WorldWideScience

Sample records for lyase-encoding gene algl

  1. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  2. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  3. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Sequence analysis and overexpression of a pectin lyase gene (pel1) from Aspergillus oryzae KBN616.

    Science.gov (United States)

    Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N

    2001-01-01

    A gene (pel1) encoding pectin lyase (Pel1) was isolated from a shoyu koji mold, Aspergillus oryzae KBN616, and characterized. The structural gene comprised 1,196 bp with a single intron. The ORF encoded 381 amino acids with a signal peptide of 20 amino acids. The deduced amino acid sequence showed high similarity to those of Aspergillus niger pectin lyases and Glomerella cingulata PnlA. The pel1 gene was successfully overexpressed under the promoter of the A. oryzae TEF1 gene. The molecular mass of the recombinant pectin lyase substantially coincided with that calculated based on nucleotide sequence.

  5. Modeling and Re-Engineering of Azotobacter vinelandii Alginate Lyase to Enhance Its Catalytic Efficiency for Accelerating Biofilm Degradation.

    Science.gov (United States)

    Jang, Chul Ho; Piao, Yu Lan; Huang, Xiaoqin; Yoon, Eun Jeong; Park, So Hee; Lee, Kyoung; Zhan, Chang-Guo; Cho, Hoon

    2016-01-01

    Alginate is known to prevent elimination of Pseudomonas aeruginosa biofilms. Alginate lyase (AlgL) might therefore facilitate treatment of Pseudomonas aeruginosa-infected cystic fibrosis patients. However, the catalytic activity of wild-type AlgL is not sufficiently high. Therefore, molecular modeling and site-directed mutagenesis of AlgL might assist in enzyme engineering for therapeutic development. AlgL, isolated from Azotobacter vinelandii, catalyzes depolymerization of alginate via a β-elimination reaction. AlgL was modeled based on the crystal structure template of Sphingomonas AlgL species A1-III. Based on this computational analysis, AlgL was subjected to site-directed mutagenesis to improve its catalytic activity. The kcat/Km of the K194E mutant showed a nearly 5-fold increase against the acetylated alginate substrate, as compared to the wild-type. Double and triple mutants (K194E/K245D, K245D/K319A, K194E/K245D/E312D, and K194E/K245D/K319A) were also prepared. The most potent mutant was observed to be K194E/K245D/K319A, which has a 10-fold improved kcat value (against acetylated alginate) compared to the wild-type enzyme. The antibiofilm effect of both AlgL forms was identified in combination with piperacillin/tazobactam (PT) and the disruption effect was significantly higher in mutant AlgL combined with PT than wild-type AlgL. However, for both the wild-type and K194E/K245D/K319A mutant, the use of the AlgL enzyme alone did not show significant antibiofilm effect.

  6. Modeling and Re-Engineering of Azotobacter vinelandii Alginate Lyase to Enhance Its Catalytic Efficiency for Accelerating Biofilm Degradation.

    Directory of Open Access Journals (Sweden)

    Chul Ho Jang

    Full Text Available Alginate is known to prevent elimination of Pseudomonas aeruginosa biofilms. Alginate lyase (AlgL might therefore facilitate treatment of Pseudomonas aeruginosa-infected cystic fibrosis patients. However, the catalytic activity of wild-type AlgL is not sufficiently high. Therefore, molecular modeling and site-directed mutagenesis of AlgL might assist in enzyme engineering for therapeutic development. AlgL, isolated from Azotobacter vinelandii, catalyzes depolymerization of alginate via a β-elimination reaction. AlgL was modeled based on the crystal structure template of Sphingomonas AlgL species A1-III. Based on this computational analysis, AlgL was subjected to site-directed mutagenesis to improve its catalytic activity. The kcat/Km of the K194E mutant showed a nearly 5-fold increase against the acetylated alginate substrate, as compared to the wild-type. Double and triple mutants (K194E/K245D, K245D/K319A, K194E/K245D/E312D, and K194E/K245D/K319A were also prepared. The most potent mutant was observed to be K194E/K245D/K319A, which has a 10-fold improved kcat value (against acetylated alginate compared to the wild-type enzyme. The antibiofilm effect of both AlgL forms was identified in combination with piperacillin/tazobactam (PT and the disruption effect was significantly higher in mutant AlgL combined with PT than wild-type AlgL. However, for both the wild-type and K194E/K245D/K319A mutant, the use of the AlgL enzyme alone did not show significant antibiofilm effect.

  7. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  8. Genetic and molecular analyses of Escherichia coli N-acetylneuraminate lyase gene.

    OpenAIRE

    Kawakami, B; Kudo, T; Narahashi, Y; Horikoshi, K

    1986-01-01

    Two plasmids containing the N-acetylneuraminate lyase (NALase) gene (nanA) of Escherichia coli, pNL1 and pNL4, were constructed. Immunoprecipitation analysis indicated that the 35,000-dalton protein encoded in pNL4 was NALase. The synthesis of NALase in E. coli carrying these plasmids was constitutive.

  9. Regulation of expression of pectate lyase genes pelA, pelD, and pelE in Erwinia chrysanthemi.

    Science.gov (United States)

    Reverchon, S; Robert-Baudouy, J

    1987-06-01

    The regulation of pelA, pelD, and pelE genes encoding three of the five major pectate lyase isoenzymes (PLa, PLd, and PLe) in Erwinia chrysanthemi B374 was analyzed by using genetic fusions to lacZ. These three genes are clustered on a 5-kilobase DNA fragment in the order pelD-pelE-pelA and constitute three independent transcriptional units. We localized the pelDEA cluster near the pro-1 marker on the genetic map of B374 by chromosomal mobilization with RP4::mini-Mu plasmid pULB110. Three classes of regulatory mutations responsible for constitutive pectate lyase synthesis have been described (kdgR, gpiR, and cri). We studied the effects of each mutation on pelE, pelD, and pelA expression independently. The mutations kdgR and gpiR mainly affect the expression of pelE and pelD, although PLa synthesis is slightly increased. The cri mutation results in a low level of constitutive expression of the three pel genes, but it is a pleiotropic mutation since other genes not involved in pectinolysis are also affected. In addition, we demonstrated that exuR, a negative regulatory gene governing the catabolism of hexuronates, does not modify the expression of pel genes. The frequency of gpiR or cri mutations (about 10(-8)) and the resulting constitutivity of pectate lyase synthesis suggest that these genes act as negative regulatory genes in addition to kdgR, which is already known to encode a repressor. Moreover, we found that expression of pel-lac fusions carried on pBR322 derivatives was higher in E. chrysanthemi than in Escherichia coli; this fact suggests the existence of positive regulation of pectate lyase synthesis in E. chrysanthemi.

  10. Cytochrome c and c1 heme lyases are essential in Plasmodium berghei.

    Science.gov (United States)

    Posayapisit, Navaporn; Songsungthong, Warangkhana; Koonyosying, Pongpisid; Falade, Mofolusho O; Uthaipibull, Chairat; Yuthavong, Yongyuth; Shaw, Philip J; Kamchonwongpaisan, Sumalee

    Malaria parasites possess a de novo heme synthetic pathway. Interestingly, this pathway is dispensable during the blood stages of development in mammalian hosts. The assembly of the two most important hemeproteins, cytochromes c and c1, is mediated by cytochrome heme lyase enzymes. Plasmodium spp. possess two cytochrome heme lyases encoded by separate genes. Given the redundancy of heme synthesis, we sought to determine if heme lyase function also exhibits redundancy. To answer this question, we performed gene knockout experiments. We found that the PBANKA_143950 and PBANKA_0602600 Plasmodium berghei genes encoding cytochrome c (Pbcchl) and cytochrome c1 (Pbcc 1 hl) heme lyases, respectively, can only be disrupted when a complementary gene is present. In contrast, four genes in the de novo heme synthesis pathway can be disrupted without complementation. This work provides evidence that Pbcchl and Pbcc 1 hl are both essential and thus may be antimalarial targets. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. One-step purification and characterization of alginate lyase from a clinical Pseudomonas aeruginosa with destructive activity on bacterial biofilm

    Directory of Open Access Journals (Sweden)

    Parinaz Ghadam

    2017-05-01

    Full Text Available Objective(s: Pseudomonas aeruginosais a Gram-negative and aerobic rod bacterium that displays mucoid and non-mucoid phenotype. Mucoid strains secrete alginate, which is the main agent of biofilms in chronic P. aeruginosa infections, show high resistance to antibiotics; consequently, the biological disruption of mucoid P. aeruginosa biofilms is an attractive area of study for researchers. Alginate lyase gene (algl is a member of alginate producing operon which by glycosidase activity produces primer for other enzymes in this cluster. Also this activity can destroy the extracellular alginate; therefore this enzyme participates in alginate production and destruction pathway. Alginate lyase causes detachment of a biofilm by reducing its adhesion to the surfaces, and increases phagocytosis and antibiotic susceptibility. In this study, alginate lyase was purified in just one step and its properties were investigated. Materials and Methods: The purification was done by affinity chromatography, analysed by SDS-PAGE, and its effect on P. aeruginosa biofilms was surveyed by micro titer plate assay and SEM. The substrate specificity of the enzyme was determined by PCR. Results: Alginate lyase from isolate 48 was purified in one step. It is more thermally resistant than alginate lyase from Pseudomonas aeruginosa PAO1 and poly M, poly G and poly MG alginate were the substrate of this enzyme. Moreover, it has an eradication effect on biofilms from P. aeruginosa 48 and PAO1. Conclusion: In this study an alginate lyase with many characteristics suitable in medicine such as thermal stability, effective on poly M alginate, and bacterial biofilm destructive was introduced and purified.

  12. A second pectin lyase gene (pel2) from Aspergillus oryzae KBN616: its sequence analysis and overexpression, and characterization of the gene products.

    Science.gov (United States)

    Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N

    2001-01-01

    A second pectin lyase gene, designated pel2, was isolated from a shoyu koji mold Aspergillus oryzae KBN616 and characterized. The structural gene comprised 1306 bp with three introns. The ORF encoded 375 amino acids with a signal peptide of 19 amino acids. The deduced amino acid sequence showed high similarity to those of A. oryzae Pel1, Aspergillus niger pectin lyases and Glomerella cingulata Pn1A. The pel2 gene was overexpressed under the control of the promoter of the A. oryzae TEF1 gene for purification and enzymatic characterization of its gene product. The gene product exhibited two molecular masses of 48 and 44 kDa due to different degrees of glycosylation. Both proteins had the same pH optimum of 6.0 and temperature optimum of 50 degrees C.

  13. Genetic analysis of the pelA-pelE cluster encoding the acidic and basic pectate lyases in Erwinia chrysanthemi EC16.

    Science.gov (United States)

    Barras, F; Chatterjee, A K

    1987-10-01

    In Erwinia chrysanthemi (EC16) the clustered pelA and pelE genes encode an acidic (pI 4.2) and a basic (pI 10.0) pectate lyase (Pel), respectively. The pelA gene has been isolated on a 1.2 kb restriction fragment and the direction of transcription determined. DNA hybridization analysis showed that the pelE sequence shares DNA homology with pelA but not with pelB or pelC, two genes encoding other Pel species in EC16. Since Pel A and Pel E enzymes showed little similarity in terms of catalytic properties, it is proposed that pelA and pelE are duplicates which have highly diverged.

  14. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    Science.gov (United States)

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  15. Novel Pectate Lyase Genes of Heterodera glycines Play Key Roles in the Early Stage of Parasitism.

    Directory of Open Access Journals (Sweden)

    Huan Peng

    Full Text Available Pectate lyases are known to play a key role in pectin degradation by catalyzing the random cleavage of internal polymer linkages (endo-pectinases. In this paper, four novel cDNAs, designated Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7, that encode pectate lyases were cloned and characterized from the soybean cyst nematode, Heterodera glycines. The predicted protein sequences of HG-PEL-3, HG-PEL-4 and HG-PEL-6 differed significantly in both their amino acid sequences and their genomic structures from other pectate lyases of H. glycines (HG-PEL-1, HG-PEL-2 and HG-PEL-7. A phylogenetic study revealed that the pectate lyase proteins of H. glycines are clustered into distinct clades and have distinct numbers and positioning of introns, which suggests that the pectate lyase genes of H. glycines may have evolved from at least two ancestral genes. A Southern blot analysis revealed that multiple Hg-pel-6-like genes were present in the H. glycines genome. In situ hybridization showed that four novel pectate lyases (Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7 were actively transcribed in the subventral esophageal gland cells. A semi-quantitative RT-PCR assay supported the finding that the expression of these genes was strong in the egg, pre-parasitic second-stage juvenile (J2 and early parasitic J2 stages and that it declined in further developmental stages of the nematode. This expression pattern suggests that these proteins play a role in the migratory phase of the nematode life cycle. Knocking down Hg-pel-6 using in vitro RNA interference resulted in a 46.9% reduction of the number of nematodes that invaded the plants and a 61.5% suppression of the development of H. glycines females within roots compared to the GFP-dsRNA control. Plant host-derived RNAi induced the silencing of the Hg-pel-6gene, which significantly reduced the nematode infection levels at 7 Days post inoculation (dpi. Similarly, this procedure reduced the number of female adults at 40 dpi

  16. Cloning and study of the pectate lyase gene of Erwinia carotovora

    International Nuclear Information System (INIS)

    Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.; Syarinskii, M.A.; Strel'chenko, P.P.; Yankovski, N.K.; Alikhanyan, S.I.; Fomichev, Yu.K.; Debabov, V.G.

    1986-01-01

    The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector λ 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representative gene libraries on phage vectors from no less than 1 μg of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, λ 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it

  17. Molecular characterization of a Penicillium chrysogenum exo-rhamnogalacturonan lyase that is structurally distinct from other polysaccharide lyase family proteins.

    Science.gov (United States)

    Iwai, Marin; Kawakami, Takuya; Ikemoto, Takeshi; Fujiwara, Daisuke; Takenaka, Shigeo; Nakazawa, Masami; Ueda, Mitsuhiro; Sakamoto, Tatsuji

    2015-10-01

    We previously described an endo-acting rhamnogalacturonan (RG) lyase, termed PcRGL4A, of Penicillium chrysogenum 31B. Here, we describe a second RG lyase, called PcRGLX. We determined the cDNA sequence of the Pcrglx gene, which encodes PcRGLX. Based on analyses using a BLAST search and a conserved domain search, PcRGLX was found to be structurally distinct from known RG lyases and might belong to a new polysaccharide lyase family together with uncharacterized fungal proteins of Nectria haematococca, Aspergillus oryzae, and Fusarium oxysporum. The Pcrglx cDNA gene product (rPcRGLX) expressed in Escherichia coli demonstrated specific activity against RG but not against homogalacturonan. Divalent cations were not essential for the enzymatic activity of rPcRGLX. rPcRGLX mainly released unsaturated galacturonosyl rhamnose (ΔGR) from RG backbones used as the substrate from the initial stage of the reaction, indicating that the enzyme can be classified as an exo-acting RG lyase (EC 4.2.2.24). This is the first report of an RG lyase with this mode of action in Eukaryota. rPcRGLX acted synergistically with PcRGL4A to degrade soybean RG and released ΔGR. This ΔGR was partially decorated with galactose (Gal) residues, indicating that rPcRGLX preferred oligomeric RGs to polymeric RGs, that the enzyme did not require Gal decoration of RG backbones for degradation, and that the enzyme bypassed the Gal side chains of RG backbones. These characteristics of rPcRGLX might be useful in the determination of complex structures of pectins.

  18. Transcriptional regulation of Saccharomyces cerevisiaeCYS3 encoding cystathionine γ-lyase

    Science.gov (United States)

    Hiraishi, Hiroyuki; Miyake, Tsuyoshi

    2008-01-01

    In studying the regulation of GSH11, the structural gene of the high-affinity glutathione transporter (GSH-P1) in Saccharomyces cerevisiae, a cis-acting cysteine responsive element, CCGCCACAC (CCG motif), was detected. Like GSH-P1, the cystathionine γ-lyase encoded by CYS3 is induced by sulfur starvation and repressed by addition of cysteine to the growth medium. We detected a CCG motif (−311 to −303) and a CGC motif (CGCCACAC; −193 to −186), which is one base shorter than the CCG motif, in the 5′-upstream region of CYS3. One copy of the centromere determining element 1, CDE1 (TCACGTGA; −217 to −210), being responsible for regulation of the sulfate assimilation pathway genes, was also detected. We tested the roles of these three elements in the regulation of CYS3. Using a lacZ-reporter assay system, we found that the CCG/CGC motif is required for activation of CYS3, as well as for its repression by cysteine. In contrast, the CDE1 motif was responsible for only activation of CYS3. We also found that two transcription factors, Met4 and VDE, are responsible for activation of CYS3 through the CCG/CGC and CDE1 motifs. These observations suggest a dual regulation of CYS3 by factors that interact with the CDE1 motif and the CCG/CGC motifs. PMID:18317767

  19. Phenylalanine ammonia-lyase (PAL) gene activity in response to ...

    African Journals Online (AJOL)

    Phenylalanine ammonia-lyase (PAL) catalyzes the biosynthesis of rosmarinic acid (RA), tyrosine and phenylalanine are the precursors of RA, while proline drives metabolite precursors toward Shikimate and phenylpropanoid pathway ending with the production of RA. The aim of this study was to investigate the PAL gene ...

  20. Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

    Science.gov (United States)

    Cai, Yongping; Lin, Yi

    2013-01-01

    In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

  1. Biocatalytic Enantioselective Synthesis of N-Substituted Aspartic Acids by Aspartate Ammonia Lyase

    NARCIS (Netherlands)

    Weiner, Barbara; Poelarends, Gerrit J.; Janssen, Dick B.; Feringa, Ben L.

    2008-01-01

    The gene encoding aspartate ammonia lyase (aspB) from Bacillus sp. YM55-1 has been cloned and overexpressed, and the recombinant enzyme containing a C-terminal His6 tag has been purified to homogeneity and subjected to kinetic characterization. Kinetic studies have shown that the His6 tag does not

  2. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  3. Identification, expression, and characterization of a novel bacterial RGI Lyase enzyme for the production of bio-functional fibers

    DEFF Research Database (Denmark)

    da Silva, Ines Isabel Cardoso Rodrigues; Larsen, Dorte Møller; Meyer, Anne S.

    2011-01-01

    A gene encoding a putative rhamnogalacturonan I (RGI) Lyase (EC 4.2.2.-) from Bacillus licheniformis (DSM13) was selected after a homology search and phylogenetic analysis and optimized with respect to codon usage. The designed gene was transformed into Pichia pastoris and the enzyme was produced...

  4. Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.

    Directory of Open Access Journals (Sweden)

    Qing Jin

    Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.

  5. Xylella fastidiosa esterase rather than hydroxynitrile lyase.

    Science.gov (United States)

    Torrelo, Guzman; Ribeiro de Souza, Fayene Zeferino; Carrilho, Emanuel; Hanefeld, Ulf

    2015-03-02

    In 2009, we reported that the product of the gene SCJ21.16 (XFa0032) from Xylella fastidiosa, a xylem-restricted plant pathogen that causes a range of diseases in several important crops, encodes a protein (XfHNL) with putative hydroxynitrile lyase activity. Sequence analysis and activity tests indicated that XfHNL exhibits an α/β-hydrolase fold and could be classified as a member of the family of FAD-independent HNLs. Here we provide a more detailed sequence analysis and new experimental data. Using pure heterologously expressed XfHNL we show that this enzyme cannot catalyse the cleavage/synthesis of mandelonitrile and that this protein is in fact a non-enantioselective esterase. Homology modelling and ligand docking simulations were used to study the active site and support these results. This finding could help elucidate the common ancestor of esterases and hydroxynitrile lyases with an α/β -hydrolase fold. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Cloning and expression of isocitrate lyase from human round worm Strongyloides stercoralis

    Directory of Open Access Journals (Sweden)

    Siddiqui A.A.

    2000-09-01

    Full Text Available A full length cDNA (1463 bp encoding isocitrate lyase (EC 4.1.3.1 of Strongyloides stercoralis is described. The nucleotide sequence of this insert identified a cDNA coding for the isocitrate lyase. The conceptually translated amino acid sequence of the open reading frame for S. stercoralis isocitrate lyase encodes a 450 amino acid residue protein with an apparent molecular weight of 50 kDa and a predicted pl of 6.39. The sequence is 69 % A/T, reflecting a characteristic A/T codon bias of S. stercoralis. The amino acid sequence of S. stercoralis isocitrate lyase is compared with bifunctional glyoxylate cycle protein of Caenorhabditis elegans and isocitrate lyases from Chlamydomonas reinhardtii and Myxococcus xanthus. The full length cDNA of S. stercoralis was expressed in pRSET vector and bacteriophage T7 promoter based expression system. S. stercoralis lyase recombinant protein, purified via immobilized metal affinity chromatography, showed a molecular mass of 50 kDa on polyacrylamide gels. The role of isocitrate lyase in the glyoxylate cycle and energy metabolism of S. stercoralis is also discussed.

  7. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  8. Two pectin lyase genes, pnl-1 and pnl-2, from Colletotrichum gloeosporioides f. sp. malvae differ in a cellulose-binding domain and in their expression during infection of Malva pusilla.

    Science.gov (United States)

    Wei, Yangdou; Shih, Jenny; Li, Jieran; Goodwin, Paul H

    2002-07-01

    Two pectin lyase genes, designated pnl-1 and pnl-2, were cloned from Colletotrichum gloeosporioides f. sp. malvae, a pathogen of round-leaved mallow (Malva pusilla). pnl-1 was isolated using cDNA from infected plant material; pnl-2 was isolated using cDNA from 3-day-old mycelia grown in mallow-cell-wall extract (MCWE) broth. pnl-1 is the first pectinase gene described thus far to encode a cellulose-binding domain (CBD), which is common in cellulases and xylanases, whereas pnl-2 encodes a pectin lyase that lacks a CBD. In pure culture, pnl-1 expression could be detected when purified pectin or glucose was the sole carbon source, but not when MCWE was the sole carbon source. The lack of pnl-1 expression appeared to be due to gene repression by some unknown factor(s) in the cell-wall extract. In contrast, expression of pnl-2 was detected in cultures when MCWE, but not when purified pectin or glucose, was the sole carbon source. In infected tissue, detection of pnl-1 expression by Northern-blot hybridization and by RT-PCR began with the onset of the necrotrophic phase of infection. Expression ofpnl-2 was not detectable by Northern-blot hybridization, but was observed byRT-PCR in both the biotrophic and necrotrophic phases of infection. The differences between pnl-1 and pnl-2 (i.e. pnl-1 encoding a CBD and differences in the expression patterns of both genes) may be related to the requirements of C. gloeosporioides f. sp. malvae to be able to grow in host tissue under the different conditions present during the biotrophic and necrotrophic phases of infection.

  9. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  10. Crystallization and preliminary X-ray analysis of argininosuccinate lyase from Streptococcus mutans

    International Nuclear Information System (INIS)

    Cao, Yan-Li; Li, Gui-Lan; Wang, Kai-Tuo; Zhang, Hong-Yin; Li, Lan-Fen

    2011-01-01

    Crystals of argininosuccinate lyase from S. mutans were obtained and X-ray data were collected to 2.5 Å resolution in space group R3. Argininosuccinate lyase (ASL) is an important enzyme in arginine synthesis and the urea cycle, which are highly conserved from bacteria to eukaryotes. The gene encoding Streptococcus mutans ASL (smASL) was amplified and cloned into expression vector pET28a. The recombinant smASL protein was expressed in a soluble form in Escherichia coli strain BL21 (DE3) and purified to homogeneity by two-step column chromatography. Crystals suitable for X-ray analysis were obtained and X-ray diffraction data were collected to a resolution of 2.5 Å. The crystals belonged to space group R3, with unit-cell parameters a = b = 254.5, c = 78.3 Å

  11. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    KAUST Repository

    La, Honggui; Ding, Bo; Mishra, Gyan Prakash; Zhou, Bo; Yang, Hongmei; Bellizzi, Maria Del Rosario; Chen, Songbiao; Meyers, Blake C.; Peng, Zhaohua; Zhu, Jian-Kang; Wang, Guoliang

    2011-01-01

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  12. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    KAUST Repository

    La, Honggui

    2011-09-06

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  13. Pectate lyase affects pathogenicity in natural isolates of Colletotrichum coccodes and in pelA gene-disrupted and gene-overexpressing mutant lines.

    Science.gov (United States)

    Ben-Daniel, Bat-Hen; Bar-Zvi, Dudy; Tsror Lahkim, Leah

    2012-02-01

    Colletotrichum coccodes (Wallr.) S. Hughes, the causal agent of black dot on potato and anthracnose on tomato, reduces yield and crop quality. We explored the role of secreted pectate lyase (PL), a cell wall-degrading enzyme, in the aggressiveness of C. coccodes. In vitro-cultivated highly aggressive isolates secreted immunologically detectable PL levels 6 h after transfer to secondary medium versus 12 h for mildly aggressive isolates, suggesting that secreted PL is a virulence factor. The gene encoding PL, CcpelA, was cloned and used for the genetic manipulation of highly (US-41 and Si-72) and mildly (Si-60) aggressive isolates. CcpelA gene-disrupted mutants showed reduced aggressiveness towards tomato fruits and impaired PL secretion and extracellular activity. Conversely, overexpression of CcpelA in the Si-60 isolate increased its aggressiveness and PL secretion. Comparison of CcpelA cloned from isolates US-41 and Si-60 revealed that both encode identical proteins, but differ in their promoters. Bioinformatics analysis for cis-acting elements suggested that the promoters of the US-41 and Si-60 isolates contain one and no AreA-binding site (GATA box), respectively. AreA has been suggested to be involved in fungal aggressiveness; therefore, CcpelA may be a key virulence factor in C. coccodes pathogenicity, and the differences in isolate aggressiveness might result from promoter activity. Quantitative reverse transcriptase-polymerase chain reaction analyses confirmed the higher level of CcpelA transcript in isolate US-41 versus Si-60. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

  14. Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

    International Nuclear Information System (INIS)

    Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

    2011-01-01

    Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

  15. Phenylalanine ammonia-lyase through evolution: A bioinformatic approach

    Directory of Open Access Journals (Sweden)

    Shiva Hemmati

    2015-03-01

    Full Text Available Phenylalanine ammonia-lyase (PAL is the first entry enzyme of the phenylpropanoid pathway that converts phenylalanine to cinnamic acid which is the precursor of various secondary metabolites. PAL is recently formulated for phenylketonuric patients in pegylated forms; therefore, screening a PAL with the highest affinity to the substrate is of a great importance. PAL exists in all higher plants and some fungi and few bacteria. Ancestors of land plants have been adopted by evolving metabolic pathways. A multi-gene family encodes PAL by gene duplication events in most plants. In this study, the taxonomic distribution and phylogeny of pal gene found in land plants, fungi and bacteria have been analyzed. It seems that the ancestor of plants acquired a pal gene via horizontal gene transfer in symbioses with bacteria and fungi. Gymnosperms have kept a diverse set of pal genes that arose from gene duplication events. In angiosperms, after the divergence of dicotyledons from monocots, pal genes were duplicated many times. The close paralogues of pal genes in some species indicate expansion of gene families after the divergence in plant pal gene evolution. Interestingly, some of the plant pals clustered by species in a way that pals within one species are more closely related to each other than to homologs in the other species which indicates this duplication event occurred more recently.

