninchi et deux postfaces. La première est de Jea...

  18. [Epidemiology of burns in France].

    Science.gov (United States)

    Latarjet, Jacques; Ravat, François

    2012-01-01

    As with most traumas, the epidemiology of the "burn" health-event has long been neglected by public health doctors and rarely considered by burns specialists. There were therefore few verified data and many approximations and preconceived ideas. The gathering of information recently undertaken in France enables the reliability of the data to be improved and the diagnostic and demographic elements relating to hospitalised patients with burns to be established.

  19. THE ADMINISTRATIVE SYSTEM IN FRANCE

    OpenAIRE

    2012-01-01

    According to the Constitution promulgated on the 6th of October 1958, with the latest amendments made in 1999, France is a presidential republic. The three authority branches are broadly represented in the French administration: the judicial branch – French courts of law are divided into: judicial courts and administrative courts. Judicial courts are under the supreme authority of the Court of Cassation with jurisdiction to cancel judgments passed courts on inferior hierarchy levels and plays...

  20. Coordination chemistry and applications of versatile 4,5-diazafluorene derivatives.

    Science.gov (United States)

    Annibale, Vincent T; Song, Datong

    2016-01-01

    This perspective review will examine the coordination chemistry and applications of metal complexes of 4,5-diazafluorene derivatives. The versatile derivatives of 4,5-diazafluorene can serve multiple roles, and display a number of coordination modes. The ambidentate derivatives with multiple coordination sites can allow for the syntheses of coordination polymers, multimetallic, and macrocyclic complexes. In addition, certain 4,5-diazafluorene derivatives can serve as spectator ligands to support reactivity at the metal centre, or as reactive actor ligands engaging in atypical reactivity patterns. The applications of metal complexes of 4,5-diazafluorene derivatives in catalysis, photochemistry and photophysics, as well as in bioinorganic chemistry are also surveyed.

  1. Determination of inositol 1,4,5-trisphosphate levels in Dictyostelium by isotope dilution assay

    Energy Technology Data Exchange (ETDEWEB)

    Van Haastert, P.J.

    1989-02-15

    A commercial isotope dilution assay was used for the determination of Ins(1,4,5)P3 levels in the microorganism Dictyostelium discoideum. Cross-reactivity in the assay was detected with extracts from cells and the medium. The compound which induced this cross-reactivity was tentatively identified as Ins(1,4,5)P3 by (i) codegradation with authentic (/sup 32/P)Ins(1,4,5)P3 by three specific Ins(1,4,5)P3 phosphatases, and (ii) co-chromatography with authentic (/sup 32/P)Ins(1,4,5)P3 on HPLC columns. The cellular concentration was estimated as 165 +/- 42 pmol/10(8) cells, yielding a mean intracellular Ins(1,4,5)P3 concentration of 3.3 microM. Dictyostelium cells secrete large amounts of Ins(1,4,5)P3 at a rate of about 10% of the cellular content per minute, yielding about 0.13 microM extracellular Ins(1,4,5)P3 after 15 min in a suspension of 10(8) cells/ml. The chemoattractant cAMP induced a transient increase of the Ins(1,4,5)P3 concentration; the data suggest an intracacellular rise from 3.3 to 5.5 microM with a maximum at 6 s after stimulation.

  2. Foreign driving licences in France

    CERN Multimedia

    HR Department

    2009-01-01

    The following information is subject to possible amendments decided by the competent French authorities. Those wishing to undertake the necessary steps with the prefectural services of the Departments of the Ain and Haute-Savoie may obtain information by calling the following numbers: + 33 4 74 32 30 65 for the Ain and + 33 4 50 33 60 00 for Haute-Savoie. 1. PERSONS RESIDING IN FRANCE 1.1 Driving licences issued by a State belonging to the EU or the EEA a) Recognition on French territory All currently valid driving licences issued by States belonging to the European Union (EU) or to the European Economic Area (EEA) are generally valid for driving on French territory. However, if the licence was originally obtained in exchange for a licence issued by a State not belonging to the EU or to the EEA and with which France has not concluded a reciprocity agreement, it will be recognised for a maximum of one year following the date of establishment of normal residence in France ...

  3. FOREIGN DRIVING LICENCES IN FRANCE

    CERN Document Server

    DSU Unit

    2008-01-01

    The following information is provided subject to possible amendments decided by the competent French authorities. Those wishing to undertake the necessary steps with the prefectural services of the Departments of Ain and Haute-Savoie may obtain information by calling the following numbers: + 33 474 32 30 65 for Ain and + 33 450 33 60 00 for Haute-Savoie. 1. PEOPLE RESIDING IN FRANCE 1.1 Driving licences issued by a state belonging to the EU or the EEA a) Recognition on French territory All currently valid driving licences issued by States belonging to the European Union (EU) or to the European Economic Area (EEA) are generally valid for driving on French territory. However, if the licence was originally obtained in exchange for a licence issued by a State not belonging to the EU or to the EEA with which France has not concluded a reciprocity agreement, it is recognised only up to one year following the date of establishment of normal residence in France (date of the first special residence permit issu...

  4. Structural studies of transition metal complexes with 4,5-bis(2-pyridylmethylsulfanyl)-4',5'-ethylenedithiotetrathiafulvalene: probing their potential for the construction of multifunctional molecular assemblies.

    Science.gov (United States)

    Liu, Shi-Xia; Dolder, Stefan; Franz, Patrick; Neels, Antonia; Stoeckli-Evans, Helen; Decurtins, Silvio

    2003-08-11

    Three divalent transition metal complexes of 4,5-bis(2-pyridylmethylsulfanyl)-4',5'-ethylenedithiotetrathiafulvalene have been prepared and crystallographically characterized. The isostructural Co(II) and the Ni(II) complexes show octahedral geometries around the metal ions with the coordination sites occupied by the pyridyl nitrogen atoms and the thioether sulfur atoms of the ligand and cis coordination of the halide ions. Cyclic voltammetry reveals that the complexation leads to a small anodic shift in the first oxidation potential of the TTF system.

  5. Directed solid-phase synthesis of trisubstituted imidazo[4,5-c]pyridines and imidazo[4,5-b]pyridines.

    Science.gov (United States)

    Lemrová, Barbora; Smyslová, Petra; Popa, Igor; Oždian, Tomáš; Zajdel, Pawel; Soural, Miroslav

    2014-10-13

    An efficient method is described for the solid-supported synthesis of imidazo[4,5-b]pyridines and imidazo[4,5-c]pyridines from 2,4-dichloro-3-nitropyridine. The key pyridine building block was reacted with polymer-supported amines, followed by replacement of the second chlorine with amines, nitro group reduction, and imidazole ring closure with aldehydes. Depending on the combination of polymer-supported and solution-phase reagents, the strategy allowed for the simple preparation of the target trisubstituted derivatives with variable positioning of the pyridine nitrogen atom. Additionally, after a slight modification of the method, the preparation of strictly isomeric imidazopyridines was possible.

  6. Outbreak of Achromobacter xylosoxidans and Ochrobactrum anthropi Infections after Prostate Biopsies, France, 2014

    Science.gov (United States)

    Cassier, Pierre; Dananché, Cédric; Hulin, Monique; Dauwalder, Olivier; Rouvière, Olivier; Bertrand, Xavier; Perraud, Michel; Bénet, Thomas; Vanhems, Philippe

    2016-01-01

    We report an outbreak of healthcare-associated prostatitis involving rare environmental pathogens in immunocompetent patients undergoing transrectal prostate biopsies at Hôpital Édouard Herriot (Lyon, France) during August 13–October 10, 2014. Despite a fluoroquinolone-based prophylaxis, 5 patients were infected with Achromobacter xylosoxidans and 3 with Ochrobactrum anthropi, which has not been reported as pathogenic in nonimmunocompromised persons. All patients recovered fully. Analysis of the outbreak included case investigation, case–control study, biopsy procedure review, microbiologic testing of environmental and clinical samples, and retrospective review of hospital records for 4 years before the outbreak. The cases resulted from asepsis errors during preparation of materials for the biopsies. A low-level outbreak involving environmental bacteria was likely present for years, masked by antimicrobial drug prophylaxis and a low number of cases. Healthcare personnel should promptly report unusual pathogens in immunocompetent patients to infection control units, and guidelines should explicitly mention asepsis during materials preparation. PMID:27434277

  7. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  8. 3-Methyl-4,5,6,7-tetrahydro-1-benzothiophene-2-carboxylic Acid

    Directory of Open Access Journals (Sweden)

    Rajendiran Nagappan

    2010-01-01

    Full Text Available 3-Methyl-4,5,6,7-tetrahydro-1-benzothiophene-2-carboxylic acid was synthesized chemoselectively from 3-formyl-4,5,6,7-tetrahydro-1-benzothiophene-2-carboxylic acid, using Et3SiH/I2 as a reducing agent. The title compound was characterized by IR, 1H NMR, 13C NMR and LCMS.

  9. Early Number and Arithmetic Performance of Ecuadorian 4-5-Year-Olds

    Science.gov (United States)

    Bojorque, Gina; Torbeyns, Joke; Moscoso, Jheni; Van Nijlen, Daniël; Verschaffel, Lieven

    2015-01-01

    This study aimed at (a) constructing a reliable and valid test to assess Ecuadorian 4-5-year olds' number and arithmetic skills; (b) providing empirical data on Ecuadorian 4-5-year olds' number and arithmetic skills; and (c) confronting these children's actual performances with the performances expected by national experts in this domain. We…

  10. Unprecedentedly mild direct Pd-catalyzed arylation of oxazolo[4,5-b]pyridine

    DEFF Research Database (Denmark)

    Zhuravlev, Fedor

    2006-01-01

    Pd-catalyzed C-2 arylation of oxazolo[4,5-b]pyridine proceeds efficiently at 30 degrees C and tolerates a variety of aryl halides, including derivatized amino acids for which no racemization was observed during the reaction. Experimental evidence for facile deprotonation of oxazolo[4,5-b]pyridine...

  11. Energy statistics France - June 2008; Statistiques energetiques France - juin 2008

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2008-07-01

    This document summarizes in a series of tables and graphics the energy statistics for France for the last decades and up to 2007: resources, uses, prices, net imports and domestic market consumption for petroleum, natural gas, electricity, and solid mineral fuels (coal, lignite, coke). 2007 statistics are presented separately for each energy source (availability, uses). The evolution of the domestic energy production and consumption and the end-use consumption per sector is also summarized for the last decades. Some primary consumption forecasts are given for 2030. (J.S.)

  12. Analysis of data mining classification by comparison of C4.5 and ID algorithms

    Science.gov (United States)

    Sudrajat, R.; Irianingsih, I.; Krisnawan, D.

    2017-01-01

    The rapid development of information technology, triggered by the intensive use of information technology. For example, data mining widely used in investment. Many techniques that can be used assisting in investment, the method that used for classification is decision tree. Decision tree has a variety of algorithms, such as C4.5 and ID3. Both algorithms can generate different models for similar data sets and different accuracy. C4.5 and ID3 algorithms with discrete data provide accuracy are 87.16% and 99.83% and C4.5 algorithm with numerical data is 89.69%. C4.5 and ID3 algorithms with discrete data provides 520 and 598 customers and C4.5 algorithm with numerical data is 546 customers. From the analysis of the both algorithm it can classified quite well because error rate less than 15%.

  13. Phenanthro[4,5-fgh]quinoxaline-Fused Subphthalocyanines: Synthesis, Structure, and Spectroscopic Characterization.

    Science.gov (United States)

    Pan, Houhe; Liu, Wenbo; Wang, Chiming; Wang, Kang; Jiang, Jianzhuang

    2016-07-01

    A series of four phenanthro[4,5-fgh]quinoxaline-fused subphthalocyanine derivatives 0-3 containing zero, one, two, and three phenanthro[4,5-fgh]quinoxaline moieties, respectively, were isolated from the mixed cyclotrimerization reaction of 2,9-di-tert-butylphenanthro[4,5-fgh]quinoxaline-5,6-dicarbonitrile with 4,5-bis(2,6-diisopropylphenoxy)phthalonitrile and characterized by a series of spectroscopic methods including MALDI-TOF mass, (1) H NMR, electronic absorption, magnetic circular dichroism (MCD), and fluorescence spectroscopy. The molecular structures for the compounds 0 and 2 were clearly revealed on the basis of single-crystal X-ray diffraction analysis. Their electrochemical properties were also studied by cyclic voltammetry. In particular, theoretical calculations in combination with the electronic absorption and electrochemical analyses revealed the significant influence of the fused-phenanthro[4,5-fgh]quinoxaline units on the electronic structures.

  14. [Raoultella planticola, a new strain degrading 2,4,5-trichlorophenoxyacetic acid].

    Science.gov (United States)

    Zharikova, N V; Markusheva, T V; Galkin, E G; Korobov, V V; Zhurenko, E Iu; Sitdikova, L R; Kolganova, T V; Kuznetsov, B B; Turova, T P

    2006-01-01

    A new strain that degrades the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) was isolated from soil, which was exposed to factors related to the petrochemical industry. According to its physiological, biochemical, cultural, and morphological traits, together with the sequence of the 16S rRNA gene, the strain was identified as Raoultella planticola 33-4ch. The strain could consume 2,4,5-T as a sole source of carbon and energy. The amount of 2,4,5-T in the culture medium decreased by 51% after five days of incubation. Raoultella planticola 33-4ch consumes 2,4,5-T to produce 4-chlorophenoxyacetic, phenoxyacetic, and 3-methyl-2,6-dioxo-4-hexenoic acids.

  15. Events - France. Stock exchange. International; Actualite - France. Bourse. International

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2000-10-01

    These columns made of short articles report on facts and events in the oil and gas industry in France and worldwide: 1 - France: increase of the production capacity of the ethylene oxide unit of BP's Lavera plant; the 'Plateaux-du-Vexin' gas pipeline crosses the Seine river; completion of the pumping of the front wreckage of the Erika tanker ship; Total inaugurates a vapor recovery unit at the Gonfreville l'Orcher refinery; a national energy saving plan for the abatement of the greenhouse effect; Sercel, a daughter company of Compagnie Generale de Geophysique (CGG), acquires Mark Products division of Shaw industries; the oil prices shoot the international trade; 2 - stock exchange: trend of market values in the context of oil crisis; 3 - international: important oil and gas strike made by TotalFinaElf and OKIOC (Offshore Kazakhstan International Operating Company) in Kazakhstan; communication: a new look for BP; status of Lukoil reserves in Russia; next round for the exploration of the Norwegian North Sea; Transocean Sedco Forex absorbs R and B Falcon Corp and becomes the first drilling contractor; ENI (Italy) becomes operator on the development of South Pars gas field (Iran) for the phases 4 and 5; Shell Overseas Investments BV, BP and Exxon Mobil have signed strategic alliance agreements with China Petroleum and Chemical Corp (Sinopec); first exploration permits for the Faeroe islands; different gas pricing rules for the industrialists in the different European countries. (J.S.)

  16. Studying in France,Serving at Home

    Institute of Scientific and Technical Information of China (English)

    1997-01-01

    DEAR EDITOR, I am a 75-year-old retired primary school teacher. I published my new work The Work-Study Movement of Young Chinese in France (1912-1930) three years ago, expressing my fondness of history, especially China’s history. Currently, I pay more attention to the Chinese women who came to France for studies in their early years, Could you publish some precise information on their situations before and after returning to China? GABRIELLE REYGNER FRANCE

  17. [Health and politics in France].

    Science.gov (United States)

    Tabuteau, Didier

    2012-06-01

    Health is a dual notion. It is individual, singular and intimate. It is also collective, statistical and political. The modern problematic of health relies upon a balance of complex relations between individual and collective acceptances of the notion. You can try to outline the evolutions and the main concepts through a quadruple approach: health and politics, health and its professionals, health and society and in the end, health and the State. The relationships between health and politics in France are affected by the historical delay of France in public health, namely because of a structural weakness of the administrative organization of public health. Nevertheless France developed a dense and well organized care system and a universal social protection against the disease. The creation of the health professions in France was marked by a historical opposition between the doctors and the state which led to a failure of hygienist medicine and a fundamental misunderstanding on health insurance. Medical domination led to the organization of a system based on professional dichotomy and the delegation of the regulation skills to the health care professionals. The role of health issues in the French society was deeply renewed by the development of the medical and epidemiological knowledge. This resulted in a new political responsibility in the management of health risks but also in the confirmation of the patients' rights and the role of their associations in the health systems operations and the piloting of public policies. In this environment, the state has recently and progressively confirmed its dominating role in the health sector. A public hospital service was created In the 60's and 70's, then in the 80's there were recurrent interventions in order to control health spendings and eventually in the 90's health safety devices were set up. More recently, a process of health policies institutionalization confirmed this evolution. In the future, health issues should

  18. CRAC channel is inhibited by neomycin in a Ptdlns(4,5)P2-independent manner.

    Science.gov (United States)

    Huang, Kun; Wang, Xuemei; Liu, Yanjun; Zhao, Yi

    2015-03-01

    Depletion of intracellular Ca(2+) stores evokes store-operated Ca(2+) entry through the Ca(2+) release-activated Ca(2+) (CRAC) channels. In this study, we found that the store-operated Ca(2+) entry was inhibited by neomycin, an aminoglycoside that strongly binds phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Patch clamp recordings revealed that neomycin blocked the CRAC currents reconstituted by co-expression of Orai1 and Stim1 in HEK293 cells. Using a rapamycin-inducible PtdIns(4,5)P2-specific phosphatase (Inp54p) system to manipulate the PtdIns(4,5)P2 in the plasma membrane, we found that the CRAC current was not altered by PtdIns(4,5)P2 depletion. This result suggests that PtdIns(4,5)P2 is not required for CRAC channel activity, and thereby, neomycin inhibits CRAC channels in a manner that is independent of neomycin-PtdIns(4,5)P2 binding.

  19. Emerging roles of PtdIns(4,5)P2--beyond the plasma membrane.

    Science.gov (United States)

    Tan, Xiaojun; Thapa, Narendra; Choi, Suyong; Anderson, Richard A

    2015-11-15

    Phosphoinositides are a collection of lipid messengers that regulate most subcellular processes. Amongst the seven phosphoinositide species, the roles for phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] at the plasma membrane, such as in endocytosis, exocytosis, actin polymerization and focal adhesion assembly, have been extensively studied. Recent studies have argued for the existence of PtdIns(4,5)P2 at multiple intracellular compartments, including the nucleus, endosomes, lysosomes, autolysosomes, autophagic precursor membranes, ER, mitochondria and the Golgi complex. Although the generation, regulation and functions of PtdIns(4,5)P2 are less well-defined in most other intracellular compartments, accumulating evidence demonstrates crucial roles for PtdIns(4,5)P2 in endolysosomal trafficking, endosomal recycling, as well as autophagosomal pathways, which are the focus of this Commentary. We summarize and discuss how phosphatidylinositol phosphate kinases, PtdIns(4,5)P2 and PtdIns(4,5)P2-effectors regulate these intracellular protein and membrane trafficking events.

  20. Smooth muscle length-dependent PI(4,5)P2 synthesis and paxillin tyrosine phosphorylation.

    Science.gov (United States)

    Sul, D; Baron, C B; Broome, R; Coburn, R F

    2001-07-01

    We studied effects of increasing the length of porcine trachealis muscle on 5.5 microM carbachol (CCh)-evoked phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] synthesis and other parameters of phosphatidylinositol (PI) turnover. PI(4,5)P2 resynthesis rates in muscle held at 1.0 optimal length (L(o)), measured over the first 6 min of CCh stimulation, were 140 +/- 12 and 227 +/- 14% of values found in muscle held at 0.5 L(o) and in free-floating muscle, respectively. Time-dependent changes in cellular masses of PI(4,5)P2, PI, and phosphatidic acid, and PI resynthesis rates, were also altered by the muscle length at which contraction occurred. In free-floating muscle, CCh did not evoke increases in tyrosine-phosphorylated paxillin (PTyr-paxillin), an index of beta1-integrin signaling; however, there were progressive increases in PTyr-paxillin in muscle held at 0.5 and 1.0 L(o) during contraction, which correlated with increases in PI(4,5)P2 synthesis rates. These data indicate that PI(4,5)P2 synthesis rates and other parameters of CCh-stimulated inositol phospholipid turnover are muscle length-dependent and provide evidence that supports the hypothesis that length-dependent beta1-integrin signals may exert control on CCh-activated PI(4,5)P2 synthesis.

  1. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits......A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  2. LPS-induced clustering of CD14 triggers generation of PI(4,5)P2.

    Science.gov (United States)

    Płóciennikowska, Agnieszka; Zdioruk, Mykola I; Traczyk, Gabriela; Świątkowska, Anna; Kwiatkowska, Katarzyna

    2015-11-15

    Bacterial lipopolysaccharide (LPS) induces strong pro-inflammatory reactions after sequential binding to CD14 protein and TLR4 receptor. Here, we show that CD14 controls generation of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] in response to LPS binding. In J774 cells and HEK293 cells expressing CD14 exposed to 10-100 ng/ml LPS, the level of PI(4,5)P2 rose in a biphasic manner with peaks at 5-10 min and 60 min. After 5-10 min of LPS stimulation, CD14 underwent prominent clustering in the plasma membrane, accompanied by accumulation of PI(4,5)P2 and type-I phosphatidylinositol 4-phosphate 5-kinase (PIP5K) isoforms Iα and Iγ (encoded by Pip5k1a and Pip5k1c, respectively) in the CD14 region. Clustering of CD14 with antibodies, without LPS and TLR4 participation, was sufficient to trigger PI(4,5)P2 elevation. The newly generated PI(4,5)P2 accumulated in rafts, which also accommodated CD14 and a large portion of PIP5K Iα and PIP5K Iγ. Silencing of PIP5K Iα and PIP5K Iγ, or application of drugs interfering with PI(4,5)P2 synthesis and availability, abolished the LPS-induced PI(4,5)P2 elevation and inhibited downstream pro-inflammatory reactions. Taken together, these data indicate that LPS induces clustering of CD14, which triggers PI(4,5)P2 generation in rafts that is required for maximal pro-inflammatory signaling of TLR4.

  3. Property study of poly nitro compounds of cis-syn-cis-2, 6-dioxodecahydro-lH, 5H-diimidazo [4, 5-b: 4', 5'-e] pyrazine

    Science.gov (United States)

    Liu, Yang; Xu, Zhibin; Xu, Yudong; Xu, Liang; Meng, Zihui

    2017-03-01

    Poly nitro group substituted cis-syn-cis-2, 6-dioxodecahydro-lH, 5H-diimidazo [4, 5-b: 4', 5'-e] pyrazine derivatives are synthesized by modified method and adequately characterized. All compounds have good performance both in density (ρ> 1.85 g/cm3) and high detonation velocity (vD > 8800 m/s, calculated). Some representative compounds, for example, 4 (vD: 9405 ms-1; P: 41.6 GPa) and 5 (vD:9781 ms-1; P: 45.6 GPa) exhibit excellent detonation performances, which are comparable with current energetic compounds such as RDX (vD: 8724 ms-1; P: 35.2 GPa) and HMX (vD:9059 ms-1; P: 39.2 GPa). Considering the sensitivity increasing with the number of nitro group, two componds with tetranitro groups (2 and 3) are worthy of deep research.

  4. Syntheses and crystal structures of two ionic liquids with halogen-bonding groups: 4,5-dibromo- and 4,5-diiodo-1-butyl-3-methylimidazolium trifluoromethanesulfonates

    Science.gov (United States)

    Mukai, Tomohiro; Nishikawa, Keiko

    2010-05-01

    We have prepared and characterized two novel Lewis acidic ionic liquids, 4,5-dibromo- and 4,5-diiodo-1-butyl-3-methylimidazolium trifluoromethanesulfonates, using differential scanning calorimetry and single-crystal X-ray analysis. The effect of the halogen species on the phase transition behaviour and the cation-anion interacting geometry was investigated. The minor difference in chemical structure strongly affects the melting point, glass transition temperature and crystal structure because of the different halogen-bonding strength and linearity between C-Br⋯O and C-I⋯O. Both the salts melt above room temperature, but the fused salts show glass-forming property and poor crystallizability.

  5. The public safety and Gaz de France; La securite du public et Gaz de France

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    In the framework of its utilities missions, Gaz de France has to assure the public safety and the continuity of the gas supply chain. To avoid accidents and help victims of accidents, Gas de France implemented a system of financial assistance but also a preventive action to verify the installations. The first part of the document presents the liabilities of Gas de France, the second part deals with the voluntarist approach of Gas de france towards the public safety. (A.L.B.)

  6. Synthesis of [4,5-[sup 3]H-Leu[sup 4

    Energy Technology Data Exchange (ETDEWEB)

    Birtle, T.; White, A.J.; Woodhouse, D.P. (Cambridge Research Biochemicals, Billingham (United Kingdom))

    1994-04-01

    The synthesis of salmon calcitonin, a C-terminal amide dotriacontapeptide, labelled with tritium in the leucine residue at position 4 to a specific activity of 100Ci mmole[sup -1] is described. The peptide was assembled using the Fmoc-Polyamide solid-phase synthesis strategy incorporating tritium labelled leucine, in the form of Fmoc-4,5-[sup 3]H-leucine-pentafluorophenylester, at the appropriate stage. The Fmoc-4,5-[sup 3]H-leucine-pentafluorophenylester was prepared via a multistage synthesis from 4,5-dehydroleucine. (Author).

  7. Density functional study on ionic liquid of 1-propyl-4,5-dibromo-3-methylimidazolium bromide

    Science.gov (United States)

    Lü, Renqing; Wang, Shutao; Lu, Yukun

    2011-03-01

    The density functional method and DNP basis set were employed to study 1-pair, 2-pair, and 3-pair of cation-anion interactions of 1-propyl-4,5-dibromo-3-methylimidazolium bromides. The calculated results reveal that H 2 atoms of 1-propyl-4,5-dibromo-3-methylimidazolium form hydrogen bondings with Br -. The natural bond orbital (NBO) and atoms in molecules (AIM) analyzes show that halogen bondings between Br - anion and imidazolium ring substituted bromine atoms were formed in the gas phase, in agreement with the crystal phase of 1-propyl-4,5-dibromo-3-methylimidazolium bromide which is governed by both hydrogen bondings and halogen bondings.

  8. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  9. Quantitative uranium speciation with U M{sub 4,5}-edge HERFD absorption spectra

    Energy Technology Data Exchange (ETDEWEB)

    Kvashnina, Kristina O.; Rossberg, Andre [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Molecular Structures

    2017-06-01

    This report gives a brief description of the quantitative uranium speciation performed by iterative transformation factor analysis (ITFA) of High Energy Resolution X-ray Fluorescence Detection (HERFD) data collected at the M{sub 4,5} edge.

  10. Antibacterial activity of synthesized 2,4,5-trisubstituted imidazole derivatives

    Digital Repository Service at National Institute of Oceanography (India)

    Khan, M.S.; Siddiqui, S.A.; Siddiqui, M.S.R.A.; Goswami, U.; Srinivasan, K.V.; Khan, M.I.

    Some novel chemically synthesized 2,4,5-trisubstituted imidazoles from aryl aldehydes and 1,2-diketones or a-hydroxyketone were screened against eight different human pathogenic bacteria and fungi. Seven compounds were found to be active against...

  11. Calcium Directly Regulates Phosphatidylinositol 4,5-Bisphosphate Headgroup Conformation and Recognition

    DEFF Research Database (Denmark)

    Bilkova, Eva; Pleskot, Roman; Rissanen, Sami

    2017-01-01

    The orchestrated recognition of phosphoinositides and concomitant intracellular release of Ca2+ is pivotal to almost every aspect of cellular processes, including membrane homeostasis, cell division and growth, vesicle trafficking, as well as secretion. Although Ca2+ is known to directly impact...... phosphoinositide clustering, little is known about the molecular basis for this or its significance in cellular signaling. Here, we study the direct interaction of Ca2+ with phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2), the main lipid marker of the plasma membrane. Electrokinetic potential measurements of PI......(4,5)P2 containing liposomes reveal that Ca2+ as well as Mg2+ reduce the zeta potential of liposomes to nearly background levels of pure phosphatidylcholine membranes. Strikingly, lipid recognition by the default PI(4,5)P2 lipid sensor, phospholipase C delta 1 pleckstrin homology domain (PLC δ1-PH...

  12. Investigation of the properties of 4,5-dialkylated N-heterocyclic carbenes

    DEFF Research Database (Denmark)

    Urban, S.; Tursky, Matyas; Frohlich, R.

    2009-01-01

    The investigation of the electronic and steric properties of 4,5-disubstituted imidazolylidenes is reported, as well as their successful application as organocatalysts in the formation of gamma-butyrolactones by conjugate Umpolung....

  13. SHG Materials Based on the AlPO4-5 Single Crystals

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Large AlPO4-5 molecular sieve single crystals with high optical quality were synthesized hydrothermally by using TPA as template. As-synthesized crystals were calcined under O2 atmosphere to remove the organic templates in the channels. Disperse-Red-1 (DR1) and p-nitroaniline (pNA) molecules have been successfully incorporated into the one-dimensional channels of AlPO4-5 single crystals respectively by means of vapor phase diffusion. XRD patterns reveal that the loading of organic molecules has not destroyed the structures of AlPO4-5 crystals. Polarizing microscope and SHG results indicate that the DR1 and pNA molecules are well aligned in a preferred direction along the crystal channels. The different polarization-dependence SH intensity shows that different SHG processes occur in the DR1- and pNA-loaded AlPO4-5 crystals.

  14. Facile construction of substituted pyrimido[4,5-d]pyrimidones by transformation of enaminouracil

    Directory of Open Access Journals (Sweden)

    Wafaa S. Hamama

    2013-03-01

    Full Text Available The reaction of 6-amino-1,3-dimethylpyrimidine-2,4(1H,3H-dione (1 as a binucleophile with primary aromatic or heterocyclic amines and formaldehyde or aromatic (heterocyclic aldehydes in a molar ratio (1:1:2 gave the pyrimido[4,5-d]pyrimidin-2,4-dione ring systems 2–5. Treatment of 1 with diamines and formalin in molar ratio (2:1:4 gave the bis-pyrimido[4,5-d]pyrimidin-2,4-diones 6–8. Furthermore, substituted pyrimido[4,5-d]pyrimidin-2,4-diones with uracil derivative 11 or spiro indole 16 were synthesized. Synthesis of pyrimido[4,5-d]pyrimidin-2,4-diones with different substitution at C-5 and C-7 was achieved to give 13 and 18, respectively.

  15. Phosphatidylinositol 4,5-bisphosphate-dependent regulation of the output in lobster olfactory receptor neurons.

    Science.gov (United States)

    Bobkov, Yuriy V; Pezier, Adeline; Corey, Elizabeth A; Ache, Barry W

    2010-05-01

    Transient receptor potential (TRP) channels often play a role in sensory transduction, including chemosensory transduction. TRP channels, a common downstream target of phosphoinositide (PI) signaling, can be modulated by exogenous phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2], phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] and/or diacylglycerol (DAG). Lobster olfactory receptor neurons (ORNs) express a TRP-related, non-selective, calcium/magnesium-permeable, sodium/calcium-gated cation (SGC) channel. Here we report that PIs regulate the function of the calcium-activated form of the lobster channel. Sequestering of endogenous PI(4,5)P2, either with an anti-PI(4,5)P2 antibody or by electrostatic screening with polyvalent cations, blocks the channel. Exogenous PI(3,4,5)P3 activates the channel independently of intracellular sodium and/or calcium. Exogenous non-hydrolysable DAG analogs fail to change the gating parameters of the channel, suggesting the channel is insensitive to DAG. Electrophysiological recording from lobster ORNs in situ using a panel of pharmacological tools targeting the key components of both PI and DAG metabolism (phospholipase C, phosphoinositide 4-kinase and DAG kinase) extend these findings to the intact ORN. PI(4,5)P2 depletion suppresses both the odorant-evoked discharge and whole-cell current of the cells, and does so possibly independently of DAG production. Collectively, our results argue that PIs can regulate output in lobster ORNs, at least in part through their action on the lobster SGC channel.

  16. Map Reduce for DC4.5 and Ensemble Learning In Distributed Data Mining

    Directory of Open Access Journals (Sweden)

    E. Chandra

    2011-01-01

    Full Text Available MapReduce one of the distributed computing techniques is integrated with decision tree classifier C4.5 in the distributed environment and ensemble learning with its classifier. This paper proposes an algorithm to classify, predict data using MapReduce for DC4.5 with ensemble learning. Proposed algorithm increases the accuracy and scalability of the data. Noise handling in the decision trees with respect to the distributed data is also handled here.

  17. Synthesis and evaluation of antitumor activity ofsome thiazolo[4,5-b]pyridines

    Directory of Open Access Journals (Sweden)

    Ogurtsov V. V.

    2012-09-01

    Full Text Available Aim. To synthesize a series of novel 3H-thiazolo[4,5-b]pyridine-2-ones by structural modification of the core heterocycle in its N3- and N6-positions and to evaluate their anticancer activity in vitro on several tumor cell lines. Methods. Organic synthesis, 1H-NMR spectroscopy, trypan blue cell viability assay. Results. A new convenient synthetic approach was developed and optimized conditions were studied for the reaction of preparation of 3H- thiazolo[4,5-b]pyridin-2-one derivatives. 5,7-Dimethyl-3H-thiazolo[4,5-b]pyridin-2-one and 6-phenylazo-5,7- dimethyl-3H-thiazolo[4,5-b]pyridin-2-one were obtained by [3 + 3]cyclocondensation of 4-iminothiazolidone- 2 with acetylacetone and phenylazoacetylacetone in methanol medium in the presence of sodium methylate. They were used as starting compounds for further structural modification of the core thiazolo[4,5-b]pyridine heterocycle in its 3- and 6-positions. On the basis of in vitro cytotoxicity studies of synthesized compounds several structure-functional relationships underlying anticancer potential of 5,7-dimethyl-3H-thiazolo[4,5-b]pyridin- 2-one derivatives were identified. Conclusions. 3H-thiazolo[4,5-b]pyridin-2-one can be considered as a promising molecular scaffold for rational design of potential anticancer drug candidates. Introduction of phenylazo substitute at C6-position of 3H-thiazolo[4,5-b]pyridin-2-one proved to be the most efficient, as it led to 3-fold increase of its anticancer potential.

  18. Interactions between Rab and Arf GTPases regulate endosomal phosphatidylinositol-4,5-bisphosphate during endocytic recycling.

    Science.gov (United States)

    Shi, Anbing; Grant, Barth D

    2013-01-01

    After endocytosis, a selective endocytic recycling process returns many endocytosed molecules back to the plasma membrane. The RAB-10/Rab10 GTPase is known to be a key recycling regulator for specific cargo molecules. New evidence, focused on C. elegans RAB-10 in polarized epithelia, points to a key role of RAB-10 in the regulation of endosomal phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2) levels. In turn, PI(4,5)P2 levels strongly influence the recruitment of many peripheral membrane proteins, including those important for vesicle budding through their membrane bending activities. Part of the effect of RAB-10 on endosomal PI(4,5)P2 is through its newly identified effector CNT-1, a predicted GTPase activating protein (GAP) of the small GTPase ARF-6/Arf6. In mammals PI(4,5)P2 generating enzymes are known Arf6 effectors. In C. elegans we found that RAB-10, CNT-1 and ARF-6 are present on the same endosomes, that RAB-10 recruits CNT-1 to endosomes, and that loss of CNT-1 or RAB-10 leads to overaccumulation of endosomal PI(4,5)P2, presumably via hyperactivation of endosomal ARF-6. In turn this leads to over-recruitment of PI(4,5)P2-dependent membrane-bending proteins RME-1/Ehd and SDPN-1/Syndapin/PACSIN. Conversely, in arf-6 mutants, endosomal PI(4,5)P2 levels were reduced and endosomal recruitment of RME-1 and SDPN-1 failed. This work makes an unexpected link between distinct classes of small GTPases that control endocytic recycling, and provides insight into how this interaction affects endosome function at the level of lipid phosphorylation.

  19. Inositol 1,3,4,5-tetrakisphosphate as a mediator of neuronal death in ischemic hippocampus.

    Science.gov (United States)

    Tsubokawa, H; Oguro, K; Robinson, H P; Masuzawa, T; Rhee, T S; Takenawa, T; Kawai, N

    1994-03-01

    Selective death of CA1 pyramidal neurons after transient forebrain ischemia has attracted interest for its possible relation to the pathogenesis of memory deficits and dementia. Using whole cell patch-clamp recording from CA1 pyramidal neurons in hippocampal slices of gerbils after ischemia we studied the intracellular signaling mechanisms related to the phosphoinositide cycle. Intracellular application of an antibody against phosphatidylinositol 4,5-bisphosphate rescued ischemic neurons from stimulus-induced irreversible depolarization. Furthermore, application of inositol 1,3,4,5-tetrakisphosphate in normal cells caused an irreversible depolarization in response to synaptic input, which mimicked the deterioration of ischemic neurons. Depolarization of both ischemic and normal neurons in the presence of inositol 1,3,4,5-tetrakisphosphate was prevented by the addition of the Ca2+ chelator, 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetra-acetate. Application of antibody against inositol 1,4,5-triphosphate 3-kinase, which blocks formation of inositol 1,3,4,5-tetrakisphosphate, also protected against cell deterioration. Our results suggest that the vulnerability of hippocampal pyramidal neurons following ischemia is caused by a disturbed phosphoinositide cascade, with one metabolite, inositol 1,3,4,5-tetrakisphosphate, playing a key role in the induction of Ca2+ accumulation, which leads to neuronal death.

  20. Analysis and risk assessment of 4(5)-methylimidazole in brown colored foods and beverages.

    Science.gov (United States)

    Lee, Sumin; Lee, Kwang-Geun

    2016-01-01

    In this study, the 4(5)-methylimidazole (4(5)-MI) levels in various 144 brown coloured foods and beverages were determined. The brown coloured foods and beverages were 62 processed sauces, 40 coffee, 9 caramel syrups, 18 red ginseng juice and 15 Japanese apricot fruit juice. The amount of 4(5)-MI in brewed coffee (1821.3 ng/g) was the highest level among the samples. The 4(5)-MI concentration in processed sauce (47.6 ng/g) was the lowest level among the samples. The levels of 4(5)-MI in various samples were found as follows: 47.6-1748.5 ng/g in processed sauces, 64.1-1821.3 ng/g in commercial coffee, 115.5-491.9 ng/g in caramel syrups, 91.0-854.1 ng/g in red ginseng juice and 137.6-587.4 ng/g in Japanese apricot fruit juice. Based on the 4(5)-MI levels, the estimated daily intake (EDI) and chronic daily intake (CDI) were calculated. EDI and CDI of red ginseng juice was the highest among all samples, and they were 1618.6 and 1256.8 ng/kg bw/day, respectively.

  1. The elongation factor Spt4/5 regulates RNA polymerase II transcription through the nucleosome

    Science.gov (United States)

    Crickard, John B.; Lee, Jaehyoun; Lee, Tae-Hee

    2017-01-01

    Abstract RNA polymerase II (RNAPII) passes through the nucleosome in a coordinated manner, generating several intermediate nucleosomal states as it breaks and then reforms histone–DNA contacts ahead of and behind it, respectively. Several studies have defined transcription-induced nucleosome intermediates using only RNA Polymerase. However, RNAPII is decorated with elongation factors as it transcribes the genome. One such factor, Spt4/5, becomes an integral component of the elongation complex, making direct contact with the ‘jaws’ of RNAPII and nucleic acids in the transcription scaffold. We have characterized the effect of incorporating Spt4/5 into the elongation complex on transcription through the 601R nucleosome. Spt4/5 suppressed RNAPII pausing at the major H3/H4-induced arrest point, resulting in downstream re-positioning of RNAPII further into the nucleosome. Using a novel single molecule FRET system, we found that Spt4/5 affected the kinetics of DNA re-wrapping and stabilized a nucleosomal intermediate with partially unwrapped DNA behind RNAPII. Comparison of nucleosomes of different sequence polarities suggest that the strength of the DNA–histone interactions behind RNAPII specifies the Spt4/5 requirement. We propose that Spt4/5 may be important to coordinate the mechanical movement of RNAPII through the nucleosome with co-transcriptional chromatin modifications during transcription, which is affected by the strength of histone–DNA interactions. PMID:28379497

  2. One-pot Synthesis of 2-Nitro-4,5-dicyano-1H-imidazole

    Institute of Scientific and Technical Information of China (English)

    XU Cheng; BIFu-qiang; FAN Xue-zhong; LI Ji-zhen; WANG Bo-zhou; GE Zhong-xue; LIU Qing; ZHANG Guo-fang

    2011-01-01

    In the last few decades,nitroimidazoles have been investigated mostly due to their properties as antibiotics,radiosensitizers and anti-protozoans[1 -3].Recently these nitroimidazoles,such as 2,4-dinitroimidazole,1-methyl-2,4,5-trinitroimidazole and their energetic salts, have attracted renewed attention for their favorable explosive performance as well as improved safety characteristics[4,5].Because of the activity of cyano group,2-nitro-4,5-dicyano-1 H-imidazole (NDCI) could be used as an intermediate in the synthesis of novel energetic materials containing nitroimidazole moiety.NDCI has been synthesized by the procedure given by Yixin Lu and coworkers[6],where the diazotization reaction and the Sandmeyer reaction were separately achieved.NDCI was obtained by adding a solution of sodium nitrite to 2-diazo4,5-dicyanoimidazole which was generated by diazotization of 2-amino-4,5-dicyano-1H-imidazole ( ADCI ) with sodium nitrite in water-hydrochloric acid and collected by filtration.Dry 2-diazo-4,5-dicyanoimidazole was so sensitive to shock that its separation may cause explosion[7].

