
Sample records for luxr homologue vjbr

  1. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue (United States)

    Shao, Chung-Ping; Hor, Lien-I


    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  2. VanT, a homologue of Vibrio harveyi LuxR, regulates serine, metalloprotease, pigment, and biofilm production in Vibrio anguillarum. (United States)

    Croxatto, Antony; Chalker, Victoria J; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L


    Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum Delta vanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the Delta vanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an L-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum Delta vanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production.

  3. Census of solo LuxR genes in prokaryotic genomes. (United States)

    Hudaiberdiev, Sanjarbek; Choudhary, Kumari S; Vera Alvarez, Roberto; Gelencsér, Zsolt; Ligeti, Balázs; Lamba, Doriano; Pongor, Sándor


    luxR genes encode transcriptional regulators that control acyl homoserine lactone-based quorum sensing (AHL QS) in Gram negative bacteria. On the bacterial chromosome, luxR genes are usually found next or near to a luxI gene encoding the AHL signal synthase. Recently, a number of luxR genes were described that have no luxI genes in their vicinity on the chromosome. These so-called solo luxR genes may either respond to internal AHL signals produced by a non-adjacent luxI in the chromosome, or can respond to exogenous signals. Here we present a survey of solo luxR genes found in complete and draft bacterial genomes in the NCBI databases using HMMs. We found that 2698 of the 3550 luxR genes found are solos, which is an unexpectedly high number even if some of the hits may be false positives. We also found that solo LuxR sequences form distinct clusters that are different from the clusters of LuxR sequences that are part of the known luxR-luxI topological arrangements. We also found a number of cases that we termed twin luxR topologies, in which two adjacent luxR genes were in tandem or divergent orientation. Many of the luxR solo clusters were devoid of the sequence motifs characteristic of AHL binding LuxR proteins so there is room to speculate that the solos may be involved in sensing hitherto unknown signals. It was noted that only some of the LuxR clades are rich in conserved cysteine residues. Molecular modeling suggests that some of the cysteines may be involved in disulfide formation, which makes us speculate that some LuxR proteins, including some of the solos may be involved in redox regulation.

  4. Systems analysis of pathogenicity BvrR/BvrS, VjbR and VirB in Brucella canis and Brucella abortus 2308

    International Nuclear Information System (INIS)

    Soto Eduarte, Maria Fernanda


    An association between the expression of the system of two BvrR/BvrS components is established with respect to the expression of proteins VirB and VjbR. The expression patterns are compared between the species B. abortus 2308 and B. canis 206-10. Strains of B. abortus and B. canis were isolated at the Escuela de Medicina Veterinaria of the Universidad Nacional de Costa Rica from an aborted fetus. The expressions of BvrR and BvrS are determined in different points of the growth curve of B. abortus 2308 and B. canis 206-10. The expressions of VjbR and VirB are defined in different points of the growth curve of B. abortus 2308 and B. canis 206-10. The expression patterns of BvrR, BvrS, VjbR and VirB are compared in different points curve of B. abortus 2308 and B. canis 206-10. The experimental analysis has required a series of reagents, equipment and fundamental materials such as: laminar flow chamber, spectrophotometer, agitator with temperature-controlled, ELISA plate reader, stirrer template, culture media, disposable plastic material, chambers for electrophoresis and Western blot, etc. [es

  5. A combination of luxR1 and luxR2 genes activates Pr-promoters of psychrophilic Aliivibrio logei lux-operon independently of chaperonin GroEL/ES and protease Lon at high concentrations of autoinducer. (United States)

    Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V


    Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. A walk into the LuxR regulators of Actinobacteria: phylogenomic distribution and functional diversity.

    Directory of Open Access Journals (Sweden)

    Catarina Lopes Santos

    Full Text Available LuxR regulators are a widely studied group of bacterial helix-turn-helix (HTH transcription factors involved in the regulation of many genes coding for important traits at an ecological and medical level. This regulatory family is particularly known by their involvement in quorum-sensing (QS mechanisms, i.e., in the bacterial ability to communicate through the synthesis and binding of molecular signals. However, these studies have been mainly focused on gram-negative organisms, and the presence of LuxR regulators in the gram-positive Actinobacteria phylum is still poorly explored. In this manuscript, the presence of LuxR regulators among Actinobacteria was assayed using a domain-based strategy. A total of 991 proteins having one LuxR domain were identified in 53 genome-sequenced actinobacterial species, of which 59% had an additional domain. In most cases (53% this domain was REC (receiver domain, suggesting that LuxR regulators in Actinobacteria may either function as single transcription factors or as part of two-component systems. The frequency, distribution and evolutionary stability of each of these sub-families of regulators was analyzed and contextualized regarding the ecological niche occupied by each organism. The results show that the presence of extra-domains in the LuxR-regulators was likely driven by a general need to physically uncouple the signal sensing from the signal transduction. Moreover, the total frequency of LuxR regulators was shown to be dependent on genetic, metabolic and ecological variables. Finally, the functional annotation of the LuxR regulators revealed that the bacterial ecological niche has biased the specialization of these proteins. In the case of pathogens, our results suggest that LuxR regulators can be involved in virulence and are therefore promising targets for future studies in the health-related biotechnology field.

  7. A Walk into the LuxR Regulators of Actinobacteria: Phylogenomic Distribution and Functional Diversity (United States)

    Santos, Catarina Lopes; Correia-Neves, Margarida; Moradas-Ferreira, Pedro; Mendes, Marta Vaz


    LuxR regulators are a widely studied group of bacterial helix-turn-helix (HTH) transcription factors involved in the regulation of many genes coding for important traits at an ecological and medical level. This regulatory family is particularly known by their involvement in quorum-sensing (QS) mechanisms, i.e., in the bacterial ability to communicate through the synthesis and binding of molecular signals. However, these studies have been mainly focused on Gram-negative organisms, and the presence of LuxR regulators in the Gram-positive Actinobacteria phylum is still poorly explored. In this manuscript, the presence of LuxR regulators among Actinobacteria was assayed using a domain-based strategy. A total of 991 proteins having one LuxR domain were identified in 53 genome-sequenced actinobacterial species, of which 59% had an additional domain. In most cases (53%) this domain was REC (receiver domain), suggesting that LuxR regulators in Actinobacteria may either function as single transcription factors or as part of two-component systems. The frequency, distribution and evolutionary stability of each of these sub-families of regulators was analyzed and contextualized regarding the ecological niche occupied by each organism. The results show that the presence of extra-domains in the LuxR-regulators was likely driven by a general need to physically uncouple the signal sensing from the signal transduction. Moreover, the total frequency of LuxR regulators was shown to be dependent on genetic, metabolic and ecological variables. Finally, the functional annotation of the LuxR regulators revealed that the bacterial ecological niche has biased the specialization of these proteins. In the case of pathogens, our results suggest that LuxR regulators can be involved in virulence and are therefore promising targets for future studies in the health-related biotechnology field. PMID:23056438

  8. A bioinformatic survey of distribution, conservation, and probable functions of LuxR solo regulators in bacteria (United States)

    Subramoni, Sujatha; Florez Salcedo, Diana Vanessa; Suarez-Moreno, Zulma R.


    LuxR solo transcriptional regulators contain both an autoinducer binding domain (ABD; N-terminal) and a DNA binding Helix-Turn-Helix domain (HTH; C-terminal), but are not associated with a cognate N-acyl homoserine lactone (AHL) synthase coding gene in the same genome. Although a few LuxR solos have been characterized, their distributions as well as their role in bacterial signal perception and other processes are poorly understood. In this study we have carried out a systematic survey of distribution of all ABD containing LuxR transcriptional regulators (QS domain LuxRs) available in the InterPro database (IPR005143), and identified those lacking a cognate AHL synthase. These LuxR solos were then analyzed regarding their taxonomical distribution, predicted functions of neighboring genes and the presence of complete AHL-QS systems in the genomes that carry them. Our analyses reveal the presence of one or multiple predicted LuxR solos in many proteobacterial genomes carrying QS domain LuxRs, some of them harboring genes for one or more AHL-QS circuits. The presence of LuxR solos in bacteria occupying diverse environments suggests potential ecological functions for these proteins beyond AHL and interkingdom signaling. Based on gene context and the conservation levels of invariant amino acids of ABD, we have classified LuxR solos into functionally meaningful groups or putative orthologs. Surprisingly, putative LuxR solos were also found in a few non-proteobacterial genomes which are not known to carry AHL-QS systems. Multiple predicted LuxR solos in the same genome appeared to have different levels of conservation of invariant amino acid residues of ABD questioning their binding to AHLs. In summary, this study provides a detailed overview of distribution of LuxR solos and their probable roles in bacteria with genome sequence information. PMID:25759807

  9. A bioinformatic survey of distribution, conservation, and probable functions of LuxR solo regulators in bacteria. (United States)

    Subramoni, Sujatha; Florez Salcedo, Diana Vanessa; Suarez-Moreno, Zulma R


    LuxR solo transcriptional regulators contain both an autoinducer binding domain (ABD; N-terminal) and a DNA binding Helix-Turn-Helix domain (HTH; C-terminal), but are not associated with a cognate N-acyl homoserine lactone (AHL) synthase coding gene in the same genome. Although a few LuxR solos have been characterized, their distributions as well as their role in bacterial signal perception and other processes are poorly understood. In this study we have carried out a systematic survey of distribution of all ABD containing LuxR transcriptional regulators (QS domain LuxRs) available in the InterPro database (IPR005143), and identified those lacking a cognate AHL synthase. These LuxR solos were then analyzed regarding their taxonomical distribution, predicted functions of neighboring genes and the presence of complete AHL-QS systems in the genomes that carry them. Our analyses reveal the presence of one or multiple predicted LuxR solos in many proteobacterial genomes carrying QS domain LuxRs, some of them harboring genes for one or more AHL-QS circuits. The presence of LuxR solos in bacteria occupying diverse environments suggests potential ecological functions for these proteins beyond AHL and interkingdom signaling. Based on gene context and the conservation levels of invariant amino acids of ABD, we have classified LuxR solos into functionally meaningful groups or putative orthologs. Surprisingly, putative LuxR solos were also found in a few non-proteobacterial genomes which are not known to carry AHL-QS systems. Multiple predicted LuxR solos in the same genome appeared to have different levels of conservation of invariant amino acid residues of ABD questioning their binding to AHLs. In summary, this study provides a detailed overview of distribution of LuxR solos and their probable roles in bacteria with genome sequence information.

  10. A bioinformatic survey of distribution, conservation and probable functions of LuxR solo regulators in bacteria

    Directory of Open Access Journals (Sweden)

    Sujatha eSubramoni


    Full Text Available LuxR solo transcriptional regulators contain both an autoinducer binding domain (ABD; N-terminal and a DNA binding Helix-Turn-Helix domain (HTH; C-terminal, but are not associated with a cognate N-acyl homoserine lactone (AHL synthase coding gene in the same genome. Although a few LuxR solos have been characterized, their distributions as well as their role in bacterial signal perception and other processes are poorly understood. In this study we have carried out a systematic survey of distribution of all ABD containing LuxR transcriptional regulators (QS domain LuxRs available in the InterPro database (IPR005143, and identified those lacking a cognate AHL synthase. These LuxR solos were then analyzed regarding their taxonomical distribution, predicted functions of neighboring genes and the presence of complete AHL-QS systems in the genomes that carry them. Our analyses reveal the presence of one or multiple predicted LuxR solos in many proteobacterial genomes carrying QS domain LuxRs, some of them harboring genes for one or more AHL-QS circuits. The presence of LuxR solos in bacteria occupying diverse environments suggests potential ecological functions for these proteins beyond AHL and interkingdom signaling. Based on gene context and the conservation levels of invariant amino acids of ABD, we have classified LuxR solos into functionally meaningful groups or putative orthologs. Surprisingly, putative LuxR solos were also found in a few non-proteobacterial genomes which are not known to carry AHL-QS systems. Multiple predicted LuxR solos in the same genome appeared to have different levels of conservation of invariant amino acid residues of ABD questioning their binding to AHLs. In summary, this study provides a detailed overview of distribution of LuxR solos and their probable roles in bacteria with genome sequence information.

  11. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex


    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  12. Halogenated furanones inhibit quorum sensing through accelerated LuxR turnover

    DEFF Research Database (Denmark)

    Manefield, M.; Rasmussen, Thomas Bovbjerg; Henzter, M.


    fischeri overproduced in Escherichia coli. Whilst a stable interaction between the algal metabolite and the bacterial protein was not found, it was noted by Western analysis that the half-life of the protein is reduced up to 100-fold in the presence of halogenated furanones. This suggests that halogenated...... that the reduction in LuxR concentration is the mechanism by which furanones control expression of AHL-dependent phenotypes. The mode of action by which halogenated furanones reduce cellular concentrations of the LuxR protein remains to be characterized....

  13. Computational Exploration of Putative LuxR Solos in Archaea and Their Functional Implications in Quorum Sensing (United States)

    Rajput, Akanksha; Kumar, Manoj


    LuxR solos are unexplored in Archaea, despite their vital role in the bacterial regulatory network. They assist bacteria in perceiving acyl homoserine lactones (AHLs) and/or non-AHLs signaling molecules for establishing intraspecies, interspecies, and interkingdom communication. In this study, we explored the potential LuxR solos of Archaea from InterPro v62.0 meta-database employing taxonomic, probable function, distribution, and evolutionary aspects to decipher their role in quorum sensing (QS). Our bioinformatics analyses showed that putative LuxR solos of Archaea shared few conserved domains with bacterial LuxR despite having less similarity within proteins. Functional characterization revealed their ability to bind various AHLs and/or non-AHLs signaling molecules that involve in QS cascades alike bacteria. Further, the phylogenetic study indicates that Archaeal LuxR solos (with less substitution per site) evolved divergently from bacteria and share distant homology along with instances of horizontal gene transfer. Moreover, Archaea possessing putative LuxR solos, exhibit the correlation between taxonomy and ecological niche despite being the inhabitant of diverse habitats like halophilic, thermophilic, barophilic, methanogenic, and chemolithotrophic. Therefore, this study would shed light in deciphering the role of the putative LuxR solos of Archaea to adapt varied habitats via multilevel communication with other organisms using QS. PMID:28515720

  14. Computational Exploration of Putative LuxR Solos in Archaea and Their Functional Implications in Quorum Sensing

    Directory of Open Access Journals (Sweden)

    Akanksha Rajput


    Full Text Available LuxR solos are unexplored in Archaea, despite their vital role in the bacterial regulatory network. They assist bacteria in perceiving acyl homoserine lactones (AHLs and/or non-AHLs signaling molecules for establishing intraspecies, interspecies, and interkingdom communication. In this study, we explored the potential LuxR solos of Archaea from InterPro v62.0 meta-database employing taxonomic, probable function, distribution, and evolutionary aspects to decipher their role in quorum sensing (QS. Our bioinformatics analyses showed that putative LuxR solos of Archaea shared few conserved domains with bacterial LuxR despite having less similarity within proteins. Functional characterization revealed their ability to bind various AHLs and/or non-AHLs signaling molecules that involve in QS cascades alike bacteria. Further, the phylogenetic study indicates that Archaeal LuxR solos (with less substitution per site evolved divergently from bacteria and share distant homology along with instances of horizontal gene transfer. Moreover, Archaea possessing putative LuxR solos, exhibit the correlation between taxonomy and ecological niche despite being the inhabitant of diverse habitats like halophilic, thermophilic, barophilic, methanogenic, and chemolithotrophic. Therefore, this study would shed light in deciphering the role of the putative LuxR solos of Archaea to adapt varied habitats via multilevel communication with other organisms using QS.

  15. XocR, a LuxR solo required for virulence in Xanthomonas oryzae pv. oryzicola. (United States)

    Xu, Huiyong; Zhao, Yancun; Qian, Guoliang; Liu, Fengquan


    Xanthomonas oryzae pv. oryzicola (Xoc) causes bacterial leaf streak (BLS) in rice, a serious bacterial disease of rice in Asia and parts of Africa. The virulence mechanisms of Xoc are not entirely clear and control measures for BLS are poorly developed. The solo LuxR proteins are widespread and shown to be involved in virulence in some plant associated bacteria (PAB). Here, we have cloned and characterized a PAB LuxR solo from Xoc, named as XocR. Mutation of xocR almost completely impaired the virulence ability of Xoc on host rice, but did not alter the ability to trigger HR (hypersensitive response, a programmed cell death) on non-host (plant) tobacco, suggesting the diversity of function of xocR in host and non-host plants. We also provide evidence to show that xocR is involved in the regulation of growth-independent cell motility in response to a yet-to-be-identified rice signal, as mutation of xocR impaired cell swimming motility of wild-type Rs105 in the presence but not absence of rice macerate. We further found that xocR regulated the transcription of two characterized virulence-associated genes (recN and trpE) in the presence of rice macerate. The promoter regions of recN and trpE possessed a potential binding motif (an imperfect pip box-like element) of XocR, raising the possibility that XocR might directly bind the promoter regions of these two genes to regulate their transcriptional activity. Our studies add a new member of PAB LuxR solos and also provide new insights into the role of PAB LuxR solo in the virulence of Xanthomonas species.

  16. Stenotrophomonas maltophilia responds to exogenous AHL signals through the LuxR solo SmoR (Smlt1839). (United States)

    Martínez, Paula; Huedo, Pol; Martinez-Servat, Sònia; Planell, Raquel; Ferrer-Navarro, Mario; Daura, Xavier; Yero, Daniel; Gibert, Isidre


    Quorum Sensing (QS) mediated by Acyl Homoserine Lactone (AHL) molecules are probably the most widespread and studied among Gram-negative bacteria. Canonical AHL systems are composed by a synthase (LuxI family) and a regulator element (LuxR family), whose genes are usually adjacent in the genome. However, incomplete AHL-QS machinery lacking the synthase LuxI is frequently observed in Proteobacteria, and the regulator element is then referred as LuxR solo. It has been shown that certain LuxR solos participate in interspecific communication by detecting signals produced by different organisms. In the case of Stenotrophomonas maltophilia, a preliminary genome sequence analysis revealed numerous putative luxR genes, none of them associated to a luxI gene. From these, the hypothetical LuxR solo Smlt1839, here designated SmoR, presents a conserved AHL binding domain and a helix-turn-helix DNA binding motif. Its genomic organization-adjacent to hchA gene-indicate that SmoR belongs to the new family "LuxR regulator chaperone HchA-associated." AHL-binding assays revealed that SmoR binds to AHLs in-vitro, at least to oxo-C8-homoserine lactone, and it regulates operon transcription, likely by recognizing a conserved palindromic regulatory box in the hchA upstream region. Supplementation with concentrated supernatants from Pseudomonas aeruginosa, which contain significant amounts of AHLs, promoted swarming motility in S. maltophilia. Contrarily, no swarming stimulation was observed when the P. aeruginosa supernatant was treated with the lactonase AiiA from Bacillus subtilis, confirming that AHL contributes to enhance the swarming ability of S. maltophilia. Finally, mutation of smoR resulted in a swarming alteration and an apparent insensitivity to the exogenous AHLs provided by P. aeruginosa. In conclusion, our results demonstrate that S. maltophilia senses AHLs produced by neighboring bacteria through the LuxR solo SmoR, regulating population behaviors such as swarming

  17. Roles of a solo LuxR in the biological control agent Lysobacter enzymogenes strain OH11. (United States)

    Qian, Guoliang; Xu, Feifei; Venturi, Vittorio; Du, Liangcheng; Liu, Fengquan


    Lysobacter enzymogenes is a ubiquitous plant-associated and environmentally friendly bacterium emerging as a novel biological control agent of plant disease. This bacterium produces diverse antifungal factors, such as lytic enzymes and a secondary metabolite (heat-stable antifungal factor [HSAF]) having antifungal activity with a novel structure and mode of action. The regulatory mechanisms for biosynthesis of antifungal factors is largely unknown in L. enzymogenes. The solo LuxR proteins have been shown to be widespread, playing important roles in plant-associated bacteria. Here, we cloned and studied a solo LuxR protein, LesR, from L. enzymogenes strain OH11. Overexpression but not deletion of lesR significantly impaired HSAF biosynthesis levels and antimicrobial activities but did not show visible effect on production of major lytic enzymes. Overexpression of lesR also led to remarkably accelerated cell aggregation and induced production of a melanin-like pigment in L. enzymogenes; these two phenotypes are mediated by the diffusible factor cell-to-cell signaling system of L. enzymogenes. The C-terminus helix-turn-helix domain was shown to be critical for several lesR-controlled functions. Overall, our study provides the first example of the roles and mechanisms of a solo LuxR protein in a plant-associated L. enzymogenes.

  18. Exploring the selectivity of auto-inducer complex with LuxR using molecular docking, mutational studies and molecular dynamics simulations (United States)

    Rajamanikandan, Sundaraj; Srinivasan, Pappu


    Bacteria communicate with one another using extracellular signaling molecules called auto-inducers (AHLs), a process termed as quorum sensing. The quorum sensing process allows bacteria to regulate various physiological activities. In this regard, quorum sensing master regulator LuxR from Vibrio harveyi represents an attractive therapeutic target for the development of novel anti-quorum sensing agents. Eventhough the binding of AHL complex with LuxR is evidenced in earlier reports, but their mode of binding is not clearly determined. Therefore, in the present work, molecular docking, in silico mutational studies, molecular dynamics simulations and free energy calculations were performed to understand the selectivity of AHL into the binding site of LuxR. The results revealed that Asn133 and Gln137 residues play a crucial role in recognizing AHL more effectively into the binding site of LuxR with good binding free energy. In addition to that, the carbonyl group presents in the lactone ring and amide group of AHL plays a vital role in the formation of hydrogen bond interactions with the protein. Further, structure based virtual screening was performed using ChemBridge database to screen potent lead molecules against LuxR. 4-benzyl-2-pyrrolidinone and N-[2(1-cyclohexen-1-yl) enthyl]-N'(2-ethoxyphenyl) were selected based on dock score, binding affinity and mode of interactions with the receptor. Furthermore, binding free energy, density functional theory and ADME prediction were performed to rank the lead molecules. Thus, the identified lead molecules can be used for the development of anti-quorum sensing drugs.

  19. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  20. Cinnamaldehyde and cinnamaldehyde derivatives reduce virulence in Vibrio spp. by decreasing the DNA-binding activity of the quorum sensing response regulator LuxR

    Directory of Open Access Journals (Sweden)

    Van Calenbergh Serge


    Full Text Available Abstract Background To date, only few compounds targeting the AI-2 based quorum sensing (QS system are known. In the present study, we screened cinnamaldehyde and substituted cinnamaldehydes for their ability to interfere with AI-2 based QS. The mechanism of QS inhibition was elucidated by measuring the effect on bioluminescence in several Vibrio harveyi mutants. We also studied in vitro the ability of these compounds to interfere with biofilm formation, stress response and virulence of Vibrio spp. The compounds were also evaluated in an in vivo assay measuring the reduction of Vibrio harveyi virulence towards Artemia shrimp. Results Our results indicate that cinnamaldehyde and several substituted derivatives interfere with AI-2 based QS without inhibiting bacterial growth. The active compounds neither interfered with the bioluminescence system as such, nor with the production of AI-2. Study of the effect in various mutants suggested that the target protein is LuxR. Mobility shift assays revealed a decreased DNA-binding ability of LuxR. The compounds were further shown to (i inhibit biofilm formation in several Vibrio spp., (ii result in a reduced ability to survive starvation and antibiotic treatment, (iii reduce pigment and protease production in Vibrio anguillarum and (iv protect gnotobiotic Artemia shrimp against virulent Vibrio harveyi BB120. Conclusion Cinnamaldehyde and cinnamaldehyde derivatives interfere with AI-2 based QS in various Vibrio spp. by decreasing the DNA-binding ability of LuxR. The use of these compounds resulted in several marked phenotypic changes, including reduced virulence and increased susceptibility to stress. Since inhibitors of AI-2 based quorum sensing are rare, and considering the role of AI-2 in several processes these compounds may be useful leads towards antipathogenic drugs.

  1. Cinnamaldehyde and cinnamaldehyde derivatives reduce virulence in Vibrio spp. by decreasing the DNA-binding activity of the quorum sensing response regulator LuxR (United States)

    Brackman, Gilles; Defoirdt, Tom; Miyamoto, Carol; Bossier, Peter; Van Calenbergh, Serge; Nelis, Hans; Coenye, Tom


    Background To date, only few compounds targeting the AI-2 based quorum sensing (QS) system are known. In the present study, we screened cinnamaldehyde and substituted cinnamaldehydes for their ability to interfere with AI-2 based QS. The mechanism of QS inhibition was elucidated by measuring the effect on bioluminescence in several Vibrio harveyi mutants. We also studied in vitro the ability of these compounds to interfere with biofilm formation, stress response and virulence of Vibrio spp. The compounds were also evaluated in an in vivo assay measuring the reduction of Vibrio harveyi virulence towards Artemia shrimp. Results Our results indicate that cinnamaldehyde and several substituted derivatives interfere with AI-2 based QS without inhibiting bacterial growth. The active compounds neither interfered with the bioluminescence system as such, nor with the production of AI-2. Study of the effect in various mutants suggested that the target protein is LuxR. Mobility shift assays revealed a decreased DNA-binding ability of LuxR. The compounds were further shown to (i) inhibit biofilm formation in several Vibrio spp., (ii) result in a reduced ability to survive starvation and antibiotic treatment, (iii) reduce pigment and protease production in Vibrio anguillarum and (iv) protect gnotobiotic Artemia shrimp against virulent Vibrio harveyi BB120. Conclusion Cinnamaldehyde and cinnamaldehyde derivatives interfere with AI-2 based QS in various Vibrio spp. by decreasing the DNA-binding ability of LuxR. The use of these compounds resulted in several marked phenotypic changes, including reduced virulence and increased susceptibility to stress. Since inhibitors of AI-2 based quorum sensing are rare, and considering the role of AI-2 in several processes these compounds may be useful leads towards antipathogenic drugs. PMID:18793453

  2. Is the Prosthetic Homologue Necessary for Embodiment? (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael


    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  3. Effect of iron on expression of efflux pump (adeABC) and quorum sensing (luxI, luxR) genes in clinical isolates of Acinetobacter baumannii. (United States)

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Valibeigi, Behnaz; Mansouri, Shahla


    Resistance-nodulation-division efflux system (RND) adeABC contributes to intrinsic resistance to various drug classes in Acinetobacter baumannii. Similarly, quorum sensing (QS) plays an important role in the biofilm formation and pathogenicity of this bacterium. The aims of this study were to evaluate the influence of iron limitation on the expression of efflux pump (adeABC) genes and QS (luxI, luxR) system by relative quantitative real-time polymerase chain reaction (qRT-PCR). In addition, DNA sequence and phylogenetic relatedness of biofilm-associated protein (Bap) gene was also investigated. Sixty-five multidrug-resistant isolates of A. baumannii were recovered from ICU patients of three hospitals in Kerman, Iran. The isolates were highly resistant to at least 11 antibiotics (MIC ≥64 μg/mL); however, 87% and 89% were susceptible to colistin and tigecycline, respectively (MIC 0.05 μg/mL) (p ≤ 0.05). We detected the presence of RND efflux pump, QS, and bap genes with the frequencies of 92% (adeA), 61.5% (adeB), 84.6% (adeC), 80% (luxI), 61% (luxR), and 66% (bap), respectively. qRT-PCR analysis showed that in some isolates, expression of both adeABC and luxI/R was increased more than fourfold in the presence of low iron (20 μm), suggesting the additional regulatory role of iron on both efflux pump and QS system. Alignment and phylogenetic analysis on the strong biofilm forming isolates confirmed that the fragments amplified were indeed part of bap gene and deduced sequence was similar to A. baumannii K9B410. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  4. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.


    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  5. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles


    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  6. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  7. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.


    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  8. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  9. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved


    Apte, Manasi S.; Meller, Victoria H.


    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  10. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera. (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross


    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  11. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte


    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  12. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev


    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  13. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.


    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  14. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.


    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  15. Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis. (United States)

    Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F


    The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is

  16. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.


    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  17. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.


    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  18. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D


    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  19. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  20. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.


    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  1. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)



    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  2. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.


    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  3. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard


    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  4. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  5. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo


    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  6. The role of the leukemia-associated ETO homologue repressors in hematopoiesis


    Olsson, André


    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  7. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.


    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas


    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  8. The actin homologue MreB organizes the bacterial cell membrane


    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.


    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  9. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.


    Full text. Phospho lipases A2 (PLA 2 ; E C, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  10. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu


    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  11. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE


    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M


    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  12. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis. (United States)

    Hermes, Fatemah A; Cronan, John E


    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  13. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4. (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng


    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  14. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes. (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto


    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  15. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue. (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji


    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  16. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis. (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D


    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  17. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.


    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  18. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj


    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  19. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast


    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.


    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  20. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson


    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  1. The actin homologue MreB organizes the bacterial cell membrane. (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W


    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  2. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)



    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  3. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M


    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  4. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)


    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  5. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P


    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  6. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.


    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  7. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.


    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  8. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H


    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  9. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver


    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  10. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.


    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  11. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru


    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  12. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David


    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  13. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.


    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  14. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells. (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano


    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  15. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A


    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  16. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis. (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D


    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  17. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail:; Heras, B., E-mail: [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)


    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  18. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures. (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J


    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  19. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger


    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  20. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA. (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam


    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex. (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi


    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  3. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns. (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael


    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  4. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten


    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  5. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi. (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain


    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  6. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance. (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan


    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  7. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.


    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  8. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus. (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee


    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan


    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  10. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati


    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  11. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba


    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  12. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng


    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  13. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues. (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J


    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  14. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu


    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  15. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok


    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  16. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair


    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  17. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen


    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  18. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.


    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  19. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family. (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique


    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  20. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza


    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  1. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger


    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  2. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt


    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  3. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo


    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  4. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)


    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  5. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L


    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  6. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography]. (United States)

    Xu, F; Liang, X; Lin, B; Su, F


    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  7. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis. (United States)

    Yasuhara, Hiroki; Oe, Yuki


    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  8. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo


    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  9. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B


    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  10. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development. (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton


    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  11. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne


    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  12. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE. (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M


    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  13. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang


    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  14. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells. (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao


    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.


    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  16. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.


    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  17. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor. (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo


    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  18. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han


    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  19. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo


    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  20. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka


    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  1. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam. (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter


    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  2. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii. (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H


    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum. (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun


    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues. (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela


    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  5. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia


    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  6. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis. (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal


    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  7. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon


    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  8. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine


    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  9. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.


    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  10. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation. (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni


    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  11. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)


    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  12. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu


    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  13. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.


    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  14. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen


    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  15. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L


    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  16. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51. (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C


    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  17. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system. (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu


    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  18. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner


    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  19. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity. (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J


    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100 (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.


    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  1. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda


    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  2. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance. (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A


    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  3. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)


    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  4. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas. (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A


    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  5. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth


    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  6. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense. (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V


    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  7. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study. (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A


    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  8. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus


    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  9. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.


    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.


    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  10. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations? (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G


    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  11. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato. (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A


    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  12. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko


    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  13. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla


    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  14. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.


    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  15. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)


    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  16. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki


    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  17. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.


    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  18. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail:


    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  19. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse. (United States)

    Brown, N K; Harvey, D J


    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  20. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly. (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M


    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  1. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.


    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  2. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo


    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  3. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes. (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J


    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  4. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole


    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  5. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants. (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana


    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  6. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi


    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  7. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT


    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  8. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová


    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  9. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora. (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie


    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  10. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.


    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  11. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael


    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  12. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil


    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  13. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  14. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew


    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  15. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development. (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk


    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  16. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion. (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine


    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  17. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus. (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  18. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue. (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S


    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  19. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen


    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  20. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling. (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M


    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  1. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue. (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann


    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum ( a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the model. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1). (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel


    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  3. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251). (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R


    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  4. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger. (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I


    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  5. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1 (United States)

    Nilsson, G.; Svensson, G.


    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  6. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment. (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin


    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl


    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  8. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD. (United States)

    Górnaś, Paweł


    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  10. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility* (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.


    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  11. BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential. (United States)

    Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A


    Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

  12. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response. (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo


    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  13. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim


    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  14. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie


    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  15. Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

    Directory of Open Access Journals (Sweden)

    Aino L K Liukko

    Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

  16. Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China. (United States)

    Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao


    In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy. (United States)

    Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J


    Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  18. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Directory of Open Access Journals (Sweden)

    John A Zebala

    Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  19. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi


    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  20. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  1. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Directory of Open Access Journals (Sweden)

    Hui Xu


    Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  2. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle. (United States)

    Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad


    MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  3. The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Charnock F Mark L


    Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

  4. Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells. (United States)

    Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo


    In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

  5. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski


    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  6. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development. (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron


    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  7. Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

    Directory of Open Access Journals (Sweden)

    Teruo Umemoto


    Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

  8. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita


    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  9. CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

    DEFF Research Database (Denmark)

    Madsen, Jens; Tornøe, Ida; Nielsen, Ole


    CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

  10. SimCP3—An Advanced Homologue of SimCP2 as a Solution-Processed Small Molecular Host Material for Blue Phosphorescence Organic Light-Emitting Diodes

    Directory of Open Access Journals (Sweden)

    Yi-Ting Lee


    Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.