  16. Cloning and knockout of formate hydrogen lyase and H{sub 2}-uptake hydrogenase genes in Enterobacter aerogenes for enhanced hydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Hongxin; Ma, Kun; Lu, Yuan; Zhang, Chong; Wang, Liyan; Xing, Xin-Hui [Institute of Biochemical Engineering, Department of Chemical Engineering, Tsinghua University, Tsinghua Yuan, Beijing 100084 (China)

    2009-01-15

    A 5431-bp DNA fragment partially encoding the formate hydrogen lyase (FHL) gene cluster hycABCDE was isolated and identified from Enterobacter aerogenes IAM1183 chromosomal DNA. All the five putative gene products showed a high degree of homology to the reported bacterial FHL proteins. The gene hycA, encoding the FHL repressor protein, and hybO, encoding the small subunit of the uptake hydrogenase, were targeted for genetic knockout for improving the hydrogen production. The pYM-Red recombination system was adopted to form insertional mutations in the E. aerogenes genome, thereby creating mutant strains of IAM1183-A ({delta} hycA), IAM1183-O ({delta} hybO), and IAM1183-AO ({delta} hycA/ {delta} hybO double knockout). The hydrogen production experiments with these mutants showed that the maximum specific hydrogen productivities of IAM1183-A, IAM1183-O, and IAM1183-AO were 2879.466 {+-} 38.59, 2747.203 {+-} 13.25 and 3372.019 {+-} 4.39 (ml h{sup -1} g{sup -1}dry cell weight), respectively, higher than that of the wild strain (2321.861 {+-} 15.34 ml h{sup -1} g{sup -1}dry cell weight). The total H{sub 2} yields by the three mutants IAM1183-A, IAM1183-O and IAM1183-AO were 0.73, 0.78, and 0.83 mol-H{sub 2}/mol glucose, respectively, while the wild-type IAM1183 was only 0.65 mol-H{sub 2}/mol glucose. The metabolites of the mutants including acetate, ethanol, 2,3-butanediol and succinate were all increased compared with that of the wild type, implying the changed metabolic flux by the mutation. In the fermentor cultivation with IAM1183 {delta} hycA/ {delta} hybO, the total hydrogen volume after 16 h cultivation reached 4.4 L, while that for the wild type was only 2.9 L. (author)

  17. Cloning, expression and characterization of phenylalanine ammonia-lyase from Rhodotorula glutinis.

    Science.gov (United States)

    Zhu, Longbao; Cui, Wenjing; Fang, Yueqin; Liu, Yi; Gao, Xinxing; Zhou, Zhemin

    2013-05-01

    The industrial-scale production of phenylalanine ammonia-lyase (PAL) mainly uses strains of Rhodotorula. However, the PAL gene from Rhodotorula has not been cloned. Here, the full-length gene of PAL from Rhodotorula glutinis was isolated. It was 2,121 bp, encoding a polypeptide with 706 amino acids and a calculated MW of 75.5 kDa. Though R. glutinis is an anamorph of Rhodosporium toruloides, the amino acid sequences of PALs them are not the same (about 74 % identity). PAL was expressed in E. coli and characterized. Its specific activity was 4.2 U mg(-1) and the k cat/K m was 1.9 × 10(4) mM(-1) s(-1), exhibiting the highest catalytic ability among the reported PALs. The genetic and biochemical information reported here should facilitate future application in industry.

  18. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  19. Evaluation of gene expression and alginate production in response to oxygen transfer in continuous culture of Azotobacter vinelandii.

    Directory of Open Access Journals (Sweden)

    Alvaro Díaz-Barrera

    Full Text Available Alginates are polysaccharides used as food additives and encapsulation agents in biotechnology, and their functional properties depend on its molecular weight. In this study, different steady-states in continuous cultures of A. vinelandii were established to determine the effect of the dilution rate (D and the agitation rate on alginate production and expression of genes involved in alginate polymerization and depolymerization. Both, the agitation and dilution rates, determined the partitioning of the carbon utilization from sucrose into alginate and CO2 under oxygen-limiting conditions. A low D (0.07 h(-1 and 500 rpm resulted in the highest carbon utilization into alginate (25%. Quantitative real-time polymerase chain reaction was used to determine the transcription level of six genes involved in alginate polymerization and depolymerization. In chemostat cultures at 0.07 h(-1, the gene expression was affected by changes in the agitation rate. By increasing the agitation rate from 400 to 600 rpm, the algE7 gene expression decreased tenfold, whereas alyA1, algL and alyA2 gene expression increased between 1.5 and 2.8 times under similar conditions evaluated. Chemostat at 0.07 h(-1 showed a highest alginate molecular weight (580 kDa at 500 rpm whereas similar molecular weights (480 kDa were obtained at 400 and 600 rpm. The highest molecular weight was not explained by changes in the expression of alg8 and alg44 (genes involved in alginate polymerization. Nonetheless, a different expression pattern observed for lyases could explain the highest alginate molecular weight obtained. Overall, the results suggest that the control of alginate molecular weight in A. vinelandii cells growing in continuous mode is determined by a balance between the gene expression of intracellular and extracellular lyases in response to oxygen availability. These findings better our understanding of the biosynthesis of bacterial alginate and help us progress toward obtain

  20. Development and validation of a microarray for the investigation of the CAZymes encoded by the human gut microbiome.

    Directory of Open Access Journals (Sweden)

    Abdessamad El Kaoutari

    Full Text Available Distal gut bacteria play a pivotal role in the digestion of dietary polysaccharides by producing a large number of carbohydrate-active enzymes (CAZymes that the host otherwise does not produce. We report here the design of a custom microarray that we used to spot non-redundant DNA probes for more than 6,500 genes encoding glycoside hydrolases and lyases selected from 174 reference genomes from distal gut bacteria. The custom microarray was tested and validated by the hybridization of bacterial DNA extracted from the stool samples of lean, obese and anorexic individuals. Our results suggest that a microarray-based study can detect genes from low-abundance bacteria better than metagenomic-based studies. A striking example was the finding that a gene encoding a GH6-family cellulase was present in all subjects examined, whereas metagenomic studies have consistently failed to detect this gene in both human and animal gut microbiomes. In addition, an examination of eight stool samples allowed the identification of a corresponding CAZome core containing 46 families of glycoside hydrolases and polysaccharide lyases, which suggests the functional stability of the gut microbiota despite large taxonomical variations between individuals.

  1. Requirement for two or more Erwinia carotovora subsp. carotovora pectolytic gene products for maceration of potato tuber tissue by Escherichia coli.

    Science.gov (United States)

    Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S

    1986-07-01

    Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that encode endo-pectate lyases, exo-pectate lyase, and endo-polygalacturonase, caused limited maceration. The pectolytic proteins associated with one of these plasmids, pDR1, have been described previously (D. P. Roberts, P. M. Berman, C. Allen, V. K. Stromberg, G. H. Lacy, and M. S. Mount, Can. J. Plant Pathol. 8:17-27, 1986) and include two secreted endo-pectate lyases. The second plasmid, pDR30, contains a 2.1-kilobase EC14 DNA insert that mediates the production of an exo-pectate lyase and an endo-polygalacturonase. These enzymes are similar in physicochemical properties to those produced by EC14. Our results suggest that the concerted activities of endo-pectate lyases with endo-polygalacturonase or exo-pectate lyase or both cause maceration.

  2. Cloning, sequence and expression of the pel gene from an Amycolata sp.

    Science.gov (United States)

    Brühlmann, F; Keen, N T

    1997-11-20

    The pel gene from an Amycolata sp. encoding a pectate lyase (EC 4.2.2.2) was isolated by activity screening a genomic DNA library in Streptomyces lividans TK24. Subsequent subcloning and sequencing of a 2.3 kb BamHI BglII fragment revealed an open reading frame of 930 nt corresponding to a protein of 29,660 Da. The overall G + C content for the coding region was 65%, with a strong G + C preference in the third (wobble) codon position (93%). A putative ribosome-binding site 5'-GGGAG-3' preceded the translational start codon by 7 base pairs. The Amycolata pectate lyase contains a signal peptide of 26 amino acids, that is cleaved after the sequence Ala-Thr-Ala. The size of the deduced protein as well as its N-terminal amino-acid sequence match the wild-type pectate lyase from the Amycolata sp. Expression of the pel gene in S. lividans TK24 resulted in high pectate lyase activity in the culture supernatant, concomitant with the appearance of a dominant protein band on a sodium dodecyl polyacrylamide gel at 30 kDa. No pectate lyase activity was detected in E. coli BL21 with the pel gene under the strong T7 promotor. The deduced amino-acid sequence showed 40% identity with PelE from Erwinia chrysanthemi and the pectate lyase from Glomerella cingulata. The Amycolata pectate lyase clearly belongs to the pectate lyase superfamily, sharing all functional amino acids and likely has a similar structural topology as Pels from Erwinia chrysanthemi and Bacillus subtilis.

  3. Genomic Characterization of Phenylalanine Ammonia Lyase Gene in Buckwheat.

    Directory of Open Access Journals (Sweden)

    Karthikeyan Thiyagarajan

    Full Text Available Phenylalanine Ammonia Lyase (PAL gene which plays a key role in bio-synthesis of medicinally important compounds, Rutin/quercetin was sequence characterized for its efficient genomics application. These compounds possessing anti-diabetic and anti-cancer properties and are predominantly produced by Fagopyrum spp. In the present study, PAL gene was sequenced from three Fagopyrum spp. (F. tataricum, F. esculentum and F. dibotrys and showed the presence of three SNPs and four insertion/deletions at intra and inter specific level. Among them, the potential SNP (position 949th bp G>C with Parsimony Informative Site was selected and successfully utilised to individuate the zygosity/allelic variation of 16 F. tataricum varieties. Insertion mutations were identified in coding region, which resulted the change of a stretch of 39 amino acids on the putative protein. Our Study revealed that autogamous species (F. tataricum has lower frequency of observed SNPs as compared to allogamous species (F. dibotrys and F. esculentum. The identified SNPs in F. tataricum didn't result to amino acid change, while in other two species it caused both conservative and non-conservative variations. Consistent pattern of SNPs across the species revealed their phylogenetic importance. We found two groups of F. tataricum and one of them was closely related with F. dibotrys. Sequence characterization information of PAL gene reported in present investigation can be utilized in genetic improvement of buckwheat in reference to its medicinal value.

  4. The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5′-deoxyribose phosphate lyase activities

    Science.gov (United States)

    Bogani, Federica; Boehmer, Paul E.

    2008-01-01

    Base excision repair (BER) is essential for maintaining genome stability both to counter the accumulation of unusual bases and to protect from base loss in the DNA. Herpes simplex virus 1 (HSV-1) is a large dsDNA virus that encodes its own DNA replication machinery, including enzymes involved in nucleotide metabolism. We report on a replicative family B and a herpesvirus-encoded DNA Pol that possesses DNA lyase activity. We have discovered that the catalytic subunit of the HSV-1 DNA polymerase (Pol) (UL30) exhibits apurinic/apyrimidinic (AP) and 5′-deoxyribose phosphate (dRP) lyase activities. These activities are integral to BER and lead to DNA cleavage on the 3′ side of abasic sites and 5′-dRP residues that remain after cleavage by 5′-AP endonuclease. The UL30-catalyzed reaction occurs independently of divalent cation and proceeds via a Schiff base intermediate, indicating that it occurs via a lyase mechanism. Partial proteolysis of the Schiff base shows that the DNA lyase activity resides in the Pol domain of UL30. These observations together with the presence of a virus-encoded uracil DNA glycosylase indicates that HSV-1 has the capacity to perform critical steps in BER. These findings have implications on the role of BER in viral genome maintenance during lytic replication and reactivation from latency. PMID:18695225

  5. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  6. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth

    2009-01-01

    With the availability of the genome sequence of the filamentous fungus Aspergillus niger, the use of targeted genetic modifications has become feasible. This, together with the fact that A. niger is well established industrially, makes this fungus an attractive micro-organism for creating a cell...... factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...... the acl gene. Additionally, the total amount of organic acids produced in the deletion strain was significantly increased. Genome-scale stoichiometric metabolic model predictions can be used for identifying gene targets. Deletion of the acl led to increased succinic acid production by A. niger....

  7. A Pectate Lyase-Coding Gene Abundantly Expressed during Early Stages of Infection Is Required for Full Virulence in Alternaria brassicicola.

    Directory of Open Access Journals (Sweden)

    Yangrae Cho

    Full Text Available Alternaria brassicicola causes black spot disease of Brassica species. The functional importance of pectin digestion enzymes and unidentified phytotoxins in fungal pathogenesis has been suspected but not verified in A. brassicicola. The fungal transcription factor AbPf2 is essential for pathogenicity and induces 106 genes during early pathogenesis, including the pectate lyase-coding gene, PL1332. The aim of this study was to test the importance and roles of PL1332 in pathogenesis. We generated deletion strains of the PL1332 gene, produced heterologous PL1332 proteins, and evaluated their association with virulence. Deletion strains of the PL1332 gene were approximately 30% less virulent than wild-type A. brassicicola, without showing differences in colony expansion on solid media and mycelial growth in nutrient-rich liquid media or minimal media with pectins as a major carbon source. Heterologous PL1332 expressed as fusion proteins digested polygalacturons in vitro. When the fusion proteins were injected into the apoplast between leaf veins of host plants the tissues turned dark brown and soft, resembling necrotic leaf tissue. The PL1332 gene was the first example identified as a general toxin-coding gene and virulence factor among the 106 genes regulated by the transcription factor, AbPf2. It was also the first gene to have its functions investigated among the 19 pectate lyase genes and several hundred putative cell-wall degrading enzymes in A. brassicicola. These results further support the importance of the AbPf2 gene as a key pathogenesis regulator and possible target for agrochemical development.

  8. Kynurenine aminotransferase III and glutamine transaminase L are identical enzymes that have cysteine S-conjugate β-lyase activity and can transaminate L-selenomethionine.

    Science.gov (United States)

    Pinto, John T; Krasnikov, Boris F; Alcutt, Steven; Jones, Melanie E; Dorai, Thambi; Villar, Maria T; Artigues, Antonio; Li, Jianyong; Cooper, Arthur J L

    2014-11-07

    Three of the four kynurenine aminotransferases (KAT I, II, and IV) that synthesize kynurenic acid, a neuromodulator, are identical to glutamine transaminase K (GTK), α-aminoadipate aminotransferase, and mitochondrial aspartate aminotransferase, respectively. GTK/KAT I and aspartate aminotransferase/KAT IV possess cysteine S-conjugate β-lyase activity. The gene for the former enzyme, GTK/KAT I, is listed in mammalian genome data banks as CCBL1 (cysteine conjugate beta-lyase 1). Also listed, despite the fact that no β-lyase activity has been assigned to the encoded protein in the genome data bank, is a CCBL2 (synonym KAT III). We show that human KAT III/CCBL2 possesses cysteine S-conjugate β-lyase activity, as does mouse KAT II. Thus, depending on the nature of the substrate, all four KATs possess cysteine S-conjugate β-lyase activity. These present studies show that KAT III and glutamine transaminase L are identical enzymes. This report also shows that KAT I, II, and III differ in their ability to transaminate methyl-L-selenocysteine (MSC) and L-selenomethionine (SM) to β-methylselenopyruvate (MSP) and α-ketomethylselenobutyrate, respectively. Previous studies have identified these seleno-α-keto acids as potent histone deacetylase inhibitors. Methylselenol (CH3SeH), also purported to have chemopreventive properties, is the γ-elimination product of SM and the β-elimination product of MSC catalyzed by cystathionine γ-lyase (γ-cystathionase). KAT I, II, and III, in part, can catalyze β-elimination reactions with MSC generating CH3SeH. Thus, the anticancer efficacy of MSC and SM will depend, in part, on the endogenous expression of various KAT enzymes and cystathionine γ-lyase present in target tissue coupled with the ability of cells to synthesize in situ either CH3SeH and/or seleno-keto acid metabolites. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  10. Molecular cloning and characterization of an Erwinia carotovora subsp. carotovora pectin lyase gene that responds to DNA-damaging agents.

    OpenAIRE

    McEvoy, J L; Murata, H; Chatterjee, A K

    1990-01-01

    recA-mediated production of pectin lyase (PNL) and the bacteriocin carotovoricin occurs in Erwinia carotovora subsp. carotovora 71 when this organism is subjected to agents that damage or inhibit the synthesis of DNA. The structural gene pnlA was isolated from a strain 71 cosmid gene library following mobilization of the cosmids into a moderate PNL producer, strain 193. The cosmid complemented pnl::Tn5 but not ctv::Tn5 mutations. A constitutive level of PNL activity was detected in RecA+ and ...

  11. High-Level Expression of a Thermally Stable Alginate Lyase Using Pichia pastoris, Characterization and Application in Producing Brown Alginate Oligosaccharide

    Directory of Open Access Journals (Sweden)

    Haifeng Li

    2018-05-01

    Full Text Available An alginate lyase encoding gene sagl from Flavobacterium sp. H63 was codon optimized and recombinantly expressed at high level in P.pastoris through high cell-density fermentation. The highest yield of recombinant enzyme of sagl (rSAGL in yeast culture supernatant reached 226.4 μg/mL (915.5 U/mL. This was the highest yield record of recombinant expression of alginate lyase so far. The rSAGL was confirmed as a partially glycosylated protein through EndoH digestion. The optimal reaction temperature and pH of this enzyme were 45 °C and 7.5; 80 mM K+ ions could improve the catalytic activity of the enzyme by 244% at most. rSAGL was a thermal stable enzyme with T5015 of 57–58 °C and T5030 of 53–54 °C. Its thermal stability was better than any known alginate lyase. In 100 mM phosphate buffer of pH 6.0, rSAGL could retain 98.8% of the initial activity after incubation at 50 °C for 2 h. Furthermore, it could retain 61.6% of the initial activity after 48 h. The specific activity of the purified rSAGL produced by P. pastoris attained 4044 U/mg protein, which was the second highest record of alginate lyase so far. When the crude enzyme of the rSAGL was directly used in transformation of sodium alginate with 40 g/L, 97.2% of the substrate was transformed to di, tri, tetra brown alginate oligosaccharide after 32 h of incubation at 50 °C, and the final concentration of reducing sugar in mixture reached 9.51 g/L. This is the first report of high-level expression of thermally stable alginate lyase using P. pastoris system.

  12. AlgM4: A New Salt-Activated Alginate Lyase of the PL7 Family with Endolytic Activity

    Directory of Open Access Journals (Sweden)

    Guiyuan Huang

    2018-04-01

    Full Text Available Alginate lyases are a group of enzymes that catalyze the depolymerization of alginates into oligosaccharides or monosaccharides. These enzymes have been widely used for a variety of purposes, such as producing bioactive oligosaccharides, controlling the rheological properties of polysaccharides, and performing structural analyses of polysaccharides. The algM4 gene of the marine bacterium Vibrio weizhoudaoensis M0101 encodes an alginate lyase that belongs to the polysaccharide lyase family 7 (PL7. In this study, the kinetic constants Vmax (maximum reaction rate and Km (Michaelis constant of AlgM4 activity were determined as 2.75 nmol/s and 2.72 mg/mL, respectively. The optimum temperature for AlgM4 activity was 30 °C, and at 70 °C, AlgM4 activity dropped to 11% of the maximum observed activity. The optimum pH for AlgM4 activity was 8.5, and AlgM4 was completely inactive at pH 11. The addition of 1 mol/L NaCl resulted in a more than sevenfold increase in the relative activity of AlgM4. The secondary structure of AlgM4 was altered in the presence of NaCl, which caused the α-helical content to decrease from 12.4 to 10.8% and the β-sheet content to decrease by 1.7%. In addition, NaCl enhanced the thermal stability of AlgM4 and increased the midpoint of thermal denaturation (Tm by 4.9 °C. AlgM4 exhibited an ability to degrade sodium alginate, poly-mannuronic acid (polyM, and poly-guluronic acid (polyG, resulting in the production of oligosaccharides with a degree of polymerization (DP of 2–9. AlgM4 possessed broader substrate, indicating that it is a bifunctional alginate lyase. Thus, AlgM4 is a novel salt-activated and bifunctional alginate lyase of the PL7 family with endolytic activity.

  13. Requirement for two or more Erwinia carotovora subsp. carotovora pectolytic gene products for maceration of potato tuber tissue by Escherichia coli.

    OpenAIRE

    Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S

    1986-01-01

    Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that en...

  14. Characterization of AlgMsp, an alginate lyase from Microbulbifer sp. 6532A.

    Directory of Open Access Journals (Sweden)

    Steven M Swift

    Full Text Available Alginate is a polysaccharide produced by certain seaweeds and bacteria that consists of mannuronic acid and guluronic acid residues. Seaweed alginate is used in food and industrial chemical processes, while the biosynthesis of bacterial alginate is associated with pathogenic Pseudomonas aeruginosa. Alginate lyases cleave this polysaccharide into short oligo-uronates and thus have the potential to be utilized for both industrial and medicinal applications. An alginate lyase gene, algMsp, from Microbulbifer sp. 6532A, was synthesized as an E.coli codon-optimized clone. The resulting 37 kDa recombinant protein, AlgMsp, was expressed, purified and characterized. The alginate lyase displayed highest activity at pH 8 and 0.2 M NaCl. Activity of the alginate lyase was greatest at 50°C; however the enzyme was not stable over time when incubated at 50°C. The alginate lyase was still highly active at 25°C and displayed little or no loss of activity after 24 hours at 25°C. The activity of AlgMsp was not dependent on the presence of divalent cations. Comparing activity of the lyase against polymannuronic acid and polyguluronic acid substrates showed a higher turnover rate for polymannuronic acid. However, AlgMSP exhibited greater catalytic efficiency with the polyguluronic acid substrate. Prolonged AlgMsp-mediated degradation of alginate produced dimer, trimer, tetramer, and pentamer oligo-uronates.

  15. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  16. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  17. [Construction and high-density fermentation of alkaline pectate lyase high-yield yeast].

    Science.gov (United States)

    Wang, Xiaowen; Xiang, La; Xu, Ting; Lu, Zhenghui; Zhang, Guimin

    2017-12-25

    Pectate lyase is widely applied in ramie degumming and fabric bioscouring in the textile industry. Compared to conventional processes that involve high alkaline and high temperature treatment, enzyme based treatments have significant advantages in fibers protectiveness, improved efficiency of refining, reduced energy consumption and pollution. Hence, it would be highly desirable to construct high-yield alkaline pectate lyase engineered strains and reduce the pectate lyase production cost. In the previous study, pectate lyase gene pel from Bacillus subtilis168 was expressed in Pichia pastoris GS115 after codon usage optimization based on the vector pHBM905A. To improve the expression level, the vector pHBM905BDM with optimized promoter and signal peptide was used to express the optimized gene pels in GS115. The transformant had increased activity from 68 U/mL to 100 U/mL with the improvement in the transcription level by 27% measured by qPCR. The transformants were further screened on pectin plates, where higher halo forming strains were picked for shake-flask fermentation and strain GS115-pHBM905BDM-pels4 showed the highest activity of 536 U/mL. Then plasmid pPIC9K-pels was constructed and electroporated into the GS115-pHBM905BDM-pels4 cells. Subsequently, high-copy transformant was screened by using the medium containing antibiotics G418, strain GS115-pHBM905BDMpPIC9K- pels1 was identified with increased activity of 770 U/mL and the copy number of pels was 7 confirmed by qPCR. Finally, the activity of pectate lyase produced by GS115-pHBM905BDM-pPIC9K-pels1reached to 2 271 U/mL in a 5-L fermentor. The activity of pectate lyase in our study reached the highest level of expression in P. pastoris, showing good application potential in the textile industry.

  18. Utilization of Glyphosate as Phosphate Source: Biochemistry and Genetics of Bacterial Carbon-Phosphorus Lyase

    Science.gov (United States)

    Zechel, David L.; Jochimsen, Bjarne

    2014-01-01

    SUMMARY After several decades of use of glyphosate, the active ingredient in weed killers such as Roundup, in fields, forests, and gardens, the biochemical pathway of transformation of glyphosate phosphorus to a useful phosphorus source for microorganisms has been disclosed. Glyphosate is a member of a large group of chemicals, phosphonic acids or phosphonates, which are characterized by a carbon-phosphorus bond. This is in contrast to the general phosphorus compounds utilized and metabolized by microorganisms. Here phosphorus is found as phosphoric acid or phosphate ion, phosphoric acid esters, or phosphoric acid anhydrides. The latter compounds contain phosphorus that is bound only to oxygen. Hydrolytic, oxidative, and radical-based mechanisms for carbon-phosphorus bond cleavage have been described. This review deals with the radical-based mechanism employed by the carbon-phosphorus lyase of the carbon-phosphorus lyase pathway, which involves reactions for activation of phosphonate, carbon-phosphorus bond cleavage, and further chemical transformation before a useful phosphate ion is generated in a series of seven or eight enzyme-catalyzed reactions. The phn genes, encoding the enzymes for this pathway, are widespread among bacterial species. The processes are described with emphasis on glyphosate as a substrate. Additionally, the catabolism of glyphosate is intimately connected with that of aminomethylphosphonate, which is also treated in this review. Results of physiological and genetic analyses are combined with those of bioinformatics analyses. PMID:24600043

  19. Expression and properties of the highly alkalophilic phenylalanine ammonia-lyase of thermophilic Rubrobacter xylanophilus.

    Directory of Open Access Journals (Sweden)

    Klaudia Kovács

    Full Text Available The sequence of a phenylalanine ammonia-lyase (PAL; EC: 4.3.1.24 of the thermophilic and radiotolerant bacterium Rubrobacter xylanophilus (RxPAL was identified by screening the genomes of bacteria for members of the phenylalanine ammonia-lyase family. A synthetic gene encoding the RxPAL protein was cloned and overexpressed in Escherichia coli TOP 10 in a soluble form with an N-terminal His6-tag and the recombinant RxPAL protein was purified by Ni-NTA affinity chromatography. The activity assay of RxPAL with l-phenylalanine at various pH values exhibited a local maximum at pH 8.5 and a global maximum at pH 11.5. Circular dichroism (CD studies showed that RxPAL is associated with an extensive α-helical character (far UV CD and two distinctive near-UV CD peaks. These structural characteristics were well preserved up to pH 11.0. The extremely high pH optimum of RxPAL can be rationalized by a three-dimensional homology model indicating possible disulfide bridges, extensive salt-bridge formation and an excess of negative electrostatic potential on the surface. Due to these properties, RxPAL may be a candidate as biocatalyst in synthetic biotransformations leading to unnatural l- or d-amino acids or as therapeutic enzyme in treatment of phenylketonuria or leukemia.