  3. Entre culture générale et enjeux des métiers d'ingénieur : la diversité des enseignements en sciences humaines et sociales à l'École Centrale de Lyon

    National Research Council Canada - National Science Library

    Hourcade, Nicolas

    2014-01-01

    ... l'École Centrale de Lyon, établissement formant des ingénieurs généralistes. Très limités au milieu des années 1990, les cours de SHS constituent aujourd'hui un aspect significatif de la formation...

  4. Baltic Factor in Russia-France Relations

    Directory of Open Access Journals (Sweden)

    Maltsev Leonid A.

    2016-12-01

    Full Text Available The article aims to identify the role of the Baltic factor in Russia-France relations. Despite the fact that the Baltic Sea region (BSR no longer plays an important role in Russia-France bilateral relations, the authors attach significance to analysing the dynamics and changes of the BSR role in European politics in the post- Napoleonic period. The authors compare the Russian and the July Monarchies (1830—1848 in the context of the current Vienna system of international relations. The article describes the role of the 1830—1831 uprising in Poland, which was an event of particular importance. The monarchies of the two countries had to take into account new social phenomena, which were more pronounced in France. After the suppression of the uprising in the Polish part of the Russian Empire, Polish emigrants residing in France became the stumbling block for the development of Russia- France relations. The article explores the role of P. de Barante, Ambassador of France to Russia and describes France and Russia’s trade and economic interests in the Baltic Sea region. The authors conclude that the specificity of Russia-France bilateral relations became more apparent during the First and Second World Wars. However, the Baltic factor has lost its relevance over time.

  5. Administrative and Judicial Cooperation in France

    NARCIS (Netherlands)

    Vervaele, J.A.E.

    2002-01-01

    There is very little knowledge in the Netherlands of how economic private law and public law are enforced in France. In France too, however, scant information can be gleaned. There is little if any contact in the university community between criminal law and administrative law, partly because crimin

  6. Natech disasters risk management in France

    OpenAIRE

    Vallée, Agnès

    2004-01-01

    International audience; France is subjected to several types of natural phenomena (floods, earthquake, landslides, storms, forest fires...) and to attacks potentially generated by human activities (industrial facilities, nuclear power plants, transportation of dangerous goods...). The natural and technological risks are managed in France, as regards prevention, protection, intervention, in order to limit their human and economic consequences. Furthermore, an industrial accident could be trigg...

  7. Arctic interests and policy of France

    OpenAIRE

    Yuri I. Rubinsky

    2016-01-01

    The author considers scientific, economic and political activities of France for the development and exploration of the Arctic, providing security there. Along with some other non-Arctic countries, France is not ready to accept such a situation when eight members of the Arctic Council solve Arctic problems on behalf of all mankind.

  8. Propuesta de KPIs para la evaluación de un Corredor Verde: tramo Madrid-Lyon del Corredor Mediterráneo

    OpenAIRE

    López Fraga, Miguel

    2014-01-01

    “Propuesta de KPIs para la evaluación de un Corredor Verde: tramo Madrid-Lyon del Corredor Mediterráneo” es un proyecto de fin de carrera de Ingeniería Industrial cuyo objetivo se enmarca dentro de la promoción del desarrollo logístico del transporte de mercancías europeo de una forma sostenible y respetuosa con el medio ambiente. Después de aclarar el concepto de corredor verde a través de la revisión del Plan de Acción Logística de la UE y establecer cinco características principales que...

  9. Superfund record of decision (EPA Region 9): Carson River Mercury Site, operable unit 1, Lyon, Storey and Churchill County, NV, March 30, 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-06-01

    The Record of Decision (ROD) presents the selected remedial action for Operable Unit 1 (OU-1) of the Carson River Mercury Site (CRMS) which is located in Lyon, Storey and Churchill Counties, Nevada. The selected remedy for the five residential yards is to excavate contaminated surface soil (estimated to go to a depth of approximately 2 feet below ground surface), dispose of the soil at the RCRA municipal landfill if the soils do not exceed the TCLP standards, and restore the excavated areas. If it is determined that all or part of the excavated soil exceeds the TCLP standards, then the excavated soil will either be treated and disposed of at a RCRA municipal landfill or disposed of at the RCRA hazardous waste landfill.

  10. Análise da contaminação fúngica em amostras de Cassia acutifolia Delile (sene) e Peumus boldus (Molina) Lyons (boldo-do-Chile) comercializadas na cidade de Campinas, Brasil Analysis of the fungal contamination in Cassia acutifolia Delile (sene) and Peumus boldus (Molina) Lyons (boldo-do-Chile) sold in Campinas, Brazil

    OpenAIRE

    Liliana O Rocha; Maria Magali S. R. Soares; Cristiana Leslie Corrêa

    2004-01-01

    A sociedade atual tem buscado a fitoterapia como um importante recurso terapêutico, sendo a avaliação da qualidade microbiológica destes produtos um requisito essencial, considerando a sua origem. Deste modo, o objetivo da pesquisa foi realizar a contagem e a identificação de fungos filamentosos em 20 amostras de folhas de Cassia acutifolia Delile (sene) e de Peumus boldus (Molina) Lyons (boldo-do-Chile) comercializadas em farmácias de manipulação e mercados da cidade de Campinas, Brasil, usa...

  11. Strain rate dependence of the tensile properties of V-(4--5%)Cr-(4--5%)Ti irradiated in EBR-II and HFBR

    Energy Technology Data Exchange (ETDEWEB)

    Zinkle, S.J.; Snead, L.L.; Robertson, J.P.; Rowcliffe, A.F. [Oak Ridge National Lab., TN (United States)

    1998-03-01

    Elevated temperature tensile tests performed on V-(405)Cr-(4-5)Ti indicate that the yield stress increases with increasing strain rate for irradiation and test temperatures near 200 C, and decreases with increasing strain rate for irradiation and test temperatures near 400 C. This observation is in qualitative agreement with the temperature-dependent strain rate effects observed on unirradiated specimens, and implies that some interstitial solute remains free to migrate in irradiated specimens. Additional strain rate data at different temperatures are needed.

  12. Post-war public housing in trouble: Papers presented at the Congress 'Post-war Public Housing in trouble', Delft, the Netherlands, October 4-5, 1984

    NARCIS (Netherlands)

    Prak, N.L.; Priemus, H.

    1985-01-01

    In a number of countries the social housing sector was given serious food for thought when some relatively new housing estates had to be demolished: Pruitt Igoe (St. Louis), Quarry Hills (Leeds), la Démocratie (Lyon), Linnaeusstraat (Leeuwarden, NL). The management of many other estates proves to be

  13. Post-war public housing in trouble: Papers presented at the Congress 'Post-war Public Housing in trouble', Delft, the Netherlands, October 4-5, 1984

    NARCIS (Netherlands)

    Prak, N.L.; Priemus, H.

    1985-01-01

    In a number of countries the social housing sector was given serious food for thought when some relatively new housing estates had to be demolished: Pruitt Igoe (St. Louis), Quarry Hills (Leeds), la Démocratie (Lyon), Linnaeusstraat (Leeuwarden, NL). The management of many other estates proves to be

  14. Sheep Feed and Scrapie, France

    Science.gov (United States)

    Philippe, Sandrine; Ducrot, Christian; Roy, Pascal; Remontet, Laurent; Jarrige, Nathalie

    2005-01-01

    Scrapie is a small ruminant, transmissible spongiform encephalopathy (TSE). Although in the past scrapie has not been considered a zoonosis, the emergence of bovine spongiform encephalopathy, transmissible to humans and experimentally to sheep, indicates that risk exists for small ruminant TSEs in humans. To identify the risk factors for introducing scrapie into sheep flocks, a case-control study was conducted in France from 1999 to 2000. Ninety-four case and 350 control flocks were matched by location and main breed. Three main hypotheses were tested: direct contact between flocks, indirect environmental contact, and foodborne risk. Statistical analysis was performed by using adjusted generalized linear models with the complementary log-log link function, considering flock size as an offset. A notable effect of using proprietary concentrates and milk replacers was observed. The risk was heterogeneous among feed factories. Contacts between flocks were not shown to be a risk factor. PMID:16102318

  15. THE ADMINISTRATIVE SYSTEM IN FRANCE

    Directory of Open Access Journals (Sweden)

    DOINA POPESCU

    2012-05-01

    Full Text Available According to the Constitution promulgated on the 6th of October 1958, with the latest amendments made in 1999, France is a presidential republic. The three authority branches are broadly represented in the French administration: the judicial branch – French courts of law are divided into: judicial courts and administrative courts. Judicial courts are under the supreme authority of the Court of Cassation with jurisdiction to cancel judgments passed courts on inferior hierarchy levels and plays a central role in the appropriate performance of the activity. The legislative body - normally, the legislation is voted by Parliament. French Parliament is comprised of two chambers: the National Assembly and the Senate. The National Assembly is elected for five years by way of direct universal voting. The Senate is elected by way of indirect universal voting by the electoral group. The election system is based on rules contained in the Election Code. The executive authority is divided between the President of the Republic and the Prime Minister. The President of the Republic makes the appointments for civil and military positions located at the highest state level. The Council of Ministers is responsible for appointing the positions of state councillors, prefect and public administration director. The central government is headed by the Prime Minister. Regional authorities – the regions are free territories administered by elected Councils. As far as the metropolitan part of France is concerned, there are 22 such territories, to which are added other four districts / counties which are located out of borders. The region’s Prefect represents the state and is empowered to deploy legal actions in order to protect the state’s best interest. County authorities – there are currently 96 de districts, to which four other territories located out of borders are added, as well as the territorial communities of Mayoutte and St-Pierre et Miquelon. There are

  16. Modified ibogaine fragments: synthesis and preliminary pharmacological characterization of 3-ethyl-5-phenyl-1,2,3,4,5, 6-hexahydroazepino[4,5-b]benzothiophenes.

    Science.gov (United States)

    Efange, S M; Mash, D C; Khare, A B; Ouyang, Q

    1998-11-05

    Five phenyl-substituted derivatives and analogues of 1,2,3,4,5, 6-hexahydroazepino[4,5-b]indole, 5, a major fragment of ibogaine (1), were synthesized and tested for binding to monoamine transporters, the NMDA receptor-coupled cation channel, and dopamine and opioid receptors. All five derivatives, 9 and 17a-d, displayed 8-10-fold higher affinity at the DA transporter than ibogaine and noribogaine (4). At the serotonin transporter, two compounds (9 and 17a) exhibited higher potency than ibogaine, while the rest had weaker binding affinities than the lead compound. In keeping with their structural similarity to ibogaine, all five compounds displayed weak to poor affinity for dopamine D1 and D2 receptors. However, two compounds, 17a,c, demonstrated moderate binding affinities at dopamine D3 receptors. All five compounds displayed weak to poor affinities for mu and kappa opioid receptors and for the NMDA receptor-coupled cation channel. Despite the qualitative differences, derivatives and analogues of 5may serve as useful substitutes for ibogaine.

  17. Interaction between an 8-methoxypyrimido[4',5':4,5] thieno (2,3-)quinoline-4(3H)one antitumour drug and deoxyribonucleic acid

    Indian Academy of Sciences (India)

    M Gopal; M S Shahabuddin; Sanjeev R Inamdar

    2002-12-01

    The interaction of 8-methoxypyrimido[4',5':4,5] thieno (2,3-)quinoline-4(3H)one (MPTQ) with DNA was studied by UV-Vis and fluorescenc'e spectrophotometry as well as by hydrodynamic methods. On binding to DNA, the absorption spectrum underwent bathochromic and hypochromic shifts and the fluorescence was quenched. Binding parameters, determined from spectrophotometric measurements by Scatchard analysis, indicated a binding constant of 3.56 × 106 M-1 for calf thymus DNA at ionic strength 0.01 M. Binding to the GC-rich DNA of Micrococcus lysodeikticus was stronger than the binding to calf thymus DNA at ionic strength 0.01 M. The MPTQ increased the viscosity of sonicated rod-like DNA fragments, producing a calculated length of 2.4 Å/bound MPTQ molecule. The binding of MPTQ to DNA increased the melting temperature by about 4°C. This research offers a new intercalation functional group to DNA targetted drug design.

  18. A novel DNA intercalator, butylamino-pyrimido[4',5':4,5]selenolo(2,3-b)quinoline, induces cell cycle arrest and apoptosis in leukemic cells.

    Science.gov (United States)

    Shahabuddin, M S; Nambiar, Mridula; Choudhary, Bibha; Advirao, Gopal M; Raghavan, Sathees C

    2010-02-01

    DNA intercalators are one of the most commonly used chemotherapeutic agents. Novel intercalating compounds of pyrimido[4',5':4,5]selenolo(2,3-b)quinoline series having a butylamino or piperazino group at fourth position (BPSQ and PPSQ, respectively) are studied. Our results showed that BPSQ induced cytotoxicity whereas PPSQ was cytostatic. The cytotoxicity induced by BPSQ was concentration- and time-dependent. Cell cycle analysis and tritiated thymidine assay revealed that BPSQ affects the cell cycle progression by arresting at S phase. The absence of p-histone H3 and reduction in the levels of PCNA in the cells treated with BPSQ further confirmed the cell cycle arrest. Further, annexin V staining, DNA fragmentation, nuclear condensation and changes in the expression levels of BCL2/BAD confirmed the activation of apoptosis. Activation of caspase 8 and lack of cleavage of caspase 9, caspase 3 and PARP suggest the possibility of BPSQ triggering extrinsic pathway for induction of apoptosis, which is discussed. Hence, we have identified a novel compound which would have clinical relevance in cancer chemotherapeutics.

  19. Compatibility study of trans-1,4,5,8-tetranitro-1,4,5,8-tetraazadecalin (TNAD) with some energetic components and inert materials.

    Science.gov (United States)

    Yan, Qi-Long; Xiao-Jiang, Li; La-Ying, Zhang; Ji-Zhen, Li; Hong-Li, Li; Zi-Ru, Liu

    2008-12-30

    The compatibility of trans-1,4,5,8-tetranitro-1,4,5,8-tetraazadecalin (TNAD) with some energetic components and inert materials of solid propellants was studied by using the pressure DSC method where, cyclotetramethylenetetranitroamine (HMX), cyclotrimethylenetrinitramine (RDX), 1,4-dinitropiperazine (DNP), 1.25/1-NC/NG mixture, lead 3-nitro-1,2,4-triazol-5-onate (NTO-Pb), aluminum powder (Al, particle size=13.6microm) and N-nitrodihydroxyethylaminedinitrate (DINA) were used as energetic components and polyethylene glycol (PEG), polyoxytetramethylene-co-oxyethylene (PET), addition product of hexamethylene diisocyanate and water (N-100), 2-nitrodianiline (2-NDPA), 1,3-dimethyl-1,3-diphenyl urea (C2), carbon black (C.B.), aluminum oxide (Al2O3), cupric 2,4-dihydroxy-benzoate (beta-Cu), cupric adipate (AD-Cu) and lead phthalate (phi-Pb) were used as inert materials. It was concluded that the binary systems of TNAD with NTO-Pb, RDX, PET and Al powder are compatible, and systems of TNAD with DINA and HMX are slightly sensitive, and with 2-NDPA, phi-Pb, beta-Cu, AD-Cu and Al2O3 are sensitive, and with PEG, N-100, C2 and C.B. are incompatible. The impact and friction sensitivity data of the TNAD and TNAD in combination with the other energetic materials under present study was also obtained, and there was no consequential affiliation between sensitivity and compatibility.

  20. Room-temperature fracture in V-(4-5)Cr-(4-5)Ti tensile specimens irradiated in Fusion-1 BOR-60 experiment

    Energy Technology Data Exchange (ETDEWEB)

    Gazda, J.; Meshii, M. [Northwestern Univ., Evanston, IL (United States); Tsai, H. [Argonne National Lab., IL (United States)

    1998-09-01

    Specimens of V-(4-5)Cr-(4-5)Ti alloys were irradiated to {approx}18 dpa at 320 C in the Fusion-1 capsule inserted into the BOR-60 reactor. Tensile tests at 23 C indicated dramatic yield strength increase (>300%), lack of work hardening, and minimal (<1%) total elongations. SEM analysis of fracture and side surfaces were conducted to determine reduction in are and the mode of fracture. The reduction of area was negligible. All but one specimen failed by a combination of ductile shear deformation and cleavage crack growth. Transgranular cleavage cracks were initiated by stress concentrations at the tips of the shear bands. In side-view observations, evidence was found of slip bands typically associated with dislocation channeling. No differences due to pre-irradiation heat treatment and heat-to-heat composition variations were detected. The only deviation from this behavior was found in V-4Cr-4Ti-B alloy, which failed in the grip portion by complete cleavage cracking.

  1. Synthesis of 4/5-deoxy-4/5-nucleobase derivatives of 3-O-methyl-D-chiro-inositol as potential antiviral agents.

    Science.gov (United States)

    Zhan, Tian-Rong; Ma, Yu-Dao; Fan, Pei-Hong; Ji, Mei; Lou, Hong-Xiang

    2006-10-01

    Using D-pinitol (= 3-O-methyl-D-chiro-inositol) as starting material, a concise synthesis of 4/5-deoxy-4/5-nucleobase derivatives 11-19 has been achieved. The key intermediate 9 was obtained in good yield via an epoxidation from mono-methanesulfonate of D-pinitol. The process of opening of the epoxide ring in 9 by nucleobases appeared to be regioselective in presence of 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU). All the synthesized carbocyclic nucleosides were assayed against several viruses and tumors such as HIV-1, HSV-1, and HSV-2, and lung and bladder cancer. However, only compounds 14b, 14a, 16a, 16b, and 19 showed mild inhibitory effect against human lung cancer cell lines (PG) with IC50 values ranging from 50 to 100 microM, and the other compounds did not exhibit any significant antiviral activity or cytotoxicity even at concentrations up to 200 microM.

  2. Analysis of Phosphatidylinositol 3,4,5-Trisphosphates of PTEN Expression on Mammalian Cells

    Directory of Open Access Journals (Sweden)

    Nusrat Jahan

    2013-09-01

    Full Text Available The goal of this study is to find an experimental condition which enables us to perform enzymatic studies on the cellular behavior of PTEN (phosphatase and tensine homolog through identification of molecular species of phosphatidylinositol 3,4,5- trisphosphates and their quantitative analysis in a mammalian cell line using mass spectrometry. We initially exployed a two-step extraction process using HCl for extraction of phosphatidylinositol 3,4,5-trisphosphates from two mammalian cell lines and further analyzed the extracted phosphatidylinositol 3,4,5-trisphosphates using tandem mass spectrometry for the identification of them. We finally quantified the concentration of phosphatidylinositol 3,4,5-trisphosphates using internal standard calibration. From these observation, we found that HEK 293-T cells is a good model to examine the enzymatic behavior of PTEN in a cell, and the minimum amount of phosphatidylinositol 3,4,5-trisphosphates is more than 50 pmol for quantification in a mass spectrometer. These results suggest that the well-optimized experimental conditions are required for the investigation of the cellular PTEN in terms of the catalytic mechanism and further for the detailed identification of cellular substrates

  3. Ultracool Field Brown Dwarf Candidates Selected at 4.5 microns

    CERN Document Server

    Eisenhardt, Peter R M; Stern, Daniel; Wright, Edward L; Ashby, Matthew L N; Brodwin, Mark; Brown, Michael J I; Bussmann, R S; Dey, Arjun; Ghez, A M; Glikman, Eilat; Gonzalez, Anthony H; Kirkpatrick, J Davy; Konopacky, Quinn; Mainzer, Amy; Vollbach, David; Wright, Shelley A

    2010-01-01

    We have identified a sample of cool field brown dwarf candidates using IRAC data from the Spitzer Deep, Wide-Field Survey (SDWFS). The candidates were selected from 400,000 SDWFS sources with [4.5] = 1.5 and [4.5] - [8.0] 70 pc. The reddest brown dwarf candidate (SDWFS J143356.62+351849.2) has [3.6] - [4.5]=2.24 and H - [4.5] > 5.7, redder than any published brown dwarf in these colors, and may be the first example of the elusive Y-dwarf spectral class. Models from Burrows et al. (2003) predict larger numbers of cool brown dwarfs should be found for a Chabrier (2003) mass function. Suppressing the model [4.5] flux by a factor of two, as indicated by previous work, brings the Burrows models and observations into reasonable agreement. The recently launc hed Wide-field Infrared Survey Explorer (WISE) will probe a volume ~40x larger and should find hundreds of brown dwarfs cooler than T7.

  4. CPAFFC Delegation Attends "Climate& Territories" Summit in France

    Institute of Scientific and Technical Information of China (English)

    Zuo; Fengqiang

    2015-01-01

    At the Climate and Territories world summit held in Lyon in July 2015,French President Francois Hollande applauded China’s commitment to reducing carbon intensity in the process of its economic growth.In his speech made after the"Mayor’s Round Table".Hollande said more than 40 countries had made promises

  5. Synthesis of N-Aryl-4,5,6,7-tetrahydroindoles

    Energy Technology Data Exchange (ETDEWEB)

    Lee, In Sook Han; Kwon, Min Jin; Lee, Chang Kiu [Kangwon National University, Chuncheon (Korea, Republic of)

    2012-01-15

    N-aryl-4,5,6,7-tetrahydroindoles were prepared in moderate to good yields from cyclohexane-1,3-dione in three steps. Indole, unlike pyrrole, undergoes electrophilic substitution at C-3. For example, a Vilsmeier reaction of indole gives 3-formylindole exclusively. On the other hand, the same reaction with pyrrole produces 2-formylpyrrole. If the introduction of a nucleophile at the C-2 of indole is desired, 4,5,6,7-tetrahydroindole should be employed as a starting material. An introduction of the substitution and a subsequent dehydrogenation of the tetrahydroindole should be carried out to complete the synthesis of the 2-substituted indole. For such purpose we previously reported the synthesis of 5-substituted 4,5,6,7-tetrahydroindoles from cyclohexanones with suitable substituents at 4-position of the cyclic ketone.

  6. Decreased plasma neurotrophin-4/5 levels in bipolar disorder patients in mania

    Directory of Open Access Journals (Sweden)

    Izabela G. Barbosa

    2014-12-01

    Full Text Available Objective: To evaluate two poorly explored neurotrophins (NT, NT-3 and NT-4/5, in bipolar disorder (BD. Methods: Forty patients with type I BD (18 in remission and 22 in mania and 25 healthy controls matched for age, gender, and educational attainment were enrolled in this study. All subjects were assessed by the Mini-International Neuropsychiatric Interview; the Young Mania Rating Scale and the Hamilton Depression Rating Scale were used to evaluate severity of symptoms in BD patients. Plasma levels of NT-3 and NT-4/5 were measured by enzyme-linked immunosorbent assay (ELISA. Results: BD patients in mania presented decreased NT-4/5 plasma levels in comparison with controls (p < 0.05. There were no significant differences in NT-3 plasma levels between BD patients and controls. Conclusion: These findings corroborate the view that neurotrophin dysfunction is associated with mood states in patients with BD.

  7. Feasibility and outcomes of intravenous thrombolysis 3-4.5 hours after stroke in Chinese patients.

    Science.gov (United States)

    Xu, Zhi-Peng; Li, Hong-Hua; Li, Ya-Hong; Zhang, Yong; Wu, Qiang; Lin, Lang

    2014-05-01

    The time window for intravenous (IV) recombinant tissue plasminogen activator (rt-PA) treatment in acute ischemic stroke (AIS) patients has been extended to 4.5 hours. But little is known about the safety and efficacy of IV rt-PA treatment in the 3-4.5 hour time window in Chinese patients with AIS. A total of 119 patients who were treated with standard IV rt-PA therapy within 4.5 hours after symptom onset were included in this study: 85 were treated within 0-3 hours and 34 were treated within 3-4.5 hours. Favorable outcome was defined as a modified Rankin scale (mRS) score of 0-1 at 6 months. The safety of IV rt-PA treatment was assessed by the rate of mortality, symptomatic intracerebral hemorrhage (SICH) and other common complications. There were no significant differences in SICH rates (2.94% versus 2.35%; p=0.85) at 24-36 hours, mortality (5.88% versus 3.53%; p=0.56), other complications (14.71% versus 11.76%; p=0.66), National Institutes of Health Stroke Scale (NIHSS) score improvement at 24 hours (41.18% versus 45.88%; p=0.64) and favorable mRS at 6 months (52.94% versus 54.12%; p=0.91) between the two time window groups. Multivariate analysis showed that advanced age, lower admission NIHSS score and shorter time from symptom onset to treatment were associated with a favorable clinical outcome. This finding showed an additional 29% of patients received IV rt-PA because of the treatment window expansion to 4.5 hours. IV rt-PA was feasible and safe for treating AIS patients in the 3-4.5 hour time window in our Chinese population.

  8. A new calmodulin-binding motif for inositol 1,4,5-trisphosphate 3-kinase regulation.

    Science.gov (United States)

    Franco-Echevarría, Elsa; Baños-Sanz, Jose I; Monterroso, Begoña; Round, Adam; Sanz-Aparicio, Julia; González, Beatriz

    2014-11-01

    IP3-3K [Ins(1,4,5)P3 3-kinase] is a key enzyme that catalyses the synthesis of Ins(1,3,4,5)P4, using Ins(1,4,5)P3 and ATP as substrates. Both inositides, substrate and product, present crucial roles in the cell. Ins(1,4,5)P3 is a key point in Ca2+ metabolism that promotes Ca2+ release from intracellular stores and together with Ins(1,3,4,5)P4 regulates Ca2+ homoeostasis. In addition, Ins(1,3,4,5)P4 is involved in immune cell development. It has been proved that Ca2+/CaM (calmodulin) regulates the activity of IP3-3K, via direct interaction between both enzymes. Although we have extensive structural knowledge of the kinase domains of the three IP3-3K isoforms, no structural information is available about the interaction between IP3-3K and Ca2+/CaM. In the present paper we describe the crystal structure of the complex between human Ca2+/CaM and the CaM-binding region of human IP3-3K isoform A (residues 158-183) and propose a model for a complex including the kinase domain. The structure obtained allowed us to identify all of the key residues involved in the interaction, which have been evaluated by site-directed mutagenesis, pull-down and fluorescence anisotropy experiments. The results allowed the identification of a new CaM-binding motif, expanding our knowledge about how CaM interacts with its partners.

  9. PtdIns(4,5)P2 signaling regulates ATG14 and autophagy.

    Science.gov (United States)

    Tan, Xiaojun; Thapa, Narendra; Liao, Yihan; Choi, Suyong; Anderson, Richard A

    2016-09-27

    Autophagy is a regulated self-digestion pathway with fundamental roles in cell homeostasis and diseases. Autophagy is regulated by coordinated actions of a series of autophagy-related (ATG) proteins. The Barkor/ATG14(L)-VPS34 (a class III phosphatidylinositol 3-kinase) complex and its product phosphatidylinositol 3-phosphate [PtdIns(3)P] play key roles in autophagy initiation. ATG14 contains a C-terminal Barkor/ATG14(L) autophagosome-targeting sequence (BATS) domain that senses the curvature of PtdIns(3)P-containing membrane. The BATS domain also strongly binds PtdIns(4,5)P2, but the functional significance has been unclear. Here we show that ATG14 specifically interacts with type Iγ PIP kinase isoform 5 (PIPKIγi5), an enzyme that generates PtdIns(4,5)P2 in mammalian cells. Autophagosomes have associated PIPKIγi5 and PtdIns(4,5)P2 that are colocalized with late endosomes and the endoplasmic reticulum. PtdIns(4,5)P2 generation at these sites requires PIPKIγi5. Loss of PIPKIγi5 results in a loss of ATG14, UV irradiation resistance-associated gene, and Beclin 1 and a block of autophagy. PtdIns(4,5)P2 binding to the ATG14-BATS domain regulates ATG14 interaction with VPS34 and Beclin 1, and thus plays a key role in ATG14 complex assembly and autophagy initiation. This study identifies an unexpected role for PtdIns(4,5)P2 signaling in the regulation of ATG14 complex and autophagy.

  10. Structure and Mechanical Properties of AlMg4.5 And AlMg4.5Mn Wires Extruded by Kobo Method

    Directory of Open Access Journals (Sweden)

    Jaskowski M.

    2014-06-01

    Full Text Available W pracy badano wpływ liczby operacji wyciskania metodą KoBo (z identycznym sumarycznym stopniem przerobu λ = 100 na strukturę, własności mechaniczne i charakterystyki umocnieniowe drutów ze stopów AlMg4.5 i AlMg4.5Mn (AA5083. Stwierdzono, że wyciskanie jednooperacyjne prowadzi w przypadku obu stopów do formowania struktury typowej dla materia- łów zrekrystalizowanych. podczas gdy zastosowanie dwuoperacyjnego wyciskania skutkuje utworzeniem struktury włóknistej o charakterze „mieszanym”, tzn. zawierającej zarówno obszary, w których dominowały procesy intensywnego zdrowienia, jak i rekrystalizacji. W konsekwencji własności wytrzymałościowe tych ostatnich są zdecydowanie wyższe zarówno po wyciskaniu, jak i po późniejszym walcowaniu na zimno. We wszystkich przypadkach na krzywych rozciągania drutów obserwowano sko- kowe oscylacje naprężenia, charakterystyczne dla efektu Portevin - LeChatelier (P-L. W nielicznych próbach rozciągania efekt P-L poprzedzała niestateczność płynięcia plastycznego typowa dla występowania pasma LUdersa. Charakterystyki umocnienia wywołane procesem walcowania wykazywały przebieg monotonicznie rosnący.

  11. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    Science.gov (United States)

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  12. 39 CFR 4.5 - Assistant Postmasters General, General Counsel, Judicial Officer, Chief Postal Inspector.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Assistant Postmasters General, General Counsel... BOARD OF GOVERNORS OF THE U.S. POSTAL SERVICE OFFICIALS (ARTICLE IV) § 4.5 Assistant Postmasters General.... 204 as Assistant Postmasters General, whether so denominated or not, as the Board authorizes by...

  13. Probing the Physical Properties of z=4.5 Lyman Alpha Emitters with Spitzer

    CERN Document Server

    Finkelstein, Keely D; Tilvi, Vithal; Malhotra, Sangeeta; Rhoads, James E; Grogin, Norman A; Pirzkal, Norbert; Dey, Arjun; Jannuzi, Buell T; Mobasher, Bahram; Pakzad, Sabrina; Salmon, Brett; Wang, Junzian

    2015-01-01

    We present the results from a stellar population modeling analysis of a sample of 162 z=4.5, and 14 z=5.7 Lyman alpha emitting galaxies (LAEs) in the Bootes field, using deep Spitzer/IRAC data at 3.6 and 4.5 um from the Spitzer Lyman Alpha Survey, along with Hubble Space Telescope NICMOS and WFC3 imaging at 1.1 and 1.6 um for a subset of the LAEs. This represents one of the largest samples of high-redshift LAEs imaged with Spitzer IRAC. We find that 30/162 (19%) of the z=4.5 LAEs and 9/14 (64%) of the z=5.7 LAEs are detected at >3-sigma in at least one IRAC band. Individual z=4.5 IRAC-detected LAEs have a large range of stellar mass, from 5x10^8 to 10^11 Msol. One-third of the IRAC-detected LAEs have older stellar population ages of 100 Myr - 1 Gyr, while the remainder have ages < 100 Myr. A stacking analysis of IRAC-undetected LAEs shows this population to be primarily low mass (8 -- 20 x 10^8 Msol) and young (64 - 570 Myr). We find a correlation between stellar mass and the dust-corrected ultraviolet-bas...

  14. Segundo Paso. Grados 4to - 5to (Second Step. Grades 4-5).

    Science.gov (United States)

    Beland, Kathy

    This document is the Spanish language supplement to "Second Step, Grades 4-5," a violence-prevention curriculum designed to reduce impulsive and aggressive behavior in young children and to increase their social competence. The supplement, which cannot be used alone, translates portions of the curriculum, such as stories and discussions,…

  15. short communication one-pot synthesis of 2,4,5-trisubstituted ...

    African Journals Online (AJOL)

    InCl3.3H2O [11], NiCl2.6H2O/Al2O3 [12], DABCO [13], magnetic Fe3O4 ... aluminium nitride [26], nano SiO2-supported ferric hydrogen sulfate (FHS) .... the existing processes in the field of 2-aryl-4,5-diphenyl imidazole derivatives synthesis.

  16. Synthesis and antimicrobial activity of 4',5,7-trihydroxy-3'-prenylflavanone

    Indian Academy of Sciences (India)

    Adiana Mohamed Adib; Farediah Ahmad; Muhammad Sum Idris

    2008-09-01

    4',5,7-Trihydroxy-3'-prenylflavanone was synthesized and tested for antibacterial effects against Bacillus subtilis, Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa. The synthesized compounds were characterized using UV, IR, MS and 1H and 13C NMR data. The antibacterial screening of the synthesized compounds were performed in vitro by the filter paper disc diffusion method.

  17. Phosphatidylinositol 4,5-bisphosphate increases Ca2+ affinity of synaptotagmin-1 by 40-fold

    NARCIS (Netherlands)

    Bogaart, G. van den; Meyenberg, K.; Diederichsen, U.; Jahn, R.

    2012-01-01

    Synaptotagmin-1 is the main Ca(2+) sensor of neuronal exocytosis. It binds to both Ca(2+) and the anionic phospholipid phosphatidylinositol 4,5-bisphosphate (PIP(2)), but the precise cooperativity of this binding is still poorly understood. Here, we used microscale thermophoresis to quantify the coo

  18. Determination of lnositol 1,4,5-Trisphosphate Levels in Dictyostelium by Isotope Dilution Assay

    NARCIS (Netherlands)

    Haastert, Peter J.M. van

    1989-01-01

    A commercial isotope dilution assay was used for the determination of Ins(1,4,5)P3 levels in the microorganism Dictyostelium discoideum. Cross-reactivity in the assay was detected with extracts from cells and the medium. The compound which induced this cross-reactivity was tentatively identified as

  19. Thrombolysis with alteplase 3 to 4.5 hours after acute ischemic stroke

    DEFF Research Database (Denmark)

    Hacke, Werner; Kaste, Markku; Bluhmki, Erich

    2008-01-01

    and 4.5 hours after the onset of a stroke. METHODS: After exclusion of patients with a brain hemorrhage or major infarction, as detected on a computed tomographic scan, we randomly assigned patients with acute ischemic stroke in a 1:1 double-blind fashion to receive treatment with intravenous alteplase...

  20. Some Observed Results of Solar Radio Spectrometer at 4.5-7.5 GHz

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new instrument of broadband solar radio spectrometer working at waveband 4.5-7.5 GHz was developed at Purple Mountain Observatory for Solar Maximum 23. Some new results of spectral observation have been obtained since August 1999. Two typical type Ⅲμ bursts with rich fine structures are presented and some interesting features discussed.

  1. Drie nuwe verklaringsopsies in die Jakobusbrief (Jak 2:1, 4: 5; 5: 6)

    African Journals Online (AJOL)

    New options in the understanding of the Epistle of James 0s 2; 1; 4:5; 5:6). New methods of .... prosopolempsia, entered the New Testament tradition first as a charac teristic of God's ..... A manual grammar of the Greek New Testament. Toronto: ...

  2. Tannic acid Catalyzed an Efficient Synthesis of 2,4,5-Triaryl-1H-Imidazole

    Directory of Open Access Journals (Sweden)

    Shitole Nana Vikram

    2013-05-01

    Full Text Available Tannic acid (C76H52O46 has been found to be an efficient catalyst for one-pot synthesis of 2,4,5-triaryl substituted imidazoles by the reaction of an arylaldehyde, benzyl/benzoin and an ammonium acetate. The short reaction time and excellent yields making this protocol practical and economically attractive.

  3. Regulation of connexin43 gap junctional communication by phosphatidylinositol 4,5-bisphosphate

    NARCIS (Netherlands)

    van Zeijl, Leonie; Ponsioen, Bas; Giepmans, Ben N G; Ariaens, Aafke; Postma, Friso R; Várnai, Péter; Balla, Tamas; Divecha, Nullin; Jalink, Kees; Moolenaar, Wouter H

    2007-01-01

    Cell-cell communication through connexin43 (Cx43)-based gap junction channels is rapidly inhibited upon activation of various G protein coupled receptors; however, the mechanism is unknown. We show that Cx43-based cell-cell communication is inhibited by depletion of phosphatidylinositol 4,5-bisphosp

  4. Bifunctional Ag/C3N4.5 composite nanobelts for photocatalysis and antibacterium

    Science.gov (United States)

    Lei, Renbo; Jian, Jikang; Zhang, Zhihua; Song, Bo; Wu, Rong

    2016-09-01

    Multiple functions can be achieved in carbon nitride-based composite nanomaterials by tuning their components and structures. Here, we report on a large-scale synthesis of novel bifunctional Ag/C3N4.5 composite nanobelts (CNBs) with efficient photocatalytic and antibacterial activity. The Ag/C3N4.5 CNBs were synthesized in high yield by a two-step route including a homogeneous precipitation process and a subsequent calcination treatment. The structural, morphological, compositional, and spectroscopic characterizations revealed that the Ag/C3N4.5 CNBs are composed of N-deficient melem ultrathin nanobelts and crystalline Ag nanoparticles attached to the surface of the nanobelts with good contact. The band gap of the Ag/C3N4.5 CNBs is determined to be about 3.04 eV. The efficient photocatalytic and antibacterial activities of the composite nanomaterials are verified by testing the degradation of Rhodamine B (RhB) and the inhibition zone to bacterium E. coli. The work provides a facile route to bifunctional carbon nitride-based composites with potential applications in the fields of the environment and biology.

  5. 4-[5-(2-Methoxyphenyl-1,3,4-oxadiazol-2-yl]benzohydrazide

    Directory of Open Access Journals (Sweden)

    Muhammad Taha

    2014-05-01

    Full Text Available 4-(5-(2-Methoxyphenyl-1,3,4-oxadiazol-2-ylbenzohydrazide (5 was synthesized by three steps. The synthesis started with 2-methoxybenzohydrazide to form hydrazone (3 which was then cyclized to oxadiazole (4 and finally, treatment of oxadiazole (4 with hydrazine hydrate afforded the final product (5.

  6. New analogues of epiboxidine incorporating the 4,5-dihydroisoxazole nucleus

    DEFF Research Database (Denmark)

    Dallanoce, Clelia; Magrone, Pietro; Bazza, Paola;

    2009-01-01

    A group of novel 4,5-dihydro-3-methylisoxazolyl derivatives, structurally related to epiboxidine (=(1R,4S,6S)-6-(3-methylisoxazol-5-yl)-7-azabicyclo[2.2.1]heptane), was prepared via 1,3-dipolar cycloaddition of acetonitrile oxide to different olefins. Target compounds 1a and 1b, 2a and 2b, 3, 4, ...

  7. Multiresistant Salmonella enterica serovar 4,[5],12:i:- in Europe: a new pandemic strain?

    NARCIS (Netherlands)

    Hopkins, K.L.; Kirchner, M.; Guerra, B.; Granier, A.; Lucarelli, C.; Porrero, M.C.; Jakubczak, A.; Threlfall, J.; Mevius, D.J.

    2010-01-01

    A marked increase in the prevalence of S. enterica serovar 4,[5],12:i:- with resistance to ampicillin, streptomycin, sulphonamides and tetracyclines (R-type ASSuT) has been noted in food-borne infections and in pigs/pig meat in several European countries in the last ten years. One hundred and sixtee

  8. DSC Study on the Age-precipitation Behavior of Al- 4 5 Cu Alloy and Mullite-fiber Reinforced Al- 4 5 Cu Composite%Al-4.5Cu和Mullite增强Al-4.5Cu复合材料时效析出行为的DSC研究

    Institute of Scientific and Technical Information of China (English)

    李伟; 龙剑平; 沈保罗; 高升吉; 涂铭旌

    2002-01-01

    用差示扫描量热法(DSC)对Al-4.5Cu合金和莫来石(Mullite)短纤维增强Al-4.5Cu复合材料的时效析出行为进行了研究;结果表明Al-4.5Cu合金和Mullite增强Al-4.5Cu复合材料固溶淬火试样的DSC扫描曲线存在较大不同,溶质原子富集区(GP)形成和溶解的信息在基体合金的DSC曲线上清晰可见,但在复合材料的DSC曲线上则很难确认,表明纤维推延或抑制了GP区的形成;中间沉淀析出相θ″和θ′的析出过程由于纤维的引入而得到明显加快,峰值温度降低,活化能减小,时效析出过程加快;但是,扫描参数选择不当时,容易对析出相的析出过程产生错误判断,应引起重视.