  11. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein. (United States)

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla


    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  12. Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture. (United States)

    Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua


    Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

  13. Fisetin up-regulates the expression of adiponectin in 3T3-L1 adipocytes via the activation of silent mating type information regulation 2 homologue 1 (SIRT1)-deacetylase and peroxisome proliferator-activated receptors (PPARs). (United States)

    Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung


    Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.

  14. The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.


    Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

  15. Etude par génétique inverse du gène codant la protéine TARGET OF RAPAMYCIN d'Arabidopsis thaliana (AtTOR), l'homologue d'une kinase contrôlant la croissance cellulaire chez les eucaryotes


    Menand, Benoit


    TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...

  16. Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, V.


    The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

  17. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection. (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime


    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  18. The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity. (United States)

    Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y


    The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.

  19. Nicolas Sarkozy a recu son homologue estonien

    Index Scriptorium Estoniae


    Prantsusmaa president Nicolas Sarkozy pakkus 7. aprillil 2008 Elysée palees kohtumisel president Toomas Hendrik Ilvesega Eestile Prantsusmaa abi tuumaenergeetika küsimustes. Vabariigi President töövisiidil Pariisis 6.-8.04.2008

  20. QStatin, a Selective Inhibitor of Quorum Sensing in Vibrio Species. (United States)

    Kim, Byoung Sik; Jang, Song Yee; Bang, Ye-Ji; Hwang, Jungwon; Koo, Youngwon; Jang, Kyung Ku; Lim, Dongyeol; Kim, Myung Hee; Choi, Sang Ho


    Pathogenic Vibrio species cause diseases in diverse marine animals reared in aquaculture. Since their pathogenesis, persistence, and survival in marine environments are regulated by quorum sensing (QS), QS interference has attracted attention as a means to control these bacteria in aquatic settings. A few QS inhibitors of Vibrio species have been reported, but detailed molecular mechanisms are lacking. Here, we identified a novel, potent, and selective Vibrio QS inhibitor, named QStatin [1-(5-bromothiophene-2-sulfonyl)-1H-pyrazole], which affects Vibrio harveyi LuxR homologues, the well-conserved master transcriptional regulators for QS in Vibrio species. Crystallographic and biochemical analyses showed that QStatin binds tightly to a putative ligand-binding pocket in SmcR, the LuxR homologue in V. vulnificus , and changes the flexibility of the protein, thereby altering its transcription regulatory activity. Transcriptome analysis revealed that QStatin results in SmcR dysfunction, affecting the expression of SmcR regulon required for virulence, motility/chemotaxis, and biofilm dynamics. Notably, QStatin attenuated representative QS-regulated phenotypes in various Vibrio species, including virulence against the brine shrimp ( Artemia franciscana ). Together, these results provide molecular insights into the mechanism of action of an effective, sustainable QS inhibitor that is less susceptible to resistance than other antimicrobial agents and useful in controlling the virulence of Vibrio species in aquacultures. IMPORTANCE Yields of aquaculture, such as penaeid shrimp hatcheries, are greatly affected by vibriosis, a disease caused by pathogenic Vibrio infections. Since bacterial cell-to-cell communication, known as quorum sensing (QS), regulates pathogenesis of Vibrio species in marine environments, QS inhibitors have attracted attention as alternatives to conventional antibiotics in aquatic settings. Here, we used target-based high-throughput screening to identify

  1. Identification of VceA and VceC, two members of the VjbR regulon that are translocated into macrophages by the Brucella type IV secretion system

    NARCIS (Netherlands)

    de Jong, Maarten F.; Sun, Yao-Hui; den Hartigh, Andreas B.; van Dijl, Jan Maarten; Tsolis, Renee M.


    Survival and replication inside host cells by Brucella spp. requires a type IV secretion system (T4SS), encoded by the virB locus. However, the identity of the molecules secreted by the T4SS has remained elusive. We hypothesized that proteins translocated by the T4SS would be co-regulated with the

  2. 阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

    Institute of Scientific and Technical Information of China (English)

    傅玉才; 章家新; 郑晓虹; 刘红


    Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆

  3. RpoS induces expression of the Vibrio anguillarum quorum-sensing regulator VanT. (United States)

    Weber, Barbara; Croxatto, Antony; Chen, Chang; Milton, Debra L


    In vibrios, regulation of the Vibrio harveyi-like LuxR transcriptional activators occurs post-transcriptionally via small regulatory RNAs (sRNAs) that destabilize the luxR mRNA at a low cell population, eliminating expression of LuxR. Expression of the sRNAs is modulated by the vibrio quorum-sensing phosphorelay systems. However, vanT mRNA, which encodes a LuxR homologue in Vibrio anguillarum, is abundant at low and high cell density, indicating that VanT expression may be regulated via additional mechanisms. In this study, Western analyses showed that VanT was expressed throughout growth with a peak of expression during late exponential growth. VanO induced partial destabilization of vanT mRNA via activation of at least one Qrr sRNA. Interestingly, the sigma factor RpoS significantly stabilized vanT mRNA and induced VanT expression during late exponential growth. This induction was in part due to RpoS repressing expression of Hfq, an RNA chaperone. RpoS is not part of the quorum-sensing regulatory cascade since RpoS did not regulate expression or activity of VanO, and RpoS was not regulated by VanO or VanT. VanT and RpoS were needed for survival following UV irradiation and for pigment and metalloprotease production, suggesting that RpoS works with the quorum-sensing systems to modulate expression of VanT, which regulates survival and stress responses.

  4. QStatin, a Selective Inhibitor of Quorum Sensing in Vibrio Species

    Directory of Open Access Journals (Sweden)

    Byoung Sik Kim


    Full Text Available Pathogenic Vibrio species cause diseases in diverse marine animals reared in aquaculture. Since their pathogenesis, persistence, and survival in marine environments are regulated by quorum sensing (QS, QS interference has attracted attention as a means to control these bacteria in aquatic settings. A few QS inhibitors of Vibrio species have been reported, but detailed molecular mechanisms are lacking. Here, we identified a novel, potent, and selective Vibrio QS inhibitor, named QStatin [1-(5-bromothiophene-2-sulfonyl-1H-pyrazole], which affects Vibrio harveyi LuxR homologues, the well-conserved master transcriptional regulators for QS in Vibrio species. Crystallographic and biochemical analyses showed that QStatin binds tightly to a putative ligand-binding pocket in SmcR, the LuxR homologue in V. vulnificus, and changes the flexibility of the protein, thereby altering its transcription regulatory activity. Transcriptome analysis revealed that QStatin results in SmcR dysfunction, affecting the expression of SmcR regulon required for virulence, motility/chemotaxis, and biofilm dynamics. Notably, QStatin attenuated representative QS-regulated phenotypes in various Vibrio species, including virulence against the brine shrimp (Artemia franciscana. Together, these results provide molecular insights into the mechanism of action of an effective, sustainable QS inhibitor that is less susceptible to resistance than other antimicrobial agents and useful in controlling the virulence of Vibrio species in aquacultures.

  5. In human pseudouridine synthase 1 (hPus1), a C-terminal helical insert blocks tRNA from binding in the same orientation as in the Pus1 bacterial homologue TruA, consistent with their different target selectivities. (United States)

    Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M


    Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Cloning and expression analysis of a partial LEAFY homologue from ...

    African Journals Online (AJOL)

    ajl yemi


    Nov 14, 2011 ... 2South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Science, Zhanjiang, Guangdong ... The leaves, stem and fruits of the pineapple plant ... First-strand cDNA was synthesized with M-MLV-.

  7. Valerophenone synthase-like chalcone synthase homologues in Humulus lupulus

    Czech Academy of Sciences Publication Activity Database

    Novák, Petr; Matoušek, Jaroslav; Bříza, Jindřich


    Roč. 46, - (2003), s. 375-381 ISSN 0006-3134 R&D Projects: GA ČR GA521/99/1591 Institutional research plan: CEZ:AV0Z5051902 Keywords : plant genetic Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

  8. LBP/BPI homologue in Eisenia andrei earthworms

    Czech Academy of Sciences Publication Activity Database

    Škanta, František; Procházková, Petra; Roubalová, Radka; Dvořák, Jiří; Bilej, Martin


    Roč. 54, č. 1 (2016), s. 1-6 ISSN 0145-305X R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Earthworm * Eisenia * LBP/BPI Subject RIV: EC - Immunology Impact factor: 3.218, year: 2016

  9. Some Cholón discourse particles and Quechua homologues

    NARCIS (Netherlands)

    Alexander-Bakkerus, A.; Romero-Figueroa, A.


    Cholón belongs to a small language family. It was spoken in North Peru in the valley of the Huallaga River. Cholón is an agglutinative SOV language, and it has, amongst other things, some twenty interesting, suffixed discourse particles: adverbial markers, emphasis markers, exclamation markers,

  10. Identification of Salp15 homologues in Ixodes ricinus ticks

    NARCIS (Netherlands)

    Hovius, J. W. R.; Ramamoorthi, N.; van't Veer, C.; de Groot, K. A.; Nijhof, A. M.; Jongejan, F.; van Dam, A. P.; Fikrig, E.


    The 15-kDa Ixodes scapularis salivary gland protein Salp15 protects Borrelia burgdorferi sensu stricto from antibody-mediated killing and facilitates infection of the mammalian host. In addition, Salp 15 has been shown to inhibit T-cell activation. We determined whether Ixodes ricinus, the major

  11. MetR and CRP bind to the Vibrio harveyi lux promoters and regulate luminescence. (United States)

    Chatterjee, Jaidip; Miyamoto, Carol M; Zouzoulas, Athina; Lang, B Franz; Skouris, Nicolas; Meighen, Edward A


    The induction of luminescence in Vibrio harveyi at the later stages of growth is controlled by a quorum-sensing mechanism in addition to nutritional signals. However, the mechanism of transmission of these signals directly to the lux promoters is unknown and only one regulatory protein, LuxR, has been shown to bind directly to lux promoter DNA. In this report, we have cloned and sequenced two genes, crp and metR, coding for the nutritional regulators, CRP (cAMP receptor protein) and MetR (a LysR homologue), involved in catabolite repression and methionine biosynthesis respectively. The metR gene was cloned based on a general strategy to detect lux DNA-binding proteins expressed from a genomic library, whereas the crp gene was cloned based on its complementation of an Escherichia coli crp mutant. Both CRP and MetR were shown to bind to lux promoter DNA, with CRP being dependent on the presence of cAMP. Expression studies indicated that the two regulators had opposite effects on luminescence: CRP was an activator and MetR a repressor. Disruption of crp decreased luminescence by about 1,000-fold showing that CRP is a major activator of luminescence the same as LuxR, whereas disruption of MetR resulted in activation of luminescence over 10-fold, confirming its function as a repressor. Comparison of the levels of the autoinducers involved in quorum sensing excreted by V. harveyi, and the crp and metR mutants, showed that autoinducer production was not significantly different, thus indicating that the nutritional signals do not affect luminescence by changing the levels of the signals required for quorum sensing. Indeed, the large effects of these nutritional sensors show that luminescence is controlled by multiple signals related to the environment and the cell density which must be integrated at the molecular level to control expression at the lux promoters.

  12. FtsZ from radiation resistant bacterium Deinococcus radiodurans is different from its characterized homologues

    International Nuclear Information System (INIS)

    Mehta, Kruti P.; Misra, H.S.


    Polymerization/depolymerization dynamics of FtsZ and its GTPase activity are interdependent and the regulation of these processes determines the growth rate in a bacterium. Deinococcus radiodurans R1 that is best known for its extraordinary radiation resistance and efficient DNA double strand break repair is a comparatively slow growing bacterium and its growth gets arrested in response to gamma radiation. Mechanisms of cell division and its regulation under gamma stressed growth condition would be worth investigating. Genome of this bacterium encodes at least all the known components of divisome. Recombinant FtsZ of D. radiodurans (drFtsZ) preferred Mg 2+ for its GTPase activity. Relatively a very low GTPase activity was observed in presence of Mn 2+ , Co 2+ and Ni 2+ while release of inorganic phosphate could not be detected in presence of other divalent ions including Ca 2+ . GTPase activity of drFtsZ was lower than E. coli but higher than Mycobacterium and it required both Mg 2+ and GTP for its polymerization. Its GTPase activity did not increase with increasing concentration of Mg 2+ and correlates with the bundling of protofilaments. Results obtained from transmission electron microscopy and sedimentation analysis supported the reciprocal correlation of polymerization/depolymerization with the levels of GTPase activity. Dynamic light scattering in presence of 5mM or higher concentration of Mg 2+ and Mn 2 showed a characteristic cyclic change in light scattering without addition of extra metal ion or GTP

  13. The ATM homologue MEC1 is required for phosphorylation of replication protein A in yeast

    International Nuclear Information System (INIS)

    Brush, G.S.; Morrow, D.M.; Hieter, P.; Kelly, T.J.


    Replication protein A (RPA) is a highly conserved single-stranded DNA-binding protein, required for cellular DNA replication, repair, and recombination. In human cells, RPA is phosphorylated during the S and G2 phases of the cell cycle and also in response to ionizing or ultraviolet radiation. Saccharomyces cerevisiae exhibits a similar pattern of cell cycle-regulated RPA phosphorylation, and our studies indicate that the radiation-induced reactions occur in yeast as well. We have examined yeast RPA phosphorylation during the normal cell cycle and in response to environmental insult, and have demonstrated that the checkpoint gene MEC1 is required for the reaction under all conditions tested. Through examination of several checkpoint mutants, we have placed RPA phosphorylation in a novel pathway of the DNA damage response. MEC1 is similar in sequence to human ATM, the gene mutated in patients with ataxia-telangiectasia (A-T). A-T cells are deficient in multiple checkpoint pathways and are hypersensitive to killing by ionizing radiation. Because A-T cells exhibit a delay in ionizing radiation-induced RPA phosphorylation, our results indicate a functional similarity between MEC1 and ATM, and suggest that RPA phosphorylation is involved in a conserved eukaryotic DNA damage-response pathway defective in A-T

  14. Conformationally restrained carbamoylcholine homologues. Synthesis, pharmacology at neuronal nicotinic acetylcholine receptors and biostructural considerations

    DEFF Research Database (Denmark)

    de la Fuente Revenga, M; Balle, Thomas; Jensen, Anders A.


    Exploration of small selective ligands for the nicotinic acetylcholine receptors (nAChRs) based on acetylcholine (ACh) has led to the development of potent agonists with clear preference for the α4β2 nAChR, the most prevalent nAChR subtype in the central nervous system. In this work we present...

  15. An archaebacterial homologue of the essential eubacterial cell division protein FtsZ. (United States)

    Baumann, P; Jackson, S P


    Life falls into three fundamental domains--Archaea, Bacteria, and Eucarya (formerly archaebacteria, eubacteria, and eukaryotes,. respectively). Though Archaea lack nuclei and share many morphological features with Bacteria, molecular analyses, principally of the transcription and translation machineries, have suggested that Archaea are more related to Eucarya than to Bacteria. Currently, little is known about the archaeal cell division apparatus. In Bacteria, a crucial component of the cell division machinery is FtsZ, a GTPase that localizes to a ring at the site of septation. Interestingly, FtsZ is distantly related in sequence to eukaryotic tubulins, which also interact with GTP and are components of the eukaryotic cell cytoskeleton. By screening for the ability to bind radiolabeled nucleotides, we have identified a protein of the hyperthermophilic archaeon Pyrococcus woesei that interacts tightly and specifically with GTP. Furthermore, through screening an expression library of P. woesei genomic DNA, we have cloned the gene encoding this protein. Sequence comparisons reveal that the P. woesei GTP-binding protein is strikingly related in sequence to eubacterial FtsZ and is marginally more similar to eukaryotic tubulins than are bacterial FtsZ proteins. Phylogenetic analyses reinforce the notion that there is an evolutionary linkage between FtsZ and tubulins. These findings suggest that the archaeal cell division apparatus may be fundamentally similar to that of Bacteria and lead us to consider the evolutionary relationships between Archaea, Bacteria, and Eucarya.

  16. An archaebacterial homologue of the essential eubacterial cell division protein FtsZ.


    Baumann, P; Jackson, S P


    Life falls into three fundamental domains--Archaea, Bacteria, and Eucarya (formerly archaebacteria, eubacteria, and eukaryotes,. respectively). Though Archaea lack nuclei and share many morphological features with Bacteria, molecular analyses, principally of the transcription and translation machineries, have suggested that Archaea are more related to Eucarya than to Bacteria. Currently, little is known about the archaeal cell division apparatus. In Bacteria, a crucial component of the cell d...

  17. Synthesis and Antiradical Activity of Isoquercitrin Esters with Aromatic Acids and Their Homologues

    Directory of Open Access Journals (Sweden)

    Eva Heřmánková-Vavříková


    Full Text Available Isoquercitrin, (IQ, quercetin-3-O-β-d-glucopyranoside is known for strong chemoprotectant activities. Acylation of flavonoid glucosides with carboxylic acids containing an aromatic ring brings entirely new properties to these compounds. Here, we describe the chemical and enzymatic synthesis of a series of IQ derivatives at the C-6″. IQ benzoate, phenylacetate, phenylpropanoate and cinnamate were prepared from respective vinyl esters using Novozym 435 (Lipase B from Candida antarctica immobilized on acrylic resin. The enzymatic procedure gave no products with “hydroxyaromatic” acids, their vinyl esters nor with their benzyl-protected forms. A chemical protection/deprotection method using Steglich reaction yielded IQ 4-hydroxybenzoate, vanillate and gallate. In case of p-coumaric, caffeic, and ferulic acid, the deprotection lead to the saturation of the double bonds at the phenylpropanoic moiety and yielded 4-hydroxy-, 3,4-dihydroxy- and 3-methoxy-4-hydroxy-phenylpropanoates. Reducing capacity of the cinnamate, gallate and 4-hydroxyphenylpropanoate towards Folin-Ciocalteau reagent was significantly lower than that of IQ, while other derivatives displayed slightly better or comparable capacity. Compared to isoquercitrin, most derivatives were less active in 1,1-diphenyl-2-picrylhydrazyl (DPPH radical scavenging, but they showed significantly better 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid, ABTS scavenging activity and were substantially more active in the inhibition of tert-butylhydroperoxide induced lipid peroxidation of rat liver microsomes. The most active compounds were the hydroxyphenylpropanoates.

  18. Lipid-regulated sterol transfer between closely apposed membranes by oxysterol-binding protein homologues. (United States)

    Schulz, Timothy A; Choi, Mal-Gi; Raychaudhuri, Sumana; Mears, Jason A; Ghirlando, Rodolfo; Hinshaw, Jenny E; Prinz, William A


    Sterols are transferred between cellular membranes by vesicular and poorly understood nonvesicular pathways. Oxysterol-binding protein-related proteins (ORPs) have been implicated in sterol sensing and nonvesicular transport. In this study, we show that yeast ORPs use a novel mechanism that allows regulated sterol transfer between closely apposed membranes, such as organelle contact sites. We find that the core lipid-binding domain found in all ORPs can simultaneously bind two membranes. Using Osh4p/Kes1p as a representative ORP, we show that ORPs have at least two membrane-binding surfaces; one near the mouth of the sterol-binding pocket and a distal site that can bind a second membrane. The distal site is required for the protein to function in cells and, remarkably, regulates the rate at which Osh4p extracts and delivers sterols in a phosphoinositide-dependent manner. Together, these findings suggest a new model of how ORPs could sense and regulate the lipid composition of adjacent membranes.

  19. A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis. (United States)

    Sourmeli, S; Papantonis, A; Lecanidou, R


    One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.

  20. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes. (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos


    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  1. Activation of pur Gene Expression by a Homologue of the Bacillus subtilis PurR repressor:

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Martinussen, Jan


    R encoded repressor from Bacillus subtilis. The wildtype purR gene complements the purine auxotrophy of a purR::Iss1mutant, and it was shown that the purR::Iss1 mutation lowers transcription from the purine regulated L. lactis purD promoter. In a parallel study on the regulation of purC and purD expression....... We have identified a PurBox sequence overlapping the -35 region of the L. lactis purR promoter and found, by studies of a purR-lacLM fusion plasmid, that purR is autoregulated. Because of the high similarity of the PurR proteins from B. subtilis and L. lactis, we looked for PurBox sequences...... in the promoter regions of the PurR regulated genes in B. subtilis, and identified a perfectly matching PurBox in the purA promoter region, and slightly degenerate PurBox like sequences in the promoter regions for the pur operon and the purR gene....

  2. Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ

    Directory of Open Access Journals (Sweden)

    Dennapa Saeloh


    Full Text Available Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach (in silico, in vitro, and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S- and (R-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states. Calculations of free binding energy showed a higher affinity of FtsZ to (S-rhodomyrtone (−35.92 ± 0.36 kcal mol−1 than the GDP substrate (−23.47 ± 0.25 kcal mol−1 while less affinity was observed in the case of (R-rhodomyrtone (−18.11 ± 0.11 kcal mol−1. In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance.

  3. Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8

    Directory of Open Access Journals (Sweden)

    Hyun Joo Chung


    Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.

  4. A structural homologue of colipase in black mamba venom revealed by NMR floating disulphide bridge analysis. (United States)

    Boisbouvier, J; Albrand, J P; Blackledge, M; Jaquinod, M; Schweitz, H; Lazdunski, M; Marion, D


    The solution structure of mamba intestinal toxin 1 (MIT1), isolated from Dendroaspis polylepis polylepis venom, has been determined. This molecule is a cysteine-rich polypeptide exhibiting no recognised family membership. Resistance to MIT1 to classical specific endoproteases produced contradictory NMR and biochemical information concerning disulphide-bridge topology. We have used distance restraints allowing ambiguous partners between S atoms in combination with NMR-derived structural information, to correctly determine the disulphide-bridge topology. The resultant solution structure of MIT1, determined to a resolution of 0.5 A, reveals an unexpectedly similar global fold with respect to colipase, a protein involved in fatty acid digestion. Colipase exhibits an analogous resistance to endoprotease activity, indicating for the first time the possible topological origins of this biochemical property. The biochemical and structural homology permitted us to propose a mechanically related digestive function for MIT1 and provides novel information concerning snake venom protein evolution. Copyright 1998 Academic Press.

  5. Search for chemical separations of the element 106 homologues in HF and HF-HCl media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy-Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Constantinescu, O.


    In order to study the chemical properties of element 263 106 in aqueous media, fast, efficient and reproducible chromatographic separations were tested on its assumed homologous: Mo, W and U. Corroborative static and dynamic off-line experiments have shown that after fixation of these three elements on anion-exchange resin in HF medium, selective elution could be achieved by using suitable concentration of HCl - HF and HCl solutions. Separations of short-lived W isotopes, produced through heavy ion irradiation were also performed on-line. (author). 27 refs., 14 figs

  6. Synthesis and pharmacological evaluation of conformationally constrained glutamic acid higher homologues

    DEFF Research Database (Denmark)

    Tamborini, Lucia; Cullia, Gregorio; Nielsen, Birgitte


    Homologation of glutamic acid chain together with conformational constraint is a commonly used strategy to achieve selectivity towards different types of glutamate receptors. In the present work, starting from two potent and selective unnatural amino acids previously developed by us, we...... investigated the effects on the activity/selectivity profile produced by a further increase in the distance between the amino acidic moiety and the distal carboxylate group. Interestingly, the insertion of an aromatic ring as a spacer produced a low micromolar affinity NMDA ligand that might represent a lead...

  7. Molecular pharmacology of homologues of ibotenic acid at cloned metabotropic glutamic acid receptors

    DEFF Research Database (Denmark)

    Bräuner-Osborne, Hans; Nielsen, B; Krogsgaard-Larsen, P


    We have studied the effects of the enantiomers of 2-amino-3-(3-hydroxyisoxazol-5-yl)propionic acid (homoibotenic acid, HIBO) and analogues substituted with a methyl, bromo or butyl group in the four position of the ring at cloned metabotropic glutamate (mGlu) receptors expressed in Chinese hamster...... ovary (CHO) cells. In contrast to the parent compound ibotenic acid, which is a potent group I and II agonist, the (S)-forms of homoibotenic acid and its analogues are selective and potent group I antagonists whereas the (R)-forms are inactive both as agonists and antagonists at group I, II, and III m......Glu receptors. Interestingly, (S)-homoibotenic acid and the analogues display equal potency at both mGlu1alpha and mGlu5a with Ki values in the range of 97 to 490 microM, (S)-homoibotenic acid and (S)-2-amino-3-(4-butyl-3-hydroxyisoxazol-5-yl)propionic acid [(S)-4-butylhomoibotenic acid] displaying the lowest...

  8. Synthesis and pharmacological evaluation of conformationally constrained glutamic acid higher homologues. (United States)

    Tamborini, Lucia; Cullia, Gregorio; Nielsen, Birgitte; De Micheli, Carlo; Conti, Paola; Pinto, Andrea


    Homologation of glutamic acid chain together with conformational constraint is a commonly used strategy to achieve selectivity towards different types of glutamate receptors. In the present work, starting from two potent and selective unnatural amino acids previously developed by us, we investigated the effects on the activity/selectivity profile produced by a further increase in the distance between the amino acidic moiety and the distal carboxylate group. Interestingly, the insertion of an aromatic ring as a spacer produced a low micromolar affinity NMDA ligand that might represent a lead for the development of a new class of NMDA antagonists. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Homologue expression of a fungal endo-1,4-β-D- xylanase using ...

    African Journals Online (AJOL)



    Mar 7, 2011 ... Hemicellulose is the second source of renewable organic carbon on earth, with a high potential for the recovery of ... SSF, solid-state fermentation; XE, xylanase extract. .... Active fractions were pooled, concentrated and.

  10. Over-expression of ZmPti1, a homologue to Pti1, increases salt ...

    African Journals Online (AJOL)



    Feb 1, 2010 ... have not been studied for its roles under salt stress condition. Previous study has ..... expression of a single Ca2+-dependent protein kinase confers both cold and ... Mechanisms of high salinity tolerance in plants. Methods ...

  11. An avian homologue of the human β3-adrenoceptor that demonstrates unique pharmacology

    International Nuclear Information System (INIS)

    Broxton, N.M.; Papaioannou, M.; Evans, B.A.; Summers, R.J.


    Full text: A novel β-adrenoceptor (AR) in the turkey (Tβ 4 -AR; Chen et al 1994) displays low homology with otherβ-AR subtypes thus appearing to represent a novel subtype. It has intermediate affinity for [ 125 I]-cyanopindolol (CYP), lower than that for β|- or β 2 -ARs but higher than for the hβ 3 -AR. However, the gene structure of the tβ 4 -AR closely resembles that of the rodent β 3 -AR gene. cDNAs containing the coding region of tβ 4 - and hβ 3 -ARs were cloned into the mammalian expression vector pCDNA3.1 and transiently expressed in CHO KI cells. The pharmacological properties of the tβ 4 -AR were investigated with binding ([ 125 I] CYP) and cAMP accumulation assays and compared to that of the human β 3 ,-AR. Both the tβ 4 - and hβ 3 -ARs displayed low affinities for CGP20712A (CGP;β 1 -AR selective; pK i , tβ 4 6.13±0.62; hβ 3 6.10±0.15) and ICI118551 (ICI; β 2 -AR selective; pK i tβ 4 7.12±0.54; hβ 3 6.62±0.33). Theβ 3 -AR selective antagonist SR59230 (pK i tβ 4 7.45±0.07; hβ 3 .0010.50) as well as a non-selective antagonist (-) propranolol (Prop; pK i tβ 4 8.90±0.15; hβ 3 7.40±0.74) had higher affinities for both receptors but showed different rank orders of potency. β-AR agonists isoprenaline (Iso; pK i , tβ 4 6.5810.19; hβ 3 5.95±0.10) and noradrenaline (NA; pK i , tβ 4 6.65±0.29; hβ 3 5.66±10.32) had higher affinity for the tβ 4 -AR. In cAMP accumulation assays, the rank orders of potency of agonists was Iso > NA > BRL37344 >>CL316243 for the tβ 4 -AR and BRL37344, Iso > NA > CL316243 for the hβ 3 -AR. The antagonists had rank orders of affinity similar to those determined from binding experiments; for tβ 4 -AR (-) Prop > SR > ICI > (+) Prop > CGP, and hβ 3 -AR, SR > (-)Prop > ICI> (+) Prop > CGP. Therefore the tβ 4 -AR, although resembling the hβ 3 -AR in gene structure, displays high affinity for (-) propranolol and relatively low affinity for β 3 -AR selective agonists. Copyright (2001) Australasian Society of Clinical and Experimental Pharmacologists and Toxicologists

  12. An X-linked homologue of the autosomal inprinted gene ZNF127 escapes X inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Longstreet, M.; Nicholls, R.D.; Willard, H.F. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others


    The ZNF127 gene has been shown to be subject to parental imprinting in both humans and the mouse and maps to within the Prader-Willi/Angelman Syndrome critical region on chromosome 15. We have cloned two X-linked related loci, one of which, ZNFXp is a transcribed gene while the other, ZNFXq, is an untranscribed pseudogene. ZNFXp is 83.6% identical to ZNFXq and 65.4% identical to ZNF127 over 1.4 kb of open reading frame they share in common, Like ZNF127, the predicted protein sequence of ZNFXp contains a C{sub 3}HC{sub 4} zinc finger domain and C{sub 3}H zinc finger-like motifs. Whereas ZNF127 has three C{sub 3}H motifs, ZNFXp has four. A strong CpG island is located within 1 kb 5{prime} of the predicted amino terminus of ZNFXp. Expression of ZNFXp has been detected from mouse/human somatic cell hybrids containing either an active (n=2) or an inactive (n=4) chromosome, and thus escapes X inactivation. Probes made from the 3{prime} UTR of ZNFXp detect a number of related loci in both human and murine DNA, none of which is the ZNF127 locus on chromosome 15. None of the detectable murine bands shows dosage differences between males and females as would be expected for X-linked loci. This raises the possibility that ZNFXp inserted into the human X chromosome after its divergence from a common ancestor with the murine X. We have mapped ZNFXp to Xp11.4 by Southern blotting and PCR of hybrid DNAs and by fluorescence in situ hybridization (FISH). ZNFXq maps within the X Inactivation Center (XIC) region on Xq13.2, approximately 300 kb distal to the XIST gene. We find it intriguing, and perhaps significant, that two members of this gene family are subject to epigenetic regulation -- one autosomal imprinting, and the other escape from X inactivation. These results could imply an evolutionary and mechanistic relationship between these two processes.

  13. Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker. (United States)

    Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F


    The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  14. Isoflavonoids are present in Arabidopsis thaliana despite the absence of any homologue to known isoflavonoid synthases

    Czech Academy of Sciences Publication Activity Database

    Lapčík, O.; Honys, David; Koblovská, R.; Macková, Z.; Vítková, M.; Klejdus, B.


    Roč. 44, 2-3 (2006), s. 106-114 ISSN 0981-9428 R&D Projects: GA ČR GA525/03/0352; GA AV ČR KJB6038409 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Brassicaceae * HPLC-MS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.847, year: 2006

  15. Synthesis and Antiradical Activity of Isoquercitrin Esters with Aromatic Acids and Their Homologues

    Czech Academy of Sciences Publication Activity Database

    Heřmánková-Vavříková, Eva; Křenková, Alena; Petrásková, Lucie; Chambers, Christopher S.; Zápal, Jakub; Kuzma, Marek; Valentová, Kateřina; Křen, Vladimír


    Roč. 18, č. 5 (2017), s. 1-14, č. článku 1074. E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GP14-14373P; GA MŠk(CZ) LD15082 Institutional support: RVO:61388971 Keywords : isoquercitrin * aromatic acid * gallic acid Subject RIV: CE - Biochemistry OBOR OECD: Microbiology Impact factor: 3.226, year: 2016

  16. Cloning of a cryptochrome homologue from the holoparasitic plant Orobanche minor Sm. (United States)

    Okazawa, Atsushi; Trakulnaleamsai, Chitra; Hiramatsu, Hiroya; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio


    Orobanche minor is a non-photosynthetic root holoparasitic plant. Although it is known that photosynthesis-related genes are inactivated or have been eliminated from the plastid genomes of holoparasites, little is known about the alterations in their genes involved in the signaling networks by which light regulates photosynthesis. Cryptochromes (crys), which are blue-light receptors, appear to control both photosynthesis-related and non-photosynthetic responses to light in higher plants. Because we are interested in to what extent a cry-mediated light signaling network remains in the holoparasites, we cloned CRY homologous cDNA from O. minor (OmCRY1) and used real-time RT-PCR to compare its expression under natural daylight and darkness. We found that the OmCRY1 has a high degree of homology with CRY1 s from photosynthetic plants. Expression of the OmCRY1 gene was higher in plants grown in the dark than that in the plants grown under natural daylight. This is the first report of the gene expression of a blue-light receptor in non-photosynthetic plants.

  17. The Drosophila Homologue of the Amyloid Precursor Protein Is a Conserved Modulator of Wnt PCP Signaling

    Czech Academy of Sciences Publication Activity Database

    Soldano, A.; Okray, Z.; Janovská, P.; Tmejová, K.; Reynaud, E.; Claeys, A.; Yan, J.; Atak, Z.K.; De Strooper, B.; Dura, J.M.; Bryja, Vítězslav; Hassan, B.A.