  20. Generation of 2-Furfurylthiol by Carbon-Sulfur Lyase from the Baijiu Yeast Saccharomyces cerevisiae G20.

    Science.gov (United States)

    Zha, Musu; Sun, Baoguo; Yin, Sheng; Mehmood, Arshad; Cheng, Lei; Wang, Chengtao

    2018-03-07

    2-Furfurylthiol is the representative aroma compound of Chinese sesame-flavored baijiu. Previous studies demonstrated that baijiu yeasts could generate 2-furfurylthiol using furfural and l-cysteine as precursors and that the Saccharomyces cerevisiae genes STR3 and CYS3 are closely related to 2-furfurylthiol biosynthesis. To confirm the mechanism of the STR3- and CYS3-gene products on 2-furfurylthiol biosynthesis, their encoded proteins were purified, and we confirmed their activities as carbon-sulfur lyases. Str3p and Cys3p were able to cleave the cysteine-furfural conjugate to release 2-furfurylthiol. Moreover, the characterization of the enzymatic properties of the purified proteins shows good thermal stabilities and wide pH tolerances, which enable their strong potential for various applications. These data provide direct evidence that yeast Str3p and Cys3p release 2-furfurylthiol in vitro, which can be applied to improve baijiu flavor.

  1. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  2. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  3. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  4. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    Science.gov (United States)

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  5. The Aspergillus nidulans acuL gene encodes a mitochondrial carrier required for the utilization of carbon sources that are metabolized via the TCA cycle.

    Science.gov (United States)

    Flipphi, Michel; Oestreicher, Nathalie; Nicolas, Valérie; Guitton, Audrey; Vélot, Christian

    2014-07-01

    In Aspergillus nidulans, the utilization of acetate as sole carbon source requires several genes (acu). Most of them are also required for the utilization of fatty acids. This is the case for acuD and acuE, which encode the two glyoxylate cycle-specific enzymes, isocitrate lyase and malate synthase, respectively, but also for acuL that we have identified as AN7287, and characterized in this study. Deletion of acuL resulted in the same phenotype as the original acuL217 mutant. acuL encodes a 322-amino acid protein which displays all the structural features of a mitochondrial membrane carrier, and shares 60% identity with the Saccharomyces cerevisiae succinate/fumarate mitochondrial antiporter Sfc1p (also named Acr1p). Consistently, the AcuL protein was shown to localize in mitochondria, and partial cross-complementation was observed between the S. cerevisiae and A. nidulans homologues. Extensive phenotypic characterization suggested that the acuL gene is involved in the utilization of carbon sources that are catabolized via the TCA cycle, and therefore require gluconeogenesis. In addition, acuL proves to be co-regulated with acuD and acuE. Overall, our data suggest that AcuL could link the glyoxylate cycle to gluconeogenesis by exchanging cytoplasmic succinate for mitochondrial fumarate. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Suppressed phenylalanine ammonia-lyase activity after heat shock in transgenic Nicotiana plumbaginifolia containing an Arabidopsis HSP18.2-parsley PAL2 chimera gene.

    Science.gov (United States)

    Moriwaki, M; Yamakawa, T; Washino, T; Kodama, T; Igarashi, Y

    1999-01-01

    The activity of phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) after heat shock (HS) in leaves and buds of transgenic Nicotiana plumbaginifolia containing an Arabidopsis HSP18.2 promoter-parsley phenylalanine ammonia-lyase 2 (HSP18.2-PAL2) chimera gene was examined. Immediately after HS treatment at 44 degrees C for 5 h, the PAL activity in both transgenic and normal (untransformed) plants was 35-38% lower than that before HS. At normal temperature (25-26 degrees C), the PAL activity recovered within 5 h of ending the HS treatment in normal plants, but not until 12-24 h in transgenic plants containing the HSP18.2-PAL2 gene. Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed the presence of parsley PAL2 mRNA in transgenic plants, which remained for 8-12 h following 5-h HS at 44 degrees C; the mRNA was not observed before HS. The content of chlorogenic acid (CGA; 3-caffeoylquinic acid) decreased drastically 8-12 h after HS in transgenic plants, but only slightly in normal plants. Thus, the decrease in PAL activity accompanied by expression of the parsley PAL2 gene after HS treatment corresponded to the decrease in CGA synthesis. These results might be attributed to post-transcriptional degradation of endogenous PAL mRNA triggered by transcription of the transgene.

  7. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  8. Cystathionine γ-lyase deficiency mediates neurodegeneration in Huntington’s disease

    Science.gov (United States)

    Paul, Bindu D.; Sbodio, Juan I.; Xu, Risheng; Vandiver, M. Scott; Cha, Jiyoung Y.; Snowman, Adele M.; Snyder, Solomon H.

    2015-01-01

    Huntington’s disease is an autosomal dominant disease associated with a mutation in the gene encoding huntingtin (Htt) leading to expanded polyglutamine repeats of mutant Htt (mHtt) that elicit oxidative stress, neurotoxicity, and motor and behavioural changes1. Huntington’s disease is characterized by highly selective and profound damage to the corpus striatum, which regulates motor function. Striatal selectivity of Huntington’s disease may reflect the striatally selective small G protein Rhes binding to mHtt and enhancing its neurotoxicity2. Specific molecular mechanisms by which mHtt elicits neurodegeneration have been hard to determine. Here we show a major depletion of cystathionine γ-lyase (CSE), the biosynthetic enzyme for cysteine, in Huntington’s disease tissues, which may mediate Huntington’s disease pathophysiology. The defect occurs at the transcriptional level and seems to reflect influences of mHtt on specificity protein 1, a transcriptional activator for CSE. Consistent with the notion of loss of CSE as a pathogenic mechanism, supplementation with cysteine reverses abnormalities in cultures of Huntington’s disease tissues and in intact mouse models of Huntington’s disease, suggesting therapeutic potential. PMID:24670645

  9. Molecular cloning, purification, and characterization of a novel polyMG-specific alginate lyase responsible for alginate MG block degradation in Stenotrophomas maltophilia KJ-2

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Su In; Kim, Hee Sook [Kyungsung Univ., Busan (Korea, Republic of). Dept. of Food Science and Biotechnology; Choi, Sung Hee; Lee, Eun Yeol [Kyung Hee Univ., Gyeonggi-do (Korea, Republic of). Dept. of Chemical Engineering

    2012-09-15

    A gene for a polyMG-specific alginate lyase possessing a novel structure was identified and cloned from Stenotrophomas maltophilia KJ-2 by using PCR with homologous nucleotide sequences-based primers. The recombinant alginate lyase consisting of 475 amino acids was purified on Ni-Sepharose column and exhibited the highest activity at pH 8 and 40 C. Interestingly, the recombinant alginate lyase was expected to have a similar catalytic active site of chondroitin B lyase but did not show chondroitin lyase activity. In the test of substrate specificity, the recombinant alginate lyase preferentially degraded the glycosidic bond of polyMG-block than polyM-block and polyG-block. The chemical structures of the degraded alginate oligosaccharides were elucidated to have mannuronate (M) at the reducing end on the basis of NMR analysis, supporting that KJ-2 polyMG-specific alginate lyase preferably degraded the glycosidic bond in M-G linkage than that in G-M linkage. The KJ-2 polyMG-specific alginate lyase can be used in combination with other alginate lyases for a synergistic saccharification of alginate. (orig.)

  10. Gene inactivation in the plant pathogen Glomerella cingulata: three strategies for the disruption of the pectin lyase gene pnlA.

    Science.gov (United States)

    Bowen, J K; Templeton, M D; Sharrock, K R; Crowhurst, R N; Rikkerink, E H

    1995-01-20

    The feasibility of performing routine transformation-mediated mutagenesis in Glomerella cingulata was analysed by adopting three one-step gene disruption strategies targeted at the pectin lyase gene pnlA. The efficiencies of disruption following transformation with gene replacement- or gene truncation-disruption vectors were compared. To effect replacement-disruption, G. cingulata was transformed with a vector carrying DNA from the pnlA locus in which the majority of the coding sequence had been replaced by the gene for hygromycin B resistance. Two of the five transformants investigated contained an inactivated pnlA gene (pnlA-); both also contained ectopically integrated vector sequences. The efficacy of gene disruption by transformation with two gene truncation-disruption vectors was also assessed. Both vectors carried at 5' and 3' truncated copy of the pnlA coding sequence, adjacent to the gene for hygromycin B resistance. The promoter sequences controlling the selectable marker differed in the two vectors. In one vector the homologous G. cingulata gpdA promoter controlled hygromycin B phosphotransferase expression (homologous truncation vector), whereas in the second vector promoter elements were from the Aspergillus nidulans gpdA gene (heterologous truncation vector). Following transformation with the homologous truncation vector, nine transformants were analysed by Southern hybridisation; no transformants contained a disrupted pnlA gene. Of nineteen heterologous truncation vector transformants, three contained a disrupted pnlA gene; Southern analysis revealed single integrations of vector sequence at pnlA in two of these transformants. pnlA mRNA was not detected by Northern hybridisation in pnlA- transformants. pnlA- transformants failed to produce a PNLA protein with a pI identical to one normally detected in wild-type isolates by silver and activity staining of isoelectric focussing gels. Pathogenesis on Capsicum and apple was unaffected by disruption of

  11. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  12. The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5′-deoxyribose phosphate lyase activities

    OpenAIRE

    Bogani, Federica; Boehmer, Paul E.

    2008-01-01

    Base excision repair (BER) is essential for maintaining genome stability both to counter the accumulation of unusual bases and to protect from base loss in the DNA. Herpes simplex virus 1 (HSV-1) is a large dsDNA virus that encodes its own DNA replication machinery, including enzymes involved in nucleotide metabolism. We report on a replicative family B and a herpesvirus-encoded DNA Pol that possesses DNA lyase activity. We have discovered that the catalytic subunit of the HSV-1 DNA polymeras...

  13. Impact of different alginate lyases on combined cellulase–lyase saccharification of brown seaweed

    DEFF Research Database (Denmark)

    Manns, Dirk Martin; Nyffenegger, Christian; Saake, B.

    2016-01-01

    -guluronic acid. When applied together with a fungal cellulase preparation (Cellic®CTec2) at pH 6 and 40 °C on a glucan rich brown seaweed Laminaria digitata the viscosity decreased in the initial minutes while measurable alginate degradation occurred primarily within the first 1–2 hours of reaction. Whereas FALy......, indicating that the degradation of mannuronic acid blocks inhibited cellulase catalyzed glucose release from L. digitata. Nevertheless, combined alginate lyase and cellulase treatment for 24 hours released all potential glucose regardless of the applied lyase. The enzymatic treatment moreover induced...

  14. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  15. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  16. Enhancing RGI lyase thermostability by targeted single point mutations

    DEFF Research Database (Denmark)

    Silva, Inês R.; Larsen, Dorte Møller; Jers, Carsten

    2013-01-01

    Rhamnogalacturonan I lyase (RGI lyase) (EC 4.2.2.-) catalyzes the cleavage of rhamnogalacturonan I in pectins by β-elimination. In this study the thermal stability of a RGI lyase (PL 11) originating from Bacillus licheniformis DSM 13/ATCC14580 was increased by a targeted protein engineering...

  17. Isolation and Functional Characterization of a Phenylalanine Ammonia-Lyase Gene (SsPAL1 from Coleus (Solenostemon scutellarioides (L. Codd

    Directory of Open Access Journals (Sweden)

    Qinlong Zhu

    2015-09-01

    Full Text Available Phenylalanine ammonia-lyase (PAL is the first enzyme involved in the phenylpropanoid pathway and plays important roles in the secondary metabolisms, development and defense of plants. To study the molecular function of PAL in anthocyanin synthesis of Coleus (Solenostemon scutellarioides (L. Codd, a Coleus PAL gene designated as SsPAL1 was cloned and characterized using a degenerate oligonucleotide primer PCR and RACE method. The full-length SsPAL1 was 2450 bp in size and consisted of one intron and two exons encoding a polypeptide of 711 amino acids. The deduced SsPAL1 protein showed high identities and structural similarities with other functional plant PAL proteins. A series of putative cis-acting elements involved in transcriptional regulation, light and stress responsiveness were found in the upstream regulatory sequence of SsPAL1. Transcription pattern analysis indicated that SsPAL1 was constitutively expressed in all tissues examined and was enhanced by light and different abiotic factors. The recombinant SsPAL1 protein exhibited high PAL activity, at optimal conditions of 60 °C and pH 8.2. Although the levels of total PAL activity and total anthocyanin concentration have a similar variation trend in different Coleus cultivars, there was no significant correlation between them (r = 0.7529, p > 0.1, suggesting that PAL was not the rate-limiting enzyme for the downstream anthocyanin biosynthetic branch in Coleus. This study enables us to further understand the role of SsPAL1 in the phenylpropanoid (flavonoids, anthocyanins biosynthesis in Coleus at the molecular level.

  18. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  19. Cloned Erwinia chrysanthemi out genes enable Escherichia coli to selectively secrete a diverse family of heterologous proteins to its milieu.

    Science.gov (United States)

    He, S Y; Lindeberg, M; Chatterjee, A K; Collmer, A

    1991-02-01

    The out genes of the enterobacterial plant pathogen Erwinia chrysanthemi are responsible for the efficient extracellular secretion of multiple plant cell wall-degrading enzymes, including four isozymes of pectate lyase, exo-poly-alpha-D-galacturonosidase, pectin methylesterase, and cellulase. Out- mutants of Er. chrysanthemi are unable to export any of these proteins beyond the periplasm and are severely reduced in virulence. We have cloned out genes from Er. chrysanthemi in the stable, low-copy-number cosmid pCPP19 by complementing several transposon-induced mutations. The cloned out genes were clustered in a 12-kilobase chromosomal DNA region, complemented all existing out mutations in Er. chrysanthemi EC16, and enabled Escherichia coli strains to efficiently secrete the extracellular pectic enzymes produced from cloned Er. chrysanthemi genes, while retaining the periplasmic marker protein beta-lactamase. DNA sequencing of a 2.4-kilobase EcoRI fragment within the out cluster revealed four genes arranged colinearly and sharing substantial similarity with the Klebsiella pneumoniae genes pulH, pulI, pulJ, and pulK, which are necessary for pullulanase secretion. However, K. pneumoniae cells harboring the cloned Er. chrysanthemi pelE gene were unable to secrete the Erwinia pectate lyase. Furthermore, the Er. chrysanthemi Out system was unable to secrete an extracellular pectate lyase encoded by a gene from a closely related plant pathogen. Erwinia carotovora ssp. carotovora. The results suggest that these enterobacteria secrete polysaccharidases by a conserved mechanism whose protein-recognition capacities have diverged.

  20. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  1. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  2. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  3. Kinetic and thermodynamic properties of alginate lyase and cellulase co-produced by Exiguobacterium species Alg-S5.

    Science.gov (United States)

    Mohapatra, Bidyut R

    2017-05-01

    In an effort to screen out the alginolytic and cellulolytic bacteria from the putrefying invasive seaweed Sargassum species accumulated off Barbados' coast, a potent bacterial strain was isolated. This bacterium, which simultaneously produced alginate lyase and cellulase, was identified as Exiguobacterium sp. Alg-S5 via the phylogenetic approach targeting the 16S rRNA gene. The co-produced alginate lyase and cellulase exhibited maximal enzymatic activity at pH 7.5 and at 40°C and 45°C, respectively. The K m and V max values recorded as 0.91mg/mL and 21.8U/mg-protein, respectively, for alginate lyase, and 10.9mg/mL and 74.6U/mg-protein, respectively, for cellulase. First order kinetic analysis of the thermal denaturation of the co-produced alginate lyase and cellulase in the temperature range from 40°C to 55°C revealed that both the enzymes were thermodynamically efficient by displaying higher activation energy and enthalpy of denaturation. These enzymatic properties indicate the potential industrial importance of this bacterium in algal biomass conversion. This appears to be the first report on assessing the efficacy of a bacterium for the co-production of alginate lyase and cellulase. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  5. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  6. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  7. Activities of methionine-γ-lyase in the acidophilic archaeon “Ferroplasma acidarmanus” strain fer1

    Directory of Open Access Journals (Sweden)

    Khan MA

    2013-04-01

    Full Text Available M A Khan,1 Madeline M López-Muñoz,2 Charles W Kaspar,3 Kai F Hung1 1Department of Biological Sciences, Eastern Illinois University, Charleston, IL, USA; 2Department of Biology, Universidad de Puerto Rico, Mayaguez, Puerto Rico; 3Bacteriology Department, University of Wisconsin, Madison, WI, USA Abstract: Biogeochemical processes on exposed pyrite ores result in extremely high levels of sulfuric acid at these locations. Acidophiles that thrive in these conditions must overcome significant challenges, including an environment with proton concentrations at pH 3 or below. The role of sulfur metabolism in the archaeon “Ferroplasma acidarmanus” strain fer1's ability to thrive in this environment was investigated due to its growth-dependent production of methanethiol, a volatile organic sulfur compound. Two putative sequences for methionine-γ-lyase (EC 4.4.1.11, an enzyme known to carry out α, γ-elimination on L-methionine to produce methanethiol, were identified in fer1. Bioinformatic analyses identified a conserved pyridoxal-5'-phosphate (PLP binding domain and a partially conserved catalytic domain in both putative sequences. Detection of PLP-dependent and L-methionine-dependent production of α-keto compounds and thiol groups in fer1 confirmed the presence of methionine-γ-lyase activity. Further, fer1 lysate was capable of processing related substrates, including D-methionine, L-cysteine, L-cystathionine, and L/D-homocysteine. When the two putative fer1 methionine-γ-lyase gene-coded proteins were expressed in Escherichia coli cells, one sequence demonstrated an ability to carry out α, γ-elimination activity, while the other exhibited γ-replacement activity. These fer1 methionine-γ-lyases also exhibited optimum pH, substrate specificity, and catalytic preferences that are different from methionine-γ-lyases from other organisms. These differences are discussed in the context of molecular phylogeny constructed using a maximum

  8. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  9. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  10. In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

    Directory of Open Access Journals (Sweden)

    Amit Kumar Dubey

    2010-01-01

    Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

  11. Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

    International Nuclear Information System (INIS)

    Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo; Hashimoto, Wataru; Murata, Kousaku

    2006-01-01

    The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2 1 and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, b = 108.3, c = 149.5 Å, β = 91.5°

  12. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  13. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  14. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  15. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  16. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  17. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  18. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  19. Co-ordinate regulation of genes involved in storage lipid mobilization in Arabidopsis thaliana.

    Science.gov (United States)

    Rylott, E L; Hooks, M A; Graham, I A

    2001-05-01

    Molecular genetic approaches in the model plant Arabidopsis thaliana (Col0) are shedding new light on the role and control of the pathways associated with the mobilization of lipid reserves during oilseed germination and post-germinative growth. Numerous independent studies have reported on the expression of individual genes encoding enzymes from the three major pathways: beta-oxidation, the glyoxylate cycle and gluconeogenesis. However, a single comprehensive study of representative genes and enzymes from the different pathways in a single plant species has not been done. Here we present results from Arabidopsis that demonstrate the co-ordinate regulation of gene expression and enzyme activities for the acyl-CoA oxidase- and 3-ketoacyl-CoA thiolase-mediated steps of beta-oxidation, the isocitrate lyase and malate synthase steps of the glyoxylate cycle and the phosphoenolpyruvate carboxykinase step of gluconeogenesis. The mRNA abundance and enzyme activities increase to a peak at stage 2, 48 h after the onset of seed germination, and decline thereafter either to undetectable levels (for malate synthase and isocitrate lyase) or low basal levels (for the genes of beta-oxidation and gluconeogenesis). The co-ordinate induction of all these genes at the onset of germination raises the possibility that a global regulatory mechanism operates to induce the expression of genes associated with the mobilization of storage reserves during the heterotrophic growth period.

  20. S1P Lyase Regulation of Thymic Egress and Oncogenic Inflammatory Signaling

    Science.gov (United States)

    Kumar, Ashok; Zamora-Pineda, Jesus; Degagné, Emilie

    2017-01-01

    Sphingosine-1-phosphate (S1P) is a potent lipid signaling molecule that regulates pleiotropic biological functions including cell migration, survival, angiogenesis, immune cell trafficking, inflammation, and carcinogenesis. It acts as a ligand for a family of cell surface receptors. S1P concentrations are high in blood and lymph but low in tissues, especially the thymus and lymphoid organs. S1P chemotactic gradients are essential for lymphocyte egress and other aspects of physiological cell trafficking. S1P is irreversibly degraded by S1P lyase (SPL). SPL regulates lymphocyte trafficking, inflammation and other physiological and pathological processes. For example, SPL located in thymic dendritic cells acts as a metabolic gatekeeper that controls the normal egress of mature T lymphocytes from the thymus into the circulation, whereas SPL deficiency in gut epithelial cells promotes colitis and colitis-associated carcinogenesis (CAC). Recently, we identified a complex syndrome comprised of nephrosis, adrenal insufficiency, and immunological defects caused by inherited mutations in human SGPL1, the gene encoding SPL. In the present article, we review current evidence supporting the role of SPL in thymic egress, inflammation, and cancer. Lastly, we summarize recent progress in understanding other SPL functions, its role in inherited disease, and SPL targeting for therapeutic purposes. PMID:29333002

  1. S1P Lyase Regulation of Thymic Egress and Oncogenic Inflammatory Signaling

    Directory of Open Access Journals (Sweden)

    Ashok Kumar

    2017-01-01

    Full Text Available Sphingosine-1-phosphate (S1P is a potent lipid signaling molecule that regulates pleiotropic biological functions including cell migration, survival, angiogenesis, immune cell trafficking, inflammation, and carcinogenesis. It acts as a ligand for a family of cell surface receptors. S1P concentrations are high in blood and lymph but low in tissues, especially the thymus and lymphoid organs. S1P chemotactic gradients are essential for lymphocyte egress and other aspects of physiological cell trafficking. S1P is irreversibly degraded by S1P lyase (SPL. SPL regulates lymphocyte trafficking, inflammation and other physiological and pathological processes. For example, SPL located in thymic dendritic cells acts as a metabolic gatekeeper that controls the normal egress of mature T lymphocytes from the thymus into the circulation, whereas SPL deficiency in gut epithelial cells promotes colitis and colitis-associated carcinogenesis (CAC. Recently, we identified a complex syndrome comprised of nephrosis, adrenal insufficiency, and immunological defects caused by inherited mutations in human SGPL1, the gene encoding SPL. In the present article, we review current evidence supporting the role of SPL in thymic egress, inflammation, and cancer. Lastly, we summarize recent progress in understanding other SPL functions, its role in inherited disease, and SPL targeting for therapeutic purposes.

  2. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  3. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  4. Disentangling the Trichoderma viridescens complex

    NARCIS (Netherlands)

    Jaklitsch, W.M.; Samuels, G.J.; Ismaiel, A.; Voglmayr, H.

    2013-01-01

    Trichoderma viridescens is recognised as a species complex. Multigene analyses based on the translation elongation factor 1-alpha encoding gene (tef1), a part of the rpb2 gene, encoding the second largest RNA polymerase subunit and the larger subunit of ATP citrate lyase (acl1) reveals 13

  5. Structural Insights Into The Bacterial Carbon-Phosphorus Lyase Machinery

    DEFF Research Database (Denmark)

    Brodersen, Ditlev Egeskov

    the proteins encoded in the phn operon act in concert to catabolise phosphonate remain unknown. We have determined the crystal structure of a 240 kDa Escherichia coli carbon-phosphorus lyase core complex at 1.7 Å and show that it comprises a highly intertwined network of subunits with several unexpected......Phosphonate compounds act as a nutrient source for some microorganisms when phosphate is limiting but require a specialised enzymatic machinery due to the presence of the highly stable carbon-phosphorus bond. Despite the fundamental importance to microbial metabolism, the details of how...... structural features. The complex contains at least two different active sites and suggest a revision of current models of carbon-phosphorus bond cleavage. Using electron microscopy, we map the binding site of an additional protein subunit, which may use ATP for driving conformational changes during...

  6. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  7. The hydroxynitrile lyase from almond: crystal structure and mechanistical studies

    International Nuclear Information System (INIS)

    Dreveny, Ingrid

    2001-09-01

    Cyanogenesis is a defense process of several thousand plant species. Hydroxynitrile lyase (HNL), a key enzyme of this process, cleaves a cyanohydrin precursor into hydrocyanic acid and the corresponding aldehyde or ketone. The reverse reaction constitutes an important tool in industrial biocatalysis. Different classes of hydroxynitrile lyases have convergently evolved from FAD-dependent oxidoreductases, α/β hydrolases and alcohol dehydrogenases. The FAD-dependent hydroxynitrile lyases (FAD-HNLs) carry a flavin cofactor whose redox properties appear to be unimportant for catalysis. The high resolution crystal structure of the hydroxynitrile lyase from almond (Prunus amygdalus), PaHNL1, has been determined and constitutes the first 3D structure of an FAD-HNL. The overall fold and the architecture of the active site region showed that PaHNL1 belongs to the glucose-methanol-choline-oxidoreductase family, with closest structural similarity to glucose oxidase. There is strong evidence from the sequence and the reaction product that FAD-dependent hydroxynitrile lyases have evolved from an aryl alcohol oxidizing precursor. Structures of PaHNL1 in complex with its natural substrate mandelonitrile and the competitive inhibitor benzyl alcohol provided insight into the residues involved in catalysis and a mechanism without participation of the cofactor could be suggested. Although the catalytic residues differ between the α/β-hydrolase-type HNLs and PaHNL1, common general features relevant for hydroxynitrile lyase activity could be proposed. (author)

  8. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  9. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  10. Studies on pectin lyase

    NARCIS (Netherlands)

    Houdenhoven, van F.E.A.