  9. Clustering of Ly alpha emitters at z approximate to 4.5

    NARCIS (Netherlands)

    Kovac, Katarina; Somerville, Rachel S.; Rhoads, James E.; Malhotra, Sangeeta; Wang, JunXian

    2007-01-01

    We present the clustering properties of 151 Ly alpha-emitting galaxies at z approximate to 4.5 selected from the Large Area Lyman Alpha (LALA) survey. Our catalog covers an area of 36'; 36' observed with five narrowband filters. We assume that the angular correlation function w(theta) is well repres

  10. Clustering of Ly alpha emitters at z approximate to 4.5

    NARCIS (Netherlands)

    Kovac, Katarina; Somerville, Rachel S.; Rhoads, James E.; Malhotra, Sangeeta; Wang, JunXian

    2007-01-01

    We present the clustering properties of 151 Ly alpha-emitting galaxies at z approximate to 4.5 selected from the Large Area Lyman Alpha (LALA) survey. Our catalog covers an area of 36'; 36' observed with five narrowband filters. We assume that the angular correlation function w(theta) is well

  11. [The occupational physician in France].

    Science.gov (United States)

    Matsuda, Shinya

    2013-10-01

    The French Labor law defines the role and its allocation criteria of the occupational physician (OP) the same as in Japan. In France, occupational medicine is one of the medical specialties. The OP resident must follow the 4 years clinical training before certification. After having finished their residency, they are entitled to work for the occupational health service office of a company or company association (in the case of small and medium sized companies). The most important characteristics of the French system is that they cover all workers regardless of company size. The main role of the OP is prevention of work related diseases and accidents. They are not allowed to do clinical services except for emergency cases. Their main activities are health examinations, health education, patrol and advice for better working condition. Formerly, it was rather difficult to attract the medical students for OP resident course because of its prevention oriented characteristics. A growing concern about the importance of health management at the work site, however, has changed the situation. Now, the number of candidates for OP resident course is increasing. Their task has expanded to cover mental health and other life style related diseases. The 2011 modification of law redefines the role of the OP as a director of an occupational health service office who has a total responsibility of multidisciplinary services. The French and Japanese occupational health systems have many of similarities. A comparative study by researchers of UOEH is expected to yield useful information.

  12. [Cannabis in France, new insights].

    Science.gov (United States)

    Costentin, Jean

    2014-03-01

    France holds the record for cannabis use in Europe, especially among adolescents. This drug of abuse is thus mainly used during a very sensitive period of brain development, education, vehicle driving and development of life projects. In addition, synthetic derivatives of tetrahydrocannabinol (THC), which are more noxious than cannabis itself are now appearing on the market. Traficking and cultivation for personnal use have intensified; products proposed for sale are richer in THC; and some methods of consumption (e-cigarettes, vaporizers, water pipes) increase the supply of THC to the lungs and thence to the body and brain. It is in this context that attempts are being made to legalize this drug of abuse. Other attempts are made to disguise it as a medication. Meanwhile, the list of its psychic as well as physical damages grows longer, with some very severe cases of major injuries. This evolution takes place in spite of numerous warnings expressed by the French Academy of Medicine. Subsequently, it is prompted to carefully and vigorously denounce these events. This will be the aim of this thematic session.

  13. VISAS FOR SWITZERLAND AND FRANCE

    CERN Multimedia

    Relations with the Host States Service

    2001-01-01

    Henceforth only the undermentioned persons shall be authorized by the Advisor for Relations with the Member States and the Advisor for Relations with the non-Member States to sign official letters of invitation and other related documents : James V. ALLABY Lyndon EVANS Cecilia JARLSKOG Nicolas KOULBERG Hélène MAUGER Michelle MAZERAND Steve MYERS Chris ONIONS Monica PEPE-ALTARELLI Agnita QUERROU Karl-Heinz SCHINDL. As a precautionary measure, all persons coming to CERN should obtain all the requisite information in good time on entry requirements applying to him or her in Switzerland and France, particularly with regard to visas. The practice is for visas to be issued by the consulate competent for the place of residence, and in some cases a special procedure must be followed. Any further information required may be obtained from the Swiss and French consulates. You may also consult the Web pages of the Swiss Federal Department of Foreign Affairs (at http://www.eda.admin.ch/eda/e/home/e...

  14. VISAS FOR SWITZERLAND AND FRANCE

    CERN Document Server

    Service des Relations avec les Pays Hôtes

    2000-01-01

    ReminderAs a precautionary measure, everyone coming to CERN should obtain all the requisite information in good time on entry requirements applying to him or her in Switzerland and France, particularly with regard to visas. The practice is for visas to be issued by the consulate competent for the place of residence, and in some cases a special procedure must be followed.Swiss and French consulates are available for any information required. You may also consult the Web pages of the Swiss Department of Foreign Affairs (at http://194.6.168.115/site/hand/eda/botschaften-text.html) or those of the French Ministry of Foreign Affairs (at http://www.diplomatie.fr/venir/visas/index.html). Information is also provided on the Relations with the Host States Service Web pages (at http://www.cern.ch/relations/). The authorities of the Host States have informed the Organisation on several occasions that they require scrupulous observance of the legislation in this field.Relations with the Host States Servicehttp://www.cern...

  15. VISAS FOR SWITZERLAND AND FRANCE

    CERN Document Server

    Service des Relations avec les Pays Hôtes

    1999-01-01

    As a precautionary measure, everyone coming to CERN should obtain all the requisite information in good time on entry requirements applying to him or her in Switzerland and France, particularly with regard to visas. The practice is for visas to be issued by the consulate competent for the place of residence, and in some cases a special procedure must be followed.Swiss and French consulates are available for any information required. You may also consult the Web pages of the Swiss Department of Foreign Affairs (at http://194.6.168.115/site/hand/eda/botschaften-text.html) or those of the French Ministry of Foreign Affairs (at http://www.diplomatie.fr/venir/visas/index.html). Information is also provided on the Relations with the Host States Service Web pages (at http://www.cern.ch/relations/). The authorities of the Host States have informed the Organization on several occasions that they require scrupulous observance of the legislation in this field.Relations with the Host StatesServicehttp://www.cern.ch/relat...

  16. Cold wake of Hurricane Frances

    Science.gov (United States)

    D'Asaro, Eric A.; Sanford, Thomas B.; Niiler, P. Peter; Terrill, Eric J.

    2007-08-01

    An array of instruments air-deployed ahead of Hurricane Frances measured the three-dimensional, time dependent response of the ocean to this strong (60 ms-1) storm. Sea surface temperature cooled by up to 2.2°C with the greatest cooling occurring in a 50-km-wide band centered 60-85 km to the right of the track. The cooling was almost entirely due to vertical mixing, not air-sea heat fluxes. Currents of up to 1.6 ms-1 and thermocline displacements of up to 50 m dispersed as near-inertial internal waves. The heat in excess of 26°C, decreased behind the storm due primarily to horizontal advection of heat away from the storm track, with a small contribution from mixing across the 26°C isotherm. SST cooling under the storm core (0.4°C) produced a 16% decrease in air-sea heat flux implying an approximately 5 ms-1 reduction in peak winds

  17. [Chronic respiratory insufficiency in France].

    Science.gov (United States)

    Chailleux, E; Boffa, C

    2001-05-31

    The data concerning the prevalence of chronic respiratory insufficiency (CRI) in France are scarce: in 1994 official numbers were 14,000 deaths due to chronic bronchitis, 2,000 due to asthma for a total number of 40,000 deaths with respiratory cause; the same year 27,000 new patients were compensated for chronic respiratory insufficiency by social security services. On January 1st 2000 the non-profit organizations was in charge of 21,500 patients with long term oxygen therapy and 10,500 with home ventilation, and the commercial companies respectively 30,000 and 6,000. Accordingly the total of patients treated at home for CRI is about 68,000. The repartition by cause of CRI, the characteristics of patients and the prognosis can be evaluated thanks to the ANTADIR observatory which collects medical data since 1981. Chronic obstructive pulmonary diseases (chronic bronchitis, emphysema, asthma, bronchiectasis) count for more than half of the total of cases. Other causes comprise pleuro-parietal diseases (tuberculosis sequelae, kyphoscoliosis), neuro-muscular diseases and interstitial lung diseases. CRI is a severe disease with a survival median of three years for chronic obstructive pulmonary diseases, and a prognosis slightly better for kyphoscoliosis and neuro-muscular diseases, and worse for pulmonary fibrosis.

  18. The disposition and metabolism of durene (1,2,4,5-tetramethylbenzene) in rats

    Energy Technology Data Exchange (ETDEWEB)

    Ligocka, D.; Sapota, A.; Rydzynski, K. [Nofer' s Inst. of Occupational Medicine, Lodz (Poland)

    2001-01-01

    The organ and tissue distribution, excretion and metabolism of [{sup 3}H]1,2,4,5-tetramethylbenzene ([{sup 3}H]durene) in male Wistar albino rats were investigated following a single i.p. administration (40 mg/kg) and within 9 days after five daily repeated administrations. Urine proved to be the main route of tritium excretion. Within the first 24 h after a single administration 69% of the radioactivity was excreted in the urine and only 9% in the feces. The highest level of tritium binding was found in the fat tissue, liver, kidneys and adrenal glands. The accumulation of tritium in the plasma proceeded with a kinetic constant of 0.49 h{sup -1}, whereas the half-life of radioactivity decayamounted to about 6.3 h. In erythrocytes, the tritium level was found to be about three times lower than in blood plasma. The total amount eliminated during the 9 days following repeated administration was about 94% of the five doses given. The highest level of tritium was found in fat tissue and adrenal glands, followed by the liver, kidneys, sciatic nerve and muscle. A gradual decline in tritium levels was observed during the following 4 days in most tissues to reach about 2% of the dose given. The main urinary metabolites resulting from the administration of durene were 2,4,5-trimethylbenzyl alcohol (about 22%), 4,5-dimethyl-1,2-benzdialdehyde (about 19%), 2,4,5-trimethylbenzaldehyde (about 19%) and 2,4,5-trimethylbenzoic acid (about 16%). The oxygen-containing metabolites accounted for almost 80%, whereas sulphur-containing metabolites accounted for approximately 10% of the products of biotransformation. In conclusion, most of the durene administered has a relatively rapid turnover rate, with minor levels retained in the tissues for longer time periods. (orig.)

  19. 75 FR 16839 - Sorbitol From France

    Science.gov (United States)

    2010-04-02

    ... From the Federal Register Online via the Government Publishing Office INTERNATIONAL TRADE COMMISSION Sorbitol From France AGENCY: United States International Trade Commission. ACTION: Revised schedule for the subject review. DATES: Effective Date: Date of Commission approval. FOR...

  20. Register for the local elections in France

    CERN Multimedia

    DSU Department

    2007-01-01

    If you are a European Union citizen residing in France and wish to vote in the forthcoming local elections you must register on the supplementary register at your town hall (mairie) before 31 December 2007. EU citizens are regarded as residing in France if their primary residence is in France or if they live there continuously. To be eligible to vote you must: be a national of one of the 26 listed States of the European Union and present a valid identification document. Residence permits are valid; be at least 18 years old by the closing date of revision of the supplementary electoral register, i.e. by the last day of February; enjoy civic rights both in France and in your State of origin. For more information: http://vosdroits.service-public.fr/particuliers/F1937.xhtml?&n=Elections&l=N4&n=Elections%20politiques&l=N47

  1. Les églises paroissiales construites dans la seconde moitié du XXe siècle et leur devenir : l’exemple de Lyon (Rhône

    Directory of Open Access Journals (Sweden)

    Maryannick Chalabi

    2012-04-01

    Full Text Available La population du diocèse de Lyon augmente de 400 000 habitants entre 1900 et 1959, et la population urbaine représente désormais 62 % de la population totale du diocèse. Pour répondre à cette évolution, l’archevêque de Lyon crée l’O.D.P.N. (Office diocésain des paroisses nouvelles. La construction de 120 centres paroissiaux est prévue pour 1964. Les premières constructions sont assez classiques (avec notamment des clochers monumentaux, et seul l’usage du béton brut marque une ouverture au modernisme. Après 1960, les curés bâtisseurs font appel à des architectes novateurs qui inventent des formes nouvelles, mais qui ne s’imposent pas dans le paysage urbain. Les dispositions intérieures relèvent des tendances modernistes et des prescriptions du concile Vatican 2. Après 1973, il n’y a pas de nouvelles constructions d’églises dans la ville, et même plusieurs fermetures sont actées ou envisagées. Cette situation attire l’attention sur la fragilité du patrimoine religieux contemporain de Lyon, qui est à la fois original et représentatif des tendances nationales.The population of the diocese of Lyon grew by 400,000 between 1900 and 1959 and 62% of this total population were now city-dwellers. In order to respond to this evolution, the archbishop of Lyon created the O.D.P.N. (Office diocésain des paroisses nouvelles, Diocesan Office of New Parishes. It planned the creation of 120 new parish centres by 1964. The first buildings were fairly classical, often with monumental bell towers. Only the use of untreated reinforced concrete suggested a sensitivity to the trends of modern architecture. After 1960, however, parish priests began to commission buildings from innovative architects who began to design new forms, but which did not really mark the landscape. Inside, the design reflected the modernist tendencies and prescriptions of the Vatican 2 Council. After 1973, there were no new churches built in the city

  2. Chinese Peking Opera Troupe Visits France

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    <正>At the invitation of the Municipal Government of Marmande, France and the Festival de Sylvanes, a Chinese Peking Opera troupe, drawn mainly from the National Academy of Chinese Theatre Arts and sent by the CPAFFC,visited France from August 19 to 31 to introduce the quintessence of Chinese culture through their performances.An additional purpose was to promote exchanges between the two countries in theatrical arts and culture,thus enhancing mutual

  3. Privatizations and corporate governance in France

    OpenAIRE

    Goldstein, A.

    2013-01-01

    From the middle of 1993, the French government has followed an ambitious privatisation programme. Nine major state-owned enterprises have been at least partially sold; other companies some of which are amongst the largest in France, will be sold in the next few years. An analysis is undertaken of how the post-1993 privatisations have related to changes in both the mechanisms of corporate governance and the market for corporate control. Privatisation in France is found to be tactically motivat...

  4. REGULATION OF HISTAMINE-INDUCED AND UTP-INDUCED INCREASES IN INS(1,4,5)P-3, INS(1,3,4,5)P-4 AND CA2+ BY CYCLIC-AMP IN DDT1 MF-2 CELLS

    NARCIS (Netherlands)

    SIPMA, H; DUIN, M; HOITING, B; DENHERTOG, A; NELEMANS, A

    1995-01-01

    1 Stimulation of P-2U-purinoceptors with UTP or histamine H-1-receptors with histamine gave rise to the formation of inositol 1,4,5-trisphosphate (Ins(1,4,5)P-3) and inositol 1,3,4,5-tetrakisphosphate (Ins(1,3,4,5)P-4) in DDT1 MF-2 smooth muscle cells. 2 Stimulation of P-2U-purinoceptors or histamin

  5. Photometry of Scattered Disk Objects at 3.6 and 4.5 μm

    Science.gov (United States)

    Melton, Chad A.; Emery, Joshua P.; Pinilla-Alonso, Noemi; Mommert, Michael; Lejoly, Cassandra; Trilling, David E.

    2016-10-01

    Scattered disk objects (SDO) are some of the most intriguing of the estimated 100,000 icy bodies located in the outer Solar System. SDOs have been gravitationally disturbed and scattered by the orbital migration of Neptune. The surface compositions of these objects provide a window into formation conditions and dynamics of the outer Solar System. Characterization of volatiles and organic materials, in particular, provide important constraints on formation conditions and subsequent surface processing of these objects. We measured fluxes of 38 SDOs at 3.6 and 4.5 μm using the Infrared Array Camera (IRAC) aboard the NASA Spitzer Space Telescope in order to characterize volatiles, silicates, and complex organics on their surfaces. Albedos calculated from these fluxes are combined with broadband albedos from ground-based observations at shorter wavelengths (spanning 0.55 - 2.22 μm) to provide spectrophotometry from 0.5 to 4.5 μm. Much of those ground-based data are from previously published literature. However, we have also conducted new ground-based Y, J, H, K observations of several of the targets. Sizes and visible geometric albedos, which are required to convert IRAC fluxes to geometric albedos, were extracted from published literature when available and computed from absolute magnitudes otherwise. Data were available to construct complete 0.55 to 4.5 μm spectrophotometric curves for 14 SDOs and partial curves for the remaining 24 SDOs. The resulting spectrophotometry of these 38 SDOs indicates a wide range of surface compositions. Several of the SDOs we observed show red visible and near-infrared spectral slopes and strong absorptions at 3.6 and 4.5 μm. These absorption features suggest the presence of complex organics. Other SDOs appear red as well, but show only moderate absorptions at 3.6 and 4.5 μm. Moderate absorption features at these wavelengths may indicate a mixture of H2O ice and refractory material on the surface. Finally, some objects show no

  6. 现代建筑与历史景观的融合——以法国里昂为例%On Integration of Modern Architecture and Historic Landscape——Two Examples in Lyon of France

    Institute of Scientific and Technical Information of China (English)

    马丽

    2011-01-01

    The article introduced two cases about modern architecture integrating into the historic landscape and summarized the design methods of the two cases.The article also analyzed the design spirits embodied by the cases,and found that they were passed down from the French history.The article offered references to designers when dealing with the relationship between new architecture and old surroundings,and inspired readers deep thoughts on protection of historic landscape.%分析法国里昂的两个现代建筑与历史景观融合与互动的案例,探讨里昂现代建筑融合历史景观的设计手法,并探析里昂现代建筑体现出来的法国历史传承下来的设计精神。旨在为我国当代建筑设计师处理现代建筑与历史景观的设计关系提供借鉴,引发读者对历史景观保护的思考。

  7. [Epidemiology of nephrolithiasis in France].

    Science.gov (United States)

    Daudon, M

    2005-12-01

    Nephrolithiasis is a frequent disease that affects about 10% of people in western countries. The prevalence of calcium oxalate stones has been constantly increasing during the past fifty years in France as well as in other industrialized countries. Stone composition varies depending to gender and age of patients and also underlines the role of other risk factors and associated pathologies such as body mass index and diabetes mellitus. The decrease in struvite frequency in female patients is the result of a significantly improved diagnostic and treatment of urinary tract infections by urea-splitting bacteria. In contrast, the increasing occurrence of weddellite calculi in stone forming women aged more than 50 years could be the consequence of post-menopausal therapy. A high prevalence of uric acid was found in overweight and obese stone formers and in diabetic ones as well. Another important finding was the increased occurrence with time of calcium oxalate stones formed from papillary Randall's plaques, especially in young patients. Nutritional risk factors for stone disease are well known: they include excessive consumption of animal proteins, sodium chloride and rapidly absorbed glucides, and insufficient dietary intake of fruits and potassium-rich vegetables, which provide an alkaline load. As a consequence, an excessive production of hydrogen ions may induce several urinary disorders including low urine pH, high urine calcium and uric acid excretion and low urine citrate excretion. Excess in calorie intake, high chocolate consumption inducing hyperoxaluria and low water intake are other factors, which favour excessive urine concentration of solutes. Restoring the dietary balance is the first advice to prevent stone recurrence. However, the striking increase of some types of calculi, such as calcium oxalate stones developed from Randall's plaque, should alert to peculiar lithogenetic risk factors and suggests that specific advices should be given to prevent stone

  8. Synthesis and Crystal Structure of 4-(Dichloroacetyl)-1-oxa-4-azaspiro[4.5]decane

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The title compound 4-(dichloroacetyl)-1-oxa-4-azaspiro[4. 5] decane (CAS number 71526-07-3, C10H15Cl2NO2, Mr = 252.13) was obtained by the reaction of dichloroacetic acid with 1-oxa-4-azaspiro[4. 5] decane. The crystal is of monoclinic, space group P21/n with the unit cell constants: a = 5.9619(4), b = 10.0066(8), c = 20.0986(4) (A), β = 90.194(3)°, V = 1199(4) (A)3, Z = 4, Dc = 1.397 g/cm3, F(000) = 528, μ(MoKα) = 0.522 mm-1, R = 0.0611 and wR = 0.1656 for 1276 observed reflections (I > 2σ(I)). X-ray analysis reveals that the cyclohexyl adopts a chair conformation and the compound is a chiral one.

  9. Parallel Synthesis of an Imidazole-4,5-dicarboxamide Library Bearing Amino Acid Esters and Alkanamines

    Directory of Open Access Journals (Sweden)

    Rosanna Solinas

    2008-12-01

    Full Text Available The imidazole-4,5-dicarboxylic acid scaffold is readily derivatized with amino acid esters and alkanamines to afford compounds with intramolecularly hydrogen bonded conformations that mimic substituted purines and therefore are hypothesized to be potential inhibitors of kinases through competitive binding to the ATP site. In this work, a total of 126 dissymmetrically disubstituted imidazole-4,5-dicarboxamides with amino acid ester and alkanamide substituents were prepared by parallel synthesis. The library members were purified by column chromatography on silica gel and the purified compounds characterized by LC-MS with LC detection at 214 nm. A selection of the final compounds was also analyzed by 1H-NMR spectroscopy. The analytically pure final products have been submitted to the Molecular Library Small Molecule Repository (MLSMR for screening in the Molecular Library Screening Center Network (MLSCN as part of the NIH Roadmap.

  10. Characterization of the Emerging Salmonella 4,[5],12:i:- in Danish Animal Production

    DEFF Research Database (Denmark)

    Argüello, Hector; Sørensen, Gitte; Carvajal, Ana

    2014-01-01

    Abstract The monophasic Salmonella variant with the antigenic formula Salmonella 4,[5],12:i:- has emerged in the last decade as one of the main serotypes related to human salmonellosis. In the present study, a collection of 94 isolates of the S. 4,12:i:- and S. 4,5,12:i:- coming from Danish farm ...... in Danish food animal production with well-characterized clones that are described by previous studies, demonstrating the emergence and spread of this serotype in Denmark....... animals, swine (86), cattle (7), and poultry (1), with well-defined identification was further typed by polymerase chain reaction serotyping, phage typing, and molecular typing (polymerase chain reaction and multilocus variable-number tandem-repeat analysis [MLVA]). Moreover, the determination...

  11. Drie nuwe verklaringsopsies in die Jakobusbrief (Jak 2:1; 4:5; 5:6

    Directory of Open Access Journals (Sweden)

    E. A.C. Pretorius

    1988-01-01

    Full Text Available New options in the understanding of the Epistle of James(Js 2:1; 4:5; 5:6 New methods of interpretation occasionally lead to new options in the understanding of texts. In the case of the Epistle of James, the interpretation has until recently stood under the spell of the 'comparative' method of Dibelius. Greater emphasis on internal cohesion in the text recently led to the proposal of the following translations: James 2:1: '... surely, you do not have the faith in our Lord ... on account of favouritism?' James 4:5: 'Do you think Scripture speaks in vain? Should the spirit which He made to dwell in us desire (the world with envy?' James 5:6 'You judge and murder the innocent. Will He (God, cf 4:6 not resist you?'

  12. Fabrication and properties of strip casting 4.5 wt% Si steel thin sheet

    Science.gov (United States)

    Zu, Guoqing; Zhang, Xiaoming; Zhao, Jingwei; Wang, Yuqian; Yan, Yi; Li, Chengang; Cao, Guangming; Jiang, Zhengyi

    2017-02-01

    Three 4.5 wt% Si steel thin sheets with different thicknesses were efficiently fabricated by twin-roll strip casting, warm rolling and cold rolling followed by final annealing. A comprehensive investigation from the workability of the as-cast strip to the magnetic property of the produces was performed to illustrate the superiority of the new materials. The results show that the as-cast strip, which has a much lower Vickers hardness than that of the 6.5 wt% Si steel, is suitable for rolling processing. The X-ray diffraction (XRD) and transmission electron microscopy (TEM) studies confirm that no ordering phase exists in the as-cast strip. The cold-rolled thin sheets exhibit good surface quality without edge cracks. Furthermore, all the three 4.5 wt% Si steel thin sheets possess relative strong //ND texture and present high magnetic inductions and low iron losses after finial annealing.

  13. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  14. Large Area Lyman Alpha Survey: Finding Young Galaxies at z=4.5

    Science.gov (United States)

    Malhotra, S.; Rhoads, J.; Dey, A.; Stern, D.; Spinrad, H.

    Strong Lyα emission is a signpost of young stars and the absence of dust and thus indicates young galaxies. To find such a population of young galaxies at z=4.5 we started the Large Area Lyman Alpha survey (LALA). This survey achieves an unprecedented combination of volume and sensitivity by using narrow-band filters on a large format (36' × 36') camera on the 4 meter telescope at KPNO. The volume density and star-formation contribution of the Lyα emitters at z=4.5 is comparable to that of Lyman break galaxies. With many candidates and a few spectroscopic confirmations in hand we discuss what the properties of Lyα emitters imply for galaxy and star formation in the early universe.

  15. Regulation of voltage-gated potassium channels by PI(4,5)P2.

    Science.gov (United States)

    Kruse, Martin; Hammond, Gerald R V; Hille, Bertil

    2012-08-01

    Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P(2)) regulates activities of numerous ion channels including inwardly rectifying potassium (K(ir)) channels, KCNQ, TRP, and voltage-gated calcium channels. Several studies suggest that voltage-gated potassium (K(V)) channels might be regulated by PI(4,5)P(2). Wide expression of K(V) channels in different cells suggests that such regulation could have broad physiological consequences. To study regulation of K(V) channels by PI(4,5)P(2), we have coexpressed several of them in tsA-201 cells with a G protein-coupled receptor (M(1)R), a voltage-sensitive lipid 5-phosphatase (Dr-VSP), or an engineered fusion protein carrying both lipid 4-phosphatase and 5-phosphatase activity (pseudojanin). These tools deplete PI(4,5)P(2) with application of muscarinic agonists, depolarization, or rapamycin, respectively. PI(4,5)P(2) at the plasma membrane was monitored by Förster resonance energy transfer (FRET) from PH probes of PLCδ1 simultaneously with whole-cell recordings. Activation of Dr-VSP or recruitment of pseudojanin inhibited K(V)7.1, K(V)7.2/7.3, and K(ir)2.1 channel current by 90-95%. Activation of M(1)R inhibited K(V)7.2/7.3 current similarly. With these tools, we tested for potential PI(4,5)P(2) regulation of activity of K(V)1.1/K(V)β1.1, K(V)1.3, K(V)1.4, and K(V)1.5/K(V)β1.3, K(V)2.1, K(V)3.4, K(V)4.2, K(V)4.3 (with different KChIPs and DPP6-s), and hERG/KCNE2. Interestingly, we found a substantial removal of inactivation for K(V)1.1/K(V)β1.1 and K(V)3.4, resulting in up-regulation of current density upon activation of M(1)R but no changes in activity upon activating only VSP or pseudojanin. The other channels tested except possibly hERG showed no alteration in activity in any of the assays we used. In conclusion, a depletion of PI(4,5)P(2) at the plasma membrane by enzymes does not seem to influence activity of most tested K(V) channels, whereas it does strongly inhibit members of the K(V)7 and K(ir) families.

  16. Exploiting the CNC side chain in heterocyclic rearrangements: synthesis of 4(5)-acylamino-imidazoles.

    Science.gov (United States)

    Piccionello, Antonio Palumbo; Buscemi, Silvestre; Vivona, Nicolò; Pace, Andrea

    2010-08-06

    A new variation on the Boulton-Katritzky reaction is reported, namely, involving use of a CNC side chain. A novel Montmorillonite-K10 catalyzed nonreductive transamination of a 3-benzoyl-1,2,4-oxadiazole afforded a 3-(alpha-aminobenzyl)-1,2,4-oxadiazole, which was condensed with benzaldehydes to afford the corresponding imines. In the presence of strong base, these imines underwent Boulton-Katritzky-type rearrangement to afford novel 4(5)-acylaminoimidazoles.

  17. Deterministic methods in radiation transport. A compilation of papers presented February 4-5, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Rice, A. F.; Roussin, R. W. [eds.

    1992-06-01

    The Seminar on Deterministic Methods in Radiation Transport was held February 4--5, 1992, in Oak Ridge, Tennessee. Eleven presentations were made and the full papers are published in this report, along with three that were submitted but not given orally. These papers represent a good overview of the state of the art in the deterministic solution of radiation transport problems for a variety of applications of current interest to the Radiation Shielding Information Center user community.

  18. Deterministic methods in radiation transport. A compilation of papers presented February 4--5, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Rice, A.F.; Roussin, R.W. [eds.

    1992-06-01

    The Seminar on Deterministic Methods in Radiation Transport was held February 4--5, 1992, in Oak Ridge, Tennessee. Eleven presentations were made and the full papers are published in this report, along with three that were submitted but not given orally. These papers represent a good overview of the state of the art in the deterministic solution of radiation transport problems for a variety of applications of current interest to the Radiation Shielding Information Center user community.

  19. Supramolecular assembly of 2,4,5-trifluorobenzoate complex based on weak interactions involving fluorine atoms

    Institute of Scientific and Technical Information of China (English)

    Chun-Hua Ge; Rui Zhang; Ping Fan; Xiang-Dong Zhang; Li-Juan Wang; Fang-Fang Wang

    2013-01-01

    The complex [Cd(tfbz)2(phen)]2 (1) (tfbz =2,4,5-trifluorobenzoate,phen =1,10-phenanthro-line) was synthesized using trifluorobenzoic acid ligand.The single-crystal structure of 1 has been determined by X-ray crystallography.The packing structure is characterized by the formation of an intricate three-dimensional supramolecular network that depends on the C-H…F,F…F, F(lp)…π (lp =lone pair) interactions.

  20. N-oxide 1,2,4,5-tetrazine-based high-performance energetic materials.

    Science.gov (United States)

    Wei, Hao; Gao, Haixiang; Shreeve, Jean'ne M

    2014-12-15

    One route to high density and high performance energetic materials based on 1,2,4,5-tetrazine is the introduction of 2,4-di-N-oxide functionalities. Based on several examples and through theoretical analysis, the strategy of regioselective introduction of these moieties into 1,2,4,5-tetrazines has been developed. Using this methodology, various new tetrazine structures containing the N-oxide functionality were synthesized and fully characterized using IR, NMR, and mass spectroscopy, elemental analysis, and single-crystal X-ray analysis. Hydrogen peroxide (50 %) was used very effectively in lieu of the usual 90 % peroxide in this system to generate N-oxide tetrazine compounds successfully. Comparison of the experimental densities of N-oxide 1,2,4,5-tetrazine compounds with their 1,2,4,5-tetrazine precursors shows that introducing the N-oxide functionality is a highly effective and feasible method to enhance the density of these materials. The heats of formation for all compounds were calculated with Gaussian 03 (revision D.01) and these values were combined with measured densities to calculate detonation pressures (P) and velocities (νD ) of these energetic materials (Explo 5.0 v. 6.01). The new oxygen-containing tetrazines exhibit high density, good thermal stability, acceptable oxygen balance, positive heat of formation, and excellent detonation properties, which, in some cases, are superior to those of 1,3,5-tritnitrotoluene (TNT), 1,3,5-trinitrotriazacyclohexane (RDX), and octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Effects of lindane, paraquat, toxaphene, and 2,4,5-trichlorophenoxyacetic acid on mallard embryo development

    Science.gov (United States)

    Hoffman, D.J.; Eastin, W.C.

    1982-01-01

    The effects were determined of externally treating mallard (Anas platyrhynchos) eggs with two insecticides (lindane and toxaphene) and two herbicides (paraquat and 2,4,5-T) with formulations and concentrations similar to field applications. Paraquat was the most embryotoxic of the four compounds regardless of the type of vehicle. The LC50 for paraquat was 1.5 lb of active ingredient/ acre in aqueous emulsion and 0.1 lb/acre in the oil vehicle. The other compounds had LC50's that were several orders of magnitude higher. Both paraquat and toxaphene caused some mortality at 1/2 of the field level of application. Paraquat impaired growth and was slightly teratogenic at 1/2 of the field level of application, but required higher concentrations (1.5 to 3 times the field level) to produce brain and visceral defects. Lindane was teratogenic, resulting in multiple defects but only at doses that were greater than five times the field level of application. Toxaphene resulted in defects of the joints at doses close to or exceeding the LC50. The herbicide 2,4,5-T resulted in few toxic effects and relatively few abnormal survivors with gross defects. The overall embryotoxicity with either vehicle was paraquat > lindane > toxaphene > 2,4,5-T on a lb per acre basis. However the potential hazard at exposures of up to five times the field level of application was paraquat > toxaphene; neither lindane nor 2,4,5-T constituted much of a hazard. Both paraquat and lindane were more toxic on a lb-peracre basis when administered in oil vehicle but only paraquat represented a potential hazard at five times the field level of application.

  2. Development of a 4.5 K Pulse Tube Cryocooler for Superconducting Electronics

    Science.gov (United States)

    Nast, Ted; Olson, Jeff; Champagne, Patrick; Mix, Jack; Evtimov, Bobby; Roth, Eric; Collaco, Andre

    2008-03-01

    Lockheed Martin's (LM) Advanced Technology Center (ATC) has developed a four stage pulse tube cryocooler (stirling-type pulse tube system) to provide cooling at 4.5 K for superconducting digital electronics communications programs. These programs utilize superconducting niobium integrated circuits [1, 2]. A prior ATC 4 stage unit has provided cooling to 3.8 K. [3] The relatively high cooling loads for the present program led us to a new design which improves the 4.5 K power efficiency over prior systems. This design includes a unique pulse tube approach using both He-3 and He-4 working gas in two compression spaces. The compressor utilizes our standard moving magnet linear motor, clearance seal and flexure bearing system. The system is compact, lightweight and reliable and utilizes our aerospace cooler technology to provide unlimited lifetime. The unit is a proof of concept, but the construction is at an engineering model level. Follow on activities for improvements of performance and more compact packaging and future production for ground based communication systems is anticipated. This paper presents the experimental results at various cooling conditions. Primary results are shown for HYPRES cooling requirements and data is also included at lower cooling loads that may be required for future space missions. The system provides a maximum of 42 mW @ 4.5 K and a no load temperature of 3 K. The majority of this work was subcontracted by HYPRES and funded by the Army and Navy. A small part of this effort to obtain data at lower cooling loads (1-10 mW @ 4.5 K) was funded by LM internal funds.

  3. Shot reproducibility of the self-magnetic-pinch diode at 4.5 MV

    OpenAIRE

    Nichelle Bennett; M. Dale Crain; Darryl W. Droemer; Raymond E. Gignac; Greg Lare; Isidro Molina; Robert Obregon; Chase C. Smith; Frank L. Wilkins; Dale R. Welch; Steve Cordova; Manuel L. Gallegos; Johnston, Mark D; Mark L. Kiefer; Joshua J. Leckbee

    2014-01-01

    In experiments conducted at Sandia National Laboratories’ RITS-6 accelerator, the self-magnetic-pinch diode exhibits significant shot-to-shot variability. Specifically, for identical hardware operated at the same voltage, some shots exhibit a catastrophic drop in diode impedance. A study is underway to identify sources of shot-to-shot variations which correlate with diode impedance collapse. The scope of this report is limited to data collected at 4.5-MV peak voltage and sources of variabilit...

  4. Conditioned taste aversion to saccharin induced by 2, 4, 5-trichlorophenoxyacetic acid in albino rats.

    Science.gov (United States)

    Sjödén, P O; Archer, T

    1977-07-01

    Four groups of Wistar rats were exposed either to saccharin + 2,4,5-T (taste-aversion group, T-A), saccharin + oil vehicle (taste-aversion control, T-A C), water + 2,4,5-T (enhanced neophobia, E-N), or water + oil (neophobia, N). Rats in the T-A group evidenced a marked aversion to saccharin in 3 consecutive preference tests, performed every third day, starting 3 days after exposure. The aversion was less pronounced, although statistically significant in 2 additional preference tests, performed respectively after a 9-day rest period of ad lib water drinking, and a 24 hr period of forced exposure to saccharin. An enhanced neophobia effect was found in the E-N group in the first preference test. Suggestions are made concerning the possible long-term effects on food preferences among wild-living animals as a result of large-scale application of 2,4,5-T-containing herbicides.

  5. Regulation of Cardiac Gene Expression by GATA-4/5/6.

    Science.gov (United States)

    Evans, T

    1997-04-01

    The identification of nuclear regulatory proteins provides great promise for advancing our understanding of the transcriptional control of cardiac gene expression. Three new members of the GATA family of DNA-binding transcription factors were recently discovered and designated GATA-4/5/6. On the basis of expression patterns, the identification of candidate cardiac target genes and the current understanding of how other GATA factors function in the hematopoietic system, it appears that these genes are important for regulating programs of cardiac development and terminal differentiation. Indeed, a functional role for GATA-4/5/6 in activating the cardiac differentiation program was demonstrated in cell culture and embryonic systems; however, recent results obtained in embryonic stem (ES) cells with a targeted mutation of GATA-4 raise new questions regarding specificity of action among the three genes. The future direction of research in the field is discussed; understanding GATA-4/5/6 function and regulation is likely to provide important insight into the specification and/or differentiation of cardiac progenitors, development and morphogenesis of the heart, and regulation of cardiac-specific gene expression. (Trends Cardiovasc Med 1997;7:75-83). © 1997, Elsevier Science Inc.

  6. On the nature of bright compact radio sources at z>4.5

    CERN Document Server

    Coppejans, Rocco; Cseh, Dávid; Müller, Cornelia; Paragi, Zsolt; Falcke, Heino; Gabányi, Krisztina É; Gurvits, Leonid I; An, Tao; Titov, Oleg

    2016-01-01

    High-redshift radio-loud quasars are used to, among other things, test the predictions of cosmological models, set constraints on black hole growth in the early universe and understand galaxy evolution. Prior to this paper, 20 extragalactic radio sources at redshifts above 4.5 have been imaged with very long baseline interferometry (VLBI). Here we report on observations of an additional ten z>4.5 sources at 1.7 and 5 GHz with the European VLBI Network (EVN), thereby increasing the number of imaged sources by 50%. Combining our newly observed sources with those from the literature, we create a substantial sample of 30 z>4.5 VLBI sources, allowing us to study the nature of these objects. Using spectral indices, variability and brightness temperatures, we conclude that of the 27 sources with sufficient information to classify, the radio emission from one source is from star formation, 13 are flat-spectrum radio quasars and 13 are steep-spectrum sources. We also argue that the steep-spectrum sources are off-axis ...

  7. 1,3-Substituted Imidazolidine-2,4,5-triones: Synthesis and Inhibition of Cholinergic Enzymes

    Directory of Open Access Journals (Sweden)

    Josef Jampilek

    2011-09-01

    Full Text Available A series of novel and highly active acetylcholinesterase and butyrylcholinesterase inhibitors derived from substituted benzothiazoles containing an imidazolidine-2,4,5-trione moiety were synthesized and characterized. The molecular structure of 1-(2,6-diisopropyl-phenyl-3-[(1R-1-(6-fluoro-1,3-benzothiazol-2-ylethyl]-imidazolidine-2,4,5-trione (3g was determined by single-crystal X-ray diffraction. Both optical isomers are present as two independent molecules in the triclinic crystal system. The lipophilicity of the compounds was determined as the partition coefficient log Kow using the traditional shake-flask method. The in vitro inhibitory activity on acetylcholinesterase from electric eel and butyrylcholinesterase isolated from equine serum was determined. The inhibitory activity on acetylcholinesterase was significantly higher than that of the standard drug rivastigmine. The discussed compounds are also promising inhibitors of butyrylcholinesterase, as some of the prepared compounds inhibit butyrylcholinesterase better than the internal standards rivastigmine and galanthamine. The highest inhibitory activity (IC50 = 1.66 μmol/L corresponds to the compound 1-(4-isopropylphenyl-3-[(R-1-(6-fluorobenzo[d]thiazol-2-ylethyl]imidazolidine-2,4,5-trione (3d. For all the studied compounds, the relationships between the lipophilicity and the chemical structure as well as their structure-activity relationships are discussed.

  8. The 4.5K refrigerators for the LHC are all present and correct!

    CERN Document Server

    2004-01-01

    Acceptance procedures for the last of the LHC 4.5 K refrigerators have been completed at Point 6. All that now remains to be done, to have the LHC refrigeration system ready by the end of 2005, is to upgrade the refrigerators recovered from LEP and install the 1.8 K cooling system. By now you will be well aware that the LHC's superconducting magnets cannot operate unless they are cooled to 1.8 K (-271°C) (see Bulletin 13-14/2002). Eight 4.5 K refrigerators, one for each sector of the LHC, are required to achieve this. In December last year the last of these refrigerators, specially designed for the LHC, was accepted at Point 6. "It is a big step forwards for the LHC's refrigeration system, as it takes its cooling capacity at 4.5 K to 140 kW, that is to say almost 40,000 litres of liquid helium per hour, a capacity never previously attained. The progress achieved since the days of LEP is impressive, particularly if one bears in mind the extent of the infrastructure required, " (see...