    Roč. 11, č. 5 (2013) E-ISSN 1545-7885 Grant - others:GA ČR(CZ) GA204/09/0498; GA ČR(CZ) GAP301/11/0747 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : PLANAR CELL POLARITY * ALZHEIMERS-DISEASE * AXONAL-TRANSPORT Subject RIV: BO - Biophysics Impact factor: 11.771, year: 2013

  18. New Homologues Series of Heterocyclic Schiff Base Ester: Synthesis and Characterization

    Directory of Open Access Journals (Sweden)

    Yee-Ting Chong


    Full Text Available A homologous series of liquid crystal bearing with heterocyclic thiophene Schiff base ester with alkanoyloxy chain (CH3(CH2nCOO–, where n=4, 6, 8, 10, 12, 14, 16 was successfully synthesized through the modification of some reported methods. The structural information of these compounds was isolated and characterized through some spectroscopic techniques, such as FTIR, 1H, and 13C NMR and elemental analysis. Textural observation was carried out using a polarizing optical microscope (POM over heating and cooling cycles. It was found that all synthesized compounds (3a–g exhibited an enantiotropic nematic phase upon the heating and cooling cycle with high thermal stability. Moreover, a characteristic bar transition texture was observed for compounds 3f and 3g which have shown transition of nematic-to-smectic C phase. This has been further confirmed by obtaining relative phase transition temperature using the differential scanning calorimetry (DSC.

  19. Immunological crossreactivity of the Mycobacterium leprae CFP-10 with its homologue in Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, A.; van Meijgaarden, K. E.; Franken, K. L. M. C.; Wieles, B.; Arend, S. M.; Faber, W. R.; Naafs, B.; Ottenhoff, T. H. M.


    Mycobacterium tuberculosis culture filtrate protein-10 (CFP-10) (Rv3874) is considered a promising antigen for the immunodiagnosis of tuberculosis (TB) together with early secreted antigens of M. tuberculosis (ESAT-6). Both ESAT-6 and CFP-10 are encoded by the RD1 region that is deleted from all

  20. Study of the behaviour of transuranics and possible chemical homologues in Lake Michigan water and biota

    International Nuclear Information System (INIS)

    Wahlgren, M.A.; Alberts, J.J.; Nelson, D.M.; Orlandini, K.A.


    Concentration factors for Pu, Am and U in Lake Michigan biota are compared to those of a number of stable trace elements that have short residence times in Lake Michigan water. The relative order of uptake for these nuclides in Lake Michigan biota is Am>Pu much>U. Evidence is summarized which suggests that the predominant oxidation state of 239 , 240 Pu in Lake Michigan water is 4+. Concentrations of 239 , 240 Pu in net plankton, filterable particulate matter, sediment trap, and benthic floc samples indicate that sorption by biogenic detritus, and settling of this material, can account for the reduced concentration of 239 , 240 Pu observed in surface waters during summer stratification, but that deposition into the sediments is primarily non-biological. Concentrations of 7 Be, 144 Ce and 137 Cs in sediment trap samples show the effect of spring convective mixing and demonstrate the resuspension of mineral-rich surficial sediments during the summer months. The effect on the concentration of dissolved plutonium in the water column, of varying degrees of resuspension of sedimentary floc, is described using a simple mass-action model. A radiochemical method for the determination of americium and uranium in Lake Michigan environmental samples is also presented. (author)

  1. Dipeptidyl peptidase-IV activity and/or structure homologues (DASH) in transformed neuroectodermal cells

    Czech Academy of Sciences Publication Activity Database

    Malík, Radek; Bušek, P.; Mareš, Vladislav; Ševčík, J.; Kleibl, Z.; Šedo, A.


    Roč. 524, - (2003), s. 95-102 ISSN 0065-2598. [International Conference on Dipeptidyl Aminopeptidases. Berlin, 26.09.2002-28.09.2002] R&D Projects: GA ČR GA301/02/0962 Grant - others:GA UK(CZ) 7/2002/C Institutional research plan: CEZ:AV0Z5011922 Keywords : DASH molecules * DPP-IV activity * glioma cells Subject RIV: FD - Oncology ; Hematology

  2. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)


    Nov 28, 2015 ... bond of a specific adenine in 28 S rRNA (Endo and Tsurugi. 1987; Barbieri et .... model. The structures were refined using Refmac. (Murshudov et al. 1997) from the ...... kine expression in treated spleen cells of rats. Mol. Cell.

  3. Collectrin, a homologue of ACE2, its transcriptional control and functional perspectives

    International Nuclear Information System (INIS)

    Zhang Yanling; Wada, Jun


    Collectrin is a type I membrane protein and shares significant homology with C-terminal domain of angiotensin-converting enzyme-2 (ACE2). However, collectrin lacks catalytic domain and it suggests the presence of uncharacterized physiological functions of collectrin. Collectrin is transcriptionally regulated by hepatocyte nuclear factor-α and -β and is highly expressed on renal proximal tubules and collecting ducts as well as pancreatic β-cells. Recent in vitro and in vivo studies demonstrated interesting physiological roles of collectrin related to insulin secretion, formation of primary cilia, renal cyst formation and amino acid transport. The common underlying molecular mechanism may be suggested by the evidence that collectrin binds to SNARE complex by interacting with snapin. Collectrin is involved in the process of vesicle transport and membrane fusion and thus it delivers insulin for exocytosis or various membrane proteins to apical plasmalemma and primary cilia. Collectrin may be the new therapeutic target for various pathological processes such as diabetes, polycystic kidney disease, hypertension and aminoaciduria

  4. Congenital sideroblastic anemia due to mutations in the mitochondrial HSP70 homologue HSPA9

    DEFF Research Database (Denmark)

    Schmitz-Abe, Klaus; Ciesielski, Szymon J.; Schmidt, Paul J.


    The congenital sideroblastic anemias (CSAs) are relatively uncommon diseases characterized by defects in mitochondrial heme synthesis, iron-sulfur (Fe-S) cluster biogenesis, or protein synthesis. Here we demonstrate that mutations in HSPA9, a mitochondrial HSP70 homolog located in the chromosome 5q...

  5. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul


    Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  6. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA-binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul


    Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  7. Vaccination against Bm86 Homologues in Rabbits Does Not Impair Ixodes ricinus Feeding or Oviposition

    NARCIS (Netherlands)

    Coumou, Jeroen; Wagemakers, Alex; Trentelman, Jos J.; Nijhof, Ard M.; Hovius, Joppe W.


    Human tick-borne diseases that are transmitted by Ixodes ricinus, such as Lyme borreliosis and tick borne encephalitis, are on the rise in Europe. Diminishing I. ricinus populations in nature can reduce tick exposure to humans, and one way to do so is by developing an anti-vector vaccine against

  8. Preferential protection of Borrelia burgdorferi sensu stricto by a Salp15 homologue in Ixodes ricinus saliva

    NARCIS (Netherlands)

    Hovius, J. W.; Schuijt, T. J.; de Groot, K. A.; Roelofs, J. J. T. H.; Oei, G. A.; Marquart, J. A.; de Beer, R.; van 't Veer, C.; van der Poll, T.; Ramamoorthi, N.; Fikrig, E.; van Dam, A. P.


    BACKGROUND: Ixodes ticks are the main vectors for Borrelia burgdorferi sensu lato. In the United States, B. burgdorferi is the sole causative agent of Lyme borreliosis and is transmitted by Ixodes scapularis. In Europe, 3 Borrelia species-B. burgdorferi, B. garinii, and B. afzelii-are prevalent,

  9. Expression profiles of aquaporin homologues and petal movement during petal development in Tulipa gesneriana. (United States)

    Azad, Abul Kalam; Hanawa, Ryosuke; Ishikawa, Takahiro; Sawa, Yoshihiro; Shibata, Hitoshi


    Previously, we have characterized two tonoplast intrinsic proteins (TIPs) and four plasma membrane intrinsic proteins (PIPs) from the 2-day-old petals of tulip (Tulipa gesneriana). In this study, we analyzed the development of tulip petals and stems, temperature-dependent petal movement, the amount of ³H₂O transported into petals and stems during petal movement, and the transcript levels of two TIP (TgTIP1;1 and TgTIP1;2) and four TgPIP genes in petals and stems, from the first day of petal opening to day 12. The development of the petals and stems was completed by days 6 and 9, respectively, after the first day of petal opening. Temperature-dependent petal movement and the amount of ³H₂O that was transported into petals could be detected at significant levels up to day 6 with petal movement reaching a peak at day 3. Real-time reverse transcription-polymerase chain reaction analysis revealed that TgTIP1;1 and TgTIP1;2 were expressed ubiquitously in petals, stems, leaves, bulbs and roots. However, the expression level of TgTIP1;2 was very low in bulbs. The expression of both TgTIP1 genes was upregulated in close association with the development of petals but not with that of the stem. The four TgPIP genes were expressed at almost the same level during the development of the petals and the stem. However, the levels of the TgTIP1 and TgPIP transcripts in petals decreased during the course of petal wilting from day 9 onwards. These results suggest that TgTIP1;1 and TgTIP1;2 may contribute to petal development. Copyright © Physiologia Plantarum 2012.

  10. The Eps15 C. elegans homologue EHS-1 is implicated in synaptic vesicle recycling

    DEFF Research Database (Denmark)

    Salcini, A E; Hilliard, M A; Croce, A


    implicated Eps15 in endocytosis, its function in the endocytic machinery remains unclear. Here we show that the Caenorhabditis elegans gene, zk1248.3 (ehs-1), is the orthologue of Eps15 in nematodes, and that its product, EHS-1, localizes to synaptic-rich regions. ehs-1-impaired worms showed temperature...

  11. Biomolecular Mechanisms of Pseudomonas aeruginosa and Escherichia coli Biofilm Formation (United States)

    Laverty, Garry; Gorman, Sean P.; Gilmore, Brendan F.


    Pseudomonas aeruginosa and Escherichia coli are the most prevalent Gram-negative biofilm forming medical device associated pathogens, particularly with respect to catheter associated urinary tract infections. In a similar manner to Gram-positive bacteria, Gram-negative biofilm formation is fundamentally determined by a series of steps outlined more fully in this review, namely adhesion, cellular aggregation, and the production of an extracellular polymeric matrix. More specifically this review will explore the biosynthesis and role of pili and flagella in Gram-negative adhesion and accumulation on surfaces in Pseudomonas aeruginosa and Escherichia coli. The process of biofilm maturation is compared and contrasted in both species, namely the production of the exopolysaccharides via the polysaccharide synthesis locus (Psl), pellicle Formation (Pel) and alginic acid synthesis in Pseudomonas aeruginosa, and UDP-4-amino-4-deoxy-l-arabinose and colonic acid synthesis in Escherichia coli. An emphasis is placed on the importance of the LuxR homologue sdiA; the luxS/autoinducer-II; an autoinducer-III/epinephrine/norepinephrine and indole mediated Quorum sensing systems in enabling Gram-negative bacteria to adapt to their environments. The majority of Gram-negative biofilms consist of polysaccharides of a simple sugar structure (either homo- or heteropolysaccharides) that provide an optimum environment for the survival and maturation of bacteria, allowing them to display increased resistance to antibiotics and predation. PMID:25438014

  12. Biomolecular Mechanisms of Pseudomonas aeruginosa and Escherichia coli Biofilm Formation

    Directory of Open Access Journals (Sweden)

    Garry Laverty


    Full Text Available Pseudomonas aeruginosa and Escherichia coli are the most prevalent Gram-negative biofilm forming medical device associated pathogens, particularly with respect to catheter associated urinary tract infections. In a similar manner to Gram-positive bacteria, Gram-negative biofilm formation is fundamentally determined by a series of steps outlined more fully in this review, namely adhesion, cellular aggregation, and the production of an extracellular polymeric matrix. More specifically this review will explore the biosynthesis and role of pili and flagella in Gram-negative adhesion and accumulation on surfaces in Pseudomonas aeruginosa and Escherichia coli. The process of biofilm maturation is compared and contrasted in both species, namely the production of the exopolysaccharides via the polysaccharide synthesis locus (Psl, pellicle Formation (Pel and alginic acid synthesis in Pseudomonas aeruginosa, and UDP-4-amino-4-deoxy-l-arabinose and colonic acid synthesis in Escherichia coli. An emphasis is placed on the importance of the LuxR homologue sdiA; the luxS/autoinducer-II; an autoinducer-III/epinephrine/norepinephrine and indole mediated Quorum sensing systems in enabling Gram-negative bacteria to adapt to their environments. The majority of Gram-negative biofilms consist of polysaccharides of a simple sugar structure (either homo- or heteropolysaccharides that provide an optimum environment for the survival and maturation of bacteria, allowing them to display increased resistance to antibiotics and predation.

  13. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    Energy Technology Data Exchange (ETDEWEB)

    Janssens, Geert, E-mail: [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Courtheyn, Dirk [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Mangelinckx, Sven [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France); De Poorter, Geert [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); De Kimpe, Norbert [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Le Bizec, Bruno [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France)


    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ{sup 13}C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the {sup 13}C/{sup 12}C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years.

  14. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    International Nuclear Information System (INIS)

    Janssens, Geert; Courtheyn, Dirk; Mangelinckx, Sven; Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno


    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ 13 C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the 13 C/ 12 C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years

  15. Expression, purification, crystallization and preliminary diffraction studies of the mammalian DAG kinase homologue YegS from Escherichia coli

    International Nuclear Information System (INIS)

    Bakali H, M. Amin; Nordlund, Pär; Hallberg, B. Martin


    The overexpression, crystallization and preliminary diffraction analysis of E. coli YegS are reported. yegS is a gene encoding a 32 kDa cytosolic protein with unknown function but with strong sequence homology to a family of structurally uncharacterized eukaryotic non-protein kinases: diacylglycerol kinases, sphingosine kinases and ceramide kinases. Here, the overexpression, crystallization and preliminary diffraction analysis of Escherichia coli YegS are reported. The crystals belong to space group P2 1 , with unit-cell parameters a = 42.4, b = 166.1, c = 48.5 Å, β = 96.97°. The presence of a dimer in the asymmetric unit was estimated to give a Matthews coefficient (V M ) of 2.5 Å 3 Da −1 and a solvent content of 50.8%(v/v). Single-wavelength diffraction data were collected to a resolution of 1.9 Å using synchrotron radiation

  16. A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue. (United States)

    Wang, S Y; Gudas, L J


    We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

  17. Herpesvirus pan encodes a functional homologue of BHRF1, the Epstein-Barr virus v-Bcl-2

    Directory of Open Access Journals (Sweden)

    Williams Tracey


    Full Text Available Abstract Background Epstein-Barr virus (EBV latently infects about 90% of the human population and is associated with benign and malignant diseases of lymphoid and epithelial origin. BHRF1, an early lytic cycle antigen, is an apoptosis suppressing member of the Bcl-2 family. In vitro studies imply that BHRF1 is dispensable for both virus replication and transformation. However, the fact that BHRF1 is highly conserved not only in all EBV isolates studied to date but also in the analogous viruses Herpesvirus papio and Herpesvirus pan that infect baboons and chimpanzees respectively, suggests BHRF1 may play an important role in vivo. Results Herpesvirus papio BHRF1 has been shown to function in an analogous manner to EBV BHRF1 in response to DNA damaging agents in human keratinocytes. In this study we show that the heterologous expression of the previously uncharacterised Herpesvirus pan BHRF1 in the human Burkitt's lymphoma cell line Ramos-BL provides similar anti-apoptotic functions to that of EBV BHRF1 in response to apoptosis triggered by serum withdrawal, etoposide treatment and ultraviolet (UV radiation. We also map the amino acid changes onto the recently solved structure of the EBV BHRF1 and reveal that these changes are unlikely to alter the 3D structure of the protein. Conclusions These findings show that the functional conservation of BHRF1 extends to a lymphoid background, suggesting that the primate virus proteins interact with cellular proteins that are themselves highly conserved across the higher primates. Further weight is added to this suggestion when we show that the difference in amino acid sequences map to regions on the 3D structure of EBV BHRF1 that are unlikely to change the conformation of the protein.

  18. TM6SF2 and MAC30, new enzyme homologues in sterol metabolism and common metabolic disease.

    Directory of Open Access Journals (Sweden)

    Luis eSanchez-Pulido


    Full Text Available Carriers of the Glu167Lys coding variant in the TM6SF2 gene have recently been identified as being more susceptible to non-alcoholic fatty liver disease (NAFLD, yet exhibit lower levels of circulating lipids and hence are protected against cardiovascular disease. Despite the physiological importance of these observations, the molecular function of TM6SF2 remains unknown, and no sequence similarity with functionally characterised proteins has been identified. In order to trace its evolutionary history and to identify functional domains, we embarked on a computational protein sequence analysis of TM6SF2. We identified a new domain, the EXPERA domain, which is conserved among TM6SF, MAC30/TMEM97 and EBP (D8,D7 sterol isomerase protein families. EBP mutations are the cause of chondrodysplasia punctata 2 X-linked dominant (CDPX2, also known as Conradi-Hünermann-Happle syndrome, a defective cholesterol biosynthesis disorder. Our analysis of evolutionary conservation among EXPERA domain-containing families and the previously suggested catalytic mechanism for the EBP enzyme, indicate that TM6SF and MAC30/TMEM97 families are both highly likely to possess, as for the EBP family, catalytic activity as sterol isomerases. This unexpected prediction of enzymatic functions for TM6SF and MAC30/TMEM97 is important because it now permits detailed experiments to investigate the function of these key proteins in various human pathologies, from cardiovascular disease to cancer.

  19. Midbrain expression of Delta-like 1 homologue is regulated by GDNF and is associated with dopaminergic differentiation

    DEFF Research Database (Denmark)

    Christophersen, Nicolai S.; Gronborg, Mette; Petersen, Thomas Nordahl


    upregulation with increased positive staining of cell bodies in the SNc and fibers in the striatum. Analysis of the developmental regulation of Dlk1 in the murine ventral midbrain showed that the upregulation of Dlk1 mRNA correlated with the generation of tyrosine hydroxylase (TH)-positive neurons. Furthermore...

  20. mu-crystallin is a mammalian homologue of Agrobacterium ornithine cyclodeaminase and is expressed in human retina.


    Kim, R Y; Gasser, R; Wistow, G J


    mu-Crystallin is the major component of the eye lens in several Australian marsupials. The complete sequence of kangaroo mu-crystallin has now been obtained by cDNA cloning. The predicted amino acid sequence shows similarity with ornithine cyclodeaminases encoded by the tumor-inducing (Ti) plasmids of Agrobacterium tumefaciens. Until now, neither ornithine cyclodeaminase nor any structurally related enzymes have been observed in eukaryotes. RNA analysis of kangaroo tissues shows that mu-cryst...

  1. Cloning and characterization of a glutathione S-transferase homologue from the plant pathogenic fungus Botrytis cinerea

    NARCIS (Netherlands)

    Prins, T.W.; Wagemakers, L.; Schouten, A.; Kan, van J.A.L.


    A gene was cloned from Botrytis cinerea that encodes a protein homologous to glutathione S-transferase (GST). The gene, denominated Bcgst1, is present in a single copy and represents the first example of such a gene from a filamentous fungus. The biochemical function of GSTs is to conjugate toxic

  2. Phytophthora capsici homologue of the cell cycle regulator SDA1 is required for sporangial morphology, mycelial growth and plant infection. (United States)

    Zhu, Chunyuan; Yang, Xiaoyan; Lv, Rongfei; Li, Zhuang; Ding, Xiaomeng; Tyler, Brett M; Zhang, Xiuguo


    SDA1 encodes a highly conserved protein that is widely distributed in eukaryotic organisms. SDA1 is essential for cell cycle progression and organization of the actin cytoskeleton in yeasts and humans. In this study, we identified a Phytophthora capsici orthologue of yeast SDA1, named PcSDA1. In P. capsici, PcSDA1 is strongly expressed in three asexual developmental states (mycelium, sporangia and germinating cysts), as well as late in infection. Silencing or overexpression of PcSDA1 in P. capsici transformants affected the growth of hyphae and sporangiophores, sporangial development, cyst germination and zoospore release. Phalloidin staining confirmed that PcSDA1 is required for organization of the actin cytoskeleton. Moreover, 4',6-diamidino-2-phenylindole (DAPI) staining and PcSDA1-green fluorescent protein (GFP) fusions revealed that PcSDA1 is involved in the regulation of nuclear distribution in hyphae and sporangia. Both silenced and overexpression transformants showed severely diminished virulence. Thus, our results suggest that PcSDA1 plays a similar role in the regulation of the actin cytoskeleton and nuclear division in this filamentous organism as in non-filamentous yeasts and human cells. © 2015 BSPP and John Wiley & Sons Ltd.

  3. What is the reason for the doubled unit-cell volumes of copper-lead-rich pavonite homologues?

    DEFF Research Database (Denmark)

    Topa, Dan; Makovicky, Emil; Balic Zunic, Tonci


    The crystal Structure of cupromakovickyite, ideally Cu8Pb4Ag2Bi18S36, from the skarn deposit at Baita Bihor, in Romania, has been solved by direct methods and refined to an RI index of 5.36% for 2680 unique reflections measured with MOKU radiation oil it four-circle diffractometer equipped...... parameter for cupromakovickyite with respect to makovickyite. To be able to compare them, the crystal structure of Cu-bearing makovickyite, Cu2.25Ag1.56 (Pb0.27Cd0.13)(Sigma 0.4)Bi10.46S18, from a scheelite deposit at Felbertal, in Austria, has been refined to in R, index of 4.36% for 1320 unique...

  4. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: a review. (United States)

    Janssens, Geert; Courtheyn, Dirk; Mangelinckx, Sven; Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno


    Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the (13)C/(12)C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. An indigoidine biosynthetic gene cluster from Streptomyces chromofuscus ATCC 49982 contains an unusual IndB homologue. (United States)

    Yu, Dayu; Xu, Fuchao; Valiente, Jonathan; Wang, Siyuan; Zhan, Jixun


    A putative indigoidine biosynthetic gene cluster was located in the genome of Streptomyces chromofuscus ATCC 49982. The silent 9.4-kb gene cluster consists of five open reading frames, named orf1, Sc-indC, Sc-indA, Sc-indB, and orf2, respectively. Sc-IndC was functionally characterized as an indigoidine synthase through heterologous expression of the enzyme in both Streptomyces coelicolor CH999 and Escherichia coli BAP1. The yield of indigoidine in E. coli BAP1 reached 2.78 g/l under the optimized conditions. The predicted protein product of Sc-indB is unusual and much larger than any other reported IndB-like protein. The N-terminal portion of this enzyme resembles IdgB and the C-terminal portion is a hypothetical protein. Sc-IndA and/or Sc-IndB were co-expressed with Sc-IndC in E. coli BAP1, which demonstrated the involvement of Sc-IndB, but not Sc-IndA, in the biosynthetic pathway of indigoidine. The yield of indigoidine was dramatically increased by 41.4 % (3.93 g/l) when Sc-IndB was co-expressed with Sc-IndC in E. coli BAP1. Indigoidine is more stable at low temperatures.

  6. Bacterial motility complexes require the actin-like protein, MreB and the Ras homologue, MglA. (United States)

    Mauriello, Emilia M F; Mouhamar, Fabrice; Nan, Beiyan; Ducret, Adrien; Dai, David; Zusman, David R; Mignot, Tâm


    Gliding motility in the bacterium Myxococcus xanthus uses two motility engines: S-motility powered by type-IV pili and A-motility powered by uncharacterized motor proteins and focal adhesion complexes. In this paper, we identified MreB, an actin-like protein, and MglA, a small GTPase of the Ras superfamily, as essential for both motility systems. A22, an inhibitor of MreB cytoskeleton assembly, reversibly inhibited S- and A-motility, causing rapid dispersal of S- and A-motility protein clusters, FrzS and AglZ. This suggests that the MreB cytoskeleton is involved in directing the positioning of these proteins. We also found that a DeltamglA motility mutant showed defective localization of AglZ and FrzS clusters. Interestingly, MglA-YFP localization mimicked both FrzS and AglZ patterns and was perturbed by A22 treatment, consistent with results indicating that both MglA and MreB bind to motility complexes. We propose that MglA and the MreB cytoskeleton act together in a pathway to localize motility proteins such as AglZ and FrzS to assemble the A-motility machineries. Interestingly, M. xanthus motility systems, like eukaryotic systems, use an actin-like protein and a small GTPase spatial regulator.

  7. Secretory leukocyte protease inhibitor (SLPI is, like its homologue trappin-2 (pre-elafin, a transglutaminase substrate.

    Directory of Open Access Journals (Sweden)

    Kévin Baranger

    Full Text Available Human lungs contain secretory leukocyte protease inhibitor (SLPI, elafin and its biologically active precursor trappin-2 (pre-elafin. These important low-molecular weight inhibitors are involved in controlling the potentially deleterious proteolytic activities of neutrophil serine proteases including elastase, proteinase 3 and cathepsin G. We have shown previously that trappin-2, and to a lesser extent, elafin can be linked covalently to various extracellular matrix proteins by tissue transglutaminases and remain potent protease inhibitors. SLPI is composed of two distinct domains, each of which is about 40% identical to elafin, but it lacks consensus transglutaminase sequence(s, unlike trappin-2 and elafin. We investigated the actions of type 2 tissue transglutaminase and plasma transglutaminase activated factor XIII on SLPI. It was readily covalently bound to fibronectin or elastin by both transglutaminases but did not compete with trappin-2 cross-linking. Cross-linked SLPI still inhibited its target proteases, elastase and cathepsin G. We have also identified the transglutamination sites within SLPI, elafin and trappin-2 by mass spectrometry analysis of tryptic digests of inhibitors cross-linked to mono-dansyl cadaverin or to a fibronectin-derived glutamine-rich peptide. Most of the reactive lysine and glutamine residues in SLPI are located in its first N-terminal elafin-like domain, while in trappin-2, they are located in both the N-terminal cementoin domain and the elafin moiety. We have also demonstrated that the transglutamination substrate status of the cementoin domain of trappin-2 can be transferred from one protein to another, suggesting that it may provide transglutaminase-dependent attachment properties for engineered proteins. We have thus added to the corpus of knowledge on the biology of these potential therapeutic inhibitors of airway proteases.

  8. Disruption of the Arabidopsis CGI-58 homologue produces Chanarin–Dorfman-like lipid droplet accumulation in plants


    James, Christopher N.; Horn, Patrick J.; Case, Charlene R.; Gidda, Satinder K.; Zhang, Daiyuan; Mullen, Robert T.; Dyer, John M.; Anderson, Richard G. W.; Chapman, Kent D.


    CGI-58 is the defective gene in the human neutral lipid storage disease called Chanarin-Dorfman syndrome. This disorder causes intracellular lipid droplets to accumulate in nonadipose tissues, such as skin and blood cells. Here, disruption of the homologous CGI-58 gene in Arabidopsis thaliana resulted in the accumulation of neutral lipid droplets in mature leaves. Mass spectroscopy of isolated lipid droplets from cgi-58 loss-of-function mutants showed they contain triacylglycerols with common...

  9. Hyper-radiation sensitivity of murine scid mutation and mapping of the human homologue HYRC1 gene

    International Nuclear Information System (INIS)

    Komatsu, Kenshi; Ohta, Tohru; Niikawa, Norio; Okumura, Yutaka; Kubota, Nobuo.


    The murine severe combined immunodeficient mutation (scid) is characterized by a lack of both B and T cells, due to a defect in lymphoid variable-(diversity)-joining(V(D)J) rearrangement. Scid cells are highly sensitive to both radiation-induced killing and chromosomal aberrations. Present experiments also demonstrated the high sensitivity of scid cells to killing, because of a deficient repair of double strand breaks(DSB). Scid cells can repair only 60% of radiation-induced DSB for 3 hours, while normal cells repair 85% of the DSB. Significantly reduced Do and n values were obtained from survival curves of scid cells and were similar to ataxia-telangiectasia(AT) cells (a unique human disease conferring whole body radiosensitivity). However, the kinetics of DNA synthesis after irradiation were different between the two cell types. In contrast with the radioresistant DNA synthesis of AT cells, DNA synthesis of scid cells was markedly inhibited after irradiation. The existence of different mutations was also supported by evidence of complementation in somatic cell hybrids between scid cells and AT cells. Using these hybrid cells, fragments of human chromosome 8 were introduced into scid cells HPRT mutant via X-irradiation and somatic cell fusion. The resulting hybrid clones contained human DNA fragment(s) which complemented the hyper-radiosensitivity of the scid cells. Alu-PCR products from these hybrids were used for chromosome painting using the technique of chromosome in situ suppression hybridization, allowing assignment of the human HYRC1 (hyper-radiosensitivity of murine scid mutation, complementing 1) gene, a candidate for a V(D)J recombinant gene, to human chromosome 8q11. (author)

  10. The mammalian homologue of yeast Afg1 ATPase (lactation elevated 1) mediates degradation of nuclear-encoded complex IV subunits

    Czech Academy of Sciences Publication Activity Database

    Česneková, J.; Rodinová, M.; Hansíková, H.; Houštěk, Josef; Zeman, J.; Stibůrek, L.


    Roč. 473, č. 6 (2016), s. 797-804 ISSN 0264-6021 R&D Projects: GA ČR(CZ) GA13-07223S Institutional support: RVO:67985823 Keywords : complex IV * LACE1 * mitochondria * oxidative phosphorylation * YME1L Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.797, year: 2016

  11. Structural domains required for channel function of the mouse transient receptor potential protein homologue TRP1beta. (United States)

    Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen


    Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.

  12. Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue. (United States)

    Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako


    Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.

  13. The human homologue of unc-93 maps to chromosome 6q27 - characterisation and analysis in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Liu, Ying; Dodds, Phillippa; Emilion, Gracy


    In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62%) on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM). To id...

  14. Scandium interaction with diantipyrylmethane homologues and 2-(n-sulphophenylazo)-1,8-dihydroxynaphthalene-3,6 sodium disulphonate

    Energy Technology Data Exchange (ETDEWEB)

    Ganago, L I; Alinovskaya, L A [AN Belorusskoj SSR, Minsk. Inst. Fiziki Tverdogo Tela i Poluprovodnikov


    The reactions of scandium with homologs of diantipyrilmethane (DAM)-propyldiantipyrilmethane (PDAM) and phenyldiantipyrilmethane (PhDAM) - are studied. The relationship of components in the complexes formed is found, and chemism of their formation is established. The complexes Sc-SPADNE (sodium salt 2-(n-sulphophenylazo)-1,8-dioxynaphthalene-3,6-disulphonic acid) are shown to form within a wide pH range. The maximum yield of complexes is observed at 6.0-7.5 pH. By the ion-exchange method the anion character of heteroligand scandium complexes is established. The complex Sc-SPADNE-PDAM is faster as compared with the complexes Sc-SPADNE-DAM and Sc-SPADNE-PhDAM. The decrease in amine excess and increase in the sensitivity of heteroligand formation of the complexes of scandium with SPADNE and PDAM make them better suited for analysis. The technique is developed for the determination of Sc/sub 2/O/sub 3/ in perovskites using the complete differential spectrophotometry method.

  15. Three newly identified galectin homologues from triangle sail mussel (Hyriopsis cumingii) function as potential pattern-recognition receptors. (United States)

    Zhao, Ling-Ling; Hui, Kaimin; Wang, Yu-Qing; Wang, Yue; Ren, Qian; Li, Xin-Cang


    Galactoside-binding lectins, also known as galectins, play crucial roles in innate immune response in invertebrates. In this study, three cDNA sequences from Hyriopsis cumingii were identified and collectively called HcGalec genes. Each of the three deduced HcGalec proteins contained a galactose-binding lectin domain or a GLECT domain. All the three HcGalec genes are mainly present in the hepatopancreas and gills, and their expression is induced at 24 h after bacterial challenge. Three recombinant HcGalec proteins can bind and agglutinate (Ca 2+ -dependent) various microorganisms, including Gram-positive and Gram-negative bacteria. These proteins can attach to mannan and peptidoglycan. Meanwhile, the expression of the three HcGalec genes in the gills were significantly down-regulated after dsRNA interference (HcGalec1-RNAi, HcGalec2-RNAi, and HcGalec3-RNAi) and Vibrio parahaemolyticus injection. The expression levels of some antimicrobial peptides, including lysozyme 1 and lysozyme 2, were also markedly decreased after dsRNA interference. Overall, these results suggested that these three HcGalec proteins may function as potential receptors participating in the innate immune responses of H. cumingii against bacterial infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Preliminary crystallographic data of the three homologues of the thiol–disulfide oxidoreductase DsbA in Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Lafaye, Céline [Laboratoire des Protéines Membranaires, Institut de Biologie Structurale, CEA/CNRS/Université Joseph Fourier, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 01 (France); Iwena, Thomas; Ferrer, Jean-Luc [Laboratoire de Cristallogénèse et Cristallisation des Protéines, Institut de Biologie Structurale, CEA/CNRS/Université Joseph Fourier, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 01 (France); Kroll, J. Simon [Department of Paediatrics, Imperial College London, St Mary’s Hospital Campus, Norfolk Place, London W2 1PG (United Kingdom); Griat, Mickael; Serre, Laurence, E-mail: [Laboratoire des Protéines Membranaires, Institut de Biologie Structurale, CEA/CNRS/Université Joseph Fourier, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 01 (France)


    The Neisseria meningitidis genome possesses three genes encoding active DsbAs. To throw light on the reason for this genetic multiplicity, the three enzymes have been purified and crystallized. Bacterial virulence depends on the correct folding of surface-exposed proteins, a process that is catalyzed by the thiol-disulfide oxidoreductase DsbA, which facilitates the synthesis of disulfide bonds in Gram-negative bacteria. Uniquely among bacteria, the Neisseria meningitidis genome possesses three genes encoding active DsbAs: DsbA1, DsbA2 and DsbA3. DsbA1 and DsbA2 have been characterized as lipoproteins involved in natural competence and in host-interactive biology, while the function of DsbA3 remains unknown. In an attempt to shed light on the reason for this multiplicity of dsbA genes, the three enzymes from N. meningitidis have been purified and crystallized in the presence of high concentrations of ammonium sulfate. The best crystals were obtained using DsbA1 and DsbA3; they belong to the orthorhombic and tetragonal systems and diffract to 1.5 and 2.7 Å resolution, respectively.