    1975-01-01

    The pectin lyase activity in the commercial enzyme preparation Ultrazym originates from more then one type of enzyme; two of them, accounting for 95 % of the total activity, have been completely purified. As purity criteria specific activity, polyacrylamide disc gel electrophoresis and SDS

  11. Molecular Cloning of cpcU and Heterodimeric Bilin Lyase Activity Analysis of CpcU and CpcS for Attachment of Phycocyanobilin to Cys-82 on the β-Subunit of Phycocyanin in Arthrospira platensis FACHB314

    Directory of Open Access Journals (Sweden)

    Fei Wu

    2016-03-01

    Full Text Available A new bilin lyase gene cpcU was cloned from Arthrospira platensis FACHB314 to study the assembly of the phycocyanin β-Subunit. Two recombinant plasmids, one contained the phycocyanobilin (PCB producing genes (hoxI and pcyA, while the other contained the gene of the β-Subunit of phycobiliprotein (cpcB and the lyase gene (cpcU, cpcS, or cpcU/S were constructed and separately transferred into Escherichia coli in order to test the activities of relevant lyases for catalyzing PCB addition to CpcB during synthesizing fluorescent β-PC of A. platensis FACHB314. The fluorescence intensity examination showed that Cys-82 maybe the active site for the β-Subunit binding to PCBs and the attachment could be carried out by CpcU, CpcS, or co-expressed cpcU/S in A. platensis FACHB314.

  12. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  13. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  14. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  15. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  16. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  17. Cloning and Expression Analysis of Phenylalanine Ammonia-Lyase Gene in the Mycelium and Fruit Body of the Edible Mushroom Flammulina velutipes

    Science.gov (United States)

    Yun, Yeo Hong; Koo, Ja Sun

    2015-01-01

    Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050

  18. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  19. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  20. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  1. Abundance and genetic diversity of microbial polygalacturonase and pectate lyase in the sheep rumen ecosystem.

    Directory of Open Access Journals (Sweden)

    Peng Yuan

    Full Text Available Efficient degradation of pectin in the rumen is necessary for plant-based feed utilization. The objective of this study was to characterize the diversity, abundance, and functions of pectinases from microorganisms in the sheep rumen.A total of 103 unique fragments of polygalacturonase (PF00295 and pectate lyase (PF00544 and PF09492 genes were retrieved from microbial DNA in the rumen of a Small Tail Han sheep, and 66% of the sequences of these fragments had low identities (<65% with known sequences. Phylogenetic tree building separated the PF00295, PF00544, and PF09492 sequences into five, three, and three clades, respectively. Cellulolytic and noncellulolytic Butyrivibrio, Prevotella, and Fibrobacter species were the major sources of the pectinases. The two most abundant pectate lyase genes were cloned, and their protein products, expressed in Escherichia coli, were characterized. Both enzymes probably act extracellularly as their nucleotide sequences contained signal sequences, and they had optimal activities at the ruminal physiological temperature and complementary pH-dependent activity profiles.This study reveals the specificity, diversity, and abundance of pectinases in the rumen ecosystem and provides two additional ruminal pectinases for potential industrial use under physiological conditions.

  2. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  3. Molecular cloning and characterization of l-methionine γ-lyase from Streptomyces avermitilis.

    Science.gov (United States)

    Kudou, Daizou; Yasuda, Eri; Hirai, Yoshiyuki; Tamura, Takashi; Inagaki, Kenji

    2015-10-01

    A pyridoxal 5'-phosphate-dependent methionine γ-lyase (MGL) was cloned from Streptomyces avermitilis catalyzed the degradation of methionine to α-ketobutyrate, methanethiol, and ammonia. The sav7062 gene (1,242 bp) was corresponded to 413 amino acid residues with a molecular mass of 42,994 Da. The deduced amino acid sequence showed a high degree of similarity to those of other MGL enzymes. The sav7062 gene was overexpressed in Escherichia coli. The enzyme was purified to homogeneity and exhibited the MGL catalytic activities. We cloned the enzyme that has the MGL activity in Streptomyces for the first time. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  5. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  6. Circadian Rhythmicity in the Activities of Phenylalanine Ammonia-Lyase from Lemna perpusilla and Spirodela polyrhiza 1

    Science.gov (United States)

    Gordon, William R.; Koukkari, Willard L.

    1978-01-01

    The oscillations in phenylalanine ammonia-lyase activity from Spirodela polyrhiza and phenylalanine ammonia-lyase and tyrosine ammonia-lyase activities from Lemna perpusilla displayed a circadian rhythm under continuous light. Rhythmicity in enzymic activity could not be detected in continuous darkness since under this condition phenylalanine ammonia-lyase activity remains at a fairly constantly low level. Results from our studies of the oscillatory pattern of the respective activities of phenylalanine and tyrosine ammonia-lyase support their “inseparability.” PMID:16660569

  7. Utilization of Aspergillus oryzae to produce pectin lyase from various agro-industrial residues

    Directory of Open Access Journals (Sweden)

    Safia Koser

    2014-07-01

    Full Text Available The present study was aimed to investigate the culture influence on pectin lyase production potential of fungal strain Aspergillus oryzae. The enzyme profile of A. oryzae showed highest activity of pectin lyase after 3rd day of incubation on lemon peel waste under solid state fermentation conditions. To induce the pectin lyase synthesis capability of A. oryzae at optimal level various culture variables including physical and nutritional parameters were optimized by adopting classical optimization technique. Therefore, through fermentation process optimization the production of pectin lyase was substantially induced up to the level of 875 U/mL, when fermentation medium of lemon peel waste inoculated with 5 mL spore suspension of A. oryzae. The optimal fermentation conditions for maximum pectin lyase yield were as: optimum pH 5, 70% moisture level and incubated at 40 °C in addition with 1% sterile glucose solution as readily available carbon source and 0.2% yeast extract as an inexpensive nitrogen supplement (1%. The results obtained in current investigation so far demonstrated that culture conditions have great influence on the pectin lyase production potential of A. oryzae.

  8. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  9. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  10. Structure and Mechanism of PhnP, a Phosphodiesterase of the Carbon-Phosphorus Lyase Pathway

    DEFF Research Database (Denmark)

    He, Shu-Mei; Wathier, Matthew; Podzelinska, Kateryna

    2011-01-01

    PhnP is a phosphodiesterase that plays an important role within the bacterial carbon-phosphorus lyase (CP-lyase) pathway by recycling a "dead-end" intermediate, 5-phospho-α-d-ribosyl 1,2-cyclic phosphate, that is formed during organophosphonate catabolism. As a member of the metallo-β-lactamase s......PhnP is a phosphodiesterase that plays an important role within the bacterial carbon-phosphorus lyase (CP-lyase) pathway by recycling a "dead-end" intermediate, 5-phospho-α-d-ribosyl 1,2-cyclic phosphate, that is formed during organophosphonate catabolism. As a member of the metallo...

  11. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  12. Cystathionine γ-lyase

    Directory of Open Access Journals (Sweden)

    Halina Jurkowska

    2014-01-01

    Full Text Available γ-Cystathionase (CTH, EC: 4.4.1.1, an enzyme widely distributed in the world of prokaryotic and eukaryotic organisms, catalyzes the formation and transformations of sulfane sulfur-containing compounds and plays a pivotal role in the L-cysteine desulfuration pathway. Human, tetrameric CTH is composed of two dimers and each monomer binds pyridoxal phosphate (PLP. The gene, located on the short arm of chromosome 1, consists of 13 exons and 12 introns. As a result of alternative splicing, three isoforms of human CTH arise. Analysis of genetic variations of the CTH encoding gene showed a large number of polymorphisms. A decrease of the expression of CTH entails a drop in the level of cysteine , glutathione (GSH, taurine and hydrogen sulfide (H2S in the cells and, more importantly, leads to cystathioninuria. H2S, endogenously formed by CTH, affects the vasodilation and regulation of blood pressure. CTH knockout mice have decreased levels of H2S, hypertension, and reduced capacity for vascular endothelium relaxation. Overexpression of the gene encoding CTH in the cells leads to increased production of H2S. H2S plays a role in protection of neurons against oxidative stress, and stimulates an increase in γ-glutamylcysteine synthetase and thereby an increase in the level of GSH. Sulfurtransferases, including CTH, can locally prevent oxidative stress due to reversible oxidation of – SH groups in the presence of increased levels of reactive oxygen species, and reduction in the presence of GSH and/or reduced thioredoxin.

  13. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  14. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  15. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  16. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  17. Prenatal diagnosis in adenylosuccinate lyase deficiency

    NARCIS (Netherlands)

    Marie, S.; Flipsen, J. W.; Duran, M.; Poll-The, B. T.; Beemer, F. A.; Bosschaart, A. N.; Vincent, M. F.; van den Berghe, G.

    2000-01-01

    Adenylosuccinate lyase deficiency, an autosomal recessive inborn error of purine synthesis, provokes accumulation in body fluids of succinylaminoimidazolecarboxamide riboside and succinyladenosine, the dephosphorylated derivatives of the two substrates of the enzyme. Most patients display severe

  18. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  19. Production and Purification of a Novel Xanthan Lyase from a Xanthan-Degrading Microbacterium sp. Strain XT11

    Directory of Open Access Journals (Sweden)

    Fan Yang

    2014-01-01

    Full Text Available A xanthan lyase was produced and purified from the culture supernatant of an excellent xanthan-modifying strain Microbacterium sp. XT11. Xanthan lyase was induced by xanthan but was inhibited by its structural monomer glucose. Its production by strain XT11 is much higher than that by all other reported strains. The purified xanthan lyase has a molecular mass of 110 kDa and a specific activity of 28.2 U/mg that was much higher than that of both Paenibacillus and Bacillus lyases. It was specific on the pyruvated mannosyl residue in the intact xanthan molecule, but about 50% lyase activity remained when xanthan was partially depyruvated. Xanthan lyase was optimally active at pH 6.0–6.5 and 40°C and alkali-tolerant at a high pH value of 11.0. The metal ions including K+, Ca2+, Na+, Mg2+, Mn2+, and Li+ strongly stimulated xanthan lyase activity but ions Zn2+ and Cu2+ were its inhibitor. Xanthan lyase should be a novel enzyme different from the other xanthan lyases ever reported.

  20. [The relationship between activity and gene expression of phenylalanine ammonia-lyase and peel pitting in 'Fengjie' navel orange fruits].

    Science.gov (United States)

    Li, Zheng-Guo; Gao, Xue; Fan, Jing; Yang, Ying-Wu; Li, Dao-Gao; Kanellis, Angelos K

    2006-06-01

    Citrus fruit is prone to develop peel pitting during development and storage, which greatly decreases its fresh market value because of the deterioration of the peel. In the present study, we have examined the effect of different temperatures (15 degrees C and 4 degrees C), waxing and mechanical damage on the changes in the activity of phenylalanine ammonia-lyase (PAL) and the incidence of peel pitting in 'Fengjie' navel orange (Citrus sinensis Osbeck) fruits. The expression levels of PAL2, PAL6 genes in the peel during the development of peel pitting have been investigated through semi-quantitative PCR method. The incidence of peel pitting was greatly enhanced by waxing and mechanical damage and was decreased in lower temperature storage (4 degrees C) (Fig.1). Waxing and mechanical damage might be the important factors inducing peel pitting and suitable low temperature could decrease the incidence of this disease. The PAL activity increased during the whole storage period in accordance with the development of this pitting (Fig.2). The expression levels of PAL2 and PAL6 genes in damaged peel were higher than those in healthy peel and the expression of PAL2 is much more higher than that of PAL6 (Figs.4 and 5). The results suggested that the enzyme activity of PAL, along with the expression of PAL2 gene is highly related to this peel pitting occurred on 'Fengjie' navel orange fruits.

  1. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  2. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  3. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  4. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  5. Utilization of Aspergillus oryzae to produce pectin lyase from various agro-industrial residues

    OpenAIRE

    Koser, Safia; Anwar, Zahid; Iqbal, Zafar; Anjum, Awais; Aqil, Tahir; Mehmood, Sajid; Irshad, Muhammad

    2014-01-01

    The present study was aimed to investigate the culture influence on pectin lyase production potential of fungal strain Aspergillus oryzae. The enzyme profile of A. oryzae showed highest activity of pectin lyase after 3rd day of incubation on lemon peel waste under solid state fermentation conditions. To induce the pectin lyase synthesis capability of A. oryzae at optimal level various culture variables including physical and nutritional parameters were optimized by adopting classical optimiza...

  6. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  7. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  8. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  9. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  10. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  11. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  12. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  13. Crystallization and preliminary X-ray analysis of βC–S lyases from two oral streptococci

    International Nuclear Information System (INIS)

    Kezuka, Yuichiro; Yoshida, Yasuo; Nonaka, Takamasa

    2009-01-01

    The βC-S lyases from two oral bacteria, Streptococcus anginosus and S. gordonii, were cloned, overproduced, purified and crystallized. The obtained crystals were characterized by X-ray diffraction. Hydrogen sulfide, which causes oral malodour, is generally produced from l-cysteine by the action of βC–S lyase from oral bacteria. The βC–S lyases from two oral bacteria, Streptococcus anginosus and S. gordonii, have been cloned, overproduced, purified and crystallized. X-ray diffraction data were collected from the two types of crystals using synchrotron radiation. The crystal of S. anginosus βC–S lyase belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 67.0, b = 111.1, c = 216.4 Å, and the crystal of S. gordonii βC–S lyase belonged to the same space group, with unit-cell parameters a = 58.0, b = 73.9. c = 187.6 Å. The structures of the βC–S lyases were solved by molecular-replacement techniques

  14. Requirement of argininosuccinate lyase for systemic nitric oxide production.

    Science.gov (United States)

    Erez, Ayelet; Nagamani, Sandesh C S; Shchelochkov, Oleg A; Premkumar, Muralidhar H; Campeau, Philippe M; Chen, Yuqing; Garg, Harsha K; Li, Li; Mian, Asad; Bertin, Terry K; Black, Jennifer O; Zeng, Heng; Tang, Yaoping; Reddy, Anilkumar K; Summar, Marshall; O'Brien, William E; Harrison, David G; Mitch, William E; Marini, Juan C; Aschner, Judy L; Bryan, Nathan S; Lee, Brendan

    2011-11-13

    Nitric oxide (NO) is crucial in diverse physiological and pathological processes. We show that a hypomorphic mouse model of argininosuccinate lyase (encoded by Asl) deficiency has a distinct phenotype of multiorgan dysfunction and NO deficiency. Loss of Asl in both humans and mice leads to reduced NO synthesis, owing to both decreased endogenous arginine synthesis and an impaired ability to use extracellular arginine for NO production. Administration of nitrite, which can be converted into NO in vivo, rescued the manifestations of NO deficiency in hypomorphic Asl mice, and a nitric oxide synthase (NOS)-independent NO donor restored NO-dependent vascular reactivity in humans with ASL deficiency. Mechanistic studies showed that ASL has a structural function in addition to its catalytic activity, by which it contributes to the formation of a multiprotein complex required for NO production. Our data demonstrate a previously unappreciated role for ASL in NOS function and NO homeostasis. Hence, ASL may serve as a target for manipulating NO production in experimental models, as well as for the treatment of NO-related diseases.

  15. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Isolation and characterization of an Antarctic Flavobacterium strain with agarase and alginate lyase activities

    Directory of Open Access Journals (Sweden)

    Lavín Paris

    2016-09-01

    Full Text Available Several bacteria that are associated with macroalgae can use phycocolloids as a carbon source. Strain INACH002, isolated from decomposing Porphyra (Rhodophyta, in King George Island, Antarctica, was screened and characterized for the ability to produce agarase and alginate-lyase enzymatic activities. Our strain INACH002 was identified as a member of the genus Flavobacterium, closely related to Flavobacterium faecale, using 16S rRNA gene analysis. The INACH002 strain was characterized as psychrotrophic due to its optimal temperature (17ºC and maximum temperature (20°C of growth. Agarase and alginate-lyase displayed enzymatic activities within a range of 10°C to 50°C, with differences in the optimal temperature to hydrolyze agar (50°C, agarose (50°C and alginate (30°C during the first 30 min of activity. Strain Flavobacterium INACH002 is a promising Antarctic biotechnological resource; however, further research is required to illustrate the structural and functional bases of the enzymatic performance observed during the degradation of different substrates at different temperatures.

  17. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  18. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  19. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  20. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  1. Reduced phenylalanine ammonia-lyase and tyrosine ammonia-lyase activities and lignin synthesis in wheat grown under low pressure sodium lamps

    Science.gov (United States)

    Guerra, D.; Anderson, A. J.; Salisbury, F. B.

    1985-01-01

    Wheat (Triticum aestivum L. cv Fremont) grown in hydroponic culture under 24-hour continuous irradiation at 560 to 580 micromoles per square meter per second from either metalhalide (MH), high pressure sodium (HPS), or low pressure sodium (LPS) lamps reached maturity in 70 days. Grain yields were similar under all three lamps, although LPS-grown plants lodged at maturity. Phenylalanine ammonia-lyase (PAL) and a tyrosine ammonia lyase (TAL) with lesser activity were detected in all extracts of leaf, inflorescence, and stem. Ammonia-lyase activities increased with age of the plant, and plants grown under the LPS lamp displayed PAL and TAL activities lower than wheat cultured under MH and HPS radiation. Greenhouse solar-grown wheat had the highest PAL and TAL activities. Lignin content of LPS-grown wheat was also significantly reduced from that of plants grown under MH or HPS lamps or in the greenhouse, showing a correlation with the reduced PAL and TAL activities. Ratios of far red-absorbing phytochrome to total phytochrome were similar for all three lamps, but the data do not yet warrant a conclusion about specific wavelengths missing from the LPS lamps that might have induced PAL and TAL activities in plants under the other lamps.

  2. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  3. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  4. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  5. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  6. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  7. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  8. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  9. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  10. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  11. Chondroitin Sulfate (CS) Lyases: Structure, Function and Application in Therapeutics.

    Science.gov (United States)

    Rani, Aruna; Patel, Seema; Goyal, Arun

    2018-01-01

    Glycosaminoglycans (GAGs) such as chondroitin sulfate (CS) are the chief natural polysaccharides which reside in biological tissues mainly in extracellular matrix. These CS along with adhesion molecules and growth factors are involved in central nervous system (CNS) development, cell progression and pathogenesis. The chondroitin lyases are the enzyme that degrade and alter the CS chains and hence modify various signalling pathways involving CS chains. These CS lyases are substrate specific, can precisely manipulate the CS polysaccharides and have various biotechnological, medical and therapeutic applications. These enzymes can be used to produce the unsaturated oligosaccharides, which have immune-modulatory, anti-inflammatory and neuroprotective properties. This review focuses on the major breakthrough of the chondroitin sulfate degrading enzymes, their structures and functioning mechanism. This also provides comprehensive information regarding production, purification, characterization of CS lyases and their major applications, both established as well as emerging ones such as neural development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. Bacteriophage SP6 encodes a second tailspike protein that recognizes Salmonella enterica serogroups C2 and C3

    International Nuclear Information System (INIS)

    Gebhart, Dana; Williams, Steven R.; Scholl, Dean

    2017-01-01

    SP6 is a salmonella phage closely related to coliphage K1-5. K1-5 is notable in that it encodes two polysaccharide-degrading tailspike proteins, an endosialidase that allows it to infect E. coli K1, and a lyase that enables it to infect K5 strains. SP6 is similar to K1-5 except that it encodes a P22-like endorhamnosidase tailspike, gp46, allowing it to infect group B Salmonella. We show here that SP6 can also infect Salmonella serogroups C 2 and C 3 and that a mutation in a putative second tailspike, gp47, eliminates this specificity. Gene 47 was fused to the coding region of the N-terminal portion of the Pseudomonas aeruginosa R2 pyocin tail fiber and expressed in trans such that the fusion protein becomes incorporated into pyocin particles. These pyocins, termed AvR2-SP47, killed serogroups C 2 and C 3 Salmonella. We conclude that SP6 encodes two tail proteins providing it a broad host range among Salmonella enterica. - Highlights: • SP6 is a “dual specificity” bacteriophage that encodes two different receptor binding proteins giving it a broad host range. • These receptor binding proteins can be used to re-target the spectrum of R-type bacteriocins to Salmonella enterica. • Both SP6 and the engineered R-type bacteriocins can kill the Salmonella serovars most associated with human disease making them attractive for development as antimicrobial agents.

  13. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  14. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  15. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  16. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  17. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  18. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  19. Epigenetic regulation of pro-inflammatory cytokine secretion by sphingosine 1-phosphate (S1P) in acute lung injury: Role of S1P lyase.

    Science.gov (United States)

    Ebenezer, David L; Fu, Panfeng; Suryadevara, Vidyani; Zhao, Yutong; Natarajan, Viswanathan

    2017-01-01

    Cellular level of sphingosine-1-phosphate (S1P), the simplest bioactive sphingolipid, is tightly regulated by its synthesis catalyzed by sphingosine kinases (SphKs) 1 & 2 and degradation mediated by S1P phosphatases, lipid phosphate phosphatases, and S1P lyase. The pleotropic actions of S1P are attributed to its unique inside-out (extracellular) signaling via G-protein-coupled S1P1-5 receptors, and intracellular receptor independent signaling. Additionally, S1P generated in the nucleus by nuclear SphK2 modulates HDAC1/2 activity, regulates histone acetylation, and transcription of pro-inflammatory genes. Here, we present data on the role of S1P lyase mediated S1P signaling in regulating LPS-induced inflammation in lung endothelium. Blocking S1P lyase expression or activity attenuated LPS-induced histone acetylation and secretion of pro-inflammatory cytokines. Degradation of S1P by S1P lyase generates Δ2-hexadecenal and ethanolamine phosphate and the long-chain fatty aldehyde produced in the cytoplasmic compartment of the endothelial cell seems to modulate histone acetylation pattern, which is different from the nuclear SphK2/S1P signaling and inhibition of HDAC1/2. These in vitro studies suggest that S1P derived long-chain fatty aldehyde may be an epigenetic regulator of pro-inflammatory genes in sepsis-induced lung inflammation. Trapping fatty aldehydes and other short chain aldehydes such as 4-hydroxynonenal derived from S1P degradation and lipid peroxidation, respectively by cell permeable agents such as phloretin or other aldehyde trapping agents may be useful in treating sepsis-induced lung inflammation via modulation of histone acetylation. . Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  1. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  2. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  3. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  4. Characterization of a Novel Alginate Lyase from Marine Bacterium Vibrio furnissii H1

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhu

    2018-01-01

    Full Text Available Alginate lyases show great potential for industrial and medicinal applications, especially as an attractive biocatalyst for the production of oligosaccharides with special bioactivities. A novel alginate lyase, AlyH1, from the marine bacterium Vibrio furnissii H1, which has been newly isolated from rotten seaweed, was purified and characterized. The purified enzyme showed the specific activity of 2.40 U/mg. Its molecular mass was 35.8 kDa. The optimal temperature and pH were 40 °C and pH 7.5, respectively. AlyH1 maintained stability at neutral pH (7.0–8.0 and temperatures below 30 °C. Metal ions Na+, Mg2+, and K+ increased the activity of the enzyme. With sodium alginate as the substrate, the Km and Vmax values of AlyH1 were 2.28 mg/mL and 2.81 U/mg, respectively. AlyH1 exhibited activities towards both polyguluronate and polymannuronate, and preferentially degraded polyguluronate. Products prepared from sodium alginate by AlyH1 were displayed to be di-, tri-, and tetra-alginate oligosaccharides. A partial amino acid sequence (190 aa of AlyH1 analysis suggested that AlyH1 was an alginate lyase of polysaccharide lyase family 7. The sequence showed less than 77% identity to the reported alginate lyases. These data demonstrated that AlyH1 could be as a novel and potential candidate in application of alginate oligosaccharides production with low polymerization degrees.

  5. Quantitation of heparosan with heparin lyase III and spectrophotometry.

    Science.gov (United States)

    Huang, Haichan; Zhao, Yingying; Lv, Shencong; Zhong, Weihong; Zhang, Fuming; Linhardt, Robert J

    2014-02-15

    Heparosan is Escherichia coli K5 capsule polysaccharide, which is the key precursor for preparing bioengineered heparin. A rapid and effective quantitative method for detecting heparosan is important in the large-scale production of heparosan. Heparin lyase III (Hep III) effectively catalyzes the heparosan depolymerization, forming unsaturated disaccharides that are measurable using a spectrophotometer at 232 nm. We report a new method for the quantitative detection of heparosan with heparin lyase III and spectrophotometry that is safer and more specific than the traditional carbazole assay. In an optimized detection system, heparosan at a minimum concentration of 0.60 g/L in fermentation broth can be detected. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  8. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  9. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  10. Catalytically important amino-acid residues of abalone alginate lyase HdAly assessed by site-directed mutagenesis

    OpenAIRE

    Yamamoto, Sayo; Sahara, Takehiko; Sato, Daisuke; Kawasaki, Kosei; Ohgiya, Satoru; Inoue, Akira; Ojima, Takao

    2008-01-01

    Alginate lyase is an enzyme that degrades alginate chains via β-elimination and has been used for the production of alginate oligosaccharides and protoplasts from brown algae. Previously, we deduced the amino-acid sequence of an abalone alginate lyase, HdAly, from its cDNA sequence and, through multiple amino-acid sequence alignment, found that several basic amino-acid residues were highly conserved among the polysaccharide-lyase family 14 (PL-14) enzymes including HdAly. In the present study...

  11. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  12. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  13. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  14. Design of thermostable rhamnogalacturonan lyase mutants from Bacillus licheniformis by combination of targeted single point mutations

    DEFF Research Database (Denmark)

    da Silva, Ines Isabel Cardoso Rodrigues; Jers, Carsten; Otten, Harm

    2014-01-01

    Rhamnogalacturonan I lyases (RGI lyases) (EC 4.2.2.-) catalyze cleavage of α-1,4 bonds between rhamnose and galacturonic acid in the backbone of pectins by β-elimination. In the present study, targeted improvement of the thermostability of a PL family 11 RGI lyase from Bacillus licheniformis (DSM......, were obtained due to additive stabilizing effects of single amino acid mutations (E434L, G55V, and G326E) compared to the wild type. The crystal structure of the B. licheniformis wild-type RGI lyase was also determined; the structural analysis corroborated that especially mutation of charged amino...

  15. Adenylosuccinate lyase (ADSL) and infantile autism: Absence of previously reported point mutation

    Energy Technology Data Exchange (ETDEWEB)

    Fon, E.A.; Sarrazin, J.; Rouleau, G.A. [Montreal General Hospital (Canada)] [and others

    1995-12-18

    Autism is a heterogeneous neuropsychiatric syndrome of unknown etiology. There is evidence that a deficiency in the enzyme adenylosuccinate lyase (ADSL), essential for de novo purine biosynthesis, could be involved in the pathogenesis of certain cases. A point mutation in the ADSL gene, resulting in a predicted serine-to-proline substitution and conferring structural instability to the mutant enzyme, has been reported previously in 3 affected siblings. In order to determine the prevalence of the mutation, we PCR-amplified the exon spanning the site of this mutation from the genomic DNA of patients fulfilling DSM-III-R criteria for autistic disorder. None of the 119 patients tested were found to have this mutation. Furthermore, on preliminary screening using single-strand conformation polymorphism (SSCP), no novel mutations were detected in the coding sequence of four ADSL exons, spanning approximately 50% of the cDNA. In light of these findings, it appears that mutations in the ADSL gene represent a distinctly uncommon cause of autism. 12 refs., 2 figs.