  9. Inositol 1,4,5-trisphosphate 3-kinases: functions and regulations

    Institute of Scientific and Technical Information of China (English)

    Hui Jun XIA; Guang YANG

    2005-01-01

    Inositol 1,4,5-trisphosphate 3-kinase (IP3 3-kinase/IP3K) plays an important role in signal transduction in animal cells by phosphorylating inositol 1,4,5-trisphosphate (IP3) to inositol 1,3,4,5-tetrakisphosphate (IP4). Both IP3 and IP4 are critical second messengers which regulate calcium (Ca2+) homeostasis. Mammalian IP3Ks are involved in many biological processes, including brain development, memory, learning and so on. It is widely reported that Ca2+ is a canonical second messenger in higher plants. Therefore, plant IP3K should also play a crucial role in plant development. Recently,we reported the identification of plant IP3K gene (AtIpk2β/AtIP3K) from Arabidopsis thaliana and its characterization.Here, we summarize the molecular cloning, biochemical properties and biological functions of IP3Ks from animal, yeast and plant. This review also discusses potential functions of IP3Ks in signaling crosstalk, inositol phosphate metabolism,gene transcriptional control and so on.

  10. Radio spectra of bright compact sources at z > 4.5

    Science.gov (United States)

    Coppejans, Rocco; van Velzen, Sjoert; Intema, Huib T.; Müller, Cornelia; Frey, Sándor; Coppejans, Deanne L.; Cseh, Dávid; Williams, Wendy L.; Falcke, Heino; Körding, Elmar G.; Orrú, Emanuela; Paragi, Zsolt; Gabányi, Krisztina É.

    2017-05-01

    High-redshift quasars are important to study galaxy and active galactic nuclei evolution, test cosmological models and study supermassive black hole growth. Optical searches for high-redshift sources have been very successful, but radio searches are not hampered by dust obscuration and should be more effective at finding sources at even higher redshifts. Identifying high-redshift sources based on radio data is, however, not trivial. Here we report on new multifrequency Giant Metrewave Radio Telescope observations of eight z > 4.5 sources previously studied at high angular resolution with very long baseline interferometry (VLBI). Combining these observations with those from the literature, we construct broad-band radio spectra of all 30 z > 4.5 sources that have been observed with VLBI. In the sample we found flat, steep and peaked spectra in approximately equal proportions. Despite several selection effects, we conclude that the z > 4.5 VLBI (and likely also non-VLBI) sources have diverse spectra and that only about a quarter of the sources in the sample have flat spectra. Previously, the majority of high-redshift radio sources were identified based on their ultrasteep spectra. Recently, a new method has been proposed to identify these objects based on their megahertz-peaked spectra. No method would have identified more than 18 per cent of the high-redshift sources in this sample. More effective methods are necessary to reliably identify complete samples of high-redshift sources based on radio data.

  11. Dephosphorylation Pathway of D-myo-Inositol 1,4,5-trisphosphate in the Unicellular Green Alga Chlamydomonas eugametos

    NARCIS (Netherlands)

    Klerk, Hans; Himbergen, John A.J. van; Musgrave, Alan; Haastert, Peter J.M. van; Ende, Herman van den

    1994-01-01

    In vitro dephosphorylation of D-myo-inositol 1,4,5-trisphosphate [Ins(l,4,5)P-3] by vegetative cells, gametes and zygotes of the green alga Chlamydomonas eugametos was studied using a soluble cell fraction as enzyme source and labelled Ins(1,4,5)P-3 as substrate. This compound was dephosphorylated y

  12. A Competition Binding Assay for Determination of the Inositol (1,4,5)-Trisphosphate Content of Human Leucocytes

    NARCIS (Netherlands)

    Nibbering, Peter H.; Zomerdijk, Timo P.L.; Haastert, Peter J.M. van; Furth, Ralph van

    1990-01-01

    We developed a competition binding assay for estimation of the intracellular inositol (1,4,5)-trisphosphate (Ins(1,4,5)P3) and optimalized it for the measurement of the Ins(1,4,5)P3 content of human blood leucocytes. The present method is considerably cheaper and requires five times fewer cells than

  13. Two dephosphorylation pathways of inositol 1,4,5-trisphosphate in homogenates of the cellular slime mould Dictyostelium discoideum

    NARCIS (Netherlands)

    Lookeren Campagne, Michiel M. van; Erneux, Cristophe; Eijk, Ronald van; Haastert, Peter J.M. van

    1988-01-01

    Dictyostelium discoideum homogenates contain phosphatase activity which rapidly dephosphorylates Ins(1,4,5)P3 (D-myo-inositol 1,4,5-trisphosphate) to Ins (myo-inositol). When assayed in Mg2+, Ins(1,4,5)P3 is dephosphorylated by the soluble Dictyostelium cell fraction to 20% Ins(1,4)P2 (D-myo-inosito

  14. PtdIns(3,4,5)P3 is a regulator of myosin-X localization and filopodia formation

    DEFF Research Database (Denmark)

    Plantard, Laure; Arjonen, Antti; Lock, John G

    2010-01-01

    Phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3] is a key regulator of cell signaling that acts by recruiting proteins to the cell membrane, such as at the leading edge during cell migration. Here, we show that PtdIns (3,4,5)P3 plays a central role in filopodia formation via the bindi...

  15. Two new G gamma chain variants: Hb F-Saint-Etienne [G gamma 79(EF3)Asp-->His] and Hb F-Lyon [G gamma 97(FG4)His-->Arg].

    Science.gov (United States)

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Berger, Claire; Perier, Christian; Barro, Claire; Francina, Alain

    2008-01-01

    Two new fetal hemoglobin (Hb F) variants affecting the (G)gamma chain are reported: Hb F-Saint-Etienne [G gamma 79(EF3)Asp-->His] and Hb F-Lyon [G gamma 97(FG4)His-->Arg]. These new Hb variants were found during a neonatal screening for hemoglobinopathies but characterized a few months later by our reference laboratory. The corresponding mutations are located on the external part of the Hb molecule and seem to be clinically silent.

  16. SYNSYSTEMATIQUE DES PRAIRIES DE FRANCE (SYNSYSTEMATIC OF THE MEADOWS OF FRANCE

    Directory of Open Access Journals (Sweden)

    J.M. GEHU

    1999-01-01

    Full Text Available The synsystematic diagram of the meadows of France proposed in this work enumerates the main associations and the prairial superior unities of France giving them their great synecological features. The majority of these communities of meadows are usable in cutting or in pasture. They are grouped in the three following classes: Arrhenatheretea elatioris, Molinio-Juncetea and Agrostietea stoloniferae.

  17. Geology of uranium vein-deposits in France; Geologie des gites uraniferes et filoniens en France

    Energy Technology Data Exchange (ETDEWEB)

    Sarcia, J.A.; Carrat, J.; Poughon, A.; Sanselme, H. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    This paper gives an outline of the characteristics of the main uranium vein deposits in France; it underlines the structural, petrographic and metallogenic similarities of these deposits. (author) [French] La note presente est un expose des caracteres generaux des principaux gites uraniferes filoniens de France; elle insiste sur les similitudes structurales, petrographiques et metallogeniques de ces gisements. (auteur)

  18. Transformando lo local desde el medio ambiente: las políticas ambientales en las ciudades de Lyon, Francia, y Aguascalientes, México (1990-2002

    Directory of Open Access Journals (Sweden)

    Carlos Gil-García

    2012-01-01

    Full Text Available En este trabajo se presenta un análisis de políticas urbano-ambientales a través de dos estudios de caso: la comunidad urbana de Lyon, en Francia, y la ciudad de Aguascalientes, México, en un periodo de doce años (1990-2002. El objetivo es analizar el diseño y aplicación de políticas, así como sus principales efectos en el territorio urbano, en la gestión pública y en la participación ciudadana en ambas ciudades. Los estudios presentan elementos importantes de transformación centrados en el medio ambiente como detonador de cambio una vez que se toman experiencias, ideas y políticas de organismos supranacionales, enfocándolos a la necesidad de posicionar a las ciudades como ejes diferenciadores e integradores de gestión ambiental.

  19. [Clause Pouteau (1725-1775), surgeon at the l'Hôtel-Dieu de Lyon: his "asepsis" using water, fire and ligne propre].

    Science.gov (United States)

    Fischer, L; Touil, K

    1998-01-01

    Claude Pouteau, Hôtel-Dieu de Lyon's surgeon (1725-1775), did not improve surgical teaching, as Mareschal or Lapeyronie did with their reforming law. But he is reminiscent of an extremely skilful surgeon, always having a remarkable high rate of recoveries. For instance when it came to operate on bladder with a perineal approach (vesical cut), only three patients died out of one hundred and twenty operations. One century before Semmelweiss and more earlier than Pasteur, Pouteau thought that hospital-gangrene was not only caused by air miasma but also by direct contact, which could be indebted dirty instruments or hands, or hospital-made bandages. So he advised impeccably cleanliness for surgical students. According to his mind, soap was inadequate for cleaning hospital linen. Those must be pull out of neat material fitted by clean hands out of hospitals. It shall be supplied every day and never gathered inside. In order to keep clear of gangrene, the patient will not wait too long inside hospital. In case of bleeding, cautery must preferable to ligature for Pouteau "We can do without the bitter sadness of seeing a lighter wound become a lethal or incurable one ..." (Posthumous works, vol. III, p. 237-238).

  20. Perícia e transformação dos conflitos ambientais nas grandes obras. O caso da nova linha ferroviária Turim‑Lyon

    Directory of Open Access Journals (Sweden)

    Micol Maggiolini

    2013-10-01

    Full Text Available As grandes obras e os conflitos locais que cada vez mais os acompanham oferecem pontos de reflexão sobre a crise ecológica e a evolução das dinâmicas democráticas. O artigo, a partir do caso do principal conflito territorial ligado à linha ferroviária Turim‑Lyon, apresenta um exemplo de alfabetização técnica das populações locais promovida por um movimento e interroga‑se sobre os efeitos que produz nas dinâmicas do conflito e sobre a sua gestão. As conclusões destacam como este processo de aprendizagem criou uma emancipação da cidadania, que acresceu a própria capacidade de relação com as partes opostas, e como o confronto num plano técnico pode facilitar a redução do conflito mas apenas em determinadas condições: na sua ausência o risco de uma radicalização parece antes ser concreto.

  1. [Epidemiology of tuberculosis in France in 2008].

    Science.gov (United States)

    Che, D; Antoine, D

    2011-07-01

    A total of 5,758 tuberculosis cases were notified in France in 2008, giving a rate of nine cases per 100,000 inhabitants. The median age was 45 years and 59% of cases were male patients. Île-de-France (Paris and greater Paris area) and French Guiana had the highest notification rate in 2008 (17.9/10(5) and 22.6/10(5) respectively). The rate of tuberculosis was higher in individuals born abroad (43.2/10(5) vs. 5.0/10(5) for individuals born in France), especially those recently arrived in France. Pulmonary tuberculosis accounted for 72% of notified cases, 76% of which were potentially contagious (positive sputum smear, or culture). Compared to 2007, the number of notified tuberculosis cases increased by 3.3% in 2008. This increase was not accompanied by a rise of severe cases (meningitis and miliary TB); this seemed to be due partly to improvement in identification and notification of cases. However this trend could require specific monitoring in future years. A national tuberculosis control program was launched in France in 2007, aiming at reducing epidemiological disparities. Clinical and public health expertise needs to be maintained on all the territory to ensure that implemented measures can have the expected impact on the epidemiology of the disease.

  2. Crystal structures of three 3,4,5-trimethoxybenzamide-based derivatives

    Directory of Open Access Journals (Sweden)

    Ligia R. Gomes

    2016-05-01

    Full Text Available The crystal structures of three benzamide derivatives, viz. N-(6-hydroxyhexyl-3,4,5-trimethoxybenzamide, C16H25NO5, (1, N-(6-anilinohexyl-3,4,5-trimethoxybenzamide, C22H30N2O4, (2, and N-(6,6-diethoxyhexyl-3,4,5-trimethoxybenzamide, C20H33NO6, (3, are described. These compounds differ only in the substituent at the end of the hexyl chain and the nature of these substituents determines the differences in hydrogen bonding between the molecules. In each molecule, the m-methoxy substituents are virtually coplanar with the benzyl ring, while the p-methoxy substituent is almost perpendicular. The carbonyl O atom of the amide rotamer is trans related with the amidic H atom. In each structure, the benzamide N—H donor group and O acceptor atoms link the molecules into C(4 chains. In 1, a terminal –OH group links the molecules into a C(3 chain and the combined effect of the C(4 and C(3 chains is a ribbon made up of screw related R22(17 rings in which the ...O—H... chain lies in the centre of the ribbon and the trimethoxybenzyl groups forms the edges. In 2, the combination of the benzamide C(4 chain and the hydrogen bond formed by the terminal N—H group to an O atom of the 4-methoxy group link the molecules into a chain of R22(17 rings. In 3, the molecules are linked only by C(4 chains.

  3. Cost-effectiveness of thrombolysis within 4.5 hours of acute ischemic stroke in China.

    Directory of Open Access Journals (Sweden)

    Yuesong Pan

    Full Text Available BACKGROUND: Previous economic studies conducted in developed countries showed intravenous tissue-type plasminogen activator (tPA is cost-effective for acute ischemic stroke. The present study aimed to determine the cost-effectiveness of tPA treatment in China, the largest developing country. METHODS: A combination of decision tree and Markov model was developed to determine the cost-effectiveness of tPA treatment versus non-tPA treatment within 4.5 hours after stroke onset. Outcomes and costs data were derived from the database of Thrombolysis Implementation and Monitor of acute ischemic Stroke in China (TIMS-China study. Efficacy data were derived from a pooled analysis of ECASS, ATLANTIS, NINDS, and EPITHET trials. Costs and quality-adjusted life-years (QALYs were compared in both short term (2 years and long term (30 years. One-way and probabilistic sensitivity analyses were performed to test the robustness of the results. RESULTS: Comparing to non-tPA treatment, tPA treatment within 4.5 hours led to a short-term gain of 0.101 QALYs at an additional cost of CNY 9,520 (US$ 1,460, yielding an incremental cost-effectiveness ratio (ICER of CNY 94,300 (US$ 14,500 per QALY gained in 2 years; and to a long-term gain of 0.422 QALYs at an additional cost of CNY 6,530 (US$ 1,000, yielding an ICER of CNY 15,500 (US$ 2,380 per QALY gained in 30 years. Probabilistic sensitivity analysis showed that tPA treatment is cost-effective in 98.7% of the simulations at a willingness-to-pay threshold of CNY 105,000 (US$ 16,200 per QALY. CONCLUSIONS: Intravenous tPA treatment within 4.5 hours is highly cost-effective for acute ischemic strokes in China.

  4. Crystal structures of three 3,4,5-tri-meth-oxy-benzamide-based derivatives.

    Science.gov (United States)

    Gomes, Ligia R; Low, John Nicolson; Oliveira, Catarina; Cagide, Fernando; Borges, Fernanda

    2016-05-01

    The crystal structures of three benzamide derivatives, viz. N-(6-hy-droxy-hex-yl)-3,4,5-tri-meth-oxy-benzamide, C16H25NO5, (1), N-(6-anilinohex-yl)-3,4,5-tri-meth-oxy-benzamide, C22H30N2O4, (2), and N-(6,6-di-eth-oxy-hex-yl)-3,4,5-tri-meth-oxy-benzamide, C20H33NO6, (3), are described. These compounds differ only in the substituent at the end of the hexyl chain and the nature of these substituents determines the differences in hydrogen bonding between the mol-ecules. In each mol-ecule, the m-meth-oxy substituents are virtually coplanar with the benzyl ring, while the p-meth-oxy substituent is almost perpendicular. The carbonyl O atom of the amide rotamer is trans related with the amidic H atom. In each structure, the benzamide N-H donor group and O acceptor atoms link the mol-ecules into C(4) chains. In 1, a terminal -OH group links the mol-ecules into a C(3) chain and the combined effect of the C(4) and C(3) chains is a ribbon made up of screw related R 2 (2)(17) rings in which the ⋯O-H⋯ chain lies in the centre of the ribbon and the tri-meth-oxy-benzyl groups forms the edges. In 2, the combination of the benzamide C(4) chain and the hydrogen bond formed by the terminal N-H group to an O atom of the 4-meth-oxy group link the mol-ecules into a chain of R 2 (2)(17) rings. In 3, the mol-ecules are linked only by C(4) chains.

  5. Prevalence and genetic diversity of the intestinal parasites Blastocystis sp. and Cryptosporidium spp. in household dogs in France and evaluation of zoonotic transmission risk.

    Science.gov (United States)

    Osman, Marwan; Bories, Jessica; El Safadi, Dima; Poirel, Marie-Thérèse; Gantois, Nausicaa; Benamrouz-Vanneste, Sadia; Delhaes, Laurence; Hugonnard, Marine; Certad, Gabriela; Zenner, Lionel; Viscogliosi, Eric

    2015-11-30

    Several parasites including the protozoa Blastocystis sp. and Cryptosporidium spp. may be causative agents of gastrointestinal symptoms in domestic dogs, and there may be a potential risk of transmission to owners. While France is one of the largest European countries in terms of its canine population, little data is available about the molecular epidemiology of these two parasites. The purpose of this study was to determine the prevalence of intestinal parasites in household dogs in France, and to evaluate the zoonotic risk of Blastocystis sp. and Cryptosporidium spp. by genotyping the corresponding isolates. To this end, 116 faecal samples were collected from household dogs regardless of breed, age or gender, living in the Lyons area, France. Various intestinal protozoa and helminths were identified by light microscopy. Screening for Blastocystis sp. and Cryptosporidium spp. were subsequently performed by PCR targeting the small subunit (SSU) rDNA coding region, followed by direct sequencing of the PCR products and analysis of the sequences obtained for genotyping. The overall prevalence of dogs infected with at least one gastrointestinal parasite was 42.2% (49/116). After light microscopy examination of faecal samples, the most common parasites found were the protozoa Giardia sp. (25.0%) and Cystoisospora sp. (19.8%). Using molecular methods, four dogs (3.4%) were shown to be infected by Blastocystis sp. and carried either subtype (ST) 2, commonly identified in various animal groups, or ST10, frequently found in bovids. Three dogs (2.6%) were positive for C. canis, infecting humans episodically. The low prevalence of both parasites, combined with the identification of C. canis and Blastocystis sp. ST2 and ST10 in the canine population, strongly suggests that dogs play a negligible role as zoonotic reservoirs for both parasites and do not seem to be natural hosts of Blastocystis sp.

  6. Zirconium phosphonate/1,4,5,8-naphthalenediimides self-assembled films

    Directory of Open Access Journals (Sweden)

    MAGALI A. RODRIGUES

    2000-03-01

    Full Text Available The formation and characterization of self-assembled films of zirconium phosphonate / N,N'-di(2-phosphonoethyl-1,4,5,8-naphthalenediimide (DPN is presented. The films were produced on glass substrates by deposition of alternating layers of Zr+4 and DPN. Films containing up to 16 layers on each side of the substrate were obtained and monitored by absorption spectroscopy and ellipsometry. When irradiated, the initially colorless films turned to a persistent pinky color reminiscent of that of DPN anion radical. These films are a promising material to the development of photovoltaic devices.

  7. Accurate labeling of the light-actinide O4,5 ionization edges

    Energy Technology Data Exchange (ETDEWEB)

    Moore, K; der Laan, G v

    2006-08-23

    In this short article the accurate labeling of the O4,5 edges of the light actinides is addressed. The O4 and O5 edges are both contained in what is termed the ''giant resonance'' and the smaller ''pre-peak'' that is observed is a consequence of first-order perturbation by the 5d spin-orbit interaction. Thus, the small prepeak in the actinide 5d {yields} 5f transition should not be labeled the O5 peak, but rather the {Delta}S=1 peak.

  8. 5-Isopropylidene-1,3-dithiolo[4,5-d][1,3]dithiole-2-thione

    Directory of Open Access Journals (Sweden)

    Yoshiro Yamashita

    2009-05-01

    Full Text Available The title compound, C7H6S5, contains a 5-ylidene-1,3-dithiolo[4,5-d][1,3]dithiole-2-thione framework, which is an important synthetic precursor of multi-dimensional organic superconductors and conductors. The molecular framework is planar with an r.m.s. deviation of 0.012 Å for the non-H atoms. In the crystal structure, molecules are linked by short intermolecular S...S interactions [3.501 (5 and 3.581 (4 Å], constructing a zigzag molecular tape network along the c axis.

  9. Issues Identified During September 2016 IBM OpenMP 4.5 Hackathon

    Energy Technology Data Exchange (ETDEWEB)

    Richards, David F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-03-15

    In September, 2016 IBM hosted an OpenMP 4.5 Hackathon at the TJ Watson Research Center. Teams from LLNL, ORNL, SNL, LANL, and LBNL attended the event. As with the 2015 hackathon, IBM produced an extremely useful and successful event with unmatched support from compiler team, applications staff, and facilities. Approximately 24 IBM staff supported 4-day hackathon and spent significant time 4-6 weeks out to prepare environment and become familiar with apps. This hackathon was also the first event to feature LLVM & XL C/C++ and Fortran compilers. This report records many of the issues encountered by the LLNL teams during the hackathon.

  10. Interactive data based on Apriori - AHP - C4.5 results assessment method

    Science.gov (United States)

    Zhao, Quan; Zhang, Li

    2017-05-01

    AHP method for weight calculation method, will introduce the subjective concept of "experts, supposed steps", for the objective result has certain uncertainty, causes the classroom interaction data attribute weights proportion difference is not big, the whole class achievement trend of convergence, introduce the concept of Apriori-AHP. C4.5 is used to calculate the weight of attribute column, and then using the Apriori-AHP algorithm calculate attribute weights, attribute importance weights on judgment performance indicators table overall consideration, with the weight of index table of gifted student achievement, make the class performance trends to fluctuate, have tended to be "standard" real results for teacher reference.

  11. (Z-3-(1-Benzofuran-2-yl-2-(3,4,5-trimethoxyphenylacrylonitrile

    Directory of Open Access Journals (Sweden)

    Sean Parkin

    2012-03-01

    Full Text Available In the title compound, C20H17NO4, the double bond of the acrylonitrile group separating the 1-benzofuran moiety from the 3,4,5-trimethoxyphenyl ring has Z geometry. The 1-benzofuran groups are π–π stacked with inversion-related counterparts such that the furan ring centroid–centroid distance is 3.804 (5 Å. The dihedral angle between the planes of the trimethoxyphenyl ring and the acrylonitrile group is 24.2 (2°.

  12. Synthesis and Biological Activity of Novel (E-N’-(Substituted-3,4,5-Trimethoxybenzohydrazide Analogs

    Directory of Open Access Journals (Sweden)

    Namala Rambabu

    2017-02-01

    Full Text Available The hydrazide-hydrazone analogs 4a-4l is described via the condensation of3,4,5-trimethoxybenzohydrazide 3 with various aromatic and hetero aromatic aldehydes a-l. Various spectroscopic techniques viz., (1H NMR, 13C NMR, IR and MS were utilized to determine the structures of synthesized compounds. These compounds were evaluated for antibacterial, antifungal screening against S.aureus, S.pyogenes, E.coli, P.aeruginosa, Aspergillusnigerand Candida albicans(Fungal strains. The results revealed that most of the hydrazone derivatives exhibited significant antibacterial activity. Furthermore, the synthesized hydrazone derivatives were found to exhibit significant antidiabetic activity when compared to insulin.

  13. Lipschitz equivalence of generalized {1,3,5}-{1,4,5} self-similar sets

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    This paper investigates the Lipschitz equivalence of generalized {1,3,5}-{1,4,5} self-similar sets D = (r1D) ∪ (r2D + (1 + r1 - r2 - r3)/2) ∪ (r3D + 1 - r3) and E = (r1E) ∪ (r2E + 1 - r2 -r3) ∪ (r3E + 1 - r3),and proves that D and E areLipschitz equivalent if and only if there are positive integers m and n such that rm1= rn3.

  14. Tetraaqua(4,5-diazafluoren-9-one-κ2N,N′nickel(II dinitrate

    Directory of Open Access Journals (Sweden)

    Meng Guo

    2009-11-01

    Full Text Available The title compound, [Ni(C11H6N2O(H2O4](NO32, was prepared by the reaction of Ni(NO32 and 4,5-diazafluoren-9-one (dafo. The crystal packing consists of a three-dimensional network via O—H...O hydrogen bonds between the coordinated water molecules and the nitrate anions. The Ni atom lies on a special position (Wyckoff position 4e, site symmetry 2, as does the carbonyl O atom.

  15. Lyα luminosity functions at redshift z ≈ 4.5

    Science.gov (United States)

    Zheng, Zhen-Ya; Finkelstein, Steven L.; Finkelstein, Keely; Tilvi, Vithal; Rhoads, James E.; Malhotra, Sangeeta; Wang, Jun-Xian; Miller, Neal; Hibon, Pascale; Xia, Lifang

    2013-06-01

    We present a spectroscopically confirmed sample of Lyman α emitting galaxies (LAEs) at z ˜ 4.5 in the Extended Chandra Deep Field-South (ECDFS), which we combine with a sample of z ˜ 4.5 LAEs from previous narrow-band surveys from the Large Area Lyman Alpha (LALA) survey to build a unified Lyα luminosity function. We spectroscopically observed 64 candidate LAEs in the ECDFS, confirming 46 objects as z ˜ 4.5 LAEs based on single-line detections with no continuum emission bluewards of the line, resulting in a Lyα confirmation rate of ˜70 per cent. We did not detect significant flux from neither the C IV λ1549 Å emission line nor the He II λ1640 Å emission line in individual LAE spectra. These lines were also undetected in a co-added spectrum, with the co-added line ratio of He II to Lyα constraining the Population III star formation rate (SFR) to be 3. Similar luminosity function differences have been used to infer evolution in the neutral gas fraction in the intergalactic medium at z > 6, yet here the difference is likely due to cosmic variance, given that the two samples are from adjoining line-of-sight volumes. Combining our new sample of LAEs with those from previous LALA narrow-band surveys at z = 4.5, we obtain one of the best measured Lyα luminosity functions to date, with our sample of over 200 spectroscopically confirmed Lyα galaxies yielding log10(L*) = 42.83 ± 0.06 (erg s-1) and log10(Φ*) = -3.48 ± 0.09 (Mpc-3). We compare our new luminosity function to others from the literature to study the evolution of the Lyα luminosity density at 0 < z < 7. We find tentative evidence for evolution in the product L*Φ*, which approximately tracks the cosmic SFR density, but since field-to-field and survey-to-survey variations are in some cases as large as the possible evolution, some caution is needed in interpreting this trend.

  16. Lyα-Emitting Galaxies at Redshift z~ 4.5 in the LALA Cetus Field

    Science.gov (United States)

    Wang, Jun-Xian; Malhotra, Sangeeta; Rhoads, James E.; Zhang, Hao-Tong; Finkelstein, Steven L.

    2009-11-01

    We present a large sample of Lyα-emitting galaxies (LAEs) spectroscopically confirmed at redshift z ≈ 4.5, based on Inamori-Magellan Areal Camera and Spectrograph spectroscopic observations of candidate z≈ 4.5 Lyα-emitting galaxies in the large area Lyman alpha (LALA) narrowband imaging survey Cetus field. We identify 110 of them as z ≈ 4.5 Lyα emitters based on single-line detections with no continuum emission blueward of the line. Six foreground galaxies are identified, either based on multiple lines or blueward continuum emission. The Lyα confirmation rate varies from <50% to 76% for candidates selected in different narrowband filters at slightly different redshifts. We find a drop in the LAE density at redshift 4.50 ± 0.03 from redshift 4.39 to 4.47 by a factor of 66%, which could be a large-scale void in the distribution of star-forming galaxies (~18 Mpc along the line of sight and ~80 Mpc across). The sample includes many objects with equivalent widths (EWs) gsim200 Å. These large EW candidates are spectroscopically confirmed at the same rate as candidates with more modest EWs. A composite spectrum of all 110 confirmed LAEs shows the characteristic asymmetry of the Lyα line. It also places new and stringent upper limits on the C IV 1549 Å/Lyα and He II 1640 Å/Lyα line ratios, providing a new upper limit on the fraction of active galactic nuclei in Lyα selected galaxy samples, and on the contribution of Pop III populations. Finally, we calculate the Lyα luminosity function for our z ≈ 4.5 sample, which is consistent with those at other redshifts, showing that there is no evolution in Lyα luminosity function from z = 3.1 to 6.6. This paper includes data gathered with the 6.5 meter Magellan Telescopes located at Las Campanas Observatory, Chile.

  17. Synthesis of inositol phosphate-based competitive antagonists of inositol 1,4,5-trisphosphate receptors

    OpenAIRE

    Konieczny, Vera; Stefanakis, John G.; Sitsanidis, Efstratios; Ioannidou, Natalia-Anastasia T.; Papadopoulos, Nikolaos V.; Fylaktakidou, Konstantina C.; Taylor, Colin W.; Koumbis, Alexandros E.

    2016-01-01

    This is the final version of the article. It first appeared from the Royal Chemistry Society via http://dx.doi.org/10.1039/C5OB02623G Inositol 1,4,5-trisphosphate receptors (IP3R) are intracellular Ca²⁺ channels that are widely expressed in animal cells, where they mediate the release of Ca²⁺ from intracellular stores evoked by extracellular stimuli. A diverse array of synthetic agonists of IP3Rs has defined structure-activity relationships, but existing antagonists have severe limitations...

  18. [Pneumococcal vaccination in France among adults].

    Science.gov (United States)

    Dubois, Gérard

    2002-01-01

    Pneumococcal vaccination has for long be controversial but has today a proven efficacy and efficiency in preventing pneumococcal pneumonia, especially their most serious expressions leading to hospitalisation or death. France has an exceptional situation, as it is one of the developed country with the lowest rate of vaccination. This is the result of restrictive, maladjusted and discrepant recommendations of different commissions and committees. The gap is even more glaring with the flue vaccination program which has nearly the same medical indications. France was the first country in the world to set up a flue vaccination program for the elderly and some chronic conditions, and this program is an obvious success. For the twentieth anniversary of this program, his author propose to extend it to pneumococcal vaccination for a better prevention of what is the first cause of death from infectious disease in France with 6000 to 13000 deaths per year.

  19. Chinese Liyuan Opera Troupe in France

    Institute of Scientific and Technical Information of China (English)

    HaoZhongwei

    2004-01-01

    The China Fujian Liyuan Opera Troupe visited France from October 16 to 21, 2003 and staged a special performance at the Theatre of the City of Paris(Theatre de la Ville de Paris) on October 20. The performance was one of the major items on the list of opera shows during the “China Culture Year” held in France. The plan to send a Chinese local opera troupe to take part in the “China Culture Year” was worked out jointly by the CPAFFC and Pierre-Jean de San Bartolome, cultural attache of the French Embassy in China.

  20. Eudora Welty in France: Questions of Obliqueness

    OpenAIRE

    Jacques Pothier

    2010-01-01

    Ten years ago the Summer 1999 issue of the Eudora Welty Newsletter opened on a section on “Welty and France”. The main article, “A Translator’s Perspective” was by Welty’s chief translator in France, Michel Gresset. Gresset lamented that Welty “had not fared as well” in France as other Southern writers like Faulkner or O’Connor, and he wondered if it was because she had not been translated by Maurice Edgar Coindreau. Michel Gresset’s article traced the history of the late and haphazard story ...

  1. Eudora Welty in France: Questions of Obliqueness

    Directory of Open Access Journals (Sweden)

    Jacques Pothier

    2010-02-01

    Full Text Available Ten years ago the Summer 1999 issue of the Eudora Welty Newsletter opened on a section on “Welty and France”. The main article, “A Translator’s Perspective” was by Welty’s chief translator in France, Michel Gresset. Gresset lamented that Welty “had not fared as well” in France as other Southern writers like Faulkner or O’Connor, and he wondered if it was because she had not been translated by Maurice Edgar Coindreau. Michel Gresset’s article traced the history of the late and haphazard story ...

  2. Eudora Welty in France: Questions of Obliqueness

    OpenAIRE

    Jacques Pothier

    2010-01-01

    Ten years ago the Summer 1999 issue of the Eudora Welty Newsletter opened on a section on “Welty and France”. The main article, “A Translator’s Perspective” was by Welty’s chief translator in France, Michel Gresset. Gresset lamented that Welty “had not fared as well” in France as other Southern writers like Faulkner or O’Connor, and he wondered if it was because she had not been translated by Maurice Edgar Coindreau. Michel Gresset’s article traced the history of the late and haphazard story ...

  3. Synthesis and characterization of copolymers 4,5-dihydroisoxazole and (-)-menthyl acrylates; Sintese e caracterizacao de copolimeros de cadeia lateral derivados de acrilatos de 4,5-di-hidroisoxazol e do (-)-mentol

    Energy Technology Data Exchange (ETDEWEB)

    Passo, Joel A.; Merlo, Aloir A. [Universidade Federal do Rio Grande do Sul, Porto Alegre, RS (Brazil). Inst. de Quimica; Eccher, Juliana; Bechtold, Ivan H. [Universidade Federal de Santa Catarina, Florianopolis, SC (Brazil). Campus Universitario Trindade. Dept. de Fisica; Kelly, Stephen M., E-mail: aloir@iq.ufrgs.br [University of Hull, Hull (United Kingdom). Dept. of Chemistry

    2012-07-01

    Five monomers 5-[4-(5-cyano-4,5-dihydroisoxazol-3-yl)phenoxy]undecyl acrylate (7a); n-alkyl 3-{l_brace}4-[5-(acryloyloxyundecyl)oxyphenyl]{r_brace}-4,5-dihydroisoxazole-5-carboxylate (7b,c for n-butyl and n-hexyl, respectively); 3-{l_brace}4-[5-(acryloyloxyundecyl) oxyphenyl]{r_brace}-4,5-dihydroisoxazole-5-carboxylic acid (7d) and (1R,2S,5R)-2-isopropyl-5-methylcyclohexyl acrylate (9) and the corresponding copolymers 10a-d,11 and homopolymers 12 from 7a and 13 from 9 were designed and synthesized. Except for acrylate 9 which is derived from (-)-menthol, all of the monomers belong to the series containing the isoxazoline ring linked to the acrylate unit by a flexible spacer chain of eleven methylene units. They presented low glass temperature and despite birefringence behavior, these copolymers showed no mesomorphic properties. (author)

  4. Crystal structure of ethylenedioxytetrathiafulvalene-4,5-bis(thiolbenzoic acid 0.25-hydrate

    Directory of Open Access Journals (Sweden)

    Yuanyuan Zhang

    2017-09-01

    Full Text Available In the title compound (systematic name: 4,4′-{[2-(5,6-dihydro-[1,3]dithiolo[4,5-b][1,4]dioxin-2-ylidene-1,3-dithiole-4,5-diyl]bis(sulfanediyl}dibenzoic acid 0.25-hydrate, C22H14O6S6·0.25H2O, the tetrathiafulvalene (TTF core adopts a boat conformation, where the central S2C=CS2 plane makes dihedral angles of 31.34 (4 and 26.83 (6°, respectively, with the peripheral S2C=CS2 and S2C2O2 planes. In the crystal, the benzoic acid molecules are linked via O—H...O hydrogen bonds, forming inversion dimers with R22(8 motifs. The dimers are linked through weak C—H...O hydrogen bonds into a chain structure along [-101]. The chains stack along the a axis through S...S and S...C short contacts, forming layers parallel to the ac plane.

  5. The ALMA Patchy Deep Survey: A blind search for [CII] emitters at z~4.5

    CERN Document Server

    Matsuda, Y; Iono, D; Hatsukade, B; Kohno, K; Tamura, Y; Yamaguchi, Y; Shimizu, I

    2015-01-01

    We present a result of a blind search for [CII] 158 $\\mu$m emitters at $z\\sim 4.5$ using ALMA Cycle~0 archival data. We collected extra-galactic data covering at 330-360 GHz (band~7) from 8 Cycle~0 projects from which initial results have been already published. The total number of fields is 243 and the total on-source exposure time is 19.2 hours. We searched for line emitters in continuum-subtracted data cubes with spectral resolutions of 50, 100, 300 and 500 km/s. We could not detect any new line emitters above a 6-$\\sigma$ significance level. This result provides upper limits to the [CII] luminosity function at $z\\sim 4.5$ over $L_{\\rm [CII]} \\sim 10^8 - 10^{10} L_{\\odot}$ or star formation rate, SFR $\\sim$ 10-1000 M$_{^\\odot}$/yr. These limits are at least 2 orders of magnitude larger than the [CII] luminosity functions expected from the $z \\sim 4$ UV luminosity function or from numerical simulation. However, this study demonstrates that we would be able to better constrain the [CII] luminosity function a...

  6. Identification of nuclear phosphatidylinositol 4,5-bisphosphate-interacting proteins by neomycin extraction.

    Science.gov (United States)

    Lewis, Aurélia E; Sommer, Lilly; Arntzen, Magnus Ø; Strahm, Yvan; Morrice, Nicholas A; Divecha, Nullin; D'Santos, Clive S

    2011-02-01

    Considerable insight into phosphoinositide-regulated cytoplasmic functions has been gained by identifying phosphoinositide-effector proteins. Phosphoinositide-regulated nuclear functions however are fewer and less clear. To address this, we established a proteomic method based on neomycin extraction of intact nuclei to enrich for nuclear phosphoinositide-effector proteins. We identified 168 proteins harboring phosphoinositide-binding domains. Although the vast majority of these contained lysine/arginine-rich patches with the following motif, K/R-(X(n= 3-7)-K-X-K/R-K/R, we also identified a smaller subset of known phosphoinositide-binding proteins containing pleckstrin homology or plant homeodomain modules. Proteins with no prior history of phosphoinositide interaction were identified, some of which have functional roles in RNA splicing and processing and chromatin assembly. The remaining proteins represent potentially other novel nuclear phosphoinositide-effector proteins and as such strengthen our appreciation of phosphoinositide-regulated nuclear functions. DNA topology was exemplar among these: Biochemical assays validated our proteomic data supporting a direct interaction between phosphatidylinositol 4,5-bisphosphate and DNA Topoisomerase IIα. In addition, a subset of neomycin extracted proteins were further validated as phosphatidyl 4,5-bisphosphate-interacting proteins by quantitative lipid pull downs. In summary, data sets such as this serve as a resource for a global view of phosphoinositide-regulated nuclear functions.

  7. Expression and Distribution Pattern of Aquaporin 4, 5 and 11 in Retinas of 15 Different Species

    Directory of Open Access Journals (Sweden)

    Barbara Amann

    2016-07-01

    Full Text Available Aquaporins (AQPs are small integral membrane proteins with 13 members in mammals and are essential for water transport across membranes. They are found in many different tissues and cells. Currently, there are conflicting results regarding retinal aquaporin expression and subcellular localization between genome and protein analyses and among various species. AQP4, 7, 9 and 11 were described in the retina of men; whereas AQP6, 8 and 10 were earlier identified in rat retinas and AQP4, 5 and 11 in horses. Since there is a lack of knowledge regarding AQP expression on protein level in retinas of different animal models, we decided to analyze retinal cellular expression of AQP4, 5 and 11 in situ with immunohistochemistry. AQP4 was detected in all 15 explored species, AQP5 and AQP11 in 14 out of 15. Interestingly, AQP4 was unambiguously expressed in Muller glial cells, whereas AQP5 was differentially allocated among the species analyzed. AQP11 expression was Muller glial cell-specific in 50% of the animals, whereas in the others, AQP11 was detected in ganglion cell layer and at photoreceptor outer segments. Our data indicate a disparity in aquaporin distribution in retinas of various animals, especially for AQP5 and 11.

  8. Converting From 3.6 and 4.5 Micron Fluxes to Stellar Mass

    CERN Document Server

    Eskew, Michael R; Meidt, Sharon E

    2012-01-01

    We use high spatial resolution maps of stellar mass and infrared flux of the Large Magellanic Cloud (LMC) to calibrate a conversion between 3.6 and 4.5 micron fluxes and stellar mass, M_* = 10^{5.65} * F_{3.6}^{2.85} * F_{4.5}^{-1.85} * (D/0.05)^2 M_solar, where fluxes are in Jy and D is the luminosity distance to the source in Mpc, and to provide an approximate empirical estimate of the fractional internal uncertainty in M_* of 0.3*sqrt{N/10^6}, where N is the number of stars in the region. We find evidence that young stars and hot dust contaminate the measurements, but attempts to remove this contamination using data that is far superior than what is generally available for unresolved galaxies resulted in marginal gains in accuracy. The scatter among mass estimates for regions in the LMC is comparable to that found by previous investigators when modeling composite populations, and so we conclude that our simple conversion is as precise as possible for the data and models currently available. Our results all...

  9. Inositol 1,4,5-trisphosphate receptor 1 is essential to spinocerebellar ataxia modeling

    Directory of Open Access Journals (Sweden)

    Sherry-Ann eBrown

    2015-01-01

    Full Text Available A suite of models was developed to study the role of inositol 1,4,5-trisphosphate receptor 1 (IP3R1 in spinocerebellar ataxias (SCAs. Several SCAs are linked to reduced abundance of IP3R1 or to supranormal sensitivity of the receptor to activation by its ligand inositol 1,4,5-trisphosphate (IP3. Detailed multidimensional models have been created to simulate biochemical calcium signaling and membrane electrophysiology in cerebellar Purkinje neurons. In these models, IP3R1-mediated calcium release is allowed to interact with ion channel response on the cell membrane. Experimental findings in mice and clinical observations in humans provide data input for the models. The SCA modeling suite helps interpret experimental results and provides suggestions to guide experiments. The models predict IP3R1 supersensitivity in SCA1 and compensatory mechanisms in SCA1, SCA2, and SCA3. Simulations explain the impact of calcium buffers. Results show that IP3R1-mediated calcium release activates voltage-gated calcium-activated potassium channels in the plasma membrane. The SCA modeling suite unifies observations from experiments in a number of SCAs. The cadre of simulations demonstrates the central role of IP3R1.