  17. Modeling and dynamics of the inward-facing state of a Na+/Cl- dependent neurotransmitter transporter homologue.

    Directory of Open Access Journals (Sweden)

    Saher Afshan Shaikh


    Full Text Available The leucine transporter (LeuT has recently commanded exceptional attention due mainly to two distinctions; it provides the only crystal structures available for a protein homologous to the pharmacologically relevant neurotransmitter: sodium symporters (NSS, and, it exhibits a hallmark 5-TM inverted repeat ("LeuT-fold", a fold recently discovered to also exist in several secondary transporter families, underscoring its general role in transporter function. Constructing the transport cycle of "LeuT-fold" transporters requires detailed structural and dynamic descriptions of the outward-facing (OF and inward-facing (IF states, as well as the intermediate states. To this end, we have modeled the structurally unknown IF state of LeuT, based on the known crystal structures of the OF state of LeuT and the IF state of vSGLT, a "LeuT-fold" transporter. The detailed methodology developed for the study combines structure-based alignment, threading, targeted MD and equilibrium MD, and can be applied to other proteins. The resulting IF-state models maintain the secondary structural features of LeuT. Water penetration and solvent accessibility calculations show that TM1, TM3, TM6 and TM8 line the substrate binding/unbinding pathway with TM10 and its pseudosymmetric partner, TM5, participating in the extracellular and intracellular halves of the lumen, respectively. We report conformational hotspots where notable changes in interactions occur between the IF and OF states. We observe Na2 exiting the LeuT-substrate- complex in the IF state, mainly due to TM1 bending. Inducing a transition in only one of the two pseudosymmetric domains, while allowing the second to respond dynamically, is found to be sufficient to induce the formation of the IF state. We also propose that TM2 and TM7 may be facilitators of TM1 and TM6 motion. Thus, this study not only presents a novel modeling methodology applied to obtain the IF state of LeuT, but also describes structural elements involved in a possibly general transport mechanism in transporters adopting the "LeuT-fold".

  18. Genomic characterization and expression profiles upon bacterial infection of a novel cystatin B homologue from disk abalone (Haliotis discus discus). (United States)

    Premachandra, H K A; Wan, Qiang; Elvitigala, Don Anushka Sandaruwan; De Zoysa, Mahanama; Choi, Cheol Young; Whang, Ilson; Lee, Jehee


    Cystatins are a large family of cysteine proteinase inhibitors which are involved in diverse biological and pathological processes. In the present study, we identified a gene related to cystatin superfamily, AbCyt B, from disk abalone Haliotis discus discus by expressed sequence tag (EST) analysis and BAC library screening. The complete cDNA sequence of AbCyt B is comprised of 1967 nucleotides with a 306 bp open reading frame (ORF) encoding for 101 amino acids. The amino acid sequence consists of a single cystatin-like domain, which has a cysteine proteinase inhibitor signature, a conserved Gly in N-terminal region, QVVAG motif and a variant of PW motif. No signal peptide, disulfide bonds or carbohydrate side chains were identified. Analysis of deduced amino acid sequence revealed that AbCyt B shares up to 44.7% identity and 65.7% similarity with the cystatin B genes from other organisms. The genomic sequence of AbCyt B is approximately 8.4 Kb, consisting of three exons and two introns. Phylogenetic tree analysis showed that AbCyt B was closely related to the cystatin B from pacific oyster (Crassostrea gigas) under the family 1.Functional analysis of recombinant AbCyt B protein exhibited inhibitory activity against the papain, with almost 84% inhibition at a concentration of 3.5 μmol/L. In tissue expression analysis, AbCyt B transcripts were expressed abundantly in the hemocyte, gill, mantle, and digestive tract, while weakly in muscle, testis, and hepatopancreas. After the immune challenge with Vibrio parahemolyticus, the AbCyt B showed significant (P<0.05) up-regulation of relative mRNA expression in gill and hemocytes at 24 and 6 h of post infection, respectively. These results collectively suggest that AbCyst B is a potent inhibitor of cysteine proteinases and is also potentially involved in immune responses against invading bacterial pathogens in abalone. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. The perilipin homologue, lipid storage droplet 2, regulates sleep homeostasis and prevents learning impairments following sleep loss.

    Directory of Open Access Journals (Sweden)

    Matthew S Thimgan


    Full Text Available Extended periods of waking result in physiological impairments in humans, rats, and flies. Sleep homeostasis, the increase in sleep observed following sleep loss, is believed to counter the negative effects of prolonged waking by restoring vital biological processes that are degraded during sleep deprivation. Sleep homeostasis, as with other behaviors, is influenced by both genes and environment. We report here that during periods of starvation, flies remain spontaneously awake but, in contrast to sleep deprivation, do not accrue any of the negative consequences of prolonged waking. Specifically, the homeostatic response and learning impairments that are a characteristic of sleep loss are not observed following prolonged waking induced by starvation. Recently, two genes, brummer (bmm and Lipid storage droplet 2 (Lsd2, have been shown to modulate the response to starvation. bmm mutants have excess fat and are resistant to starvation, whereas Lsd2 mutants are lean and sensitive to starvation. Thus, we hypothesized that bmm and Lsd2 may play a role in sleep regulation. Indeed, bmm mutant flies display a large homeostatic response following sleep deprivation. In contrast, Lsd2 mutant flies, which phenocopy aspects of starvation as measured by low triglyceride stores, do not exhibit a homeostatic response following sleep loss. Importantly, Lsd2 mutant flies are not learning impaired after sleep deprivation. These results provide the first genetic evidence, to our knowledge, that lipid metabolism plays an important role in regulating the homeostatic response and can protect against neuronal impairments induced by prolonged waking.

  20. Switch of SpnR function from activating to inhibiting quorum sensing by its exogenous addition

    Energy Technology Data Exchange (ETDEWEB)

    Takayama, Yuriko [Department of Innovation Systems Engineering, Graduate School of Engineering, Utsunomiya University, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); CREST, Japan Science and Technology Agency, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); Kato, Norihiro, E-mail: [CREST, Japan Science and Technology Agency, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); Department of Material and Environmental Chemistry, Graduate School of Engineering, Utsunomiya University, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan)


    The opportunistic human pathogen Serratia marcescens AS-1 produces the N-hexanoylhomoserine lactone (C6HSL) receptor SpnR, a homologue of LuxR from Vibrio fischeri, which activates pig clusters to produce the antibacterial prodigiosin. In this study, we attempted to artificially regulate quorum sensing (QS) by changing the role of SpnR in N-acylhomoserine lactone (AHL)-mediated QS. SpnR was obtained as a fusion protein tagged with maltose-binding protein (MBP) from overexpression in Escherichia coli, and its specific affinity to C6HSL was demonstrated by quartz crystal microbalance analysis and AHL-bioassay with Chromobacterium violaceum CV026. Prodigiosin production was effectively inhibited by externally added MBP-SpnR in both wild-type AS-1 and the AHL synthase-defective mutant AS-1(ΔspnI). For the mutant, the induced amount of prodigiosin was drastically reduced to approximately 4% with the addition of 18 μM MBP-SpnR to the liquid medium, indicating 81% trapping of C6HSL. A system for inhibiting QS can be constructed by adding exogenous AHL receptor to the culture broth to keep the concentration of free AHL low, whereas intracellular SpnR naturally functions as the activator in response to QS. - Highlights: • Quorum sensing (QS) regulates the expression of some bacterial genes. • We added an AHL receptor to culture media to inhibit QS in Serratia marcescens AS-1. • The exogenous receptor effectively bound C6HSL and inhibited QS. • This approach can be used to artificially regulate AHL-mediated QS.

  1. Switch of SpnR function from activating to inhibiting quorum sensing by its exogenous addition

    International Nuclear Information System (INIS)

    Takayama, Yuriko; Kato, Norihiro


    The opportunistic human pathogen Serratia marcescens AS-1 produces the N-hexanoylhomoserine lactone (C6HSL) receptor SpnR, a homologue of LuxR from Vibrio fischeri, which activates pig clusters to produce the antibacterial prodigiosin. In this study, we attempted to artificially regulate quorum sensing (QS) by changing the role of SpnR in N-acylhomoserine lactone (AHL)-mediated QS. SpnR was obtained as a fusion protein tagged with maltose-binding protein (MBP) from overexpression in Escherichia coli, and its specific affinity to C6HSL was demonstrated by quartz crystal microbalance analysis and AHL-bioassay with Chromobacterium violaceum CV026. Prodigiosin production was effectively inhibited by externally added MBP-SpnR in both wild-type AS-1 and the AHL synthase-defective mutant AS-1(ΔspnI). For the mutant, the induced amount of prodigiosin was drastically reduced to approximately 4% with the addition of 18 μM MBP-SpnR to the liquid medium, indicating 81% trapping of C6HSL. A system for inhibiting QS can be constructed by adding exogenous AHL receptor to the culture broth to keep the concentration of free AHL low, whereas intracellular SpnR naturally functions as the activator in response to QS. - Highlights: • Quorum sensing (QS) regulates the expression of some bacterial genes. • We added an AHL receptor to culture media to inhibit QS in Serratia marcescens AS-1. • The exogenous receptor effectively bound C6HSL and inhibited QS. • This approach can be used to artificially regulate AHL-mediated QS.

  2. Octanoyl-Homoserine Lactone Is the Cognate Signal for Burkholderia mallei BmaR1-BmaI1 Quorum Sensing

    National Research Council Canada - National Science Library

    Duerkop, Breck A; Ulrich, Ricky L; Greenberg, E. P


    .... The obligate animal pathogen Burkholderia mallei produces several acyl-HSLs, and the B. mallei genome has four luxR and two luxI homologs, each of which has been established as a virulence factor...

  3. Tumour cell expression of C4.4A, a structural homologue of the urokinase receptor, correlates with poor prognosis in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Hansen, Line V.; Skov, Birgit G; Ploug, Michael


    expression. In the present study, we therefore explored the possible association between C4.4A expression and prognosis in patients with non-small cell lung cancer (NSCLC). EXPERIMENTAL DESIGN: Tissue sections from 108 NSCLC patients were subjected to immunohistochemical staining using a polyclonal antibody...

  4. Difference equation model for isothermal gas chromatography expresses retention behavior of homologues of n-alkanes excluding the influence of holdup time (United States)

    Wu, Liejun; Chen, Yongli; Caccamise, Sarah A.L.; Li, Qing X.


    A difference equation (DE) model is developed using the methylene retention increment (Δtz) of n-alkanes to avoid the influence of gas holdup time (tM). The effects of the equation orders (1st–5th) on the accuracy of a curve fitting show that a linear equation (LE) is less satisfactory and it is not necessary to use a complicated cubic or higher order equation. The relationship between the logarithm of Δtz and the carbon number (z) of the n-alkanes under isothermal conditions closely follows the quadratic equation for C3–C30 n-alkanes at column temperatures of 24–260 °C. The first and second order forward differences of the expression (Δlog Δtz and Δ2log Δtz, respectively) are linear and constant, respectively, which validates the DE model. This DE model lays a necessary foundation for further developing a retention model to accurately describe the relationship between the adjusted retention time and z of n-alkanes. PMID:22939376

  5. Dataset of the human homologues and orthologues of lipid-metabolic genes identified as DAF-16 targets their roles in lipid and energy metabolism

    Directory of Open Access Journals (Sweden)

    Lavender Yuen-Nam Fan


    Full Text Available The data presented in this article are related to the review article entitled ‘Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis’ (Saavedra-Garcia et al., 2017 [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.

  6. KdpE and a putative RsbQ homologue contribute to growth of Listeria monocytogenes at high osmolarity and low temperature

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Kallipolitis, Birgitte H; Ingmer, Hanne


    The kdp locus of Listeria monocytogenes encodes products with homology to structural proteins of a high-affinity potassium uptake system and to a two-component signal transduction system commonly involved in controlling gene expression. We have investigated the role of kdpE, encoding......-frame deletions of either kdpE or orfX were unaffected by high osmolarity. Transcriptional analysis of kdpE and orfX revealed that their products are encoded by the same transcript. Thus, our data indicate that the absence of both KdpE and OrfX influences growth under osmotic pressure. Interestingly, Orf...

  7. Altered expression of the urokinase receptor homologue, C4.4A, in invasive areas of human esophageal squamous cell carcinoma

    DEFF Research Database (Denmark)

    Hansen, L.V.; Laerum, O.D.; Illemann, M.


    . In the present study, we have therefore analyzed the expression of C4.4A in 14 esophageal squamous cell carcinomas (ESCC). Normal squamous esophageal epithelium shows a strong cell surface associated C4.4A expression in the suprabasal layers, whereas basal cells are negative. Upon transition to dysplasia...... and carcinoma in situ the expression of C4.4A is abruptly and coordinately weakened. Double immunofluorescence staining of normal and dysplastic tissue showed that C4.4A colocalizes with the epithelial cell surface marker E-cadherin in the suprabasal cells and has a complementary expression pattern compared...... to the proliferation marker Ki-67. A prominent, but frequently intracellular, C4.4A expression reappeared in tumor cells located at the invasive front and local lymph node metastases. Because C4.4A was reported previously to be a putative laminin-5 (LN5) ligand, and both proteins are expressed by invasive tumor cells...

  8. Responses of wild watermelon to drought stress: accumulation of an ArgE homologue and citrulline in leaves during water deficits. (United States)

    Kawasaki, S; Miyake, C; Kohchi, T; Fujii, S; Uchida, M; Yokota, A


    Wild watermelon from the Botswana desert had an ability to survive under severe drought conditions by maintaining its water status (water content and water potential). In the analysis by two-dimensional electrophoresis of leaf proteins, seven spots were newly induced after watering stopped. One with the molecular mass of 40 kilodaltons of the spots was accumulated abundantly. The cDNA encoding for the protein was cloned based on its amino-terminal sequence and the amino acid sequence deduced from the determined nucleotide sequences of the cDNA exhibited homology to the enzymes belong to the ArgE/DapE/Acy1/Cpg2/YscS protein family (including acetylornithine deacetylase, carboxypeptidase and aminoacylase-1). This suggests that the protein is involved in the release of free amino acid by hydrolyzing a peptidic bond. As the drought stress progressed, citrulline became one of the major components in the total free amino acids. Eight days after withholding watering, although the lower leaves wilted significantly, the upper leaves still maintained their water status and the content of citrulline reached about 50% in the total free amino acids. The accumulation of citrulline during the drought stress in wild watermelon is an unique phenomenon in C3-plants. These results suggest that the drought tolerance of wild watermelon is related to (1) the maintenance of the water status and (2) a metabolic change to accumulate citrulline.

  9. upSET, the Drosophila homologue of SET3, Is Required for Viability and the Proper Balance of Active and Repressive Chromatin Marks

    Directory of Open Access Journals (Sweden)

    Kyle A. McElroy


    Full Text Available Chromatin plays a critical role in faithful implementation of gene expression programs. Different post-translational modifications (PTMs of histone proteins reflect the underlying state of gene activity, and many chromatin proteins write, erase, bind, or are repelled by, these histone marks. One such protein is UpSET, the Drosophila homolog of yeast Set3 and mammalian KMT2E (MLL5. Here, we show that UpSET is necessary for the proper balance between active and repressed states. Using CRISPR/Cas-9 editing, we generated S2 cells that are mutant for upSET. We found that loss of UpSET is tolerated in S2 cells, but that heterochromatin is misregulated, as evidenced by a strong decrease in H3K9me2 levels assessed by bulk histone PTM quantification. To test whether this finding was consistent in the whole organism, we deleted the upSET coding sequence using CRISPR/Cas-9, which we found to be lethal in both sexes in flies. We were able to rescue this lethality using a tagged upSET transgene, and found that UpSET protein localizes to transcriptional start sites (TSS of active genes throughout the genome. Misregulated heterochromatin is apparent by suppressed position effect variegation of the wm4 allele in heterozygous upSET-deleted flies. Using nascent-RNA sequencing in the upSET-mutant S2 lines, we show that this result applies to heterochromatin genes generally. Our findings support a critical role for UpSET in maintaining heterochromatin, perhaps by delimiting the active chromatin environment.

  10. A STE12 homologue of the homothallic ascomycete Sordaria macrospora interacts with the MADS box protein MCM1 and is required for ascosporogenesis. (United States)

    Nolting, Nicole; Pöggeler, Stefanie


    The MADS box protein MCM1 controls diverse developmental processes and is essential for fruiting body formation in the homothallic ascomycete Sordaria macrospora. MADS box proteins derive their regulatory specificity from a wide range of different protein interactions. We have recently shown that the S. macrospora MCM1 is able to interact with the alpha-domain mating-type protein SMTA-1. To further evaluate the functional roles of MCM1, we used the yeast two-hybrid approach to identify MCM1-interacting proteins. From this screen, we isolated a protein with a putative N-terminal homeodomain and C-terminal C2/H2-Zn2+ finger domains. The protein is a member of the highly conserved fungal STE12 transcription factor family of proteins and was therefore termed STE12. Furthermore, we demonstrate by means of two-hybrid and far western analysis that in addition to MCM1, the S. macrospora STE12 protein is able to interact with the mating-type protein SMTA-1. Unlike the situation in the closely related heterothallic ascomycete Neurospora crassa, deletion (Delta) of the ste12 gene in S. macrospora neither affects vegetative growth nor fruiting body formation. However, ascus and ascospore development are highly impaired by the Deltaste12 mutation. Our data provide another example of the functional divergence within the fungal STE12 transcription factor family.

  11. Structural and biophysical studies with the MjTX-I, a Lys49-phospholipase A2 homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Salvador, G.H.M.; Fernandes, C.A.H.; Fernandez, R.M.; Fontes, M.R.M.; Marchi-Salvador, D.P.; Soares, A.M.; Oliveira, C.L.P


    Full text: Phospholipases A 2 (PLA 2 ) are small proteins found in a great diversity of organisms and belong to a superfamily of proteins involved in many important pharmacological processes, such as neurotoxicity, myotoxicity, platelet aggregation, and anticoagulant activity. Ophidic accidents caused by snakes from Bothrops genus are not efficiently neutralized by conventional serum therapy, and then detailed studies with this class of proteins may be very important to supplement this conventional therapy. Miotoxin-I (MjTX-I) is a basic Lys49-PLA 2 , isolated from Bothrops moojeni snake venom, which induces a drastic local myonecrosis. Crystal structure of MjTX-I shows four molecules in the asymmetric unit, an unusually oligomeric conformation for snake venom Lys49-PLA 2 s. However, bioinformatics techniques indicate a dimer as the biological oligomeric conformation. To get additional information of its biological conformation, we also performed Dynamic Light Scattering, Size Exclusion Chromatography and Small Angle X-ray Scattering experiments. These techniques showed a monomer as the most probable biological conformation in water; however small changes in pH and ionic strength result in different oligomeric assemblies. These novel information for Lys49-PLA 2 s may result in important conclusions for this intriguing class of toxins. (author)

  12. Dataset of the human homologues and orthologues of lipid-metabolic genes identified as DAF-16 targets their roles in lipid and energy metabolism. (United States)

    Fan, Lavender Yuen-Nam; Saavedra-García, Paula; Lam, Eric Wing-Fai


    The data presented in this article are related to the review article entitled 'Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis' (Saavedra-Garcia et al., 2017) [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.

  13. Structural and biophysical studies with the MjTX-I, a Lys49-phospholipase A{sub 2} homologue from Bothrops moojeni venom

    Energy Technology Data Exchange (ETDEWEB)

    Salvador, G.H.M.; Fernandes, C.A.H.; Fernandez, R.M.; Fontes, M.R.M. [UNESP, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi-Salvador, D.P. [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil); Soares, A.M. [Universidade de Sao Paulo (USP-RP), Ribeirao Preto, SP (Brazil); Oliveira, C.L.P [Universidade de Sao Paulo (USP), SP (Brazil)


    Full text: Phospholipases A{sub 2} (PLA{sub 2}) are small proteins found in a great diversity of organisms and belong to a superfamily of proteins involved in many important pharmacological processes, such as neurotoxicity, myotoxicity, platelet aggregation, and anticoagulant activity. Ophidic accidents caused by snakes from Bothrops genus are not efficiently neutralized by conventional serum therapy, and then detailed studies with this class of proteins may be very important to supplement this conventional therapy. Miotoxin-I (MjTX-I) is a basic Lys49-PLA{sub 2}, isolated from Bothrops moojeni snake venom, which induces a drastic local myonecrosis. Crystal structure of MjTX-I shows four molecules in the asymmetric unit, an unusually oligomeric conformation for snake venom Lys49-PLA{sub 2}s. However, bioinformatics techniques indicate a dimer as the biological oligomeric conformation. To get additional information of its biological conformation, we also performed Dynamic Light Scattering, Size Exclusion Chromatography and Small Angle X-ray Scattering experiments. These techniques showed a monomer as the most probable biological conformation in water; however small changes in pH and ionic strength result in different oligomeric assemblies. These novel information for Lys49-PLA{sub 2}s may result in important conclusions for this intriguing class of toxins. (author)

  14. A Lectin from Dioclea violacea Interacts with Midgut Surface of Lutzomyia migonei, Unlike Its Homologues, Cratylia floribunda Lectin and Canavalia gladiata Lectin

    Directory of Open Access Journals (Sweden)

    Juliana Montezuma Barbosa Monteiro Tínel


    Full Text Available Leishmaniasis is a vector-borne disease transmitted by phlebotomine sand fly. Susceptibility and refractoriness to Leishmania depend on the outcome of multiple interactions that take place within the sand fly gut. Promastigote attachment to sand fly midgut epithelium is essential to avoid being excreted together with the digested blood meal. Promastigote and gut sand fly surface glycans are important ligands in this attachment. The purpose of the present study was to evaluate the interaction of three lectins isolated from leguminous seeds (Diocleinae subtribe, D-glucose and D-mannose-binding, with glycans on Lutzomyia migonei midgut. To study this interaction the lectins were labeled with FITC and a fluorescence assay was performed. The results showed that only Dioclea violacea lectin (DVL was able to interact with midgut glycans, unlike Cratylia floribunda lectin (CFL and Canavalia gladiata lectin (CGL. Furthermore, when DVL was blocked with D-mannose the interaction was inhibited. Differences of spatial arrangement of residues and volume of carbohydrate recognition domain (CRD may be the cause of the fine specificity of DVL for glycans in the surface on Lu. migonei midgut. The findings in this study showed the presence of glycans in the midgut with glucose/mannose residues in its composition and these residues may be important in interaction between Lu. migonei midgut and Leishmania.

  15. NHE1 inhibition by amiloride- and benzoylguanidine-type compounds. Inhibitor binding loci deduced from chimeras of NHE1 homologues with endogenous differences in inhibitor sensitivity

    DEFF Research Database (Denmark)

    Pedersen, Stine F; King, Scott A; Nygaard, Eva B


    NHE1). Although highly homologous to the amiloride- and HOE-sensitive human NHE1 (hNHE1), AtNHE1 is insensitive to HOE-type and PaNHE1 to both amiloride- and HOE-type compounds. Here we generated chimeras to "knock in" amiloride and HOE sensitivity to PaNHE1, and we thereby identified several NHE1...

  16. Biologics beyond TNF-α inhibitors and the effect of targeting the homologues TL1A-DR3 pathway in chronic inflammatory disorders

    DEFF Research Database (Denmark)

    Tougaard, Peter; Zervides, Kristoffer Alexander; Skov, Søren


    novel drugs that target TNF-α signaling are still being developed. Indeed, blockade of this pathway seems so important amongst immune-targets that TNF-α targeted therapies will continue to have a significant role in the treatment of chronic inflammation. However, up to 40% of RA and IBD patients do...... as a highly promising strategy for treatment of chronic inflammatory disorders....

  17. HTLV-2B Tax oncoprotein is modified by ubiquitination and sumoylation and displays intracellular localization similar to its homologue HTLV-1 Tax

    International Nuclear Information System (INIS)

    Turci, Marco; Lodewick, Julie; Righi, Paola; Polania, Angela; Romanelli, Maria Grazia; Bex, Francoise; Bertazzoni, Umberto


    HTLV-1 is more pathogenic than HTLV-2B. The difference is generally attributed to the properties of their individual transactivating Tax proteins. By using internal Flag-6His tagged Tax-1 and Tax-2B, which display transcriptional activities comparable to the untagged proteins and can be recognized by a single anti-Flag antibody, we demonstrate that Tax-2B is modified by ubiquitination and sumoylation. In addition, Tax2B is distributed in punctuate nuclear structures that include the RelA subunit of NF-κB, as has been previously demonstrated for Tax-1

  18. Influence of l-Leucine and l-Alanine on Lrp Regulation of foo, Coding for F1651, a Pap Homologue


    Berthiaume, Frédéric; Crost, Cécile; Labrie, Vincent; Martin, Christine; Newman, Elaine B.; Harel, Josée


    The foo operon encodes F1651 fimbriae that belong to the P-regulatory family and are synthesized by septicemic Escherichia coli. Using an Lrp-deficient host and the lrp gene cloned under the arabinose pBAD promoter, we demonstrated that foo was transcribed proportionally to the amount of Lrp synthesized. l-Leucine and l-alanine decreased drastically the steady-state transcription of foo and modified phase variation, independently of the presence of FooI. Specific mutations in the C-terminal r...

  19. Functional analysis of the murine cytomegalovirus chemokine receptor homologue M33: ablation of constitutive signaling is associated with an attenuated phenotype in vivo

    DEFF Research Database (Denmark)

    Case, Ruth; Sharp, Emma; Benned-Jensen, Tau


    the salivary glands. In this study, we probed N- and C-terminal regions of M33 as well as known 7TMR signature motifs in transmembrane (TM) II and TM III to determine the impact on cell surface expression, constitutive signaling, and in vivo phenotype. The region between amino acids R(340) and A(353) of the C...

  20. Investigating the Role of the Arabidopsis Homologue of the Human G3BP in RNA Metabolism, Cellular Stress Responses and Innate Immunity

    KAUST Repository

    Abulfaraj, Aala A.


    Mitogen-activated protein kinases (MAPKs) belong to the most conserved signaling pathways and are found in all eukaryotes, including humans where they play important roles in various diseases and cancer. Stimulation of this signal transduction pathway by microbe-associated molecular patterns (MAMP) results in a multitude of events to regulate innate immune responses in Arabidopsis thaliana stimulating large-scale changes in gene expression. Starting from a phosphoproteomic screen in Arabidopsis thaliana wild type and mpk3, mpk4 and mpk6 mutants following microbe-associated molecular pattern (MAMP) treatment, several novel chromatin-associated proteins were identified that are differentially phosphorylated by stress-induced protein kinases. Arabidopsis Ras GTPase-activating protein SH3-domain-binding protein (AtG3BP-1) is a downstream putative substrate of the MAMP-stimulated MAPK pathway that is phosphorylated by MPK3, 4 and 6 in in vitro kinase assays. AtG3BP1 belongs to a highly conserved family of RNA-binding proteins in eukaryotes that link kinase receptormediated signaling to RNA metabolism. Here, we report the characterization of the Arabidopsis homolog of human G3BP1 in plant innate immunity. AtG3BP1 negatively regulates plant immunity and defense immune responses. Atg3bp1 mutant lines show constitutive stomata closure, expression of a number of key defense marker genes, and accumulate salicylic acid but not jasmonic acid. Furthermore, Atg3bp1 plants exhibit enhanced resistance to the biotrophic pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated by stomatal and apoplastic immunity in Atg3bp1. More generally, our data reinforce that AtG3BP1 is a key mediator of plant defense responses and transient expression of AtG3BP1 delivered striking disease resistance in the absence of yield penalty, highlighting a potential application of this gene in crop protection.

  1. Macrophage migration inhibitory factor (MIF) family in arthropods: Cloning and expression analysis of two MIF and one D-dopachrome tautomerase (DDT) homologues in mud crabs, Scylla paramamosain. (United States)

    Huang, Wen-Shu; Duan, Li-Peng; Huang, Bei; Wang, Ke-Jian; Zhang, Cai-Liang; Jia, Qin-Qin; Nie, Pin; Wang, Tiehui


    The macrophage migration inhibitory factor (MIF) family, consisting of MIF and D-dopachrome tautomerase (DDT) in vertebrates, is evolutionarily ancient and has been found across Kingdoms including vertebrates, invertebrates, plants and bacteria. The mammalian MIF family are chemokines at the top of the inflammatory cascade in combating infections. They also possess enzymatic activities, e.g. DDT catalysis results in the production of 5,6-dihydroxyindole (DHI), a precursor of eumelanin. MIF-like genes are widely distributed, but DDT-like genes have only been described in vertebrates and a nematode. In this report, we cloned a DDT-like gene, for the first time in arthropods, and a second MIF in mud crab. The mud crab MIF family have a three exon/two intron structure as seen in vertebrates. The identification of a DDT-like gene in mud crab and other arthropods suggests that the separation of MIF and DDT preceded the divergence of protostomes and deuterostomes. The MIF family is differentially expressed in tissues of adults and during embryonic development and early life. The high level expression of the MIF family in immune tissues, such as intestine and hepatopancreas, suggests an important role in mud crab innate immunity. Mud crab DDT is highly expressed in early embryos, in megalops and crablets and this coincides with the requirement for melanisation in egg chorion tanning and cuticular hardening in arthropods, suggesting a potential novel role of DDT in melanogenesis via its tautomerase activity to produce DHI in mud crab. The clarification of the presence of both MIF and DDT in this report paves the way for further investigation of their functional roles in immunity and in melanogenesis in mud crab and other arthropods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. The murine homologue of HIRA, a DiGeorge syndrome candidate gene, is expressed in embryonic structures affected in human CATCH22 patients

    NARCIS (Netherlands)

    L.G. Wilming (Laurens); C.A. Snoeren; A.L. Rijswijk (Angelique); C. Meijers (Carel); F.G. Grosveld (Frank)


    textabstractA wide spectrum of birth defects is caused by deletions of the DiGeorge syndrome chromosomal region at 22q11. Characteristic features include cranio-facial, cardiac and thymic malformations, which are thought to arise form disturbances in the interactions

  3. Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologues, Lim15/Dmc1, but does not stimulate its strand transfer activity

    International Nuclear Information System (INIS)

    Hamada, Fumika N.; Koshiyama, Akiyo; Namekawa, Satoshi H.; Ishii, Satomi; Iwabata, Kazuki; Sugawara, Hiroko; Nara, Takayuki Y.; Sakaguchi, Kengo; Sawado, Tomoyuki


    PCNA is a multi-functional protein that is involved in various nuclear events. Here we show that PCNA participates in events occurring during early meiotic prophase. Analysis of protein-protein interactions using surface plasmon resonance indicates that Coprinus cinereus PCNA (CoPCNA) specifically interacts with a meiotic specific RecA-like factor, C. cinereus Lim15/Dmc1 (CoLim15) in vitro. The binding efficiency increases with addition of Mg 2+ ions, while ATP inhibits the interaction. Co-immunoprecipitation experiments indicate that the CoLim15 protein interacts with the CoPCNA protein in vitro and in the cell extracts. Despite the interaction between these two factors, no enhancement of CoLim15-dependent strand transfer activity by CoPCNA was found in vitro. We propose that the interaction between Lim15/Dmc1 and PCNA mediates the recombination-associated DNA synthesis during meiosis


    We recently described a general method that can improve microarray analysis of toxicant-exposed cells that uses the intrinsic power of transcriptional coupling and toxicant concentration-expression response data. In this analysis, we characterized changes in global gene expressio...

  5. The chicken type III GnRH receptor homologue is predominantly expressed in the pituitary, and exhibits similar ligand selectivity to the type I receptor (United States)

    Joseph, Nerine T; Morgan, Kevin; Sellar, Robin; McBride, Derek; Millar, Robert P; Dunn, Ian C


    Two GnRH isoforms (cGnRH-I and GnRH-II) and two GnRH receptor subtypes (cGnRH-R-I and cGnRH-R-III) occur in chickens. Differential roles for these molecules in regulating gonadotrophin secretion or other functions are unclear. To investigate this we cloned cGnRH-R-III from a broiler chicken and compared its structure, expression and pharmacological properties with cGnRH-R-I. The broiler cGnRH-R-III cDNA was 100% identical to the sequence reported in the red jungle fowl and white leghorn breed. Pituitary cGnRH-R-III mRNA was ∼1400-fold more abundant than cGnRH-R-I mRNA. Northern analysis indicated a single cGnRH-R-III transcript. A pronounced sex and age difference existed, with higher pituitary transcript levels in sexually mature females versus juvenile females. In contrast, higher expression levels occurred in juvenile males versus sexually mature males. Functional studies in COS-7 cells indicated that cGnRH-R-III has a higher binding affinity for GnRH-II than cGnRH-I (Kd: 0·57 vs 19·8 nM) with more potent stimulation of inositol phosphate production (ED50: 0·8 vs 4·38 nM). Similar results were found for cGnRH-R-I, (Kd: 0·51 vs 10·8 nM) and (ED50: 0·7 vs 2·8 nM). The initial rate of internalisation was faster for cGnRH-R-III than cGnRH-R-I (26 vs 15·8%/min). Effects of GnRH antagonists were compared at the two receptors. Antagonist #27 distinguished between cGnRH-R-I and cGnRH-R-III (IC50: 2·3 vs 351 nM). These results suggest that cGnRH-R-III is probably the major mediator of pituitary gonadotroph function, that antagonist #27 may allow delineation of receptor subtype function in vitro and in vivo and that tissue-specific recruitment of cGnRH-R isoforms has occurred during evolution. PMID:19380456

  6. Gene dosage effects of the imprinted delta-like homologue 1 (dlk1/pref1 in development: implications for the evolution of imprinting.