  16. A radiometric technique for the measurement of adenylosuccinate lyase

    International Nuclear Information System (INIS)

    Park, K.W.; Tyagi, A.K.; Cooney, D.A.

    1980-01-01

    When radioactive adenylosuccinic acid (AMP-S) is metabolized to AMP and fumaric acid by the enzyme adenylosuccinate lyase (EC 4.3.2.2), a proton is released to the solvent as 3 H 2 O. This removal is believed to be stereospecifically identical to that catalyzed by the enzyme, L-aspartase, and therefore entails the loss of a proton from C-3 of the dicarboxylic acid moiety of the nucleotide. Advantage has been taken of this fact in the design of a facile assay for this enzyme. The assay permits the simultaneous estimation of the lyase activity in a large battery of samples; it is not interfered with by opalescent or proteinaceous suspensions; it is accurate and outstandingly sensitive. (Auth.)

  17. Alfalfa contains substantial 9-hydroperoxide lyase activity and a 3Z:2E-enal isomerase

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Noordermeer, M.A.; Veldink, G.A.

    1999-01-01

    Fatty acid hydroperoxides formed by lipoxygenase can be cleaved by hydroperoxide lyase resulting in the formation of short-chain aldehydes and omega-oxo acids. Plant hydroperoxide lyases use 13- or 9-hydroperoxy linoleic and linolenic acid as substrates. Alfalfa (Medicago sativa L.) has been

  18. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  19. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  20. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  1. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  2. Biochemical Validation of the Glyoxylate Cycle in the Cyanobacterium Chlorogloeopsis fritschii Strain PCC 9212.

    Science.gov (United States)

    Zhang, Shuyi; Bryant, Donald A

    2015-05-29

    Cyanobacteria are important photoautotrophic bacteria with extensive but variable metabolic capacities. The existence of the glyoxylate cycle, a variant of the TCA cycle, is still poorly documented in cyanobacteria. Previous studies reported the activities of isocitrate lyase and malate synthase, the key enzymes of the glyoxylate cycle in some cyanobacteria, but other studies concluded that these enzymes are missing. In this study the genes encoding isocitrate lyase and malate synthase from Chlorogloeopsis fritschii PCC 9212 were identified, and the recombinant enzymes were biochemically characterized. Consistent with the presence of the enzymes of the glyoxylate cycle, C. fritschii could assimilate acetate under both light and dark growth conditions. Transcript abundances for isocitrate lyase and malate synthase increased, and C. fritschii grew faster, when the growth medium was supplemented with acetate. Adding acetate to the growth medium also increased the yield of poly-3-hydroxybutyrate. When the genes encoding isocitrate lyase and malate synthase were expressed in Synechococcus sp. PCC 7002, the acetate assimilation capacity of the resulting strain was greater than that of wild type. Database searches showed that the genes for the glyoxylate cycle exist in only a few other cyanobacteria, all of which are able to fix nitrogen. This study demonstrates that the glyoxylate cycle exists in a few cyanobacteria, and that this pathway plays an important role in the assimilation of acetate for growth in one of those organisms. The glyoxylate cycle might play a role in coordinating carbon and nitrogen metabolism under conditions of nitrogen fixation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  4. Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

    NARCIS (Netherlands)

    Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

    2017-01-01

    BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

  5. A comparative transcriptome analysis of a wild purple potato and its red mutant provides insight into the mechanism of anthocyanin transformation.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available In this study, a red mutant was obtained through in vitro regeneration of a wild purple potato. High-performance liquid chromatography and Mass spectrometry analysis revealed that pelargonidin-3-O-glucoside and petunidin-3-O-glucoside were main anthocyanins in the mutant and wild type tubers, respectively. In order to thoroughly understand the mechanism of anthocyanin transformation in two materials, a comparative transcriptome analysis of the mutant and wild type was carried out through high-throughput RNA sequencing, and 295 differentially expressed genes (DEGs were obtained. Real-time qRT-PCR validation of DEGs was consistent with the transcriptome date. The DEGs mainly influenced biological and metabolic pathways, including phenylpropanoid biosynthesis and translation, and biosynthesis of flavone and flavonol. In anthocyanin biosynthetic pathway, the analysis of structural genes expressions showed that three genes, one encoding phenylalanine ammonia-lyase, one encoding 4-coumarate-CoA ligase and one encoding flavonoid 3',5'-hydroxylasem were significantly down-regulated in the mutant; one gene encoding phenylalanine ammonia-lyase was significantly up-regulated. Moreover, the transcription factors, such as bZIP family, MYB family, LOB family, MADS family, zf-HD family and C2H2 family, were significantly regulated in anthocyanin transformation. Response proteins of hormone, such as gibberellin, abscisic acid and brassinosteroid, were also significantly regulated in anthocyanin transformation. The information contributes to discovering the candidate genes in anthocyanin transformation, which can serve as a comprehensive resource for molecular mechanism research of anthocyanin transformation in potatoes.

  6. Lactic acid bacteria involved in cocoa beans fermentation from Ivory Coast: Species diversity and citrate lyase production.

    Science.gov (United States)

    Ouattara, Hadja D; Ouattara, Honoré G; Droux, Michel; Reverchon, Sylvie; Nasser, William; Niamke, Sébastien L

    2017-09-01

    Microbial fermentation is an indispensable process for high quality chocolate from cocoa bean raw material. lactic acid bacteria (LAB) are among the major microorganisms responsible for cocoa fermentation but their exact role remains to be elucidated. In this study, we analyzed the diversity of LAB in six cocoa producing regions of Ivory Coast. Ribosomal 16S gene sequence analysis showed that Lactobacillus plantarum and Leuconostoc mesenteroides are the dominant LAB species in these six regions. In addition, other species were identified as the minor microbial population, namely Lactobacillus curieae, Enterococcus faecium, Fructobacillus pseudoficulneus, Lactobacillus casei, Weissella paramesenteroides and Weissella cibaria. However, in each region, the LAB microbial population was composed of a restricted number of species (maximum 5 species), which varied between the different regions. LAB implication in the breakdown of citric acid was investigated as a fundamental property for a successful cocoa fermentation process. High citrate lyase producer strains were characterized by rapid citric acid consumption, as revealed by a 4-fold decrease in citric acid concentration in the growth medium within 12h, concomitant with an increase in acetic acid and lactic acid concentration. The production of citrate lyase was strongly dependent on environmental conditions, with optimum production at acidic pH (pHfermentation. This study reveals that one of the major roles of LAB in the cocoa fermentation process involves the breakdown of citric acid during the early stage of cocoa fermentation through the activity of citrate lyase. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  8. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  9. Hematopoietic Sphingosine 1-Phosphate Lyase Deficiency Decreases Atherosclerotic Lesion Development in LDL-Receptor Deficient Mice

    NARCIS (Netherlands)

    Bot, Martine; Van Veldhoven, Paul P.; de Jager, Saskia C. A.; Johnson, Jason; Nijstad, Niels; Van Santbrink, Peter J.; Westra, Marijke M.; Van Der Hoeven, Gerd; Gijbels, Marion J.; Mueller-Tidow, Carsten; Varga, Georg; Tietge, Uwe J. F.; Kuiper, Johan; Van Berkel, Theo J. C.; Nofer, Jerzy-Roch; Bot, Ilze; Biessen, Erik A. L.

    2013-01-01

    Aims: Altered sphingosine 1-phosphate (S1P) homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1(-/-)) deficiency on leukocyte subsets

  10. Hematopoietic sphingosine 1-phosphate lyase deficiency decreases atherosclerotic lesion development in LDL-receptor deficient mice

    NARCIS (Netherlands)

    Bot, Martine; van Veldhoven, Paul P.; de Jager, Saskia C. A.; Johnson, Jason; Nijstad, Niels; van Santbrink, Peter J.; Westra, Marijke M.; van der Hoeven, Gerd; Gijbels, Marion J.; Müller-Tidow, Carsten; Varga, Georg; Tietge, Uwe J. F.; Kuiper, Johan; van Berkel, Theo J. C.; Nofer, Jerzy-Roch; Bot, Ilze; Biessen, Erik A. L.

    2013-01-01

    Altered sphingosine 1-phosphate (S1P) homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1(-/-)) deficiency on leukocyte subsets relevant to

  11. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  12. Hematopoietic Sphingosine 1-Phosphate Lyase Deficiency Decreases Atherosclerotic Lesion Development in LDL-Receptor Deficient Mice

    NARCIS (Netherlands)

    Bot, M.; Veldhoven, van P.P.; Jager, de S.C.; Johnson, J.; Nijstad, N.; van, Santbrink P.J.; Westra, M.M.; Hoeven, van der G.; Gijbels, M.J.; Muller-Tidow, C.; Varga, G.; Tietge, U.J.; Kuiper, J.; Berkel, van T.J.; Nofer, J.R.; Bot, I.; Biessen, E.A.

    2013-01-01

    Abstract Aims Altered sphingosine 1-phosphate (S1P) homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1−/−) deficiency on leukocyte

  13. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  14. Bacteriophage SP6 encodes a second tailspike protein that recognizes Salmonella enterica serogroups C{sub 2} and C{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Gebhart, Dana; Williams, Steven R.; Scholl, Dean, E-mail: dean@avidbiotics.com

    2017-07-15

    SP6 is a salmonella phage closely related to coliphage K1-5. K1-5 is notable in that it encodes two polysaccharide-degrading tailspike proteins, an endosialidase that allows it to infect E. coli K1, and a lyase that enables it to infect K5 strains. SP6 is similar to K1-5 except that it encodes a P22-like endorhamnosidase tailspike, gp46, allowing it to infect group B Salmonella. We show here that SP6 can also infect Salmonella serogroups C{sub 2} and C{sub 3} and that a mutation in a putative second tailspike, gp47, eliminates this specificity. Gene 47 was fused to the coding region of the N-terminal portion of the Pseudomonas aeruginosa R2 pyocin tail fiber and expressed in trans such that the fusion protein becomes incorporated into pyocin particles. These pyocins, termed AvR2-SP47, killed serogroups C{sub 2} and C{sub 3}Salmonella. We conclude that SP6 encodes two tail proteins providing it a broad host range among Salmonella enterica. - Highlights: • SP6 is a “dual specificity” bacteriophage that encodes two different receptor binding proteins giving it a broad host range. • These receptor binding proteins can be used to re-target the spectrum of R-type bacteriocins to Salmonella enterica. • Both SP6 and the engineered R-type bacteriocins can kill the Salmonella serovars most associated with human disease making them attractive for development as antimicrobial agents.

  15. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  16. Regulation of two loblolly pine (Pinus taeda L.) isocitrate lyase genes in megagametophytes of mature and stratified seeds and during postgerminative growth.

    Science.gov (United States)

    Mullen, R T; Gifford, D J

    1997-03-01

    Two full-length cDNAs encoding the glyoxysomal enzyme isocitrate lyase (ICL) were isolated from a lambda ZAP cDNA library prepared from megagametophyte mRNAs extracted from seeds imbibed at 30 degrees C for 8 days. The cDNAs, designated Ptbs ICL 8 and Ptbs ICL 12, have open reading frames of 1740 and 1719 bp, with deduced amino acid sequences of 580 and 573 residues, respectively. The predicted amino acid sequences of Ptbs ICL 8 and Ptbs ICL 12 exhibit a 79% identity with each other, and have a greater than 75% identity with ICLs from various angiosperm species. The C-termini of Ptbs ICL 8 and Ptbs ICL 12 terminate with the tripeptide Ser-Arg-Met and Ala-Arg-Met, respectively, both being conserved variants of the type 1 peroxisomal targeting signal. RNA blot and slot analysis revealed that Ptbs ICL 8 and Ptbs ICL 12 mRNAs were present at low levels in the megagametophyte of the mature and stratified seeds, and that the level of both transcripts increased markedly upon seed germination. Protein blot analysis indicated that the steady-state level of ICL was low in the mature and stratified seed, then increased rapidly upon seed germination, peaking at around 8-10 days after imbibition (DAI). Changes in the level of ICL activity in cell-free extracts was similar to the steady-state protein content with the exception that ICL activity was not detected in megagametophyte extracts of mature or stratified seeds. From 10-12 DAI when the megagametophyte tissue senesced, ICL activity decreased rapidly to near undetectable levels. In contrast, steady-state levels of ICL protein and mRNA remained relatively constant during megagametophyte senescence. In vivo synthesis of ICL protein was measured to shed light on these differences. ICL immunoselected from [(35)S]-methionine labelled proteins indicated that ICL was synthesized at very low levels during megagametophyte senescence. Together, the results show that loblolly pine ICL gene expression is complex. While temporal

  17. Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae.

    Science.gov (United States)

    Shahbaaz, Mohd; Ahmad, Faizan; Imtaiyaz Hassan, Md

    2015-06-01

    Haemophilus influenzae is a small pleomorphic Gram-negative bacteria which causes several chronic diseases, including bacteremia, meningitis, cellulitis, epiglottitis, septic arthritis, pneumonia, and empyema. Here we extensively analyzed the sequenced genome of H. influenzae strain Rd KW20 using protein family databases, protein structure prediction, pathways and genome context methods to assign a precise function to proteins whose functions are unknown. These proteins are termed as hypothetical proteins (HPs), for which no experimental information is available. Function prediction of these proteins would surely be supportive to precisely understand the biochemical pathways and mechanism of pathogenesis of Haemophilus influenzae. During the extensive analysis of H. influenzae genome, we found the presence of eight HPs showing lyase activity. Subsequently, we modeled and analyzed three-dimensional structure of all these HPs to determine their functions more precisely. We found these HPs possess cystathionine-β-synthase, cyclase, carboxymuconolactone decarboxylase, pseudouridine synthase A and C, D-tagatose-1,6-bisphosphate aldolase and aminodeoxychorismate lyase-like features, indicating their corresponding functions in the H. influenzae. Lyases are actively involved in the regulation of biosynthesis of various hormones, metabolic pathways, signal transduction, and DNA repair. Lyases are also considered as a key player for various biological processes. These enzymes are critically essential for the survival and pathogenesis of H. influenzae and, therefore, these enzymes may be considered as a potential target for structure-based rational drug design. Our structure-function relationship analysis will be useful to search and design potential lead molecules based on the structure of these lyases, for drug design and discovery.

  18. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  19. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  20. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  1. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  2. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  3. Developmental role of phenylalanine-ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) genes during adventitious rooting of Juglans regia L. microshoots.

    Science.gov (United States)

    Cheniany, Monireh; Ganjeali, Ali

    2016-12-01

    Phenylalanine-ammonia-lyase and cinnamate-4-hydroxylase play important role in the phenylpropanoid pathway, which produces many biologically important secondary metabolites participating in normal plant development. Flavonol quercetin is the main representant of these compounds that has been identified in numerous Juglans spp. In this survey, the developmental expression patterns of PAL and C4H genes during in vitro rooting of two walnut cultivars 'Sunland' and 'Howard' was examined by RT-PCR. To understand the potential role in rooting, the changing pattern of endogenous content of quercetin was also analyzed by HPLC. The 'Sunland' with better capacity to root had more quercetin content during the "inductive phase" of rooting than 'Howard'. In each cultivar, the level of PAL transcripts showed the same behavior with the changing patterns of quercetin during root formation of microshoots. The positive correlation between the changes of quercetin and PAL-mRNA indicated that PAL gene may have an immediate effect on flavonoid pathway metabolites including quercetin. Although the behavioral change of C4H expression was similar in both cultivars during root formation (with significantly more level for 'Howard'), it was not coincide with the changes of quercerin concentrations. Our results showed that C4H function is important for the normal development, but its transcriptional regulation does not correlate with quercetin as an efficient phenolic compound for walnut rhizogenesis.

  4. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  5. Ammonia lyases and aminomutases as biocatalysts for the synthesis of α-amino and β-amino acids.

    Science.gov (United States)

    Turner, Nicholas J

    2011-04-01

    Ammonia lyases catalyse the reversible addition of ammonia to cinnamic acid (1: R=H) and p-hydroxycinnamic (1: R=OH) to generate L-phenylalanine (2: R=H) and L-tyrosine (2: R=OH) respectively (Figure 1a). Both phenylalanine ammonia lyase (PAL) and tyrosine ammonia lyase (TAL) are widely distributed in plants, fungi and prokaryotes. Recently there has been interest in the use of these enzymes for the synthesis of a broader range of L-arylalanines. Aminomutases catalyse a related reaction, namely the interconversion of α-amino acids to β-amino acids (Figure 1b). In the case of L-phenylalanine, this reaction is catalysed by phenylalanine aminomutase (PAM) and proceeds stereospecifically via the intermediate cinnamic acid to generate β-Phe 3. Ammonia lyases and aminomutases are related in sequence and structure and share the same active site cofactor 4-methylideneimidazole-5-one (MIO). There is currently interest in the possibility of using these biocatalysts to prepare a wide range of enantiomerically pure l-configured α-amino and β-amino acids. Recent reviews have focused on the mechanism of these MIO containing enzymes. The aim of this review is to review recent progress in the application of ammonia lyase and aminomutase enzymes to prepare enantiomerically pure α-amino and β-amino acids. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  7. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  8. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  9. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  10. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  11. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  12. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  13. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  14. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  15. A fast and quantitative evaluation of the Aspergillus fumigatus biofilm adhesion properties by means of digital pulsed force mode

    International Nuclear Information System (INIS)

    Maiorana, Alessandro; Papi, Massimiliano; Bugli, Francesca; Torelli, Riccardo; Maulucci, Giuseppe; Cacaci, Margherita; Posteraro, Brunella; Sanguinetti, Maurizio; De Spirito, Marco

    2013-01-01

    The opportunistic pathogenic mould Aspergillus fumigatus (A. fumigatus) is an increasing cause of morbidity and mortality in immunocompromised and in part immunocompetent patients. A. fumigatus can grow in multicellular communities by the formation of a hyphal network embedded in an extracellular matrix (ECM) meanly composed by polysaccharides, melanin, proteins. Because adhesion properties is one primary factor affecting the balance between growth, detachment and biofilm formation, its quantification is essential in understanding, predicting, and modelling biofilm development. Atomic force microscopy (AFM) imaging and force spectroscopy have recently opened a range of novel applications in microbiology including the imaging and manipulation of membrane proteins at the subnanometer level, the observation of the surface of living cells at high resolution, the mapping of local properties such as surface charges, the measurement of elastic properties of cell-surface constituents and the probing of cellular interactions using functionalized probes. Nevertheless, the principal disadvantage of this approach is the relatively slow acquisition rate that makes AFM is not able to detect fast dynamics. In this study we demonstrated that digital pulsed force mode (DPFM) atomic force microscopy can be used to obtain high-resolution topographical images and to quantify the adhesion properties of the A. fumigatus biofilm with an high acquisition rate. Here we show by means of DPFM-AFM that Alginate Lyase (AlgL), an enzyme known to reduce negatively charged alginate levels in microbial biofilm, is able to reduce the biofilm adhesion forces forming several nano-fractures in the ECM. These results suggest that the AlgL could used to enhance the antifungal drugs transit through the ECM.

  16. A fast and quantitative evaluation of the Aspergillus fumigatus biofilm adhesion properties by means of digital pulsed force mode

    Energy Technology Data Exchange (ETDEWEB)

    Maiorana, Alessandro [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Papi, Massimiliano, E-mail: m.papi@rm.unicatt.it [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Bugli, Francesca; Torelli, Riccardo [Istituto di Microbiologia, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Maulucci, Giuseppe [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Cacaci, Margherita; Posteraro, Brunella; Sanguinetti, Maurizio [Istituto di Microbiologia, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); De Spirito, Marco [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy)

    2013-08-15

    The opportunistic pathogenic mould Aspergillus fumigatus (A. fumigatus) is an increasing cause of morbidity and mortality in immunocompromised and in part immunocompetent patients. A. fumigatus can grow in multicellular communities by the formation of a hyphal network embedded in an extracellular matrix (ECM) meanly composed by polysaccharides, melanin, proteins. Because adhesion properties is one primary factor affecting the balance between growth, detachment and biofilm formation, its quantification is essential in understanding, predicting, and modelling biofilm development. Atomic force microscopy (AFM) imaging and force spectroscopy have recently opened a range of novel applications in microbiology including the imaging and manipulation of membrane proteins at the subnanometer level, the observation of the surface of living cells at high resolution, the mapping of local properties such as surface charges, the measurement of elastic properties of cell-surface constituents and the probing of cellular interactions using functionalized probes. Nevertheless, the principal disadvantage of this approach is the relatively slow acquisition rate that makes AFM is not able to detect fast dynamics. In this study we demonstrated that digital pulsed force mode (DPFM) atomic force microscopy can be used to obtain high-resolution topographical images and to quantify the adhesion properties of the A. fumigatus biofilm with an high acquisition rate. Here we show by means of DPFM-AFM that Alginate Lyase (AlgL), an enzyme known to reduce negatively charged alginate levels in microbial biofilm, is able to reduce the biofilm adhesion forces forming several nano-fractures in the ECM. These results suggest that the AlgL could used to enhance the antifungal drugs transit through the ECM.

  17. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  18. PECTATE LYASE-LIKE 9 from Brassica campestris is associated with intine formation.

    Science.gov (United States)

    Jiang, Jingjing; Yao, Lina; Yu, Youjian; Liang, Ying; Jiang, Jianxia; Ye, Nenghui; Miao, Ying; Cao, Jiashu

    2014-12-01

    Brassica campestris pectate lyase-like 9 (BcPLL9) was previously identified as a differentially expressed gene both in buds during late pollen developmental stage and in pistils during fertilization in Chinese cabbage. To characterize the gene's function, antisense-RNA lines of BcPLL9 (bcpll9) were constructed in Chinese cabbage. Self- and cross-fertilization experiments harvested half seed yields when bcpll9 lines were used as pollen donors. In vivo and in vitro pollen germination assays showed that nearly half of the pollen tubes in bcpll9 were irregular with shorter length and uneven surface. Aniline blue staining identified abnormal accumulation of a specific bright blue unknown material in the bcpll9 pollen portion. Scanning electron microscopy observation verified the abnormal outthrust material to be near the pollen germinal furrows. Transmission electron microscopy observation revealed the internal endintine layer was overdeveloped and predominantly occupied the intine. This abnormally formed intine likely induced the wavy structure and growth arrest of the pollen tube in half of the bcpll9 pollen grains, which resulted in less seed yields. Collectively, this study presented a novel PLL gene that has an important function in B. campestris intine formation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  20. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  1. Crystal structure and characterization of a novel L-serine ammonia-lyase from Rhizomucor miehei

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Zhen [College of Food Science and Nutritional Engineering, Beijing Advanced Innovation Center of Food Nutrition and Human Health, China Agricultural University, Beijing 100083 (China); Yan, Qiaojuan [College of Engineering, China Agricultural University, Beijing 100083 (China); Ma, Qingjun [Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071 (China); Jiang, Zhengqiang, E-mail: zhqjiang@cau.edu.cn [College of Food Science and Nutritional Engineering, Beijing Advanced Innovation Center of Food Nutrition and Human Health, China Agricultural University, Beijing 100083 (China)

    2015-10-23

    L-serine ammonia-lyase, as a member of the β-family of pyridoxal-5′-phosphate (PLP) dependent enzymes, catalyzes the conversion of L-serine (L-threonine) to pyruvate (α-ketobutyrate) and ammonia. The crystal structure of L-serine ammonia-lyase from Rhizomucor miehei (RmSDH) was solved at 1.76 Å resolution by X-ray diffraction method. The overall structure of RmSDH had the characteristic β-family PLP dependent enzyme fold. It consisted of two distinct domains, both of which show the typical open twisted α/β structure. A PLP cofactor was located in the crevice between the two domains, which was attached to Lys52 by a Schiff-base linkage. Unique residue substitutions (Gly78, Pro79, Ser146, Ser147 and Thr312) were discovered at the catalytic site of RmSDH by comparison of structures of RmSDH and other reported eukaryotic L-serine ammonia-lyases. Optimal pH and temperature of the purified RmSDH were 7.5 and 40 °C, respectively. It was stable in the pH range of 7.0–9.0 and at temperatures below 40 °C. This is the first crystal structure of a fungal L-serine ammonia-lyase. It will be useful to study the catalytic mechanism of β-elimination enzymes and will provide a basis for further enzyme engineering. - Highlights: • The crystal structure of a fungal L-serine ammonia-lyase (RmSDH) was solved. • Five unique residue substitutions are found at the catalytic site of RmSDH. • RmSDH was expressed in Pichia. pastoris and biochemically characterized. • RmSDH has potential application in splitting D/L-serine.

  2. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  3. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  4. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  5. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  6. Cystathionine .gamma.-lyase: Clinical, metabolic, genetic, and structural studies

    Czech Academy of Sciences Publication Activity Database

    Kraus, J. P.; Hašek, Jindřich; Kožich, V.; Collard, R.; Venezia, S.; Janošíková, B.; Wang, J.; Stabler, S. P.; Allen, R. H.; Jakobs, C.; Finn, C. T.; Chien, Y. H.; Hwu, W. L.; Hegele, R. A.; Mudd, S. H.

    2009-01-01

    Roč. 97, č. 4 (2009), s. 250-259 ISSN 1096-7192 R&D Projects: GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : cystathionine gamma-lyase * cystathioninuria * hypercystathioninemia Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.897, year: 2009

  7. Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

    Science.gov (United States)

    Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

    2005-01-01

    Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

  8. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  9. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  10. Processes for the production of hydroxycinnamic acids using polypeptides having tyrosine ammonia lyase activity

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention generally relates to the field of biotechnology as it applies to the production of hydroxycinnamic acids using polypeptides having tyrosine ammonia lyase activity. More particularly, the present invention pertains to polypeptides having tyrosine ammonia lyase activity and high...... substrate specificity towards tyrosine, which makes them particularly suitable in the production of p-coumaric acid and other hydroxycinnamic acids. The present invention thus provides processes for the production of p-coumaric acid and other hydroxycinnamic acids employing these polypeptides as well...

  11. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  12. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  13. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  14. Hematopoietic sphingosine 1-phosphate lyase deficiency decreases atherosclerotic lesion development in LDL-receptor deficient mice.