  10. Cytotoxic 3,4,5-trimethoxychalcones as mitotic arresters and cell migration inhibitors

    Science.gov (United States)

    Salum, Lívia B.; Altei, Wanessa F.; Chiaradia, Louise D.; Cordeiro, Marlon N.S.; Canevarolo, Rafael R.; Melo, Carolina P.S.; Winter, Evelyn; Mattei, Bruno; Daghestani, Hikmat N.; Santos-Silva, Maria Cláudia; Creczynski-Pasa, Tânia B.; Yunes, Rosendo A.; Yunes, José A.; Andricopulo, Adriano D.; Day, Billy W.; Nunes, Ricardo J.; Vogt, Andreas

    2013-01-01

    Based on classical colchicine site ligands and a computational model of the colchicine binding site on beta tubulin, two classes of chalcone derivatives were designed, synthesized and evaluated for inhibition of tubulin assembly and toxicity in human cancer cell lines. Docking studies suggested that the chalcone scaffold could fit the colchicine site on tubulin in an orientation similar to that of the natural product. In particular, a 3,4,5-trimethoxyphenyl ring adjacent to the carbonyl group appeared to benefit the ligand-tubulin interaction, occupying the same subcavity as the corresponding moiety in colchicine. Consistent with modeling predictions, several 3,4,5-trimethoxychalcones showed improved cytotoxicity to murine acute lymphoblastic leukemia cells compared with a previously described parent compound, and inhibited tubulin assembly in vitro as potently as colchicine. The most potent chalcones inhibited the growth of human leukemia cell lines at nanomolar concentrations, caused microtubule destabilization and mitotic arrest in human cervical cancer cells, and inhibited human breast cancer cell migration in scratch wound and Boyden chamber assays. PMID:23524161

  11. Phosphatidylinositol 4,5-bisphosphate formation in rabbit skeletal and heart muscle membranes.

    Science.gov (United States)

    Varsányi, M; Messer, M; Brandt, N R; Heilmeyer, L M

    1986-08-14

    Incubation of rabbit skeletal muscle microsomes or isolated triads with gamma 32P-ATP/Mg2+ in the absence and in the presence of added phosphatidylinositol resulted in the formation of phosphatidylinositol 4-phosphate catalyzed by phosphatidylinositol kinase. When phosphatidylinositol 4-phosphate was added as exogenous substrate, phosphatidylinositol 4,5-bisphosphate was also formed demonstrating the presence of a membrane bound phosphatidylinositol 4-phosphate kinase. Triads were broken mechanically in a French press and separated on a continuous sucrose gradient. Incubation of these fractions with gamma 32P-ATP/Mg2+ resulted in a rapid labeling of phospholipid in a membrane fraction banding between transverse tubules and the terminal cisternae. Partial triad breakage and triad reformation experiments indicated that this phosphatidylinositol kinase was associated with T-tubules. When exogenous phosphatidylinositol 4-phosphate was employed as substrate phosphatidylinositol 4,5-bisphosphate and phosphatidic acid were formed, indicating the presence of all the enzymes of the polyphosphoinositide signaling system in this special membrane fraction. In contrast, heart muscle microsomes or plasma membranes can catalyze this reaction sequence from endogenous formed phosphatidylinositol 4-phosphate.

  12. Gaz de France annual report 2003; Gaz de France rapport annuel 2003

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    Today, Gaz de France Group ranks as one of the largest gas utilities in Europe. This success is the fruit of a growth strategy that fuses economic, social and environmental imperatives. To respond more efficiently to fluctuations in the natural gas market and continue to expand its range of competitive products and services, Gaz de France has committed to integrated development across the full spectrum of natural gas activities, from exploration and production to the sale of energy and related services. As the leading supplier of natural gas in France, Gaz de France has honed a targeted policy to acquire equity interests and assets, mainly in Europe, assuring the Group of a privileged place at the heart of the European gas grid. As European energy markets continue to open more widely to competition, the Group intends to benefit from its presence in all the sectors of the natural gas industry and in the European market to confirm its position as an integrated energy operator, focused on gas, among Europe's leaders. To achieve this goal, Gaz de France will concentrate in a balanced fashion on activities linked to infrastructures and activities related to energy supply and services. While assuming its public service responsibilities, the Group will expand the range of products and services to customers. This activity report presents: consolidated financial highlights, profile, corporate governance, Gaz de France's ambition, panorama of activities: energy supply and services (exploration - production, purchase and sale of energy, services), infrastructures (transmission and storage - France, distribution - France, transmission and distribution - international), Commitments of Gaz de France (human resources, research and development, sustainable development, map of main subsidiaries and affiliates)

  13. Spiroheterocyclization of Methyl 1-Aryl-3-cinnamoyl-4,5-dioxo-4,5-dihydro-1H-pyrrole-2-carboxylates by the Action of 3-(Arylamino-1H-inden-1-ones

    Directory of Open Access Journals (Sweden)

    Аndrey N. Maslivets

    2012-11-01

    Full Text Available Methyl 1-aryl-3-cinnamoyl-4,5-dioxo-4,5-dihydro-1H-pyrrole-2-carboxylates interact with 3-(arylamino-1H-inden-1-ones to give the corresponding 1,1'-diaryl-3'-cinnamoyl-4'-hydroxy-1H-spiro[indeno[1,2-b]pyrrole-3,2'-pyrrole]-2,4,5'(1'H-triones in good yields.

  14. Which sustainable energy policy in France?; Quelle politique energetique durable en France?

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    Concurrently to the National Debate on the energies, a real debate has been proposed by seven associations of the environment protection and improvement. This debate, international, wonders on the energy choices in France. Presentations of the interveners and working documents are provided on the following topics: energy choices for the economic development, renewable energies, the possibilities and the development of the solar energy in France, the economic interest of the cogeneration, quick overview of the wind energy in France, energy production data, the transport and the greenhouse effect, the sustainable development and the energy policy and the local governments. (A.L.B.)

  15. Gaz de France. Operation note; Gaz de France. Note d'operation

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    This note was published for the public at the occasion of the admission to Euronext's Eurolist of the existing shares that make the capital of Gaz de France company, the French gas utility. The note gives some informations about Gaz de France activity, and about its strategy of development in the European gas market. Then it describes the offer relative to the opening of Gaz de France capital. Some selected financial data and some precision about the risk factors and the management of the company complete the document. (J.S.)

  16. First Total Synthesis of 4,5-Secoeudesmane-type and Iphionane-type Compounds- Synthesis of 4,5-Dioxo-seco-γ-eudesmol and 5β ,11-Dihydroxyiphionan-4-one

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    @@ 4, 5-Secoeudesmane-type and iphionane-type compounds are sesquiterpenes with new carbon skeletons found in natrual sources in recent years.1-6 The co-occurence of 4, 5-secoeudesmanes, iphionanes and eudesmanes as natrual products suggests that 4, 5-secoeudesmanes, iphionanes most likely are generated biogenetically from eudesmanes, and iphionanes are formed biogenetically by aldol reaction of 4, 5-dioxosecoeudesmanes1,4,6,7. The study on the synthesis of this two kind of new sesquiterpenes has not been reported in the literature.

  17. Inositol (1,4,5)-trisphosphate activates a calcium channel in isolated sarcoplasmic reticulum membranes.

    Science.gov (United States)

    Suárez-Isla, B. A.; Irribarra, V.; Oberhauser, A.; Larralde, L.; Bull, R.; Hidalgo, C.; Jaimovich, E.

    1988-01-01

    Sarcoplasmic reticulum membrane vesicles isolated from frog skeletal muscle display high conductance calcium channels when fused into phospholipid bilayers. The channels are selective for calcium and barium over Tris. The fractional open time was voltage-independent (-40 to +25 mV), but was steeply dependent on the free cis [Ca2+] (P0 = 0.02 at 10 microM cis Ca2+ and 0.77 at 150 microM Ca2+; estimated Hill coefficient: 1.6). Addition of ATP (1 mM; cis) further increased P0 from 0.77 to 0.94. Calcium activation was reversed by addition of EGTA to the cis compartment. Magnesium (2 mM) increased the frequency of rapid closures and 8 mM magnesium decreased the current amplitude from 3.4 to 1.2 pA at 0 mV, suggesting a reversible fast blockade. Addition of increasing concentrations of inositol (1, 4, 5)-triphosphate (cis), increased P0 from 0.10 +/- 0.01 (mean +/- SEM) in the control to 0.85 +/- 0.02 at 50 microM in an approximately sigmoidal fashion, with an apparent half-maximal activation at 15 microM inositol (1, 4, 5)-trisphosphate in the presence of 40 microM cis Ca2+. Lower concentrations of this agonist were required to produce a significant increase in P0 when 10 microM or less cis Ca2+ were used. The channel was blocked by the addition to the cis compartment of either 0.5 mM lanthanum, 0.5 microM ruthenium red, or 200 nM ryanodine, all known inhibitors of Ca2+ release from sarcoplasmic reticulum vesicles. These results demonstrate the presence of calcium channels in the sarcoplasmic reticulum from frog skeletal muscle with a pharmacological profile consistent with a role in excitation contraction coupling and with the hypothesis that inositol ( 1,4,5)-trisphosphate is a physiological agonist in this process. PMID:2852037

  18. A Luminosity Function of Lyα-emitting Galaxies at z ~ 4.5

    Science.gov (United States)

    Dawson, Steve; Rhoads, James E.; Malhotra, Sangeeta; Stern, Daniel; Wang, JunXian; Dey, Arjun; Spinrad, Hyron; Jannuzi, Buell T.

    2007-12-01

    We present a catalog of 59 z~4.5 Lyα-emitting galaxies spectroscopically confirmed in a campaign of Keck DEIMOS follow-up observations to candidates selected in the Large Area Lyα (LALA) narrowband imaging survey. We targeted 97 candidates for spectroscopic follow-up by accounting for the variety of conditions under which we performed spectroscopy, we estimate a selection reliability of ~76%. Together with our previous sample of Keck LRIS confirmations, the 59 sources confirmed herein bring the total catalog to 73 spectroscopically confirmed z~4.5 Lyα-emitting galaxies in the ~0.7 deg2 covered by the LALA imaging. As with the Keck LRIS sample, we find that a nonnegligible fraction of the confirmed Lyα lines have rest-frame equivalent widths (Wrestλ) that exceed the maximum predicted for normal stellar populations: 17%-31% (93% confidence) of the detected galaxies show Wrestλ>190 Å, and 12%-27% (90% confidence) show Wrestλ>240 Å. We construct a luminosity function of z~4.5 Lyα emission lines for comparison to Lyα luminosity functions spanning 3.1

  19. Investigation Of Water Assisted Phase Transformation Process From AlPO4-5 to AlPO4-tridymite

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Suochang; Zhao, Zhenchao; Hu, Mary Y.; Han, Xiuwen; Hu, Jian Z.; Bao, Xinhe

    2016-03-15

    Water assisted phase transformation process from crystalized AlPO4-5 to AlPO4-tridymite was studied by the combination of X-ray diffraction (XRD), Scanning Electron Microscopy (SEM) and in situ multinuclear MAS NMR. It is found that water first activates the residue amorphous aluminophosphate in crystalized AlPO4-5 sample through hydrolysis and condensation reactions. Then the activated aluminophosphate species reassemble into AlPO4-tridymite crystalline. Meanwhile, AlPO4-5 transforms into orthorhombic phase during heating process. With further crystallization of AlPO4-tridymite, the amorphous phase is gradually consumed, and mass transportation between AlPO4-5 and AlPO4-tridymite is established through gradually amorphization of AlPO4-5. Finally, most of the AlPO4-5 transforms into the thermodynamically stable dense phase AlPO4-tridymite.

  20. Insights into the molecular recognition of the granuphilin C2A domain with PI(4,5)P2.

    Science.gov (United States)

    Wan, Chanjuan; Wu, Bo; Song, Zhenwei; Zhang, Jiahai; Chu, Huiying; Wang, Aoli; Liu, Qingsong; Shi, Yunyu; Li, Guohui; Wang, Junfeng

    2015-02-01

    Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) is a key player in regulating the process of excytosis, including insulin secretion. Granuphilin, a tandem C2 domain containing protein, mediates the docking of insulin granules onto plasma membrane. The C2A domain plays key roles in this process through interaction with PI(4,5)P2. In this study, we have investigated the molecular recognition mechanism of granuphilin-C2A domain to PI(4,5)P2 head group, and further to PI(4,5)P2-nanodisc by NMR, ITC, MST and SEC methods. Our results demonstrate that PI(4,5)P2 binds to the concave surface of granuphilin-C2A domain. The key residues involved in the binding were validated by mutation analysis.

  1. Correlation in Rectal Cancer Between Clinical Tumor Response After Neoadjuvant Radiotherapy and Sphincter or Organ Preservation: 10-Year Results of the Lyon R 96-02 Randomized Trial

    Energy Technology Data Exchange (ETDEWEB)

    Ortholan, Cecile [Department of Radiation Oncology, Antoine Lacassagne Cancer Center, Nice, UNSA (Universite de Nice Sophia-Antipolis) (France); Department of Oncology-Radiotherapy, Hopital Princesse Grace, Monaco (France); Romestaing, Pascale [Hopital Prive Jean Mermoz, Lyon (France); Chapet, Olivier [Department of Radiation Oncology, Lyon Sud University Hospital, Hospices Civils de Lyon, Lyon (France); Gerard, Jean Pierre, E-mail: jean-pierre.gerard@nice.unicancer.fr [Department of Radiation Oncology, Antoine Lacassagne Cancer Center, Nice, UNSA (Universite de Nice Sophia-Antipolis) (France)

    2012-06-01

    Purpose: To investigate, in rectal cancer, the benefit of a neoadjuvant radiation dose escalation with endocavitary contact radiotherapy (CXRT) in addition to external beam radiotherapy (EBRT). This article provides an update of the Lyon R96-02 Phase III trial. Methods and Materials: A total of 88 patients with T2 to T3 carcinoma of the lower rectum were randomly assigned to neoadjuvant EBRT 39 Gy in 13 fractions (43 patients) vs. the same EBRT with CXRT boost, 85 Gy in three fractions (45 patients). Median follow-up was 132 months. Results: The 10-year cumulated rate of permanent colostomy (CRPC) was 63% in the EBRT group vs. 29% in the EBRT+CXRT group (p < 0.001). The 10-year rate of local recurrence was 15% vs. 10% (p = 0.69); 10-year disease-free survival was 54% vs. 53% (p = 0.99); and 10-year overall survival was 56% vs. 55% (p = 0.85). Data of clinical response (CR) were available for 78 patients (36 in the EBRT group and 42 in the EBRT+CXRT group): 12 patients were in complete CR (1 patient vs. 11 patients), 53 patients had a CR {>=}50% (24 patients vs. 29 patients), and 13 patients had a CR <50% (11 patients vs. 2 patients) (p < 0.001). Of the 65 patients with CR {>=}50%, 9 had an organ preservation procedure (meaning no rectal resection) taking advantage of major CR. The 10-year CRPC was 17% for patients with complete CR, 42% for patients with CR {>=}50%, and 77% for patients with CR <50% (p = 0.014). Conclusion: In cancer of the lower rectum, CXRT increases the complete CR, turning in a significantly higher rate of long-term permanent sphincter and organ preservation.

  2. 40 CFR 721.5645 - Pentane 1,1,1,2,3,4,4,5,5,5,-decafluoro.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Pentane 1,1,1,2,3,4,4,5,5,5... Specific Chemical Substances § 721.5645 Pentane 1,1,1,2,3,4,4,5,5,5,-decafluoro. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as pentane 1,1,1,2,3,4,4,5,5...

  3. 75 FR 39277 - Sorbitol From France; Determination

    Science.gov (United States)

    2010-07-08

    ... The Commission instituted this review on July 1, 2009 (74 FR 31762, July 2, 2009) and determined on... publishing the notice in the Federal Register on December 17, 2009 (74 FR 66992). The hearing was held in... COMMISSION Sorbitol From France; Determination On the basis of the record \\1\\ developed in the subject...

  4. Competence: Conceptual Approach and Practice in France

    Science.gov (United States)

    Le Deist, Francoise

    2009-01-01

    Purpose: The purpose of this article is to analyse the conceptual approaches to competence and practice in competence management in France. Design/methodology/approach: Extensive literature review, discussion with academic experts in the French competence network of AGRH and interviews concerning developments following the 2003 national agreement…

  5. The reception of Cambodian refugees in France

    NARCIS (Netherlands)

    Wijers, G.D.M.

    2011-01-01

    Cambodian refugees’ arrival in France has helped initiate an atypical political mobilization in the process of their reception. The French political power balance, the sociocultural “mood” (zeitgeist) and the “mediatization” of the Indochinese region have impacted on their resettlement and given the

  6. Lombroso in France. A paradoxical reception

    OpenAIRE

    Renneville, Marc

    2013-01-01

    International audience; La réception paradoxale de Lombroso en France. Initialement positive voire enthousiaste, cette réception est rapidement devenue critique tout en donnant une large audience à la théorie du criminel-né

  7. A Paradox in Physics Education in France

    Science.gov (United States)

    Smigiel, Eddie; Sonntag, Michel

    2013-01-01

    This paper deals with the nature and the level of difficulty of teaching and learning physics in the first year of undergraduate engineering schools in France. Our case study is based on a survey regarding a classic and basic question in applied physics, and which was conducted with a group of second-year students in a post-baccalaureate 1…

  8. Is cancer mortality increasing in France?

    OpenAIRE

    Hill, C.; Jan, P; Doyon, F

    2001-01-01

    Long-term trends in cancer mortality are reported by site. Overall, cancer mortality has been decreasing in France since 1987 in the male population and since 1968 in the female population. Improvement in treatments and diagnosis should lead to persistently declining mortality rates, unless the tobacco epidemic reverses the trend in female mortality. © 2001 Cancer Research Campaign http://www.bjcancer.com

  9. France's Rich Relation: The Oc Connection.

    Science.gov (United States)

    Belasco, Simon

    1990-01-01

    A discussion of Occitan, a Romance language spoken in a large portion of France, looks at the history; irregular characteristics; orthographic and morphophonemic variations across dialects; and present status, which is in danger of becoming extinct because of neglect, of the language. (MSE)

  10. Caricature freedom of expression in France

    Directory of Open Access Journals (Sweden)

    Renán Vega Cantor

    2016-04-01

    Full Text Available In this article we will present a sample of the way in France, the acclaimed birthplace and home of freedom of expression, censored, persecuted, and even imprisons those who dare to criticize the Israel lobby or their positions are not in tune with the thought “warm” right, the academic and cultural world

  11. Limits to expression on religion in France

    NARCIS (Netherlands)

    Janssen, E.

    2009-01-01

    During the last decade conflicts about expression on religion have increased globally. Generally, these conflicts are regarded as a conflict between freedom of speech and freedom of thought, conscience and religion. In France there are many active religious interest groups that aim to protect a cert

  12. A Paradox in Physics Education in France

    Science.gov (United States)

    Smigiel, Eddie; Sonntag, Michel

    2013-01-01

    This paper deals with the nature and the level of difficulty of teaching and learning physics in the first year of undergraduate engineering schools in France. Our case study is based on a survey regarding a classic and basic question in applied physics, and which was conducted with a group of second-year students in a post-baccalaureate 1…

  13. Competitive development of the agricultural enterprises France

    Directory of Open Access Journals (Sweden)

    Olena Yushkevych

    2013-05-01

    Full Text Available The stages which determine the development of agricultural enterprises in France are investigated in the article. In the course of implementation of Ukrainian-French programs of scientific and educational cooperation on the problems of the management of agricultural enterprises in State Educational Institutions training specialists (cities of Chartres and Vic–en Bigorre, France it was found that the major components of development of agricultural enterprises in France are as follows: agricultural policy, education, motivation, information and management. The problem of the diversified development in the context of transition to green economy and sustainable development is considered. It is determined that an example of competitive development of agricultural enterprises in France is the establishment and operation of professional associations, in particular, cooperatives and clusters. The priority directions of economic and ecological development of agricultural enterprises for Ukraine are offered in order to implement potential opportunities of agricultural enterprises and to relocate the resources into new kinds of agricultural and non-agricultural activities

  14. Future climate data from RCP 4.5 and occurrence of malaria in Korea.

    Science.gov (United States)

    Kwak, Jaewon; Noh, Huiseong; Kim, Soojun; Singh, Vijay P; Hong, Seung Jin; Kim, Duckgil; Lee, Keonhaeng; Kang, Narae; Kim, Hung Soo

    2014-10-15

    Since its reappearance at the Military Demarcation Line in 1993, malaria has been occurring annually in Korea. Malaria is regarded as a third grade nationally notifiable disease susceptible to climate change. The objective of this study is to quantify the effect of climatic factors on the occurrence of malaria in Korea and construct a malaria occurrence model for predicting the future trend of malaria under the influence of climate change. Using data from 2001-2011, the effect of time lag between malaria occurrence and mean temperature, relative humidity and total precipitation was investigated using spectral analysis. Also, a principal component regression model was constructed, considering multicollinearity. Future climate data, generated from RCP 4.5 climate change scenario and CNCM3 climate model, was applied to the constructed regression model to simulate future malaria occurrence and analyze the trend of occurrence. Results show an increase in the occurrence of malaria and the shortening of annual time of occurrence in the future.

  15. Linking structure to function: Recent lessons from inositol 1,4,5-trisphosphate receptor mutagenesis.

    Science.gov (United States)

    Yule, David I; Betzenhauser, Matthew J; Joseph, Suresh K

    2010-06-01

    Great insight has been gained into the structure and function of the inositol 1,4,5 trisphosphate receptor (InsP(3)R) by studies employing mutagenesis of the cDNA encoding the receptor. Notably, early studies using this approach defined the key constituents required for InsP(3) binding in the N-terminus and the membrane spanning regions in the C-terminal domain responsible for channel formation, targeting and function. In this article we evaluate recent studies which have used a similar approach to investigate key residues underlying the in vivo modulation by select regulatory factors. In addition, we review studies defining the structural requirements in the channel domain which comprise the conduction pathway and are suggested to be involved in the gating of the channel.

  16. On the Stability of 4,5 in the Relativistic R3BP with Radiating Secondary

    Indian Academy of Sciences (India)

    Jagadish Singh; Nakone Bello

    2014-12-01

    This paper discusses the motion of a test particle in the neighbourhood of the triangular points 4,5 by considering the less massive primary (secondary) as a source of radiation in the framework of the relativistic restricted three-body problem (R3BP). It is found that the positions and stability of the triangular point are affected by both relativistic and electromagnetic radiation factors. It turns out that both the coordinates of the infinitesimal mass are affected, contrary to the classical where this happens only for one coordinate. A practical application of this model could be the study of dynamical evolution of dust particles in orbits around a binary system with a dark degenerate first primary and a secondary stellar companion.

  17. Operation of the Four 12 kW at 4.5 K Refrigerators for LEP

    CERN Document Server

    Bangert, N

    1999-01-01

    In 1998 the first energy upgrade of the LEP Electron/Positron collider, LEP2, was completed at CERN. Sixty-eight superconducting modules supplied by four 12 kW @ 4.5 K equivalent power refrigerators have been operated allowing a colliding beam energy of 94.5 GeV. Meanwhile, the operation and maintenance responsibilities were transferred to an industrial firm on the basis of a result-oriented contract. After a short description of the operational organization, we report on the operation of the LEP2 cryogenic system over the past three years. Particular attention is given to power availability, failure statistics and recovery time after interruptions. The most relevant problems and their solutions are exposed. Finally, we review the interactions between the cryogenic system and the particle beams, which are limiting the ultimate performance of the LEP collider.

  18. Structural systematics of some metal complexes with 4,5-diazafluoren-9-one

    Indian Academy of Sciences (India)

    Abhijit Pal; Bhaskar Biswas; Merry Mitra; Chandra Shekhar Purohit; Chia-Her Lind; Rajarshi Ghosh

    2014-05-01

    Synthesis and X-ray structural characterization of three complexes of type cis-[M(dafone)2(NCS)2] (M = Co(II), 1; Ni(II), 2; Zn(II), 3; dafone = 4,5-diazafluoren-9-one) and a polymer cis-[Cd(dafone)(NCS)2]n (4) have been reported. Each of the four complexes is crystallized in orthorhombic crystal system. Structural study reveals that each metal(II) centre in the four complexes adopts distorted octahedral geometry with MN6 chromophore in 1-3 and MN4S2 chromophore in 4. The room temperature steady-state fluorescent intensity of dafone in dimethyl formamide at 402 nm is found to be quenched in these reported dafone complexes (1-4).

  19. A 4.5-megabase YAC contig and physical map over the hemochromatosis gene region

    Energy Technology Data Exchange (ETDEWEB)

    Burt, M.J.; Smit, D.J.; Pyper, W.R.; Powell, L.W.; Jazwinska, E.C. [Univ. of Queensland, Brisbane (Australia)

    1996-04-15

    We have constructed a yeast artificial chromosome (YAC) contig over the candidate hemochromatosis gene region. This contig comprises hemochromatosis gene region. This contig comprises 16 YACs from the CEPH, Washington University, and ICI YAC libraries and covers 4.5 Mb at 6p21.3-6p22. The complete contig has been restriction mapped, enabling the precise relationship between the YACs to be determined and the mapping of a total of 12 STSs. Nine of these are highly polymorphic STSs that are closely linked to hemochromatosis; this series includes D6S265 and D6S1260, which comprise the most proximal and distal markers linked to HC. This is the first YAC contig that spans the hemochromatosis candidate region, and it provides valuable resource material for the cloning of this and other genes in the region distal to the MHC class I complex. 33 refs., 1 fig., 1 tab.

  20. Local 4/5-law and energy dissipation anomaly in turbulence of incompressible MHD Equations

    Science.gov (United States)

    Guo, Shanshan; Tan, Zhong

    2016-12-01

    In this paper, we establish the longitudinal and transverse local energy balance equation of distributional solutions of the incompressible three-dimensional MHD equations. In particular, we find that the functions D_L^ɛ (u,B) and D_T^ɛ (u,B) appeared in the energy balance, all converging to the defect distribution (in the sense of distributions) D(u,B) which has been defined in Gao et al. (Acta Math Sci 33:865-871, 2013). Furthermore, we give a simpler form of defect distribution term, which is similar to the relation in turbulence theory, called the "4 / 3-law." As a corollary, we give the analogous "4 / 5-law" holds in the local sense.

  1. Regulation of the inositol 1,4,5-trisphosphate receptor by tyrosine phosphorylation.

    Science.gov (United States)

    Jayaraman, T; Ondrias, K; Ondriasová, E; Marks, A R

    1996-06-07

    Tyrosine kinases indirectly raise intracellular calcium concentration ([Ca2+]i) by activating phospholipases that generate inositol 1,4,5-trisphosphate (IP3). IP3 activates the IP3 receptor (IP3R), an intracellular calcium release channel on the endoplasmic reticulum. T cell receptor stimulation triggered a physical association between the nonreceptor protein tyrosine kinase Fyn and the IP3R, which induced tyrosine phosphorylation of the IP3R. Fyn activated an IP3-gated calcium channel in vitro, and tyrosine phosphorylation of the IP3R during T cell activation was reduced in thymocytes from fyn-/- mice. Thus, activation of the IP3R by tyrosine phosphorylation may play a role in regulating [Ca2+]i.

  2. Vertical kinematics of the thick disc at 4.5 < R < 9.5 kpc

    CERN Document Server

    Hattori, Kohei

    2015-01-01

    We explored a method to reconstruct the distribution function of the Galactic thick disc within the action space where nearby thick-disc stars are distributed. By applying this method to 127 chemically-selected thick-disc stars in the Solar neighbourhood, we found that the vertical velocity dispersion that corresponds to the reconstructed distribution function declines approximately as $\\exp (-R/R_s)$ at 4.5 kpc < R < 9.5 kpc, with $R_s$ = 8.3 $\\pm$ 1.1 (rand.) $\\pm$ 1.6 (sys.) kpc. Also, we found that the vertical velocity dispersion $\\sigma_z$ of our local thick-disc stars shows only weak dependency on radial and azimuthal velocities $(v_R, v_\\phi)$. We discuss possible implications of these results on the global structure of the Milky Way thick disc.

  3. Synthesis of AlPO4-5 and CrAPO-5 using aluminum dross.

    Science.gov (United States)

    Kim, Jun; Biswas, Kalidas; Jhon, Ki-Won; Jeong, Soon-Yong; Ahn, Wha-Seung

    2009-09-30

    AlPO(4)-5 and its chromium-containing analogue, CrAPO-5, were prepared using aluminum dross in the presence of triethylamine as a structure directing agent; both Al dross powder and an extracted precipitate from Al dross in an alkali solution were used as an aluminum source. These materials were characterized by XRD, BET surface area measurement, SEM, EDX, XRF, ESR, and UV-vis spectroscopy. Their textural properties were found close to those of the corresponding reference samples prepared using pure Al(OH)(3). CrAPO-5 samples prepared from the aluminum dross were tested as a catalyst for liquid phase oxidation of tetralin using t-butyl hydroperoxide as an oxidizing agent, which showed virtually identical catalytic performances to that obtained by a reference CrAPO-5 catalyst.

  4. Use of quantitative microbial risk assessment when investigating foodborne illness outbreaks: the example of a monophasic Salmonella Typhimurium 4,5,12:i:- outbreak implicating beef burgers.

    Science.gov (United States)

    Guillier, Laurent; Danan, Corinne; Bergis, Hélène; Delignette-Muller, Marie-Laure; Granier, Sophie; Rudelle, Sylvie; Beaufort, Annie; Brisabois, Anne

    2013-09-16

    A major community outbreak of salmonellosis occurred in France in October 2010. Classical epidemiological investigations led to the identification of beef burgers as the cause of the outbreak and the presence of the emerging monophasic Salmonella Typhimurium 4,5,12:i:-. The objective of this study was to understand the events that led to this large outbreak, that is to say, what are the contributing factors associated with consumer exposure to Salmonella. To this end, intensive microbiological investigations on several beef burgers were conducted and a risk assessment model was built. The microbiological results confirm the presence of Salmonella in all analysed frozen burgers at high levels of contamination above 1000 MPN/g. These results in frozen burgers combined with a model of thermal destruction were used to estimate the dose ingested by the exposed persons. Most people that consumed cooked beef burgers were exposed from 1.6 to 3.1 log₁₀ (MPN). The number of sick people predicted with a dose-response relationship for Salmonella is consistent with the observed number of salmonellosis cases. The very high initial contamination level in frozen beef burgers is the primary cause of this large outbreak rather than bad cooking practices. Intensive investigations, modelling of the initial contamination and quantitative exposure and risk assessments are complementary to epidemiological investigation. They can be valuable elements for the assessment of missing information or the identification of the primary causes of outbreaks.

  5. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  6. Localization of phosphatidylinositol 4,5-bisphosphate to lipid rafts and uroids in the human protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Koushik, Amrita B; Powell, Rhonda R; Temesvari, Lesly A

    2013-06-01

    Entamoeba histolytica is an intestinal protozoan parasite and is the causative agent of amoebiasis. During invasive infection, highly motile amoebae destroy the colonic epithelium, enter the blood circulation, and disseminate to other organs such as liver, causing liver abscess. Motility is a key factor in E. histolytica pathogenesis, and this process relies on a dynamic actomyosin cytoskeleton. In other systems, phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] is known to regulate a wide variety of cellular functions, including signal transduction, actin remodeling, and cell motility. Little is known about the role of PI(4,5)P2 in E. histolytica pathogenicity. In this study, we demonstrate that PI(4,5)P2 is localized to cholesterol-rich microdomains, lipid rafts, and the actin-rich fractions of the E. histolytica membrane. Microscopy revealed that the trailing edge of polarized trophozoites, uroids, are highly enriched in lipid rafts and their constituent lipid, PI(4,5)P2. Polarization and enrichment of uroids and rafts with PI(4,5)P2 were enhanced upon treatment of E. histolytica cells with cholesterol. Exposure to cholesterol also increased intracellular calcium, which is a downstream effector of PI(4,5)P2, with a concomitant increase in motility. Together, our data suggest that in E. histolytica, PI(4,5)P2 may signal from lipid rafts and cholesterol may play a role in triggering PI(4,5)P2-mediated signaling to enhance the motility of this pathogen.

  7. Carcinogenic 4(5)-methylimidazole found in beverages, sauces, and caramel colors: chemical properties, analysis, and biological activities.

    Science.gov (United States)

    Hengel, Matt; Shibamoto, Takayuki

    2013-01-30

    Since the National Toxicology Program (NTP) identified 4(5)-methylimidazole [4(5)-MI] as a cancer causing chemical in 2007 and the State of California added it to the Proposition 65 list of compounds as a carcinogen on January 7, 2011, many researchers and regulatory agencies have become focused on the presence of 4(5)-MI in foods and beverages. 4(5)-MI has been known to form in the Maillard reaction system consisting of a sugar and ammonia-a typical caramel-color preparation method for beverages. 4(5)-MI is identified in various beverages and sauces, which are colored with caramel, as well as in caramel color itself. Analysis of 4(5)-MI is extremely difficult due to its high water solubility, but the analytical method for 4(5)-MI has progressed from conventional paper chromatography, gas chromatography, and gas chromatography-mass spectrometry to the most advanced high-performance liquid chromatography-mass spectrometry. Various studies indicate that caramel colors and carbonated beverages contain 4(5)-MI in levels ranging from 0 to around 1000 ppm and from 0 to about 500 ppm, respectively. Reports of the toxicity of 4(5)-MI at relatively high levels suggest that it may cause some adverse effects on human consumers.

  8. "Bonne Route"...avec Radio France Internationale ("Have a Good Trip"...with Radio France Internationale).

    Science.gov (United States)

    de Saivre, Denyse

    1989-01-01

    Radio France International, the Alliance Francaise, and the Hachette publishing company have collaborated to develop an instructional radio series linking the broadcasts with published instructional materials. Considerations addressed in the program's development are discussed. (MSE)

  9. Les instituts universitaires de technologie en France. (The university institutes of technology in France)

    Science.gov (United States)

    Pineau, Gaston

    1971-01-01

    In 1966 France passed legislation naming three types of technical training: two year postbaccalaureate, short-cycle for those without a bachelor's degree, adult education, for those already employed. (MF)

  10. Petroleum in France: the main results in 2005; Petrole en France: les principaux resultats en 2005

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    This presentation takes stock on the petroleum market in France in 2005. It provides information on the petroleum consumption, the imports and exports, the prices, the production, the refineries and the stocks. (A.L.B.)

  11. The Future of the CEMAC CFA Franc

    Directory of Open Access Journals (Sweden)

    Julius Agbor Agbor

    2013-08-01

    Full Text Available A total of 80 currency boards have come into existence at some point since the mid-19th century, but to date only about 15 of them still exist, among which is the CFA franc monetary zone. The future sustainability of the CFA franc zone, to which the CEMAC CFA franc belongs, is increasingly questioned in the light of increasing asymmetries in exposure to external shocks, differential speeds of adjustment of the real exchange rate following shocks, differential impacts in economic fundamentals, and low levels of intra-regional trade and financial flows between CEMAC and WAEMU. For the CEMAC bloc of countries in particular, the future sustainability of the fixed exchange regime depends crucially on continued oil exports, which currently represent about 90percent of export revenues and 40 percent of GDP. Should oil reserves deplete in the near future or oil prices decline significantly, a substantial source of foreign reserves would be lost, thereby exposing the regime to collapse. Even without resource depletion, continued volatility in global financial markets is increasing the risks of collapse of the fixed exchange regime as oil and commodity price swings ignite currency speculation as well as render reserves much more volatile. Against this backdrop, the present study examines the stakes facing the CEMAC CFA franc, discusses the exit options from the currency board and makes recommendations towards a sustainable monetary policy framework for CEMAC countries going forward. The analysis points to the imperative of pursuing a full monetary union with a single CEMAC franc pegged to the U.S. dollar and further suggest that, like the experience of the eurozone, the CEMAC monetary arrangement can be best implemented only by complying with the principle of political union.

  12. Satellite remote sensing of hailstorms in France

    Science.gov (United States)

    Melcón, Pablo; Merino, Andrés; Sánchez, José Luis; López, Laura; Hermida, Lucía

    2016-12-01

    Hailstorms are meteorological phenomena of great interest to the scientific community, owing to their socioeconomic impact, which is mainly on agricultural production. With its global coverage and high spatial and temporal resolution, satellite remote sensing can contribute to monitoring of such events through the development of appropriate techniques. This paper presents an extensive validation in the south of France of a hail detection tool (HDT) developed for the Middle Ebro Valley (MEV). The HDT is based on consecutive application of two filters, a convection mask (CM) and hail mask (HM), using spectral channels of the Meteosat Second Generation (MSG) satellite. The south of France is an ideal area for studying hailstorms, because there is a robust database of hail falls recorded by an extensive network of hailpads managed by the Association Nationale d'Etude et de Lutte contre les Fleáux Atmosphériques (ANELFA). The results show noticeably poorer performance of the HDT in France relative to that in the MEV, with probability of detection (POD) 60.4% and false alarm rate (FAR) 26.6%. For this reason, a new tool to suit the characteristics of hailstorms in France has been developed. The France Hail Detection Tool (FHDT) was developed using logistic regression from channels of the Spinning Enhanced Visible and Infrared Imager (SEVIRI) sensor of the MSG. The FHDT was validated, resulting in POD 69.3% and FAR 15.4%, thus improving hail detection in the study area as compared with the previous tool. The new tool was tested in a case study with satisfactory results, supporting its future practical application.

  13. Critical acidity loads in France; Charges critiques d`acidite en France

    Energy Technology Data Exchange (ETDEWEB)

    Probst, A.; Party, J.P.; Fevrier, C. [Centre de Geochimie de la Surface (UPR 06251 du CNRS), 67 - Strasbourg (France); Dambrine, E. [Centre de Recherches Forestieres, INRA, 45 - Orleans (France); Thomas, A.L.; King, D. [Institut National de Recherches Agronomique (INRA), 45 - ORDON (France); Stussi, J.M. [Centre National de la Recherche Scientifique (CNRS), 54 - Vandoeuvre-les-Nancy (France)

    1997-12-31

    Based on results from several systematic forest and surface water monitoring programs, carried out in various parts of France as well as in Europe, acidity critical loads have been calculated for soils and surface waters; critical loads are presented for water and soils in crystalline mountainous regions such as Ardennes, Vosges and Massif Central; links with geochemistry, ecosystems and types of trees are discussed and perspectives are given for the calculation of acid and nitrogen critical loads on the whole France

  14. Gaz de France. Source document; Gaz de France. Document de base

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This document was issued by Gaz de France, the French gas utility, at the occasion of the opening of the capital of the company. It is intended to shareholders and presents some informations relative to the stocks admitted to Euronext's Eurolist, some general informations about the company and its capital, some informations about the activities of Gaz de France group, about its financial situation and results, about its management, and about its recent evolution and future perspectives. (J.S.)

  15. Fourth High Level China-France Forum on Local Government Cooperation Held in France

    Institute of Scientific and Technical Information of China (English)

    Kang; Jingyuan

    2015-01-01

    To substantiate the Medium and Long-Term Plan for ChinaFrance Relations and build a strong people-to-people and cultural exchange mechanism,the Fourth High Level China-France Forumon Local Government Cooperation was held in Strasburg from November 6 to 7,2014.The Forum,jointly sponsored by the CPAFFC,the French Ministry of Foreign Affairs and International Development,the French National Committee of Local Government Co-

  16. Aging in France: Population Trends, Policy Issues, and Research Institutions

    Science.gov (United States)

    Beland, Daniel; Durandal, Jean-Philippe Viriot

    2013-01-01

    Like in other advanced industrial countries, in France, demographic aging has become a widely debated research and policy topic. This article offers a brief overview of major aging-related trends in France. The article describes France's demographics of aging, explores key policy matters, maps the institutional field of French social gerontology…

  17. 78 FR 75579 - Low Enriched Uranium From France

    Science.gov (United States)

    2013-12-12

    ... COMMISSION Low Enriched Uranium From France Determination On the basis of the record \\1\\ developed in the... antidumping duty order on low enriched uranium from France would be likely to lead to continuation or...), entitled Low Enriched Uranium from France: Investigation No. 731-TA-909 (Second Review). By order of...

  18. Aging in France: Population Trends, Policy Issues, and Research Institutions

    Science.gov (United States)

    Beland, Daniel; Durandal, Jean-Philippe Viriot

    2013-01-01

    Like in other advanced industrial countries, in France, demographic aging has become a widely debated research and policy topic. This article offers a brief overview of major aging-related trends in France. The article describes France's demographics of aging, explores key policy matters, maps the institutional field of French social gerontology…

  19. A Construction of Ramsey Graph of R(4,5)by the Method of Recursive Generation%拉姆齐图R(4,5)的递阶生成

    Institute of Scientific and Technical Information of China (English)

    斯勤夫; 段禅伦

    2004-01-01

    对于已知经典的拉姆齐数,其对应的拉姆齐图R(3,3),R(3,4)R(3,5),R(3,6),R(3,7),R(3,8)和R(3,9)均可递阶生成.给出了一个通过R(4,4)图递阶生成的一个R(4,5)拉姆齐图,证明了R(4,5)≥25.同时发现修改所构造的R(4,5)图的10条拉姆齐临界边,该图将变为经典10-正则的R(4,5)图.%For the known classic Ramsey numbers,the Ramsey graphs of R(3,3),R(3,4),R(3,5),R(3,6),R(3,7) and R(3,8) can be constructed by the method of recursive generation.A construction of Ramsey graphs R(4,5) by the method of recursive generation is given and R(4,5) 25 is proved.Some critical edges are found in the graph,by changing the color of some critical edges,the Ramsey graph of R(4,5) will turn into a 10-regular symmetric cyclic Ramsey graph of R(4,5).

  20. Visualization of Ins(1,4,5)P3 dynamics in living cells: two distinct pathways for Ins(1,4,5)P3 generation following mechanical stimulation of HSY-EA1 cells.

    Science.gov (United States)

    Nezu, Akihiro; Tanimura, Akihiko; Morita, Takao; Tojyo, Yosuke

    2010-07-01

    In the present study, the contribution of inositol (1,4,5)-trisphosphate [Ins(1,4,5)P(3)] generation on the mechanical-stimulation-induced Ca(2+) response was investigated in HSY-EA1 cells. Mechanical stimulation induced a local increase in the cytosolic concentration of Ins(1,4,5)P(3) ([IP(3)](i)), as indicated by the Ins(1,4,5)P(3) biosensor LIBRAvIII. The area of this increase expanded like an intracellular Ins(1,4,5)P(3) wave as [IP(3)](i) increased in the stimulated region. A small transient [IP(3)](i) increase was subsequently seen in neighboring cells. The phospholipase C inhibitor U-73122 abolished these Ins(1,4,5)P(3) responses and resultant Ca(2+) releases. The purinergic receptor blocker suramin completely blocked increases in [IP(3)](1) and the Ca(2+) release in neighboring cells, but failed to attenuate the responses in mechanically stimulated cells. These results indicate that generation of Ins(1,4,5)P(3) in response to mechanical stimulation is primarily independent of extracellular ATP. The speed of the mechanical-stimulation-induced [IP(3)](i) increase was much more rapid than that induced by a supramaximal concentration of ATP (1 mM). The contribution of the Ins(1,4,5)P(3)-induced Ca(2+) release was larger than that of Ca(2+) entry in the Ca(2+) response to mechanical stimulation in HSY-EA1 cells.

  1. PEG-400 as an efficient reaction medium for the synthesis of 2,4,5-triaryl-1H-imidazoles and 1,2,4,5-tetraaryl-1H-imidazoles

    Institute of Scientific and Technical Information of China (English)

    Xi Cun Wang; Hai Peng Gong; Zheng Jun Quan; Lei Li; He Lin Ye

    2009-01-01

    An efficient protocol for the one-pot multicomponent synthesis of various 2,4,5-triaryl- IH-imidazoles and 1,2,4,5-tetraaryl-1H-imidazoles using PEG-400 as reaction medium is described. This method has the advantages of good yields, less pollution and simple reaction conditions.

  2. Wage differences according to health status in France.

    Science.gov (United States)

    Ben Halima, Mohamed Ali; Rococo, Emeline

    2014-11-01

    Many OECD countries have implemented anti-discrimination laws in recent decades. However, according to the annual report published in 2010 by the French High Authority for the Fight against Discrimination and for Equality, the second most commonly cited factor in discrimination claims since 2005 is a handicap or health status. The aim of this research is to estimate the level of unexplained components in the wage gap that can be attributed to wage discrimination based on health status in France in 2010 utilizing data from the Health, Healthcare and Insurance survey among 1594 individuals. Three health indicators are used: self-perceived health status, activity limitations and long-term chronic illness. To measure the wage gap according to an individual's health status, the analysis considers the endogenous selection of health status and unobserved differences in productivity. The results demonstrate that wage discrimination is experienced by individuals in poor health regardless of the health indicator utilized. The hourly wage rate among individuals with poor self-assessed health status is on average 14.2% lower than among individuals with good self-assessed health status. However, for individuals suffering from a long-term chronic illness or an activity limitation, the gap is 6.3% and 4.5%, respectively. The decomposition performed on wage differences according to health status by correcting for health status selection bias and controlling for unobserved differences in productivity indicates that the 'unexplained component' that can be attributed to wage discrimination is equal to 50%.

  3. Homeostatic regulation of the PI(4,5)P2-Ca(2+) signaling system at ER-PM junctions.

    Science.gov (United States)

    Chang, Chi-Lun; Liou, Jen

    2016-08-01

    The phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2)-Ca(2+) signaling system is important for cell activation in response to various extracellular stimuli. This signaling system is initiated by receptor-induced hydrolysis of PI(4,5)P2 in the plasma membrane (PM) to generate the soluble second messenger inositol 1,4,5-trisphosphate (IP3). IP3 subsequently triggers the release of Ca(2+) from the endoplasmic reticulum (ER) store to the cytosol to activate Ca(2+)-mediated responses, such as secretion and proliferation. The consumed PM PI(4,5)P2 and ER Ca(2+) must be quickly restored to sustain signaling responses, and to maintain the homeostasis of PI(4,5)P2 and Ca(2+). Since phosphatidylinositol (PI), the precursor lipid for PM PI(4,5)P2, is synthesized in the ER membrane, and a Ca(2+) influx across the PM is required to refill the ER Ca(2+) store, efficient communications between the ER and the PM are critical for the homeostatic regulation of the PI(4,5)P2-Ca(2+) signaling system. This review describes the major findings that established the framework of the PI(4,5)P2-Ca(2+) signaling system, and recent discoveries on feedback control mechanisms at ER-PM junctions that sustain the PI(4,5)P2-Ca(2+) signaling system. Particular emphasis is placed on the characterization of ER-PM junctions where efficient communications between the ER and the PM occur, and the activation mechanisms of proteins that dynamically localize to ER-PM junctions to provide the feedback control during PI(4,5)P2-Ca(2+) signaling, including the ER Ca(2+) sensor STIM1, the extended synaptotagmin E-Syt1, and the PI transfer protein Nir2. This article is part of a Special Issue entitled: The cellular lipid landscape edited by Tim P. Levine and Anant K. Menon.

  4. The Post-traditional Chef in Traditional France: Negotiating the Gastronational myth in Le chef en France

    DEFF Research Database (Denmark)

    Leer, Jonatan

    narrative. The paper will explore an example of this tendency, namely the French show Le Chef en France (2012)hosted by France celebrity chef number one: Cyril Lignac. The analysis will focus on how the show tries to reconstruct a myth of France as a unique culture united by specific French attitude towards...

  5. Optimal management of breast cancer in the elderly patient: current perspectives

    Directory of Open Access Journals (Sweden)

    Le Saux O

    2015-01-01

    Full Text Available Olivia Le Saux,1 Bertrand Ripamonti,2 Amandine Bruyas,3,4 Olivier Bonin,4 Gilles Freyer,1,4 Marc Bonnefoy,4,5 Claire Falandry4,51Medical Oncology Unit, Lyon Sud University Hospital, Hospices Civils de Lyon, Pierre-Bénite, 2Gynaecology-Obstetrics Department, University Hospital, Saint-Etienne, 3Croix Rousse University Hospital, Hospices Civils de Lyon, Pierre-Bénite, 4Lyon University, Lyon, 5Geriatric Unit, Lyon Sud University Hospital, Hospices Civils de Lyon, Pierre-Bénite, FranceAbstract: Breast cancer (BC is the most common female malignancy in the world and almost one third of cases occur after 70 years of age. Optimal management of BC in the elderly is a real challenge and requires a multidisciplinary approach, mainly because the elderly population is heterogeneous. In this review, we describe the various possibilities of treatment for localized or metastatic BC in an aging population. We provide an overview of the comprehensive geriatric assessment, surgery, radiotherapy, and adjuvant therapy for early localized BC and of chemotherapy and targeted therapies for metastatic BC. Finally, we attempt to put into perspective the necessary balance between the expected benefits and risks, especially in the adjuvant setting.Keywords: elderly, breast cancer, geriatric assessment, surgery, chemotherapy, radiotherapy

  6. A Method for the Synthesis of Tetranitroglycoluril from Imidazo-[4,5-d]-imidazoles with Loss of Dinitrogen Oxide

    Science.gov (United States)

    2014-12-01

    A Method for the Synthesis of Tetranitroglycoluril from Imidazo-[4,5-d]- imidazoles with Loss of Dinitrogen Oxide by William M Sherrill, Eric...Method for the Synthesis of Tetranitroglycoluril from Imidazo-[4,5-d]- imidazoles with Loss of Dinitrogen Oxide William M Sherril and Joseph E Banning...

  7. Synaptic PI(3,4,5)P3 Is Required for Syntaxin1A Clustering and Neurotransmitter Release

    NARCIS (Netherlands)

    Khuong, T.M.; Habets, R.L.; Kuenen, S.; Witkowska, A.; Kasprowicz, J.; Swerts, J.; Jahn, R.; Bogaart, G. van den; Verstreken, P.

    2013-01-01

    PI(3,4,5)P3 is a low-abundance lipid thought to play a role in the regulation of synaptic activity; however, the mechanism remains obscure. We have constructed novel split Venus-based probes and used superresolution imaging to localize PI(3,4,5)P3 at Drosophila larval neuromuscular synapses. We find

  8. New EMBO members' review: actin cytoskeleton regulation through modulation of PI(4,5)P(2) rafts.

    Science.gov (United States)

    Caroni, P

    2001-08-15

    The phosphoinositide lipid PI(4,5)P(2) is now established as a key cofactor in signaling to the actin cytoskeleton and in vesicle trafficking. PI(4,5)P(2) accumulates at membrane rafts and promotes local co-recruitment and activation of specific signaling components at the cell membrane. PI(4,5)P(2) rafts may thus be platforms for local regulation of morphogenetic activity at the cell membrane. Raft PI(4,5)P(2) is regulated by lipid kinases (PI5-kinases) and lipid phosphatases (e.g. synaptojanin). In addition, GAP43-like proteins have recently emerged as a group of PI(4,5)P(2) raft-modulating proteins. These locally abundant proteins accumulate at inner leaflet plasmalemmal rafts where they bind to and co-distribute with PI(4,5)P(2), and promote actin cytoskeleton accumulation and dynamics. In keeping with their proposed role as positive modulators of PI(4,5)P(2) raft function, GAP43-like proteins confer competence for regulated morphogenetic activity on cells that express them. Their function has been investigated extensively in the nervous system, where their expression promotes neurite outgrowth, anatomical plasticity and nerve regeneration. Extrinsic signals and intrinsic factors may thus converge to modulate PI(4,5)P(2) rafts, upstream of regulated activity at the cell surface.

  9. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  10. Synthetic polyspermine imidazole-4, 5-amide as an efficient and cytotoxicity-free gene delivery system

    Directory of Open Access Journals (Sweden)

    Duan S

    2012-07-01

    Full Text Available Shi-Yue Duan, Xue-Mei Ge, Nan Lu, Fei Wu, Weien Yuan, Tuo JinSchool of Pharmacy, Shanghai Jiao Tong University, Shanghai, 200240, People's Republic of ChinaAbstract: A chemically dynamic spermine-based polymer: polyspermine imidazole-4, 5-amide (PSIA, Mw > 7 kDa was designed, synthesized, and evaluated in terms of its ability to deliver nucleic acids. This polymer was made from an endogenous monomer professionally condensing genes in sperms, spermine, and a known safety drug metabolite, imidazole-4, 5-dicarboxylic acid, through a bis-amide bond conjugated with the imidazole ring. This polymer can condense pDNA at a W/W ratio above 10 to form polyplexes (100–200 nm in diameter, which is consistent with the observation by transmission electron microscopy (TEM, and the zeta potential was in the range of 10–20 mV. The pDNA packaged polymer was stable in phosphate buffer solution (PBS at pH 7.4 (simulated body fluid while the polyplexes were releasing pDNA into the solution at pH 5.8 (simulated endo-lysosomes due to the degradation of the bis-amide linkages in response to changes in pH values. PSIA-polyplexes were able to achieve efficient cellular uptake and luciferase gene silencing by co-transfection of pDNA and siRNA in COS-7 cells and HepG2 cells with negligible cytotoxicity. Biodistribution of Rhodamine B-labeled PSIA-polyplexes after being systemically injected in BALB/c nude-mice showed that the polyplexes circulated throughout the body, accumulated mainly in the kidney at 4 hours of sample administration, and moved to the liver and spleen after 24 hours. All the results suggested that PSIA offered a promising example to balance the transfection efficiency and toxicity of a synthetic carrier system for the delivery of therapeutic nucleic acids.Keywords: gene delivery, polyspermine, cytotoxicity, transfection efficiency, biodistribution

  11. Translocation between PI(4,5)P2-poor and PI(4,5)P2-rich microdomains during store depletion determines STIM1 conformation and Orai1 gating.

    Science.gov (United States)

    Maléth, Jozsef; Choi, Seok; Muallem, Shmuel; Ahuja, Malini

    2014-12-17

    The Orai1-STIM1 current undergoes slow Ca(2+)-dependent inactivation (SCDI) mediated by the binding of SARAF to STIM1. Here we report the use of SCDI by SARAF as a probe of the conformation and microdomain localization of the Orai1-STIM1 complex. We find that the interaction of STIM1 with Orai1 carboxyl terminus (C terminus) and the STIM1 K-domain are required for the interaction of SARAF with STIM1 and SCDI. STIM1-Orai1 must be in a PM/ER microdomain tethered by E-Syt1, stabilized by septin4 and enriched in PI(4,5)P2 for STIM1-SARAF interaction. Targeting STIM1 to PI(4,5)P2-rich and -poor microdomains reveals that SARAF-dependent SCDI is observed only when STIM1-Orai1 are within the PI(4,5)P2-rich microdomain. Notably, store depletion results in transient localization of STIM1-Orai1 in the PI(4,5)P2-poor microdomain, which then translocates to the PI(4,5)P2-rich domain. These findings reveal the role of PM/ER tethers in the regulation of Orai1 function and a mode of regulation by PI(4,5)P2 involving translocation between PI(4,5)P2 microdomains.

  12. 1-(2,4-Dinitrophenyl-2-[(E-(3,4,5-trimethoxybenzylidene]hydrazine

    Directory of Open Access Journals (Sweden)

    Suchada Chantrapromma

    2014-02-01

    Full Text Available Molecules of the title compound, C16H16N4O7, are not planar with a dihedral angle of 5.50 (11° between the substituted benzene rings. The two meta-methoxy groups of the 3,4,5-trimethoxybenzene moiety lie in the plane of the attached ring [Cmethyl–O–C–C torsion angles −0.1 (4° and −3.7 (3°] while the para-methoxy substituent lies out of the plane [Cmethyl—O—C—C, −86.0 (3°]. An intramolecular N—H...O hydrogen bond involving the 2-nitro substituent generates an S(6 ring motif. In the crystal structure, molecules are linked by weak C—H...O interactions into screw chains, that are arranged into a sheet parallel to the bc plane. These sheets are connected by π–π stacking interactions between the nitro and methoxy substituted aromatic rings with a centroid–centroid separation of 3.9420 (13 Å. C—H...π contacts further stabilize the two-dimensional network.

  13. Research of quasi-solid fracture behavior of casting Al-4.5Cu alloys

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The influencing mechanisms of elements Ti and Ce and their interactions on fracture behaviors of casting alloys Al-4.5Cu-0.6Mn were studied by observing tensile fracture behavior in quasi-solid zone under SEM and EDX instruments.The results indicate that the resistance stress against hot cracking can be improved obviously by addition of Ti, because of its grain refining function. It is also found that, when Ce is added into the alloys, besides its effect in refining crystalline, the mechanical behavior of lower melting point eutectic phase in quasi-solid zone can be improved efficiently by some compounds with Ce formed and deposited between dendrites. Therefore, a coiligating effect of Ti and Ce on improving resistance stress against hot cracking is more efficient than that only single alloy element is applied. When hot cracking occurs, grains yield at first, and then crack spreads. Both inter-grain and trans-grain fractures are observed, but the major fracture manner is brittleness.

  14. Food neophobia and mealtime food consumption in 4-5 year old children.

    Science.gov (United States)

    Cooke, Lucy; Carnell, Susan; Wardle, Jane

    2006-07-06

    Previous research has documented a negative association between maternal report of child food neophobia and reported frequency of consumption of fruit, vegetables, and meat. This study aimed to establish whether neophobia is associated with lower intake of these food types in naturalistic mealtime situations. One hundred and nine parents of 4-5 year olds completed questionnaires which included a six-item version of the Child Food Neophobia Scale (CFNS). The children took part in a series of 3 test lunch meals at weekly intervals at school at which they were presented with: chicken, cheese, bread, cheese crackers, chocolate biscuits, grapes and tomatoes or carrot sticks. Food items served to each child were weighed before and after the meal to assess total intake of items in four categories: Fruit and vegetables, Protein foods, Starchy foods and Snack foods. Pearson Product Moment Correlations and independent t tests were performed to examine associations between scores on the CFNS and consumption during lunches. Neophobia was associated with lower consumption of fruit and vegetables, protein foods and total calories, but there was no association with intake of starch or snack foods. These results support previous research that has suggested that neophobia impacts differentially on consumption of different food types. Specifically it appears that children who score highly on the CFNS eat less fruit, vegetables and protein foods than their less neophobic peers. Attempts to increase intake of fruit, vegetables and protein might usefully incorporate strategies known to reduce the neophobic response.

  15. Future Climate Data from RCP 4.5 and Occurrence of Malaria in Korea

    Directory of Open Access Journals (Sweden)

    Jaewon Kwak

    2014-10-01

    Full Text Available Since its reappearance at the Military Demarcation Line in 1993, malaria has been occurring annually in Korea. Malaria is regarded as a third grade nationally notifiable disease susceptible to climate change. The objective of this study is to quantify the effect of climatic factors on the occurrence of malaria in Korea and construct a malaria occurrence model for predicting the future trend of malaria under the influence of climate change. Using data from 2001–2011, the effect of time lag between malaria occurrence and mean temperature, relative humidity and total precipitation was investigated using spectral analysis. Also, a principal component regression model was constructed, considering multicollinearity. Future climate data, generated from RCP 4.5 climate change scenario and CNCM3 climate model, was applied to the constructed regression model to simulate future malaria occurrence and analyze the trend of occurrence. Results show an increase in the occurrence of malaria and the shortening of annual time of occurrence in the future.

  16. GROMACS 4.5: A high-throughput and highly parallel open source molecular simulation toolkit

    Energy Technology Data Exchange (ETDEWEB)

    Pronk, Sander [Science for Life Lab., Stockholm (Sweden); KTH Royal Institute of Technology, Stockholm (Sweden); Pall, Szilard [Science for Life Lab., Stockholm (Sweden); KTH Royal Institute of Technology, Stockholm (Sweden); Schulz, Roland [Univ. of Tennessee, Knoxville, TN (United States); Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Larsson, Per [Univ. of Virginia, Charlottesville, VA (United States); Bjelkmar, Par [Science for Life Lab., Stockholm (Sweden); Stockholm Univ., Stockholm (Sweden); Apostolov, Rossen [Science for Life Lab., Stockholm (Sweden); KTH Royal Institute of Technology, Stockholm (Sweden); Shirts, Michael R. [Univ. of Virginia, Charlottesville, VA (United States); Smith, Jeremy C. [Univ. of Tennessee, Knoxville, TN (United States); Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kasson, Peter M. [Univ. of Virginia, Charlottesville, VA (United States); van der Spoel, David [Science for Life Lab., Stockholm (Sweden); Uppsala Univ., Uppsala (Sweden); Hess, Berk [Science for Life Lab., Stockholm (Sweden); KTH Royal Institute of Technology, Stockholm (Sweden); Lindahl, Erik [Science for Life Lab., Stockholm (Sweden); KTH Royal Institute of Technology, Stockholm (Sweden); Stockholm Univ., Stockholm (Sweden)

    2013-02-13

    In this study, molecular simulation has historically been a low-throughput technique, but faster computers and increasing amounts of genomic and structural data are changing this by enabling large-scale automated simulation of, for instance, many conformers or mutants of biomolecules with or without a range of ligands. At the same time, advances in performance and scaling now make it possible to model complex biomolecular interaction and function in a manner directly testable by experiment. These applications share a need for fast and efficient software that can be deployed on massive scale in clusters, web servers, distributed computing or cloud resources. As a result, we present a range of new simulation algorithms and features developed during the past 4 years, leading up to the GROMACS 4.5 software package. The software now automatically handles wide classes of biomolecules, such as proteins, nucleic acids and lipids, and comes with all commonly used force fields for these molecules built-in. GROMACS supports several implicit solvent models, as well as new free-energy algorithms, and the software now uses multithreading for efficient parallelization even on low-end systems, including windows-based workstations. Together with hand-tuned assembly kernels and state-of-the-art parallelization, this provides extremely high performance and cost efficiency for high-throughput as well as massively parallel simulations.

  17. Age-associated repression of type 1 inositol 1, 4, 5-triphosphate receptor impairs muscle regeneration

    Science.gov (United States)

    Lee, Bora; Lee, Seung-Min; Bahn, Young Jae; Lee, Kwang-Pyo; Kang, Moonkyung; Kim, Yeon-Soo; Woo, Sun-Hee; Lim, Jae-Young; Kim, Eunhee; Kwon, Ki-Sun

    2016-01-01

    Skeletal muscle mass and power decrease with age, leading to impairment of mobility and metabolism in the elderly. Ca2+ signaling is crucial for myoblast differentiation as well as muscle contraction through activation of transcription factors and Ca2+-dependent kinases and phosphatases. Ca2+ channels, such as dihydropyridine receptor (DHPR), two-pore channel (TPC) and inositol 1,4,5-triphosphate receptor (ITPR), function to maintain Ca2+ homeostasis in myoblasts. Here, we observed a significant decrease in expression of type 1 IP3 receptor (ITPR1), but not types 2 and 3, in aged mice skeletal muscle and isolated myoblasts, compared with those of young mice. ITPR1 knockdown using shRNA-expressing viruses in C2C12 myoblasts and tibialis anterior muscle of mice inhibited myotube formation and muscle regeneration after injury, respectively, a typical phenotype of aged muscle. This aging phenotype was associated with repression of muscle-specific genes and activation of the epidermal growth factor receptor (EGFR)-Ras-extracellular signal-regulated kinase (ERK) pathway. ERK inhibition by U0126 not only induced recovery of myotube formation in old myoblasts but also facilitated muscle regeneration after injury in aged muscle. The conserved decline in ITPR1 expression in aged human skeletal muscle suggests utility as a potential therapeutic target for sarcopenia, which can be treated using ERK inhibition strategies. PMID:27658230

  18. Whole-population vision screening in children aged 4-5 years to detect amblyopia.

    Science.gov (United States)

    Solebo, Ameenat Lola; Cumberland, Phillippa M; Rahi, Jugnoo S

    2015-06-06

    Amblyopia is a neurodevelopmental disorder that affects at least 2% of most populations and can lead to permanently reduced vision if not detected and treated within a specific period in childhood. Whole-population screening of children younger than 5 years is applied in many countries. The substantial diversity in existing programmes reflects their heterogeneous implementation in the absence of the complete evidence base that is now a pre-requisite for instituting screening. The functional importance of amblyopia at an individual level is unclear as data are scarce, but in view of the high prevalence the population-level effect might be notable. Screening of all children aged 4-5 years (eg, at school entry) confers most benefit and addresses inequity in access to timely treatment. Screening at younger ages is associated with increased risk of false-positive results, and at older ages with poor outcomes for children with moderate to severe amblyopia. We suggest that the real-life adverse effects of amblyopia should be characterised and screening and diagnosis should be standardised. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. BMP-mediated induction of GATA4/5/6 blocks somitic responsiveness to SHH.

    Science.gov (United States)

    Daoud, Georges; Kempf, Hervé; Kumar, Deepak; Kozhemyakina, Elena; Holowacz, Tamara; Kim, Dae-Won; Ionescu, Andreia; Lassar, Andrew B

    2014-10-01

    The relative timing of SHH and BMP signals controls whether presomitic mesoderm (PSM) cells will adopt either a chondrogenic or lateral plate mesoderm fate. Here we document that SHH-mediated induction of Nkx3.2 maintains the competence of somitic cells to initiate chondrogenesis in response to subsequent BMP signals by repressing BMP-dependent induction of GATA genes. Conversely, administration of BMP signals to PSM or forced expression of GATA family members in chick PSM explants blocks induction of hedgehog-dependent gene expression. We demonstrate that GATA factors can interact with Gli factors and can recruit the transcriptional co-factor FOG1 (ZFPM1) to the regulatory region of the mouse Gli1 gene, repressing the induction of Gli1 by SHH by binding to both GATA and Gli binding sites. Knockdown of FOG1 reverses the ability of GATA factors to repress Gli1 expression. Our findings uncover a novel role for GATA transcription factors as repressors of hedgehog signaling, and document that NKX3.2 maintains the ability of sclerotomal cells to express SHH transcriptional targets in the presence of BMP signals by repressing the induction of Gata4/5/6.

  20. The Ca2+-activated cation channel TRPM4 is regulated by phosphatidylinositol 4,5-biphosphate.

    Science.gov (United States)

    Nilius, Bernd; Mahieu, Frank; Prenen, Jean; Janssens, Annelies; Owsianik, Grzegorz; Vennekens, Rudi; Voets, Thomas

    2006-02-08

    Transient receptor potential (TRP) channel, melastatin subfamily (TRPM)4 is a Ca2+-activated monovalent cation channel that depolarizes the plasma membrane and thereby modulates Ca2+ influx through Ca2+-permeable pathways. A typical feature of TRPM4 is its rapid desensitization to intracellular Ca2+ ([Ca2+]i). Here we show that phosphatidylinositol 4,5-biphosphate (PIP2) counteracts desensitization to [Ca2+]i in inside-out patches and rundown of TRPM4 currents in whole-cell patch-clamp experiments. PIP2 shifted the voltage dependence of TRPM4 activation towards negative potentials and increased the channel's Ca2+ sensitivity 100-fold. Conversely, activation of the phospholipase C (PLC)-coupled M1 muscarinic receptor or pharmacological depletion of cellular PIP2 potently inhibited currents through TRPM4. Neutralization of basic residues in a C-terminal pleckstrin homology (PH) domain accelerated TRPM4 current desensitization and strongly attenuated the effect of PIP2, whereas mutations to the C-terminal TRP box and TRP domain had no effect on the PIP2 sensitivity. Our data demonstrate that PIP2 is a strong positive modulator of TRPM4, and implicate the C-terminal PH domain in PIP2 action. PLC-mediated PIP2 breakdown may constitute a physiologically important brake on TRPM4 activity.

  1. Almost there: Sector 7-8 being cooled to 4.5K!

    CERN Multimedia

    2007-01-01

    The cool down of the 3km long LHC sector 7-8 between point 7 (Ferney-Voltaire) and point 8 (Prévessin) has entered a new phase. The cryostats with the superconducting magnets, which had been kept around 20 K (-253°C) for the past week, are gradually being cooled down to 4.5 K (-268°C) and filled with liquid helium. This new phase in the cooling process was successfully started on Monday 5 March and is progressing after a tuning session that lasted most of the day. To get down to 1.9K (-271°C), a new component of the cryogenics plant, the 1.8K units, will be turned on. In the meantime the teams who will carry out the magnet powering are busy validating the test procedures and running the interlock tests to ensure safe operation of the equipment. They are ready to start the powering as soon as the cryo team reaches stable conditions at 1.9 K. Follow the cool down on the Hardware Commissioning Coordination website.

  2. Induction of inositol 1,4,5 trisphosphate receptor genes by ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Yan, J. [Queensland Inst. of Medical Research, Brisbane, QLD (Australia)]|[Queensland Univ., Brisbane, QLD (Australia). Dept. of Surgery; Khanna, K.K.; Lavin, M.F. [Queensland Inst. of Medical Research, Brisbane, QLD (Australia)

    1996-05-01

    We used differential display, a method designed to amplify partial cDNA sequences from subsets of mRNAs, to identify mRNAs induced by ionizing radiation in human Epstein Barr Virus (EBV)-transformed lymphoblastoid cells. Increased expression of a cDNA corresponding to the inositol 1,4,5 trisphosphate receptor (InsP{sub 3}R) type 1 was observed after exposure of cells to 3Gy {gamma}-rays. This was confirmed by Northern blot analysis. The increase in mRNA for InsP{sub 3}R type 1 was accompanied by a corresponding increase in the level of InsP{sub 3}R type 1 protein as determined by Western blotting. Exposure of cells from patients with the human genetic disorder ataxia-telangiectasia (A-T), characterized by hypersensitivity to ionizing radiation, failed to change the levels of InsP{sub 3}R type 1 mRNA and, as expected, there was no increase in InsP{sub 3}R type 1 protein in A-T cells in response to radiation exposure. Protein levels for two other InsP{sub 3}Rs, types 2 and 3, were observed to increase in control and A-T cells after exposure to ionizing radiation. The induction of the InsP{sub 3}R type 1, which is primarily located in the endoplasmic reticulum, may play an important role in radiation signal transduction. (Author).

  3. Optimization and in vivo toxicity evaluation of G4.5 PAMAM dendrimer-risperidone complexes.

    Directory of Open Access Journals (Sweden)

    Maria Jimena Prieto

    Full Text Available Risperidone is an approved antipsychotic drug belonging to the chemical class of benzisoxazole. This drug has low solubility in aqueous medium and poor bioavailability due to extensive first-pass metabolism and high protein binding (>90%. Since new strategies to improve efficient treatments are needed, we studied the efficiency of anionic G4.5 PAMAM dendrimers as nanocarriers for this therapeutic drug. To this end, we explored dendrimer-risperidone complexation dependence on solvent concentration, pH and molar relationship. The best dendrimer-risperidone incorporation (46 risperidone molecules per dendrimer was achieved with a mixture of chloroform:methanol 50∶50 v/v solution pH 3. In addition, to explore the possible effects of this complex, in vivo studies were carried out in the zebrafish model. Changes in the development of dopaminergic neurons and motoneurons were studied using tyrosine hydroxylase and calretinin, respectively. Physiological changes were studied through histological sections stained with hematoxylin-eosin to observe possible morphological brain changes. The most significant changes were observed when larvae were treated with free risperidone, and no changes were observed when larvae were treated with the complex.

  4. Optimization and in vivo toxicity evaluation of G4.5 PAMAM dendrimer-risperidone complexes.

    Science.gov (United States)

    Prieto, Maria Jimena; del Rio Zabala, Nahuel Eduardo; Marotta, Cristian Hernán; Carreño Gutierrez, Hector; Arévalo Arévalo, Rosario; Chiaramoni, Nadia Silvia; del Valle Alonso, Silvia

    2014-01-01

    Risperidone is an approved antipsychotic drug belonging to the chemical class of benzisoxazole. This drug has low solubility in aqueous medium and poor bioavailability due to extensive first-pass metabolism and high protein binding (>90%). Since new strategies to improve efficient treatments are needed, we studied the efficiency of anionic G4.5 PAMAM dendrimers as nanocarriers for this therapeutic drug. To this end, we explored dendrimer-risperidone complexation dependence on solvent concentration, pH and molar relationship. The best dendrimer-risperidone incorporation (46 risperidone molecules per dendrimer) was achieved with a mixture of chloroform:methanol 50∶50 v/v solution pH 3. In addition, to explore the possible effects of this complex, in vivo studies were carried out in the zebrafish model. Changes in the development of dopaminergic neurons and motoneurons were studied using tyrosine hydroxylase and calretinin, respectively. Physiological changes were studied through histological sections stained with hematoxylin-eosin to observe possible morphological brain changes. The most significant changes were observed when larvae were treated with free risperidone, and no changes were observed when larvae were treated with the complex.

  5. Research of quasi-solid fracture behavior of casting AI-4.5Cu alloys

    Directory of Open Access Journals (Sweden)

    Shengquan DONG

    2005-02-01

    Full Text Available The influencing mechanisms of elements Ti and Ce and their interactions on fracture behaviors of casting alloys AI-4.5Cu-0.6Mn were studied by observing tensile fracture behavior in quasi-solid zone under SEM and EDX instruments.The results indicate that the resistance stress against hot cracking can be improved obviously by addition of Ti, because of its grain refining function. It is also found that, when Ce is added into the alloys, besides its effect in refining crystalline, the mechanical behavior of lower melting point eutectic phase in quasi-solid zone can be improved efficiently by some compounds with Ce formed and deposited between dendrites. Therefore, a colligating effect of Ti and Ce on improving resistance stress against hot cracking is more efficient than that only single alloy element is applied. When hot cracking occurs, grains yield at first, and then crack spreads. Both inter-grain and trans-grain fractures are observed, but the major fracture manner is brittleness.

  6. The inositol 1,4,5-trisphosphate receptor regulates autophagy through its interaction with Beclin 1.

    Science.gov (United States)

    Vicencio, J M; Ortiz, C; Criollo, A; Jones, A W E; Kepp, O; Galluzzi, L; Joza, N; Vitale, I; Morselli, E; Tailler, M; Castedo, M; Maiuri, M C; Molgó, J; Szabadkai, G; Lavandero, S; Kroemer, G

    2009-07-01

    The inositol 1,4,5-trisphosphate receptor (IP(3)R) is a major regulator of apoptotic signaling. Through interactions with members of the Bcl-2 family of proteins, it drives calcium (Ca(2+)) transients from the endoplasmic reticulum (ER) to mitochondria, thereby establishing a functional and physical link between these organelles. Importantly, the IP(3)R also regulates autophagy, and in particular, its inhibition/depletion strongly induces macroautophagy. Here, we show that the IP(3)R antagonist xestospongin B induces autophagy by disrupting a molecular complex formed by the IP(3)R and Beclin 1, an interaction that is increased or inhibited by overexpression or knockdown of Bcl-2, respectively. An effect of Beclin 1 on Ca(2+) homeostasis was discarded as siRNA-mediated knockdown of Beclin 1 did not affect cytosolic or luminal ER Ca(2+) levels. Xestospongin B- or starvation-induced autophagy was inhibited by overexpression of the IP(3)R ligand-binding domain, which coimmunoprecipitated with Beclin 1. These results identify IP(3)R as a new regulator of the Beclin 1 complex that may bridge signals converging on the ER and initial phagophore formation.

  7. Distribution and release of 2,4,5-trichlorobiphenyl in ice

    Directory of Open Access Journals (Sweden)

    Guo-xia Pei

    2015-04-01

    Full Text Available The distribution of persistent organic pollutants (POPs in ice and the release of POPs from ice during ice melting have an important influence on the eco-environment and water quality of a river. Through laboratory simulation experiments, the distribution and release of 2,4,5-trichlorobiphenyl (PCB29 in ice and the partition coefficients of PCB29 in ice water at different temperatures, concentrations, and pH levels were studied. The results showed that, at different temperatures and concentrations, the concentration of PCB29 in ice increased progressively with depth. The modes of release of different concentrations of PCB29 from ice were obtained. A large amount of PCB29 was released rapidly in the first melting period, and then the remaining PCB29 was released uniformly. The pH value dominated both the distribution and late release of PCB29 in ice. In ice water, at different temperatures, concentrations, and pH levels, the majority of PCB29 entered the water, and a lesser amount remained in the ice. Finally, laboratory experiment results were verified with field investigations. A theoretical framework is provided by this research of the behavior of POPs in ice under different environmental conditions, but a more quantitative understanding of the behavior of POPs in ice will need to be developed through further laboratory studies combined with field investigations.

  8. Structural and Theoretical Investigation of Anhydrous 3,4,5-Triacetoxybenzoic Acid.

    Directory of Open Access Journals (Sweden)

    Paulo S Carvalho

    Full Text Available A comprehensive investigation of anhydrous form of 3,4,5-Triacetoxybenzoic acid (TABA is reported. Single crystal X-ray diffraction, Thermal analysis, Fourier Transform Infrared spectroscopy (FTIR and DFT calculations were applied for TABA characterization. This anhydrous phase crystallizes in the triclinic [Formula: see text] space group (Z' = 1 and its packing shows a supramolecular motif in a classical [Formula: see text] ring formed by acid-acid groups association. The phase stability is accounted in terms of supramolecular architecture and its thermal behaviour. Conformation search at B3LYP/6-311++G(2d,p level of theory shows the existence of three stable conformers and the most stable conformation was found experimentally. The reactivity of TABA was investigated using the molecular orbital theory and molecular electrostatic potential. The calculation results were used to simulate the infrared spectrum. There is a good agreement between calculated and experimental IR spectrum, which allowed the assignment of the normal vibrational modes.

  9. Human Talent Prediction in HRM using C4.5 Classification Algorithm

    Directory of Open Access Journals (Sweden)

    Hamidah Jantan,

    2010-11-01

    Full Text Available In HRM, among the challenges for HR professionals is to manage an organization’s talents, especially to ensure the right person for the right job at the right time. Human talent prediction is an alternative to handle this issue. Due to that reason, classification and prediction in data mining which is commonly used in many areas can also be implemented to human talent. There are many classification techniques in data mining techniques such as Decision Tree, Neural Network, Rough Set Theory, Bayesian theory and Fuzzy logic. Decision tree is among the popular classification techniques, which can produce the interpretable rules or logic statement. Thegenerated rules from the selected technique can be used for future prediction. In this article, we present the study on how the potential human talent can be predicted using a decision tree classifier. By using this technique, the pattern of talent performance can be identified through the classification process. In that case, the hidden and valuable knowledge discovered in the related databases will be summarized in the decision tree structure. In this study, we use decision tree C4.5 classification algorithm to generate the classification rules for human talent performance records. Finally, the generated rules are evaluated using the unseen data in order to estimate the accuracy of the prediction result.

  10. A White Light Megaflare on the dM4.5e Star YZ CMi

    CERN Document Server

    Kowalski, Adam F; Holtzman, Jon A; Wisniewski, John P; Hilton, Eric J

    2010-01-01

    On UT 2009 January 16, we observed a white light megaflare on the dM4.5e star YZ CMi as part of a long-term spectroscopic flare-monitoring campaign to constrain the spectral shape of optical flare continuum emission. Simultaneous U-band photometric and 3350A-9260A spectroscopic observations were obtained during 1.3 hours of the flare decay. The event persisted for more than 7 hours and at flare peak, the U-band flux was almost 6 magnitudes brighter than in the quiescent state. The properties of this flare mark it as one of the most energetic and longest-lasting white light flares ever to be observed on an isolated low-mass star. We present the U-band flare energetics and a flare continuum analysis. For the first time, we show convincingly with spectra that the shape of the blue continuum from 3350A to 4800A can be represented as a sum of two components: a Balmer continuum as predicted by the Allred et al radiative hydrodynamic flare models and a T ~ 10,000K blackbody emission component as suggested by many pr...

  11. Reactions of organyl and silyl alanes with 1,3,4,5,6-pentamethyl-2-aminoborazine.

    Science.gov (United States)

    Fan, Maomin; Duesler, Eileen N; Nöth, Heinrich; Paine, Robert T

    2010-03-15

    The reactions of (Me(3)Si)(3)Al, Me(3)Al, Et(3)Al, and i-Bu(3)Al with 1,3,4,5,6-pentamethyl-2-aminoborazine have been examined. An amine alane adduct (Me(3)Si)(3)Al.NH(2)B(3)(Me)(2)N(3)Me(3) (1) and several elimination products [(Me(3)Si)(2)AlN(H)B(3)(Me)(2)N(3)Me(3)](2) (2), [(Me(3)SiAl)(4)(Me(3)SiN)(3)NH] (3), [Me(2)AlN(H) B(3)(Me)(2)N(3)Me(3)](2) (4), [Et(2)AlN(H) B(3)(Me)(2)N(3)Me(3)](2) (5), and [i-Bu(2)AlN(H) B(3)(Me)(2)N(3)Me(3)](2) (6) have been isolated. Compounds 1, 2, 4-6 have been spectroscopically characterized, and single crystal X-ray diffraction structure determinations have been completed for 1-4 and 6. The molecular chemistry provides insight into the reaction of Me(3)Al and 1,3,5-N-trimethyl-2,4,6-B-triaminoborazine that, upon pyrolysis, produces AlN/BN composite ceramic materials.

  12. Klasifikasi Nilai Kelayakan Calon Debitur Baru Menggunakan Decision Tree C4.5

    Directory of Open Access Journals (Sweden)

    Bambang Hermanto

    2017-01-01

    Full Text Available In an effort to improve the quality of customer service, especially in terms of feasibility assessment of borrowers due to the increasing number of new prospective borrowers loans financing the purchase of a motor vehicle, then the company needs a decision making tool allowing you to easily and quickly estimate Where the debtor is able to pay off the loans. This study discusses the process generates C4.5 decision tree algorithm and utilizing the learning group of debtor financing dataset motorcycle. The decision tree is then interpreted into the form of decision rules that can be understood and used as a reference in processing the data of borrowers in determining the feasibility of prospective new borrowers. Feasibility value refers to the value of the destination parameter credit status. If the value of the credit is paid off status mean estimated prospective borrower is able to repay the loan in question, but if the credit status parameters estimated worth pull means candidates concerned debtor is unable to pay loans.. System testing is done by comparing the results of the testing data by learning data in three scenarios with the decision that the data is valid at over 70% for all case scenarios. Moreover, in generated tree  and generate rules takes fairly quickly, which is no more than 15 minutes for each test scenario

  13. Histology of a Marfan aorta 4.5 years after personalized external aortic root support.

    Science.gov (United States)

    Pepper, John; Goddard, Martin; Mohiaddin, Raad; Treasure, Tom

    2015-09-01

    In 2008, a 26-year old man had personalized external aortic root support (PEARS) with a macroporous mesh. He was the 16th of 46 patients to have this operation. He had a typical Marfan habitus. His mother died of this disease as did his brother, with an aortic dissection. The patient himself died suddenly 4.5 years after his PEARS operation. At autopsy, there was no blood in the pericardium. The coronary orifices and proximal arteries were normal. His bicuspid aortic valve was minimally regurgitant as it was prior to operation and remained throughout follow-up. Macroscopically the implanted mesh was embedded in the adventitia and not separable from the aortic wall. Microscopically it was fully incorporated with collagen fibres as has been seen in our animal studies. The unsupported aortic arch showed some focal fragmentation of elastic fibres and a mild increase in mucopolysaccharides consistent with Marfan syndrome. These appearances were not present in the supported aortic root, which had the histological appearance of a normal aorta. He was the first patient to die with an implant. The histological appearances suggest the possibility that the incorporated support of the aortic root allowed recovery of the microstructure of the media.

  14. Reduction of carcinogenic 4(5)-methylimidazole in a caramel model system: influence of food additives.

    Science.gov (United States)

    Seo, Seulgi; Ka, Mi-Hyun; Lee, Kwang-Geun

    2014-07-09

    The effect of various food additives on the formation of carcinogenic 4(5)-methylimidazole (4-MI) in a caramel model system was investigated. The relationship between the levels of 4-MI and various pyrazines was studied. When glucose and ammonium hydroxide were heated, the amount of 4-MI was 556 ± 1.3 μg/mL, which increased to 583 ± 2.6 μg/mL by the addition of 0.1 M of sodium sulfite. When various food additives, such as 0.1 M of iron sulfate, magnesium sulfate, zinc sulfate, tryptophan, and cysteine were added, the amount of 4-MI was reduced to 110 ± 0.7, 483 ± 2.0, 460 ± 2.0, 409 ± 4.4, and 397 ± 1.7 μg/mL, respectively. The greatest reduction, 80%, occurred with the addition of iron sulfate. Among the 12 pyrazines, 2-ethyl-6-methylpyrazine with 4-MI showed the highest correlation (r = -0.8239).

  15. Reactivity and Synthetic Applications of 4,5-Dicyanopyridazine: An Overview

    Directory of Open Access Journals (Sweden)

    Donatella Giomi

    2010-03-01

    Full Text Available Despite the poor reputation of electron-deficient pyridazines in intermolecular Hetero Diels-Alder (HDA reactions, 4,5-dicyanopyridazine (DCP showed a surprising reactivity as a heterocyclic azadiene in inverse electron-demand HDA processes with different dienophiles. The use of alkenes, alkynes and enamines as 2p electron counterparts afforded dicyanocyclohexa-1,3-dienes and substituted phthalonitriles, respectively, while the use of suitable bis-dienophiles provides a general strategy for the one-pot synthesis of polycyclic carbo- and hetero-cage systemsthrough pericyclic three-step homodomino processes. HDA reactions with heterocyclic dienophiles allowed direct benzoannelation: in particular, pyrrole and indole derivatives were converted to dicyano-indoles and -carbazoles. In addition an unprecedented reactivity of DCP as a very reactive heterocyclic electrophile at the C-4 carbon was also evidenced: by changing the experimental conditions, cyanopyrrolyl- and cyanoindolyl-pyridazines were obtained through reactions of pyrrole and indole systems as carbon nucleophiles in formal SNAr2 processes where a CN group of DCP acts as leaving group. Thus, careful control of the reaction conditions allows exploitation of both pathways for the synthesis of different classes of heterocyclic derivatives.

  16. Purine DNA adducts of 4,5-dioxovaleric acid and 2,4-decadienal.

    Science.gov (United States)

    Cadet, J; Carvalho, V M; Onuki, J; Douki, T; Medeiros, M H; Di Mascio, P D

    1999-01-01

    The present overview describes recent findings on the formation of cyclic adducts of purine DNA bases after reaction with two aldehyde compounds, 4,5-dioxovaleric acid (DOVA) and 2,4-decadlenal (DDE), which are involved in 5-aminolaevulinic acid (ALA) accumulation and lipid peroxidation, respectively. ALA accumulates under pathological conditions and is associated with an increased incidence of liver cancer. The final oxidation product of ALA, DOVA, is an efficient alkylating agent of the guanine moieties in both nucleoside and isolated DNA. Adducts were produced through the formation of a Schiff base involving the N2-amino group of 2'-deoxyguanosine and the ketone function of DOVA, respectively. DDE is an important breakdown product of lipid peroxidation. It is cytotoxic to mammalian cells and is known to be implicated in DNA damage. It can bind to 2'-deoxyadenosine, yielding highly fluorescent products, including 1,N6-etheno-2'-deoxyadenosine and two other, related adducts. The reaction mechanism for the formation of DDE-2'-deoxyadenosine adducts involves epoxidation of DDE and subsequent addition of the resulting reactive intermediates to the N6 amino group of 2'-deoxyadenosine, followed by cyclization at the N1 site. Formation of endogenous DNA adducts may contribute to the genotoxic potential of ALA and DDE.

  17. Numerical study of successive CMEs during November 4-5, 1998

    Institute of Scientific and Technical Information of China (English)

    ZHOU YuFen; FENG XueShang

    2008-01-01

    We present the solar-terrestrial transit process of three successive coronal mass ejections (CMEs) of November 4-5, 1998 originating from active region 8375 by using a Ume-dependent three-dimensional magnetohydrodynamics (MHD) simula-tion. These CMEs interacted with each other while they were propagating in inter-planetary space and finally formed a "complex ejecta". A newly developed SIP-CESE MHD model was applied to solve MHD equations numerically. The quiet solar wind was started from Parker-like 10 solar wind solution and the magnetic field map was calculated from the solar photospheric magnetic field data. In our simulation, the ejections were initiated using pulse in the real active region 8375. The interplanetary disturbance parameters, such as speed, direction and angular size of the expanding CME, were determined from the SOHO/LASCO data with the cone-model. We discussed the three-dimensional aspects of the propagation, in-teracllon and merging of the three ejections. The simulated interplanetary shocks were compared with the nearby-Earth measurement. The results showed that our simulation could reproduce and explain some of the general features observed by satellite for the "complex ejects".

  18. Performance appraisal of VAS radiometry for GOES-4, -5 and -6

    Science.gov (United States)

    Chesters, D.; Robinson, W. D.

    1983-01-01

    The first three VISSR Atmospheric Sounders (VAS) were launched on GOES-4, -5, and -6 in 1980, 1981 and 1983. Postlaunch radiometric performance is assessed for noise, biases, registration and reliability, with special attention to calibration and problems in the data processing chain. The postlaunch performance of the VAS radiometer meets its prelaunch design specifications, particularly those related to image formation and noise reduction. The best instrument is carried on GOES-5, currently operational as GOES-EAST. Single sample noise is lower than expected, especially for the small longwave and large shortwave detectors. Detector to detector offsets are correctable to within the resolution limits of the instrument. Truncation, zero point and droop errors are insignificant. Absolute calibration errors, estimated from HIRS and from radiation transfer calculations, indicate moderate, but stable biases. Relative calibration errors from scanline to scanline are noticeable, but meet sounding requirements for temporarily and spatially averaged sounding fields of view. The VAS instrument is a potentially useful radiometer for mesoscale sounding operations. Image quality is very good. Soundings derived from quality controlled data meet prelaunch requirements when calculated with noise and bias resistant algorithms.

  19. Activationless charge transport across 4.5 to 22 nm in molecular electronic junctions.

    Science.gov (United States)

    Yan, Haijun; Bergren, Adam Johan; McCreery, Richard; Della Rocca, Maria Luisa; Martin, Pascal; Lafarge, Philippe; Lacroix, Jean Christophe

    2013-04-01

    In this work, we bridge the gap between short-range tunneling in molecular junctions and activated hopping in bulk organic films, and greatly extend the distance range of charge transport in molecular electronic devices. Three distinct transport mechanisms were observed for 4.5-22-nm-thick oligo(thiophene) layers between carbon contacts, with tunneling operative when d  16 nm for high temperatures and low bias, and a third mechanism consistent with field-induced ionization of highest occupied molecular orbitals or interface states to generate charge carriers when d = 8-22 nm. Transport in the 8-22-nm range is weakly temperature dependent, with a field-dependent activation barrier that becomes negligible at moderate bias. We thus report here a unique, activationless transport mechanism, operative over 8-22-nm distances without involving hopping, which severely limits carrier mobility and device lifetime in organic semiconductors. Charge transport in molecular electronic junctions can thus be effective for transport distances significantly greater than the 1-5 nm associated with quantum-mechanical tunneling.

  20. Roles of inositol 1,4,5-trisphosphate receptors in spinocerebellar ataxias.

    Science.gov (United States)

    Tada, Masayoshi; Nishizawa, Masatoyo; Onodera, Osamu

    2016-03-01

    Modulation of the intracellular calcium concentration is a ubiquitous signaling system involved in the control of numerous biological processes in a wide variety of cells. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3Rs), which act as calcium release channels in the ER membrane, play a key role in the regulation of intracellular calcium concentration. IP3R type 1 (IP3R1) is the major neuronal IP3R isoform in the central nervous system and particularly abundant in cerebellar Purkinje cells. Heterozygous deletions or missense mutations in ITPR1, which encodes IP3R1, result in autosomal dominantly inherited spinocerebellar ataxias (SCAs), including SCA types 15 (SCA15) and 29 (SCA29). In addition, homozygous missense mutations in carbonic anhydrase-related protein VIII (CARP), which suppresses the ability of IP3 to bind to IP3R1, cause a recessively inherited ataxia with mild cognitive impairment with/without quadrupedal gait. Moreover, cytosolic calcium overload with excessive IP3R1 activity has been implicated in the pathogenesis of other SCAs, including SCA types 2 (SCA2) and 3 (SCA3). These facts indicate that dysregulation of IP3R-mediated calcium signaling is linked to the pathogenesis of SCAs. Here, we focus on the molecular basis of SCA15 and SCA29, which are caused by mutations in ITPR1. In addition, we discuss other SCAs whose pathogenesis may be linked to aberrant activation of IP3R-mediated Ca(2+) signaling.

  1. Shot reproducibility of the self-magnetic-pinch diode at 4.5 MV

    Directory of Open Access Journals (Sweden)

    Nichelle Bennett

    2014-05-01

    Full Text Available In experiments conducted at Sandia National Laboratories’ RITS-6 accelerator, the self-magnetic-pinch diode exhibits significant shot-to-shot variability. Specifically, for identical hardware operated at the same voltage, some shots exhibit a catastrophic drop in diode impedance. A study is underway to identify sources of shot-to-shot variations which correlate with diode impedance collapse. The scope of this report is limited to data collected at 4.5-MV peak voltage and sources of variability which occur away from the diode, such as sheath electron emission and trajectories, variations in pulsed power, load and transmission line alignment, and different field shapers. We find no changes in the transmission line hardware, alignment, or hardware preparation methods which correlate with impedance collapse. However, in classifying good versus poor shots, we find that there is not a continuous spectrum of diode impedance behavior but that the good and poor shots can be grouped into two distinct impedance profiles. In poor shots, the sheath current in the load region falls from 16%–30% of the total current to less than 10%. This result will form the basis of a follow-up study focusing on the variability resulting from diode physics.

  2. A Map of Dust Reddening to 4.5 kpc from Pan-STARRS1

    CERN Document Server

    Schlafly, E F; Finkbeiner, D P; Juric, M; Rix, H -W; Martin, N F; Burgett, W S; Chambers, K C; Draper, P W; Hodapp, K W; Kaiser, N; Kudritzki, R -P; Magnier, E A; Metcalfe, N; Morgan, J S; Price, P A; Stubbs, C W; Tonry, J L; Wainscoat, R J; Waters, C

    2014-01-01

    We present a map of the dust reddening to 4.5 kpc derived from Pan-STARRS1 stellar photometry. The map covers almost the entire sky north of declination -30 degrees at a resolution of 7' to 14', and is based on the estimated distances and reddenings to more than 500 million stars. The technique is designed to map dust in the Galactic plane, where many other techniques are stymied by the presence of multiple dust clouds at different distances along each line of sight. This reddening-based dust map agrees closely with the Schlegel, Finkbeiner, and Davis (SFD; 1998) far-infrared emission-based dust map away from the Galactic plane, and the most prominent differences between the two maps stem from known limitations of SFD in the plane. We also compare the map with Planck, finding likewise good agreement in general at high latitudes. The use of optical data from Pan-STARRS1 yields reddening uncertainty as low as 25 mmag E(B-V).

  3. A map of dust reddening to 4.5 kpc from Pan-STARRS1

    Energy Technology Data Exchange (ETDEWEB)

    Schlafly, E. F.; Rix, H.-W.; Martin, N. F. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Green, G.; Finkbeiner, D. P. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Jurić, M. [LSST Corporation, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Burgett, W. S.; Chambers, K. C.; Hodapp, K. W.; Kaiser, N.; Kudritzki, R.-P.; Magnier, E. A.; Morgan, J. S.; Tonry, J. L.; Wainscoat, R. J.; Waters, C. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Draper, P. W.; Metcalfe, N. [Department of Physics, Durham University, South Road, Durham DH1 3LE (United Kingdom); Price, P. A. [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Stubbs, C. W. [Department of Physics, Harvard University, 17 Oxford Street, Cambridge, MA 02138 (United States)

    2014-07-01

    We present a map of the dust reddening to 4.5 kpc derived from Pan-STARRS1 stellar photometry. The map covers almost the entire sky north of declination –30° at a resolution of 7'-14', and is based on the estimated distances and reddenings to more than 500 million stars. The technique is designed to map dust in the Galactic plane, where many other techniques are stymied by the presence of multiple dust clouds at different distances along each line of sight. This reddening-based dust map agrees closely with the Schlegel et al. (SFD) far-infrared emission-based dust map away from the Galactic plane, and the most prominent differences between the two maps stem from known limitations of SFD in the plane. We also compare the map with Planck, finding likewise good agreement in general at high latitudes. The use of optical data from Pan-STARRS1 yields reddening uncertainty as low as 25 mmag E(B – V).

  4. High-spin states with seniority v=4, 5, and 6 in 119-126Sn

    Science.gov (United States)

    Astier, A.; Porquet, M.-G.; Theisen, Ch.; Verney, D.; Deloncle, I.; Houry, M.; Lucas, R.; Azaiez, F.; Barreau, G.; Curien, D.; Dorvaux, O.; Duchêne, G.; Gall, B. J. P.; Redon, N.; Rousseau, M.; Stézowski, O.

    2012-05-01

    The 119-126Sn nuclei have been produced as fission fragments in two reactions induced by heavy ions: 12C+238U at a bombarding energy of 90 MeV and 18O+208Pb at 85 MeV. Their level schemes have been built from γ rays detected using the Euroball array. High-spin states located above the long-lived isomeric states of the even- and odd-A 120-126Sn nuclei have been identified. Moreover, isomeric states lying around 4.5 MeV have been established in 120,122,124,126Sn from the delayed coincidences between the fission fragment detector SAPhIR and the Euroball array. The states located above 3 MeV excitation energy are ascribed to several broken pairs of neutrons occupying the νh11/2 orbit. The maximum value of angular momentum available in such a high-j shell, i.e., for midoccupation and the breaking of the three neutron pairs, has been identified. This process is observed for the first time in spherical nuclei.

  5. Investigations of shot reproducibility for the SMP diode at 4.5 MV.

    Energy Technology Data Exchange (ETDEWEB)

    Bennett, Nichelle; Crain, Marlon D.; Droemer, Darryl W.; Gignac, Raymond Edward; Lare, Gregory A.; Molina, Isidro; Obregon, Rafael; Smith, Chase C.; Wilkins, Frank Lee; Welch, Dale Robert; Cordova, Steve Ray; Gallegos, M.; Johnston, Mark D.; Kiefer, Mark L; Leckbee, Joshua J.; Nielsen, Daniel Scott; Oliver, Bryan Velten; Renk, Timothy Jerome; Romero, Tobias; Webb, Timothy Jay; Ziska, Derek Raymond

    2013-11-01

    In experiments conducted on the RITS-6 accelerator, the SMP diode exhibits sig- ni cant shot-to-shot variability. Speci cally, for identical hardware operated at the same voltage, some shots exhibit a catastrophic drop in diode impedance. A study is underway to identify sources of shot-to-shot variations which correlate with diode impedance collapse. To remove knob emission as a source, only data from a shot series conducted with a 4.5-MV peak voltage are considered. The scope of this report is limited to sources of variability which occur away from the diode, such as power ow emission and trajectory changes, variations in pulsed power, dustbin and transmission line alignment, and di erent knob shapes. We nd no changes in the transmission line hardware, alignment, or hardware preparation methods which correlate with impedance collapse. However, in classifying good versus poor shots, we nd that there is not a continuous spectrum of diode impedance behavior but that the good and poor shots can be grouped into two distinct impedance pro les. This result forms the basis of a follow-on study focusing on the variability resulting from diode physics. 3

  6. Binding of PLCδ1PH-GFP to Ptdlns(4,5)P2 prevents inhibition of phospholipase C-mediated hydrolysis of Ptdlns(4,5)P2 by neomycin

    Institute of Scientific and Technical Information of China (English)

    Chuan WANG; Xiao-na DU; Qing-zhong JIA; Hai-lin ZHANG

    2005-01-01

    Aim: To investigate the effects of the pleckstrin homology (PH) domain of phospholipase Cδ1 (PLCδ1PH) on inhibition of phospholipase C (PLC)-mediated hydrolysis of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] by neomycin.Methods: A fusion construct of green fluorescent protein (GFP) and PLCδ1PH (PLCδ1PH-GFP), which is known to bind Ptdlns(4,5)P2 specifically, together with laser-scanning confocal microscopy, was used to trace PtdIns(4,5)P2 translocation.Results: Stimulation of the type 1 muscarinic receptor and the bradykinin 2 receptor induced a reversible PLCδ1PH-GFP translocation from the membrane to the cytosol in COS-7 cells. PLC inhibitor U73122 blocked the translocation.Wortmannin, a known PtdIns kinase inhibitor, did not affect the translocation induced by ACh, but blocked recovery after translocation, indicating that PtdIns(4,5)P2 hydrolysis occurs through receptor-mediated PLC activation.Neomycin, a commonly used phospholipase C blocker, failed to block the receptor-induced PLCδ1PH-GFP translocation, indicating that neomycin is unable to block PLC-mediated PtdIns(4,5)P2 hydrolysis. However, in the absence of PLCδ1PH-GFP expression, neomycin abolished the receptor-induced hydrolysis of PtdIns(4,5)P2 by PLC. Conclusion: Although PLCδ1PH and neomycin bind to PtdIns(4,5)P2 in a similar way, they have distinct effects on receptor-mediated activation of PLC and PtdIns(4,5)P2 hydrolysis.

  7. CLONING AND CHARACTERIZATION OF A CHROMOSOMAL DNA REGION REQUIRED FOR GROWTH ON 2,4,5-T BY PSEUDOMONAS CEPACIA AC1100

    Science.gov (United States)

    A series of spontaneous 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) nonmetabolizing mutants of Pseudomonas cepacia AC1100 were characterized to be defective in either 2,4,5-T uptake or conversion of this compound to 2,4,5-trichlorophenol (2,4,5-TCP). Two of these mutants, RHC22 a...

  8. PLC-mediated PI(4,5)P2 hydrolysis regulates activation and inactivation of TRPC6/7 channels.

    Science.gov (United States)

    Itsuki, Kyohei; Imai, Yuko; Hase, Hideharu; Okamura, Yasushi; Inoue, Ryuji; Mori, Masayuki X

    2014-02-01

    Transient receptor potential classical (or canonical) (TRPC)3, TRPC6, and TRPC7 are a subfamily of TRPC channels activated by diacylglycerol (DAG) produced through the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) by phospholipase C (PLC). PI(4,5)P2 depletion by a heterologously expressed phosphatase inhibits TRPC3, TRPC6, and TRPC7 activity independently of DAG; however, the physiological role of PI(4,5)P2 reduction on channel activity remains unclear. We used Förster resonance energy transfer (FRET) to measure PI(4,5)P2 or DAG dynamics concurrently with TRPC6 or TRPC7 currents after agonist stimulation of receptors that couple to Gq and thereby activate PLC. Measurements made at different levels of receptor activation revealed a correlation between the kinetics of PI(4,5)P2 reduction and those of receptor-operated TRPC6 and TRPC7 current activation and inactivation. In contrast, DAG production correlated with channel activation but not inactivation; moreover, the time course of channel inactivation was unchanged in protein kinase C-insensitive mutants. These results suggest that inactivation of receptor-operated TRPC currents is primarily mediated by the dissociation of PI(4,5)P2. We determined the functional dissociation constant of PI(4,5)P2 to TRPC channels using FRET of the PLCδ Pleckstrin homology domain (PHd), which binds PI(4,5)P2, and used this constant to fit our experimental data to a model in which channel gating is controlled by PI(4,5)P2 and DAG. This model predicted similar FRET dynamics of the PHd to measured FRET in either human embryonic kidney cells or smooth muscle cells, whereas a model lacking PI(4,5)P2 regulation failed to reproduce the experimental data, confirming the inhibitory role of PI(4,5)P2 depletion on TRPC currents. Our model also explains various PLC-dependent characteristics of channel activity, including limitation of maximum open probability, shortening of the peak time, and the bell-shaped response of total

  9. Diphtheria: a zoonotic disease in France?

    Science.gov (United States)

    Bonmarin, Isabelle; Guiso, Nicole; Le Flèche-Matéos, Anne; Patey, Olivier; Patrick, A D Grimont; Levy-Bruhl, Daniel

    2009-06-24

    Thanks to vaccination, diphtheria has almost disappeared in France. The case definition, used for mandatory notification, was expanded in 2003 to include toxin-producing strains of Corynebacterium ulcerans. We describe the epidemiology of diphtheria in France from 1990 to 2008. No cases occurred between 1990 and 2001. Since 2002, 19 cases have been reported: 4 cases due to Corynebacterium diphtheriae related to exposure in endemic countries, and 15 cases due to other corynebacteria, including 4 cases of pseudomembranous pharyngitis, mainly related to contact with domestic animals. High vaccination coverage in the population and sensitive surveillance need to be maintained. Moreover, control measures need to be adapted to the non-C. diphtheriae toxigenic species.

  10. Acerca de Juana Francés

    Directory of Open Access Journals (Sweden)

    Laura Fernández Orgaz

    2003-01-01

    Full Text Available Partiendo de la desigual visibilidad de Juana Francés frente al resto de compañeros de su generación, el artículo considera algunos de los factores que provocaron esta injusta situación. Así mismo se aborda un recorrido por la intensa y variada trayectoria creativa de la artista que incluye sus etapas más significativas analizadas.Taking into account the poor visibility of Juana Francés compared to tfie rest of tier generation colleagues, ttie article reflects on some of tfie causes ttiat provoked this unfair situation. In addition to that, tfie article explores the intense and diverse artistic career including her most significant stages.

  11. La production des huiles essentielles en France

    OpenAIRE

    Fernandez, Xavier; Monge, Romain; Chailan, Claude

    2012-01-01

    National audience; The essential oil production in France : species, economy, enhancing.; L'huile essentielle ou essence végétale se définit comme étant un liquide hydrophobe des composés odoriférants volatils secrété par une plante. Ce mélange complexe de diverses molécules (alcools, terpènes, cétones, etc...) est obtenu par distillation à la vapeur d'eau ; en France, ces productions originales sont partie prenante d'une filière dont l'aval est constitué par l'industrie du parfum, de la cosm...

  12. Privatizations and corporate governance in France

    Directory of Open Access Journals (Sweden)

    A. GOLDSTEIN

    2013-10-01

    Full Text Available From the middle of 1993, the French government has followed an ambitious privatisation programme. Nine major state-owned enterprises have been at least partially sold; other companies some of which are amongst the largest in France, will be sold in the next few years. An analysis is undertaken of how the post-1993 privatisations have related to changes in both the mechanisms of corporate governance and the market for corporate control. Privatisation in France is found to be tactically motivated rather than being spurred by efficiency. Privatisation opened more political than economic opportunities, and corporate governance stayed in stable entities to protect managers from take-over threats. However, a move that will allow organisational competition between Anglo-Saxon and German-Japanese mechanisms may further improve governance of large French corporations.

  13. Utilizing alternative energy sources in France

    Energy Technology Data Exchange (ETDEWEB)

    Magnien, M.

    1977-01-01

    The relative merits of various alternative-energy sources are discussed with particular reference to their suitability in the French context. The case is presented for decentralized solar power as against centralized solar-power production and some test installations in France are described. The potential for geothermal power is examined, and it is shown that the resource is essentially nonrenewable. A history of wind generation in France is presented, and power extraction from the seas is discussed, with particular reference to the Rance tidal-power scheme. While the public romance with alternative-energy schemes is accepted, it is pointed out that this may only last for as long as their implementation is on a small scale.

  14. Financial Literacy and Financial Planning in France.

    OpenAIRE

    Luc Arrondel; Majdi Debbich; Frédérique Savignac

    2013-01-01

    How are people financially literate in France? We address this question using the PATER survey and following the Lusardi and Mitchell (2011c) approach. We find that some subpopulations are less financially literate than others: women, young and old people as well as less-educated people are more likely to face difficulties when dealing with fundamental financial concepts such as risk diversification, inflation and interest compounding. We also find some differences in financial knowledge depe...

  15. First case of human gongylonemosis in France

    Directory of Open Access Journals (Sweden)

    Pesson Bernard

    2013-01-01

    Full Text Available Gongylonema spp. are cosmopolitan spirurid nematodes that are common parasites of wild and domesticated mammals and birds. Gongylonema pulchrum Molin, 1857 is most common in ruminants, where it invades mucosa and submucosa of the mouth, tongue, oesophagus and forestomachs. It extremely rarely occurs in man, and fewer than 60 cases have been reported worldwide. We report a case from the Alsace region, which appears to be the first case of human gongylonemosis described in France.

  16. Minimally Invasive Forefoot Surgery in France.

    Science.gov (United States)

    Meusnier, Tristan; Mukish, Prikesht

    2016-06-01

    Study groups have been formed in France to advance the use of minimally invasive surgery. These techniques are becoming more frequently used and the technique nuances are continuing to evolve. The objective of this article was to advance the awareness of the current trends in minimally invasive surgery for common diseases of the forefoot. The percutaneous surgery at the forefoot is less developed at this time, but also will be discussed.

  17. Shielding design for PWR in France

    Energy Technology Data Exchange (ETDEWEB)

    Champion, G.; Charransol; Le Dieu de Ville, A.; Nimal, J.C.; Vergnaud, T.

    1983-05-01

    Shielding calculation scheme used in France for PWR is presented here for 900 MWe and 1300 MWe plants built by EDF the French utility giving electricity. Neutron dose rate at areas accessible by personnel during the reactor operation is calculated and compared with the measurements which were carried out in 900 MWe units up to now. Measurements on the first French 1300 MWe reactor are foreseen at the end of 1983.

  18. Pingyao Traditional Cultural Exhibition Mounted in France

    Institute of Scientific and Technical Information of China (English)

    Ni; Yuan

    2014-01-01

    <正>On the initiative of Provins,a commune in the Nord Department of Northern France and a friendship city of Pingyao in Shanxi Province,an exhibition of Pingyao traditional cultural and art works was staged from June 14 to 17.On display in the ancient SaintQuiriace Collegiate Church were 40 artworks characteristic of the traditional folk art of North China including old photos of Pingyao,calligraphic works,paintings,paper-cut,embroidery and shadow puppets.

  19. France: Nukes Stuck between NATO and EU

    Science.gov (United States)

    2013-03-01

    Between U.S., UK And French Nuclear Policies And Doctrines, Paris: Chercheur associe au CERI , 2007; Bruno Tertrais, “France,” In Governing the Bomb, by...Policies And Doctrines, Paris: Chercheur associe au CERI , 2007; Bruno Tertrais, “The Last to Disarm? The Future of France’s Nuclear Weapons...2007. ———. A Comparison Between U.S., UK And French Nuclear Policies And Doctrines. Paris: Chercheur associe au CERI , 2007. Tertrais, Bruno

  20. Frances Keesler Graham (1918-2013).

    Science.gov (United States)

    Berg, W Keith

    2014-09-01

    Frances Keesler Graham, noted psychophysiologist and developmental researcher, died on April 16, 2013. Fran was born in Canastota, New York, on August 1, 1918. Fran's high-quality research, her success in obtaining 39 years of uninterrupted funding, and the very high regard in which she was held among her colleagues led to numerous awards and honors. Fran was demanding but equally willing to provide extensive assistance to students willing to work hard.

  1. [Suicide in France, a situational analysis].

    Science.gov (United States)

    Facy, Françoise

    2017-04-01

    The fall in the number of suicides in France in no way diminishes the urgent need to act and reinforce the efforts, initiatives and resources to fight against this human tragedy. Public policies are starting to show results. The action of the French national suicide watch, associations, health professionals as well as the perspectives of the French national mental health council should amplify this movement. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. A paradox in physics education in France

    Science.gov (United States)

    Smigiel, Eddie; Sonntag, Michel

    2013-07-01

    This paper deals with the nature and the level of difficulty of teaching and learning physics in the first year of undergraduate engineering schools in France. Our case study is based on a survey regarding a classic and basic question in applied physics, and which was conducted with a group of second-year students in a post-baccalaureateThe French baccalaureate (baccalauréat) is the examination students must pass to graduate from high school. undergraduate engineering school. The responses to the survey indicate that many students fall into a kind of mathematical ‘formalism’, which prevents them from understanding the actual physics behind the question. This leads us to believe that we must reconsider the way that physics is taught. An analysis of a physics teaching sequence in French and English undergraduate textbooks confirms the weight given to mathematical formalism in France. When approached from a purely mathematical angle, physics becomes a long and slow process of assimilation of the specific scientific culture that underlies the teaching model used in classes préparatoires, classes that are usually presented as a model of academic excellence. However, this model appears to be less suitable when teaching more ‘ordinary students’, who respond better when taken through a ‘detour’ of the ‘important roots’ of physics. This paper shows that in France historically rooted pedagogical traditions persist, ignoring the latest advances in research on science teaching.

  3. Synaptic PI(3,4,5)P3 is required for Syntaxin1A clustering and neurotransmitter release.

    Science.gov (United States)

    Khuong, Thang Manh; Habets, Ron L P; Kuenen, Sabine; Witkowska, Agata; Kasprowicz, Jaroslaw; Swerts, Jef; Jahn, Reinhard; van den Bogaart, Geert; Verstreken, Patrik

    2013-03-20

    PI(3,4,5)P3 is a low-abundance lipid thought to play a role in the regulation of synaptic activity; however, the mechanism remains obscure. We have constructed novel split Venus-based probes and used superresolution imaging to localize PI(3,4,5)P3 at Drosophila larval neuromuscular synapses. We find the lipid in membrane domains at neurotransmitter release sites, where it concentrates with Syntaxin1A, a protein essential for vesicle fusion. Reducing PI(3,4,5)P3 availability disperses Syntaxin1A clusters and increasing PI(3,4,5)P3 levels rescues this defect. In artificial giant unilamellar vesicles, PI(3,4,5)P3 also induces Syntaxin1A domain formation and this clustering, in vitro and in vivo, is dependent on positively charged residues in the Syntaxin1A-juxtamembrane domain. Functionally, reduced PI(3,4,5)P3 causes temperature-sensitive paralysis and reduced neurotransmitter release, a phenotype also seen in animals expressing a Syntaxin1A with a mutated juxtamembrane domain. Thus, our data indicate that PI(3,4,5)P3, based on electrostatic interactions, clusters Syntaxin1A at release sites to regulate neurotransmitter release.

  4. PI(4,5)P2 regulates myoblast fusion through Arp2/3 regulator localization at the fusion site.

    Science.gov (United States)

    Bothe, Ingo; Deng, Su; Baylies, Mary

    2014-06-01

    Cell-cell fusion is a regulated process that requires merging of the opposing membranes and underlying cytoskeletons. However, the integration between membrane and cytoskeleton signaling during fusion is not known. Using Drosophila, we demonstrate that the membrane phosphoinositide PI(4,5)P2 is a crucial regulator of F-actin dynamics during myoblast fusion. PI(4,5)P2 is locally enriched and colocalizes spatially and temporally with the F-actin focus that defines the fusion site. PI(4,5)P2 enrichment depends on receptor engagement but is upstream or parallel to actin remodeling. Regulators of actin branching via Arp2/3 colocalize with PI(4,5)P2 in vivo and bind PI(4,5)P2 in vitro. Manipulation of PI(4,5)P2 availability leads to impaired fusion, with a reduction in the F-actin focus size and altered focus morphology. Mechanistically, the changes in the actin focus are due to a failure in the enrichment of actin regulators at the fusion site. Moreover, improper localization of these regulators hinders expansion of the fusion interface. Thus, PI(4,5)P2 enrichment at the fusion site encodes spatial and temporal information that regulates fusion progression through the localization of activators of actin polymerization.

  5. PI(4,5)P2-dependent microdomain assemblies capture microtubules to promote and control leading edge motility.

    Science.gov (United States)

    Golub, Tamara; Caroni, Pico

    2005-04-11

    The lipid second messenger PI(4,5)P(2) modulates actin dynamics, and its local accumulation at plasmalemmal microdomains (rafts) might mediate regulation of protrusive motility. However, how PI(4,5)P(2)-rich rafts regulate surface motility is not well understood. Here, we show that upon signals promoting cell surface motility, PI(4,5)P(2) directs the assembly of dynamic raft-rich plasmalemmal patches, which promote and sustain protrusive motility. The accumulation of PI(4,5)P(2) at rafts, together with Cdc42, promotes patch assembly through N-WASP. The patches exhibit locally regulated PI(4,5)P(2) turnover and reduced diffusion-mediated exchange with their environment. Patches capture microtubules (MTs) through patch IQGAP1, to stabilize MTs at the leading edge. Captured MTs in turn deliver PKA to patches to promote patch clustering through further PI(4,5)P(2) accumulation in response to cAMP. Patch clustering restricts, spatially confines, and polarizes protrusive motility. Thus, PI(4,5)P(2)-dependent raft-rich patches enhance local signaling for motility, and their assembly into clusters is regulated through captured MTs and PKA, coupling local regulation of motility to cell polarity, and organization.

  6. Removal of 2,4,5-trichlorophenol by bacterial isolates from the secondary sludge of pulp and paper mill.

    Science.gov (United States)

    Karn, Santosh Kr; Reddy, M Sudhakara

    2013-09-01

    2,4,5-trichlorophenol (2,4,5-TCP) mineralizing bacteria were isolated from the secondary sludge of pulp and paper industry. These isolates used 2,4,5-TCP as a source of carbon and energy and were capable of degrading this compound, as indicated by stoichimetric release of chloride and biomass formation. Based on 16S rRNA sequence analysis, these bacteria were identified as Kocuria sp. (CL2), Bacillus pumillus (CL5), Pseudomonas stutzeri (CL7). HPLC analysis revealed that these isolates were able to degrade 2,4,5-TCP at higher concentrations (600 mg/l or 3.0 mM). A consortia of these isolates completely removed 2,4,5-TCP from the sludge obtained from pulp and paper mill within 2 weeks when supplemented at a rate of 100 mg l(-1) . Bacterial consortium also significantly reduced absorbable organic halogen (AOX) and extractable organic halogen (EOX) by 61% and 63%, respectively from the sludge. These isolates have high potential to remove 2,4,5-TCP and may be used for remediation of pulp paper mill waste containing 2,4,5-TCP.

  7. Functional inositol 1,4,5-trisphosphate receptors assembled from concatenated homo- and heteromeric subunits.

    Science.gov (United States)

    Alzayady, Kamil J; Wagner, Larry E; Chandrasekhar, Rahul; Monteagudo, Alina; Godiska, Ronald; Tall, Gregory G; Joseph, Suresh K; Yule, David I

    2013-10-11

    Vertebrate genomes code for three subtypes of inositol 1,4,5-trisphosphate (IP3) receptors (IP3R1, -2, and -3). Individual IP3R monomers are assembled to form homo- and heterotetrameric channels that mediate Ca(2+) release from intracellular stores. IP3R subtypes are regulated differentially by IP3, Ca(2+), ATP, and various other cellular factors and events. IP3R subtypes are seldom expressed in isolation in individual cell types, and cells often express different complements of IP3R subtypes. When multiple subtypes of IP3R are co-expressed, the subunit composition of channels cannot be specifically defined. Thus, how the subunit composition of heterotetrameric IP3R channels contributes to shaping the spatio-temporal properties of IP3-mediated Ca(2+) signals has been difficult to evaluate. To address this question, we created concatenated IP3R linked by short flexible linkers. Dimeric constructs were expressed in DT40-3KO cells, an IP3R null cell line. The dimeric proteins were localized to membranes, ran as intact dimeric proteins on SDS-PAGE, and migrated as an ∼1100-kDa band on blue native gels exactly as wild type IP3R. Importantly, IP3R channels formed from concatenated dimers were fully functional as indicated by agonist-induced Ca(2+) release. Using single channel "on-nucleus" patch clamp, the channels assembled from homodimers were essentially indistinguishable from those formed by the wild type receptor. However, the activity of channels formed from concatenated IP3R1 and IP3R2 heterodimers was dominated by IP3R2 in terms of the characteristics of regulation by ATP. These studies provide the first insight into the regulation of heterotetrameric IP3R of defined composition. Importantly, the results indicate that the properties of these channels are not simply a blend of those of the constituent IP3R monomers.

  8. Proteolytic fragmentation of inositol 1,4,5-trisphosphate receptors: a novel mechanism regulating channel activity?

    Science.gov (United States)

    Wang, Liwei; Alzayady, Kamil J; Yule, David I

    2016-06-01

    Inositol 1,4,5-trisphosphate receptors (IP3 Rs) are a family of ubiquitously expressed intracellular Ca(2+) release channels. Regulation of channel activity by Ca(2+) , nucleotides, phosphorylation, protein binding partners and other cellular factors is thought to play a major role in defining the specific spatiotemporal characteristics of intracellular Ca(2+) signals. These properties are, in turn, believed pivotal for the selective and specific physiological activation of Ca(2+) -dependent effectors. IP3 Rs are also substrates for the intracellular cysteine proteases, calpain and caspase. Cleavage of the IP3 R has been proposed to play a role in apoptotic cell death by uncoupling regions important for IP3 binding from the channel domain, leaving an unregulated leaky Ca(2+) pore. Contrary to this hypothesis, we demonstrate following proteolysis that N- and C-termini of IP3 R1 remain associated, presumably through non-covalent interactions. Further, we show that complementary fragments of IP3 R1 assemble into tetrameric structures and retain their ability to be regulated robustly by IP3 . While peptide continuity is clearly not necessary for IP3 -gating of the channel, we propose that cleavage of the IP3 R peptide chain may alter other important regulatory events to modulate channel activity. In this scenario, stimulation of the cleaved IP3 R may support distinct spatiotemporal Ca(2+) signals and activation of specific effectors. Notably, in many adaptive physiological events, the non-apoptotic activities of caspase and calpain are demonstrated to be important, but the substrates of the proteases are poorly defined. We speculate that proteolytic fragmentation may represent a novel form of IP3 R regulation, which plays a role in varied adaptive physiological processes.