    Directory of Open Access Journals (Sweden)

    Simao Teixeira da Rocha


    Full Text Available Genomic imprinting is a normal process that causes genes to be expressed according to parental origin. The selective advantage conferred by imprinting is not understood but is hypothesised to act on dosage-critical genes. Here, we report a unique model in which the consequences of a single, double, and triple dosage of the imprinted Dlk1/Pref1, normally repressed on the maternally inherited chromosome, can be assessed in the growing embryo. BAC-transgenic mice were generated that over-express Dlk1 from endogenous regulators at all sites of embryonic activity. Triple dosage causes lethality associated with major organ abnormalities. Embryos expressing a double dose of Dlk1, recapitulating loss of imprinting, are growth enhanced but fail to thrive in early life, despite the early growth advantage. Thus, any benefit conferred by increased embryonic size is offset by postnatal lethality. We propose a negative correlation between gene dosage and survival that fixes an upper limit on growth promotion by Dlk1, and we hypothesize that trade-off between growth and lethality might have driven imprinting at this locus.

  7. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli. (United States)

    Grove, Jane I; Wood, Stuart R; Briggs, Geoffrey S; Oldham, Neil J; Lloyd, Robert G


    RecN is a highly conserved, SMC-like protein in bacteria. It plays an important role in the repair of DNA double-strand breaks and is therefore a key factor in maintaining genome integrity. The insolubility of Escherichia coli RecN has limited efforts to unravel its function. We overcame this limitation by replacing the resident coding sequence with that of Haemophilus influenzae RecN. The heterologous construct expresses Haemophilus RecN from the SOS-inducible E. coli promoter. The hybrid gene is fully functional, promoting survival after I-SceI induced DNA breakage, gamma irradiation or exposure to mitomycin C as effectively as the native gene, indicating that the repair activity is conserved between these two species. H. influenzae RecN is quite soluble, even when expressed at high levels, and is readily purified. Its analysis by ionisation-mass spectrometry, gel filtration and glutaraldehyde crosslinking indicates that it is probably a dimer under physiological conditions, although a higher multimer cannot be excluded. The purified protein displays a weak ATPase activity that is essential for its DNA repair function in vivo. However, no DNA-binding activity was detected, which contrasts with RecN from Bacillus subtilis. RecN proteins from Aquifex aeolicus and Bacteriodes fragilis also proved soluble. Neither binds DNA, but the Aquifex RecN has weak ATPase activity. Our findings support studies indicating that RecN, and the SOS response in general, behave differently in E. coli and B. subtilis. The hybrid recN reported provides new opportunities to study the genetics and biochemistry of how RecN operates in E. coli.

  8. The catalytic subunit of human protein kinase CK2 structurally deviates from its maize homologue in complex with the nucleotide competitive inhibitor emodin

    DEFF Research Database (Denmark)

    Raaf, Jennifer; Klopffleisch, Karsten; Issinger, Olaf-Georg


    The Ser/Thr kinase CK2 (former name: casein kinase 2) is a heterotetrameric enzyme composed of two catalytic chains (CK2alpha) attached to a dimer of noncatalytic subunits. Together with the cyclin-dependent kinases and the mitogen-activated protein kinases, CK2alpha belongs to the CMGC family of...

  9. The light gene of Drosophila melanogaster encodes a homologue of VPS41, a yeast gene involved in cellular-protein trafficking. (United States)

    Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M


    Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.

  10. KdpE and a putative RsbQ homologue contribute to growth of Listeria monocytogenes at high osmolarity and low temperature

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Kallipolitis, Birgitte H; Ingmer, Hanne


    The kdp locus of Listeria monocytogenes encodes products with homology to structural proteins of a high-affinity potassium uptake system and to a two-component signal transduction system commonly involved in controlling gene expression. We have investigated the role of kdpE, encoding the transcri......The kdp locus of Listeria monocytogenes encodes products with homology to structural proteins of a high-affinity potassium uptake system and to a two-component signal transduction system commonly involved in controlling gene expression. We have investigated the role of kdpE, encoding...... the transcriptional response regulator, as well as of the downstream gene, orfX, in adaptation of L. monocytogenes EGD to NaCl and low temperature. When grown in chemically defined medium the addition of NaCl to 2% decreased the growth rate of a mutant with an insertional inactivated kdpE, while mutants carrying in......-frame deletions of either kdpE or orfX were unaffected by high osmolarity. Transcriptional analysis of kdpE and orfX revealed that their products are encoded by the same transcript. Thus, our data indicate that the absence of both KdpE and OrfX influences growth under osmotic pressure. Interestingly, Orf...

  11. Pilot-plant cultivation of Streptomyces griseus producing homologues of nonactin by precursor-directed biosynthesis and their identification by LC/MS-ESI

    Czech Academy of Sciences Publication Activity Database

    Řezanka, Tomáš; Prell, Aleš; Spížek, Jaroslav; Sigler, Karel


    Roč. 63, č. 8 (2010), s. 524-529 ISSN 0021-8820 R&D Projects: GA MŠk 1M06011 Institutional research plan: CEZ:AV0Z50200510 Keywords : liquid chromatography/MS-ESI * pilot-plant cultivation * precursor-directed biosynthesis Subject RIV: EE - Microbiology, Virology Impact factor: 1.628, year: 2010

  12. Disrupted epithelial/macrophage crosstalk via Spinster homologue 2-mediated S1P signaling may drive defective macrophage phagocytic function in COPD.

    Directory of Open Access Journals (Sweden)

    Hai B Tran

    Full Text Available We have previously established a link between impaired phagocytic capacity and deregulated S1P signaling in alveolar macrophages from COPD subjects. We hypothesize that this defect may include a disruption of epithelial-macrophage crosstalk via Spns2-mediated intercellular S1P signaling.Primary alveolar macrophages and bronchial epithelial cells from COPD subjects and controls, cell lines, and a mouse model of chronic cigarette smoke exposure were studied. Cells were exposed to 10% cigarette smoke extract, or vehicle control. Spns2 expression and subcellular localization was studied by immunofluorescence, confocal microscopy and RT-PCR. Phagocytosis was assessed by flow-cytometry. Levels of intra- and extracellular S1P were measured by S1P [3H]-labeling.Spns2 expression was significantly increased (p<0.05 in alveolar macrophages from current-smokers/COPD patients (n = 5 compared to healthy nonsmokers (n = 8 and non-smoker lung transplant patients (n = 4. Consistent with this finding, cigarette smoke induced a significant increase in Spns2 expression in both human alveolar and THP-1 macrophages. In contrast, a remarkable Spns2 down-regulation was noted in response to cigarette smoke in 16HBE14o- cell line (p<0.001 in 3 experiments, primary nasal epithelial cells (p<0.01 in 2 experiments, and in smoke-exposed mice (p<0.001, n = 6 animals per group. Spns2 was localized to cilia in primary bronchial epithelial cells. In both macrophage and epithelial cell types, Spns2 was also found localized to cytoplasm and the nucleus, in line with a predicted bipartile Nuclear Localization Signal at the position aa282 of the human Spns2 sequence. In smoke-exposed mice, alveolar macrophage phagocytic function positively correlated with Spns2 protein expression in bronchial epithelial cells.Our data suggest that the epithelium may be the major source for extracellular S1P in the airway and that there is a possible disruption of epithelial/macrophage cross talk via Spns2-mediated S1P signaling in COPD and in response to cigarette smoke exposure.

  13. Disrupted epithelial/macrophage crosstalk via Spinster homologue 2-mediated S1P signaling may drive defective macrophage phagocytic function in COPD. (United States)

    Tran, Hai B; Jersmann, Hubertus; Truong, Tung Thanh; Hamon, Rhys; Roscioli, Eugene; Ween, Miranda; Pitman, Melissa R; Pitson, Stuart M; Hodge, Greg; Reynolds, Paul N; Hodge, Sandra


    We have previously established a link between impaired phagocytic capacity and deregulated S1P signaling in alveolar macrophages from COPD subjects. We hypothesize that this defect may include a disruption of epithelial-macrophage crosstalk via Spns2-mediated intercellular S1P signaling. Primary alveolar macrophages and bronchial epithelial cells from COPD subjects and controls, cell lines, and a mouse model of chronic cigarette smoke exposure were studied. Cells were exposed to 10% cigarette smoke extract, or vehicle control. Spns2 expression and subcellular localization was studied by immunofluorescence, confocal microscopy and RT-PCR. Phagocytosis was assessed by flow-cytometry. Levels of intra- and extracellular S1P were measured by S1P [3H]-labeling. Spns2 expression was significantly increased (pS1P in the airway and that there is a possible disruption of epithelial/macrophage cross talk via Spns2-mediated S1P signaling in COPD and in response to cigarette smoke exposure.

  14. Combination of Hypomorphic Mutations of the Drosophila Homologues of Aryl Hydrocarbon Receptor and Nucleosome Assembly Protein Family Genes Disrupts Morphogenesis, Memory and Detoxification


    Kuzin, Boris A.; Nikitina, Ekaterina A.; Cherezov, Roman O.; Vorontsova, Julia E.; Slezinger, Mikhail S.; Zatsepina, Olga G.; Simonova, Olga B.; Enikolopov, Grigori N.; Savvateeva-Popova, Elena V.


    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response...

  15. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification. (United States)

    Kuzin, Boris A; Nikitina, Ekaterina A; Cherezov, Roman O; Vorontsova, Julia E; Slezinger, Mikhail S; Zatsepina, Olga G; Simonova, Olga B; Enikolopov, Grigori N; Savvateeva-Popova, Elena V


    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  16. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Directory of Open Access Journals (Sweden)

    Boris A Kuzin

    Full Text Available Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  17. Investigating the Role of the Arabidopsis Homologue of the Human G3BP in RNA Metabolism, Cellular Stress Responses and Innate Immunity

    KAUST Repository

    Abulfaraj, Aala A.


    immunity and defense immune responses. Atg3bp1 mutant lines show constitutive stomata closure, expression of a number of key defense marker genes, and accumulate salicylic acid but not jasmonic acid. Furthermore, Atg3bp1 plants exhibit enhanced resistance

  18. Cloning of a protein arginine methyltransferase PRMT1 homologue from Schistosoma mansoni: Evidence for roles in nuclear receptor signaling and RNA metabolism

    International Nuclear Information System (INIS)

    Mansure, Jose Joao; Furtado, Daniel Rodrigues; Bastos de Oliveira, Francisco Meirelles; Rumjanek, Franklin David; Franco, Gloria Regina; Fantappie, Marcelo Rosado


    The most studied arginine methyltransferase is the type I enzyme, which catalyzes the transfer of an S-adenosyl-L-methionine to a broad spectrum of substrates, including histones, RNA-transporting proteins, and nuclear hormone receptor coactivators. We cloned a cDNA encoding a protein arginine methyltransferase in Schistosoma mansoni (SmPRMT1). SmPRMT1 is highly homologous to the vertebrate PRMT1 enzyme. In vitro methylation assays showed that SmPRMT1 recombinant protein was able to specifically methylate histone H4. Two schistosome proteins likely to be involved in RNA metabolism, SMYB1 and SmSmD3, that display a number of RGG motifs, were strongly methylated by SmPRMT1. In vitro GST pull-down assays showed that SMYB1 and SmSmD3 physically interacted with SmPRMT1. Additional GST pull-down assay suggested the occurrence of a ternary complex including SmPRMT1, SmRXR1 nuclear receptor, and the p160 (SRC-1) nuclear receptor coactivator. Together, these data suggest a mechanism by which SmPRMT1 plays a role in nuclear receptor-mediated chromatin remodeling and RNA transactions

  19. Mating type gene homologues and putative sex pheromone-sensing pathway in arbuscular mycorrhizal fungi, a presumably asexual plant root symbiont.

    Directory of Open Access Journals (Sweden)

    Sébastien Halary

    Full Text Available The fungal kingdom displays a fascinating diversity of sex-determination systems. Recent advances in genomics provide insights into the molecular mechanisms of sex, mating type determination, and evolution of sexual reproduction in many fungal species in both ancient and modern phylogenetic lineages. All major fungal groups have evolved sexual differentiation and recombination pathways. However, sexuality is unknown in arbuscular mycorrhizal fungi (AMF of the phylum Glomeromycota, an ecologically vital group of obligate plant root symbionts. AMF are commonly considered an ancient asexual lineage dating back to the Ordovician, approximately 460 M years ago. In this study, we used genomic and transcriptomic surveys of several AMF species to demonstrate the presence of conserved putative sex pheromone-sensing mitogen-activated protein (MAP kinases, comparable to those described in Ascomycota and Basidiomycota. We also find genes for high mobility group (HMG transcription factors, homologous to SexM and SexP genes in the Mucorales. The SexM genes show a remarkable sequence diversity among multiple copies in the genome, while only a single SexP sequence was detected in some isolates of Rhizophagus irregularis. In the Mucorales and Microsporidia, the sexM gene is flanked by genes for a triosephosphate transporter (TPT and a RNA helicase, but we find no evidence for synteny in the vicinity of the Sex locus in AMF. Nonetheless, our results, together with previous observations on meiotic machinery, suggest that AMF could undergo a complete sexual reproduction cycle.

  20. Crystallization and preliminary X-ray crystallographic studies of a Lys49-phospholipase A2 homologue from Bothrops pirajai venom complexed with rosmarinic acid

    International Nuclear Information System (INIS)

    Santos, Juliana I. dos; Santos-Filho, Norival A.; Soares, Andreimar M.; Fontes, Marcos R. M.


    PrTX-I, a noncatalytic and myotoxic Lys49-phospholipase A 2 from B. pirajai venom, was cocrystallized with the inhibitor rosmarinic acid from C. verbenacea. The crystals diffracted X-rays to 1.8 Å resolution and the structure was solved, indicating a remarkable electronic density for the ligand at the entrance to the hydrophobic channel. PrTX-I, a noncatalytic and myotoxic Lys49-phospholipase A 2 from Bothrops pirajai venom, was crystallized in the presence of the inhibitor rosmarinic acid (RA). This is the active compound in the methanolic extract of Cordia verbenacea, a plant that is largely used in Brazilian folk medicine. The crystals diffracted X-rays to 1.8 Å resolution and the structure was solved by molecular-replacement techniques, showing electron density that corresponds to RA molecules at the entrance to the hydrophobic channel. The crystals belong to space group P2 1 2 1 2 1 , indicating conformational changes in the structure after ligand binding: the crystals of all apo Lys49-phospholipase A 2 structures belong to space group P3 1 21, while the crystals of complexed structures belong to space groups P2 1 or P2 1 2 1 2 1

  1. Crystallization and preliminary X-ray crystallographic studies of a Lys49-phospholipase A{sub 2} homologue from Bothrops pirajai venom complexed with rosmarinic acid

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Juliana I. dos [Departamento de Física e Biofísica, Instituto de Biociências, UNESP - Universidade Estadual Paulista, Botucatu-SP (Brazil); Instituto Nacional de Ciência e Tecnologia em Toxinas, CNPq (Brazil); Santos-Filho, Norival A.; Soares, Andreimar M. [Instituto Nacional de Ciência e Tecnologia em Toxinas, CNPq (Brazil); Departamento de Análizes Clínicas, Toxicológicas e Bromatológicas, FCFRP, USP, Ribeirão Preto-SP (Brazil); Fontes, Marcos R. M., [Departamento de Física e Biofísica, Instituto de Biociências, UNESP - Universidade Estadual Paulista, Botucatu-SP (Brazil); Instituto Nacional de Ciência e Tecnologia em Toxinas, CNPq (Brazil)


    PrTX-I, a noncatalytic and myotoxic Lys49-phospholipase A{sub 2} from B. pirajai venom, was cocrystallized with the inhibitor rosmarinic acid from C. verbenacea. The crystals diffracted X-rays to 1.8 Å resolution and the structure was solved, indicating a remarkable electronic density for the ligand at the entrance to the hydrophobic channel. PrTX-I, a noncatalytic and myotoxic Lys49-phospholipase A{sub 2} from Bothrops pirajai venom, was crystallized in the presence of the inhibitor rosmarinic acid (RA). This is the active compound in the methanolic extract of Cordia verbenacea, a plant that is largely used in Brazilian folk medicine. The crystals diffracted X-rays to 1.8 Å resolution and the structure was solved by molecular-replacement techniques, showing electron density that corresponds to RA molecules at the entrance to the hydrophobic channel. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, indicating conformational changes in the structure after ligand binding: the crystals of all apo Lys49-phospholipase A{sub 2} structures belong to space group P3{sub 1}21, while the crystals of complexed structures belong to space groups P2{sub 1} or P2{sub 1}2{sub 1}2{sub 1}.

  2. Anion exchange behavior of Ti, Zr, Hf, Nb and Ta as homologues of Rf and Db in mixed HF-acetone solutions

    International Nuclear Information System (INIS)

    Aksenov, N.V.; Bozhikov, G.A.; Starodub, G.Ya.; Dmitriev, S.N.; Filosofov, D.V.; Jon Sun Jin; Radchenko, V.I.; Lebedev, N.A.; Novgorodov, A.F.


    We studied in detail the sorption behavior of Ti, Zr, Hf, Nb and Ta on AG 1 anion exchange resin in HF-acetone mixed solutions as a function of organic cosolvent and acid concentrations. Anion exchange behavior was found to be strongly acetone concentration dependent. The distribution coefficients of Ti, Zr, Hf and Nb increased and those of Ta decreased with increasing content of acetone in HF solutions. With increasing HF concentration, anion exchange equilibrium analysis indicated the formation of fluoride complexes of group-4 elements with charge -3 and Ta with charge -2. For Nb the slope of -2 increased up to -5. Optimal conditions for separation of the elements using AIX chromatography were found. Group-4 elements formed MF 7 3- (M = Ti, Zr, Hf) complexes whose sorption decreased Ti > Hf > Zr in reverse order of complex stability. This fact is of particular interest for studying ion exchange behavior of Rf compared to Ti. The advantages of studying chemical properties of Rf and Db in aqueous HF solutions mixed with organic solvents are briefly discussed

  3. Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue. (United States)

    Busot, Grethel Yanet; McClure, Bruce; Ibarra-Sánchez, Claudia Patricia; Jiménez-Durán, Karina; Vázquez-Santana, Sonia; Cruz-García, Felipe


    After landing on a wet stigma, pollen grains hydrate and germination generally occurs. However, there is no certainty of the pollen tube growth through the style to reach the ovary. The pistil is a gatekeeper that evolved in many species to recognize and reject the self-pollen, avoiding endogamy and encouraging cross-pollination. However, recognition is a complex process, and specific factors are needed. Here the isolation and characterization of a stigma-specific protein from N. alata, NaStEP (N. alata Stigma Expressed Protein), that is homologous to Kunitz-type proteinase inhibitors, are reported. Activity gel assays showed that NaStEP is not a functional serine proteinase inhibitor. Immunohistochemical and protein blot analyses revealed that NaStEP is detectable in stigmas of self-incompatible (SI) species N. alata, N. forgetiana, and N. bonariensis, but not in self-compatible (SC) species N. tabacum, N. plumbaginifolia, N. benthamiana, N. longiflora, and N. glauca. NaStEP contains the vacuolar targeting sequence NPIVL, and immunocytochemistry experiments showed vacuolar localization in unpollinated stigmas. After self-pollination or pollination with pollen from the SC species N. tabacum or N. plumbaginifolia, NaStEP was also found in the stigmatic exudate. The synthesis and presence in the stigmatic exudate of this protein was strongly induced in N. alata following incompatible pollination with N. tabacum pollen. The transfer of NaStEP to the stigmatic exudate was accompanied by perforation of the stigmatic cell wall, which appeared to release the vacuolar contents to the apoplastic space. The increase in NaStEP synthesis after pollination and its presence in the stigmatic exudates suggest that this protein may play a role in the early pollen-stigma interactions that regulate pollen tube growth in Nicotiana.

  4. Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue


    Busot, Grethel Yanet; McClure, Bruce; Ibarra-S?nchez, Claudia Patricia; Jim?nez-Dur?n, Karina; V?zquez-Santana, Sonia; Cruz-Garc?a, Felipe


    After landing on a wet stigma, pollen grains hydrate and germination generally occurs. However, there is no certainty of the pollen tube growth through the style to reach the ovary. The pistil is a gatekeeper that evolved in many species to recognize and reject the self-pollen, avoiding endogamy and encouraging cross-pollination. However, recognition is a complex process, and specific factors are needed. Here the isolation and characterization of a stigma-specific protein from N. alata, NaStE...

  5. Fission Yeast SCYL1/2 Homologue Ppk32: A Novel Regulator of TOR Signalling That Governs Survival during Brefeldin A Induced Stress to Protein Trafficking. (United States)

    Kowalczyk, Katarzyna M; Petersen, Janni


    Target of Rapamycin (TOR) signalling allows eukaryotic cells to adjust cell growth in response to changes in their nutritional and environmental context. The two distinct TOR complexes (TORC1/2) localise to the cell's internal membrane compartments; the endoplasmic reticulum (ER), Golgi apparatus and lysosomes/vacuoles. Here, we show that Ppk32, a SCYL family pseudo-kinase, is a novel regulator of TOR signalling. The absence of ppk32 expression confers resistance to TOR inhibition. Ppk32 inhibition of TORC1 is critical for cell survival following Brefeldin A (BFA) induced stress. Treatment of wild type cells with either the TORC1 specific inhibitor rapamycin or the general TOR inhibitor Torin1 confirmed that a reduction in TORC1 activity promoted recovery from BFA induced stress. Phosphorylation of Ppk32 on two residues that are conserved within the SCYL pseudo-kinase family are required for this TOR inhibition. Phosphorylation on these sites controls Ppk32 protein levels and sensitivity to BFA. BFA induced ER stress does not account for the response to BFA that we report here, however BFA is also known to induce Golgi stress and impair traffic to lysosomes. In summary, Ppk32 reduce TOR signalling in response to BFA induced stress to support cell survival.

  6. Effect of network mesh size on the thermo-mechanical properties of epoxy nanocomposites with the heavier homologue of POSS, the inorganic butylstannoxane cages

    Czech Academy of Sciences Publication Activity Database

    Rodzen, Krzysztof; Strachota, Adam; Ribot, F.; Šlouf, Miroslav


    Roč. 57, August (2014), s. 169-181 ISSN 0014-3057 R&D Projects: GA ČR GAP108/11/2151 Institutional support: RVO:61389013 Keywords : nanocomposite * POSS * stannoxane Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.005, year: 2014

  7. Characterization of a Vibrio vulnificus LysR homologue, HupR, which regulates expression of the haem uptake outer membrane protein, HupA. (United States)

    Litwin, C M; Quackenbush, J


    In Vibrio vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. Here, we show that the DNA upstream of hupA (haem uptake receptor) in V. vulnificus encodes a protein in the inverse orientation to hupA (named hupR). HupR shares homology with the LysR family of positive transcriptional activators. A hupA-lacZ fusion contained on a plasmid was transformed into Fur(-), Fur(+)and HupR(-)strains of V. vulnificus. The beta-galactosidase assays and Northern blot analysis showed that transcription of hupA is negatively regulated by iron and the Fur repressor in V. vulnificus. Under low-iron conditions with added haemin, the expression of hupA in the hupR mutant was significantly lower than in the wild-type. This diminished response to haem was detected by both Northern blot and hupA-lacZ fusion analysis. The haem response of hupA in the hupR mutant was restored to wild-type levels when complemented with hupR in trans. These studies suggest that HupR may act as a positive regulator of hupA transcription under low-iron conditions in the presence of haemin. Copyright 2001 Academic Press.

  8. A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues

    NARCIS (Netherlands)

    Marcel, T.C.; Varshney, R.K.; Barbieri, M.; Jafary, H.; Kock, de M.J.D.; Graner, A.; Niks, R.E.


    A consensus map of barley was constructed based on three reference doubled haploid (DH) populations and three recombinant inbred line (RIL) populations. Several sets of microsatellites were used as bridge markers in the integration of those populations previously genotyped with RFLP or with AFLP

  9. A lumpy skin disease virus deficient of an IL-10 gene homologue provides protective immunity against virulent capripoxvirus challenge in sheep and goats. (United States)

    Boshra, Hani; Truong, Thang; Nfon, Charles; Bowden, Timothy R; Gerdts, Volker; Tikoo, Suresh; Babiuk, Lorne A; Kara, Pravesh; Mather, Arshad; Wallace, David B; Babiuk, Shawn


    Sheep and goat pox continue to be important livestock diseases that pose a major threat to the livestock industry in many regions in Africa and Asia. Currently, several live attenuated vaccines are available and used in endemic countries to control these diseases. One of these is a partially attenuated strain of lumpy skin disease virus (LSDV), KS-1, which provides cross-protection against both sheep pox and goat pox. However, when used in highly stressed dairy cattle to protect against lumpy skin disease (LSD) the vaccine can cause clinical disease. In order to develop safer vaccines effective against all three diseases, a pathogenic strain of LSDV (Warmbaths [WB], South Africa) was attenuated by removing a putative virulence factor gene (IL-10-like) using gene knockout (KO) technology. This construct (LSDV WB005KO) was then evaluated as a vaccine for sheep and goats against virulent capripoxvirus challenge. Sheep and goats were vaccinated with the construct and the animals were observed for 21days. The vaccine appeared to be safe, and did not cause disease, although it induced minor inflammation at the injection site similar to that caused by other attenuated sheep and goat pox vaccines. In addition, no virus replication was detected in blood, oral or nasal swabs using real-time PCR following vaccination and low levels of neutralising antibodies were detected in both sheep and goats. Leukocytes isolated from vaccinated animals following vaccination elicited capripoxvirus-specific IFN-γ secretion, suggesting that immunity was also T-cell mediated. Following challenge with virulent capripoxvirus, vaccinated sheep and goats were found to be completely protected and exhibited no clinical disease. Furthermore, real-time PCR of blood samples at various time points suggested that viremia was absent in both groups of vaccinated animals, as opposed to capripoxvirus-related clinical disease and viremia observed in the unvaccinated animals. These findings suggest that this novel knockout strain of LSDV has potential as a vaccine to protect livestock against sheep pox and goat pox. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  10. The crystal structure of Cu1.78Bi4.73Se8, an N=3 pavonite homologue with a Cu-for-Bi substitution

    DEFF Research Database (Denmark)

    Makovicky, Emil; Søtofte, Inger; Karup-Møller, Sven


    Abstract: Cu1.78Bi4.73Se8, synthesized in a dry phase system Cu-Bi-Se at 450 degrees C, is monoclinic, a = 13.759 angstrom, b = 4.168 angstrom, c = 14.683 angstrom, beta = 115.61 degrees, space group C2/m. It is an N = 3 member of the pavonite homologous series, with the composition limits Cu1.96Bi...

  11. Disruption of the Saccharomyces cerevisiae homologue to the murine fatty acid transport protein impairs uptake and growth on long-chain fatty acids

    DEFF Research Database (Denmark)

    Færgeman, Nils J.; DiRusso, C C; Elberger, A


    decrease in the uptake of the fluorescent long-chain fatty acid analogue boron dipyrromethene difluoride dodecanoic acid (BODIPY-3823); 3) a reduced rate of exogenous oleate incorporation into phospholipids; and 4) a 2-3-fold decrease in the rates of oleate uptake. These data support the hypothesis...

  12. Plasmodium falciparum Hsp70-z, an Hsp110 homologue, exhibits independent chaperone activity and interacts with Hsp70-1 in a nucleotide-dependent fashion. (United States)

    Zininga, Tawanda; Achilonu, Ikechukwu; Hoppe, Heinrich; Prinsloo, Earl; Dirr, Heini W; Shonhai, Addmore


    The role of molecular chaperones, among them heat shock proteins (Hsps), in the development of malaria parasites has been well documented. Hsp70s are molecular chaperones that facilitate protein folding. Hsp70 proteins are composed of an N-terminal nucleotide binding domain (NBD), which confers them with ATPase activity and a C-terminal substrate binding domain (SBD). In the ADP-bound state, Hsp70 possesses high affinity for substrate and releases the folded substrate when it is bound to ATP. The two domains are connected by a conserved linker segment. Hsp110 proteins possess an extended lid segment, a feature that distinguishes them from canonical Hsp70s. Plasmodium falciparum Hsp70-z (PfHsp70-z) is a member of the Hsp110 family of Hsp70-like proteins. PfHsp70-z is essential for survival of malaria parasites and is thought to play an important role as a molecular chaperone and nucleotide exchange factor of its cytosolic canonical Hsp70 counterpart, PfHsp70-1. Unlike PfHsp70-1 whose functions are fairly well established, the structure-function features of PfHsp70-z remain to be fully elucidated. In the current study, we established that PfHsp70-z possesses independent chaperone activity. In fact, PfHsp70-z appears to be marginally more effective in suppressing protein aggregation than its cytosol-localized partner, PfHsp70-1. Furthermore, based on coimmunoaffinity chromatography and surface plasmon resonance analyses, PfHsp70-z associated with PfHsp70-1 in a nucleotide-dependent fashion. Our findings suggest that besides serving as a molecular chaperone, PfHsp70-z could facilitate the nucleotide exchange function of PfHsp70-1. These dual functions explain why it is essential for parasite survival.

  13. Mutating the heme sensing response regulator HssR in Staphylococcus aureus but not in the Listeria monocytogenes homologue results in increased tolerance to the antimicrobial peptide Plectasin

    DEFF Research Database (Denmark)

    Thomsen, L. E.; Gottlieb, Caroline Trebbien; Gottschalk, S.


    . However, in S. aureus, four mutants with insertion in the heme response regulator (hssR) were 2-4 fold more resistant to plectasin as compared to the wild type. The hssR mutation also enhanced resistance to the plectasin-like defensin eurocin, but not to other classes of HDPs or to other stressors tested...... is incompletely understood and such knowledge is required to evaluate their potential as antimicrobial therapeutics. Plectasin is a recently discovered HDP active against Gram-positive bacteria with the human pathogen, Staphylococcus aureus (S. aureus) being highly susceptible and the food borne pathogen...... constructed bacterial transposon mutant libraries of S. aureus NCTC8325-4 and L. monocytogenes 4446 and screened for increased resistance to the peptide. No resistant mutants arose when L. monocytogenes was screened on plates containing 5 and 10 fold Minimal Inhibitory Concentration (MIC) of plectasin...

  14. nuvA, an Aspergillus nidulans gene involved in DNA repair and recombination, is a homologue of Saccharomyces cerevisiae RAD18 and Neurospora crassa uvs-2. (United States)

    Iwanejko, L; Cotton, C; Jones, G; Tomsett, B; Strike, P


    A 40 kb genomic clone and 2.3 kb EcoRI subclone that rescued the DNA repair and recombination defects of the Aspergillus nidulans nuvA11 mutant were isolated and the subclone sequenced. The subclone hybridized to a cosmid in a chromosome-specific library confirming the assignment of nuvA to linkage group IV and indicating its closeness to bimD. Amplification by PCR clarified the relative positions of nuvA and bimD. A region identified within the subclone, encoding a C3HC4 zinc finger motif, was used as a probe to retrieve a cDNA clone. Sequencing of this clone showed that the nuvA gene has an ORF of 1329 bp with two introns of 51 bp and 60 bp. Expression of nuvA appears to be extremely low. The putative NUVA polypeptide has two zinc finger motifs, a molecular mass of 48906 Da and has 39% identity with the Neurospora crassa uvs-2 and 25% identity with the Saccharomyces cerevisiae RAD18 translation products. Although mutations in nuvA, uvs-2 and RAD18 produce similar phenotypes, only the nuvA11 mutation affects meiotic recombination. A role for nuvA in both DNA repair and genetic recombination is proposed.

  15. Functional characterisation of the Schizosaccharomyces pombe homologue of the leukaemia-associated translocation breakpoint binding protein translin and its binding partner, TRAX. (United States)

    Jaendling, Alessa; Ramayah, Soshila; Pryce, David W; McFarlane, Ramsay J


    Translin is a conserved protein which associates with the breakpoint junctions of chromosomal translocations linked with the development of some human cancers. It binds to both DNA and RNA and has been implicated in mRNA metabolism and regulation of genome stability. It has a binding partner, translin-associated protein X (TRAX), levels of which are regulated by the translin protein in higher eukaryotes. In this study we find that this regulatory function is conserved in the lower eukaryotes, suggesting that translin and TRAX have important functions which provide a selective advantage to both unicellular and multi-cellular eukaryotes, indicating that this function may not be tissue-specific in nature. However, to date, the biological importance of translin and TRAX remains unclear. Here we systematically investigate proposals that suggest translin and TRAX play roles in controlling mitotic cell proliferation, DNA damage responses, genome stability, meiotic/mitotic recombination and stability of GT-rich repeat sequences. We find no evidence for translin and/or TRAX primary function in these pathways, indicating that the conserved biochemical function of translin is not implicated in primary pathways for regulating genome stability and/or segregation.

  16. FK506 biosynthesis is regulated by two positive regulatory elements in Streptomyces tsukubaensis

    Directory of Open Access Journals (Sweden)

    Goranovič Dušan


    Full Text Available Abstract Background FK506 (Tacrolimus is an important immunosuppressant, produced by industrial biosynthetic processes using various Streptomyces species. Considering the complex structure of FK506, it is reasonable to expect complex regulatory networks controlling its biosynthesis. Regulatory elements, present in gene clusters can have a profound influence on the final yield of target product and can play an important role in development of industrial bioprocesses. Results Three putative regulatory elements, namely fkbR, belonging to the LysR-type family, fkbN, a large ATP-binding regulator of the LuxR family (LAL-type and allN, a homologue of AsnC family regulatory proteins, were identified in the FK506 gene cluster from Streptomyces tsukubaensis NRRL 18488, a progenitor of industrial strains used for production of FK506. Inactivation of fkbN caused a complete disruption of FK506 biosynthesis, while inactivation of fkbR resulted in about 80% reduction of FK506 yield. No functional role in the regulation of the FK506 gene cluster has been observed for the allN gene. Using RT-PCR and a reporter system based on a chalcone synthase rppA, we demonstrated, that in the wild type as well as in fkbN- and fkbR-inactivated strains, fkbR is transcribed in all stages of cultivation, even before the onset of FK506 production, whereas fkbN expression is initiated approximately with the initiation of FK506 production. Surprisingly, inactivation of fkbN (or fkbR does not abolish the transcription of the genes in the FK506 gene cluster in general, but may reduce expression of some of the tested biosynthetic genes. Finally, introduction of a second copy of the fkbR or fkbN genes under the control of the strong ermE* promoter into the wild type strain resulted in 30% and 55% of yield improvement, respectively. Conclusions Our results clearly demonstrate the positive regulatory role of fkbR and fkbN genes in FK506 biosynthesis in S. tsukubaensis NRRL 18488. We

  17. Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion. (United States)

    Li, Peng; Tian, Mingxing; Bao, Yanqing; Hu, Hai; Liu, Jiameng; Yin, Yi; Ding, Chan; Wang, Shaohui; Yu, Shengqing


    Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS) and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant Δ rfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the molecular

  18. Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion

    Directory of Open Access Journals (Sweden)

    Peng Li


    Full Text Available Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant ΔrfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the

  19. Discovery of a quorum sensing modulator pharmacophore by 3D small-molecule microarray screening

    DEFF Research Database (Denmark)

    Marsden, David M; Nicholson, Rebecca L; Skindersoe, Mette E


    ligand-binding domains of the LuxR homolog CarR from Erwinia carotovora subsp. carotovora. The 3D microarray platform was used to discover the biologically active chloro-pyridine pharmacophore, which was validated using a fluorometric ligand binding assay and ITC. Analogs containing the chloro...

  20. Light Exposure Assessment of Danish Indoor, outdoor and Night-Shift Workers

    DEFF Research Database (Denmark)

    Markvart, Jakob


    A research talk about: • The Lux@r project - The context of this talk • Light and light exposure - What When and Where • Light as a “one-dimensional unit” – things that matters: 1. Spectral sensitivity 2. Spatial sensitivity...

  1. Expression and Quorum Sensing Regulation of Type III Secretion System Genes of Vibrio harveyi during Infection of Gnotobiotic Brine Shrimp.

    Directory of Open Access Journals (Sweden)

    H A Darshanee Ruwandeepika

    Full Text Available Type III secretion systems enable pathogens to inject their virulence factors directly into the cytoplasm of the host cells. The type III secretion system of Vibrio harveyi, a major pathogen of aquatic organisms and a model species in quorum sensing studies, is repressed by the quorum sensing master regulator LuxR. In this study, we found that during infection of gnotobiotic brine shrimp larvae, the expression levels of three type III secretion operons in V. harveyi increased within the first 12h after challenge and decreased again thereafter. The in vivo expression levels were highest in a mutant with a quorum sensing system that is locked in low cell density configuration (minimal LuxR levels and lowest in a mutant with a quorum sensing system that is locked in the high cell density configuration (maximal LuxR levels, which is consistent with repression of type III secretion by LuxR. Remarkably, in vivo expression levels of the type III secretion system genes were much (> 1000 fold higher than the in vitro expression levels, indicating that (currently unknown host factors significantly induce the type III secretion system. Given the fact that type III secretion is energy-consuming, repression by the quorum sensing master regulators might be a mechanism to save energy under conditions where it does not provide an advantage to the cells.

  2. Prediction by promoter logic in bacterial quorum sensing.

    Directory of Open Access Journals (Sweden)

    Navneet Rai


    Full Text Available Quorum-sensing systems mediate chemical communication between bacterial cells, coordinating cell-density-dependent processes like biofilm formation and virulence-factor expression. In the proteobacterial LuxI/LuxR quorum sensing paradigm, a signaling molecule generated by an enzyme (LuxI diffuses between cells and allosterically stimulates a transcriptional regulator (LuxR to activate its cognate promoter (pR. By expressing either LuxI or LuxR in positive feedback from pR, these versatile systems can generate smooth (monostable or abrupt (bistable density-dependent responses to suit the ecological context. Here we combine theory and experiment to demonstrate that the promoter logic of pR - its measured activity as a function of LuxI and LuxR levels - contains all the biochemical information required to quantitatively predict the responses of such feedback loops. The interplay of promoter logic with feedback topology underlies the versatility of the LuxI/LuxR paradigm: LuxR and LuxI positive-feedback systems show dramatically different responses, while a dual positive/negative-feedback system displays synchronized oscillations. These results highlight the dual utility of promoter logic: to probe microscopic parameters and predict macroscopic phenotype.

  3. Saturation mutagenesis of a CepR binding site as a means to identify new quorum-regulated promoters in Burkholderia cenocepacia (United States)

    Burkholderia cenocepacia, an opportunistic pathogen of humans, encodes the CepI and CepR proteins, which resemble the LuxI and LuxR quorum sensing proteins of Vibrio fischeri. CepI directs the synthesis of octanoylhomoserine lactone (OHL), while CepR is an OHL dependent transcription factor. In pr...

  4. Iron control of the Vibrio fischeri luminescence system in Escherichia coli. (United States)

    Dunlap, P V


    Iron influences luminescence in Vibrio fischeri; cultures iron-restricted for growth rate induce luminescence at a lower optical density (OD) than faster growing, iron-replete cultures. An iron restriction effect analogous to that in V. fischeri (slower growth, induction of luminescence at a lower OD) was established using Escherichia coli tonB and tonB+ strains transformed with recombinant plasmids containing the V. fischeri lux genes (luxR luxICDABEG) and grown in the presence and absence of the iron chelator ethylenediamine-di(o-hydroxylphenyl acetic acid) (EDDHA). This permitted the mechanism of iron control of luminescence to be examined. A fur mutant and its parent strain containing the intact lux genes exhibited no difference in the OD at induction of luminescence. Therefore, an iron-binding repressor protein apparently is not involved in iron control of luminescence. Furthermore, in the tonB and in tonB+ strains containing lux plasmids with Mu dI(lacZ) fusions in luxR, levels of beta-galactosidase activity (expression from the luxR promoter) and luciferase activity (expression from the luxICDABEG promoter) both increased by a similar amount (8-9 fold each for tonB, 2-3 fold each for tonB+) in the presence of EDDHA. Similar results were obtained with the luxR gene present on a complementing plasmid. The previously identified regulatory factors that control the lux system (autoinducer-LuxR protein, cyclic AMP-cAMP receptor protein) differentially control expression from the luxR and luxICDABEG promoters, increasing expression from one while decreasing expression from the other. Consequently, these results suggest that the effect of iron on the V. fischeri luminescence system is indirect.

  5. Cloning of a cDNA encoding the rat high molecular weight neurofilament peptide (NF-H): Developmental and tissue expression in the rat, and mapping of its human homologue to chromosomes 1 and 22

    International Nuclear Information System (INIS)

    Lieberburg, I.; Spinner, N.; Snyder, S.


    Neurofilaments (NFs) are the intermediate filaments specific to nervous tissue. Three peptides with apparent molecular masses of approximately 68 (NF-L), 145 (NF-M), and 200 (NF-H) kDa appear to be the major components of NF. The expression of these peptides is specific to nervous tissue and is developmentally regulated. Recently, complete cDNAs encoding NF-L and NF-M, and partial cDNAs encoding NF-H, have been described. To better understand the normal pathophysiology of NFs the authors chose to clone the cDNA encoding the rat NF-H peptide. Using monoclonal antibodies that recognized NF-H, they screened a rat brain λgt11 library and identified a clone that contained a 2,100-nucleotide cDNA insert representing the carboxyl-terminal portion of the NF-H protein. Levels of NF-H mRNA varied 20-fold among brain regions, with highest levels in pons/medulla, spinal cord, and cerebellum, and lowest levels in olfactory bulb and hypothalamus. Based on these results, the authors infer that half of the developmental increase and most of the interregional variation in the levels of the NF-H mRNA are mediated through message stabilization. Sequence information revealed that the carboxyl-terminal region of the NF-H peptide contained a unique serine-, proline-, alanine-, glutamic acid-, and lysine-rich repeat. Genomic blots revealed a single copy of the gene in the rat genome and two copies in the human genome. In situ hybridizations performed on human chromosomes mapped the NF-H gene to chromosomes 1 and 22

  6. The structure of the transposable genetic element ISBsu2 from the cryptic plasmid p1516 of a soil Bacillus subtilis strain and the presence of homologues of this element in the chromosomes of various Bacillus subtilis strains

    NARCIS (Netherlands)

    Holsappel, S; Gagarina, EY; Poluektova, EU; Nezametdinova, VZ; Gel'fand, MS; Prozorov, AA; Bron, S


    A cryptic plasmid from a soil strain of Bacillus subtilis was found to contain a sequence having features of an IS element. Homologous sequences were also found in the chromosome of this strain and in the chromosomes of some other B. subtilis strains.

  7. Hepatitis B virus induces cell proliferation via HBx-induced microRNA-21 in hepatocellular carcinoma by targeting programmed cell death protein4 (PDCD4 and phosphatase and tensin homologue (PTEN.

    Directory of Open Access Journals (Sweden)

    Preeti Damania

    Full Text Available Hepatitis B viral infection-induced hepatocellular carcinoma is one of the major problems in the developing countries. One of the HBV proteins, HBx, modulates the host cell machinery via several mechanisms. In this study we hypothesized that HBV enhances cell proliferation via HBx-induced microRNA-21 in hepatocellular carcinoma. HBx gene was over-expressed, and miRNA-21 expression and cell proliferation were measured in Huh 7 and Hep G2 cells. miRNA-21 was over-expressed in these cells, cell proliferation and the target proteins were analyzed. To confirm the role of miRNA-21 in HBx-induced proliferation, Hep G cells (a cell line that expresses HBV stably were used for miRNA-21 inhibition studies. HBx over-expression enhanced proliferation (3.7- and 4.5-fold increase; n = 3; p<0.01 and miRNA-21 expression (24- and 36-fold increase, normalized with 5S rRNA; p<0.001 in Huh 7 and Hep G2 cells respectively. HBx also resulted in the inhibition of miRNA-21 target proteins, PDCD4 and PTEN. miRNA-21 resulted in a significant increase in proliferation (2- and 2.3-fold increase over control cells; p<0.05 in Huh 7 and Hep G2 cells respectively and decreased target proteins, PDCD4 and PTEN expression. Anti-miR-21 resulted in a significant decrease in proliferation (p<0.05 and increased miRNA-21 target protein expression. We conclude that HBV infection enhances cell proliferation, at least in part, via HBx-induced miRNA-21 expression during hepatocellular carcinoma progression.

  8. Structural and Biophysical Characterization of the Mycobacterium tuberculosis Protein Rv0577, a Protein Associated with Neutral Red Staining of Virulent Tuberculosis Strains and Homologue of the Streptomyces coelicolor Protein KbpA

    Energy Technology Data Exchange (ETDEWEB)

    Buchko, Garry W.; Echols, Nathaniel; Flynn, E. M.; Ng, Ho-Leung; Stephenson, Sam; Kim, Heungbok; Myler, Peter J.; Terwilliger, Thomas C.; Alber, Tom; Kim, Chang Y.


    The 261-residue Mycobacterium tuberculosis protein Rv0577 is a prominent antigen in tuberculosis patients, the responsible component for neutral red staining of virulent strains of M. tuberculosis, a putative component in a methylglyoxal detoxification pathway, and an agonist of toll-like receptor 2. It also has 36% sequence identity to AfsK-binding protein A (KbpA), a component in the complex secondary metabolite pathways in the Streptomycetes genus from which many commercial antibiotics are derived. To gain insight into the biological function of Rv0577 and the family of KpbA kinase regulators, the crystal structure for Rv0577 was determined to a resolution of 1.75 Å (3OXH), binding properties with neutral red and deoxyadenosine (Ado) surveyed, backbone dynamics measured, and thermal stability assayed by CD spectroscopy. The protein is composed of four approximate repeats with an topology arranged radially in consecutive pairs to form two continuous eight-strand -sheets capped on both ends with an -helix. The two -sheets intersect in the center at roughly a right angle and form an asymmetric deep “saddle” on both sides of the protein, saddle one (P11 to A129) and saddle two (L143 to A258), that may serve to bind ligands. NMR chemical shift perturbation experiments show that neutral red binds to Rv0577, further cementing the role of Rv0577 in the neutral red staining of virulent strains of M. tuberculosis. Similar experiments show that adenosine also bind to Rv0577, although less tightly, with estimated dissociation constants of 4.1 ± 0.3 mM for saddle one and > 1 M for saddle two. Heteronuclear steady-state {1H}-15N NOE, T1, and T2 values were generally uniform through-out the sequence with only a few modest pockets of differences suggestive of slightly different motion in loops between -strands in saddle 1. Circular dichroism spectroscopy characterization of the thermal stability of Rv0577 indicated irreversible unfolding upon heating with an estimated melting temperature of 56 °C. While it is not known if Rv0577 has a kinase regulatory role similar to its Streptomyces homolog KbpA, protein kinase and phosphatase signaling help M. tuberculosis adapt to the hostile host environment during infections. Consequently, new anti-tuberculosis drugs targeting Rv0577 may act by interfering with multiple mechanisms; a potential signaling machinery as well as toll-like receptor 2 activation and the methylglyoxal detoxification pathway.

  9. Expression of natural human b1,4-GalT1 variants and of non-mammalian homologues in plants leads to differences in galactosylation of N-glycans

    NARCIS (Netherlands)

    Hesselink, T.; Rouwendal, G.J.A.; Henquet, M.G.L.; Florack, D.E.A.; Helsper, J.P.F.G.; Bosch, H.J.


    b1,4-Galactosylation of plant N-glycans is a prerequisite for commercial production of certain biopharmaceuticals in plants. Two different types of galactosylated N-glycans have initially been reported in plants as the result of expression of human b1,4-galactosyltransferase 1 (GalT). Here we show

  10. Synthesis and Near IR Photoluminescence of Os(II) Bis(2,2'-bipyridine) (3,8-Diarylethynyl-1,10-phemanthroline) Complexes: Anomalous Behavior of the 3,8-Dinitrophenylethynyl-substituted Homologue (United States)

    Yang, Jinhua; Dass, Amala; Sotiriou-Leventis, Chariklia; Tyson, Daniel S.; Leventis, Nicholas


    A large bathochromic shift (50 nm) and emission in the near infrared is observed by attaching arylethynyl groups at the 3,8-positions of the 1,10-phenanthroline ligand (phen) of [Os(bipy)2(phen)]2+ (where bipy = 2,2'-bipyridine). Thus [Os(bipy)2(3,8-di-4-methoxyphenylethynyl-1,10-phenathroline)]2+ emits at 795 nm, while [Os(bipy)2(3,8-diphenylethynyl-1,10-phenanthroline)]2+ emits at 815 nm. According to this trend it would have been expected that [Os(bipy)2(3,8-di-4-nitrophenylethynyl-1,10-phenathroline)]2+ emits farther in the near infrared. Nevertheless, this complex is not photoluminescent because of intramolecular electron transfer quenching of the MLCT excited state by the nitroaromatic group. These results set structural and redox potential standards in the design of near infrared emitters based on [Os(bipy)2(phen)]2+ type complexes.

  11. The modular xylanase Xyn10A from Rhodothermus marinus is cell-attached, and its C-terminal domain has several putative homologues among cell-attached proteins within the phylum Bacteroidetes

    DEFF Research Database (Denmark)

    Karlsson, Eva Nordberg; Hachem, Maher Abou; Ramchuran, Santosh


    -termini of proteins that were predominantly extra-cellular/cell attached. A primary structure motif of three conserved regions including structurally important glycines and a proline was also identified suggesting a conserved 3D fold. This bioinformatic evidence suggested a possible role of this domain in mediating...

  12. Sequence similarities of protein kinase substrates and inhibitors with immunoglobulins and model immunoglobulin homologue: cell adhesion molecule from the living fossil sponge Geodia cydonium. Mapping of coherent database similarities and implications for evolution of CDR1 and hypermutation

    Czech Academy of Sciences Publication Activity Database

    Kubrycht, J.; Borecký, Jiří; Souček, P.; Ježek, Petr


    Roč. 49, č. 3 (2004), s. 219-246 ISSN 0015-5632 R&D Projects: GA MZd NJ6747 Institutional research plan: CEZ:AV0Z5011922 Keywords : CDR1 * immunoglobulin Subject RIV: EE - Microbiology, Virology Impact factor: 1.034, year: 2004

  13. Hydroxypropyl-β-CD vs. its α-homologue for a 3D modified polyrotaxane network formation and properties: the relationship between modified CD and polymer revealed through comparison. (United States)

    Li, Zhao; Zheng, Zhen; Su, Shan; Yu, Lin; Wang, Xinling


    The threading mechanism of the hydroxypropyl-cyclodextrin (Hy-CD)/tetrahedron-like poly(ethylene glycol) (tetra-PEG) based host-guest complex and the relationship between Hy-CD and poly(ethylene oxide) (PEO) in the three-dimensional modified polyrotaxane (PR) formed by the complex were revealed through the comparison between Hy-β-CD/tetra-PEG and Hy-α-CD/tetra-PEG based systems from the macroscopic material view to the microscopic molecular view. The complexation between Hy-CD and tetra-PEG in water experiences a threading-dethreading-rethreading process which is controlled by the intermolecular interaction intensity or molecular hindrance depending on the feed ratio of Hy-CD to tetra-PEG. In the 3D modified PR, the methyl group of the Hy part on one Hy-CD can insert into the cavity of the adjacent Hy-CD and interacts with both the interior surface of the cavity and the PEO segment within the cavity if the cavity of Hy-CD is large enough. The threaded Hy-CD in the PR straightens the chain of PEO and suppresses the segment motion of the PEO. With the decrease of the cavity size of Hy-CD, the degree of suppression on the segment motion of PEO increases. Hy-CD threaded on the PEO chain can also deform when the 3D modified PR is compressed, and the degree of deformation increases with the increase of the cavity size of Hy-CD. These results of the modified CD/PEG based complex system set it apart from the unmodified CD/PEG based one, and reveal the structure-property relationship of this new type of Hy-CD/tetra-PEG based 3D modified PR material.

  14. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M


    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  15. Mechanism for iron control of the Vibrio fischeri luminescence system: involvement of cyclic AMP and cyclic AMP receptor protein and modulation of DNA level. (United States)

    Dunlap, P V


    Iron controls luminescence in Vibrio fischeri by an indirect but undefined mechanism. To gain insight into that mechanism, the involvement of cyclic AMP (cAMP) and cAMP receptor protein (CRP) and of modulation of DNA levels in iron control of luminescence were examined in V. fischeri and in Escherichia coli containing the cloned V. fischeri lux genes on plasmids. For V. fischeri and E. coli adenylate cyclase (cya) and CRP (crp) mutants containing intact lux genes (luxR luxICDABEG), presence of the iron chelator ethylenediamine-di(o-hydroxyphenyl acetic acid) (EDDHA) increased expression of the luminescence system like in the parent strains only in the cya mutants in the presence of added cAMP. In the E. coli strains containing a plasmid with a Mu dl(lacZ) fusion in luxR, levels of beta-galactosidase activity (expression from the luxR promoter) and luciferase activity (expression from the lux operon promoter) were both 2-3-fold higher in the presence of EDDHA in the parent strain, and for the mutants this response to EDDHA was observed only in the cya mutant in the presence of added cAMP. Therefore, cAMP and CRP are required for the iron restriction effect on luminescence, and their involvement in iron control apparently is distinct from the known differential control of transcription from the luxR and luxICDABEG promoters by cAMP-CRP. Furthermore, plasmid and chromosomal DNA levels were higher in E. coli and V. fischeri in the presence of EDDHA. The higher DNA levels correlated with an increase in expression of chromosomally encoded beta-galactosidase in E. coli and with a higher level of autoinducer in cultures of V. fischeri. These results implicate cAMP-CRP and modulation of DNA levels in the mechanism of iron control of the V. fischeri luminescence system.

  16. Exposure to static magnetic field stimulates quorum sensing circuit in luminescent Vibrio strains of the Harveyi clade.

    Directory of Open Access Journals (Sweden)

    Adelfia Talà

    Full Text Available In this study, the evidence of electron-dense magnetic inclusions with polyhedral shape in the cytoplasm of Harveyi clade Vibrio strain PS1, a bioluminescent bacterium living in symbiosis with marine organisms, led us to investigate the behavior of this bacterium under exposure to static magnetic fields ranging between 20 and 2000 Gauss. When compared to sham-exposed, the light emission of magnetic field-exposed bacteria growing on solid medium at 18°C ±0.1°C was increased up to two-fold as a function of dose and growth phase. Stimulation of bioluminescence by magnetic field was more pronounced during the post-exponential growth and stationary phase, and was lost when bacteria were grown in the presence of the iron chelator deferoxamine, which caused disassembly of the magnetic inclusions suggesting their involvement in magnetic response. As in luminescent Vibrio spp. bioluminescence is regulated by quorum sensing, possible effects of magnetic field exposure on quorum sensing were investigated. Measurement of mRNA levels by reverse transcriptase real time-PCR demonstrated that luxR regulatory gene and luxCDABE operon coding for luciferase and fatty acid reductase complex were significantly up-regulated in magnetic field-exposed bacteria. In contrast, genes coding for a type III secretion system, whose expression was negatively affected by LuxR, were down-regulated. Up-regulation of luxR paralleled with down-regulation of small RNAs that mediate destabilization of luxR mRNA in quorum sensing signaling pathways. The results of experiments with the well-studied Vibrio campbellii strain BB120 (originally classified as Vibrio harveyi and derivative mutants unable to synthesize autoinducers suggest that the effects of magnetic fields on quorum sensing may be mediated by AI-2, the interspecies quorum sensing signal molecule.

  17. Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes †


    Lee, Kyu-Ho; Ruby, Edward G.


    Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both lu...

  18. Global Analysis of the Burkholderia thailandensis Quorum Sensing-Controlled Regulon


    Majerczyk, Charlotte; Brittnacher, Mitchell; Jacobs, Michael; Armour, Christopher D.; Radey, Mathew; Schneider, Emily; Phattarasokul, Somsak; Bunt, Richard; Greenberg, E. Peter


    Burkholderia thailandensis contains three acyl-homoserine lactone quorum sensing circuits and has two additional LuxR homologs. To identify B. thailandensis quorum sensing-controlled genes, we carried out transcriptome sequencing (RNA-seq) analyses of quorum sensing mutants and their parent. The analyses were grounded in the fact that we identified genes coding for factors shown previously to be regulated by quorum sensing among a larger set of quorum-controlled genes. We also found that gene...

  19. ExpI and PhzI are descendants of the long lost cognate signal synthase for SdiA.

    Directory of Open Access Journals (Sweden)

    Anice Sabag-Daigle

    Full Text Available SdiA of E. coli and Salmonella is a LuxR homolog that detects N-acyl homoserine lactones (AHLs. Most LuxR homologs function together with a cognate AHL synthase (a LuxI homolog, but SdiA does not. Instead, SdiA detects AHLs produced by other bacterial species. In this report, we performed a phylogenetic analysis of SdiA. The results suggest that one branch of the Enterobacteriaceae obtained a rhlR/rhlI pair by horizontal transfer. The Erwinia and Pantoea branches still contain the complete pair where it is known as expR/expI and phzR/phzI, respectively. A deletion event removed the luxI homolog from the remainder of the group, leaving just the luxR homolog known as sdiA. Thus ExpR and PhzR are SdiA orthologs and ExpI and PhzI are descendants of the long lost cognate signal synthase of SdiA.

  20. A mathematical model and quantitative comparison of the small RNA circuit in the Vibrio harveyi and Vibrio cholerae quorum sensing systems

    International Nuclear Information System (INIS)

    Hunter, G A M; Vasquez, F Guevara; Keener, J P


    Quorum sensing is the process by which bacteria regulate their gene expression based on the local cell-population density. The quorum sensing systems of Vibrio harveyi and Vibrio cholerae are comprised of a phosphorelay cascade coupled to a small RNA (sRNA) circuit. The sRNA circuit contains multiple quorum regulated small RNA (Qrr) that regulate expression of the homologous master transcriptional regulators LuxR (in V. harveyi) and HapR (in V. cholerae). Their quorum sensing systems are topologically similar and homologous thereby making it difficult to understand why repression of HapR is more robust than LuxR to changes in Qrr. In this work we formulate and parameterize a novel mathematical model of the V. harveyi and V. cholerae sRNA circuit. We parameterize the model by fitting it to a variety of empirical data from both species. We show that we can distinguish all of the parameters and that the parameterizations (one for each species) are robust to errors in the data. We then use our model to propose some experiments to identify and explain kinetic differences between the species. We find that V. cholerae Qrr are more abundant and more sensitive to changes in LuxO than V. harveyi Qrr and argue that this is why expression of HapR is more robust than LuxR to changes in Qrr. (paper)

  1. PcaO Positively Regulates pcaHG of the β-Ketoadipate Pathway in Corynebacterium glutamicum▿


    Zhao, Ke-Xin; Huang, Yan; Chen, Xi; Wang, Nan-Xi; Liu, Shuang-Jiang


    We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the β-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167ΔpcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by p...

  2. Regulation of Long-Chain N-Acyl-Homoserine Lactones in Agrobacterium vitis


    Hao, Guixia; Burr, Thomas J.


    Homologs of quorum-sensing luxR and luxI regulatory genes, avsR and avsI, were identified in Agrobacterium vitis strain F2/5. Compared to other LuxI proteins from related species, the deduced AvsI shows the greatest identity to SinI (71%) from Sinorhizobium meliloti Rm1021. AvsR possesses characteristic autoinducer binding and helix-turn-helix DNA binding domains and shares a high level of identity with SinR (38%) from Rm1021. Site-directed mutagenesis of avsR and avsI was performed, and both...

  3. Evaluación de un modelo de infección murino para la evaluación de vacunas homólogas y heterólogas contra Brucella canis Evaluation of a mouse infection model to evaluate homologue and heterologue vaccines against Brucella canis in mouse model


    M Clausse; S.M. Estein


    La brucelosis canina es una enfermedad zoonótica que afecta a los caninos y provoca importantes pérdidas económicas en criaderos. En la actualidad, no existe una vacuna para la prevención de esta enfermedad. Una limitante en el desarrollo de una vacuna eficaz es la falta de un modelo experimental que permita evaluar la infección con Brucella canis. En este trabajo, se desarrolló un modelo ratón para evaluar la infección esplénica por B. canis empleando distintas dosis, tiempos de sacrificio y...

  4. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function. (United States)

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A


    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  5. Investigations on FCAM-III (Ca2.38Mg2.09Fe3+10.61Fe2+1.59Al9.33O36): A new homologue of the aenigmatite structure-type in the system CaO-MgO-Fe2O3-Al2O3 (United States)

    Zöll, Klaus; Kahlenberg, Volker; Krüger, Hannes; Tropper, Peter


    In the course of a systematic study of a part of the quaternary system Fe2O3-CaO-Al2O3-MgO (FCAM) the previously unknown compound Ca2.38Mg2.09Fe3+10.61Fe2+1.59Al9.33O36 (FCAM-III) has been synthesized. By analogy with the so-called SFCA series [1-5], our investigation in the system of FCAM shows the existence of a stoichiometric homologous series M14+6nO20+8n, where M = Fe, Ca, Al, Mg and n = 1 or 2. In air, we can prove the formation of coexisting FCAM-III and FCAM-I solid solutions at 1400 °C. By increasing the temperature up to 1425 °C FCAM-I disappears completely and FCAM-III co-exists with magnesiumferrite and a variety of calcium iron oxides. At 1450 °C FCAM-III breaks down to a mixture of FCAM-I again as well as magnesioferrite and melt. Small single-crystals of FCAM-III up to 35 μm in size could be retrieved from the 1425 °C experiment and were subsequently characterized using electron microprobe analysis and synchroton X-ray single-crystal diffraction. Finally the Fe2+/Fetot ratio was calculated from the total iron content based on the crystal-chemical formula obtained from EMPA measurements and charge balance considerations. FCAM-III or Ca2.38Mg2.09Fe3+10.61Fe2+1.59Al9.33O36 has a triclinic crystal structure (space group P 1 ̅). The basic crystallographic data are: a = 10.223(22) Å, b = 10.316(21) Å, c = 14.203(15) Å, α = 93.473(50)°, β = 107.418(67)°, γ = 109.646(60)°, V = 1323.85(2) ų, Z = 1. Using Schreinemaker's technique to analyze the phase relations in the system Fe2O3-CaO-Al2O3-MgO it was possible to obtain the semi-quantitative stability relations between the participating phases and construct a topologically correct phase sequence as a function of T and fO2. The analysis shows that Ca2Al0.5Fe1.5O5 (C2A0.25F0.75) and CaAl1.5Fe2.5O7 (CA0.75F1.25) with higher calculated Fe2+ contents are preferably formed at lower oxygen fugacity and react to CaAl0.5Fe1.5O4 (CA0.25F0.75) by increasing fO2. Spinel-type magnesium-aluminium-ferrite (Mg,Fe2+)Fe3+1.25Al0.75O4 or (MA0.375F0.625) is the typical phase which occurs at high temperature (1400 °C).

  6. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano


    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  7. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M


    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  8. Inhibitory role of acyl homoserine lactones in hemolytic activity and viability of Streptococcus pyogenes M6 S165. (United States)

    Saroj, Sunil D; Holmer, Linda; Berengueras, Júlia M; Jonsson, Ann-Beth


    Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence.

  9. Quorum sensing regulates the osmotic stress response in Vibrio harveyi. (United States)

    van Kessel, Julia C; Rutherford, Steven T; Cong, Jian-Ping; Quinodoz, Sofia; Healy, James; Bassler, Bonnie L


    Bacteria use a chemical communication process called quorum sensing to monitor cell density and to alter behavior in response to fluctuations in population numbers. Previous studies with Vibrio harveyi have shown that LuxR, the master quorum-sensing regulator, activates and represses >600 genes. These include six genes that encode homologs of the Escherichia coli Bet and ProU systems for synthesis and transport, respectively, of glycine betaine, an osmoprotectant used during osmotic stress. Here we show that LuxR activates expression of the glycine betaine operon betIBA-proXWV, which enhances growth recovery under osmotic stress conditions. BetI, an autorepressor of the V. harveyi betIBA-proXWV operon, activates the expression of genes encoding regulatory small RNAs that control quorum-sensing transitions. Connecting quorum-sensing and glycine betaine pathways presumably enables V. harveyi to tune its execution of collective behaviors to its tolerance to stress. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. Fulltext PDF

    Indian Academy of Sciences (India)


    The discovery of the. RNAi-based gene silencing process called meiotic silencing by unpaired DNA now provides an explana- tion for how normal sequence strains come to be selected. Meiotic silencing silences genes that are unpaired in meiosis, as well as their homologues, regardless of whether or not the homologues ...

  11. How do individuals cope with stress? Behavioural, physiological and neuronal differences between proactive and reactive coping styles in fish

    DEFF Research Database (Denmark)

    Vindas, Marco A; Gorissen, Marnix; Höglund, Erik


    of the 5-HT1A receptor abundance) in the proposed amygdala homologue (Dm), increased expression of the neuroplasticity marker brain derived neurotropic factor (bdnf) in both Dl and Vv (lateral septum homologue), as well as increased expression of the corticotropin releasing factor 1 (crf1) receptor...

  12. The crystal structure of (001) twinned xilingolite, Pb3Bi2S6, from Mittal-Hohtenn, Valais, Switzerland

    DEFF Research Database (Denmark)

    Berlepsch, Peter; Armbruster, Thomas; Makovicky, Emil


    geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland......geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland...

  13. Sex determination of baleen whale artefacts

    DEFF Research Database (Denmark)

    Sinding, Mikkel Holger Strander; Tervo, Outi M.; Grønnow, Bjarne


    to 4500 years old bowhead whale samples, and for comparison on dilution series from modern bowhead whales of known sex. DNA sequencing of PCR products obtained from the ancient material confirmed a higher proportion of successful PCR amplifications of the X homologue over the Y homologue. This potentially...

  14. Development of the Zebra Danio Model: Carcinogenesis and Gene Transfer Studies (United States)


    Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of...protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo

  15. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pO160E1 LG_O03 ... 2.6 ... 10.1139/g01-082 11681610

  16. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pN59E5 LG_O09 ... 2.7 ... 10.1139/g01-082 11681610

  17. Virulence Effects and Signaling Partners Modulated by Brucella melitensis Light-sensing Histidine Kinase (United States)

    Gourley, Christopher R.

    The facultative intracellular pathogen Brucella melitensis utilizes diverse virulence factors. A Brucella light sensing histidine kinase can influence in vitro virulence of the bacteria during intracellular infection. First, we demonstrated that the B. melitensis light sensing kinase (BM-LOV-HK) affects virulence in an IRF-1-/- mouse model of infection. Infection with a Δ BM-LOV-HK strain resulted in less bacterial colonization of IRF-1-/- spleens and extended survivorship compared to mice infected with wild type B. melitensis 16M. Second, using PCR arrays, we observed less expression of innate and adaptive immune system activation markers in ΔBM-LOV-HK infected mouse spleens than wild type B. melitensis 16M infected mouse spleens 6 days after infection. Third, we demonstrated by microarray analysis of B. melitensis that deletion of BM-LOV-HK alters bacterial gene expression. Downregulation of genes involved in control of the general stress response system included the alternative sigma factor RpoE1 and its anti-anti sigma factor PhyR. Conversely, genes involved in flagella production, quorum sensing, and the type IV secretion system (VirB operon) were upregulated in the Δ BM-LOV-HK strain compared to the wild type B. melitensis 16M. Analysis of genes differentially regulated in Δ BM-LOV-HK versus the wild type strain indicated an overlap of 110 genes with data from previous quorum sensing regulator studies of Δ vjbR and/ΔblxR(babR) strains. Also, several predicted RpoE1 binding sites located upstream of genes were differentially regulated in the ΔBM-LOV-HK strain. Our results suggest BM-LOV-HK is important for in vivo Brucella virulence, and reveals that BM-LOV-HK directly or indirect regulates members of the Brucella quorum sensing, type IV secretion, and general stress systems.

  18. Transcriptome analysis of the Brucella abortus BvrR/BvrS two-component regulatory system.

    Directory of Open Access Journals (Sweden)

    Cristina Viadas

    Full Text Available BACKGROUND: The two-component BvrR/BvrS system is essential for Brucella abortus virulence. It was shown previously that its dysfunction alters the expression of some major outer membrane proteins and the pattern of lipid A acylation. To determine the genes regulated by BvrR/BvrS, we performed a whole-genome microarray analysis using B. abortus RNA obtained from wild type and bvrR mutant cells grown in the same conditions. METHODOLOGY/PRINCIPAL FINDINGS: A total of 127 differentially expressed genes were found: 83 were over expressed and 44 were less expressed in the bvrR mutant. Two operons, the phosphotransferase system and the maltose transport system, were down-regulated. Several genes involved in cell envelope or outer membrane biogenesis were differentially expressed: genes for outer membrane proteins (omp25a, omp25d, lipoproteins, LPS and fatty acid biosynthesis, stress response proteins, chaperones, flagellar genes, and twelve genes encoding ABC transport systems. Ten genes related with carbon metabolism (pckA and fumB among others were up-regulated in the bvrR mutant, and denitrification genes (nirK, norC and nosZ were also regulated. Notably, seven transcriptional regulators were affected, including VjbR, ExoR and OmpR that were less expressed in the bvrR mutant. Finally, the expression of eleven genes which have been previously related with Brucella virulence was also altered. CONCLUSIONS/SIGNIFICANCE: All these data corroborate the impact of BvrR/BvrS on cell envelope modulation, confirm that this system controls the carbon and nitrogen metabolism, and suggest a cross-talk among some regulators to adjust the Brucella physiology to the shift expected to occur during the transit from the extracellular to the intracellular niche.

  19. A positive feedback-based gene circuit to increase the production of a membrane protein

    Directory of Open Access Journals (Sweden)

    Gennis Robert B


    Full Text Available Abstract Background Membrane proteins are an important class of proteins, playing a key role in many biological processes, and are a promising target in pharmaceutical development. However, membrane proteins are often difficult to produce in large quantities for the purpose of crystallographic or biochemical analyses. Results In this paper, we demonstrate that synthetic gene circuits designed specifically to overexpress certain genes can be applied to manipulate the expression kinetics of a model membrane protein, cytochrome bd quinol oxidase in E. coli, resulting in increased expression rates. The synthetic circuit involved is an engineered, autoinducer-independent variant of the lux operon activator LuxR from V. fischeri in an autoregulatory, positive feedback configuration. Conclusions Our proof-of-concept experiments indicate a statistically significant increase in the rate of production of the bd oxidase membrane protein. Synthetic gene networks provide a feasible solution for the problem of membrane protein production.

  20. Comparative analysis of the survival and gene expression of pathogenic strains Vibrio harveyi after starvation. (United States)

    Sun, Jingjing; Gao, Xiaojian; Qun, Jiang; Du, Xuedi; Bi, Keran; Zhang, Xiaojun; Lin, Li


    This study aimed to evaluate the survival and gene expression of Vibrio harveyi under starvation conditions. The microcosms V. harveyi were incubated in sterilized seawater for 4 weeks at room temperature. Overall, the cell numeration declined rapidly about 10 3 CFU/ml during starvation, with a tiny rebound at day 21. Scanning electron microscopy revealed that rod-shaped cells became sphere with a rippled cell surface. By polymerase chain reaction (PCR) assay, nine genes, named luxR, toxR, vhhB, flaA, topA, fur, rpoS, mreB and ftsZ, were detected in the non-starved cells. In the starved cells, the expression levels of the detected genes declined substantially ranging from 0.005-fold to 0.028-fold compared to the non-starved cells performed by reverse transcription quantitative real-time PCR with 16S rRNA as the internal control. In the recovering cells, the expression levels of the detected genes, except luxR and mreB, were upregulated dramatically compared to the wild, especially topA (23.720-fold), fur (39.400-fold) and toxR (9.837-fold), validating that the expressions of both the metabolism and virulence genes were important for growth and survival of V. harveyi. The results may shed a new light on understanding of stress adaptation in bacteria. © FEMS 2016. All rights reserved. For permissions, please e-mail:

  1. Autoinducers act as biological timers in Vibrio harveyi. (United States)

    Anetzberger, Claudia; Reiger, Matthias; Fekete, Agnes; Schell, Ursula; Stambrau, Nina; Plener, Laure; Kopka, Joachim; Schmitt-Kopplin, Phillippe; Hilbi, Hubert; Jung, Kirsten


    Quorum sensing regulates cell density-dependent phenotypes and involves the synthesis, excretion and detection of so-called autoinducers. Vibrio harveyi strain ATCC BAA-1116 (recently reclassified as Vibrio campbellii), one of the best-characterized model organisms for the study of quorum sensing, produces and responds to three autoinducers. HAI-1, AI-2 and CAI-1 are recognized by different receptors, but all information is channeled into the same signaling cascade, which controls a specific set of genes. Here we examine temporal variations of availability and concentration of the three autoinducers in V. harveyi, and monitor the phenotypes they regulate, from the early exponential to the stationary growth phase in liquid culture. Specifically, the exponential growth phase is characterized by an increase in AI-2 and the induction of bioluminescence, while HAI-1 and CAI-1 are undetectable prior to the late exponential growth phase. CAI-1 activity reaches its maximum upon entry into stationary phase, while molar concentrations of AI-2 and HAI-1 become approximately equal. Similarly, autoinducer-dependent exoproteolytic activity increases at the transition into stationary phase. These findings are reflected in temporal alterations in expression of the luxR gene that encodes the master regulator LuxR, and of four autoinducer-regulated genes during growth. Moreover, in vitro phosphorylation assays reveal a tight correlation between the HAI-1/AI-2 ratio as input and levels of receptor-mediated phosphorylation of LuxU as output. Our study supports a model in which the combinations of autoinducers available, rather than cell density per se, determine the timing of various processes in V. harveyi populations.

  2. Autoinducers act as biological timers in Vibrio harveyi.

    Directory of Open Access Journals (Sweden)

    Claudia Anetzberger

    Full Text Available Quorum sensing regulates cell density-dependent phenotypes and involves the synthesis, excretion and detection of so-called autoinducers. Vibrio harveyi strain ATCC BAA-1116 (recently reclassified as Vibrio campbellii, one of the best-characterized model organisms for the study of quorum sensing, produces and responds to three autoinducers. HAI-1, AI-2 and CAI-1 are recognized by different receptors, but all information is channeled into the same signaling cascade, which controls a specific set of genes. Here we examine temporal variations of availability and concentration of the three autoinducers in V. harveyi, and monitor the phenotypes they regulate, from the early exponential to the stationary growth phase in liquid culture. Specifically, the exponential growth phase is characterized by an increase in AI-2 and the induction of bioluminescence, while HAI-1 and CAI-1 are undetectable prior to the late exponential growth phase. CAI-1 activity reaches its maximum upon entry into stationary phase, while molar concentrations of AI-2 and HAI-1 become approximately equal. Similarly, autoinducer-dependent exoproteolytic activity increases at the transition into stationary phase. These findings are reflected in temporal alterations in expression of the luxR gene that encodes the master regulator LuxR, and of four autoinducer-regulated genes during growth. Moreover, in vitro phosphorylation assays reveal a tight correlation between the HAI-1/AI-2 ratio as input and levels of receptor-mediated phosphorylation of LuxU as output. Our study supports a model in which the combinations of autoinducers available, rather than cell density per se, determine the timing of various processes in V. harveyi populations.

  3. Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes. (United States)

    Lee, K H; Ruby, E G


    Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples.

  4. Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes † (United States)

    Lee, Kyu-Ho; Ruby, Edward G.


    Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (≤1 to 3 CFU/100 ml). However, probe-positive colonies of V. fischeri (up to 900 CFU/100 ml) were found only in seawater collected from within the natural habitats of the squids. A number of criteria were used to confirm that these probe-positive strains were indistinguishable from symbiotic V. fischeri. Therefore, the luxA and luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples. Images PMID:16348678

  5. The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases. (United States)

    Wang, Tao; Xiong, Jian-Qiong


    The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.

  6. Multiplicity of 3-Ketosteroid-9 alpha-Hydroxylase Enzymes in Rhodococcus rhodochrous DSM43269 for Specific Degradation of Different Classes of Steroids


    Petrusma, Mirjan; Hessels, Gerda; Dijkhuizen, Lubbert; van der Geize, Robert


    The well-known large catabolic potential of rhodococci is greatly facilitated by an impressive gene multiplicity. This study reports on the multiplicity of kshA, encoding the oxygenase component of 3-ketosteroid 9 alpha-hydroxylase, a key enzyme in steroid catabolism. Five kshA homologues (kshA1 to kshA5) were previously identified in Rhodococcus rhodochrous DSM43269. These KshA(DSM43269) homologues are distributed over several phylogenetic groups. The involvement of these KshA homologues in ...

  7. Some studies on tar pillets at Veraval coast (Gujarat)

    Digital Repository Service at National Institute of Oceanography (India)

    Kadam, A.N.

    Infrared spectroscopic (IR) analysis indicated that the tar pillets contain saturated hydrocarbons particularly higher homologues of n-paraffins, unsaturated and carbonyl type of polar compounds. Gas chromatographic (GLC) fingerprint pattern...

  8. A Novel Tyrosine Kinase Expressed in Breast Tumors

    National Research Council Canada - National Science Library

    Tyner, Angela


    .... Sik interacts with Sam68 through both its SH3 and SH2 domains. Transfected Sik and Sam68 colocalize to the nucleoplasm of nontransformed NMuMG mammary epithelial cells, while the human homologue of Sik (BRK...

  9. Understanding sex determination in the mouse: genetics ...

    Indian Academy of Sciences (India)

    challenge now is to understand how controlled epigenomic changes effect the now familiar sexually dimorphic transcriptomic profiles of the ... Cattanach, personal communication, April 2015. .... The human homologue, DMRT1, is found on.

  10. Extracellular Matrix Regulations of Membrane Type 1 - Matrix Metalloproteinasis (MT1-MMP) and Matrix Metalloproteinase-2 (MMP-2) in Human Breast Fibroblasts

    National Research Council Canada - National Science Library

    Harnandez-Barrantes, Sonia


    .... Thus, under certain conditions, TIMP-2 is a positive regulator of MMP activity. TIMP-4, a close homologue of TIMP-2 also binds to pro-MMP- 2 and can potentially participate in pro-MMP-2 activation...

  11. Modelling of the Kinetics of Sulfure Compounds in Desulfurisation Processes Based on Industry Data of Plant

    Directory of Open Access Journals (Sweden)

    Krivtcova Nadezhda


    Full Text Available Modelling of sulfur compounds kinetics was performed, including kinetics of benzothiophene and dibenzothiophene homologues. Modelling is based on experimental data obtained from monitoring of industrial hydrotreating set. Obtained results include kinetic parameters of reactions.

  12. Modelling of the Kinetics of Sulfure Compounds in Desulfurisation Processes Based on Industry Data of Plant


    Krivtsova, Nadezhda Igorevna; Tataurshikov, A.; Kotkova, Elena


    Modelling of sulfur compounds kinetics was performed, including kinetics of benzothiophene and dibenzothiophene homologues. Modelling is based on experimental data obtained from monitoring of industrial hydrotreating set. Obtained results include kinetic parameters of reactions.

  13. Fulltext PDF

    Indian Academy of Sciences (India)


    hetC homologue in the genome of P. syringae by analysing the genome sequence of ... 1994 Vegetative incompatibility in Neurospora – its effect on horizontal transfer of mitochondrial plasmids and senescence in natural populations; Curr.

  14. Localization of two mammalian cyclin dependent kinases during mammalian meiosis

    NARCIS (Netherlands)

    Ashley, T.; Walpita, D.; de rooij, D. G.


    Mammalian meiotic progression, like mitotic cell cycle progression, is regulated by cyclins and cyclin dependent kinases (CDKs). However, the unique requirements of meiosis (homologous synapsis, reciprocal recombination and the dual divisions that segregate first homologues, then sister chromatids)

  15. Reference: 306 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available of the endoreduplication cycle in Arabidopsis requires a plant homologue of archaeal DNA topoisomerase (topo) VI. To further understa...nd how DNA is endoreduplicated and how this process is r

  16. Quorum Sensing: A Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei

    National Research Council Canada - National Science Library

    Ulrich, Ricky L; DeShazer, David; Hines, Harry B; Jeddeloh, Jeffrey A


    .... To determine if QS is involved in the virulence of B. mallei, we generated mutations in each putative luxIR homologue and tested the pathogenicities of the derivative strains in aerosol BALB/c mouse and intraperitoneal hamster models...

  17. Quorum Sensing: A transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei

    National Research Council Canada - National Science Library

    Ulrich, Ricky


    .... To determine if QS is involved in the virulence of B. mallei, we generated mutations in each putative luxIR homologue and tested the pathogenicities of the derivative strains in aerosol BALB/c mouse and intraperitoneal hamster models...

  18. The Basal Cell Marker p63 and Prostate Stem Cells

    National Research Council Canada - National Science Library

    Signoretti, Sabina


    ...(s) involved in prostate carcinogenesis. The p53-homologue p63 is selectively expressed in the basal cell compartment of a variety of epithelial tissues and p63 deficient mice show severe defects in the development of epithelial organs...

  19. The Basal Cell Marker p63 and Prostate Stem Cells

    National Research Council Canada - National Science Library

    Signoretti, Sabina


    ...(s) involved in prostate carcinogenesis. The p53-homologue p63 is selectively expressed in the basal cell compartment of a variety of epithelial tissues and p63 deficient mice show severe defects in the development of epithelial organs...

  20. The Basal Cell Marker p63 and Prostate Stem Cells

    National Research Council Canada - National Science Library

    Signoretti, Sabina


    ...(s) involved in prostate carcinogenesis. The p53-homologue p63 is selectively expressed in the basal cell compartment of a variety of epithelial tissues and p63 deficient mice show severe defects in the development of epithelial organs...

  1. Isolation and characterization of differentially expressed genes in ...

    African Journals Online (AJOL)


    Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

  2. 750-IJBCS-Article-Dr Danho Mathias

    African Journals Online (AJOL)


    des extraits de feuilles et de graines de neem (Azadirachta indica) sur le ... insecticide homologué à base de cartap, six traitements avec trois différentes ...... Effects of different neem preparations in comparison to synthetic insecticides on.

  3. Research Article Molecular cloning and mRNA expression pattern of ...

    Indian Academy of Sciences (India)


    homologue from the brain of Misgurnus anguillicaudatus using homologous cloning and ... developmental processes, including sex determination, embryonic stem cell ..... anguillicaudatus, possibly aiding in unravelling reproductive biology ... significant difference (p < 0.05) between female and male in the same tissue.

  4. Linear C32H66 hydrocarbon in the mixed state with C10H22 ...

    Indian Academy of Sciences (India)


    S R Research Laboratory for Studies in Crystallization Phenomena, 10-1-96, ... mixed state with certain shorter chain length homologues (SMOLLENCs), estimated ... Methods. Five hydrocarbons of even carbon numbers, C10, C12, C14, C16 ...

  5. Molecular characterization of the thioredoxin system from Methanosarcina acetivorans


    McCarver, Addison C.; Lessner, Daniel J.


    The thioredoxin system, composed of thioredoxin reductase (TrxR) and thioredoxin (Trx), is widely distributed in nature, where it serves key roles in electron transfer and in defense against oxidative stress. Although recent evidence reveals Trx homologues are almost universally present among the methane-producing archaea (methanogens), a complete thioredoxin system has not been characterized from any methanogen. We examined the phylogeny of Trx homologues among methanogens and characterized ...

  6. Elucidating the Role of CaMKK in Cell Cycle and Cell Fate using a C. elegans model (United States)


    domain) or the Aspergillus homologue, anCaMKB (48% overall)(Figure 2). To functionally compare the C. elegans proteins with their mammalian homologues...subunit on the yeast proteome . EMBO J 18, 4157-68 (1999). 14 19. H. Tokumitsu et aL, Substrate recognition by Ca2+/Calmodulin-dependent protein kinase...2 Nicholas School of the Environment Duke University, Durham, NC 27710 Ethan@Duke.Edu In a variety of models, from Xenopus oocytes to Aspergillus to

  7. Comparing and contrasting Escherichia coli and Mycobacterium tuberculosis mechanosensitive channels (MscL) - New gain of function mutations in the loop region


    Maurer, Joshua A.; Elmore, Donald E.; Lester, Henry A.; Dougherty, Dennis A.


    Sequence analysis of 35 putative MscL homologues was used to develop an optimal alignment for Escherichia coli and Mycobacterium tuberculosis MscL and to place these homologues into sequence subfamilies. By using this alignment, previously identified E. coli MscL mutants that displayed severe and very severe gain of function phenotypes were mapped onto the M. tuberculosis MscL sequence. Not all of the resulting M. tuberculosis mutants displayed a gain of function phenotype; for instance, norm...

  8. Identification of potential genetic components involved in the deviant quorum-sensing signaling pathways of Burkholderia glumae through a functional genomics approach

    Directory of Open Access Journals (Sweden)

    Ruoxi eChen


    Full Text Available Burkholderia glumae is the chief causal agent for bacterial panicle blight of rice. The acyl-homoserine lactone (AHL-mediated quorum-sensing (QS system dependent on a pair of luxI and luxR homologs, tofI and tofR, is the primary cell-to-cell signaling mechanism determining the virulence of this bacterium. Production of toxoflavin, a major virulence factor of B. glumae, is known to be dependent on the tofI/tofR QS system. In our previous study, however, it was observed that B. glumae mutants defective in tofI or tofR produced toxoflavin if they grew on the surface of a solid medium, suggesting that alternative signaling pathways independent of tofI or tofR are activated in that growth condition for the production of toxoflavin. In this study, potential genetic components involved in the tofI- and tofR-independent signaling pathways for toxoflavin production were sought through screening random mini-Tn5 mutants of B. glumae to better understand the intercellular signaling pathways of this pathogen. Fifteen and three genes were initially identified as the potential genetic elements of the tofI- and tofR-independent pathways, respectively. Especially, the ORF (bglu_2g06320 divergently transcribed from toxJ, which encodes an orphan LuxR protein and controls toxoflavin biosynthesis, was newly identified in this study as a gene required for the tofR-independent toxoflavin production and named as toxK. Among those genes, flhD, dgcB, and wyzB were further studied to validate their functions in the tofI-independent toxoflavin production, and similar studies were also conducted with qsmR and toxK for their functions in the tofR-independent toxoflavin production. This work provides a foundation for future comprehensive studies of the intercellular signaling systems of B. glumae and other related pathogenic bacteria.

  9. Activity, Abundance, and Localization of Quorum Sensing Receptors in Vibrio harveyi. (United States)

    Lorenz, Nicola; Shin, Jae Yen; Jung, Kirsten


    Quorum sensing (QS) is a process enabling a bacterial population to communicate via small molecules called autoinducers (AIs). This intercellular communication process allows single cells to synchronize their behavior within a population. The marine bacterium Vibrio harveyi ATCC BAA-1116 channels the information of three AI signals into one QS cascade. Three receptors perceive these AIs, the hybrid histidine kinases LuxN, Lux(P)Q and CqsS, to transduce the information to the histidine phosphotransfer (HPt) protein LuxU via phosphorelay, and finally to the response regulator LuxO. Hence, the level of phosphorylated LuxO depends on the AI concentrations. The phosphorylated LuxO (P-LuxO) controls the expression of small regulatory RNAs (sRNAs), which together with the RNA chaperon Hfq, destabilize the transcript of the master regulator luxR . LuxR is responsible for the induction and repression of several genes (e.g., for bioluminescence, exoprotease and siderophore production). In vivo studies with various mutants have demonstrated that the ratio between kinase and phosphatase activities of the individual QS receptors and therefore the P-LuxO/LuxO ratio is crucial not only for the output strength but also for the degree of noise. This study was undertaken to better understand the inherent design principles of this complex signaling cascade, which allows sensing and integration of different signals, but also the differentiated output in individual cells. Therefore, we quantitatively analyzed not only the enzymatic activities, but also the abundance and localization of the three QS receptors. We found that LuxN presents the highest capacity to phosphorylate LuxU, while the phosphatase activity was comparable to LuxQ and CqsS in vitro . In whole cells the copy number of LuxN was higher than that of LuxQ and CqsS, and further increased in the late exponential growth phase. Microscopy experiments indicate that LuxN and LuxQ form independent clusters. Altogether, these

  10. Influence of light, UV-B radiation, and herbicides on wax biosynthesis of cucumber seedlings

    International Nuclear Information System (INIS)

    Tevini, M.; Steinmüller, D.


    The behavior of cuticular alkane-1-ols and alkanes were studied in different developmental stages of cucumber seedlings grown in the dark or under white light, with or without UV-B radiation or in presence of wax biosynthesis inhibitors, trichloroacetic acid and metolachlor. Accumulation of alkane-1-ols increased light independently with seedling age. Synthesis of alkanes was strictly light and dose dependent. Addition of UV-B radiation did not alter the amounts of alkanes or alcohols, however, the distribution of homologues was shifted towards shorter chain homologues. Treatments with Cl 3 AcOH resulted in strong inhibition of alkane accumulation, whereas the amount of alkane-1-ols was changed neither at low nor at moderate concentrations of Cl 3 AcOH but their homologue distribution shifted towards longer chain lengths. This shifting was depressed in the presence of UV-B. At high concentrations of Cl 3 Ac0H similar homologue distributions as produced by UV-B (shift to shorter homologues) were observed. Metolachlor treatment resulted in an inhibition of alkane-1-ol production connected with rising amounts of alkanes, predominantly of short chain species. A simple model of wax biosynthesis is proposed which describes the interactions with white light, UV-B radiation and herbicides. (author)

  11. Conserved chromosomal positions of dual domains of the ets protooncogene in cats, mice, and humans

    International Nuclear Information System (INIS)

    Watson, D.K.; McWilliams-Smith, M.J.; Kozak, C.


    The mammalian protooncogene homologue of the avian v-ets sequence from the E26 retrovirus consists of two sequentially distinct domains located on different chromosomes. Using somatic cell hybrid panels, the authors have mapped the mammalian homologue of the 5' v-ets-domain to chromosome 11 (ETS1) in man, to chromosome 9 (ets-1) in mouse, and to chromosome D1 (ETS1) in the domestic cat. The mammalian homologue of the 3' v-ets domain was similarly mapped to human chromosome 21 (ETS2), to mouse chromosome 16 (Ets-2), and to feline chromosome C2 (ETS2). Both protooncogenes fell in syntenic groups of homologous linked loci that were conserved among the three species. The occurrence of two distinct functional protooncogenes and their conservation of linkage positions in the three mammalian orders indicate that these two genes have been separate since before the evolutionary divergence of mammals

  12. Contrastive Analysis of the Raman Spectra of Polychlorinated Benzene: Hexachlorobenzene and Benzene

    Directory of Open Access Journals (Sweden)

    Zhengjun Zhang


    Full Text Available Detection of persistent pollutants such as polychlorinated benzene in environment in trace amounts is challenging, but important. It is more difficult to distinguish homologues and isomers of organic pollutantd when present in trace amounts because of their similar physical and chemical properties. In this work we simulate the Raman spectra of hexachlorobenzene and benzene, and figure out the vibration mode of each main peak. The effect on the Raman spectrum of changing substituents from H to Cl is analyzed to reveal the relations between the Raman spectra of homologues and isomers of polychlorinated benzene, which should be helpful for distinguishing one kind of polychlorinated benzene from its homologues and isomers by surface enhanced Raman scattering.

  13. Molecular characterization and expression analysis of chloroplast protein import components in tomato (Solanum lycopersicum.

    Directory of Open Access Journals (Sweden)

    Jianmin Yan

    Full Text Available The translocon at the outer envelope membrane of chloroplasts (Toc mediates the recognition and initial import into the organelle of thousands of nucleus-encoded proteins. These proteins are translated in the cytosol as precursor proteins with cleavable amino-terminal targeting sequences called transit peptides. The majority of the known Toc components that mediate chloroplast protein import were originally identified in pea, and more recently have been studied most extensively in Arabidopsis. With the completion of the tomato genome sequencing project, it is now possible to identify putative homologues of the chloroplast import components in tomato. In the work reported here, the Toc GTPase cDNAs from tomato were identified, cloned and analyzed. The analysis revealed that there are four Toc159 homologues (slToc159-1, -2, -3 and -4 and two Toc34 homologues (slToc34-1 and -2 in tomato, and it was shown that tomato Toc159 and Toc34 homologues share high sequence similarity with the comparable import apparatus components from Arabidopsis and pea. Thus, tomato is a valid model for further study of this system. The expression level of Toc complex components was also investigated in different tissues during tomato development. The two tomato Toc34 homologues are expressed at higher levels in non-photosynthetic tissues, whereas, the expression of two tomato Toc159 homologues, slToc159-1 and slToc159-4, were higher in photosynthetic tissues, and the expression patterns of slToc159-2 was not significantly different in photosynthetic and non-photosynthetic tissues, and slToc159-3 expression was limited to a few select tissues.

  14. Synthesis and antimicrobial activity of long-chain 3,4-Epoxy-2-alkanones. (United States)

    Wood, William F


    3,4-Epoxy-2-dodecanone, a major component in the preorbital gland of the African grey duiker (Sylvicapra grimmia), showed antimicrobial activity in preliminary tests. The C(11) to C(17) homologues of this compound were prepared and their activity against several pathogenic dermal bacteria and fungi was tested. 3,4-Epoxy-2-dodecanone and 3,4-epoxy-2-tridecanone inhibited the growth of Trichophyton mentagrophytes at 25 Îg/mL. Moderate inhibition of the growth of the bacteria Propionibacterium acnes and the lipophilic yeast, Pityrosporum ovale, was seen for several of the homologues.

  15. Transcriptome study of storage protein genes of field-grown barley in response to inorganic nitrogen fertilizers

    DEFF Research Database (Denmark)

    Hansen, Michael; Bowra, Steve; Lange, Mette


    The storage proteins of barley, in terms of both amino acid profile and quantity, are traits strongly influenced by the amount of nitrogen applied. Given this, we performed a developmental expression analysis of the genes from barley grains grown under field conditions to further our understanding...... profile under different N regimes. Reviewing the expression of the storage protein homologues within the families revealed markedly different temporal profiles; for example, some alleles were expressed very early in development. Furthermore, the differential temporal expression of the homologues suggested...

  16. Non-native acylated homoserine lactones reveal that LuxIR quorum sensing promotes symbiont stability (United States)

    Ho, Jessica S.; Geske, Grant D.; Blackwell, Helen E.; Ruby, Edward G.


    SUMMARY Quorum sensing, a group behavior coordinated by a diffusible pheromone signal and a cognate receptor, is typical of bacteria that form symbioses with plants and animals. LuxIR-type acyl homoserine-lactone (AHL) quorum sensing is common in Gram-negative proteobacteria, and many members of this group have additional quorum-sensing networks. The bioluminescent symbiont Vibrio fischeri encodes two AHL signal synthases: AinS and LuxI. AinS-dependent quorum sensing converges with LuxI-dependent quorum sensing at the LuxR regulatory element. Both AinS- and LuxI-mediated signaling are required for efficient and persistent colonization of the squid host, Euprymna scolopes. The basis of the mutualism is symbiont bioluminescence, which is regulated by both LuxI- and AinS-dependent quorum sensing, and is essential for maintaining a colonization of the host. Here, we used chemical and genetic approaches to probe the dynamics of LuxI- and AinS-mediated regulation of bioluminescence during symbiosis. We demonstrate that both native AHLs and non-native AHL analogs can be used to non-invasively and specifically modulate induction of symbiotic bioluminescence via LuxI-dependent quorum sensing. Our data suggest that the first day of colonization, during which symbiont bioluminescence is induced by LuxIR, is a critical period that determines the stability of the V. fischeri population once symbiosis is established. PMID:24191970

  17. Evaluation of New Inorganic Scintillators for Application in a Prototype Small Animal PET Scanner

    CERN Document Server

    Kuntner, C


    In the study of new pharmaceuticals as well as brain and genetic research, Positron Emission Tomography (PET) is a useful method. It has also recently entered the clinical domain in cardiology and particularly in oncology. Small animals such as mice, are often used to validate sophisticated models of human disease. High spatial resolution PET instrumentation is therefore necessary due to the reduced dimensions of the organs. Inorganic scintillators are employed in most of the diagnostic imaging devices. The ultimate performance of the PET scanner is tightly bound to the scintillation properties of the crystals. In the last years there has been an effort to develop new scintillating materials characterized by high light output, high detection efficiency and fast decay time. The most studied systems are mainly Ce3+-doped crystals such as LSO:Ce, YAP:Ce, LuAP:Ce, and recently also mixed Lux(RE3+)1-xAlO3:Ce crystals. These crystals are very attractive for medical application because of their high density (with th...

  18. Highlighting of quorum sensing lux genes and their expression in the hydrothermal vent shrimp Rimicaris exoculata ectosymbiontic community. Possible use as biogeographic markers.

    Directory of Open Access Journals (Sweden)

    Simon Le Bloa

    Full Text Available Rimicaris exoculata is a caridean shrimp that dominates the fauna at several hydrothermal vent sites of the Mid-Atlantic Ridge. It has two distinct and stable microbial communities. One of these epibiontic bacterial communities is located in the shrimp gut and has a distribution and role that are poorly understood. The second colonizes its enlarged gill chamber and is involved in host nutrition. It is eliminated after each molt, and has colonization processes reminiscent of those of a biofilm. The presence and expression of genes usually involved in quorum sensing (QS were then studied. At four sites, Rainbow, TAG, Snake Pit and Logatchev, two lux genes were identified in the R. exoculata epibiontic community at different shrimp molt stages and life stages. RT-PCR experiments highlighted lux gene expression activity at TAG, Snake Pit and Rainbow vent sites. Their potential QS activity and their possible roles in epibiont colonization processes are discussed. Moreover, phylogenetic analysis has shown the presence of three clades for luxS (Epsilonproteobacteria and four clades for luxR (Gammaproteobacteria genes, each clade being restricted to a single site. These genes are more divergent than the 16S rRNA one. They could therefore be used as biogeographical genetic markers.

  19. Quorum-sensing-directed protein expression in Serratia proteamaculans B5a

    DEFF Research Database (Denmark)

    Christensen, Allan Beck; Riedel, Kathrin; Eberl, Leo


    N-Acyl-L-homoserine-lactone-producing Serratia species are frequently encountered in spoiling foods of vegetable and protein origin. The role of quorum sensing in the food spoiling properties of these bacteria is currently being investigated. A set of luxR luxI homologous genes encoding a putative...... quorum sensor was identified in the N-(3-oxo-hexanoyl)-L-homoserine lactone (3-oxo-C6-HSL)-producing Serratia proteamaculans strain B5a. The 3-oxo-C6-HSL synthase SprI showed 79% similarity with Esal from Pantoea stewartii and the putative regulatory protein SprR was 86% similar to the SpnR of Serratia...... marcescens. Proteome analysis suggested that the presence of at least 39 intracellular proteins was affected by the 3-oxo-C6-HSL-based quorum sensing system. The lipB-encoded secretion system was identified as one target gene of the quorum sensing system. LipB was required for the production of extracellular...

  20. Artificially constructed quorum-sensing circuits are used for subtle control of bacterial population density.

    Directory of Open Access Journals (Sweden)

    Zhaoshou Wang

    Full Text Available Vibrio fischeri is a typical quorum-sensing bacterium for which lux box, luxR, and luxI have been identified as the key elements involved in quorum sensing. To decode the quorum-sensing mechanism, an artificially constructed cell-cell communication system has been built. In brief, the system expresses several programmed cell-death BioBricks and quorum-sensing genes driven by the promoters lux pR and PlacO-1 in Escherichia coli cells. Their transformation and expression was confirmed by gel electrophoresis and sequencing. To evaluate its performance, viable cell numbers at various time periods were investigated. Our results showed that bacteria expressing killer proteins corresponding to ribosome binding site efficiency of 0.07, 0.3, 0.6, or 1.0 successfully sensed each other in a population-dependent manner and communicated with each other to subtly control their population density. This was also validated using a proposed simple mathematical model.

  1. Expedient construction of small molecule macroarrays via sequential palladium- and copper-mediated reactions and their ex situ biological testing. (United States)

    Frei, Reto; Breitbach, Anthony S; Blackwell, Helen E


    We report the highly efficient syntheses of a series of focused libraries in the small molecule macroarray format using Suzuki-Miyaura and copper-catalyzed azide-alkyne cycloaddition (or "click") reactions. The libraries were based on stilbene and triazole scaffolds, which are known to have a broad range of biological activities, including quorum-sensing (QS) modulation in bacteria. The library products were generated in parallel on the macroarray in extremely short reaction times (~10-20 min) and isolated in excellent purities. Biological testing of one macroarray library post-cleavage (ex situ) revealed several potent agonists of the QS receptor, LuxR, in Vibrio fischeri. These synthetic agonists, in contrast to others that we have reported, were only active in the presence of the native QS signal in V. fischeri, which is suggestive of a different mode of activity. Notably, the results presented herein showcase the ready compatibility of the macroarray platform with chemical reactions that are commonly utilized in small molecule probe and drug discovery today. As such, this work serves to expand the utility of the small molecule macroarray as a rapid and operationally straightforward approach toward the synthesis and screening of bioactive agents.

  2. A modular positive feedback-based gene amplifier

    Directory of Open Access Journals (Sweden)

    Bhalerao Kaustubh D


    Full Text Available Abstract Background Positive feedback is a common mechanism used in the regulation of many gene circuits as it can amplify the response to inducers and also generate binary outputs and hysteresis. In the context of electrical circuit design, positive feedback is often considered in the design of amplifiers. Similar approaches, therefore, may be used for the design of amplifiers in synthetic gene circuits with applications, for example, in cell-based sensors. Results We developed a modular positive feedback circuit that can function as a genetic signal amplifier, heightening the sensitivity to inducer signals as well as increasing maximum expression levels without the need for an external cofactor. The design utilizes a constitutively active, autoinducer-independent variant of the quorum-sensing regulator LuxR. We experimentally tested the ability of the positive feedback module to separately amplify the output of a one-component tetracycline sensor and a two-component aspartate sensor. In each case, the positive feedback module amplified the response to the respective inducers, both with regards to the dynamic range and sensitivity. Conclusions The advantage of our design is that the actual feedback mechanism depends only on a single gene and does not require any other modulation. Furthermore, this circuit can amplify any transcriptional signal, not just one encoded within the circuit or tuned by an external inducer. As our design is modular, it can potentially be used as a component in the design of more complex synthetic gene circuits.

  3. A quorum sensing-disrupting brominated thiophenone with a promising therapeutic potential to treat luminescent vibriosis.

    Directory of Open Access Journals (Sweden)

    Tom Defoirdt

    Full Text Available Vibrio harveyi is amongst the most important bacterial pathogens in aquaculture. Novel methods to control this pathogen are needed since many strains have acquired resistance to antibiotics. We previously showed that quorum sensing-disrupting furanones are able to protect brine shrimp larvae against vibriosis. However, a major problem of these compounds is that they are toxic toward higher organisms and therefore, they are not safe to be used in aquaculture. The synthesis of brominated thiophenones, sulphur analogues of the quorum sensing-disrupting furanones, has recently been reported. In the present study, we report that these compounds block quorum sensing in V. harveyi at concentrations in the low micromolar range. Bioluminescence experiments with V. harveyi quorum sensing mutants and a fluorescence anisotropy assay indicated that the compounds disrupt quorum sensing in this bacterium by decreasing the ability of the quorum sensing master regulator LuxR to bind to its target promoter DNA. In vivo challenge tests with gnotobiotic brine shrimp larvae showed that thiophenone compound TF310, (Z-4-((5-(bromomethylene-2-oxo-2,5-dihydrothiophen-3-ylmethoxy-4-oxobutanoic acid, completely protected the larvae from V. harveyi BB120 when dosed to the culture water at 2.5 µM or more, whereas severe toxicity was only observed at 250 µM. This makes TF310 showing the highest therapeutic index of all quorum sensing-disrupting compounds tested thus far in our brine shrimp model system.

  4. Global Analysis of the Burkholderia thailandensis Quorum Sensing-Controlled Regulon (United States)

    Majerczyk, Charlotte; Brittnacher, Mitchell; Jacobs, Michael; Armour, Christopher D.; Radey, Mathew; Schneider, Emily; Phattarasokul, Somsak; Bunt, Richard


    Burkholderia thailandensis contains three acyl-homoserine lactone quorum sensing circuits and has two additional LuxR homologs. To identify B. thailandensis quorum sensing-controlled genes, we carried out transcriptome sequencing (RNA-seq) analyses of quorum sensing mutants and their parent. The analyses were grounded in the fact that we identified genes coding for factors shown previously to be regulated by quorum sensing among a larger set of quorum-controlled genes. We also found that genes coding for contact-dependent inhibition were induced by quorum sensing and confirmed that specific quorum sensing mutants had a contact-dependent inhibition defect. Additional quorum-controlled genes included those for the production of numerous secondary metabolites, an uncharacterized exopolysaccharide, and a predicted chitin-binding protein. This study provides insights into the roles of the three quorum sensing circuits in the saprophytic lifestyle of B. thailandensis, and it provides a foundation on which to build an understanding of the roles of quorum sensing in the biology of B. thailandensis and the closely related pathogenic Burkholderia pseudomallei and Burkholderia mallei. PMID:24464461

  5. A quorum sensing-disrupting brominated thiophenone with a promising therapeutic potential to treat luminescent vibriosis. (United States)

    Defoirdt, Tom; Benneche, Tore; Brackman, Gilles; Coenye, Tom; Sorgeloos, Patrick; Scheie, Anne Aamdal


    Vibrio harveyi is amongst the most important bacterial pathogens in aquaculture. Novel methods to control this pathogen are needed since many strains have acquired resistance to antibiotics. We previously showed that quorum sensing-disrupting furanones are able to protect brine shrimp larvae against vibriosis. However, a major problem of these compounds is that they are toxic toward higher organisms and therefore, they are not safe to be used in aquaculture. The synthesis of brominated thiophenones, sulphur analogues of the quorum sensing-disrupting furanones, has recently been reported. In the present study, we report that these compounds block quorum sensing in V. harveyi at concentrations in the low micromolar range. Bioluminescence experiments with V. harveyi quorum sensing mutants and a fluorescence anisotropy assay indicated that the compounds disrupt quorum sensing in this bacterium by decreasing the ability of the quorum sensing master regulator LuxR to bind to its target promoter DNA. In vivo challenge tests with gnotobiotic brine shrimp larvae showed that thiophenone compound TF310, (Z)-4-((5-(bromomethylene)-2-oxo-2,5-dihydrothiophen-3-yl)methoxy)-4-oxobutanoic acid, completely protected the larvae from V. harveyi BB120 when dosed to the culture water at 2.5 µM or more, whereas severe toxicity was only observed at 250 µM. This makes TF310 showing the highest therapeutic index of all quorum sensing-disrupting compounds tested thus far in our brine shrimp model system.

  6. A Lux-like Quorum Sensing System in the Extreme Acidophile Acidithiobacillus ferrooxidans

    Directory of Open Access Journals (Sweden)



    Full Text Available The genome of the acidophilic, proteobacterium Acidithiobacillus ferrooxidans, contains linked but divergently oriented genes, termed afeI and afeR, whose predicted protein products are significantly similar to the LuxI and LuxR families of proteins. A possible promoter and Lux box are predicted upstream of afeI. A cloned copy of afeI, expressed in E. coli, encodes an enzyme that catalyzes the production of a diffusible compound identified by gas chromatography and mass spectrometry as an unsubstituted N-acyl homoserine lactone (AHL of chain length C14. This AHL can be detected by a reporter strain of Sinorhizobium meliloti Rm41 suggesting that it is biologically active. The reporter strain also responds to extracts of the supernatant of A. ferrooxidans grown to early stationary phase in sulfur medium indicating that a diffusible AHL is produced by this microorganism. Semi-quantitative RT-PCR experiments indicate that afeI and afeR are expressed maximally in early stationary phase and are more expressed when A. ferrooxidans is grown in sulfur- rather than iron-containing medium. Given the predicted amino acid sequence and functional properties of AfeI and AfeR it is proposed that A. ferrooxidans has a quorum sensing system similar to the LuxI-LuxR paradigm.

  7. A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics. (United States)

    Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L


    Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Global analysis of the Burkholderia thailandensis quorum sensing-controlled regulon. (United States)

    Majerczyk, Charlotte; Brittnacher, Mitchell; Jacobs, Michael; Armour, Christopher D; Radey, Mathew; Schneider, Emily; Phattarasokul, Somsak; Bunt, Richard; Greenberg, E Peter


    Burkholderia thailandensis contains three acyl-homoserine lactone quorum sensing circuits and has two additional LuxR homologs. To identify B. thailandensis quorum sensing-controlled genes, we carried out transcriptome sequencing (RNA-seq) analyses of quorum sensing mutants and their parent. The analyses were grounded in the fact that we identified genes coding for factors shown previously to be regulated by quorum sensing among a larger set of quorum-controlled genes. We also found that genes coding for contact-dependent inhibition were induced by quorum sensing and confirmed that specific quorum sensing mutants had a contact-dependent inhibition defect. Additional quorum-controlled genes included those for the production of numerous secondary metabolites, an uncharacterized exopolysaccharide, and a predicted chitin-binding protein. This study provides insights into the roles of the three quorum sensing circuits in the saprophytic lifestyle of B. thailandensis, and it provides a foundation on which to build an understanding of the roles of quorum sensing in the biology of B. thailandensis and the closely related pathogenic Burkholderia pseudomallei and Burkholderia mallei.

  9. Productivity and biochemical properties of green tea in response to ...

    Indian Academy of Sciences (India)

    The expression of three homologues of the expansin genes, which regulate plant cell growth, and the CsCHS gene encoding a tea chalcone synthase, which critically regulates the biosynthesis of catechols, were induced in germinal leaves of tea plants following treatment with HpaG1–94 or HpaGXooc. Higher levels of ...

  10. Draft genome sequence of Penicillium marneffei strain PM1. (United States)

    Woo, Patrick C Y; Lau, Susanna K P; Liu, Bin; Cai, James J; Chong, Ken T K; Tse, Herman; Kao, Richard Y T; Chan, Che-Man; Chow, Wang-Ngai; Yuen, Kwok-Yung


    Penicillium marneffei is the most important thermal dimorphic, pathogenic fungus endemic in China and Southeast Asia and is particularly important in HIV-positive patients. We report the 28,887,485-bp draft genome sequence of P. marneffei, which contains its complete mitochondrial genome, sexual cycle genes, a high diversity of Mp1p homologues, and polyketide synthase genes.

  11. Characterization of a chestnut FLORICAULA/LEAFY homologous ...

    African Journals Online (AJOL)

    Furthermore, the flowering effectiveness of the gene was assessed with transgenic Arabidopsis. CmLFY protein showed a high degree of similarity to PEAFLO (78%), which is a homologue of FLO/LFY from pea. RT-PCR analysis showed that, CmLFY expressed at high levels in inflorescences, but not in young leaves, fruits ...

  12. An extensive microarray analysis of AAL-toxin-induced cell death in Arabidopsis thaliana brings new insights into the complexity of programmed cell death in plants

    NARCIS (Netherlands)

    Gechev, T.S.; Gadjev, I.Z.; Hille, J.


    A T-DNA knockout of the Arabidopsis homologue of the tomato disease resistance gene Asc was obtained. The asc gene renders plants sensitive to programmed cell death (PCD) triggered by the fungal AAL toxin. To obtain more insights into the nature of AAL-toxin-induced cell death and to identify genes

  13. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik


    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  14. Studies on extraction behavior of U(VI) and Th(IV) from nitric acid medium using tri-iso-amyl phosphate (TiAP)/ n-dodecane as extractant

    International Nuclear Information System (INIS)

    Jadhav, S.T.; Tripathi, S.C.; Singh, S.K.; Gandhi, P.M.; Janardan, P.


    Tri-iso-amyl phosphate is a higher homologue of TBP, retaining many advantages of TBP while eliminating or mitigating its disadvantages. Its longer, branched alkyl chain, resists third phase formation during overloading of actinides. The TiAP is being considered as an alternative of TBP for the reprocessing of Fast Breeder Reactor fuels due to its various advantages over TBP

  15. Correlation of Mycotoxin Fumonisin B2 Production and Presence of the Fumonisin Biosynthetic Gene fum8 in Aspergillus niger from Grape (United States)

    Fumonisins are mycotoxins associated with cancer and several other serious diseases in humans and animals. Production of the mycotoxins has been reported for over two decades in Fusarium species, but has been reported only recently in strains of Aspergillus niger. In addition, a homologue of the f...

  16. Induction of lethal mutations in the x-chromosome of unirradiated Drosophila oocytes after fertilization by irradiated spermatozoa

    International Nuclear Information System (INIS)

    Shaposhnikov, M.V.; Zainullin, V.G.


    Full text: In primary study on Drosophila it was found that irradiated male X-chromosomes induce recessive lethals in unirradiated female homologues (Abeleva et al., 1961, Radiobiologya. 1:123-126). The same effects were obtained in Drosophila in some recent investigations. The mechanisms of these effects is unknown. However it may be responsible for low-dose radiation effects as it induce mutations in unirradiated DNA. We assume that this effect may be a result of activation of error prone repair in response to preliminary DNA lesions in irradiated chromosome. In this research we analyse the frequencies of the recessive lethal mutations in the X-chromosome of Drosophila females mated with irradiated Basc males. We used acute irradiation with a dose rate of 10 Gy. For testing our hypothesis we use the mus209 and mei-41 mutant females. Mus209 is a PCNA gene homologue and mei-41 is a homologue of ATM gene. These genes are involved in post-replication DNA repair which may be error prone repair in Drosophila. It was obtained the tendency to decreasing the mutation rate at the mei-41[D5] background and decreasing mutation rate in mus209[B1] background in comparison with wild type strains CS (p<0.05). The obtained results demonstrate the possible role of mus209[B1] and mei-41[D5] genes in the inducing of mutations in the unirradiated X-chromosome in the presence of irradiated homologue

  17. Physiological activation of the human cerebral cortex during auditory perception and speech revealed by regional increases in cerebral blood flow

    DEFF Research Database (Denmark)

    Lassen, N A; Friberg, L


    by measuring regional cerebral blood flow CBF after intracarotid Xenon-133 injection are reviewed with emphasis on tests involving auditory perception and speech, and approach allowing to visualize Wernicke and Broca's areas and their contralateral homologues in vivo. The completely atraumatic tomographic CBF...

  18. Functional Analysis of Breast Cancer Susceptibility Gene BRCA2

    National Research Council Canada - National Science Library

    Wang, Yingcai


    ...- specific RecA homologue, but not with XRCC2, Rad51D or the replication Protein (RPA). The specific interaction of BRCA2 and hsDMCl suggests that BRCA2 may be involved in DNA recombination and repair both in germ and somatic cells...

  19. Solid-phase synthesis and pharmacological evaluation of analogues of PhTX-12-A potent and selective nicotinic acetylcholine receptor antagonist

    DEFF Research Database (Denmark)

    Strømgaard, Kristian; Mellor, Ian R; Andersen, Kim


    Philanthotoxin-12 (PhTX-12) is a novel potent and selective, noncompetitive antagonist of nicotinic acetylcholine receptors (nAChRs). Homologues of PhTX-12 with 7-11 methylene groups between the primary amino group and the aromatic head-group were synthesized using solid-phase methodology. In vitro...

  20. Ternary mixtures of alkyltriphenylphosphonium bromides (C12 TPB ...

    Indian Academy of Sciences (India)


    Critical Micellar Concentrations (CMCs) by conductometry, but their ternary mixtures produce single ... efficiently quenched pyrene fluorescence; the performances of the homologues in this respect were assessed. Keywords ..... The shape of the amphiphile aggregates ..... Haque M E, Das A R and Moulik S P 1999 J. Colloid.

  1. Depletion of Acyl-Coenzyme A-Binding Protein Affects Sphingolipid Synthesis and Causes Vesicle Accumulation and Membrane Defects in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Gaigg, B; Neergaard, T B; Schneiter, R


    Deletion of the yeast gene ACB1 encoding Acb1p, the yeast homologue of the acyl-CoA-binding protein (ACBP), resulted in a slower growing phenotype that adapted into a faster growing phenotype with a frequency >1:10(5). A conditional knockout strain (Y700pGAL1-ACB1) with the ACB1 gene under contro...

  2. The POU-er of gene nomenclature

    DEFF Research Database (Denmark)

    Frankenberg, Stephen R; Frank, Dale; Harland, Richard


    The pluripotency factor POU5F1 (OCT4) is well known as a key regulator of stem cell fate. Homologues of POU5F1 exist throughout vertebrates, but the evolutionary and functional relationships between the various family members have been unclear. The level to which function has been conserved withi...

  3. Identification of a mitochondrial external NADPH dehydrogenase by overexpression in transgenic ¤Nicotiana sylvestris¤

    DEFF Research Database (Denmark)

    Michalecka, A.M.; Agius, S.C.; Møller, I.M.


    The plant respiratory chain contains a complex setup of non-energy conserving NAD(P)H dehydrogenases, the physiological consequences of which are highly unclear. An expression construct for the potato (Solanum tuberosum L., cv. Desiree) ndb1 gene, a homologue of bacterial and fungal type II NAD...

  4. Effect of linguistic experience on the discrimination of Shona lexical ...

    African Journals Online (AJOL)

    To this effect tone perceptual discrimination was investigated in experiment 1 using minimal pairs of Shona words and their filtered homologues, whereas experiment 2 tested the effect of increasing the number of phonetic contrasts using minimal and non-minimal pairs in Shona words and low-pass filtered stimuli.

  5. Bone-97 Alcohol and Skeletal Adaptation to Mechanical Usage (United States)


    nucleotide mismatches and recruit heterodimers of the MutL homologues (MLH1- PMS2 , MLH1-PMS1, or MLH1-MLH3) to base mismatches (32, 34). These MLH1...generate modified base pairs) (44, 46, 66). Indeed, cells deficient in MLH1 or its interacting protein PMS2 are resistant to apoptosis induced by cisplatin

  6. Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis

    NARCIS (Netherlands)

    Giger, Roman J; Wolfer, D P; De Wit, G M; Verhaagen, J


    Semaphorin III/collapsin-1 (semaIII/coll-1) is a chemorepellent that exhibits a repulsive effect on growth cones of dorsal root ganglion neurons. To identify structures that express semaIII/coll-1 in developing mammals, we cloned the rat homologue and performed in situ hybridization on embryonic,

  7. Functional analysis of PI-like gene in relation to flower development ...

    Indian Academy of Sciences (India)

    lying flower development in bamboo, a petal-identity gene was identified as a ... 35S::BoPI fully rescued the defective petal forma- tion in the ... Arabidopsis converted sepals to petals; BoPI-C interacted with BoAP3 on yeast two-hybrid assay, just like the full-length ... PI homologue function in regulating perianth organ forma-.

  8. Functional analysis of the conserved transcriptional regulator CfWor1 in Cladosporium fulvum reveals diverse roles in the virulence of plant pathogenic fungi

    NARCIS (Netherlands)

    Ökmen, B.; Collemare, J.; Griffiths, S.A.; Burgt, van der A.; Cox, R.; Wit, de P.J.G.M.


    Fungal Wor1-like proteins are conserved transcriptional regulators that are reported to regulate the virulence of several plant pathogenic fungi by affecting the expression of virulence genes. Here, we report the functional analysis of CfWor1, the homologue of Wor1 in Cladosporium fulvum. ¿cfwor1

  9. ORF Alignment: NT_033777 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NT_033777 gi|24648160 >1mc2A 1 134 1 122 2e-29 ... gb|AAB20876.1| ammodytin L=myotoxi...c phospholipase A2 homologue [Vipera ... ammodytes=European viper, Peptide, 123 aa] ... Length

  10. Targeting of SNAP-23 and SNAP-25 in polarized epithelial cells

    NARCIS (Netherlands)

    Low, SH; Roche, PA; Anderson, HA; van Ijzendoorn, SCD; Zhang, M; Mostov, KE; Weimbs, T


    SNAP-23 is the ubiquitously expressed homologue of the neuronal SNAP-25, which functions in synaptic vesicle fusion, We have investigated the subcellular localization of SNAP-23 in polarized epithelial cells, In hepatocyte-derived HepG2 cells and in Madin-Darby canine kidney (MDCK) cells, the

  11. Lutte chimique contre le Feu bactérien : quelques résultats d'essais


    Lecomte, Pascal; Larue, P.


    Introduction[br/] 1- Produits homologués[br/] 2- Efficacité et sélectivité[br/] 2.1. Test en contamination artificielle[br/] 2.2. Test en contamination naturelle[br/] 2.3. Sélectivité[br/] Conclusion

  12. Expression of EZH2 and Ki-67 in colorectal cancer and associations with treatment response and prognosis

    NARCIS (Netherlands)

    Fluge, Ø.; Gravdal, K.; Carlsen, E.; Vonen, B.; Kjellevold, K.; Refsum, S.; Lilleng, R.; Eide, T.J.; Halvorsen, T.B.; Tveit, K.M.; Otte, A.P.; Akslen, L.A.; Dahl, O.


    Background: Enhancer of zeste homologue 2 (EZH2) is a member of the Polycomb group of genes that is involved in epigenetic silencing and cell cycle regulation. Methods: We studied EZH2 expression in 409 patients with colorectal cancer stages II and III. The patients were included in a randomised

  13. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    DEFF Research Database (Denmark)

    Vorum, H; Liu, X; Madsen, Peder


    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  14. Interactions between the toxin kid of the bacterial parD system and the antitoxins Kis and MazE

    NARCIS (Netherlands)

    Kamphuis, M.B.; Monti, M.C.; van den Heuvel, R.H.H.; Santos-Sierra, S.; Folkers, G.E.; Lemonnier, M.; Diaz-Orejas, R.; Heck, A.J.R.; Boelens, R.


    The proteins Kid and Kis are the toxin and antitoxin, respectively, encoded by the parD operon of Escherichia coli plasmid R1. Kis prevents the inhibition of E. coli cell growth caused by the RNA cleavage activity of Kid. Overproduction of MazE, the chromosome-encoded homologue of Kis, has been

  15. Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc-3 is associated with homozygotic presence of a mutated eIF4E allele

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Lund, Ole Søgaard; Larsen, Richard


    -3 and bc-u, have been proposed to control resistance to the potyviruses Bean common mosaic virus (BCMV) and Bean common mosaic necrosis virus. In order to identify molecular entities for these genes, we cloned and sequenced P. vulgaris homologues of genes encoding the eIF proteins eIF4E, eIF(iso)4E...

  16. Human calumenin localizes to the secretory pathway and is secreted to the medium

    DEFF Research Database (Denmark)

    Vorum, H; Hager, H; Christensen, Birgitte Mønster


    Calumenin belongs to a family of multiple EF-hand proteins that include reticulocalbin, ERC-55, and Cab45. Reticulocalbin and ERC-55 localize to the ER due to a C-terminal HDEL retrieval signal. Cab45 contains a HEEF C-terminal sequence and is localized to the Golgi apparatus. The murine homologue...

  17. Associations of dietary methyl donor intake with MLH1 promoter hypermethylation and related molecular phenotypes in sporadic colorectal cancer

    NARCIS (Netherlands)

    Vogel, S. de; Bongaerts, B.W.C.; Wouters, K.A.D.; Kester, A.D.M.; Schouten, L.J.; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Engeland, M. van; Weijenberg, M.P.


    Intake of dietary factors that serve as methyl group donors may influence promoter hypermethylation in colorectal carcinogenesis. We investigated whether dietary folate, vitamin B2 and vitamin B6, methionine and alcohol were associated with mutL homologue 1 (MLH1) hypermethylation and the related

  18. Toward an understanding of the molecular mechanisms of barnacle larval settlement: A comparative transcriptomic approach

    KAUST Repository

    Chen, Zhang-Fan; Matsumura, Kiyotaka; Wang, Hao; Arellano, Shawn M.; Yan, Xingcheng; Alam, Intikhab; Archer, John A.C.; Bajic, Vladimir B.; Qian, Pei-Yuan


    of cyprids; 3) 20 kDa-cement protein homologues were expressed in the cyprid cement gland and probably function during attachment; and 4) receptor tyrosine kinases were expressed higher in cyprid stage and may be involved in signal perception during larval

  19. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The structures of nine independent crystals of bitter gourd seed lectin (BGSL), a non-toxic homologue of type II RIPS, and its sugar complexes have been determined. The four-chain, two-fold symmetric, protein is made up of two identical two-chain modules, each consisting of a catalytic chain and a lectin chain, connected ...

  20. EST Table: BY915319 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available BY915319 fbpv0592 10/09/28 52 %/103 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 49 %/102 aa FBpp0127246|DanaGF24054-PA 10/08/28 n.h 10/09/1

  1. EST Table: BP124521 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available BP124521 epV32477 10/09/28 59 %/164 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 55 %/163 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

  2. EST Table: BP123885 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available BP123885 epV31590 10/09/28 57 %/174 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 55 %/163 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

  3. EST Table: BP125106 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available BP125106 fbpv0387 10/09/28 58 %/165 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 56 %/165 aa FBpp0212871|DsimGD14469-PA 10/08/28 n.h 10/09/1

  4. EST Table: BP125521 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available BP125521 fbpv0944 10/09/28 59 %/165 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 56 %/164 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

  5. EST Table: BP125005 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available BP125005 fbpv0197 10/09/28 58 %/185 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 58 %/173 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

  6. Dpb11/TopBP1 contributes to genomicstability via homologous recombinationand checkpoint signaling

    DEFF Research Database (Denmark)

    Germann, Susanne Manuela

    for recruitment. Also, the chicken homologue TopBP1 colocalizes with RPA1 as well as Rad51 when DNA damage is induced. Previously, dpb11 mutants have been shown to be sensitive to DNA-damaging agents that cause DSBs, DNA alkylation and stalled replication forks. Interestingly, we found the point mutants dpb11-PF...

  7. CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL

    NARCIS (Netherlands)

    Bartuzi, Paulina; Billadeau, Daniel D.; Favier, Robert; Rong, Shunxing; Dekker, Daphne; Fedoseienko, Alina; Fieten, Hille; Wijers, Melinde; Levels, Johannes H.; Huijkman, Nicolette; Kloosterhuis, Niels; Van der Molen, Henk; Brufau, Gemma; Groen, Albert K.; Elliott, Alison M.; Kuivenhoven, Jan Albert; Plecko, Barbara; Grangl, Gernot; McGaughran, Julie; Horton, Jay D.; Burstein, Ezra; Hofker, Marten H.; van de Sluis, Bart


    The low-density lipoprotein receptor (LDLR) plays a pivotal role in clearing atherogenic circulating low-density lipoprotein (LDL) cholesterol. Here we show that the COMMD/CCDC22/CCDC93 (CCC) and the Wiskott-Aldrich syndrome protein and SCAR homologue (WASH) complexes are both crucial for endosomal

  8. CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL

    NARCIS (Netherlands)

    Bartuzi, Paulina; Billadeau, Daniel D.; Favier, Robert; Rong, Shunxing; Dekker, Daphne; Fedoseienko, Alina; Fieten, Hille; Wijers, Melinde; Levels, Johannes H.; Huijkman, Nicolette; Kloosterhuis, Niels; van der Molen, Henk; Brufau, Gemma; Groen, Albert K.; Elliott, Alison M.; Kuivenhoven, Jan Albert; Plecko, Barbara; Grangl, Gernot; McGaughran, Julie; Horton, Jay D.; Burstein, Ezra; Hofker, Marten H.; van de Sluis, Bart

    The low-density lipoprotein receptor (LDLR) plays a pivotal role in clearing atherogenic circulating low-density lipoprotein (LDL) cholesterol. Here we show that the COMMD/CCDC22/CCDC93 (CCC) and the Wiskott-Aldrich syndrome protein and SCAR homologue (WASH) complexes are both crucial for endosomal

  9. Identification and quantification of 1,3-dimethylbutylamine (DMBA) from Camellia sinensis tea leaves and dietary supplements (United States)

    1, 3-Dimethylbutylamine (DMBA), is a CNS stimulant which has recently been identified in multiple dietary supplements and sometimes labeled as a natural constituent of Pouchung tea. DMBA is an homologue of 1,3-dimethylamylamine (DMAA) which the US Food and Drug Administration has attempted to remov...

  10. Increasing complexity of the bacterial cytoskeleton

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Löwe, Jan


    Bacteria contain cytoskeletal elements involved in major cellular processes including DNA segregation and cell morphogenesis and division. Distant bacterial homologues of tubulin (FtsZ) and actin (MreB and ParM) not only resemble their eukaryotic counterparts structurally but also show similar...

  11. The human E48 antigen, highly homologous to the murine Ly-6 antigen ThB, is a GPI-anchored molecule apparently involved in keratinocyte cell-cell adhesion

    NARCIS (Netherlands)

    Brakenhoff, R H; Gerretsen, M; Knippels, E M; van Dijk, M.; van Essen, H; Weghuis, D O; Sinke, R J; Snow, G B; van Dongen, G A

    The E48 antigen, a putative human homologue of the 20-kD protein present in desmosomal preparations of bovine muzzle, and formerly called desmoglein III (dg4), is a promising target antigen for antibody-based therapy of squamous cell carcinoma in man. To anticipate the effect of high antibody dose

  12. Pten regulates spindle pole movement through Dlg1-mediated recruitment of Eg5 to centrosomes

    NARCIS (Netherlands)

    Ree, J.H. van; Nam, H.J.; Jeganathan, K.B.; Kanakkanthara, A.; Deursen, J.M.A. van


    Phosphatase and tensin homologue (Pten) suppresses neoplastic growth by negatively regulating PI(3)K signalling through its phosphatase activity. To gain insight into the actions of non-catalytic Pten domains in normal physiological processes and tumorigenesis, we engineered mice lacking the

  13. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase. (United States)

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J


    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  14. Structural and functional studies of a Cu+-ATPase from Legionella pneumophila

    DEFF Research Database (Denmark)

    Mattle, Daniel

    During his studies, Daniel Mattle explored the copper(I) export mechanism of a P-type Cu+ ATPase from Legionella pneumophila – a homologue to the human Cu+ ATPases. Cu+ ATPases are responsible for the homeostatic control of the physiological relevant – but toxic – copper(I) cations. To assess...

  15. Several distinct localization patterns for penicillin-binding proteins in Bacillus subtilis

    NARCIS (Netherlands)

    Scheffers, Dirk-Jan; Jones, Laura J.F.; Errington, Jeffery


    Bacterial cell shape is determined by a rigid external cell wall. In most non-coccoid bacteria, this shape is also determined by an internal cytoskeleton formed by the actin homologues MreB and/or Mbl. To gain further insights into the topological control of cell wall synthesis in bacteria, we have

  16. Selective inhibition of Sarcocystis neurona calcium-dependent protein kinase 1 for equine protozoal myeloencephalitis therapy (United States)

    Sarcocystis neurona is the most frequent cause of Equine Protozoal Myeloencephalitis (EPM), a debilitating neurologic disease of horses that can be difficult to treat. We identified SnCDPK1, the S. neurona homologue of calcium dependent protein kinase 1 (CDPK1), a validated drug target in Toxoplasma...

  17. Modulation of N400 in Chronic Non-Fluent Aphasia Using Low Frequency Repetitive Transcranial Magnetic Stimulation (rTMS) (United States)

    Barwood, Caroline H. S.; Murdoch, Bruce E.; Whelan, Brooke-Mai; Lloyd, David; Riek, Stephan; O'Sullivan, John D.; Coulthard, Alan; Wong, Andrew


    Low frequency Repetitive Transcranial Magnetic Stimulation (rTMS) has previously been applied to language homologues in non-fluent populations of persons with aphasia yielding significant improvements in behavioral language function up to 43 months post stimulation. The present study aimed to investigate the electrophysiological correlates…

  18. ALKBH8-mediated formation of a novel diastereomeric pair of wobble nucleosides in mammalian tRNA

    DEFF Research Database (Denmark)

    van den Born, E.; Vagbo, C. B.; Songe-Moller, L.


    Mammals have nine different homologues (ALKBH1-9) of the Escherichia coli DNA repair demethylase AlkB. ALKBH2 is a genuine DNA repair enzyme, but the in vivo function of the other ALKBH proteins has remained elusive. It was recently shown that ALKBH8 contains an additional transfer RNA ( t...

  19. Maintaining cell identity

    DEFF Research Database (Denmark)

    Comet, Itys; Riising, Eva M; Leblanc, Benjamin


    Enhancer of zeste homologue 2 (EZH2), the catalytic subunit of Polycomb repressive complex 2 (PRC2), has attracted broad research attention in the past few years because of its involvement in the development and maintenance of many types of cancer and the use of specific EZH2 inhibitors in clinic...

  20. Cloning, characterization and promoter analysis of common carp

    Indian Academy of Sciences (India)

    Some members of hairy/Enhancer-of-split-related gene (HES) family have important effects on axial mesoderm segmentation and the establishment and maintenance of the somite fringe. In fishes, the her6 gene, a member of the HES family, is the homologue of hes1 in mammals and chicken. In this study, the her6 gene ...