    Directory of Open Access Journals (Sweden)

    Martine Bot

    Full Text Available AIMS: Altered sphingosine 1-phosphate (S1P homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1(-/- deficiency on leukocyte subsets relevant to atherosclerosis. METHODS AND RESULTS: LDL receptor deficient mice that were transplanted with Sgpl1(-/- bone marrow showed disrupted S1P gradients translating into lymphopenia and abrogated lymphocyte mitogenic and cytokine response as compared to controls. Remarkably however, Sgpl1(-/- chimeras displayed mild monocytosis, due to impeded stromal retention and myelopoiesis, and plasma cytokine and macrophage expression patterns, that were largely compatible with classical macrophage activation. Collectively these two phenotypic features of Sgpl1 deficiency culminated in diminished atherogenic response. CONCLUSIONS: Here we not only firmly establish the critical role of hematopoietic S1P lyase in controlling S1P levels and T cell trafficking in blood and lymphoid tissue, but also identify leukocyte Sgpl1 as critical factor in monocyte macrophage differentiation and function. Its, partly counterbalancing, pro- and anti-inflammatory activity spectrum imply that intervention in S1P lyase function in inflammatory disorders such as atherosclerosis should be considered with caution.

  15. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  16. Characterization of a new (R)-hydroxynitrile lyase from the Japanese apricot Prunus mume and cDNA cloning and secretory expression of one of the isozymes in Pichia pastoris.

    Science.gov (United States)

    Fukuta, Yasuhisa; Nanda, Samik; Kato, Yasuo; Yurimoto, Hiroya; Sakai, Yasuyoshi; Komeda, Hidenobu; Asano, Yasuhisa

    2011-01-01

    PmHNL, a hydroxynitrile lyase from Japanese apricot ume (Prunus mume) seed was purified to homogeneity by ammonium sulfate fractionation and chromatographic steps. The purified enzyme was a monomer with molecular mass of 58 kDa. It was a flavoprotein similar to other hydroxynitrile lyases of the Rosaceae family. It was active over a broad temperature, and pH range. The N-terminal amino acid sequence (20 amino acids) was identical with that of the enzyme from almond (Prunus dulcis). Based on the N-terminal sequence of the purified enzyme and the conserved amino acid sequences of the enzymes from Pr. dulcis, inverse PCR method was used for cloning of a putative PmHNL (PmHNL2) gene from a Pr. mume seedling. Then the cDNA for the enzyme was cloned. The deduced amino acid sequence was found to be highly similar (95%) to that of an enzyme from Pr. serotina, isozyme 2. The recombinant Pichia pastoris transformed with the PmHNL2 gene secreted an active enzyme in glycosylated form.

  17. Characterization of C-S lyase from Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 and its potential role in food flavour applications.

    Science.gov (United States)

    Allegrini, Alessandra; Astegno, Alessandra; La Verde, Valentina; Dominici, Paola

    2017-04-01

    Volatile thiols have substantial impact on the aroma of many beverages and foods. Thus, the control of their formation, which has been linked to C-S lyase enzymatic activities, is of great significance in industrial applications involving food flavours. Herein, we have carried out a spectroscopic and functional characterization of a putative pyridoxal 5'-phosphate (PLP)-dependent C-S lyase from the lactic acid bacterium Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 (LDB C-S lyase). Recombinant LDB C-S lyase exists as a tetramer in solution and shows spectral properties of enzymes containing PLP as cofactor. The enzyme has a broad substrate specificity toward sulphur-containing amino acids with aminoethyl-L-cysteine and L-cystine being the most effective substrates over L-cysteine and L-cystathionine. Notably, the protein also reveals cysteine-S-conjugate β-lyase activity in vitro, and is able to cleave a cysteinylated substrate precursor into the corresponding flavour-contributing thiol, with a catalytic efficiency higher than L-cystathionine. Contrary to similar enzymes of other lactic acid bacteria however, LDB C-S lyase is not capable of α,γ-elimination activity towards L-methionine to produce methanethiol, which is a significant compound in flavour development. Based on our results, future developments can be expected regarding the flavour-forming potential of Lactobacillus C-S lyase and its use in enhancing food flavours. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  18. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  19. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  20. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  1. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  2. Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

    Science.gov (United States)

    Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

    2009-01-01

    There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

  3. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  4. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  5. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  6. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  7. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  8. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  9. Priming ammonia lyases and aminomutases for industrial and therapeutic applications

    NARCIS (Netherlands)

    Heberling, Matthew M.; Wu, Bian; Bartsch, Sebastian; Janssen, Dick B.

    Ammonia lyases (AL) and aminomutases (AM) are emerging in green synthetic routes to chiral amines and an AL is being explored as an enzyme therapeutic for treating phenylketonuria and cancer. Although the restricted substrate range of the wild-type enzymes limits their widespread application, the

  10. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  11. Correlation between the cystathionine-r-lyase (CES) and the ...

    African Journals Online (AJOL)

    Background: The infection of Helicobacter pylori (H. pylori) is one of the most important causes of gastric ulcer disease. The role of hydrogen sulfide (H2S) production in H. pylori-induced gastric ulcer disease. Aim: The expression of cystathionine-γ-lyase (CSE) was determined, and correlated with the severity of gastric ulcer ...

  12. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  13. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  14. [Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

    Science.gov (United States)

    Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

    2008-01-01

    The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

  15. ATP-Citrate Lyase Controls a Glucose-to-Acetate Metabolic Switch

    Directory of Open Access Journals (Sweden)

    Steven Zhao

    2016-10-01

    Full Text Available Mechanisms of metabolic flexibility enable cells to survive under stressful conditions and can thwart therapeutic responses. Acetyl-coenzyme A (CoA plays central roles in energy production, lipid metabolism, and epigenomic modifications. Here, we show that, upon genetic deletion of Acly, the gene coding for ATP-citrate lyase (ACLY, cells remain viable and proliferate, although at an impaired rate. In the absence of ACLY, cells upregulate ACSS2 and utilize exogenous acetate to provide acetyl-CoA for de novo lipogenesis (DNL and histone acetylation. A physiological level of acetate is sufficient for cell viability and abundant acetyl-CoA production, although histone acetylation levels remain low in ACLY-deficient cells unless supplemented with high levels of acetate. ACLY-deficient adipocytes accumulate lipid in vivo, exhibit increased acetyl-CoA and malonyl-CoA production from acetate, and display some differences in fatty acid content and synthesis. Together, these data indicate that engagement of acetate metabolism is a crucial, although partial, mechanism of compensation for ACLY deficiency.

  16. ATP-Citrate Lyase Controls a Glucose-to-Acetate Metabolic Switch.

    Science.gov (United States)

    Zhao, Steven; Torres, AnnMarie; Henry, Ryan A; Trefely, Sophie; Wallace, Martina; Lee, Joyce V; Carrer, Alessandro; Sengupta, Arjun; Campbell, Sydney L; Kuo, Yin-Ming; Frey, Alexander J; Meurs, Noah; Viola, John M; Blair, Ian A; Weljie, Aalim M; Metallo, Christian M; Snyder, Nathaniel W; Andrews, Andrew J; Wellen, Kathryn E

    2016-10-18

    Mechanisms of metabolic flexibility enable cells to survive under stressful conditions and can thwart therapeutic responses. Acetyl-coenzyme A (CoA) plays central roles in energy production, lipid metabolism, and epigenomic modifications. Here, we show that, upon genetic deletion of Acly, the gene coding for ATP-citrate lyase (ACLY), cells remain viable and proliferate, although at an impaired rate. In the absence of ACLY, cells upregulate ACSS2 and utilize exogenous acetate to provide acetyl-CoA for de novo lipogenesis (DNL) and histone acetylation. A physiological level of acetate is sufficient for cell viability and abundant acetyl-CoA production, although histone acetylation levels remain low in ACLY-deficient cells unless supplemented with high levels of acetate. ACLY-deficient adipocytes accumulate lipid in vivo, exhibit increased acetyl-CoA and malonyl-CoA production from acetate, and display some differences in fatty acid content and synthesis. Together, these data indicate that engagement of acetate metabolism is a crucial, although partial, mechanism of compensation for ACLY deficiency. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  18. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  19. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  20. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  1. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  2. Characterization of the N-linked glycosylation site of recombinant pectate lyase

    NARCIS (Netherlands)

    Colangelo, J.; Licon, V.; Benen, J.A.E.; Visser, J.; Bergmann, C.; Orlando, R.

    1999-01-01

    Recombinant pectate lyase from Aspergillus niger was overexpressed in Aspergillus nidulans. The two recombinant proteins produced differed in molecular mass by 1200 Da, which suggested that the larger molecular weight protein was glycosylated. The deduced amino acid sequence was searched for

  3. The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

    Science.gov (United States)

    Santiago, Margarita; Gardner, Richard C

    2015-07-01

    Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

  4. Biochemical, Kinetic, and Spectroscopic Characterization of Ruegeria pomeroyi DddW--A Mononuclear Iron-Dependent DMSP Lyase.

    Directory of Open Access Journals (Sweden)

    Adam E Brummett

    Full Text Available The osmolyte dimethylsulfoniopropionate (DMSP is a key nutrient in marine environments and its catabolism by bacteria through enzymes known as DMSP lyases generates dimethylsulfide (DMS, a gas of importance in climate regulation, the sulfur cycle, and signaling to higher organisms. Despite the environmental significance of DMSP lyases, little is known about how they function at the mechanistic level. In this study we biochemically characterize DddW, a DMSP lyase from the model roseobacter Ruegeria pomeroyi DSS-3. DddW is a 16.9 kDa enzyme that contains a C-terminal cupin domain and liberates acrylate, a proton, and DMS from the DMSP substrate. Our studies show that as-purified DddW is a metalloenzyme, like the DddQ and DddP DMSP lyases, but contains an iron cofactor. The metal cofactor is essential for DddW DMSP lyase activity since addition of the metal chelator EDTA abolishes its enzymatic activity, as do substitution mutations of key metal-binding residues in the cupin motif (His81, His83, Glu87, and His121. Measurements of metal binding affinity and catalytic activity indicate that Fe(II is most likely the preferred catalytic metal ion with a nanomolar binding affinity. Stoichiometry studies suggest DddW requires one Fe(II per monomer. Electronic absorption and electron paramagnetic resonance (EPR studies show an interaction between NO and Fe(II-DddW, with NO binding to the EPR silent Fe(II site giving rise to an EPR active species (g = 4.29, 3.95, 2.00. The change in the rhombicity of the EPR signal is observed in the presence of DMSP, indicating that substrate binds to the iron site without displacing bound NO. This work provides insight into the mechanism of DMSP cleavage catalyzed by DddW.

  5. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Directory of Open Access Journals (Sweden)

    Tatiana Takahasi Komoto

    2015-01-01

    Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.

  6. Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

    DEFF Research Database (Denmark)

    Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

    2005-01-01

    Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

  7. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  8. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  9. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  10. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  11. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  12. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  13. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  14. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  15. ¹³C metabolic flux analysis identifies an unusual route for pyruvate dissimilation in mycobacteria which requires isocitrate lyase and carbon dioxide fixation.

    Directory of Open Access Journals (Sweden)

    Dany J V Beste

    2011-07-01

    Full Text Available Mycobacterium tuberculosis requires the enzyme isocitrate lyase (ICL for growth and virulence in vivo. The demonstration that M. tuberculosis also requires ICL for survival during nutrient starvation and has a role during steady state growth in a glycerol limited chemostat indicates a function for this enzyme which extends beyond fat metabolism. As isocitrate lyase is a potential drug target elucidating the role of this enzyme is of importance; however, the role of isocitrate lyase has never been investigated at the level of in vivo fluxes. Here we show that deletion of one of the two icl genes impairs the replication of Mycobacterium bovis BCG at slow growth rate in a carbon limited chemostat. In order to further understand the role of isocitrate lyase in the central metabolism of mycobacteria the effect of growth rate on the in vivo fluxes was studied for the first time using ¹³C-metabolic flux analysis (MFA. Tracer experiments were performed with steady state chemostat cultures of BCG or M. tuberculosis supplied with ¹³C labeled glycerol or sodium bicarbonate. Through measurements of the ¹³C isotopomer labeling patterns in protein-derived amino acids and enzymatic activity assays we have identified the activity of a novel pathway for pyruvate dissimilation. We named this the GAS pathway because it utilizes the Glyoxylate shunt and Anapleurotic reactions for oxidation of pyruvate, and Succinyl CoA synthetase for the generation of succinyl CoA combined with a very low flux through the succinate--oxaloacetate segment of the tricarboxylic acid cycle. We confirm that M. tuberculosis can fix carbon from CO₂ into biomass. As the human host is abundant in CO₂ this finding requires further investigation in vivo as CO₂ fixation may provide a point of vulnerability that could be targeted with novel drugs. This study also provides a platform for further studies into the metabolism of M. tuberculosis using ¹³C-MFA.

  16. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  17. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  18. Integrated Analysis of the Effects of Cold and Dehydration on Rice Metabolites, Phytohormones, and Gene Transcripts1[W][OPEN

    Science.gov (United States)

    Maruyama, Kyonoshin; Urano, Kaoru; Yoshiwara, Kyouko; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Kojima, Mikiko; Sakakibara, Hitoshi; Shibata, Daisuke; Saito, Kazuki; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2014-01-01

    Correlations between gene expression and metabolite/phytohormone levels under abiotic stress conditions have been reported for Arabidopsis (Arabidopsis thaliana). However, little is known about these correlations in rice (Oryza sativa ‘Nipponbare’), despite its importance as a model monocot. We performed an integrated analysis to clarify the relationships among cold- and dehydration-responsive metabolites, phytohormones, and gene transcription in rice. An integrated analysis of metabolites and gene expression indicated that several genes encoding enzymes involved in starch degradation, sucrose metabolism, and the glyoxylate cycle are up-regulated in rice plants exposed to cold or dehydration and that these changes are correlated with the accumulation of glucose (Glc), fructose, and sucrose. In particular, high expression levels of genes encoding isocitrate lyase and malate synthase in the glyoxylate cycle correlate with increased Glc levels in rice, but not in Arabidopsis, under dehydration conditions, indicating that the regulation of the glyoxylate cycle may be involved in Glc accumulation under dehydration conditions in rice but not Arabidopsis. An integrated analysis of phytohormones and gene transcripts revealed an inverse relationship between abscisic acid (ABA) signaling and cytokinin (CK) signaling under cold and dehydration stresses; these stresses increase ABA signaling and decrease CK signaling. High levels of Oryza sativa 9-cis-epoxycarotenoid dioxygenase transcripts correlate with ABA accumulation, and low levels of Cytochrome P450 (CYP) 735A transcripts correlate with decreased levels of a CK precursor in rice. This reduced expression of CYP735As occurs in rice but not Arabidopsis. Therefore, transcriptional regulation of CYP735As might be involved in regulating CK levels under cold and dehydration conditions in rice but not Arabidopsis. PMID:24515831

  19. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  20. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  1. Microbial β-etherases and glutathione lyases for lignin valorisation in biorefineries: current state and future perspectives.

    Science.gov (United States)

    Husarcíková, Jana; Voß, Hauke; Domínguez de María, Pablo; Schallmey, Anett

    2018-05-04

    Lignin is the major aromatic biopolymer in nature, and it is considered a valuable feedstock for the future supply of aromatics. Hence, its valorisation in biorefineries is of high importance, and various chemical and enzymatic approaches for lignin depolymerisation have been reported. Among the enzymes known to act on lignin, β-etherases offer the possibility for a selective cleavage of the β-O-4 aryl ether bonds present in lignin. These enzymes, together with glutathione lyases, catalyse a reductive, glutathione-dependent ether bond cleavage displaying high stereospecificity. β-Etherases and glutathione lyases both belong to the superfamily of glutathione transferases, and several structures have been solved recently. Additionally, different approaches for their application in lignin valorisation have been reported in the last years. This review gives an overview on the current knowledge on β-etherases and glutathione lyases, their biochemical and structural features, and critically discusses their potential for application in biorefineries.

  2. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  3. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  4. Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jendresen, Christian Bille; Stahlhut, Steen Gustav; Li, Mingji

    2015-01-01

    Phenylalanine and tyrosine ammonia-lyases form cinnamic acid and p-coumaric acid, which are precursors of a wide range of aromatic compounds of biotechnological interest. Lack of highly active and specific tyrosine ammonia-lyases has previously been a limitation in metabolic engineering approaches...

  5. Pectinolytic bacteria and their secreted pectate lyases: agents for the maceration and solubilization of phytomass for fuels production

    Energy Technology Data Exchange (ETDEWEB)

    Preston, J.F. III; Rice, J.D.; Chow, M.C. (Florida Univ., Gainesville, FL (United States). Dept. of Microbiology and Cell Science)

    1993-01-01

    The objectives of this research have been to identify the pectinolytic enzymes secreted by bacteria and apply these towards the enhanced maceration and solubilization of plant material, focusing on the pectate lyases secreted by the phytopathogenic strains of Erwinia chrysanthemi, the ruminant resident Lachnospira multiparus, and the wood digestor isolate, Clostridium populeti. An HPLC approach has been developed that permits the kinetic analysis of each enzyme with respect to the formation of individual products during the pectate depolymerization process. This approach has demonstrated that each of these organisms secretes a nonrandom trimer-generating pectate lyase with a combination of endolytic and exolytic depolymerizing mechanisms. Two different strains of E. chrysanthemi secrete a battery of pectate lyases that include random endolytic as well as nonrandom dimer - and nonrandom trimer-generating endolytic/exolytic mechanisms. (author)

  6. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  7. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  8. Catalytic Mechanisms and Biocatalytic Applications of Aspartate and Methylaspartate Ammonia Lyases

    NARCIS (Netherlands)

    de Villiers, Marianne; Veetil, Vinod Puthan; Raj, Hans; de Villiers, Jandre; Poelarends, Gerrit J.

    2012-01-01

    Ammonia lyases catalyze the formation of alpha-beta-unsaturated bonds by the elimination of ammonia from their substrates. This conceptually straightforward reaction has been the emphasis of many studies, with the main focus on the catalytic mechanism of these enzymes and/or the use of these enzymes

  9. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  10. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  11. S1P lyase in thymic perivascular spaces promotes egress of mature thymocytes via up-regulation of S1P receptor 1.

    Science.gov (United States)

    Maeda, Yasuhiro; Yagi, Hideki; Takemoto, Kana; Utsumi, Hiroyuki; Fukunari, Atsushi; Sugahara, Kunio; Masuko, Takashi; Chiba, Kenji

    2014-05-01

    Sphingosine 1-phosphate (S1P) and S1P receptor 1 (S1P1) play an important role in the egress of mature CD4 or CD8 single-positive (SP) thymocytes from the thymus. Fingolimod hydrochloride (FTY720), an S1P1 functional antagonist, induced significant accumulation of CD62L(high)CD69(low) mature SP thymocytes in the thymic medulla. Immunohistochemical staining using anti-S1P1 antibody revealed that S1P1 is predominantly expressed on thymocytes in the thymic medulla and is strongly down-regulated even at 3h after FTY720 administration. 2-Acetyl-4-tetrahydroxybutylimidazole (THI), an S1P lyase inhibitor, also induced accumulation of mature SP thymocytes in the thymic medulla with an enlargement of the perivascular spaces (PVS). At 6h after THI administration, S1P1-expressing thymocytes reduced partially as if to form clusters and hardly existed in the proximity of CD31-expressing blood vessels in the thymic medulla, suggesting S1P lyase expression in the cells constructing thymic medullary PVS. To determine the cells expressing S1P lyase in the thymus, we newly established a mAb (YK19-2) specific for mouse S1P lyase. Immunohistochemical staining with YK19-2 revealed that S1P lyase is predominantly expressed in non-lymphoid thymic stromal cells in the thymic medulla. In the thymic medullary PVS, S1P lyase was expressed in ER-TR7-positive cells (reticular fibroblasts and pericytes) and CD31-positive vascular endothelial cells. Our findings suggest that S1P lyase expressed in the thymic medullary PVS keeps the tissue S1P concentration low around the vessels and promotes thymic egress via up-regulation of S1P1.

  12. Sugar-cane juice induces pectin lyase and polygalacturonase in Penicillium griseoroseum

    Directory of Open Access Journals (Sweden)

    Minussi Rosana Cristina

    1998-01-01

    Full Text Available The use of other inducers as substitutes for pectin was studied aiming to reduce the production costs of pectic enzymes. The effects of sugar-cane juice on the production of pectin lyase (PL and polygalacturonase (PG by Penicillium griseoroseum were investigated. The fungus was cultured in a mineral medium (pH 6.3 in a rotary shaker (150 rpm for 48 h at 25oC. Culture media were supplemented with yeast extract and sucrose or sugar-cane juice. Sugar-cane juice added singly to the medium promoted higher PL activity and mycelial dry weight when compared to pectin and the use of sugar-cane juice and yeast extract yielded levels of PG activity that were similar to those obtained with sucrose-yeast extract or pectin. The results indicated that, even at low concentrations, sugar-cane juice was capable of inducing pectin lyase and polygalacturonase with no cellulase activity in P. griseoroseum.

  13. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  14. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  15. Engineering methylaspartate ammonia lyase for the asymmetric synthesis of unnatural amino acids

    NARCIS (Netherlands)

    Raj, Hans; Szymanski, Wiktor; de Villiers, Jandre; Rozeboom, Henriëtte J.; Puthan Veetil, Vinod; Reis, Carlos R.; Villiers, Marianne de; Dekker, Frank J.; Wildeman, Stefaan de; Quax, Wim J.; Thunnissen, Andy-Mark W.H.; Feringa, Ben L.; Janssen, Dick B.; Poelarends, Gerrit J.

    The redesign of enzymes to produce catalysts for a predefined transformation remains a major challenge in protein engineering. Here, we describe the structure-based engineering of methylaspartate ammonia lyase (which in nature catalyses the conversion of 3-methylaspartate to ammonia and

  16. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  17. Purification and Characterization of a Unique Pectin Lyase from Aspergillus giganteus Able to Release Unsaturated Monogalacturonate during Pectin Degradation

    Directory of Open Access Journals (Sweden)

    Danielle Biscaro Pedrolli

    2014-01-01

    Full Text Available A pectin lyase, named PLIII, was purified to homogeneity from the culture filtrate of Aspergillus giganteus grown in submerged culture containing orange peel waste as carbon source. PLIII was able to digest apple pectin and citrus pectins with different degrees of methyl esterification. Interestingly, the PLIII activity was stimulated in the presence of some divalent cations including Pb2+ and was not significantly affected by Hg2+. Like other pectin lyases, PLIII is stimulated by but is not dependent on Ca2+. The main soluble product released during the degradation of pectic substances promoted by the PLIII is compatible with an unsaturated monogalacturonate. PLIII is a unique enzyme able to release unsaturated monogalacturonate as the only soluble product during the degradation of pectic substances; therefore, PLIII was classified as an exo-pectin lyase. To our knowledge, this is the first characterization of an exo-pectin lyase. The PLIII described in this work is potentially useful for ethanol production from pectin-rich biomass, besides other common applications for alkaline pectinases like preparation of textile fibers, coffee and tea fermentation, vegetable oil extraction, and the treatment of pulp in papermaking.

  18. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  19. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  20. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  1. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  2. Genetically engineering Synechocystis sp. Pasteur Culture Collection 6803 for the sustainable production of the plant secondary metabolite p-coumaric acid.

    Science.gov (United States)

    Xue, Yong; Zhang, Yan; Cheng, Dan; Daddy, Soumana; He, Qingfang

    2014-07-01

    p-Coumaric acid is the precursor of phenylpropanoids, which are plant secondary metabolites that are beneficial to human health. Tyrosine ammonia lyase catalyzes the production of p-coumaric acid from tyrosine. Because of their photosynthetic ability and biosynthetic versatility, cyanobacteria are promising candidates for the production of certain plant metabolites, including phenylpropanoids. Here, we produced p-coumaric acid in a strain of transgenic cyanobacterium Synechocystis sp. Pasteur Culture Collection 6803 (hereafter Synechocystis 6803). Whereas a strain of Synechocystis 6803 genetically engineered to express sam8, a tyrosine ammonia lyase gene from the actinomycete Saccharothrix espanaensis, accumulated little or no p-coumaric acid, a strain that both expressed sam8 and lacked slr1573, a native hypothetical gene shown here to encode a laccase that oxidizes polyphenols, produced ∼82.6 mg/L p-coumaric acid, which was readily purified from the growth medium.

  3. Mechanism of Cytochrome P450 17A1-Catalyzed Hydroxylase and Lyase Reactions

    DEFF Research Database (Denmark)

    Bonomo, Silvia; Jorgensen, Flemming Steen; Olsen, Lars

    2017-01-01

    Cytochrome P450 17A1 (CYP17A1) catalyzes C17 hydroxylation of pregnenolone and progesterone and the subsequent C17–C20 bond cleavage (lyase reaction) to form androgen precursors. Compound I (Cpd I) and peroxo anion (POA) are the heme-reactive species underlying the two reactions. We have characte...... the concept that the selectivity of the steroidogenic CYPs is ruled by direct interactions with the enzyme, in contrast to the selectivity of drug-metabolizing CYPs, where the reactivity of the substrates dominates....... characterized the reaction path for both the hydroxylase and lyase reactions using density functional theory (DFT) calculations and the enzyme–substrate interactions by molecular dynamics (MD) simulations. Activation barriers for positions subject to hydroxylase reaction have values close to each other and span...

  4. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  5. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  6. Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

    Directory of Open Access Journals (Sweden)

    DEWI FITRIANI

    2010-06-01

    Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

  7. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  8. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  9. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  10. An acidic pectin lyase from Aspergillus niger with favourable efficiency in fruit juice clarification.

    Science.gov (United States)

    Xu, S X; Qin, X; Liu, B; Zhang, D Q; Zhang, W; Wu, K; Zhang, Y H

    2015-02-01

    The pectin lyase gene pnl-zj5a from Aspergillus niger ZJ5 was identified and expressed in Pichia pastoris. PNL-ZJ5A was purified by ultrafiltration, anion exchange and gel chromatography. The Km and Vmax values determined using citrus pectin were 0.66 mg ml(-1) and 32.6 μmol min(-1) mg(-1) , respectively. PNL-ZJ5A exhibited optimal activity at 43°C and retained activity over 25-50°C. PNL-ZJ5A was optimally active at pH 5 and effective in apple juice clarification. Compared with controls, PNL-ZJ5A increased the fruit juice yield significantly. Furthermore, PNL-ZJ5A reduced the viscosity of apple juice by 38.8% and increased its transmittance by 86.3%. PNL-ZJ5A combined with a commercial pectin esterase resulted in higher juice volume. © 2014 The Society for Applied Microbiology.