  9. Hydrogen peroxide down-regulates inositol 1,4,5-trisphosphate receptor content through proteasome activation.

    Science.gov (United States)

    Martín-Garrido, A; Boyano-Adánez, M C; Alique, M; Calleros, L; Serrano, I; Griera, M; Rodríguez-Puyol, D; Griendling, K K; Rodríguez-Puyol, M

    2009-11-15

    Hydrogen peroxide (H(2)O(2)) is implicated in the regulation of signaling pathways leading to changes in vascular smooth muscle function. Contractile effects produced by H(2)O(2) are due to the phosphorylation of myosin light chain kinase triggered by increases in intracellular calcium (Ca(2+)) from intracellular stores or influx of extracellular Ca(2+). One mechanism for mobilizing such stores involves the phosphoinositide pathway. Inositol 1,4,5-trisphosphate (IP(3)) mobilizes intracellular Ca(2+) by binding to a family of receptors (IP(3)Rs) on the endoplasmic-sarcoplasmic reticulum that act as ligand-gated Ca(2+) channels. IP(3)Rs can be rapidly ubiquitinated and degraded by the proteasome, causing a decrease in cellular IP(3)R content. In this study we show that IP(3)R(1) and IP(3)R(3) are down-regulated when vascular smooth muscle cells (VSMC) are stimulated by H(2)O(2), through an increase in proteasome activity. Moreover, we demonstrate that the decrease in IP(3)R by H(2)O(2) is accompanied by a reduction in calcium efflux induced by IP(3) in VSMC. Also, we observed that angiotensin II (ANGII) induces a decrease in IP(3)R by activation of NADPH oxidase and that preincubation with H(2)O(2) decreases ANGII-mediated calcium efflux and planar cell surface area in VSMC. The decreased IP(3) receptor content observed in cells was also found in aortic rings, which exhibited a decreased ANGII-dependent contraction after treatment with H(2)O(2). Altogether, these results suggest that H(2)O(2) mediates IP(3)R down-regulation via proteasome activity.

  10. Use of the 4/5 Kolmogorov equation for describing some characteristics of fully developed turbulence

    Science.gov (United States)

    Tatarskii, V. I.

    2005-03-01

    The Kolmogorov equation, which relates the second-order structure function Dll(r ) and the third-ordrer structure function Dlll(r ), may be presented as a closed linear integrodifferential equation for the probability distribution function W(U ,r) of longitudinal velocity difference U. In general, without any restrictions, the function of two variables W(U ,r) may be presented as [Dll(r )]-1/2F(U/√Dll(r ) ,r). As a first approximation, we neglect dependence of F on the second argument r. In this approximation (self-similarity of the probability density function), the integrodifferential equation for W reduces to the ordinary nonlinear differential equation for Dll(r ). It follows from this equation that for r →∞ the function Dll(r )˜r2/3. This consideration does not use the 1941 Kolmogorov hypothesis that is based on dimension analysis. Any deviations from the 2/3 law, including intermittency effects, must be related to the violation of the above-mentioned self-similarity of W, i.e., with the additional dependence of F on the second argument r. On the basis of experimental data, we suggest a simple model of W, which allows us to describe deviations from the 2/3 law, caused by intermittency, and describe the local exponents κ in the structure functions ⟨∣U(r)∣ρ⟩˜rκ(ρ ) for moderate ρ. The so called "bottleneck effect" also can be described by 4/5 Kolmogorov equation.

  11. Searching for Organics Preserved in 4.5 Billion Year Old Salt

    Science.gov (United States)

    Zolensky, Michael E.; Fries, M.; Steele, A.; Bodnar, R.

    2012-01-01

    Our understanding of early solar system fluids took a dramatic turn a decade ago with the discovery of fluid inclusion-bearing halite (NaCl) crystals in the matrix of two freshly fallen brecciated H chondrite falls, Monahans and Zag. Both meteorites are regolith breccias, and contain xenolithic halite (and minor admixed sylvite -- KCl, crystals in their regolith lithologies. The halites are purple to dark blue, due to the presence of color centers (electrons in anion vacancies) which slowly accumulated as 40K (in sylvite) decayed over billions of years. The halites were dated by K-Ar, Rb-Sr and I-Xe systematics to be 4.5 billion years old. The "blue" halites were a fantastic discovery for the following reasons: (1) Halite+sylvite can be dated (K is in sylvite and will substitute for Na in halite, Rb substitutes in halite for Na, and I substitutes for Cl). (2) The blue color is lost if the halite dissolves on Earth and reprecipitates (because the newly-formed halite has no color centers), so the color serves as a "freshness" or pristinity indicator. (3) Halite frequently contains aqueous fluid inclusions. (4) Halite contains no structural oxygen, carbon or hydrogen, making them ideal materials to measure these isotopic systems in any fluid inclusions. (5) It is possible to directly measure fluid inclusion formation temperatures, and thus directly measure the temperature of the mineralizing aqueous fluid. In addition to these two ordinary chondrites halite grains have been reliably reported in several ureilites, an additional ordinary chondrite (Jilin), and in the carbonaceous chondrite (Murchison), although these reports were unfortunately not taken seriously. We have lately found additional fluid inclusions in carbonates in several additional carbonaceous chondrites. Meteoritic aqueous fluid inclusions are apparently relatively widespread in meteorites, though very small and thus difficult to analyze.

  12. The 18 May 2012 (Ms 4.5) Chapala Lake, Jalisco, Mexico Earthquake

    Science.gov (United States)

    Yamamoto, J.; Espindola, J. M.

    2015-12-01

    The central part of Jalisco, Mexico has experienced at different times the occurrence of low magnitude earthquakes series. Although the effect of these earthquakes have been limited to relatively small areas have caused general alarm within the population and even in some cases true catastrophes (e.g. San Cristobal 1875). These groups of earthquakes that have lasted for weeks and even months have greater importance because they affect the most populous state area including the capital city of Guadalajara. An extraordinary example of these series of earthquakes occurred on 8 may 1912 that lasted until September. In the first 18 days 64 events were felt by residents of Guadalajara. Since then, there has been a relative seismic activity calm in the region. This paper analyzes the earthquake of May 18, 2012 (03:07 UT) occurred at the West edge of Lake Chapala. While it's an event of low magnitude (4.5 Ms) it has the importance of having occurred just 60 km to the South of Guadalajara and for which instrumental data of first quality is available. The focus of the earthquake was located at 20.30 ° N and 103.49 ° W at a depth of 0 km using arrivals of P and S waves at 16 regional seismic stations. However, by the errors of localization inherent in the method focus could be in a range of 0 to 5 km deep. The mechanism of failure using the polarities of the first arrivals favors a clear faulting of dip slip type along a plane with strike = 227 °, Dip = 80 °, and Rake = 93 °. Waveforms analysis is being used to corroborate these results.

  13. 3,4,5-Trichloroaniline nephrotoxicity in vitro: potential role of free radicals and renal biotransformation.

    Science.gov (United States)

    Racine, Christopher; Ward, Dakota; Anestis, Dianne K; Ferguson, Travis; Preston, Deborah; Rankin, Gary O

    2014-11-13

    Chloroanilines are widely used in the manufacture of drugs, pesticides and industrial intermediates. Among the trichloroanilines, 3,4,5-trichloroaniline (TCA) is the most potent nephrotoxicant in vivo. The purpose of this study was to examine the nephrotoxic potential of TCA in vitro and to determine if renal biotransformation and/or free radicals contributed to TCA cytotoxicity using isolated renal cortical cells (IRCC) from male Fischer 344 rats as the animal model. IRCC (~4 million cells/mL; 3 mL) were incubated with TCA (0, 0.1, 0.25, 0.5 or 1.0 mM) for 60-120 min. In some experiments, IRCC were pretreated with an antioxidant or a cytochrome P450 (CYP), flavin monooxygenase (FMO), cyclooxygenase or peroxidase inhibitor prior to incubation with dimethyl sulfoxide (control) or TCA (0.5 mM) for 120 min. At 60 min, TCA did not induce cytotoxicity, but induced cytotoxicity as early as 90 min with 0.5 mM or higher TCA and at 120 min with 0.1 mM or higher TCA, as evidenced by increased lactate dehydrogenase (LDH) release. Pretreatment with the CYP inhibitor piperonyl butoxide, the cyclooxygenase inhibitor indomethacin or the peroxidase inhibitor mercaptosuccinate attenuated TCA cytotoxicity, while pretreatment with FMO inhibitors or the CYP inhibitor metyrapone had no effect on TCA nephrotoxicity. Pretreatment with an antioxidant (α-tocopherol, glutathione, ascorbate or N-acetyl-L-cysteine) also reduced or completely blocked TCA cytotoxicity. These results indicate that TCA is directly nephrotoxic to IRCC in a time and concentration dependent manner. Bioactivation of TCA to toxic metabolites by CYP, cyclooxygenase and/or peroxidase contributes to the mechanism of TCA nephrotoxicity. Lastly, free radicals play a role in TCA cytotoxicity, although the exact nature of the origin of these radicals remains to be determined.

  14. Inositol-1,4,5-trisphosphate receptor regulates hepatic gluconeogenesis in fasting and diabetes.

    Science.gov (United States)

    Wang, Yiguo; Li, Gang; Goode, Jason; Paz, Jose C; Ouyang, Kunfu; Screaton, Robert; Fischer, Wolfgang H; Chen, Ju; Tabas, Ira; Montminy, Marc

    2012-04-08

    In the fasted state, increases in circulating glucagon promote hepatic glucose production through induction of the gluconeogenic program. Triggering of the cyclic AMP pathway increases gluconeogenic gene expression via the de-phosphorylation of the CREB co-activator CRTC2 (ref. 1). Glucagon promotes CRTC2 dephosphorylation in part through the protein kinase A (PKA)-mediated inhibition of the CRTC2 kinase SIK2. A number of Ser/Thr phosphatases seem to be capable of dephosphorylating CRTC2 (refs 2, 3), but the mechanisms by which hormonal cues regulate these enzymes remain unclear. Here we show in mice that glucagon stimulates CRTC2 dephosphorylation in hepatocytes by mobilizing intracellular calcium stores and activating the calcium/calmodulin-dependent Ser/Thr-phosphatase calcineurin (also known as PP3CA). Glucagon increased cytosolic calcium concentration through the PKA-mediated phosphorylation of inositol-1,4,5-trisphosphate receptors (InsP(3)Rs), which associate with CRTC2. After their activation, InsP(3)Rs enhanced gluconeogenic gene expression by promoting the calcineurin-mediated dephosphorylation of CRTC2. During feeding, increases in insulin signalling reduced CRTC2 activity via the AKT-mediated inactivation of InsP(3)Rs. InsP(3)R activity was increased in diabetes, leading to upregulation of the gluconeogenic program. As hepatic downregulation of InsP(3)Rs and calcineurin improved circulating glucose levels in insulin resistance, these results demonstrate how interactions between cAMP and calcium pathways at the level of the InsP(3)R modulate hepatic glucose production under fasting conditions and in diabetes.

  15. Gaz de France 2006 annual report; Gaz de France 2006 rapport d'activite

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    Gaz de France is major European energy utility, which produces, purchases, transports, distributes and sells natural gas, electricity and related services for its residential, corporate and local government customers. Its strategic focuses are to develop an ambitious marketing strategy, pursue a supply and procurement policy that guarantees the Group's competitiveness, confirm its position as a benchmark infrastructure manager, and speed up its profitable growth in Europe. Gaz de France aligns its strategy with a concrete and ambitious sustainable development policy. Its growth model is based on responsiveness to customers and constructive dialogue with its employees and partners. This document is the activity report of the group for the year 2006. It presents: 1 - the corporate profile of the group; 2 - its strategies (energy, energy supply, infrastructures); 3 - its financial highlights; 4 - its governance, shareholders and human resources; 5 - the activities of the group (exploration and production, energy procurement, energy sales, services, transmission France, storage France, LNG terminals, distribution France, transmission and distribution international, research and development); 6 - its 2006 financial data and financial summary.

  16. Synthesis and Fungicidal Activity of 4,5-Dimethyl Furan Aminonitriles Derivatives%4,5-二甲基呋喃氨基腈衍生物的合成及抗菌活性

    Institute of Scientific and Technical Information of China (English)

    李艳; 吴鸣虎

    2011-01-01

    Reaction of 4,5- dimethyl furan aminonitriles with aromatic .aldehydes gives Schiff bases, which is reduced with NaBH4 to provide 8 new 4,5- dimethyl furan aminonitriles derivatives. Their structures are characterized by 'HNMR ,IR, MS. The preliminary bioassays indicate that these compounds possess certain fungicidal activities against five kinds of fungi at a concentration of 200 mg/L.%通过4,5-二甲基呋喃氨基腈与芳醛反应,制得希夫碱,再采用NaBH4还原,合成了8个新型的4,5-二甲基呋喃氨基腈衍生物.其结构经1H NMR,IR,EI—Ms分析证实.生物活性测试结果表明,目标化合物具有一定的抗菌活性.

  17. TERRAIN, LYON COUNTY, KENTUCKY USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — Terrain data, as defined in FEMA Guidelines and Specifications, Appendix N: Data Capture Standards, describes the digital topographic data that was used to create...

  18. FLOODPLAIN, LYON COUNTY, KENTUCKY USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Floodplain Mapping/Redelineation study deliverables depict and quantify the flood risks for the study area. The primary risk classifications used are the...

  19. Microwave-assisted rapid synthesis of methyl 2,4,5-trimethoxyphenylpropionate, a metabolite of Cordia alliodora.

    Science.gov (United States)

    Sinha, A K; Joshi, B P; Sharma, A; Kumar, J K; Kaul, V K

    2003-12-01

    Microwave assisted condensation of asaronaldehyde (2) with malonic acid in piperidine-AcOH provides 2,4,5-trimethoxycinnamic acid (3) in 87% yield within 4 min, which upon further reduction with PdCl2- HCOOH-aq. NaOH gives 3-(2,4,5-trimethoxy)phenyl propionic acid (4) in 88% yield within 3 min. Esterification of 4 with MeOH-H+ gives methyl 2,4,5-trimethoxyphenylpropionate (1), a metabolite of Cordia alliodora, in 94% yield within 3 min (overall 69% yield).

  20. Highly stereoselective construction of spiro[4.5]decanes by SmI(2)-promoted ketyl radical mediated tandem cyclization.

    Science.gov (United States)

    Inui, Masaharu; Nakazaki, Atsuo; Kobayashi, Susumu

    2007-02-01

    [reaction: see text] Ketyl radical mediated tandem cyclization of omega-alkynyl carbonyl compounds bearing activated alkene using SmI(2) gave spiro[4.5]decanes stereoselectively. In the presence of HMPA, alpha,beta-unsaturated esters and alkenyl phosphonates were converted to spiro[4.5]decanes and a monocyclic compound, respectively. In the presence of Sm, bicyclic lactones were obtained from alpha,beta-unsaturated esters. The spiro[4.5]decane was provided from an alkenyl phosphonate. Interestingly, the stereochemical changeover at the first cyclization has been controlled by means of a variety of activators.

  1. Characteristics of Salmonella enterica serovar 4,[5],12:i:- as a monophasic variant of serovar Typhimurium.

    Science.gov (United States)

    Ido, Noriko; Lee, Ken-ichi; Iwabuchi, Kaori; Izumiya, Hidemasa; Uchida, Ikuo; Kusumoto, Masahiro; Iwata, Taketoshi; Ohnishi, Makoto; Akiba, Masato

    2014-01-01

    Salmonella enterica subspecies enterica serovar 4,[5],12:i:- (S. 4,[5]12:i:-) is believed to be a monophasic variant of S. enterica serovar Typhimurium (S. Typhimurium). This study was conducted to corroborate this hypothesis and to identify the molecular and phenotypic characteristics of the S. 4,[5]12:i:- isolates in Japan. A total of 51 S. 4,[5]12:i:- isolates derived from humans, cattle, swine, chickens, birds, meat (pork), and river water in 15 prefectures in Japan between 2000 and 2010 were analyzed. All the S. 4,[5],12:i:- isolates were identified as S. Typhimurium by two different polymerase chain reactions (PCR) for identification of S. Typhimurium. Of the 51 S. 4,[5],12:i:- isolates, 39 (76.5%) harbored a 94-kb virulence plasmid, which is known to be specific for S. Typhimurium. These data suggest that the S. 4,[5],12:i:- isolates are monophasic variants of S. Typhimurium. The flagellar phase variation is induced by three adjacent genes (fljA, fljB, and hin) in the chromosome. The results of PCR mapping of this region and comparative genomic hybridization analysis suggested that the deletion of the fljAB operon and its flanking region was the major genetic basis of the monophasic phenotype of S. 4,[5],12:i:-. The fljAB operon and hin gene were detectable in eight of the S. 4,[5],12:i:- isolates with common amino acid substitutions of A46T in FljA and R140L in Hin. The introduction of these mutations into S. Typhimurium isolates led to the loss of selectability of isolates expressing the phase 2 H antigen. These data suggested that a point mutation was the genetic basis, at least in part, of the S. 4,[5],12:i:- isolates. The results of phenotypic analysis suggested that the S. 4,[5],12:i:- isolates in Japan consist of multiple distinct clones. This is the first detailed characterization of the S. 4,[5],12:i:- isolates derived from various sources across Japan.

  2. Oxyphyllones A and B, novel sesquiterpenes with an unusual 4,5-secoeudesmane skeleton from Alpinia oxyphylla

    Institute of Scientific and Technical Information of China (English)

    Jun Ju Xu; Ning Hua Tan; Jiang Xiong; Abiodun Humphrey Adebayo; Hong Jin Han; Guang Zhi Zeng; Chang Jiu Ji; Yu Mei Zhang; Mei Ju Zhu

    2009-01-01

    Two novel 4,5-secoeudesmane sesquiterpenoids, oxyphyllones A (1) and B (2) were isolated from the fruits of Alpinia oxyphylla. Their structures were established by spectroscopic methods including 1D and 2D NMR spectra. These two compounds are the first example of naturally occurring sesquiterpenoids with a 4,5-secocudesmane skeleton in the family of Zingiberaceae and oxyphyllone A (1) is the first 4,5-secoeudesmane type of 13-norsesquiterpenoid. Compounds 1 and 2 exhibited no cytotoxicities against three cancer cell lines at 10 μg/mL.

  3. Stimulation of inositol 1,4,5-trisphosphate (IP3 receptor subtypes by analogues of IP3.

    Directory of Open Access Journals (Sweden)

    Huma Saleem

    Full Text Available Most animal cells express mixtures of the three subtypes of inositol 1,4,5-trisphosphate receptor (IP(3R encoded by vertebrate genomes. Activation of each subtype by different agonists has not hitherto been examined in cells expressing defined homogenous populations of IP(3R. Here we measure Ca(2+ release evoked by synthetic analogues of IP(3 using a Ca(2+ indicator within the lumen of the endoplasmic reticulum of permeabilized DT40 cells stably expressing single subtypes of mammalian IP(3R. Phosphorylation of (1,4,5IP(3 to (1,3,4,5IP(4 reduced potency by ~100-fold. Relative to (1,4,5IP(3, the potencies of IP(3 analogues modified at the 1-position (malachite green (1,4,5IP(3, 2-position (2-deoxy(1,4,5IP(3 or 3-position (3-deoxy(1,4,5IP(3, (1,3,4,5IP(4 were similar for each IP(3R subtype. The potency of an analogue, (1,4,6IP(3, in which the orientations of the 2- and 3-hydroxyl groups were inverted, was also reduced similarly for all three IP(3R subtypes. Most analogues of IP(3 interact similarly with the three IP(3R subtypes, but the decrease in potency accompanying removal of the 1-phosphate from (1,4,5IP(3 was least for IP(3R3. Addition of a large chromophore (malachite green to the 1-phosphate of (1,4,5IP(3 only modestly reduced potency suggesting that similar analogues could be used to measure (1,4,5IP(3 binding optically. These data provide the first structure-activity analyses of key IP(3 analogues using homogenous populations of each mammalian IP(3R subtype. They demonstrate broadly similar structure-activity relationships for all mammalian IP(3R subtypes and establish the potential utility of (1,4,5IP(3 analogues with chromophores attached to the 1-position.

  4. Characteristics of Salmonella enterica serovar 4,[5],12:i:- as a monophasic variant of serovar Typhimurium.

    Directory of Open Access Journals (Sweden)

    Noriko Ido

    Full Text Available Salmonella enterica subspecies enterica serovar 4,[5],12:i:- (S. 4,[5]12:i:- is believed to be a monophasic variant of S. enterica serovar Typhimurium (S. Typhimurium. This study was conducted to corroborate this hypothesis and to identify the molecular and phenotypic characteristics of the S. 4,[5]12:i:- isolates in Japan. A total of 51 S. 4,[5]12:i:- isolates derived from humans, cattle, swine, chickens, birds, meat (pork, and river water in 15 prefectures in Japan between 2000 and 2010 were analyzed. All the S. 4,[5],12:i:- isolates were identified as S. Typhimurium by two different polymerase chain reactions (PCR for identification of S. Typhimurium. Of the 51 S. 4,[5],12:i:- isolates, 39 (76.5% harbored a 94-kb virulence plasmid, which is known to be specific for S. Typhimurium. These data suggest that the S. 4,[5],12:i:- isolates are monophasic variants of S. Typhimurium. The flagellar phase variation is induced by three adjacent genes (fljA, fljB, and hin in the chromosome. The results of PCR mapping of this region and comparative genomic hybridization analysis suggested that the deletion of the fljAB operon and its flanking region was the major genetic basis of the monophasic phenotype of S. 4,[5],12:i:-. The fljAB operon and hin gene were detectable in eight of the S. 4,[5],12:i:- isolates with common amino acid substitutions of A46T in FljA and R140L in Hin. The introduction of these mutations into S. Typhimurium isolates led to the loss of selectability of isolates expressing the phase 2 H antigen. These data suggested that a point mutation was the genetic basis, at least in part, of the S. 4,[5],12:i:- isolates. The results of phenotypic analysis suggested that the S. 4,[5],12:i:- isolates in Japan consist of multiple distinct clones. This is the first detailed characterization of the S. 4,[5],12:i:- isolates derived from various sources across Japan.

  5. A REACTION OF 4, 5-DIPHENYLIMIDAZOLE NITRATION IN THE PRESENCE OF SOME 3D-METALS NITRATES

    Directory of Open Access Journals (Sweden)

    I. Voda

    2012-12-01

    Full Text Available By interaction of cobalt(II, nickel(II, or zinc(II nitrate with 4,5- diphenylimidazole in methanol in solvotermal conditions the new derivative of imidazole (4,5-diphenyl-2-nitroimidazole and three new coordinative compounds [M(4,5-Ph2ImNO22(CH3OH2] have been synthesized and investigated. Metal ions have a distorted octahedral environment with N2O4. Coordination number of metal is six. Ligand is coordinated to metal ion by one oxygen atom of nitrogroup and one nitrogen atom of imidazole.

  6. Tsg101 regulates PI(4,5)P2/Ca2+ signaling for HIV-1 Gag assembly

    OpenAIRE

    Ehrlich, Lorna S.; Sara ePhotiadis; Medina, Gisselle N.; Whittredge, Paul B.; Taraska, Justin W; Susan eWatanabe; Carol A Carter

    2014-01-01

    Our previous studies identified the 1,4,5-inositol trisphosphate receptor (IP3R), a channel mediating release of Ca2+ from ER stores, as a cellular factor differentially associated with HIV-1 Gag that might facilitate ESCRT function in virus budding. Channel opening requires activation that is initiated by binding of 1,4,5-triphosphate (IP3), a product of phospholipase C (PLC)-mediated PI(4,5)P2 hydrolysis. The store emptying that follows stimulates store refilling which requires intact PI(4,...

  7. Live cell imaging with protein domains capable of recognizing phosphatidylinositol 4,5-bisphosphate; a comparative study

    Directory of Open Access Journals (Sweden)

    Lemmon Mark A

    2009-09-01

    Full Text Available Abstract Background Phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5P2] is a critically important regulatory phospholipid found in the plasma membrane of all eukaryotic cells. In addition to being a precursor of important second messengers, PtdIns(4,5P2 also regulates ion channels and transporters and serves the endocytic machinery by recruiting clathrin adaptor proteins. Visualization of the localization and dynamic changes in PtdIns(4,5P2 levels in living cells is critical to understanding the biology of PtdIns(4,5P2. This has been mostly achieved with the use of the pleckstrin homology (PH domain of PLCδ1 fused to GFP. Here we report on a comparative analysis of several recently-described yeast PH domains as well as the mammalian Tubby domain to evaluate their usefulness as PtdIns(4,5P2 imaging tools. Results All of the yeast PH domains that have been previously shown to bind PtdIns(4,5P2 showed plasma membrane localization but only a subset responded to manipulations of plasma membrane PtdIns(4,5P2. None of these domains showed any advantage over the PLCδ1PH-GFP reporter and were compromised either in their expression levels, nuclear localization or by causing peculiar membrane structures. In contrast, the Tubby domain showed high membrane localization consistent with PtdIns(4,5P2 binding and displayed no affinity for the soluble headgroup, Ins(1,4,5P3. Detailed comparison of the Tubby and PLCδ1PH domains showed that the Tubby domain has a higher affinity for membrane PtdIns(4,5P2 and therefore displays a lower sensitivity to report on changes of this lipid during phospholipase C activation. Conclusion These results showed that both the PLCδ1PH-GFP and the GFP-Tubby domain are useful reporters of PtdIns(4,5P2 changes in the plasma membrane, with distinct advantages and disadvantages. While the PLCδ1PH-GFP is a more sensitive reporter, its Ins(1,4,5P3 binding may compromise its accuracy to measure PtdIns(4,5P2changes. The Tubby domain

  8. Characterising an intense PM pollution episode in March 2015 in France from multi-site approach and near real time data: Climatology, variabilities, geographical origins and model evaluation

    Science.gov (United States)

    Petit, J.-E.; Amodeo, T.; Meleux, F.; Bessagnet, B.; Menut, L.; Grenier, D.; Pellan, Y.; Ockler, A.; Rocq, B.; Gros, V.; Sciare, J.; Favez, O.

    2017-04-01

    During March 2015, a severe and large-scale particulate matter (PM) pollution episode occurred in France. Measurements in near real-time of the major chemical composition at four different urban background sites across the country (Paris, Creil, Metz and Lyon) allowed the investigation of spatiotemporal variabilities during this episode. A climatology approach showed that all sites experienced clear unusual rain shortage, a pattern that is also found on a longer timescale, highlighting the role of synoptic conditions over Wester-Europe. This episode is characterized by a strong predominance of secondary pollution, and more particularly of ammonium nitrate, which accounted for more than 50% of submicron aerosols at all sites during the most intense period of the episode. Pollution advection is illustrated by similar variabilities in Paris and Creil (distant of around 100 km), as well as trajectory analyses applied on nitrate and sulphate. Local sources, especially wood burning, are however found to contribute to local/regional sub-episodes, notably in Metz. Finally, simulated concentrations from Chemistry-Transport model CHIMERE were compared to observed ones. Results highlighted different patterns depending on the chemical components and the measuring site, reinforcing the need of such exercises over other pollution episodes and sites.

  9. Cocaine profiling for strategic intelligence, a cross-border project between France and Switzerland: part II. Validation of the statistical methodology for the profiling of cocaine.

    Science.gov (United States)

    Lociciro, S; Esseiva, P; Hayoz, P; Dujourdy, L; Besacier, F; Margot, P

    2008-05-20

    Harmonisation and optimization of analytical and statistical methodologies were carried out between two forensic laboratories (Lausanne, Switzerland and Lyon, France) in order to provide drug intelligence for cross-border cocaine seizures. Part I dealt with the optimization of the analytical method and its robustness. This second part investigates statistical methodologies that will provide reliable comparison of cocaine seizures analysed on two different gas chromatographs interfaced with a flame ionisation detectors (GC-FIDs) in two distinct laboratories. Sixty-six statistical combinations (ten data pre-treatments followed by six different distance measurements and correlation coefficients) were applied. One pre-treatment (N+S: area of each peak is divided by its standard deviation calculated from the whole data set) followed by the Cosine or Pearson correlation coefficients were found to be the best statistical compromise for optimal discrimination of linked and non-linked samples. The centralisation of the analyses in one single laboratory is not a required condition anymore to compare samples seized in different countries. This allows collaboration, but also, jurisdictional control over data.

  10. Development of nuclear transfer and parthenogenetic rabbit embryos activated with inositol 1,4,5-trisphosphate.

    Science.gov (United States)

    Mitalipov, S M; White, K L; Farrar, V R; Morrey, J; Reed, W A

    1999-04-01

    The present study was carried out to evaluate the effects of different activation protocols, enucleation methods, and culture media on the development of parthenogenetic and nuclear transfer (NT) rabbit embryos. Electroporation of 25 mM inositol 1,4, 5-trisphosphate (IP3) in calcium- and magnesium-free PBS immediately induced a single intracellular calcium transient in 6 out of 14 metaphase II-stage rabbit oocytes evaluated during a 10-min recording period. The percentage of oocytes treated with IP3 followed by 6-dimethylaminopurine (IP3 + DMAP) that cleaved (83.9%) and reached the blastocyst stage (50%) was significantly higher (p < 0.05) than those activated with multiple pulses (61.6% and 30.1%, respectively) or treated with ionomycin + DMAP (52.9% and 5.7%, respectively). Development of IP3 + DMAP-activated rabbit oocytes and in vivo-fertilized zygotes in different culture media was studied. Development of activated oocytes to the blastocyst stage in Earle's balanced salt solution (EBSS) supplemented with MEM nonessential amino acids, basal medium Eagle amino acids, 1 mM L-glutamine, 0.4 mM sodium pyruvate, and 10% fetal bovine serum (FBS) (EBSS-complete) (40.6%) was significantly higher (p < 0.05) than those that developed in either Dulbecco's Modified Eagle's medium (DMEM)/RPMI + 10% FBS (15.5%) or CR1aa + 10% FBS (4%) medium. In addition, 100% of in vivo-fertilized rabbit zygotes developed to the blastocyst stage in EBSS-complete. A third set of experiments was carried out to study the efficiency of blind versus stained (Hoechst 33342) enucleation of oocytes. Twenty-nine of 48 blind enucleated and IP3 + DMAP-activated oocytes cleaved (60.4%), and 15 (31.2%) subsequently reached the blastocyst stage, whereas 9 of 52 oocytes enucleated using epifluorescence (17.3%) cleaved, and none of these reached the blastocyst stage. When the above parameters that yielded the highest blastocysts were combined in an NT experiment using adult rabbit fibroblast nuclei, 72

  11. Gas Phase Chromatography of some Group 4, 5, and 6 Halides

    Energy Technology Data Exchange (ETDEWEB)

    Sylwester, Eric Robert [Univ. of California, Berkeley, CA (United States)

    1998-10-01

    Gas phase chromatography using The Heavy Element Volatility Instrument (HEVI) and the On Line Gas Apparatus (OLGA III) was used to determine volatilities of ZrBr4, HfBr4, RfBr4, NbBr5, TaOBr3, HaCl5, WBr6, FrBr, and BiBr3. Short-lived isotopes of Zr, Hf, Rf, Nb, Ta, Ha, W, and Bi were produced via compound nucleus reactions at the 88-Inch Cyclotron at Lawrence Berkeley National Laboratory and transported to the experimental apparatus using a He gas transport system. The isotopes were halogenated, separated from the other reaction products, and their volatilities determined by isothermal gas phase chromatography. Adsorption Enthalpy (ΔHa) values for these compounds were calculated using a Monte Carlo simulation program modeling the gas phase chromatography column. All bromides showed lower volatility than molecules of similar molecular structures formed as chlorides, but followed similar trends by central element. Tantalum was observed to form the oxybromide, analogous to the formation of the oxychloride under the same conditions. For the group 4 elements, the following order in volatility and ΔHa was observed: RfBr4 > ZrBr4 > HfBr4. The ΔHa values determined for the group 4, 5, and 6 halides are in general agreement with other experimental data and theoretical predictions. Preliminary experiments were performed on Me-bromides. A new measurement of the half-life of 261Rf was performed. 261Rf was produced via the 248Cm(18O, 5n) reaction and observed with a half-life of 74-6+7 seconds, in excellent agreement with the previous measurement of 78-6+11 seconds. We recommend a new half-life of 75±7 seconds for 261Rf based on these two measurements. Preliminary studies in transforming HEVI from an isothermal (constant

  12. Alkylation of Sulfur Ligand in Cysteinate-Iron Chelates by a 1,2,4,5-Tetraoxane

    Institute of Scientific and Technical Information of China (English)

    刘鹤华; 伍贻康; 沈鑫

    2003-01-01

    Reaction of a 1,2, 4, 5-tetraoxane with cysteinate-iron in the presence of excess methyl cysteinate led to formation of sulfuralkylated methyl cysteinate in 33 % yield, illustrating a possible mechanism for tetraoxanes' antimalarial action.

  13. Gaz de France annual report 2001; Gaz de France rapport annuel 2001

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    One of Europe's leading gas utilities, the Gaz de France Group operates in all sectors of the natural gas industry, from exploration and production to energy distribution and services, to respond to customer demand efficiently and achieve sustained and profitable growth. To this end, the Group is organized in five lines of business: exploration and production, supply and trading, transmission, distribution and services. Active in 33 countries, the Gaz de France Group first targets growth in Europe, its natural environment. The opening of energy markets and its position at the center of Europe's gas grids offers the Group many opportunities in trading, transmission for third parties, distribution and services. Since August 10, 2000, Gaz de France has made it possible for other gas operators to access its transmission system. The Group capitalizes on its expertise at the global level as well, in emerging markets like Mexico and in fields in which it has recognized know-how, such as liquefied natural gas (LNG). To ensure this growth and pursue its penetration of European and world markets, the Gaz de France Group implements a policy of cooperation and partnership with other energy sector operators, demonstrates its well-developed ability to innovate and practices a customer-focused organization that offers competitive, tailored services to residential users, companies and local governments. The Group has chosen to pursue this growth through a strategy of sustainable development. By making natural gas more accessible and promoting its uses, Gaz de France integrates demand-side management of energy, fosters human development and ensures environmental protection in France, Europe and the world. This activity report presents: the corporate profile of the group, the international natural gas businesses, the financial highlights, the growth objectives of the group in all its businesses (exploration and production, supply and trading, transmission, distribution

  14. Rapid redistribution of phosphatidylinositol-(4,5)-bisphosphate and septins during the Candida albicans response to caspofungin.

    Science.gov (United States)

    Badrane, Hassan; Nguyen, M Hong; Blankenship, Jill R; Cheng, Shaoji; Hao, Binghua; Mitchell, Aaron P; Clancy, Cornelius J

    2012-09-01

    We previously showed that phosphatidylinositol-(4,5)-bisphosphate [PI(4,5)P2] and septin regulation play major roles in maintaining Candida albicans cell wall integrity in response to caspofungin and other stressors. Here, we establish a link between PI(4,5)P2 signaling and septin localization and demonstrate that rapid redistribution of PI(4,5)P2 and septins is part of the natural response of C. albicans to caspofungin. First, we studied caspofungin-hypersusceptible C. albicans irs4 and inp51 mutants, which have elevated PI(4,5)P2 levels due to loss of PI(4,5)P2-specific 5'-phosphatase activity. PI(4,5)P2 accumulated in discrete patches, rather than uniformly, along surfaces of mutants in yeast and filamentous morphologies, as visualized with a green fluorescent protein (GFP)-pleckstrin homology domain. The patches also contained chitin (calcofluor white staining) and cell wall protein Rbt5 (Rbt5-GFP). By transmission electron microscopy, patches corresponded to plasma membrane invaginations that incorporated cell wall material. Fluorescently tagged septins Cdc10 and Sep7 colocalized to these sites, consistent with well-described PI(4,5)P2-septin physical interactions. Based on expression patterns of cell wall damage response genes, irs4 and inp51 mutants were firmly positioned within a group of caspofungin-hypersusceptible, septin-regulatory protein kinase mutants. irs4 and inp51 were linked most closely to the gin4 mutant by expression profiling, PI(4,5)P2-septin-chitin redistribution and other phenotypes. Finally, sublethal 5-min exposure of wild-type C. albicans to caspofungin resulted in redistribution of PI(4,5)P2 and septins in a manner similar to those of irs4, inp51, and gin4 mutants. Taken together, our data suggest that the C. albicans Irs4-Inp51 5'-phosphatase complex and Gin4 function upstream of PI(4,5)P2 and septins in a pathway that helps govern responses to caspofungin.

  15. Water Mediated Synthesis of N′-Arylmethylene-4,5,6,7-tetrahydro-2H-indazole-3-carbohydrazide Library

    Directory of Open Access Journals (Sweden)

    Mahesh M. Savant

    2014-01-01

    Full Text Available A novel two-step synthesis of 4,5,6,7-tetrahydro-2H-indazole-3-carbohydrazide has been developed. The library of N′-arylmethylene-4,5,6,7-tetrahydro-2H-indazole-3-carbohydrazide was generated by coupling of hydrazide to various aromatic and heterocyclic aldehydes in water media at ambient temperature with great flexibility regarding reaction time and yield.

  16. Water Mediated Synthesis of N′-Arylmethylene-4,5,6,7-tetrahydro-2H-indazole-3-carbohydrazide Library

    OpenAIRE

    Savant, Mahesh M.; Pansuriya, Akshay M.; Bhuva, Chirag V.; Naval Kapuriya; Yogesh T. Naliapara

    2014-01-01

    A novel two-step synthesis of 4,5,6,7-tetrahydro-2H-indazole-3-carbohydrazide has been developed. The library of N′-arylmethylene-4,5,6,7-tetrahydro-2H-indazole-3-carbohydrazide was generated by coupling of hydrazide to various aromatic and heterocyclic aldehydes in water media at ambient temperature with great flexibility regarding reaction time and yield.

  17. Accelerated dendritic development of rat cortical pyramidal cells and interneurons after biolistic transfection with BDNF and NT4/5.

    Science.gov (United States)

    Wirth, Marcus J; Brun, Annika; Grabert, Jochen; Patz, Silke; Wahle, Petra

    2003-12-01

    Neurotrophins are candidate molecules for regulating dendritogenesis. We report here on dendritic growth of rat visual cortex pyramidal and interneurons overexpressing 'brain-derived neurotrophic factor' BDNF and 'neurotrophin 4/5' NT4/5. Neurons in organotypic cultures were transfected with plasmids encoding either 'enhanced green fluorescent protein' EGFP, BDNF/EGFP or NT4/5/EGFP either at the day of birth with analysis at 5 days in vitro, or at 5 days in vitro with analysis at 10 days in vitro. In pyramidal neurons, both TrkB ligands increased dendritic length and number of segments without affecting maximum branch order and number of primary dendrites. In the early time window, only infragranular neurons were responsive. Neurons in layers II/III became responsive to NT4/5, but not BDNF, during the later time window. BDNF and NT4/5 transfectants at 10 days in vitro had still significantly shorter dendrites than adult pyramidal neurons, suggesting a massive growth spurt after 10 days in vitro. However, segment numbers were already in the range of adult neurons. Although this suggested a role for BDNF, long-term activity-deprived, and thus BDNF-deprived, pyramidal cells developed a dendritic complexity not different from neurons in active cultures except for higher spine densities on neurons of layers II/III and VI. Neutralization of endogenous NT4/5 causes shorter and less branched dendrites at 10 days in vitro suggesting an essential role for NT4/5. Neutralization of BDNF had no effect. Transfected multipolar interneurons became identifiable during the second time window. Both TrkB ligands significantly increased number of segments and branch order towards the adult state with little effects on dendritic length. The results suggested that early in development BDNF and NT4/5 probably accelerate dendritogenesis in an autocrine fashion. In particular, branch formation was advanced towards the adult pattern in pyramidal cells and interneurons.

  18. Synthesis and Biological Activity of 4,5-Dihydro-1,2,4-triazole-5-thione Schiff Base

    Institute of Scientific and Technical Information of China (English)

    SUN, Xiaohong; BAI, Yan; LIU, Yuanfa; CHEN, Bang; JIA, Yingqi; ZENG, Zhenfang

    2009-01-01

    The 4,5-dihydro-1,2,4-triazole Schiff base derivatives were synthesized with 4-amino-4,5-dihydro-3-(phenoxy- methyl)-1H-1,2,4-triazole-5-thione and substituted benzaidehydes. The chemical structures of the compounds have been confirmed by 1H NMR, IR spectra and elemental analysis. Their biological activities were investigated, and the results showed that they exhibited good fungicidal activities.

  19. Aromatic derivatives of 1H-2,3-dihydropyrazolo(4,5-b)-1,5-diazepine

    Energy Technology Data Exchange (ETDEWEB)

    Orlov, V.D.; Kiroga, Kh.; Kolos, N.N.

    1987-09-01

    Aromatic derivatives of 1H-2,3-dihydropyrazole(4,5-b)-1,5-diazepine were obtained by the reaction of 1-phenyl-3-methyl-4,5-diaminopyrazole with chalcones and acetylarenes, catalyzed by acetic or sulfuric acid. The seven-membered ring in these compounds has a conformation of the boat type. The IR, UV, PMR, and mass spectra of the compounds are discussed.

  20. Selectively fluorinated cyclohexane building blocks: Derivatives of carbonylated all-cis-3-phenyl-1,2,4,5-tetrafluorocyclohexane

    Directory of Open Access Journals (Sweden)

    Mohammed Salah Ayoup

    2015-12-01

    Full Text Available Palladium catalysed carbonylation reactions using the meta- and para-iodo derivatives of all-cis-3-phenyl-1,2,4,5-tetrafluorocyclohexane (4 are illustrated as the start point for a variety of functional group interconversions. The resultant benzaldehyde and benzoic acids offer novel building blocks for further derivatisation and facilitate the incorporation of the facially polarised all-cis-1,2,4,5-tetrafluorocyclohexane motif into more advanced molecular scaffolds.