  11. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

    OpenAIRE

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-01-01

    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  12. Perturbation of formate pathway for hydrogen production by expressions of formate hydrogen lyase and its transcriptional activator in wild Enterobacter aerogenes and its mutants

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Yuan; Zhao, Hongxin; Zhang, Chong; Lai, Qiheng; Xing, Xin-Hui [Institute of Biochemical Engineering, Department of Chemical Engineering, Tsinghua University, Beijing 100084 (China)

    2009-06-15

    To examine perturbation effects of formate pathway on hydrogen productivity in Enterobacter aerogenes (Ea), formate dehydrogenase FDH-H gene (fdhF) and formate hydrogen lyase activator protein FHLA gene (fhlA) originated from Escherichia coli, were overexpressed in the wild strain Ea, its hycA-deleted mutant (A) by knockout the formate hydrogen lyase repressor and hybO-deleted mutant (O) by knockout of the uptake hydrogenase, respectively. Overexpression of fdhF and fhlA promoted cell growth and volumetric hydrogen production rates of all the strains, and the hydrogen production per gram cell dry weight (CDW) for Ea, A and O was increased by 38.5%, 21.8% and 5.25%, respectively. The fdhF and fhlA overexpression improved the hydrogen yield per mol glucose of strains Ea and A, but declined that of strain O. The increase of hydrogen yield of the strain Ea with fdhF and fhlA expression was mainly attributed to the increase of formate pathway, while for the mutant A, the improved hydrogen yield with fdhF and fhlA expression was mainly due to the increase of NADH pathway. Analysis of the metabolites and ratio of ethanol-to-acetate showed that the cellular redox state balance and energy level were also changed for these strains by fdhF and fhlA expression. These findings demonstrated that the hydrogen production was not only dependent on the hydrogenase genes, but was also affected by the regulation of the whole metabolism. Therefore, fdhF and fhlA expression in different strains of E. aerogenes could exhibit different perturbation effects on the metabolism and the hydrogen productivity. (author)

  13. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  14. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    OpenAIRE

    Xu, J; Johnson, R C

    1995-01-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

  15. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  16. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  17. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  18. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  19. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  20. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  1. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  2. RegA Plays a Key Role in Oxygen-Dependent Establishment of Persistence and in Isocitrate Lyase Activity, a Critical Determinant of In vivo Brucella suis Pathogenicity

    Directory of Open Access Journals (Sweden)

    Elias Abdou

    2017-05-01

    Full Text Available For aerobic human pathogens, adaptation to hypoxia is a critical factor for the establishment of persistent infections, as oxygen availability is low inside the host. The two-component system RegB/A of Brucella suis plays a central role in the control of respiratory systems adapted to oxygen deficiency, and in persistence in vivo. Using an original “in vitro model of persistence” consisting in gradual oxygen depletion, we compared transcriptomes and proteomes of wild-type and ΔregA strains to identify the RegA-regulon potentially involved in the set-up of persistence. Consecutive to oxygen consumption resulting in growth arrest, 12% of the genes in B. suis were potentially controlled directly or indirectly by RegA, among which numerous transcriptional regulators were up-regulated. In contrast, genes or proteins involved in envelope biogenesis and in cellular division were repressed, suggesting a possible role for RegA in the set-up of a non-proliferative persistence state. Importantly, the greatest number of the RegA-repressed genes and proteins, including aceA encoding the functional IsoCitrate Lyase (ICL, were involved in energy production. A potential consequence of this RegA impact may be the slowing-down of the central metabolism as B. suis progressively enters into persistence. Moreover, ICL is an essential determinant of pathogenesis and long-term interactions with the host, as demonstrated by the strict dependence of B. suis on ICL activity for multiplication and persistence during in vivo infection. RegA regulates gene or protein expression of all functional groups, which is why RegA is a key regulator of B. suis in adaptation to oxygen depletion. This function may contribute to the constraint of bacterial growth, typical of chronic infection. Oxygen-dependent activation of two-component systems that control persistence regulons, shared by several aerobic human pathogens, has not been studied in Brucella sp. before. This work

  3. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  4. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  5. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  6. Comparison of expression, purification and characterization of a new pectate lyase from Phytophthora capsici using two different methods

    Directory of Open Access Journals (Sweden)

    Zhang Xiuguo

    2011-04-01

    Full Text Available Abstract Background Pectate lyases (PELs play an important role in the infection process of plant pathogens and also have a commercial significance in industrial applications. Most of the PELs were expressed as soluble recombinant proteins, while a few recombinant proteins were insoluble. The production of a large-scale soluble recombinant PEL would allow not only a more detailed structural and functional characterization of this enzyme but also may have important applications in the food industry. Results We cloned a new pectate lyase gene (Pcpel2 from Phytophthora capsici. Pcpel2 was constructed by pET system and pMAL system, and both constructs were used to express the PCPEL2 in Escherichia coli BL21 (DE3 pLysS. The expressed products were purified using affinity chromatography and gel filtration chromatography. The purity, specific activity and pathogenicity of the purified PCPEL2 expressed by the pMAL system were higher than the purified PCPEL2 expressed by the pET system. In addition, some other characteristics of the purified PCPEL2 differed from the two systems, such as crystallographic features. Purified PCPEL2 expressed by the pMAL system was crystallized by the hanging-drop vapour-diffusion method at 289 K, and initial crystals were grown. Conclusion The two different methods and comparison presented here would be highly valuable in obtaining an ideal enzyme for the downstream experiments, and supply an useful alternative to purify some insoluble recombinant proteins.

  7. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  8. Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

    Science.gov (United States)

    Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

    2016-01-01

    Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

  9. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  10. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  11. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    Directory of Open Access Journals (Sweden)

    Beatriz Moreno

    2016-07-01

    Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

  12. Characterization of two bacterial hydroxynitrile lyases with high similarity to cupin superfamily proteins

    NARCIS (Netherlands)

    Hussain, Z.; Wiedner, R.; Steiner, K.; Hajek, T.; Avi, M.; Hecher, B.; Sessitsch, A.; Schwab, H.

    2012-01-01

    Hydroxynitrile lyases (HNLs) catalyze the cleavage of cyanohydrins. In the reverse reaction, they catalyze the formation of carbon-carbon bonds by enantioselective condensation of hydrocyanic acid with carbonyls. In this study, we describe two proteins from endophytic bacteria that display activity

  13. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  14. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  15. Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

    Science.gov (United States)

    Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

    2016-08-01

    The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Sugarcane expressed sequences tags (ESTs encoding enzymes involved in lignin biosynthesis pathways

    Directory of Open Access Journals (Sweden)

    Ramos Rose Lucia Braz

    2001-01-01

    Full Text Available Lignins are phenolic polymers found in the secondary wall of plant conductive systems where they play an important role by reducing the permeability of the cell wall to water. Lignins are also responsible for the rigidity of the cell wall and are involved in mechanisms of resistance to pathogens. The metabolic routes and enzymes involved in synthesis of lignins have been largely characterized and representative genes that encode enzymes involved in these processes have been cloned from several plant species. The synthesis of lignins is liked to the general metabolism of the phenylpropanoids in plants, having enzymes (e.g. phenylalanine ammonia-lyase (PAL, cinnamate 4-hydroxylase (C4H and caffeic acid O-methyltransferase (COMT common to other processes as well as specific enzymes such as cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. Some maize and sorghum mutants, shown to have defective in CAD and/or COMT activity, are easier to digest because they have a reduced lignin content, something which has motivated different research groups to alter the lignin content and composition of model plants by genetic engineering try to improve, for example, the efficiency of paper pulping and digestibility. In the work reported in this paper, we have made an inventory of the sugarcane expressed sequence tag (EST coding for enzymes involved in lignin metabolism which are present in the sugarcane EST genome project (SUCEST database. Our analysis focused on the key enzymes ferulate-5-hydroxylase (F5H, caffeic acid O-methyltransferase (COMT, caffeoyl CoA O-methyltransferase (CCoAOMT, hydroxycinnamate CoA ligase (4CL, cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. The comparative analysis of these genes with those described in other species could be used as molecular markers for breeding as well as for the manipulation of lignin metabolism in sugarcane.

  17. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  18. Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Dunham Stephen

    2009-11-01

    Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

  19. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  20. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  1. Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

    Science.gov (United States)

    Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

    2012-10-15

    IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

  2. Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

    Directory of Open Access Journals (Sweden)

    Senta Heiss-Blanquet

    Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

  3. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  4. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  5. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  6. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  7. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

    Science.gov (United States)

    de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

    2002-04-15

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

  8. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  9. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  10. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  11. PECTATE LYASE-LIKE10 is associated with pollen wall development in Brassica campestris.

    Science.gov (United States)

    Jiang, Jingjing; Yao, Lina; Yu, Youjian; Lv, Meiling; Miao, Ying; Cao, Jiashu

    2014-11-01

    PECTATE LYASE-LIKE10 (PLL10) was previously identified as one of the differentially expressed genes both in microspores during the late pollen developmental stages and in pistils during the fertilization process in Chinese cabbage (Brassica campestris ssp. chinensis). Here, antisense-RNA was used to study the functions of BcPLL10 in Chinese cabbage. Abnormal pollen was identified in the transgenic lines (bcpll10-4, -5, and -6). In fertilization experiments, fewer seeds were harvested when the antisense-RNA lines were used as pollen donor. In vivo and in vitro pollen germination assays less germinated pollen tubes were observed in bcpll10 lines. Scanning electron microscopy observation verified that the tryphine materials were over accumulated around the pollen surface and sticked them together in bcpll10. Moreover, transmission electron microscopy observation revealed that the internal endintine was overdeveloped and predominantly occupied the intine, and disturbed the normal proportional distribution of the two layers in the non-germinal furrow region; and no obvious demarcation existed between them in the germinal furrow region in the bcpll10 pollen. Collectively, this study presented a novel PLL gene that played an important role during the pollen wall development in B. campestris, which may also possess potential importance for male sterility usage in agriculture. © 2014 Institute of Botany, Chinese Academy of Sciences.

  12. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency.

    Science.gov (United States)

    Stuy, M; Chen, G-F; Masonek, J M; Scharschmidt, B F

    2015-09-01

    A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS) and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB). The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet.

  13. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency☆

    Science.gov (United States)

    Stuy, M.; Chen, G.-F.; Masonek, J.M.; Scharschmidt, B.F.

    2015-01-01

    A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS) and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB). The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet. PMID:26937403

  14. The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

    DEFF Research Database (Denmark)

    Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H

    2012-01-01

    OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

  15. Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

    Science.gov (United States)

    Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

    2010-07-04

    Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  16. Characterization of Benzoyl Coenzyme A Biosynthesis Genes in the Enterocin-Producing Bacterium “Streptomyces maritimus”

    Science.gov (United States)

    Xiang, Longkuan; Moore, Bradley S.

    2003-01-01

    The novel benzoyl coenzyme A (benzoyl-CoA) biosynthesis pathway in “Streptomyces maritimus” was investigated through a series of target-directed mutations. Genes involved in benzoyl-CoA formation were disrupted through single-crossover homologous recombination, and the resulting mutants were analyzed for their ability to biosynthesize the benzoyl-CoA-primed polyketide antibiotic enterocin. Inactivation of the unique phenylalanine ammonia-lyase-encoding gene encP was previously shown to be absolutely required for benzoyl-CoA formation in “S. maritimus”. The fatty acid β-oxidation-related genes encH, -I, and -J, on the other hand, are necessary but not required. In each case, the yield of benzoyl-CoA-primed enterocin dropped below wild-type levels. We attribute the reduced benzoyl-CoA formation in these specific mutants to functional substitution and cross-talk between the products of genes encH, -I, and -J and the enzyme homologues of primary metabolism. Disruption of the benzoate-CoA ligase encN gene did not perturb enterocin production, however, demonstrating that encN is extraneous and that benzoic acid is not a pathway intermediate. EncN rather serves as a substitute pathway for utilizing exogenous benzoic acid. These experiments provide further support that benzoyl-CoA is formed in a novel bacterial pathway that resembles the eukaryotic assembly of benzoyl-CoA from phenylalanine via a β-oxidative path. PMID:12511484

  17. Multiple plasmid-borne virulence genes of Clavibacter michiganensis ssp. capsici critical for disease development in pepper.

    Science.gov (United States)

    Hwang, In Sun; Oh, Eom-Ji; Kim, Donghyuk; Oh, Chang-Sik

    2018-02-01

    Clavibacter michiganensis ssp. capsici is a Gram-positive plant-pathogenic bacterium causing bacterial canker disease in pepper. Virulence genes and mechanisms of C. michiganensis ssp. capsici in pepper have not yet been studied. To identify virulence genes of C. michiganensis ssp. capsici, comparative genome analyses with C. michiganensis ssp. capsici and its related C. michiganensis subspecies, and functional analysis of its putative virulence genes during infection were performed. The C. michiganensis ssp. capsici type strain PF008 carries one chromosome (3.056 Mb) and two plasmids (39 kb pCM1 Cmc and 145 kb pCM2 Cmc ). The genome analyses showed that this bacterium lacks a chromosomal pathogenicity island and celA gene that are important for disease development by C. michiganensis ssp. michiganensis in tomato, but carries most putative virulence genes in both plasmids. Virulence of pCM1 Cmc -cured C. michiganensis ssp. capsici was greatly reduced compared with the wild-type strain in pepper. The complementation analysis with pCM1 Cmc -located putative virulence genes showed that at least five genes, chpE, chpG, ppaA1, ppaB1 and pelA1, encoding serine proteases or pectate lyase contribute to disease development in pepper. In conclusion, C. michiganensis ssp. capsici has a unique genome structure, and its multiple plasmid-borne genes play critical roles in virulence in pepper, either separately or together. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  18. Targeting sphingosine-1-phosphate lyase as an anabolic therapy for bone loss.

    Science.gov (United States)

    Weske, Sarah; Vaidya, Mithila; Reese, Alina; von Wnuck Lipinski, Karin; Keul, Petra; Bayer, Julia K; Fischer, Jens W; Flögel, Ulrich; Nelsen, Jens; Epple, Matthias; Scatena, Marta; Schwedhelm, Edzard; Dörr, Marcus; Völzke, Henry; Moritz, Eileen; Hannemann, Anke; Rauch, Bernhard H; Gräler, Markus H; Heusch, Gerd; Levkau, Bodo

    2018-05-01

    Sphingosine-1-phosphate (S1P) signaling influences bone metabolism, but its therapeutic potential in bone disorders has remained unexplored. We show that raising S1P levels in adult mice through conditionally deleting or pharmacologically inhibiting S1P lyase, the sole enzyme responsible for irreversibly degrading S1P, markedly increased bone formation, mass and strength and substantially decreased white adipose tissue. S1P signaling through S1P 2 potently stimulated osteoblastogenesis at the expense of adipogenesis by inversely regulating osterix and PPAR-γ, and it simultaneously inhibited osteoclastogenesis by inducing osteoprotegerin through newly discovered p38-GSK3β-β-catenin and WNT5A-LRP5 pathways. Accordingly, S1P 2 -deficient mice were osteopenic and obese. In ovariectomy-induced osteopenia, S1P lyase inhibition was as effective as intermittent parathyroid hormone (iPTH) treatment in increasing bone mass and was superior to iPTH in enhancing bone strength. Furthermore, lyase inhibition in mice successfully corrected severe genetic osteoporosis caused by osteoprotegerin deficiency. Human data from 4,091 participants of the SHIP-Trend population-based study revealed a positive association between serum levels of S1P and bone formation markers, but not resorption markers. Furthermore, serum S1P levels were positively associated with serum calcium , negatively with PTH , and curvilinearly with body mass index. Bone stiffness, as determined through quantitative ultrasound, was inversely related to levels of both S1P and the bone formation marker PINP, suggesting that S1P stimulates osteoanabolic activity to counteract decreasing bone quality. S1P-based drugs should be considered as a promising therapeutic avenue for the treatment of osteoporotic diseases.

  19. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    Science.gov (United States)

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  20. Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

    Directory of Open Access Journals (Sweden)

    Vera S Bogdanova

    Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

  1. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  3. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  5. The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin.

    Science.gov (United States)

    Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E

    2015-01-01

    The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Understanding Which Residues of the Active Site and Loop Structure of a Tyrosine Aminomutase Define Its Mutase and Lyase Activities.

    Science.gov (United States)

    Attanayake, Gayanthi; Walter, Tyler; Walker, Kevin D

    2018-05-30

    Site-directed mutations and substrate analogues were used to gain insights into the branch-point reaction of the 3,5-dihydro-5-methylidene-4 H-imidazol-4-one (MIO)-tyrosine aminomutase from Oryza sativa ( OsTAM). Exchanging the active residues of OsTAM (Y125C/N446K) for those in a phenylalanine aminomutase TcPAM altered its substrate specificity from tyrosine to phenylalanine. The aminomutase mechanism of OsTAM surprisingly changed almost exclusively to that of an ammonia lyase making cinnamic acid (>95%) over β-phenylalanine [Walter, T., et al. (2016) Biochemistry 55, 3497-3503]. We hypothesized that the missing electronics or sterics on the aryl ring of the phenylalanine substrate, compared with the sizable electron-donating hydroxyl of the natural tyrosine substrate, influenced the unexpected lyase reactivity of the OsTAM mutant. The double mutant was incubated with 16 α-phenylalanine substituent analogues of varying electronic strengths and sterics. The mutant converted each analogue principally to its acrylate with ∼50% conversion of the p-Br substrate, making only a small amount of the β-amino acid. The inner loop structure over the entrance to the active site was also mutated to assess how the lyase and mutase activities are affected. An OsTAM loop mutant, matching the loop residues of TcPAM, still chiefly made >95% of the acrylate from each substrate. A combined active site:loop mutant was most reactive but remained a lyase, making 10-fold more acrylates than other mutants did. While mutations within the active site changed the substrate specificity of OsTAM, continued exploration is needed to fully understand the interplay among the inner loop, the substrate, and the active site in defining the mutase and lyase activities.

  7. Cloning and characterization of a 9-lipoxygenase gene induced by pathogen attack from Nicotiana benthamiana for biotechnological application

    Directory of Open Access Journals (Sweden)

    Schwab Wilfried

    2011-03-01

    Full Text Available Abstract Background Plant lipoxygenases (LOXs have been proposed to form biologically active compounds both during normal developmental stages such as germination or growth as well as during responses to environmental stress such as wounding or pathogen attack. In our previous study, we found that enzyme activity of endogenous 9-LOX in Nicotiana benthamiana was highly induced by agroinfiltration using a tobacco mosaic virus (TMV based vector system. Results A LOX gene which is expressed after treatment of the viral vectors was isolated from Nicotiana benthamiana. As the encoded LOX has a high amino acid identity to other 9-LOX proteins, the gene was named as Nb-9-LOX. It was heterologously expressed in yeast cells and its enzymatic activity was characterized. The yeast cells expressed large quantities of stable 9-LOX (0.9 U ml-1 cell cultures which can oxygenate linoleic acid resulting in high yields (18 μmol ml-1 cell cultures of hydroperoxy fatty acid. The product specificity of Nb-9-LOX was examined by incubation of linoleic acid and Nb-9-LOX in combination with a 13-hydroperoxide lyase from watermelon (Cl-13-HPL or a 9/13-hydroperoxide lyase from melon (Cm-9/13-HPL and by LC-MS analysis. The result showed that Nb-9-LOX possesses both 9- and 13-LOX specificity, with high predominance for the 9-LOX function. The combination of recombinant Nb-9-LOX and recombinant Cm-9/13-HPL produced large amounts of C9-aldehydes (3.3 μmol mg-1 crude protein. The yield of C9-aldehydes from linoleic acid was 64%. Conclusion The yeast expressed Nb-9-LOX can be used to produce C9-aldehydes on a large scale in combination with a HPL gene with 9-HPL function, or to effectively produce 9-hydroxy-10(E,12(Z-octadecadienoic acid in a biocatalytic process in combination with cysteine as a mild reducing agent.

  8. CLE peptide-encoding gene families in Medicago truncatula and Lotus japonicus, compared with those of soybean, common bean and Arabidopsis

    DEFF Research Database (Denmark)

    Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M

    2017-01-01

    these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...

  9. Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA

    DEFF Research Database (Denmark)

    Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.

    2002-01-01

    The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...

  10. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  11. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  12. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency

    Directory of Open Access Journals (Sweden)

    M. Stuy

    2015-09-01

    Full Text Available A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB. The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet.

  13. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  14. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  15. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  16. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  18. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  19. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  20. Anaerobic choline metabolism in microcompartments promotes growth and swarming of Proteus mirabilis.

    Science.gov (United States)

    Jameson, Eleanor; Fu, Tiantian; Brown, Ian R; Paszkiewicz, Konrad; Purdy, Kevin J; Frank, Stefanie; Chen, Yin

    2016-09-01

    Gammaproteobacteria are important gut microbes but only persist at low levels in the healthy gut. The ecology of Gammaproteobacteria in the gut environment is poorly understood. Here, we demonstrate that choline is an important growth substrate for representatives of Gammaproteobacteria. Using Proteus mirabilis as a model, we investigate the role of choline metabolism and demonstrate that the cutC gene, encoding a choline-trimethylamine lyase, is essential for choline degradation to trimethylamine by targeted mutagenesis of cutC and subsequent complementation experiments. Proteus mirabilis can rapidly utilize choline to enhance growth rate and cell yield in broth culture. Importantly, choline also enhances swarming-associated colony expansion of P. mirabilis under anaerobic conditions on a solid surface. Comparative transcriptomics demonstrated that choline not only induces choline-trimethylamine lyase but also genes encoding shell proteins for the formation of bacterial microcompartments. Subsequent analyses by transmission electron microscopy confirmed the presence of such novel microcompartments in cells cultivated in liquid broth and hyper-flagellated swarmer cells from solid medium. Together, our study reveals choline metabolism as an adaptation strategy for P. mirabilis and contributes to better understand the ecology of this bacterium in health and disease. © 2015 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  2. Cystathionine γ-lyase deficiency mediates neurodegeneration in Huntington’s disease

    OpenAIRE

    Paul, Bindu D.; Sbodio, Juan I.; Xu, Risheng; Vandiver, M. Scott; Cha, Jiyoung Y.; Snowman, Adele M.; Snyder, Solomon H.

    2014-01-01

    Huntington’s disease is an autosomal dominant disease associated with a mutation in the gene encoding huntingtin (Htt) leading to expanded polyglutamine repeats of mutant Htt (mHtt) that elicit oxidative stress, neurotoxicity, and motor and behavioural changes1. Huntington’s disease is characterized by highly selective and profound damage to the corpus striatum, which regulates motor function. Striatal selectivity of Huntington’s disease may reflect the striatally selective small G protein Rh...

  3. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  4. Identification of fungal oxaloacetate hydrolyase within the isocitrate lyase/PEP mutase enzyme superfamily using a sequence marker-based method

    NARCIS (Netherlands)

    Joosten, H.J.; Han, Y.; Niu, W.; Vervoort, J.J.M.; Dunaway-Mariano, D.; Schaap, P.J.

    2008-01-01

    Aspergillus niger produces oxalic acid through the hydrolysis of oxaloacetate, catalyzed by the cytoplasmic enzyme oxaloacetate acetylhydrolase (OAH). The A. niger genome encodes four additional open reading frames with strong sequence similarity to OAH yet only the oahA gene encodes OAH activity.

  5. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  6. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    Directory of Open Access Journals (Sweden)

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  7. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  8. A young root-specific gene (ArMY2) from horseradish encoding a MYR II myrosinase with kinetic preference for the root-specific glucosinolate gluconasturtiin.

    Science.gov (United States)

    Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang

    2014-03-01

    The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  10. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  11. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  12. Regulation and Functional Expression of Cinnamate 4-Hydroxylase from Parsley

    Science.gov (United States)

    Koopmann, Edda; Logemann, Elke; Hahlbrock, Klaus

    1999-01-01

    A previously isolated parsley (Petroselinum crispum) cDNA with high sequence similarity to cinnamate 4-hydroxylase (C4H) cDNAs from several plant sources was expressed in yeast (Saccharomyces cerevisiae) containing a plant NADPH:cytochrome P450 oxidoreductase and verified as encoding a functional C4H (CYP73A10). Low genomic complexity and the occurrence of a single type of cDNA suggest the existence of only one C4H gene in parsley. The encoded mRNA and protein, in contrast to those of a functionally related NADPH:cytochrome P450 oxidoreductase, were strictly coregulated with phenylalanine ammonia-lyase mRNA and protein, respectively, as demonstrated by coinduction under various conditions and colocalization in situ in cross-sections from several different parsley tissues. These results support the hypothesis that the genes encoding the core reactions of phenylpropanoid metabolism form a tight regulatory unit. PMID:9880345

  13. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  14. New lupane triterpenoids from Solidago canadensis that inhibit the lyase activity of DNA polymerase beta.

    Science.gov (United States)

    Chaturvedula, V S Prakash; Zhou, Bing-Nan; Gao, Zhijie; Thomas, Shannon J; Hecht, Sidney M; Kingston, David G I

    2004-12-01

    Bioassay-directed fractionation of a methyl ethyl ketone extract of Solidago canadensis L. (Asteraceae), using an assay to detect the lyase activity of DNA polymerase beta, resulted in the isolation of the four new lupane triterpenoids 1-4 and the seven known compounds lupeol, lupeyl acetate, ursolic acid, cycloartenol, cycloartenyl palmitate, alpha-amyrin acetate, and stigmasterol. The structures of the new compounds were established as 3beta-(3R-acetoxyhexadecanoyloxy)-lup-20(29)-ene (1), 3beta-(3-ketohexadecanoyloxy)-lup-20(29)-ene (2), 3beta-(3R-acetoxyhexadecanoyloxy)-29-nor-lupan-20-one (3), and 3beta-(3-hetohexadecanoyloxy)-29-nor-lupan-20-one (4), respectively, on the basis of extensive 1D and 2D NMR spectroscopic interpretation and chemical modification studies. All 11 compounds were inhibitory to the lyase activity of DNA polymerase beta.

  15. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  16. Molecular detection of genes encoding AcrAB , Qep A efflux pumps in Klebsiella pneumoniae strains isolated from hospitalized patients in selected hospitals in Tehran

    Directory of Open Access Journals (Sweden)

    Mohsen Heidary

    2017-03-01

    Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae  (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.

  17. Arsenic Demethylation by a C·As Lyase in Cyanobacterium Nostoc sp. PCC 7120.

    Science.gov (United States)

    Yan, Yu; Ye, Jun; Xue, Xi-Mei; Zhu, Yong-Guan

    2015-12-15

    Arsenic, a ubiquitous toxic substance, exists mainly as inorganic forms in the environment. It is perceived that organoarsenicals can be demethylated and degraded into inorganic arsenic by microorganisms. Few studies have focused on the mechanism of arsenic demethylation in bacteria. Here, we investigated arsenic demethylation in a typical freshwater cyanobacterium Nostoc sp. PCC 7120. This bacterium was able to demethylate monomethylarsenite [MAs(III)] rapidly to arsenite [As(III)] and also had the ability to demethylate monomethylarsenate [MAs(V)] to As(III). The NsarsI encoding a C·As lyase responsible for MAs(III) demethylation was cloned from Nostoc sp. PCC 7120 and heterologously expressed in an As-hypersensitive strain Escherichia coli AW3110 (ΔarsRBC). Expression of NsarsI was shown to confer MAs(III) resistance through arsenic demethylation. The purified NsArsI was further identified and functionally characterized in vitro. NsArsI existed mainly as the trimeric state, and the kinetic data were well-fit to the Hill equation with K0.5 = 7.55 ± 0.33 μM for MAs(III), Vmax = 0.79 ± 0.02 μM min(-1), and h = 2.7. Both of the NsArsI truncated derivatives lacking the C-terminal 10 residues (ArsI10) or 23 residues (ArsI23) had a reduced ability of MAs(III) demethylation. These results provide new insights for understanding the important role of cyanobacteria in arsenic biogeochemical cycling in the environment.

  18. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    Science.gov (United States)

    2010-01-01

    Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

  19. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Mishra Mukti N

    2010-07-01

    Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  20. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    Science.gov (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

    2013-03-01

    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  1. Snapshot of the eukaryotic gene expression in muskoxen rumen--a metatranscriptomic approach.

    Directory of Open Access Journals (Sweden)

    Meng Qi

    Full Text Available BACKGROUND: Herbivores rely on digestive tract lignocellulolytic microorganisms, including bacteria, fungi and protozoa, to derive energy and carbon from plant cell wall polysaccharides. Culture independent metagenomic studies have been used to reveal the genetic content of the bacterial species within gut microbiomes. However, the nature of the genes encoded by eukaryotic protozoa and fungi within these environments has not been explored using metagenomic or metatranscriptomic approaches. METHODOLOGY/PRINCIPAL FINDINGS: In this study, a metatranscriptomic approach was used to investigate the functional diversity of the eukaryotic microorganisms within the rumen of muskoxen (Ovibos moschatus, with a focus on plant cell wall degrading enzymes. Polyadenylated RNA (mRNA was sequenced on the Illumina Genome Analyzer II system and 2.8 gigabases of sequences were obtained and 59129 contigs assembled. Plant cell wall degrading enzyme modules including glycoside hydrolases, carbohydrate esterases and polysaccharide lyases were identified from over 2500 contigs. These included a number of glycoside hydrolase family 6 (GH6, GH48 and swollenin modules, which have rarely been described in previous gut metagenomic studies. CONCLUSIONS/SIGNIFICANCE: The muskoxen rumen metatranscriptome demonstrates a much higher percentage of cellulase enzyme discovery and an 8.7x higher rate of total carbohydrate active enzyme discovery per gigabase of sequence than previous rumen metagenomes. This study provides a snapshot of eukaryotic gene expression in the muskoxen rumen, and identifies a number of candidate genes coding for potentially valuable lignocellulolytic enzymes.

  2. Snapshot of the Eukaryotic Gene Expression in Muskoxen Rumen—A Metatranscriptomic Approach

    Science.gov (United States)

    O'Toole, Nicholas; Barboza, Perry S.; Ungerfeld, Emilio; Leigh, Mary Beth; Selinger, L. Brent; Butler, Greg; Tsang, Adrian; McAllister, Tim A.; Forster, Robert J.

    2011-01-01

    Background Herbivores rely on digestive tract lignocellulolytic microorganisms, including bacteria, fungi and protozoa, to derive energy and carbon from plant cell wall polysaccharides. Culture independent metagenomic studies have been used to reveal the genetic content of the bacterial species within gut microbiomes. However, the nature of the genes encoded by eukaryotic protozoa and fungi within these environments has not been explored using metagenomic or metatranscriptomic approaches. Methodology/Principal Findings In this study, a metatranscriptomic approach was used to investigate the functional diversity of the eukaryotic microorganisms within the rumen of muskoxen (Ovibos moschatus), with a focus on plant cell wall degrading enzymes. Polyadenylated RNA (mRNA) was sequenced on the Illumina Genome Analyzer II system and 2.8 gigabases of sequences were obtained and 59129 contigs assembled. Plant cell wall degrading enzyme modules including glycoside hydrolases, carbohydrate esterases and polysaccharide lyases were identified from over 2500 contigs. These included a number of glycoside hydrolase family 6 (GH6), GH48 and swollenin modules, which have rarely been described in previous gut metagenomic studies. Conclusions/Significance The muskoxen rumen metatranscriptome demonstrates a much higher percentage of cellulase enzyme discovery and an 8.7x higher rate of total carbohydrate active enzyme discovery per gigabase of sequence than previous rumen metagenomes. This study provides a snapshot of eukaryotic gene expression in the muskoxen rumen, and identifies a number of candidate genes coding for potentially valuable lignocellulolytic enzymes. PMID:21655220

  3. Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.

    Science.gov (United States)

    Scorpio, A; Zhang, Y

    1996-06-01

    Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.

  4. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    Science.gov (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  5. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

  6. Structural insights into the bacterial carbon - phosphorus lyase machinery

    DEFF Research Database (Denmark)

    Seweryn, Paulina; Van, Lan Bich; Kjeldgaard, Morten

    2015-01-01

    Phosphorus is required for all life and microorganisms can extract it from their environment through several metabolic pathways. When phosphate is in limited supply, some bacteria are able to use phosphonate compounds, which require specialized enzymatic machinery to break the stable carbon......–phosphorus (C–P) bond. Despite its importance, the details of how this machinery catabolizes phosphonates remain unknown. Here we determine the crystal structure of the 240-kilodalton Escherichia coli C–P lyase core complex (PhnG–PhnH–PhnI–PhnJ; PhnGHIJ), and show that it is a two-fold symmetric hetero...

  7. When genome-based approach meets the ‘old but good’: revealing genes involved in the antibacterial activity of Pseudomonas sp. P482 against soft rot pathogens.

    Directory of Open Access Journals (Sweden)

    Dorota Magdalena Krzyżanowska

    2016-05-01

    Full Text Available Dickeya solani and Pectobacterium carotovorum subsp. brasili¬ense are recently established species of bacterial plant pathogens causing black leg and soft rot of many vegetables and ornamental plants. Pseudomonas sp. strain P482 inhibits the growth of these pathogens, a desired trait considering the limited measures to combat these diseases. In this study, we determined the genetic background of the antibacterial activity of P482, and established the phylogenetic position of this strain.Pseudomonas sp. P482 was classified as Pseudomonas donghuensis. Genome mining revealed that the P482 genome does not contain genes determining the synthesis of known antimicrobials. However, the ClusterFinder algorithm, designed to detect atypical or novel classes of secondary metabolite gene clusters, predicted 18 such clusters in the genome. Screening of a Tn5 mutant library yielded an antimicrobial negative transposon mutant. The transposon insertion was located in a gene encoding an HpcH/HpaI aldolase/citrate lyase family protein. This gene is located in a hypothetical cluster predicted by the ClusterFinder, together with the downstream homologues of four nfs genes, that confer production of a nonfluorescent siderophore by P. donghuensis HYST. Site-directed inactivation of the HpcH/HpaI aldolase gene, the adjacent short chain dehydrogenase gene, as well as a homologue of an essential nfs cluster gene, all abolished the antimicrobial activity of the P482, suggesting their involvement in a common biosynthesis pathway. However, none of the mutants showed a decreased siderophore yield, neither was the antimicrobial activity of the wild type P482 compromised by high iron bioavailability.A genomic region comprising the nfs cluster and three upstream genes is involved in the antibacterial activity of P. donghuensis P482 against D. solani and P. carotovorum subsp. brasiliense. The genes studied are unique to the two known P. donghuensis strains. This study

  8. [Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

    Science.gov (United States)

    Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

    2014-01-01

    In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

  9. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  10. Sphingosine-1-Phosphate Lyase Deficient Cells as a Tool to Study Protein Lipid Interactions.

    Directory of Open Access Journals (Sweden)

    Mathias J Gerl

    Full Text Available Cell membranes contain hundreds to thousands of individual lipid species that are of structural importance but also specifically interact with proteins. Due to their highly controlled synthesis and role in signaling events sphingolipids are an intensely studied class of lipids. In order to investigate their metabolism and to study proteins interacting with sphingolipids, metabolic labeling based on photoactivatable sphingoid bases is the most straightforward approach. In order to monitor protein-lipid-crosslink products, sphingosine derivatives containing a reporter moiety, such as a radiolabel or a clickable group, are used. In normal cells, degradation of sphingoid bases via action of the checkpoint enzyme sphingosine-1-phosphate lyase occurs at position C2-C3 of the sphingoid base and channels the resulting hexadecenal into the glycerolipid biosynthesis pathway. In case the functionalized sphingosine looses the reporter moiety during its degradation, specificity towards sphingolipid labeling is maintained. In case degradation of a sphingosine derivative does not remove either the photoactivatable or reporter group from the resulting hexadecenal, specificity towards sphingolipid labeling can be achieved by blocking sphingosine-1-phosphate lyase activity and thus preventing sphingosine derivatives to be channeled into the sphingolipid-to-glycerolipid metabolic pathway. Here we report an approach using clustered, regularly interspaced, short palindromic repeats (CRISPR-associated nuclease Cas9 to create a sphingosine-1-phosphate lyase (SGPL1 HeLa knockout cell line to disrupt the sphingolipid-to-glycerolipid metabolic pathway. We found that the lipid and protein compositions as well as sphingolipid metabolism of SGPL1 knock-out HeLa cells only show little adaptations, which validates these cells as model systems to study transient protein-sphingolipid interactions.

  11. Nucleotide sequence, organization and expression of rdgA and rdgB genes that regulate pectin lyase production in the plant pathogenic bacterium Erwinia carotovora subsp. carotovora in response to DNA-damaging agents.

    Science.gov (United States)

    Liu, Y; Chatterjee, A; Chatterjee, A K

    1994-12-01

    In most soft-rotting Erwinia spp., including E. carotovora subsp. carotovora strain 71 (Ecc71), production of the plant cell wall degrading enzyme pectin lyase (Pnl) is activated by DNA-damaging agents such as mitomycin C (MC). Induction of Pnl production in Ecc71 requires a functional recA gene and the rdg locus. DNA sequencing and RNA analyses revealed that the rdg locus contains two regulatory genes, rdgA and rdgB, in separate transcriptional units. There is high homology between RdgA and repressors of lambdoid phages, specially phi 80. RdgB, however, has significant homology with transcriptional activators of Mu phage. Both RdgA and RdgB are also predicted to possess helix-turn-helix motifs. By replacing the rdgB promoter with the IPTG-inducible tac promoter, we have determined that rdgB by itself can activate Pnl production in Escherichia coli. However, deletion analysis of rdg+ DNA indicated that, when driven by their native promoters, functions of both rdgA and rdgB are required for the induction of pnlA expression by MC treatment. While rdgB transcription occurs only after MC treatment, a substantial level of rdgA mRNA is detected in the absence of MC treatment. Moreover, upon induction with MC, a new rdgA mRNA species, initiated from a different start site, is produced at a high level. Thus, the two closely linked rdgA and rdgB genes, required for the regulation of Pnl production, are expressed differently in Ecc71.

  12. Construction of a genetically modified wine yeast strain expressing the Aspergillus aculeatus rhaA gene, encoding an -L-Rhamnosidase of enological interest

    NARCIS (Netherlands)

    Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.

    2003-01-01

    The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain

  13. Identification and validation of human papillomavirus encoded microRNAs.

    Directory of Open Access Journals (Sweden)

    Kui Qian

    Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.

  14. The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

    Directory of Open Access Journals (Sweden)

    Sandro Roselli

    Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

  15. The Role of OmpR in the Expression of Genes of the KdgR Regulon Involved in the Uptake and Depolymerization of Oligogalacturonides in Yersinia enterocolitica

    Directory of Open Access Journals (Sweden)

    Marta Nieckarz

    2017-08-01

    Full Text Available Oligogalacturonide (OGA-specific porins of the KdgM family have previously been identified and characterized in enterobacterial plant pathogens. We found that deletion of the gene encoding response regulator OmpR causes the porin KdgM2 to become one of the most abundant proteins in the outer membrane of the human enteropathogen Yersinia enterocolitica. Reporter gene fusion and real-time PCR analysis confirmed that the expression of kdgM2 is repressed by OmpR. We also found that kdgM2 expression is subject to negative regulation by KdgR, a specific repressor of genes involved in the uptake and metabolism of pectin derivatives in plant pathogens. The additive effect of kdgR and ompR mutations suggested that KdgR and OmpR regulate kdgM2 expression independently. We confirmed that kdgM2 occurs in an operon with the pelP gene, encoding the periplasmic pectate lyase PelP. A pectinolytic assay showed strong upregulation of PelP production/activity in a Y. enterocolitica strain lacking OmpR and KdgR, which corroborates the repression exerted by these regulators on kdgM2. In addition, our data showed that OmpR is responsible for up regulation of the kdgM1 gene encoding the second specific oligogalacturonide porin KdgM1. This indicates the involvement of OmpR in the reciprocal regulation of both KdgM1 and KdgM2. Moreover, we demonstrated the negative impact of OmpR on kdgR transcription, which might positively affect the expression of genes of the KdgR regulon. Binding of OmpR to the promoter regions of the kdgM2-pelP-sghX operon, and kdgM1 and kdgR genes was confirmed using the electrophoretic mobility shift assay, suggesting that OmpR can directly regulate their transcription. We also found that the overexpression of porin KdgM2 increases outer membrane permeability. Thus, OmpR-mediated regulation of the KdgM porins may contribute to the fitness of Y. enterocolitica in particular local environments.

  16. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  17. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  18. Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

    Directory of Open Access Journals (Sweden)

    Wang Yu

    2011-04-01

    Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15

  19. Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1.

    Science.gov (United States)

    Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang

    2011-04-06

    In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and

  20. A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

    Science.gov (United States)

    Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

    2017-01-01

    Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

  1. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  2. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  3. Direct Activation of Amidohydrolase Domain-Containing 1 Gene by Thyroid Hormone Implicates a Role in the Formation of Adult Intestinal Stem Cells During Xenopus Metamorphosis.

    Science.gov (United States)

    Okada, Morihiro; Miller, Thomas C; Fu, Liezhen; Shi, Yun-Bo

    2015-09-01

    The T3-dependent anuran metamorphosis resembles postembryonic development in mammals, the period around birth when plasma T3 levels peak. In particular, the remodeling of the intestine during metamorphosis mimics neonatal intestinal maturation in mammals when the adult intestinal epithelial self-renewing system is established. We have been using intestinal metamorphosis to investigate how the organ-specific adult stem cells are formed during vertebrate development. Early studies in Xenopus laevis have shown that this process involves complete degeneration of the larval epithelium and de novo formation of adult stem cells. A tissue-specific microarray analysis of intestinal gene expression during Xenopus laevis metamorphosis has identified a number of candidate stem cell genes. Here we have carried out detailed analyses of one such gene, amidohydrolase domain containing 1 (AMDHD1) gene, which encodes an enzyme in the histidine catabolic pathway. We show that AMDHD1 is exclusively expressed in the proliferating adult epithelial stem cells during metamorphosis with little expression in other intestinal tissues. We further provide evidence that T3 activates AMDHD1 gene expression directly at the transcription level through T3 receptor binding to the AMDHD1 gene in the intestine. In addition, we have reported earlier that histidine ammonia-lyase gene, another gene in histidine catabolic pathway, is similarly regulated by T3 in the intestine. These results together suggest that histidine catabolism plays a critical role in the formation and/or proliferation of adult intestinal stem cells during metamorphosis.

  4. Gene activation by UV light, fungal elicitor or fungal infection in Petroselinum crispum is correlated with repression of cell cycle-related genes

    International Nuclear Information System (INIS)

    Logemann, E.; Wu ShengCheng; Schröder, J.; Schmelzer, E.; Somssich, I.E.; Hahlbrock, K.

    1995-01-01

    The effects of UV light or fungal elicitors on plant cells have so far been studied mostly with respect to defense-related gene activation. Here, an inverse correlation of these stimulatory effects with the activities of several cell cycle-related genes is demonstrated. Concomitant with the induction of flavonoid biosynthetic enzymes in UV-irradiated cell suspension cultures of parsley (Petroselinum crispum), total histone synthesis declined to about half the initial rate. A subclass of the histone H3 gene family was selected to demonstrate the close correlation of its expression with cell division, both in intact plants and cultured cells. Using RNA-blot and run-on transcription assays, it was shown that one arbitrarily selected subclass of each of the histone H2A, H2B, H3 and H4 gene families and of the genes encoding a p34cdc2 protein kinase and a mitotic cyclin were transcriptionally repressed in UV-irradiated as well as fungal elicitor-treated parsley cells. The timing and extent of repression differed between the two stimuli; the response to light was more transient and smaller in magnitude. These differential responses to light and elicitor were inversely correlated with the induction of phenylalanine ammonia-lyase, a key enzyme of phenylpropanoid metabolism. Essentially the same result was obtained with a defined oligopeptide elicitor, indicating that the same signaling pathway is responsible for defense-related gene activation and cell cycle-related gene repression. A temporary (UV light) or long-lasting (fungal elicitor) cessation of cell culture growth is most likely due to an arrest of cell division which may be a prerequisite for full commitment of the cells to transcriptional activation of full commitment of the cells to transcriptional activation of pathways involved in UV protection or pathogen defense. This conclusion is corroborated by the observation that the histone H3 mRNA level greatly declined around fungal infection sites in young parsley

  5. Molecular Cloning and Nucleotide Sequence of the Gene Encoding the Major Peptidoglycan Hydrolase of Lactococcus lactis, a Muramidase Needed for Cell Separation

    NARCIS (Netherlands)

    Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.

    A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,

  6. Linkage of the gene that encodes the alpha 1 chain of type V collagen (COL5A1) to type II Ehlers-Danlos syndrome (EDS II).

    Science.gov (United States)

    Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B

    1995-09-01

    Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.

  7. Molecular analysis of human argininosuccinate lyase: Mutant characterization and alternative splicing of the coding region

    International Nuclear Information System (INIS)

    Walker, D.C.; McCloskey, D.A.; Simard, L.R.; McInnes, R.R.

    1990-01-01

    Argininosuccinic acid lyase (ASAL) deficiency is a clinically heterogeneous autosomal recessive urea cycle disorder. The authors previously established by complementation analysis that 29 ASAL-deficient patients have heterogeneous mutations in a single gene. To prove that the ASAL structural gene is the affected locus, they sequenced polymerase chain reaction-amplified ASAL cDNA of a representative mutant from the single complementation group. Fibroblast strain 944 from a late-onset patient who was the product of a consanguineous mating, had only a single base-pair change in the coding region, a C-283→ T transition at a CpG dinucleotide in exon 3. This substitution converts Arg-95 to Cys (R95C), occurs in a stretch of 13 residues that is identical in yeast and human ASAL, and was present in both of the patient's alleles but not in 14 other mutant or 10 normal alleles. They observed that amplified cDNA from mutant 944 and normal cells (liver, keratinocytes, lymphoblasts, and fibroblasts) contained, in addition to the expected 5' 513-base-pair band, a prominent 318-base-pair ASAL band formed by the splicing of exon 2 from the transcript. The short transcript maintains the ASAL reading frame but removes Lys-51, a residue that may be essential for catalysis, since it binds the argininosuccinate substrate. They conclude (i) that the identification of the R95C mutation in strain 944 demonstrates that virtually all ASAL deficiency results from defects in the ASAL structural gene and (ii) that minor alternative splicing of the coding region occurs at the ASAL locus

  8. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  9. A member of a new plant gene family encoding a meprin and TRAF homology (MATH) domain-containing protein is involved in restriction of long distance movement of plant viruses

    Science.gov (United States)

    Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie

    2010-01-01

    Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558

  10. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

    Science.gov (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

    2009-08-01

    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  11. One Year Experience of Pheburane® (Sodium Phenylbutyrate) Treatment in a Patient with Argininosuccinate Lyase Deficiency

    OpenAIRE

    Uçar, Sema Kalkan; Ozbaran, Burcu; Altinok, Yasemin Atik; Kose, Melis; Canda, Ebru; Kagnici, Mehtap; Coker, Mahmut

    2015-01-01

    Argininosuccinate lyase deficiency (ASLD) is a urea cycle disorder (UCD) treated with dietary adjustment and nitrogen scavenging agents. “Pheburane®” is a new tasteless and odour-free formulation of sodium phenylbutyrate, indicated in the treatment of UCD.

  12. MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

    NARCIS (Netherlands)

    ENGEL, H; KAZEMIER, B; KECK, W

    The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

  13. Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))

    1988-11-01

    The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

  14. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  15. Virally encoded 7TM receptors

    DEFF Research Database (Denmark)

    Rosenkilde, M M; Waldhoer, M; Lüttichau, H R

    2001-01-01

    expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...

  16. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  17. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  18. Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme.

    Science.gov (United States)

    Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O

    1998-01-01

    All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

  19. Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes

    Directory of Open Access Journals (Sweden)

    Nandagopal Murugan

    2018-02-01

    Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.

  20. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  1. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  2. Levels of potential bioactive compounds including carotenoids, vitamin C and phenolic compounds, and expression of their cognate biosynthetic genes vary significantly in different varieties of potato (Solanum tuberosum L.) grown under uniform cultural conditions.

    Science.gov (United States)

    Valcarcel, Jesus; Reilly, Kim; Gaffney, Michael; O'Brien, Nora M

    2016-02-01

    In addition to their high carbohydrate content, potatoes are also an important dietary source of vitamin C and bioactive secondary metabolites, including phenolic compounds and carotenoids, which have been suggested to play a role in human health. The expression of genes encoding key enzymes involved in the synthesis of these compounds was assessed by reverse transcription-quantitative polymerase chain reaction and compared to the accumulation of the corresponding product in seven potato varieties showing contrasting levels of metabolite accumulation. Strong positive correlations were found between phenolic content in the flesh of tubers and transcript levels of phenylalanine ammonia lyase (PAL) and chalcone synthase (CHS) genes. The expression of PAL and CHS was also related to that of AN1, a transcription factor involved in the synthesis of anthocyanins, suggesting that these genes are regulated in a coordinated manner. No clear relationship was found between transcript levels of phytoene synthase (PSY) or L-galactono-1,4-lactone dehydrogenase (GLDH) genes and total carotenoid or vitamin C accumulation, respectively. Data indicate that levels of total phenolic and flavonoid compounds in potato are controlled primarily by PAL and CHS gene expression. Transcript levels of PSY and GLDH did not control accumulation of carotenoids or vitamin C. © 2015 Society of Chemical Industry.

  3. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  4. Activation of the jasmonic acid pathway by depletion of the hydroperoxide lyase OsHPL3 reveals crosstalk between the HPL and AOS branches of the oxylipin pathway in rice.

    Directory of Open Access Journals (Sweden)

    Xiaoqiang Liu

    Full Text Available The allene oxide synthase (AOS and hydroperoxide lyase (HPL branches of the oxylipin pathway, which underlie the production of jasmonates and aldehydes, respectively, function in plant responses to a range of stresses. Regulatory crosstalk has been proposed to exist between these two signaling branches; however, there is no direct evidence of this. Here, we identified and characterized a jasmonic acid (JA overproduction mutant, cea62, by screening a rice T-DNA insertion mutant library for lineages that constitutively express the AOS gene. Map-based cloning was used to identify the underlying gene as hydroperoxide lyase OsHPL3. HPL3 expression and the enzyme activity of its product, (E-2-hexenal, were depleted in the cea62 mutant, which resulted in the dramatic overproduction of JA, the activation of JA signaling, and the emergence of the lesion mimic phenotype. A time-course analysis of lesion formation and of the induction of defense responsive genes in the cea62 mutant revealed that the activation of JA biosynthesis and signaling in cea62 was regulated in a developmental manner, as was OsHPL3 activity in the wild-type plant. Microarray analysis showed that the JA-governed defense response was greatly activated in cea62 and this plant exhibited enhanced resistance to the T1 strain of the bacterial blight pathogen Xanthomonasoryzaepvoryzae (Xoo. The wounding response was attenuated in cea62 plants during the early stages of development, but partially recovered when JA levels were elevated during the later stages. In contrast, the wounding response was not altered during the different developmental stages of wild-type plants. These findings suggest that these two branches of the oxylipin pathway exhibit crosstalk with regards to biosynthesis and signaling and cooperate with each other to function in diverse stress responses.

  5. In vitro efficacy of a gene-activated nerve guidance conduit incorporating non-viral PEI-pDNA nanoparticles carrying genes encoding for NGF, GDNF and c-Jun.

    Science.gov (United States)

    Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J

    2018-06-07

    Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate

  6. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-07-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  7. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    Science.gov (United States)

    Xu, J; Johnson, R C

    1995-06-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.

  8. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  9. Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

    Science.gov (United States)

    Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

    1998-01-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023

  10. Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics.

    Science.gov (United States)

    Allignet, J; Liassine, N; el Solh, N

    1998-07-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.

  11. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

    Science.gov (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

    1997-07-01

    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  12. Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

    Science.gov (United States)

    Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

    1999-07-01

    The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

  13. Associations between variants of the HAL gene and milk production traits in Chinese Holstein cows.

    Science.gov (United States)

    Wang, Haifei; Jiang, Li; Wang, Wenwen; Zhang, Shengli; Yin, Zongjun; Zhang, Qin; Liu, Jian-Feng

    2014-11-25

    The histidine ammonia-lyse gene (HAL) encodes the histidine ammonia-lyase, which catalyzes the first reaction of histidine catabolism. In our previous genome-wide association study in Chinese Holstein cows to identify genetic variants affecting milk production traits, a SNP (rs41647754) located 357 bp upstream of HAL, was found to be significantly associated with milk yield and milk protein yield. In addition, the HAL gene resides within the reported QTLs for milk production traits. The aims of this study were to identify genetic variants in HAL and to test the association between these variants and milk production traits. Fifteen SNPs were identified within the regions under study of the HAL gene, including three coding mutations, seven intronic mutations, one promoter region mutation, and four 3'UTR mutations. Nine of these identified SNPs were chosen for subsequent genotyping and association analyses. Our results showed that five SNP markers (ss974768522, ss974768525, ss974768531, ss974768533 and ss974768534) were significantly associated with one or more milk production traits. Haplotype analysis showed that two haplotype blocks were significantly associated with milk yield and milk protein yield, providing additional support for the association between HAL variants and milk production traits in dairy cows (P HAL gene and milk production traits in Chinese Holstein cows, indicating the potential role of HAL variants in these traits. These identified SNPs may serve as genetic markers used in genomic selection schemes to accelerate the genetic gains of milk production traits in dairy cattle.

  14. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  15. The Drosophila melanogaster DmCK2beta transcription unit encodes for functionally non-redundant protein isoforms.

    Science.gov (United States)

    Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas

    2006-06-07

    Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes