Cinnamaldehyde and cinnamaldehyde derivatives reduce virulence in Vibrio spp. by decreasing the DNA-binding activity of the quorum sensing response regulator LuxR

Science.gov (United States)

Brackman, Gilles; Defoirdt, Tom; Miyamoto, Carol; Bossier, Peter; Van Calenbergh, Serge; Nelis, Hans; Coenye, Tom

2008-01-01

Background To date, only few compounds targeting the AI-2 based quorum sensing (QS) system are known. In the present study, we screened cinnamaldehyde and substituted cinnamaldehydes for their ability to interfere with AI-2 based QS. The mechanism of QS inhibition was elucidated by measuring the effect on bioluminescence in several Vibrio harveyi mutants. We also studied in vitro the ability of these compounds to interfere with biofilm formation, stress response and virulence of Vibrio spp. The compounds were also evaluated in an in vivo assay measuring the reduction of Vibrio harveyi virulence towards Artemia shrimp. Results Our results indicate that cinnamaldehyde and several substituted derivatives interfere with AI-2 based QS without inhibiting bacterial growth. The active compounds neither interfered with the bioluminescence system as such, nor with the production of AI-2. Study of the effect in various mutants suggested that the target protein is LuxR. Mobility shift assays revealed a decreased DNA-binding ability of LuxR. The compounds were further shown to (i) inhibit biofilm formation in several Vibrio spp., (ii) result in a reduced ability to survive starvation and antibiotic treatment, (iii) reduce pigment and protease production in Vibrio anguillarum and (iv) protect gnotobiotic Artemia shrimp against virulent Vibrio harveyi BB120. Conclusion Cinnamaldehyde and cinnamaldehyde derivatives interfere with AI-2 based QS in various Vibrio spp. by decreasing the DNA-binding ability of LuxR. The use of these compounds resulted in several marked phenotypic changes, including reduced virulence and increased susceptibility to stress. Since inhibitors of AI-2 based quorum sensing are rare, and considering the role of AI-2 in several processes these compounds may be useful leads towards antipathogenic drugs. PMID:18793453

RpoS induces expression of the Vibrio anguillarum quorum-sensing regulator VanT.

Science.gov (United States)

Weber, Barbara; Croxatto, Antony; Chen, Chang; Milton, Debra L

2008-03-01

In vibrios, regulation of the Vibrio harveyi-like LuxR transcriptional activators occurs post-transcriptionally via small regulatory RNAs (sRNAs) that destabilize the luxR mRNA at a low cell population, eliminating expression of LuxR. Expression of the sRNAs is modulated by the vibrio quorum-sensing phosphorelay systems. However, vanT mRNA, which encodes a LuxR homologue in Vibrio anguillarum, is abundant at low and high cell density, indicating that VanT expression may be regulated via additional mechanisms. In this study, Western analyses showed that VanT was expressed throughout growth with a peak of expression during late exponential growth. VanO induced partial destabilization of vanT mRNA via activation of at least one Qrr sRNA. Interestingly, the sigma factor RpoS significantly stabilized vanT mRNA and induced VanT expression during late exponential growth. This induction was in part due to RpoS repressing expression of Hfq, an RNA chaperone. RpoS is not part of the quorum-sensing regulatory cascade since RpoS did not regulate expression or activity of VanO, and RpoS was not regulated by VanO or VanT. VanT and RpoS were needed for survival following UV irradiation and for pigment and metalloprotease production, suggesting that RpoS works with the quorum-sensing systems to modulate expression of VanT, which regulates survival and stress responses.

Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

Directory of Open Access Journals (Sweden)

Manasi S. Apte

2012-01-01

Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

QStatin, a Selective Inhibitor of Quorum Sensing in Vibrio Species

Directory of Open Access Journals (Sweden)

Byoung Sik Kim

2018-01-01

Full Text Available Pathogenic Vibrio species cause diseases in diverse marine animals reared in aquaculture. Since their pathogenesis, persistence, and survival in marine environments are regulated by quorum sensing (QS, QS interference has attracted attention as a means to control these bacteria in aquatic settings. A few QS inhibitors of Vibrio species have been reported, but detailed molecular mechanisms are lacking. Here, we identified a novel, potent, and selective Vibrio QS inhibitor, named QStatin [1-(5-bromothiophene-2-sulfonyl-1H-pyrazole], which affects Vibrio harveyi LuxR homologues, the well-conserved master transcriptional regulators for QS in Vibrio species. Crystallographic and biochemical analyses showed that QStatin binds tightly to a putative ligand-binding pocket in SmcR, the LuxR homologue in V. vulnificus, and changes the flexibility of the protein, thereby altering its transcription regulatory activity. Transcriptome analysis revealed that QStatin results in SmcR dysfunction, affecting the expression of SmcR regulon required for virulence, motility/chemotaxis, and biofilm dynamics. Notably, QStatin attenuated representative QS-regulated phenotypes in various Vibrio species, including virulence against the brine shrimp (Artemia franciscana. Together, these results provide molecular insights into the mechanism of action of an effective, sustainable QS inhibitor that is less susceptible to resistance than other antimicrobial agents and useful in controlling the virulence of Vibrio species in aquacultures.

Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

OpenAIRE

Apte, Manasi S.; Meller, Victoria H.

2011-01-01

Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

Effect of iron on expression of efflux pump (adeABC) and quorum sensing (luxI, luxR) genes in clinical isolates of Acinetobacter baumannii.

Science.gov (United States)

Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Valibeigi, Behnaz; Mansouri, Shahla

2015-11-01

Resistance-nodulation-division efflux system (RND) adeABC contributes to intrinsic resistance to various drug classes in Acinetobacter baumannii. Similarly, quorum sensing (QS) plays an important role in the biofilm formation and pathogenicity of this bacterium. The aims of this study were to evaluate the influence of iron limitation on the expression of efflux pump (adeABC) genes and QS (luxI, luxR) system by relative quantitative real-time polymerase chain reaction (qRT-PCR). In addition, DNA sequence and phylogenetic relatedness of biofilm-associated protein (Bap) gene was also investigated. Sixty-five multidrug-resistant isolates of A. baumannii were recovered from ICU patients of three hospitals in Kerman, Iran. The isolates were highly resistant to at least 11 antibiotics (MIC ≥64 μg/mL); however, 87% and 89% were susceptible to colistin and tigecycline, respectively (MIC 0.05 μg/mL) (p ≤ 0.05). We detected the presence of RND efflux pump, QS, and bap genes with the frequencies of 92% (adeA), 61.5% (adeB), 84.6% (adeC), 80% (luxI), 61% (luxR), and 66% (bap), respectively. qRT-PCR analysis showed that in some isolates, expression of both adeABC and luxI/R was increased more than fourfold in the presence of low iron (20 μm), suggesting the additional regulatory role of iron on both efflux pump and QS system. Alignment and phylogenetic analysis on the strong biofilm forming isolates confirmed that the fragments amplified were indeed part of bap gene and deduced sequence was similar to A. baumannii K9B410. © 2015 APMIS. Published by John Wiley & Sons Ltd.

Monolayer structures of alkyl aldehydes: Odd-membered homologues

International Nuclear Information System (INIS)

Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

2011-01-01

Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

The Mycobacterium tuberculosis homologue of the Mycobacterium ...

African Journals Online (AJOL)

With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

Detection of a Yersinia pestis gene homologue in rodent samples

Directory of Open Access Journals (Sweden)

Timothy A. Giles

2016-08-01

Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

Phosphatase and tensin homologue deleted on chromosome 10 ...

African Journals Online (AJOL)

Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

International Nuclear Information System (INIS)

Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

2006-01-01

The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

Isolation and characterization of an AGAMOUS homologue from cocoa

NARCIS (Netherlands)

Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

2006-01-01

We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

The actin homologue MreB organizes the bacterial cell membrane

NARCIS (Netherlands)

Strahl, H.; Burmann, F.; Hamoen, L.W.

2014-01-01

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

Science.gov (United States)

Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

2002-12-01

The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

Characterization and cloning of TMV resistance gene N homologues ...

African Journals Online (AJOL)

Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

DEFF Research Database (Denmark)

Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

2011-01-01

The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

International Nuclear Information System (INIS)

Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

2012-01-01

A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

Energy Technology Data Exchange (ETDEWEB)

Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

2012-08-31

A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

Cloning and characterization of maize ZmSPK1, a homologue to ...

African Journals Online (AJOL)

hope&shola

2006-03-15

Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

DEFF Research Database (Denmark)

van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

2017-01-01

, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

Science.gov (United States)

Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

2017-01-01

Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

Behaviour of the homologues of Rf and Db in complexing media

International Nuclear Information System (INIS)

Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

1999-01-01

In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

The actin homologue MreB organizes the bacterial cell membrane

OpenAIRE

Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

2014-01-01

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

OpenAIRE

Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

2007-01-01

Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

Science.gov (United States)

Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

2010-01-01

Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion.

Science.gov (United States)

Li, Peng; Tian, Mingxing; Bao, Yanqing; Hu, Hai; Liu, Jiameng; Yin, Yi; Ding, Chan; Wang, Shaohui; Yu, Shengqing

2017-01-01

Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS) and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant Δ rfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the molecular

Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion

Directory of Open Access Journals (Sweden)

Peng Li

2017-09-01

Full Text Available Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant ΔrfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the

Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

DEFF Research Database (Denmark)

Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

2009-01-01

hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

NARCIS (Netherlands)

Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

2004-01-01

Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

Structural studies on a non-toxic homologue of type II RIPs from ...

Indian Academy of Sciences (India)

Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

OpenAIRE

Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

1994-01-01

The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

International Nuclear Information System (INIS)

Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

1997-01-01

Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

DEFF Research Database (Denmark)

Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

2006-01-01

A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

Science.gov (United States)

Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

2012-10-18

Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

Science.gov (United States)

Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

2006-08-15

Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

The role of the leukemia-associated ETO homologue repressors in hematopoiesis

OpenAIRE

Olsson, André

2006-01-01

The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

International Nuclear Information System (INIS)

Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

2009-01-01

Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

Science.gov (United States)

Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

1995-11-01

We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

Science.gov (United States)

Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

2015-10-14

The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

Science.gov (United States)

Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

2015-03-01

NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

Is the Prosthetic Homologue Necessary for Embodiment?

Science.gov (United States)

Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

2016-01-01

Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

Science.gov (United States)

Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

2015-08-01

Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

Science.gov (United States)

Hermes, Fatemah A; Cronan, John E

2013-10-01

The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

Science.gov (United States)

Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

2013-09-15

Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

NARCIS (Netherlands)

Spassieva, S; Hille, J

Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

Directory of Open Access Journals (Sweden)

Jianrao HU, Mingfu CAO, Jiong Chen

2009-10-01

Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

Science.gov (United States)

Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

2018-05-15

The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is

Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

OpenAIRE

Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

2015-01-01

ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

Directory of Open Access Journals (Sweden)

Bart eGeurten

2012-03-01

Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

International Nuclear Information System (INIS)

Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

1997-01-01

Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

[Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

Science.gov (United States)

Xu, F; Liang, X; Lin, B; Su, F

1999-03-01

Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

Science.gov (United States)

Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

2015-12-01

Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

MetR and CRP bind to the Vibrio harveyi lux promoters and regulate luminescence.

Science.gov (United States)

Chatterjee, Jaidip; Miyamoto, Carol M; Zouzoulas, Athina; Lang, B Franz; Skouris, Nicolas; Meighen, Edward A

2002-10-01

The induction of luminescence in Vibrio harveyi at the later stages of growth is controlled by a quorum-sensing mechanism in addition to nutritional signals. However, the mechanism of transmission of these signals directly to the lux promoters is unknown and only one regulatory protein, LuxR, has been shown to bind directly to lux promoter DNA. In this report, we have cloned and sequenced two genes, crp and metR, coding for the nutritional regulators, CRP (cAMP receptor protein) and MetR (a LysR homologue), involved in catabolite repression and methionine biosynthesis respectively. The metR gene was cloned based on a general strategy to detect lux DNA-binding proteins expressed from a genomic library, whereas the crp gene was cloned based on its complementation of an Escherichia coli crp mutant. Both CRP and MetR were shown to bind to lux promoter DNA, with CRP being dependent on the presence of cAMP. Expression studies indicated that the two regulators had opposite effects on luminescence: CRP was an activator and MetR a repressor. Disruption of crp decreased luminescence by about 1,000-fold showing that CRP is a major activator of luminescence the same as LuxR, whereas disruption of MetR resulted in activation of luminescence over 10-fold, confirming its function as a repressor. Comparison of the levels of the autoinducers involved in quorum sensing excreted by V. harveyi, and the crp and metR mutants, showed that autoinducer production was not significantly different, thus indicating that the nutritional signals do not affect luminescence by changing the levels of the signals required for quorum sensing. Indeed, the large effects of these nutritional sensors show that luminescence is controlled by multiple signals related to the environment and the cell density which must be integrated at the molecular level to control expression at the lux promoters.

CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

Science.gov (United States)

The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

Science.gov (United States)

Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

2012-01-01

Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

Directory of Open Access Journals (Sweden)

Moore Landon L

2008-02-01

Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

NARCIS (Netherlands)

Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

2002-01-01

In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

NARCIS (Netherlands)

Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

2004-01-01

A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

International Nuclear Information System (INIS)

Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

1993-01-01

Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

The actin homologue MreB organizes the bacterial cell membrane.

Science.gov (United States)

Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

2014-03-07

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

Prediction by promoter logic in bacterial quorum sensing.

Directory of Open Access Journals (Sweden)

Navneet Rai

2012-01-01

Full Text Available Quorum-sensing systems mediate chemical communication between bacterial cells, coordinating cell-density-dependent processes like biofilm formation and virulence-factor expression. In the proteobacterial LuxI/LuxR quorum sensing paradigm, a signaling molecule generated by an enzyme (LuxI diffuses between cells and allosterically stimulates a transcriptional regulator (LuxR to activate its cognate promoter (pR. By expressing either LuxI or LuxR in positive feedback from pR, these versatile systems can generate smooth (monostable or abrupt (bistable density-dependent responses to suit the ecological context. Here we combine theory and experiment to demonstrate that the promoter logic of pR - its measured activity as a function of LuxI and LuxR levels - contains all the biochemical information required to quantitatively predict the responses of such feedback loops. The interplay of promoter logic with feedback topology underlies the versatility of the LuxI/LuxR paradigm: LuxR and LuxI positive-feedback systems show dramatically different responses, while a dual positive/negative-feedback system displays synchronized oscillations. These results highlight the dual utility of promoter logic: to probe microscopic parameters and predict macroscopic phenotype.

Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

Directory of Open Access Journals (Sweden)

Grauman Peter L

2007-07-01

Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

Science.gov (United States)

Nilsson, G.; Svensson, G.

2001-01-01

Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

Iron control of the Vibrio fischeri luminescence system in Escherichia coli.

Science.gov (United States)

Dunlap, P V

1992-01-01

Iron influences luminescence in Vibrio fischeri; cultures iron-restricted for growth rate induce luminescence at a lower optical density (OD) than faster growing, iron-replete cultures. An iron restriction effect analogous to that in V. fischeri (slower growth, induction of luminescence at a lower OD) was established using Escherichia coli tonB and tonB+ strains transformed with recombinant plasmids containing the V. fischeri lux genes (luxR luxICDABEG) and grown in the presence and absence of the iron chelator ethylenediamine-di(o-hydroxylphenyl acetic acid) (EDDHA). This permitted the mechanism of iron control of luminescence to be examined. A fur mutant and its parent strain containing the intact lux genes exhibited no difference in the OD at induction of luminescence. Therefore, an iron-binding repressor protein apparently is not involved in iron control of luminescence. Furthermore, in the tonB and in tonB+ strains containing lux plasmids with Mu dI(lacZ) fusions in luxR, levels of beta-galactosidase activity (expression from the luxR promoter) and luciferase activity (expression from the luxICDABEG promoter) both increased by a similar amount (8-9 fold each for tonB, 2-3 fold each for tonB+) in the presence of EDDHA. Similar results were obtained with the luxR gene present on a complementing plasmid. The previously identified regulatory factors that control the lux system (autoinducer-LuxR protein, cyclic AMP-cAMP receptor protein) differentially control expression from the luxR and luxICDABEG promoters, increasing expression from one while decreasing expression from the other. Consequently, these results suggest that the effect of iron on the V. fischeri luminescence system is indirect.

Isolation of a cotton NADP(H oxidase homologue induced by drought stress

Directory of Open Access Journals (Sweden)

NEPOMUCENO ALEXANDRE LIMA

2000-01-01

Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

Science.gov (United States)

Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

2017-01-01

Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

Science.gov (United States)

García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

2011-08-01

Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

Energy Technology Data Exchange (ETDEWEB)

Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

2012-08-21

DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

Expression and Quorum Sensing Regulation of Type III Secretion System Genes of Vibrio harveyi during Infection of Gnotobiotic Brine Shrimp.

Directory of Open Access Journals (Sweden)

H A Darshanee Ruwandeepika

Full Text Available Type III secretion systems enable pathogens to inject their virulence factors directly into the cytoplasm of the host cells. The type III secretion system of Vibrio harveyi, a major pathogen of aquatic organisms and a model species in quorum sensing studies, is repressed by the quorum sensing master regulator LuxR. In this study, we found that during infection of gnotobiotic brine shrimp larvae, the expression levels of three type III secretion operons in V. harveyi increased within the first 12h after challenge and decreased again thereafter. The in vivo expression levels were highest in a mutant with a quorum sensing system that is locked in low cell density configuration (minimal LuxR levels and lowest in a mutant with a quorum sensing system that is locked in the high cell density configuration (maximal LuxR levels, which is consistent with repression of type III secretion by LuxR. Remarkably, in vivo expression levels of the type III secretion system genes were much (> 1000 fold higher than the in vitro expression levels, indicating that (currently unknown host factors significantly induce the type III secretion system. Given the fact that type III secretion is energy-consuming, repression by the quorum sensing master regulators might be a mechanism to save energy under conditions where it does not provide an advantage to the cells.

Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

DEFF Research Database (Denmark)

Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

2010-01-01

The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

ExpI and PhzI are descendants of the long lost cognate signal synthase for SdiA.

Directory of Open Access Journals (Sweden)

Anice Sabag-Daigle

Full Text Available SdiA of E. coli and Salmonella is a LuxR homolog that detects N-acyl homoserine lactones (AHLs. Most LuxR homologs function together with a cognate AHL synthase (a LuxI homolog, but SdiA does not. Instead, SdiA detects AHLs produced by other bacterial species. In this report, we performed a phylogenetic analysis of SdiA. The results suggest that one branch of the Enterobacteriaceae obtained a rhlR/rhlI pair by horizontal transfer. The Erwinia and Pantoea branches still contain the complete pair where it is known as expR/expI and phzR/phzI, respectively. A deletion event removed the luxI homolog from the remainder of the group, leaving just the luxR homolog known as sdiA. Thus ExpR and PhzR are SdiA orthologs and ExpI and PhzI are descendants of the long lost cognate signal synthase of SdiA.

The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

Science.gov (United States)

Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

2001-08-01

The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

OpenAIRE

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

The urokinase receptor and its structural homologue C4.4A in human cancer

DEFF Research Database (Denmark)

Jacobsen, B; Ploug, M

2008-01-01

The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

Directory of Open Access Journals (Sweden)

Phelan Anne

2007-06-01

Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

International Nuclear Information System (INIS)

Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

2004-01-01

To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

Energy Technology Data Exchange (ETDEWEB)

Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

2011-12-31

The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

Science.gov (United States)

Górnaś, Paweł

2015-04-01

The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

Science.gov (United States)

Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

2003-05-01

Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

Directory of Open Access Journals (Sweden)

Goldman Gustavo H

2010-01-01

Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

Science.gov (United States)

Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

2005-08-01

The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

Science.gov (United States)

Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

2018-03-01

Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

Energy Technology Data Exchange (ETDEWEB)

Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

Directory of Open Access Journals (Sweden)

Wang Haiyang

2002-12-01

Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

Science.gov (United States)

Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

2017-10-02

The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

Science.gov (United States)

Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

1998-11-01

Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

Mechanism for iron control of the Vibrio fischeri luminescence system: involvement of cyclic AMP and cyclic AMP receptor protein and modulation of DNA level.

Science.gov (United States)

Dunlap, P V

1992-07-01

Iron controls luminescence in Vibrio fischeri by an indirect but undefined mechanism. To gain insight into that mechanism, the involvement of cyclic AMP (cAMP) and cAMP receptor protein (CRP) and of modulation of DNA levels in iron control of luminescence were examined in V. fischeri and in Escherichia coli containing the cloned V. fischeri lux genes on plasmids. For V. fischeri and E. coli adenylate cyclase (cya) and CRP (crp) mutants containing intact lux genes (luxR luxICDABEG), presence of the iron chelator ethylenediamine-di(o-hydroxyphenyl acetic acid) (EDDHA) increased expression of the luminescence system like in the parent strains only in the cya mutants in the presence of added cAMP. In the E. coli strains containing a plasmid with a Mu dl(lacZ) fusion in luxR, levels of beta-galactosidase activity (expression from the luxR promoter) and luciferase activity (expression from the lux operon promoter) were both 2-3-fold higher in the presence of EDDHA in the parent strain, and for the mutants this response to EDDHA was observed only in the cya mutant in the presence of added cAMP. Therefore, cAMP and CRP are required for the iron restriction effect on luminescence, and their involvement in iron control apparently is distinct from the known differential control of transcription from the luxR and luxICDABEG promoters by cAMP-CRP. Furthermore, plasmid and chromosomal DNA levels were higher in E. coli and V. fischeri in the presence of EDDHA. The higher DNA levels correlated with an increase in expression of chromosomally encoded beta-galactosidase in E. coli and with a higher level of autoinducer in cultures of V. fischeri. These results implicate cAMP-CRP and modulation of DNA levels in the mechanism of iron control of the V. fischeri luminescence system.

Exposure to static magnetic field stimulates quorum sensing circuit in luminescent Vibrio strains of the Harveyi clade.

Directory of Open Access Journals (Sweden)

Adelfia Talà

Full Text Available In this study, the evidence of electron-dense magnetic inclusions with polyhedral shape in the cytoplasm of Harveyi clade Vibrio strain PS1, a bioluminescent bacterium living in symbiosis with marine organisms, led us to investigate the behavior of this bacterium under exposure to static magnetic fields ranging between 20 and 2000 Gauss. When compared to sham-exposed, the light emission of magnetic field-exposed bacteria growing on solid medium at 18°C ±0.1°C was increased up to two-fold as a function of dose and growth phase. Stimulation of bioluminescence by magnetic field was more pronounced during the post-exponential growth and stationary phase, and was lost when bacteria were grown in the presence of the iron chelator deferoxamine, which caused disassembly of the magnetic inclusions suggesting their involvement in magnetic response. As in luminescent Vibrio spp. bioluminescence is regulated by quorum sensing, possible effects of magnetic field exposure on quorum sensing were investigated. Measurement of mRNA levels by reverse transcriptase real time-PCR demonstrated that luxR regulatory gene and luxCDABE operon coding for luciferase and fatty acid reductase complex were significantly up-regulated in magnetic field-exposed bacteria. In contrast, genes coding for a type III secretion system, whose expression was negatively affected by LuxR, were down-regulated. Up-regulation of luxR paralleled with down-regulation of small RNAs that mediate destabilization of luxR mRNA in quorum sensing signaling pathways. The results of experiments with the well-studied Vibrio campbellii strain BB120 (originally classified as Vibrio harveyi and derivative mutants unable to synthesize autoinducers suggest that the effects of magnetic fields on quorum sensing may be mediated by AI-2, the interspecies quorum sensing signal molecule.

Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

OpenAIRE

Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

1996-01-01

In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

Science.gov (United States)

Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

2017-06-01

This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

International Nuclear Information System (INIS)

Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

2013-01-01

We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

International Nuclear Information System (INIS)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

2005-01-01

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

Czech Academy of Sciences Publication Activity Database

Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

2012-01-01

Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

Biomolecular Mechanisms of Pseudomonas aeruginosa and Escherichia coli Biofilm Formation

Science.gov (United States)

Laverty, Garry; Gorman, Sean P.; Gilmore, Brendan F.

2014-01-01

Pseudomonas aeruginosa and Escherichia coli are the most prevalent Gram-negative biofilm forming medical device associated pathogens, particularly with respect to catheter associated urinary tract infections. In a similar manner to Gram-positive bacteria, Gram-negative biofilm formation is fundamentally determined by a series of steps outlined more fully in this review, namely adhesion, cellular aggregation, and the production of an extracellular polymeric matrix. More specifically this review will explore the biosynthesis and role of pili and flagella in Gram-negative adhesion and accumulation on surfaces in Pseudomonas aeruginosa and Escherichia coli. The process of biofilm maturation is compared and contrasted in both species, namely the production of the exopolysaccharides via the polysaccharide synthesis locus (Psl), pellicle Formation (Pel) and alginic acid synthesis in Pseudomonas aeruginosa, and UDP-4-amino-4-deoxy-l-arabinose and colonic acid synthesis in Escherichia coli. An emphasis is placed on the importance of the LuxR homologue sdiA; the luxS/autoinducer-II; an autoinducer-III/epinephrine/norepinephrine and indole mediated Quorum sensing systems in enabling Gram-negative bacteria to adapt to their environments. The majority of Gram-negative biofilms consist of polysaccharides of a simple sugar structure (either homo- or heteropolysaccharides) that provide an optimum environment for the survival and maturation of bacteria, allowing them to display increased resistance to antibiotics and predation. PMID:25438014

Biomolecular Mechanisms of Pseudomonas aeruginosa and Escherichia coli Biofilm Formation

Directory of Open Access Journals (Sweden)

Garry Laverty

2014-07-01

Full Text Available Pseudomonas aeruginosa and Escherichia coli are the most prevalent Gram-negative biofilm forming medical device associated pathogens, particularly with respect to catheter associated urinary tract infections. In a similar manner to Gram-positive bacteria, Gram-negative biofilm formation is fundamentally determined by a series of steps outlined more fully in this review, namely adhesion, cellular aggregation, and the production of an extracellular polymeric matrix. More specifically this review will explore the biosynthesis and role of pili and flagella in Gram-negative adhesion and accumulation on surfaces in Pseudomonas aeruginosa and Escherichia coli. The process of biofilm maturation is compared and contrasted in both species, namely the production of the exopolysaccharides via the polysaccharide synthesis locus (Psl, pellicle Formation (Pel and alginic acid synthesis in Pseudomonas aeruginosa, and UDP-4-amino-4-deoxy-l-arabinose and colonic acid synthesis in Escherichia coli. An emphasis is placed on the importance of the LuxR homologue sdiA; the luxS/autoinducer-II; an autoinducer-III/epinephrine/norepinephrine and indole mediated Quorum sensing systems in enabling Gram-negative bacteria to adapt to their environments. The majority of Gram-negative biofilms consist of polysaccharides of a simple sugar structure (either homo- or heteropolysaccharides that provide an optimum environment for the survival and maturation of bacteria, allowing them to display increased resistance to antibiotics and predation.

Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

International Nuclear Information System (INIS)

Singh, S.; Yamashita, A.; Gouaux, E.

2007-01-01

Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

Energy Technology Data Exchange (ETDEWEB)

Singh,S.; Yamashita, A.; Gouaux, E.

2007-01-01

Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

International Nuclear Information System (INIS)

Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

2005-01-01

We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

Science.gov (United States)

Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

2007-07-01

Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

Science.gov (United States)

Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

2016-01-01

We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

International Nuclear Information System (INIS)

Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

2005-01-01

In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

DEFF Research Database (Denmark)

Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

2010-01-01

The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

Energy Technology Data Exchange (ETDEWEB)

Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

2014-01-03

Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

Science.gov (United States)

Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

2011-01-01

High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

Science.gov (United States)

Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2011-11-01

Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

International Nuclear Information System (INIS)

Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

2006-01-01

Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

A mathematical model and quantitative comparison of the small RNA circuit in the Vibrio harveyi and Vibrio cholerae quorum sensing systems

International Nuclear Information System (INIS)

Hunter, G A M; Vasquez, F Guevara; Keener, J P

2013-01-01

Quorum sensing is the process by which bacteria regulate their gene expression based on the local cell-population density. The quorum sensing systems of Vibrio harveyi and Vibrio cholerae are comprised of a phosphorelay cascade coupled to a small RNA (sRNA) circuit. The sRNA circuit contains multiple quorum regulated small RNA (Qrr) that regulate expression of the homologous master transcriptional regulators LuxR (in V. harveyi) and HapR (in V. cholerae). Their quorum sensing systems are topologically similar and homologous thereby making it difficult to understand why repression of HapR is more robust than LuxR to changes in Qrr. In this work we formulate and parameterize a novel mathematical model of the V. harveyi and V. cholerae sRNA circuit. We parameterize the model by fitting it to a variety of empirical data from both species. We show that we can distinguish all of the parameters and that the parameterizations (one for each species) are robust to errors in the data. We then use our model to propose some experiments to identify and explain kinetic differences between the species. We find that V. cholerae Qrr are more abundant and more sensitive to changes in LuxO than V. harveyi Qrr and argue that this is why expression of HapR is more robust than LuxR to changes in Qrr. (paper)

Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

Science.gov (United States)

Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

2017-07-01

The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

Directory of Open Access Journals (Sweden)

Watanabe Haruo

2005-10-01

Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

Science.gov (United States)

Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

2013-05-10

Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

Octanoyl-Homoserine Lactone Is the Cognate Signal for Burkholderia mallei BmaR1-BmaI1 Quorum Sensing

National Research Council Canada - National Science Library

Duerkop, Breck A; Ulrich, Ricky L; Greenberg, E. P

2007-01-01

.... The obligate animal pathogen Burkholderia mallei produces several acyl-HSLs, and the B. mallei genome has four luxR and two luxI homologs, each of which has been established as a virulence factor...

Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

DEFF Research Database (Denmark)

Koch, Birgit; Nybroe, Ole

2006-01-01

A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

Science.gov (United States)

Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

2013-09-11

Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

Directory of Open Access Journals (Sweden)

Yanyan Lu

2018-04-01

Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

Science.gov (United States)

Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

2018-01-01

Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

Science.gov (United States)

Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

2014-01-01

Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

Science.gov (United States)

Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

2017-10-01

Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

Science.gov (United States)

Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

2014-01-01

A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

Science.gov (United States)

Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

2017-10-01

In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

Science.gov (United States)

Brown, N K; Harvey, D J

1988-04-01

Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

CERN Document Server

Neuhausen, J; Eichler, B

2004-01-01

The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

Science.gov (United States)

Yasuhara, Hiroki; Oe, Yuki

2011-07-01

TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

International Nuclear Information System (INIS)

Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

2007-01-01

RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

International Nuclear Information System (INIS)

Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

2005-01-01

Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

Light Exposure Assessment of Danish Indoor, outdoor and Night-Shift Workers

DEFF Research Database (Denmark)

Markvart, Jakob

2017-01-01

A research talk about: • The Lux@r project - The context of this talk • Light and light exposure - What When and Where • Light as a “one-dimensional unit” – things that matters: 1. Spectral sensitivity 2. Spatial sensitivity...

Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

Science.gov (United States)

Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

2013-01-01

Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

Directory of Open Access Journals (Sweden)

Shuai Wang

Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

Energy Technology Data Exchange (ETDEWEB)

Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

2013-11-29

Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

International Nuclear Information System (INIS)

Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

2013-01-01

Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

Discovery of a quorum sensing modulator pharmacophore by 3D small-molecule microarray screening

DEFF Research Database (Denmark)

Marsden, David M; Nicholson, Rebecca L; Skindersoe, Mette E

2010-01-01

ligand-binding domains of the LuxR homolog CarR from Erwinia carotovora subsp. carotovora. The 3D microarray platform was used to discover the biologically active chloro-pyridine pharmacophore, which was validated using a fluorometric ligand binding assay and ITC. Analogs containing the chloro...

Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

Science.gov (United States)

Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

2015-03-01

Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

International Nuclear Information System (INIS)

Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

2007-01-01

A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

Science.gov (United States)

Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

2015-12-01

The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

Science.gov (United States)

Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

2018-02-28

Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

International Nuclear Information System (INIS)

Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

2003-01-01

Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

Inhibitory role of acyl homoserine lactones in hemolytic activity and viability of Streptococcus pyogenes M6 S165.

Science.gov (United States)

Saroj, Sunil D; Holmer, Linda; Berengueras, Júlia M; Jonsson, Ann-Beth

2017-03-17

Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence.

Quorum sensing regulates the osmotic stress response in Vibrio harveyi.

Science.gov (United States)

van Kessel, Julia C; Rutherford, Steven T; Cong, Jian-Ping; Quinodoz, Sofia; Healy, James; Bassler, Bonnie L

2015-01-01

Bacteria use a chemical communication process called quorum sensing to monitor cell density and to alter behavior in response to fluctuations in population numbers. Previous studies with Vibrio harveyi have shown that LuxR, the master quorum-sensing regulator, activates and represses >600 genes. These include six genes that encode homologs of the Escherichia coli Bet and ProU systems for synthesis and transport, respectively, of glycine betaine, an osmoprotectant used during osmotic stress. Here we show that LuxR activates expression of the glycine betaine operon betIBA-proXWV, which enhances growth recovery under osmotic stress conditions. BetI, an autorepressor of the V. harveyi betIBA-proXWV operon, activates the expression of genes encoding regulatory small RNAs that control quorum-sensing transitions. Connecting quorum-sensing and glycine betaine pathways presumably enables V. harveyi to tune its execution of collective behaviors to its tolerance to stress. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

SimCP3—An Advanced Homologue of SimCP2 as a Solution-Processed Small Molecular Host Material for Blue Phosphorescence Organic Light-Emitting Diodes

Directory of Open Access Journals (Sweden)

Yi-Ting Lee

2016-09-01

Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.

Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

Directory of Open Access Journals (Sweden)

Teruo Umemoto

2012-03-01

Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

Switch of SpnR function from activating to inhibiting quorum sensing by its exogenous addition

International Nuclear Information System (INIS)

Takayama, Yuriko; Kato, Norihiro

2016-01-01

The opportunistic human pathogen Serratia marcescens AS-1 produces the N-hexanoylhomoserine lactone (C6HSL) receptor SpnR, a homologue of LuxR from Vibrio fischeri, which activates pig clusters to produce the antibacterial prodigiosin. In this study, we attempted to artificially regulate quorum sensing (QS) by changing the role of SpnR in N-acylhomoserine lactone (AHL)-mediated QS. SpnR was obtained as a fusion protein tagged with maltose-binding protein (MBP) from overexpression in Escherichia coli, and its specific affinity to C6HSL was demonstrated by quartz crystal microbalance analysis and AHL-bioassay with Chromobacterium violaceum CV026. Prodigiosin production was effectively inhibited by externally added MBP-SpnR in both wild-type AS-1 and the AHL synthase-defective mutant AS-1(ΔspnI). For the mutant, the induced amount of prodigiosin was drastically reduced to approximately 4% with the addition of 18 μM MBP-SpnR to the liquid medium, indicating 81% trapping of C6HSL. A system for inhibiting QS can be constructed by adding exogenous AHL receptor to the culture broth to keep the concentration of free AHL low, whereas intracellular SpnR naturally functions as the activator in response to QS. - Highlights: • Quorum sensing (QS) regulates the expression of some bacterial genes. • We added an AHL receptor to culture media to inhibit QS in Serratia marcescens AS-1. • The exogenous receptor effectively bound C6HSL and inhibited QS. • This approach can be used to artificially regulate AHL-mediated QS.

Switch of SpnR function from activating to inhibiting quorum sensing by its exogenous addition

Energy Technology Data Exchange (ETDEWEB)

Takayama, Yuriko [Department of Innovation Systems Engineering, Graduate School of Engineering, Utsunomiya University, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); CREST, Japan Science and Technology Agency, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); Kato, Norihiro, E-mail: katon@cc.utsunomiya-u.ac.jp [CREST, Japan Science and Technology Agency, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); Department of Material and Environmental Chemistry, Graduate School of Engineering, Utsunomiya University, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan)

2016-09-02

The opportunistic human pathogen Serratia marcescens AS-1 produces the N-hexanoylhomoserine lactone (C6HSL) receptor SpnR, a homologue of LuxR from Vibrio fischeri, which activates pig clusters to produce the antibacterial prodigiosin. In this study, we attempted to artificially regulate quorum sensing (QS) by changing the role of SpnR in N-acylhomoserine lactone (AHL)-mediated QS. SpnR was obtained as a fusion protein tagged with maltose-binding protein (MBP) from overexpression in Escherichia coli, and its specific affinity to C6HSL was demonstrated by quartz crystal microbalance analysis and AHL-bioassay with Chromobacterium violaceum CV026. Prodigiosin production was effectively inhibited by externally added MBP-SpnR in both wild-type AS-1 and the AHL synthase-defective mutant AS-1(ΔspnI). For the mutant, the induced amount of prodigiosin was drastically reduced to approximately 4% with the addition of 18 μM MBP-SpnR to the liquid medium, indicating 81% trapping of C6HSL. A system for inhibiting QS can be constructed by adding exogenous AHL receptor to the culture broth to keep the concentration of free AHL low, whereas intracellular SpnR naturally functions as the activator in response to QS. - Highlights: • Quorum sensing (QS) regulates the expression of some bacterial genes. • We added an AHL receptor to culture media to inhibit QS in Serratia marcescens AS-1. • The exogenous receptor effectively bound C6HSL and inhibited QS. • This approach can be used to artificially regulate AHL-mediated QS.

Saturation mutagenesis of a CepR binding site as a means to identify new quorum-regulated promoters in Burkholderia cenocepacia

Science.gov (United States)

Burkholderia cenocepacia, an opportunistic pathogen of humans, encodes the CepI and CepR proteins, which resemble the LuxI and LuxR quorum sensing proteins of Vibrio fischeri. CepI directs the synthesis of octanoylhomoserine lactone (OHL), while CepR is an OHL dependent transcription factor. In pr...

Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

Science.gov (United States)

Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

2018-01-11

Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

Directory of Open Access Journals (Sweden)

Aldo Nicosia

2018-01-01

Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

Science.gov (United States)

Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

2009-12-01

Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

Science.gov (United States)

Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

2014-10-01

Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

Institute of Scientific and Technical Information of China (English)

Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

2014-01-01

Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

International Nuclear Information System (INIS)

Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

2010-01-01

Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

DEFF Research Database (Denmark)

Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

2010-01-01

Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

International Nuclear Information System (INIS)

Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

2007-01-01

Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

Directory of Open Access Journals (Sweden)

McNeel Gordon Jantzen

2014-03-01

Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

Science.gov (United States)

Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

2011-02-25

Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

Energy Technology Data Exchange (ETDEWEB)

Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

2010-07-01

Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

Science.gov (United States)

Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

2000-04-01

The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

Science.gov (United States)

Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

2009-09-01

Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

KAUST Repository

He, Li-Sheng

2013-05-22

The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

KAUST Repository

He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

2013-01-01

The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

Science.gov (United States)

Bernhards, Yasmine; Pöggeler, Stefanie

2011-04-01

Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

Science.gov (United States)

Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

2015-10-01

To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

Science.gov (United States)

van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

1997-05-01

We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

Science.gov (United States)

Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

2017-08-01

Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

Science.gov (United States)

La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

2012-11-30

Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

Science.gov (United States)

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-10-15

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

Directory of Open Access Journals (Sweden)

Yeon Soo Han

2013-10-01

Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

Science.gov (United States)

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-01-01

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

Science.gov (United States)

Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

2013-12-01

Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

Etude par génétique inverse du gène codant la protéine TARGET OF RAPAMYCIN d'Arabidopsis thaliana (AtTOR), l'homologue d'une kinase contrôlant la croissance cellulaire chez les eucaryotes

OpenAIRE

Menand, Benoit

2002-01-01

TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...

Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

Directory of Open Access Journals (Sweden)

E Wyroba

2009-08-01

Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

Science.gov (United States)

Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

2008-02-01

The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

Directory of Open Access Journals (Sweden)

Srinivas Garlapati

2011-03-01

Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

Science.gov (United States)

Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

2017-01-01

The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

Directory of Open Access Journals (Sweden)

Nikola Kellner

2014-01-01

Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

Science.gov (United States)

Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

2017-11-01

Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

Energy Technology Data Exchange (ETDEWEB)

Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

2014-08-01

Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

Science.gov (United States)

Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

2015-07-30

Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

Science.gov (United States)

Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

2012-10-22

The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

Directory of Open Access Journals (Sweden)

Zhitao Qi

2015-01-01

Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

Directory of Open Access Journals (Sweden)

Miki Noda

2016-06-01

Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

Science.gov (United States)

Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

2010-01-01

The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

Global Analysis of the Burkholderia thailandensis Quorum Sensing-Controlled Regulon

OpenAIRE

Majerczyk, Charlotte; Brittnacher, Mitchell; Jacobs, Michael; Armour, Christopher D.; Radey, Mathew; Schneider, Emily; Phattarasokul, Somsak; Bunt, Richard; Greenberg, E. Peter

2014-01-01

Burkholderia thailandensis contains three acyl-homoserine lactone quorum sensing circuits and has two additional LuxR homologs. To identify B. thailandensis quorum sensing-controlled genes, we carried out transcriptome sequencing (RNA-seq) analyses of quorum sensing mutants and their parent. The analyses were grounded in the fact that we identified genes coding for factors shown previously to be regulated by quorum sensing among a larger set of quorum-controlled genes. We also found that gene...

The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

Directory of Open Access Journals (Sweden)

Markéta Kostrouchová

2017-06-01

Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

Directory of Open Access Journals (Sweden)

Livia C. T. Scorza

2017-02-01

Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes †

OpenAIRE

Lee, Kyu-Ho; Ruby, Edward G.

1992-01-01

Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both lu...

CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

DEFF Research Database (Denmark)

Madsen, Jens; Tornøe, Ida; Nielsen, Ole

2003-01-01

CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

Directory of Open Access Journals (Sweden)

Thomas Anne VT

2005-10-01

Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

Directory of Open Access Journals (Sweden)

Zengliang Ruan

Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

KAUST Repository

Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

2016-01-01

Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

KAUST Repository

Qiu, Jiaen

2016-06-23

Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

Science.gov (United States)

Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

2017-04-01

Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential.

Science.gov (United States)

Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A

2017-09-01

Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

International Nuclear Information System (INIS)

Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

1990-01-01

Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

Science.gov (United States)

Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

2012-01-01

Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

Science.gov (United States)

Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

1999-04-30

Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

Science.gov (United States)

Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

2012-04-01

The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Comparative analysis of the survival and gene expression of pathogenic strains Vibrio harveyi after starvation.

Science.gov (United States)

Sun, Jingjing; Gao, Xiaojian; Qun, Jiang; Du, Xuedi; Bi, Keran; Zhang, Xiaojun; Lin, Li

2016-11-01

This study aimed to evaluate the survival and gene expression of Vibrio harveyi under starvation conditions. The microcosms V. harveyi were incubated in sterilized seawater for 4 weeks at room temperature. Overall, the cell numeration declined rapidly about 10 3 CFU/ml during starvation, with a tiny rebound at day 21. Scanning electron microscopy revealed that rod-shaped cells became sphere with a rippled cell surface. By polymerase chain reaction (PCR) assay, nine genes, named luxR, toxR, vhhB, flaA, topA, fur, rpoS, mreB and ftsZ, were detected in the non-starved cells. In the starved cells, the expression levels of the detected genes declined substantially ranging from 0.005-fold to 0.028-fold compared to the non-starved cells performed by reverse transcription quantitative real-time PCR with 16S rRNA as the internal control. In the recovering cells, the expression levels of the detected genes, except luxR and mreB, were upregulated dramatically compared to the wild, especially topA (23.720-fold), fur (39.400-fold) and toxR (9.837-fold), validating that the expressions of both the metabolism and virulence genes were important for growth and survival of V. harveyi. The results may shed a new light on understanding of stress adaptation in bacteria. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China.

Science.gov (United States)

Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao

2017-08-01

In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

Science.gov (United States)

Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

2014-01-01

Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

Directory of Open Access Journals (Sweden)

John A Zebala

Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Pavol Mikoláš

Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

Brucella abortus: pathogenicity and gene regulation of virulence

Directory of Open Access Journals (Sweden)

Olga Rivas-Solano

2015-06-01

Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

PcaO Positively Regulates pcaHG of the β-Ketoadipate Pathway in Corynebacterium glutamicum▿

OpenAIRE

Zhao, Ke-Xin; Huang, Yan; Chen, Xi; Wang, Nan-Xi; Liu, Shuang-Jiang

2010-01-01

We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the β-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167ΔpcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by p...

Regulation of Long-Chain N-Acyl-Homoserine Lactones in Agrobacterium vitis

OpenAIRE

Hao, Guixia; Burr, Thomas J.

2006-01-01

Homologs of quorum-sensing luxR and luxI regulatory genes, avsR and avsI, were identified in Agrobacterium vitis strain F2/5. Compared to other LuxI proteins from related species, the deduced AvsI shows the greatest identity to SinI (71%) from Sinorhizobium meliloti Rm1021. AvsR possesses characteristic autoinducer binding and helix-turn-helix DNA binding domains and shares a high level of identity with SinR (38%) from Rm1021. Site-directed mutagenesis of avsR and avsI was performed, and both...

Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

Science.gov (United States)

Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

2015-09-01

Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

Directory of Open Access Journals (Sweden)

Hui Xu

2010-11-01

Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

Science.gov (United States)

Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

2010-11-01

MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

Science.gov (United States)

Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

2006-10-01

Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

Directory of Open Access Journals (Sweden)

Knüchel Ruth

2008-05-01

Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

Science.gov (United States)

Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

2008-01-01

The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

Science.gov (United States)

Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

2007-07-01

A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

Science.gov (United States)

Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

2013-01-01

PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

Directory of Open Access Journals (Sweden)

Adriano Senatore

Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

Directory of Open Access Journals (Sweden)

Aino L K Liukko

Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

Energy Technology Data Exchange (ETDEWEB)

McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.

1997-12-15

Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

Science.gov (United States)

Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

2016-01-01

Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

Autoinducers act as biological timers in Vibrio harveyi.

Science.gov (United States)

Anetzberger, Claudia; Reiger, Matthias; Fekete, Agnes; Schell, Ursula; Stambrau, Nina; Plener, Laure; Kopka, Joachim; Schmitt-Kopplin, Phillippe; Hilbi, Hubert; Jung, Kirsten

2012-01-01

Quorum sensing regulates cell density-dependent phenotypes and involves the synthesis, excretion and detection of so-called autoinducers. Vibrio harveyi strain ATCC BAA-1116 (recently reclassified as Vibrio campbellii), one of the best-characterized model organisms for the study of quorum sensing, produces and responds to three autoinducers. HAI-1, AI-2 and CAI-1 are recognized by different receptors, but all information is channeled into the same signaling cascade, which controls a specific set of genes. Here we examine temporal variations of availability and concentration of the three autoinducers in V. harveyi, and monitor the phenotypes they regulate, from the early exponential to the stationary growth phase in liquid culture. Specifically, the exponential growth phase is characterized by an increase in AI-2 and the induction of bioluminescence, while HAI-1 and CAI-1 are undetectable prior to the late exponential growth phase. CAI-1 activity reaches its maximum upon entry into stationary phase, while molar concentrations of AI-2 and HAI-1 become approximately equal. Similarly, autoinducer-dependent exoproteolytic activity increases at the transition into stationary phase. These findings are reflected in temporal alterations in expression of the luxR gene that encodes the master regulator LuxR, and of four autoinducer-regulated genes during growth. Moreover, in vitro phosphorylation assays reveal a tight correlation between the HAI-1/AI-2 ratio as input and levels of receptor-mediated phosphorylation of LuxU as output. Our study supports a model in which the combinations of autoinducers available, rather than cell density per se, determine the timing of various processes in V. harveyi populations.

Autoinducers act as biological timers in Vibrio harveyi.

Directory of Open Access Journals (Sweden)

Claudia Anetzberger

Full Text Available Quorum sensing regulates cell density-dependent phenotypes and involves the synthesis, excretion and detection of so-called autoinducers. Vibrio harveyi strain ATCC BAA-1116 (recently reclassified as Vibrio campbellii, one of the best-characterized model organisms for the study of quorum sensing, produces and responds to three autoinducers. HAI-1, AI-2 and CAI-1 are recognized by different receptors, but all information is channeled into the same signaling cascade, which controls a specific set of genes. Here we examine temporal variations of availability and concentration of the three autoinducers in V. harveyi, and monitor the phenotypes they regulate, from the early exponential to the stationary growth phase in liquid culture. Specifically, the exponential growth phase is characterized by an increase in AI-2 and the induction of bioluminescence, while HAI-1 and CAI-1 are undetectable prior to the late exponential growth phase. CAI-1 activity reaches its maximum upon entry into stationary phase, while molar concentrations of AI-2 and HAI-1 become approximately equal. Similarly, autoinducer-dependent exoproteolytic activity increases at the transition into stationary phase. These findings are reflected in temporal alterations in expression of the luxR gene that encodes the master regulator LuxR, and of four autoinducer-regulated genes during growth. Moreover, in vitro phosphorylation assays reveal a tight correlation between the HAI-1/AI-2 ratio as input and levels of receptor-mediated phosphorylation of LuxU as output. Our study supports a model in which the combinations of autoinducers available, rather than cell density per se, determine the timing of various processes in V. harveyi populations.

Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

Directory of Open Access Journals (Sweden)

Ling Nie

2016-01-01

Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

Directory of Open Access Journals (Sweden)

Aleksander F Sikorski

2007-01-01

Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

International Nuclear Information System (INIS)

Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

2005-01-01

E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

Fisetin up-regulates the expression of adiponectin in 3T3-L1 adipocytes via the activation of silent mating type information regulation 2 homologue 1 (SIRT1)-deacetylase and peroxisome proliferator-activated receptors (PPARs).

Science.gov (United States)

Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung

2014-10-29

Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.

Identification of potential genetic components involved in the deviant quorum-sensing signaling pathways of Burkholderia glumae through a functional genomics approach

Directory of Open Access Journals (Sweden)

Ruoxi eChen

2015-03-01

Full Text Available Burkholderia glumae is the chief causal agent for bacterial panicle blight of rice. The acyl-homoserine lactone (AHL-mediated quorum-sensing (QS system dependent on a pair of luxI and luxR homologs, tofI and tofR, is the primary cell-to-cell signaling mechanism determining the virulence of this bacterium. Production of toxoflavin, a major virulence factor of B. glumae, is known to be dependent on the tofI/tofR QS system. In our previous study, however, it was observed that B. glumae mutants defective in tofI or tofR produced toxoflavin if they grew on the surface of a solid medium, suggesting that alternative signaling pathways independent of tofI or tofR are activated in that growth condition for the production of toxoflavin. In this study, potential genetic components involved in the tofI- and tofR-independent signaling pathways for toxoflavin production were sought through screening random mini-Tn5 mutants of B. glumae to better understand the intercellular signaling pathways of this pathogen. Fifteen and three genes were initially identified as the potential genetic elements of the tofI- and tofR-independent pathways, respectively. Especially, the ORF (bglu_2g06320 divergently transcribed from toxJ, which encodes an orphan LuxR protein and controls toxoflavin biosynthesis, was newly identified in this study as a gene required for the tofR-independent toxoflavin production and named as toxK. Among those genes, flhD, dgcB, and wyzB were further studied to validate their functions in the tofI-independent toxoflavin production, and similar studies were also conducted with qsmR and toxK for their functions in the tofR-independent toxoflavin production. This work provides a foundation for future comprehensive studies of the intercellular signaling systems of B. glumae and other related pathogenic bacteria.

Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes.

Science.gov (United States)

Lee, K H; Ruby, E G

1992-03-01

Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples.

Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes †

Science.gov (United States)

Lee, Kyu-Ho; Ruby, Edward G.

1992-01-01

Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (≤1 to 3 CFU/100 ml). However, probe-positive colonies of V. fischeri (up to 900 CFU/100 ml) were found only in seawater collected from within the natural habitats of the squids. A number of criteria were used to confirm that these probe-positive strains were indistinguishable from symbiotic V. fischeri. Therefore, the luxA and luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples. Images PMID:16348678

Multiplicity of 3-Ketosteroid-9 alpha-Hydroxylase Enzymes in Rhodococcus rhodochrous DSM43269 for Specific Degradation of Different Classes of Steroids

OpenAIRE

Petrusma, Mirjan; Hessels, Gerda; Dijkhuizen, Lubbert; van der Geize, Robert

2011-01-01

The well-known large catabolic potential of rhodococci is greatly facilitated by an impressive gene multiplicity. This study reports on the multiplicity of kshA, encoding the oxygenase component of 3-ketosteroid 9 alpha-hydroxylase, a key enzyme in steroid catabolism. Five kshA homologues (kshA1 to kshA5) were previously identified in Rhodococcus rhodochrous DSM43269. These KshA(DSM43269) homologues are distributed over several phylogenetic groups. The involvement of these KshA homologues in ...

The crystal structure of (001) twinned xilingolite, Pb3Bi2S6, from Mittal-Hohtenn, Valais, Switzerland

DEFF Research Database (Denmark)

Berlepsch, Peter; Armbruster, Thomas; Makovicky, Emil

2002-01-01

geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland......geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland...

The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

Directory of Open Access Journals (Sweden)

Charnock F Mark L

2002-10-01

Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

Science.gov (United States)

Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

2003-10-01

In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pO160E1 LG_O03 ... 2.6 ... 10.1139/g01-082 11681610

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pN59E5 LG_O09 ... 2.7 ... 10.1139/g01-082 11681610

Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

Science.gov (United States)

Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

2015-07-01

Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

Influence of light, UV-B radiation, and herbicides on wax biosynthesis of cucumber seedlings

International Nuclear Information System (INIS)

Tevini, M.; Steinmüller, D.

1987-01-01

The behavior of cuticular alkane-1-ols and alkanes were studied in different developmental stages of cucumber seedlings grown in the dark or under white light, with or without UV-B radiation or in presence of wax biosynthesis inhibitors, trichloroacetic acid and metolachlor. Accumulation of alkane-1-ols increased light independently with seedling age. Synthesis of alkanes was strictly light and dose dependent. Addition of UV-B radiation did not alter the amounts of alkanes or alcohols, however, the distribution of homologues was shifted towards shorter chain homologues. Treatments with Cl 3 AcOH resulted in strong inhibition of alkane accumulation, whereas the amount of alkane-1-ols was changed neither at low nor at moderate concentrations of Cl 3 AcOH but their homologue distribution shifted towards longer chain lengths. This shifting was depressed in the presence of UV-B. At high concentrations of Cl 3 Ac0H similar homologue distributions as produced by UV-B (shift to shorter homologues) were observed. Metolachlor treatment resulted in an inhibition of alkane-1-ol production connected with rising amounts of alkanes, predominantly of short chain species. A simple model of wax biosynthesis is proposed which describes the interactions with white light, UV-B radiation and herbicides. (author)

How do individuals cope with stress? Behavioural, physiological and neuronal differences between proactive and reactive coping styles in fish

DEFF Research Database (Denmark)

Vindas, Marco A; Gorissen, Marnix; Höglund, Erik

2017-01-01

of the 5-HT1A receptor abundance) in the proposed amygdala homologue (Dm), increased expression of the neuroplasticity marker brain derived neurotropic factor (bdnf) in both Dl and Vv (lateral septum homologue), as well as increased expression of the corticotropin releasing factor 1 (crf1) receptor...

TRAP230/ARC240 and TRAP240/ARC250 Mediator subunits are functionally conserved through evolution

DEFF Research Database (Denmark)

Samuelsen, Camilla O; Baraznenok, Vera; Khorosjutina, Olga

2003-01-01

In Saccharomyces cerevisiae Mediator, a subgroup of proteins (Srb8, Srb9, Srb10, and Srb11) form a module, which is involved in negative regulation of transcription. Homologues of Srb10 and Srb11 are found in some mammalian Mediator preparations, whereas no clear homologues have been reported...... for Srb8 and Srb9. Here, we identify a TRAP240/ARC250 homologue in Schizosaccharomyces pombe and demonstrate that this protein, spTrap240, is stably associated with a larger form of Mediator, which also contains conserved homologues of Srb8, Srb10, and Srb11. We find that spTrap240 and Sch. pombe Srb8 (sp......Srb8) regulate the same distinct subset of genes and have indistinguishable phenotypic characteristics. Importantly, Mediator containing the spSrb8/spTrap240/spSrb10/spSrb11 subunits is isolated only in free form, devoid of RNA polymerase II. In contrast, Mediator lacking this module associates...

Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

Energy Technology Data Exchange (ETDEWEB)

Garcia, V.

2001-12-15

The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

Sex determination of baleen whale artefacts

DEFF Research Database (Denmark)

Sinding, Mikkel Holger Strander; Tervo, Outi M.; Grønnow, Bjarne

2016-01-01

to 4500 years old bowhead whale samples, and for comparison on dilution series from modern bowhead whales of known sex. DNA sequencing of PCR products obtained from the ancient material confirmed a higher proportion of successful PCR amplifications of the X homologue over the Y homologue. This potentially...

Molecular characterization and expression analysis of chloroplast protein import components in tomato (Solanum lycopersicum.

Directory of Open Access Journals (Sweden)

Jianmin Yan

Full Text Available The translocon at the outer envelope membrane of chloroplasts (Toc mediates the recognition and initial import into the organelle of thousands of nucleus-encoded proteins. These proteins are translated in the cytosol as precursor proteins with cleavable amino-terminal targeting sequences called transit peptides. The majority of the known Toc components that mediate chloroplast protein import were originally identified in pea, and more recently have been studied most extensively in Arabidopsis. With the completion of the tomato genome sequencing project, it is now possible to identify putative homologues of the chloroplast import components in tomato. In the work reported here, the Toc GTPase cDNAs from tomato were identified, cloned and analyzed. The analysis revealed that there are four Toc159 homologues (slToc159-1, -2, -3 and -4 and two Toc34 homologues (slToc34-1 and -2 in tomato, and it was shown that tomato Toc159 and Toc34 homologues share high sequence similarity with the comparable import apparatus components from Arabidopsis and pea. Thus, tomato is a valid model for further study of this system. The expression level of Toc complex components was also investigated in different tissues during tomato development. The two tomato Toc34 homologues are expressed at higher levels in non-photosynthetic tissues, whereas, the expression of two tomato Toc159 homologues, slToc159-1 and slToc159-4, were higher in photosynthetic tissues, and the expression patterns of slToc159-2 was not significantly different in photosynthetic and non-photosynthetic tissues, and slToc159-3 expression was limited to a few select tissues.

FK506 biosynthesis is regulated by two positive regulatory elements in Streptomyces tsukubaensis

Directory of Open Access Journals (Sweden)

Goranovič Dušan

2012-10-01

Full Text Available Abstract Background FK506 (Tacrolimus is an important immunosuppressant, produced by industrial biosynthetic processes using various Streptomyces species. Considering the complex structure of FK506, it is reasonable to expect complex regulatory networks controlling its biosynthesis. Regulatory elements, present in gene clusters can have a profound influence on the final yield of target product and can play an important role in development of industrial bioprocesses. Results Three putative regulatory elements, namely fkbR, belonging to the LysR-type family, fkbN, a large ATP-binding regulator of the LuxR family (LAL-type and allN, a homologue of AsnC family regulatory proteins, were identified in the FK506 gene cluster from Streptomyces tsukubaensis NRRL 18488, a progenitor of industrial strains used for production of FK506. Inactivation of fkbN caused a complete disruption of FK506 biosynthesis, while inactivation of fkbR resulted in about 80% reduction of FK506 yield. No functional role in the regulation of the FK506 gene cluster has been observed for the allN gene. Using RT-PCR and a reporter system based on a chalcone synthase rppA, we demonstrated, that in the wild type as well as in fkbN- and fkbR-inactivated strains, fkbR is transcribed in all stages of cultivation, even before the onset of FK506 production, whereas fkbN expression is initiated approximately with the initiation of FK506 production. Surprisingly, inactivation of fkbN (or fkbR does not abolish the transcription of the genes in the FK506 gene cluster in general, but may reduce expression of some of the tested biosynthetic genes. Finally, introduction of a second copy of the fkbR or fkbN genes under the control of the strong ermE* promoter into the wild type strain resulted in 30% and 55% of yield improvement, respectively. Conclusions Our results clearly demonstrate the positive regulatory role of fkbR and fkbN genes in FK506 biosynthesis in S. tsukubaensis NRRL 18488. We

The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.

Science.gov (United States)

Wang, Tao; Xiong, Jian-Qiong

2016-02-01

The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.

Fulltext PDF

Indian Academy of Sciences (India)

Madhu

The discovery of the. RNAi-based gene silencing process called meiotic silencing by unpaired DNA now provides an explana- tion for how normal sequence strains come to be selected. Meiotic silencing silences genes that are unpaired in meiosis, as well as their homologues, regardless of whether or not the homologues ...

Development of the Zebra Danio Model: Carcinogenesis and Gene Transfer Studies

Science.gov (United States)

1996-09-01

Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of...protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo

The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity.

Science.gov (United States)

Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y

2004-03-19

The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.

Contrastive Analysis of the Raman Spectra of Polychlorinated Benzene: Hexachlorobenzene and Benzene

Directory of Open Access Journals (Sweden)

Zhengjun Zhang

2011-12-01

Full Text Available Detection of persistent pollutants such as polychlorinated benzene in environment in trace amounts is challenging, but important. It is more difficult to distinguish homologues and isomers of organic pollutantd when present in trace amounts because of their similar physical and chemical properties. In this work we simulate the Raman spectra of hexachlorobenzene and benzene, and figure out the vibration mode of each main peak. The effect on the Raman spectrum of changing substituents from H to Cl is analyzed to reveal the relations between the Raman spectra of homologues and isomers of polychlorinated benzene, which should be helpful for distinguishing one kind of polychlorinated benzene from its homologues and isomers by surface enhanced Raman scattering.

Pollination induces autophagy in petunia petals via ethylene.

Science.gov (United States)

Shibuya, Kenichi; Niki, Tomoko; Ichimura, Kazuo

2013-02-01

Autophagy is one of the main mechanisms of degradation and remobilization of macromolecules, and it appears to play an important role in petal senescence. However, little is known about the regulatory mechanisms of autophagy in petal senescence. Autophagic processes were observed by electron microscopy and monodansylcadaverine staining of senescing petals of petunia (Petunia hybrida); autophagy-related gene 8 (ATG8) homologues were isolated from petunia and the regulation of expression was analysed. Nutrient remobilization was also examined during pollination-induced petal senescence. Active autophagic processes were observed in the mesophyll cells of senescing petunia petals. Pollination induced the expression of PhATG8 homologues and was accompanied by an increase in ethylene production. Ethylene inhibitor treatment in pollinated flowers delayed the induction of PhATG8 homologues, and ethylene treatment rapidly upregulated PhATG8 homologues in petunia petals. Dry weight and nitrogen content were decreased in the petals and increased in the ovaries after pollination in detached flowers. These results indicated that pollination induces autophagy and that ethylene is a key regulator of autophagy in petal senescence of petunia. The data also demonstrated the translocation of nutrients from the petals to the ovaries during pollination-induced petal senescence.

Characterization of the Pseudomonas aeruginosa Lol system as a lipoprotein sorting mechanism.

Science.gov (United States)

Tanaka, Shin-Ya; Narita, Shin-Ichiro; Tokuda, Hajime

2007-05-04

Escherichia coli lipoproteins are localized to either the inner or the outer membrane depending on the residue that is present next to the N-terminal acylated Cys. Asp at position 2 causes the retention of lipoproteins in the inner membrane. In contrast, the accompanying study (9) revealed that the residues at positions 3 and 4 determine the membrane specificity of lipoproteins in Pseudomonas aeruginosa. Since the five Lol proteins involved in the sorting of E. coli lipoproteins are conserved in P. aeruginosa, we examined whether or not the Lol proteins of P. aeruginosa are also involved in lipoprotein sorting but utilize different signals. The genes encoding LolCDE, LolA, and LolB homologues were cloned and expressed. The LolCDE homologue thus purified was reconstituted into proteoliposomes with lipoproteins. When incubated in the presence of ATP and a LolA homologue, the reconstituted LolCDE homologue released lipoproteins, leading to the formation of a LolA-lipoprotein complex. Lipoproteins were then incorporated into the outer membrane depending on a LolB homologue. As revealed in vivo, lipoproteins with Lys and Ser at positions 3 and 4, respectively, remained in proteoliposomes. On the other hand, E. coli LolCDE released lipoproteins with this signal and transferred them to LolA of not only E. coli but also P. aeruginosa. These results indicate that Lol proteins are responsible for the sorting of lipoproteins to the outer membrane of P. aeruginosa, as in the case of E. coli, but respond differently to inner membrane retention signals.

Molecular characterization of the thioredoxin system from Methanosarcina acetivorans

OpenAIRE

McCarver, Addison C.; Lessner, Daniel J.

2014-01-01

The thioredoxin system, composed of thioredoxin reductase (TrxR) and thioredoxin (Trx), is widely distributed in nature, where it serves key roles in electron transfer and in defense against oxidative stress. Although recent evidence reveals Trx homologues are almost universally present among the methane-producing archaea (methanogens), a complete thioredoxin system has not been characterized from any methanogen. We examined the phylogeny of Trx homologues among methanogens and characterized ...

Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

Science.gov (United States)

Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

2011-08-01

DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

Elucidating the Role of CaMKK in Cell Cycle and Cell Fate using a C. elegans model

Science.gov (United States)

2000-07-01

domain) or the Aspergillus homologue, anCaMKB (48% overall)(Figure 2). To functionally compare the C. elegans proteins with their mammalian homologues...subunit on the yeast proteome . EMBO J 18, 4157-68 (1999). 14 19. H. Tokumitsu et aL, Substrate recognition by Ca2+/Calmodulin-dependent protein kinase...2 Nicholas School of the Environment Duke University, Durham, NC 27710 Ethan@Duke.Edu In a variety of models, from Xenopus oocytes to Aspergillus to

Activity, Abundance, and Localization of Quorum Sensing Receptors in Vibrio harveyi.

Science.gov (United States)

Lorenz, Nicola; Shin, Jae Yen; Jung, Kirsten

2017-01-01

Quorum sensing (QS) is a process enabling a bacterial population to communicate via small molecules called autoinducers (AIs). This intercellular communication process allows single cells to synchronize their behavior within a population. The marine bacterium Vibrio harveyi ATCC BAA-1116 channels the information of three AI signals into one QS cascade. Three receptors perceive these AIs, the hybrid histidine kinases LuxN, Lux(P)Q and CqsS, to transduce the information to the histidine phosphotransfer (HPt) protein LuxU via phosphorelay, and finally to the response regulator LuxO. Hence, the level of phosphorylated LuxO depends on the AI concentrations. The phosphorylated LuxO (P-LuxO) controls the expression of small regulatory RNAs (sRNAs), which together with the RNA chaperon Hfq, destabilize the transcript of the master regulator luxR . LuxR is responsible for the induction and repression of several genes (e.g., for bioluminescence, exoprotease and siderophore production). In vivo studies with various mutants have demonstrated that the ratio between kinase and phosphatase activities of the individual QS receptors and therefore the P-LuxO/LuxO ratio is crucial not only for the output strength but also for the degree of noise. This study was undertaken to better understand the inherent design principles of this complex signaling cascade, which allows sensing and integration of different signals, but also the differentiated output in individual cells. Therefore, we quantitatively analyzed not only the enzymatic activities, but also the abundance and localization of the three QS receptors. We found that LuxN presents the highest capacity to phosphorylate LuxU, while the phosphatase activity was comparable to LuxQ and CqsS in vitro . In whole cells the copy number of LuxN was higher than that of LuxQ and CqsS, and further increased in the late exponential growth phase. Microscopy experiments indicate that LuxN and LuxQ form independent clusters. Altogether, these

A positive feedback-based gene circuit to increase the production of a membrane protein

Directory of Open Access Journals (Sweden)

Gennis Robert B

2010-05-01

Full Text Available Abstract Background Membrane proteins are an important class of proteins, playing a key role in many biological processes, and are a promising target in pharmaceutical development. However, membrane proteins are often difficult to produce in large quantities for the purpose of crystallographic or biochemical analyses. Results In this paper, we demonstrate that synthetic gene circuits designed specifically to overexpress certain genes can be applied to manipulate the expression kinetics of a model membrane protein, cytochrome bd quinol oxidase in E. coli, resulting in increased expression rates. The synthetic circuit involved is an engineered, autoinducer-independent variant of the lux operon activator LuxR from V. fischeri in an autoregulatory, positive feedback configuration. Conclusions Our proof-of-concept experiments indicate a statistically significant increase in the rate of production of the bd oxidase membrane protein. Synthetic gene networks provide a feasible solution for the problem of membrane protein production.

Comparing and contrasting Escherichia coli and Mycobacterium tuberculosis mechanosensitive channels (MscL) - New gain of function mutations in the loop region

OpenAIRE

Maurer, Joshua A.; Elmore, Donald E.; Lester, Henry A.; Dougherty, Dennis A.

2000-01-01

Sequence analysis of 35 putative MscL homologues was used to develop an optimal alignment for Escherichia coli and Mycobacterium tuberculosis MscL and to place these homologues into sequence subfamilies. By using this alignment, previously identified E. coli MscL mutants that displayed severe and very severe gain of function phenotypes were mapped onto the M. tuberculosis MscL sequence. Not all of the resulting M. tuberculosis mutants displayed a gain of function phenotype; for instance, norm...

Conserved chromosomal positions of dual domains of the ets protooncogene in cats, mice, and humans

International Nuclear Information System (INIS)

Watson, D.K.; McWilliams-Smith, M.J.; Kozak, C.

1986-01-01

The mammalian protooncogene homologue of the avian v-ets sequence from the E26 retrovirus consists of two sequentially distinct domains located on different chromosomes. Using somatic cell hybrid panels, the authors have mapped the mammalian homologue of the 5' v-ets-domain to chromosome 11 (ETS1) in man, to chromosome 9 (ets-1) in mouse, and to chromosome D1 (ETS1) in the domestic cat. The mammalian homologue of the 3' v-ets domain was similarly mapped to human chromosome 21 (ETS2), to mouse chromosome 16 (Ets-2), and to feline chromosome C2 (ETS2). Both protooncogenes fell in syntenic groups of homologous linked loci that were conserved among the three species. The occurrence of two distinct functional protooncogenes and their conservation of linkage positions in the three mammalian orders indicate that these two genes have been separate since before the evolutionary divergence of mammals

Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

Science.gov (United States)

Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

2018-01-01

ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

Nicolas Sarkozy a recu son homologue estonien

Index Scriptorium Estoniae

2008-01-01

Prantsusmaa president Nicolas Sarkozy pakkus 7. aprillil 2008 Elysée palees kohtumisel president Toomas Hendrik Ilvesega Eestile Prantsusmaa abi tuumaenergeetika küsimustes. Vabariigi President töövisiidil Pariisis 6.-8.04.2008

LBP/BPI homologue in Eisenia andrei earthworms

Czech Academy of Sciences Publication Activity Database

Škanta, František; Procházková, Petra; Roubalová, Radka; Dvořák, Jiří; Bilej, Martin

2016-01-01

Roč. 54, č. 1 (2016), s. 1-6 ISSN 0145-305X R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Earthworm * Eisenia * LBP/BPI Subject RIV: EC - Immunology Impact factor: 3.218, year: 2016

Transcriptome study of storage protein genes of field-grown barley in response to inorganic nitrogen fertilizers

DEFF Research Database (Denmark)

Hansen, Michael; Bowra, Steve; Lange, Mette

2010-01-01

The storage proteins of barley, in terms of both amino acid profile and quantity, are traits strongly influenced by the amount of nitrogen applied. Given this, we performed a developmental expression analysis of the genes from barley grains grown under field conditions to further our understanding...... profile under different N regimes. Reviewing the expression of the storage protein homologues within the families revealed markedly different temporal profiles; for example, some alleles were expressed very early in development. Furthermore, the differential temporal expression of the homologues suggested...

In human pseudouridine synthase 1 (hPus1), a C-terminal helical insert blocks tRNA from binding in the same orientation as in the Pus1 bacterial homologue TruA, consistent with their different target selectivities.

Science.gov (United States)

Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M

2013-10-23

Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.

Quorum-sensing-directed protein expression in Serratia proteamaculans B5a

DEFF Research Database (Denmark)

Christensen, Allan Beck; Riedel, Kathrin; Eberl, Leo

2003-01-01

N-Acyl-L-homoserine-lactone-producing Serratia species are frequently encountered in spoiling foods of vegetable and protein origin. The role of quorum sensing in the food spoiling properties of these bacteria is currently being investigated. A set of luxR luxI homologous genes encoding a putative...... quorum sensor was identified in the N-(3-oxo-hexanoyl)-L-homoserine lactone (3-oxo-C6-HSL)-producing Serratia proteamaculans strain B5a. The 3-oxo-C6-HSL synthase SprI showed 79% similarity with Esal from Pantoea stewartii and the putative regulatory protein SprR was 86% similar to the SpnR of Serratia...... marcescens. Proteome analysis suggested that the presence of at least 39 intracellular proteins was affected by the 3-oxo-C6-HSL-based quorum sensing system. The lipB-encoded secretion system was identified as one target gene of the quorum sensing system. LipB was required for the production of extracellular...

Artificially constructed quorum-sensing circuits are used for subtle control of bacterial population density.

Directory of Open Access Journals (Sweden)

Zhaoshou Wang

Full Text Available Vibrio fischeri is a typical quorum-sensing bacterium for which lux box, luxR, and luxI have been identified as the key elements involved in quorum sensing. To decode the quorum-sensing mechanism, an artificially constructed cell-cell communication system has been built. In brief, the system expresses several programmed cell-death BioBricks and quorum-sensing genes driven by the promoters lux pR and PlacO-1 in Escherichia coli cells. Their transformation and expression was confirmed by gel electrophoresis and sequencing. To evaluate its performance, viable cell numbers at various time periods were investigated. Our results showed that bacteria expressing killer proteins corresponding to ribosome binding site efficiency of 0.07, 0.3, 0.6, or 1.0 successfully sensed each other in a population-dependent manner and communicated with each other to subtly control their population density. This was also validated using a proposed simple mathematical model.

Protannotator: a semiautomated pipeline for chromosome-wise functional annotation of the "missing" human proteome.

Science.gov (United States)

Islam, Mohammad T; Garg, Gagan; Hancock, William S; Risk, Brian A; Baker, Mark S; Ranganathan, Shoba

2014-01-03

The chromosome-centric human proteome project (C-HPP) aims to define the complete set of proteins encoded in each human chromosome. The neXtProt database (September 2013) lists 20,128 proteins for the human proteome, of which 3831 human proteins (∼19%) are considered "missing" according to the standard metrics table (released September 27, 2013). In support of the C-HPP initiative, we have extended the annotation strategy developed for human chromosome 7 "missing" proteins into a semiautomated pipeline to functionally annotate the "missing" human proteome. This pipeline integrates a suite of bioinformatics analysis and annotation software tools to identify homologues and map putative functional signatures, gene ontology, and biochemical pathways. From sequential BLAST searches, we have primarily identified homologues from reviewed nonhuman mammalian proteins with protein evidence for 1271 (33.2%) "missing" proteins, followed by 703 (18.4%) homologues from reviewed nonhuman mammalian proteins and subsequently 564 (14.7%) homologues from reviewed human proteins. Functional annotations for 1945 (50.8%) "missing" proteins were also determined. To accelerate the identification of "missing" proteins from proteomics studies, we generated proteotypic peptides in silico. Matching these proteotypic peptides to ENCODE proteogenomic data resulted in proteomic evidence for 107 (2.8%) of the 3831 "missing proteins, while evidence from a recent membrane proteomic study supported the existence for another 15 "missing" proteins. The chromosome-wise functional annotation of all "missing" proteins is freely available to the scientific community through our web server (http://biolinfo.org/protannotator).

Induction of lethal mutations in the x-chromosome of unirradiated Drosophila oocytes after fertilization by irradiated spermatozoa

International Nuclear Information System (INIS)

Shaposhnikov, M.V.; Zainullin, V.G.

2003-01-01

Full text: In primary study on Drosophila it was found that irradiated male X-chromosomes induce recessive lethals in unirradiated female homologues (Abeleva et al., 1961, Radiobiologya. 1:123-126). The same effects were obtained in Drosophila in some recent investigations. The mechanisms of these effects is unknown. However it may be responsible for low-dose radiation effects as it induce mutations in unirradiated DNA. We assume that this effect may be a result of activation of error prone repair in response to preliminary DNA lesions in irradiated chromosome. In this research we analyse the frequencies of the recessive lethal mutations in the X-chromosome of Drosophila females mated with irradiated Basc males. We used acute irradiation with a dose rate of 10 Gy. For testing our hypothesis we use the mus209 and mei-41 mutant females. Mus209 is a PCNA gene homologue and mei-41 is a homologue of ATM gene. These genes are involved in post-replication DNA repair which may be error prone repair in Drosophila. It was obtained the tendency to decreasing the mutation rate at the mei-41[D5] background and decreasing mutation rate in mus209[B1] background in comparison with wild type strains CS (p<0.05). The obtained results demonstrate the possible role of mus209[B1] and mei-41[D5] genes in the inducing of mutations in the unirradiated X-chromosome in the presence of irradiated homologue

Synthesis and antimicrobial activity of long-chain 3,4-Epoxy-2-alkanones.

Science.gov (United States)

Wood, William F

2010-01-01

3,4-Epoxy-2-dodecanone, a major component in the preorbital gland of the African grey duiker (Sylvicapra grimmia), showed antimicrobial activity in preliminary tests. The C(11) to C(17) homologues of this compound were prepared and their activity against several pathogenic dermal bacteria and fungi was tested. 3,4-Epoxy-2-dodecanone and 3,4-epoxy-2-tridecanone inhibited the growth of Trichophyton mentagrophytes at 25 Îg/mL. Moderate inhibition of the growth of the bacteria Propionibacterium acnes and the lipophilic yeast, Pityrosporum ovale, was seen for several of the homologues.

Ca2+-dependent phospholipid scrambling by a reconstituted TMEM16 ion channel.

Science.gov (United States)

Malvezzi, Mattia; Chalat, Madhavan; Janjusevic, Radmila; Picollo, Alessandra; Terashima, Hiroyuki; Menon, Anant K; Accardi, Alessio

2013-01-01

Phospholipid (PL) scramblases disrupt the lipid asymmetry of the plasma membrane, externalizing phosphatidylserine to trigger blood coagulation and mark apoptotic cells. Recently, members of the TMEM16 family of Ca(2+)-gated channels have been shown to be involved in Ca(2+)-dependent scrambling. It is however controversial whether they are scramblases or channels regulating scrambling. Here we show that purified afTMEM16, from Aspergillus fumigatus, is a dual-function protein: it is a Ca(2+)-gated channel, with characteristics of other TMEM16 homologues, and a Ca(2+)-dependent scramblase, with the expected properties of mammalian PL scramblases. Remarkably, we find that a single Ca(2+) site regulates separate transmembrane pathways for ions and lipids. Two other purified TMEM16-channel homologues do not mediate scrambling, suggesting that the family diverged into channels and channel/scramblases. We propose that the spatial separation of the ion and lipid pathways underlies the evolutionary divergence of the TMEM16 family, and that other homologues, such as TMEM16F, might also be dual-function channel/scramblases.

Prokaryotic cells: structural organisation of the cytoskeleton and organelles

Directory of Open Access Journals (Sweden)

Wanderley de Souza

2012-05-01

Full Text Available For many years, prokaryotic cells were distinguished from eukaryotic cells based on the simplicity of their cytoplasm, in which the presence of organelles and cytoskeletal structures had not been discovered. Based on current knowledge, this review describes the complex components of the prokaryotic cell cytoskeleton, including (i tubulin homologues composed of FtsZ, BtuA, BtuB and several associated proteins, which play a fundamental role in cell division, (ii actin-like homologues, such as MreB and Mb1, which are involved in controlling cell width and cell length, and (iii intermediate filament homologues, including crescentin and CfpA, which localise on the concave side of a bacterium and along its inner curvature and associate with its membrane. Some prokaryotes exhibit specialised membrane-bound organelles in the cytoplasm, such as magnetosomes and acidocalcisomes, as well as protein complexes, such as carboxysomes. This review also examines recent data on the presence of nanotubes, which are structures that are well characterised in mammalian cells that allow direct contact and communication between cells.

Plant Wax n-Alkane and n-Alkanoic Acid Signatures Overprinted by Microbial Contributions and Old Carbon in Meromictic Lake Sediments

Science.gov (United States)

Makou, Matthew; Eglinton, Timothy; McIntyre, Cameron; Montluçon, Daniel; Antheaume, Ingrid; Grossi, Vincent

2018-01-01

Specific n-alkanes and n-alkanoic acids are commonly used as biomarkers in paleoenvironmental reconstruction, yet any individual homologue may originate from multiple biological sources. Here we improve source and age controls for these compounds in meromictic systems by measuring the radiocarbon (14C) ages of specific homologues preserved in twentieth century Lake Pavin (France) sediments. In contrast to many studies, 14C ages generally decreased with increasing carbon chain length, from 7.3 to 2.6 ka for the C14-C30 n-alkanoic acids and from 9.2 to 0.3 ka for the C21-C33 n-alkanes. Given a known hard water effect, these values suggest that aquatic microbial sources predominate and contributed to most of the homologues measured. Only the longest chain n-alkanes exclusively represent inputs of higher plant waxes, which were previously sequestered in soils over centennial to millennial timescales prior to transport and deposition. These findings suggest that biomarker source and age should be carefully established for lacustrine settings.

HPLC/ESI-quadrupole ion trap mass spectrometry for characterization and direct quantification of amphoteric and nonionic surfactants in aqueous samples

Science.gov (United States)

Levine, Lanfang H.; Garland, Jay L.; Johnson, Jodie V.

2002-01-01

An amphoteric (cocamidopropylbetaine, CAPB) and a nonionic (alcohol polyethoxylate, AE) surfactant were characterized by electrospray ionization quadrupole ion trap mass spectrometry (ESI-MS) as to their homologue distribution and ionization/fragmentation chemistry. Quantitative methods involving reversed-phase gradient HPLC and (+)ESI-MSn were developed to directly determine these surfactants in hydroponic plant growth medium that received simulated graywater. The predominant homologues, 12 C alkyl CAPB and 9 EO AE, were monitored to represent the total amount of the respective surfactants. The methods demonstrated dynamic linear ranges of 0.5-250 ng (r2 > 0.996) for CAPB and 8-560 ng (r2 > 0.998) for AE homologue mixture, corresponding to minimum quantification limits of 25 ppb CAPB and 0.4 ppm AE with 20-microL injections. This translated into an even lower limit for individual components due to the polydispersive nature of the surfactants. The procedure was successfully employed for the assessment of CAPB and AE biodegradation in a hydroponic plant growth system used as a graywater bioreactor.

4-alkyl-L-(Dehydro)proline biosynthesis in actinobacteria involves N-terminal nucleophile-hydrolase activity of γ-glutamyltranspeptidase homolog for C-C bond cleavage

Science.gov (United States)

Zhong, Guannan; Zhao, Qunfei; Zhang, Qinglin; Liu, Wen

2017-07-01

γ-Glutamyltranspeptidases (γ-GTs), ubiquitous in glutathione metabolism for γ-glutamyl transfer/hydrolysis, are N-terminal nucleophile (Ntn)-hydrolase fold proteins that share an autoproteolytic process for self-activation. γ-GT homologues are widely present in Gram-positive actinobacteria where their Ntn-hydrolase activities, however, are not involved in glutathione metabolism. Herein, we demonstrate that the formation of 4-Alkyl-L-(dehydro)proline (ALDP) residues, the non-proteinogenic α-amino acids that serve as vital components of many bioactive metabolites found in actinobacteria, involves unprecedented Ntn-hydrolase activity of γ-GT homologue for C-C bond cleavage. The related enzymes share a key Thr residue, which acts as an internal nucleophile for protein hydrolysis and then as a newly released N-terminal nucleophile for carboxylate side-chain processing likely through the generation of an oxalyl-Thr enzyme intermediate. These findings provide mechanistic insights into the biosynthesis of various ALDP residues/associated natural products, highlight the versatile functions of Ntn-hydrolase fold proteins, and particularly generate interest in thus far less-appreciated γ-GT homologues in actinobacteria.

Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine

International Nuclear Information System (INIS)

Kim, Moon-Jung; Lee, Byung Cheon; Hwang, Kwang Yeon; Gladyshev, Vadim N.; Kim, Hwa-Young

2015-01-01

Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. 75 Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K m than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue

Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine

Energy Technology Data Exchange (ETDEWEB)

Kim, Moon-Jung [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of); Lee, Byung Cheon [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Hwang, Kwang Yeon [Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Gladyshev, Vadim N. [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of)

2015-06-12

Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. {sup 75}Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K{sub m} than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue.

Profiling antibody responses to infections by Chlamydia abortus enables identification of potential virulence factors and candidates for serodiagnosis.

Directory of Open Access Journals (Sweden)

Vera Forsbach-Birk

Full Text Available Enzootic abortion of ewes (EAE due to infection with the obligate intracellular pathogen Chlamydia (C. abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP, CAB167 (homologue of the "translocated actin recruitment protein", TARP, CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF, CAB776 (homologue of the "Polymorphic membrane protein D", PmpD, and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.

Profiling antibody responses to infections by Chlamydia abortus enables identification of potential virulence factors and candidates for serodiagnosis.

Science.gov (United States)

Forsbach-Birk, Vera; Foddis, Corinna; Simnacher, Ulrike; Wilkat, Max; Longbottom, David; Walder, Gernot; Benesch, Christiane; Ganter, Martin; Sachse, Konrad; Essig, Andreas

2013-01-01

Enzootic abortion of ewes (EAE) due to infection with the obligate intracellular pathogen Chlamydia (C.) abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP), CAB167 (homologue of the "translocated actin recruitment protein", TARP), CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF), CAB776 (homologue of the "Polymorphic membrane protein D", PmpD), and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP) and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.

Profiling Antibody Responses to Infections by Chlamydia abortus Enables Identification of Potential Virulence Factors and Candidates for Serodiagnosis

Science.gov (United States)

Forsbach-Birk, Vera; Foddis, Corinna; Simnacher, Ulrike; Wilkat, Max; Longbottom, David; Walder, Gernot; Benesch, Christiane; Ganter, Martin; Sachse, Konrad; Essig, Andreas

2013-01-01

Enzootic abortion of ewes (EAE) due to infection with the obligate intracellular pathogen Chlamydia (C.) abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the “macrophage infectivity potentiator”, MIP), CAB167 (homologue of the “translocated actin recruitment protein”, TARP), CAB712 (homologue of the “chlamydial protease-like activity factor”, CPAF), CAB776 (homologue of the “Polymorphic membrane protein D”, PmpD), and the “hypothetical proteins” CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP) and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus. PMID:24260366

Contrasting behavior of heterochromatic and euchromatic chromosome portions and pericentric genome separation in pre-bouquet spermatocytes of hybrid mice.

Science.gov (United States)

Scherthan, Harry; Schöfisch, Karina; Dell, Thomas; Illner, Doris

2014-12-01

The spatial distribution of parental genomes has attracted much interest because intranuclear chromosome distribution can modulate the transcriptome of cells and influence the efficacy of meiotic homologue pairing. Pairing of parental chromosomes is imperative to sexual reproduction as it translates into homologue segregation and genome haploidization to counteract the genome doubling at fertilization. Differential FISH tagging of parental pericentromeric genome portions and specific painting of euchromatic chromosome arms in Mus musculus (MMU) × Mus spretus (MSP) hybrid spermatogenesis disclosed a phase of homotypic non-homologous pericentromere clustering that led to parental pericentric genome separation from the pre-leptoteneup to zygotene stages. Preferential clustering of MMU pericentromeres correlated with particular enrichment of epigenetic marks (H3K9me3), HP1-γ and structural maintenance of chromosomes SMC6 complex proteins at the MMU major satellite DNA repeats. In contrast to the separation of heterochromatic pericentric genome portions, the euchromatic arms of homeologous chromosomes showed considerable presynaptic pairing already during leptotene stage of all mice investigated. Pericentric genome separation was eventually disbanded by telomere clustering that concentrated both parental pericentric genome portions in a limited nuclear sector of the bouquet nucleus. Our data disclose the differential behavior of pericentromeric heterochromatin and the euchromatic portions of the parental genomes during homologue search. Homotypic pericentromere clustering early in prophase I may contribute to the exclusion of large repetitive DNA domains from homology search, while the telomere bouquet congregates and registers spatially separated portions of the genome to fuel synapsis initiation and high levels of homologue pairing, thus contributing to the fidelity of meiosis and reproduction.

The vacuolar channel VvALMT9 mediates malate and tartrate accumulation in berries of Vitis vinifera.

Science.gov (United States)

De Angeli, Alexis; Baetz, Ulrike; Francisco, Rita; Zhang, Jingbo; Chaves, Maria Manuela; Regalado, Ana

2013-08-01

Vitis vinifera L. represents an economically important fruit species. Grape and wine flavour is made from a complex set of compounds. The acidity of berries is a major parameter in determining grape berry quality for wine making and fruit consumption. Despite the importance of malic and tartaric acid (TA) storage and transport for grape berry acidity, no vacuolar transporter for malate or tartrate has been identified so far. Some members of the aluminium-activated malate transporter (ALMT) anion channel family from Arabidopsis thaliana have been shown to be involved in mediating malate fluxes across the tonoplast. Therefore, we hypothesised that a homologue of these channels could have a similar role in V. vinifera grape berries. We identified homologues of the Arabidopsis vacuolar anion channel AtALMT9 through a TBLASTX search on the V. vinifera genome database. We cloned the closest homologue of AtALMT9 from grape berry cDNA and designated it VvALMT9. The expression profile revealed that VvALMT9 is constitutively expressed in berry mesocarp tissue and that its transcription level increases during fruit maturation. Moreover, we found that VvALMT9 is targeted to the vacuolar membrane. Using patch-clamp analysis, we could show that, besides malate, VvALMT9 mediates tartrate currents which are higher than in its Arabidopsis homologue. In summary, in the present study we provide evidence that VvALMT9 is a vacuolar malate channel expressed in grape berries. Interestingly, in V. vinifera, a tartrate-producing plant, the permeability of the channel is apparently adjusted to TA.

Gel shift analysis of the empA promoter region in Vibrio anguillarum

Directory of Open Access Journals (Sweden)

Denkin Steven M

2004-10-01

Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

The contribution of Nth and Nei DNA glycosylases to mutagenesis in Mycobacterium smegmatis.

Science.gov (United States)

Moolla, Nabiela; Goosens, Vivianne J; Kana, Bavesh D; Gordhan, Bhavna G

2014-01-01

The increased prevalence of drug resistant strains of Mycobacterium tuberculosis (Mtb) indicates that significant mutagenesis occurs during tuberculosis disease in humans. DNA damage by host-derived reactive oxygen/nitrogen species is hypothesized to be critical for the mutagenic process in Mtb thus, highlighting an important role for DNA repair enzymes in maintenance of genome fidelity. Formamidopyrimidine (Fpg/MutM/Fapy) and EndonucleaseVIII (Nei) constitute the Fpg/Nei family of DNA glycosylases and together with EndonucleaseIII (Nth) are central to the base excision repair pathway in bacteria. In this study we assess the contribution of Nei and Nth DNA repair enzymes in Mycobacterium smegmatis (Msm), which retains a single nth homologue and duplications of the Fpg (fpg1 and fpg2) and Nei (nei1 and nei2) homologues. Using an Escherichia coli nth deletion mutant, we confirm the functionality of the mycobacterial nth gene in the base excision repair pathway. Msm mutants lacking nei1, nei2 and nth individually or in combination did not display aberrant growth in broth culture. Deletion of nth individually results in increased UV-induced mutagenesis and combinatorial deletion with the nei homologues results in reduced survival under oxidative stress conditions and an increase in spontaneous mutagenesis to rifampicin. Deletion of nth together with the fpg homolgues did not result in any growth/survival defects or changes in mutation rate. Furthermore, no differential emergence of the common rifampicin resistance conferring genotypes were noted. Collectively, these data confirm a role for Nth in base excision repair in mycobacteria and further highlight a novel interplay between the Nth and Nei homologues in spontaneous mutagenesis. Copyright © 2013 Elsevier B.V. All rights reserved.

The ZNF75 zinc finger gene subfamily: Isolation and mapping of the four members in humans and great apes

Energy Technology Data Exchange (ETDEWEB)

Villa, A.; Strina, D.; Frattini, A. [Consiglio Nazionale delle Ricerche, Milan (Italy)] [and others

1996-07-15

We have previously reported the characterization of the human ZNF75 gene located on Xq26, which has only limited homology (less than 65%) to other ZF genes in the databases. Here, we describe three human zinc finger genes with 86 to 95% homology to ZNF75 at the nucleotide level, which represent all the members of the human ZNF75 subfamily. One of these, ZNF75B, is a pseudogene mapped to chromosome 12q13. The other two, ZNF75A and ZNF75C, maintain on ORF in the sequenced region, and at least the latter is expressed in the U937 cell line. They were mapped to chromosomes 16 and 11, respectively. All these genes are conserved in chimpanzees, gorillas, and orangutans. The ZNF75B homologue is a pseudogene in all three great apes, and in chimpanzee it is located on chromosome 10 (phylogenetic XII), at p13 (corresponding to the human 12q13). The chimpanzee homologue of ZNF75 is also located on the Xq26 chromosome, in the same region, as detected by in situ hybridization. As expected, nucleotide changes were clearly more abundant between human and organutan than between human and chimpanzee or gorilla homologues. Members of the same class were more similar to each other than to the other homologues within the same species. This suggests that the duplication and/or retrotranscription events occurred in a common ancestor long before great ape speciation. This, together with the existance of at least two genes in cows and horses, suggests a relatively high conservation of this gene family. 20 refs., 5 figs., 1 tab.

Structure of a hexameric form of RadA recombinase from Methanococcus voltae

International Nuclear Information System (INIS)

Du, Liqin; Luo, Yu

2012-01-01

Hexameric rings of RadA recombinase from M. voltae have been crystallized. Structural comparisons suggest that homologues of RadA tend to form double-ringed assemblies. Archaeal RadA proteins are close homologues of eukaryal Rad51 and DMC1 proteins and are remote homologues of bacterial RecA proteins. For the repair of double-stranded breaks in DNA, these recombinases promote a pivotal strand-exchange reaction between homologous single-stranded and double-stranded DNA substrates. This DNA-repair function also plays a key role in the resistance of cancer cells to chemotherapy and radiotherapy and in the resistance of bacterial cells to antibiotics. A hexameric form of a truncated Methanococcus voltae RadA protein devoid of its small N-terminal domain has been crystallized. The RadA hexamers further assemble into two-ringed assemblies. Similar assemblies can be observed in the crystals of Pyrococcus furiosus RadA and Homo sapiens DMC1. In all of these two-ringed assemblies the DNA-interacting L1 region of each protomer points inward towards the centre, creating a highly positively charged locus. The electrostatic characteristics of the central channels can be utilized in the design of novel recombinase inhibitors

Impact of dechlorination processes on the sediment-water exchange of PCDD/F in Passaic river cores

Energy Technology Data Exchange (ETDEWEB)

Adriaens, P.; Khijniak, A. [Civil and Environmental Engineering, Univ. of Michigan, Ann Arbor (United States); Jones, K.; Green, N. [Environmental Science, Lancaster Univ. (United Kingdom); Gruden, C. [Univ. of Toledo, OH (United States)

2004-09-15

The potential for natural dechlorination processes in sediments to impact the biogeochemical cycling of dioxins and furans has been proposed as a possible mechanism to explain the prevalence of lesser halogenated dioxins and furans at the air-water interface. The hypothesis was supported by multiple lines of evidence, but has not been directly demonstrated. Field evidence indicated dynamic air-water exchange of PCDD/Fs in the Raritan Bay/Hudson River Estuary, whereby lesser chlorinated (predominantly diCDD/F) were present in the particle and apparent dissolved phase. Fugacity calculations indicated that the water column served as the source of these homologue groups. Laboratory evidence from Passaic River sediment cores and microbiallymediated dechlorination demonstrated that historic dioxins can undergo extensive dechlorination reactions, culminating in the formation of mono-and diCDD homologues. Similar pathways have been observed with PCDF, resulting in the accumulation of triCDF. The current paper reports on an investigation addressing the hypothesis of whether the lesser chlorinated PCDD/F observed at the air-water interface could be the result of selective dissolution of these congeners or homologues from sediments as they are produced during microbial dechlorination.

Polyoxyethylene Tallow Amine, a Glyphosate Formulation Adjuvant: Soil Adsorption Characteristics, Degradation Profile, and Occurrence on Selected Soils from Agricultural Fields in Iowa, Illinois, Indiana, Kansas, Mississippi, and Missouri.

Science.gov (United States)

Tush, Daniel; Meyer, Michael T

2016-06-07

Polyoxyethylene tallow amine (POEA) is an inert ingredient added to formulations of glyphosate, the most widely applied agricultural herbicide. POEA has been shown to have toxic effects to some aquatic organisms making the potential transport of POEA from the application site into the environment an important concern. This study characterized the adsorption of POEA to soils and assessed its occurrence and homologue distribution in agricultural soils from six states. Adsorption experiments of POEA to selected soils showed that POEA adsorbed much stronger than glyphosate; calcium chloride increased the binding of POEA; and the binding of POEA was stronger in low pH conditions. POEA was detected on a soil sample from an agricultural field near Lawrence, Kansas, but with a loss of homologues that contain alkenes. POEA was also detected on soil samples collected between February and early March from corn and soybean fields from ten different sites in five other states (Iowa, Illinois, Indiana, Missouri, Mississippi). This is the first study to characterize the adsorption of POEA to soil, the potential widespread occurrence of POEA on agricultural soils, and the persistence of the POEA homologues on agricultural soils into the following growing season.

Identification of VceA and VceC, two members of the VjbR regulon that are translocated into macrophages by the Brucella type IV secretion system

NARCIS (Netherlands)

de Jong, Maarten F.; Sun, Yao-Hui; den Hartigh, Andreas B.; van Dijl, Jan Maarten; Tsolis, Renee M.

2008-01-01

Survival and replication inside host cells by Brucella spp. requires a type IV secretion system (T4SS), encoded by the virB locus. However, the identity of the molecules secreted by the T4SS has remained elusive. We hypothesized that proteins translocated by the T4SS would be co-regulated with the

Evaluation of New Inorganic Scintillators for Application in a Prototype Small Animal PET Scanner

CERN Document Server

Kuntner, C

2003-01-01

In the study of new pharmaceuticals as well as brain and genetic research, Positron Emission Tomography (PET) is a useful method. It has also recently entered the clinical domain in cardiology and particularly in oncology. Small animals such as mice, are often used to validate sophisticated models of human disease. High spatial resolution PET instrumentation is therefore necessary due to the reduced dimensions of the organs. Inorganic scintillators are employed in most of the diagnostic imaging devices. The ultimate performance of the PET scanner is tightly bound to the scintillation properties of the crystals. In the last years there has been an effort to develop new scintillating materials characterized by high light output, high detection efficiency and fast decay time. The most studied systems are mainly Ce3+-doped crystals such as LSO:Ce, YAP:Ce, LuAP:Ce, and recently also mixed Lux(RE3+)1-xAlO3:Ce crystals. These crystals are very attractive for medical application because of their high density (with th...

Global Analysis of the Burkholderia thailandensis Quorum Sensing-Controlled Regulon

Science.gov (United States)

Majerczyk, Charlotte; Brittnacher, Mitchell; Jacobs, Michael; Armour, Christopher D.; Radey, Mathew; Schneider, Emily; Phattarasokul, Somsak; Bunt, Richard

2014-01-01

Burkholderia thailandensis contains three acyl-homoserine lactone quorum sensing circuits and has two additional LuxR homologs. To identify B. thailandensis quorum sensing-controlled genes, we carried out transcriptome sequencing (RNA-seq) analyses of quorum sensing mutants and their parent. The analyses were grounded in the fact that we identified genes coding for factors shown previously to be regulated by quorum sensing among a larger set of quorum-controlled genes. We also found that genes coding for contact-dependent inhibition were induced by quorum sensing and confirmed that specific quorum sensing mutants had a contact-dependent inhibition defect. Additional quorum-controlled genes included those for the production of numerous secondary metabolites, an uncharacterized exopolysaccharide, and a predicted chitin-binding protein. This study provides insights into the roles of the three quorum sensing circuits in the saprophytic lifestyle of B. thailandensis, and it provides a foundation on which to build an understanding of the roles of quorum sensing in the biology of B. thailandensis and the closely related pathogenic Burkholderia pseudomallei and Burkholderia mallei. PMID:24464461

Global analysis of the Burkholderia thailandensis quorum sensing-controlled regulon.

Science.gov (United States)

Majerczyk, Charlotte; Brittnacher, Mitchell; Jacobs, Michael; Armour, Christopher D; Radey, Mathew; Schneider, Emily; Phattarasokul, Somsak; Bunt, Richard; Greenberg, E Peter

2014-04-01

Burkholderia thailandensis contains three acyl-homoserine lactone quorum sensing circuits and has two additional LuxR homologs. To identify B. thailandensis quorum sensing-controlled genes, we carried out transcriptome sequencing (RNA-seq) analyses of quorum sensing mutants and their parent. The analyses were grounded in the fact that we identified genes coding for factors shown previously to be regulated by quorum sensing among a larger set of quorum-controlled genes. We also found that genes coding for contact-dependent inhibition were induced by quorum sensing and confirmed that specific quorum sensing mutants had a contact-dependent inhibition defect. Additional quorum-controlled genes included those for the production of numerous secondary metabolites, an uncharacterized exopolysaccharide, and a predicted chitin-binding protein. This study provides insights into the roles of the three quorum sensing circuits in the saprophytic lifestyle of B. thailandensis, and it provides a foundation on which to build an understanding of the roles of quorum sensing in the biology of B. thailandensis and the closely related pathogenic Burkholderia pseudomallei and Burkholderia mallei.

Mycobacterium smegmatis Ku binds DNA without free ends.

Science.gov (United States)

Kushwaha, Ambuj K; Grove, Anne

2013-12-01

Ku is central to the non-homologous end-joining pathway of double-strand-break repair in all three major domains of life, with eukaryotic homologues being associated with more diversified roles compared with prokaryotic and archaeal homologues. Ku has a conserved central 'ring-shaped' core domain. While prokaryotic homologues lack the N- and C-terminal domains that impart functional diversity to eukaryotic Ku, analyses of Ku from certain prokaryotes such as Pseudomonas aeruginosa and Mycobacterium smegmatis have revealed the presence of distinct C-terminal extensions that modulate DNA-binding properties. We report in the present paper that the lysine-rich C-terminal extension of M. smegmatis Ku contacts the core protein domain as evidenced by an increase in DNA-binding affinity and a decrease in thermal stability and intrinsic tryptophan fluorescence upon its deletion. Ku deleted for this C-terminus requires free DNA ends for binding, but translocates to internal DNA sites. In contrast, full-length Ku can directly bind DNA without free ends, suggesting that this property is conferred by its C-terminus. Such binding to internal DNA sites may facilitate recruitment to sites of DNA damage. The results of the present study also suggest that extensions beyond the shared core domain may have independently evolved to expand Ku function.

Br...Br and van der Waals interactions along a homologous series: crystal packing of 1,2-dibromo-4,5-dialkoxybenzenes.

Science.gov (United States)

Suarez, Sebastián A; Muller, Federico; Gutiérrez Suburu, Matías E; Fonrouge, Ana; Baggio, Ricardo F; Cukiernik, Fabio D

2016-10-01

The crystalline structures of four homologues of the 1,2-dibromo-4,5-dialkoxybenzene series [Br 2 C 6 H 2 (OC n H 2n + 1 ) 2 for n = 2, 12, 14 and 18] have been solved by means of single-crystal crystallography. Comparison along the series, including the previously reported n = 10 and n = 16 derivatives, shows a clear metric trend (b and c essentially fixed along the series and a growing linearly with n), in spite of some subtle differences in space groups and/or packing modes. A uniform packing pattern for the aliphatic chains has been found for the n = 12 to 18 homologues, which slightly differs from that of the n = 10 derivative. The crystalline structures of all the higher homologues (n = 10-18) seem to arise from van der Waals interchain interactions and, to a lesser extent, type II Br...Br interactions. The dominant role of interchain interactions provides direct structural support for the usual interpretation of melting point trends like that found along this series. Atoms in Molecules (AIM) analysis allows a comparison of the relative magnitude of the interchain and Br...Br interactions, an analysis validated by the measured melting enthalpies.

MODELING OF ALKYL SALICYLATE COMPOUNDS AS UV ABSORBER BASED ON ELECTRONIC TRANSITION BY USING SEMIEMPIRICAL QUANTUM MECHANICS ZINDO/s CALCULATION

Directory of Open Access Journals (Sweden)

Iqmal Tahir

2010-06-01

Full Text Available Modeling of several alkyl salicylates based on electronic transition by using semiempriical mechanical quantum ZINDO/s calculation has been done. Object of these research were assumed only alkyl salicylates of C4 (butyl until C8 (octyl homologue with 4-7 example structures of each homologue. All of the computation have been performed using quantum chemistry - package software Hyperchem 6.0. The research covered about drawing each of the structure, geometry optimization using semiempirical AM1 algorithm and followed with single point calculation using semiempirical ZINDO/s technique. ZINDO/s calculations used a defined criteria that is singly excited - Configuration Interaction (CI, gap of HOMO-LUMO energy transition was 2 and degeneracy level was 3. Analysis of the theoretical spectra was focused in the UV-B (290-320 nm and UV-C (200-290 nm area. The result showed that modeling of the compound can be used for predicting the type of UV protection activity depending with the electronic transition in the UV area. Modification of the alkyl homologue relatively did not change the value of wavelength absorbtion to indicate the UV protection activity. Alkyl salicylate compounds were predicted as UV-C sunscreen or relatively the compounds have protection effect for UV-C.   Keywords: alkyl salicylate, sunscreen, semiempirical methods

Effects of alkylresorcinols on volume and structure of yeast-leavened bread.

Science.gov (United States)

Andersson, Annica Am; Landberg, Rikard; Söderman, Thomas; Hedkvist, Sofie; Katina, Kati; Juvonen, Riikka; Holopainen, Ulla; Lehtinen, Pekka; Aman, Per

2011-01-30

Alkylresorcinols (AR) are amphiphilic phenolic compounds found in high amounts in wheat, durum wheat and rye, with different homologue composition for each cereal. The effect of different amounts of added AR from these cereals on bread volume, height, porosity and microstructure was studied. Breads with added rye bran (with high levels of AR) or acetone-extracted rye bran (with low levels of AR) were also baked, as well as breads with finely milled forms of each of these brans. Breads with high amounts of added AR, irrespective of AR homologue composition, had a lower volume, a more compact structure and an adverse microstructure compared with breads with no or low levels of added AR. AR were also shown to inhibit the activity of baker's yeast. There was no difference in bread volume and porosity between bread baked with rye bran and acetone-extracted rye bran or with brans of different particle size. Irrespective of homologue composition, AR had a negative effect on wheat bread properties when added in high amounts as purified extracts from wheat, durum wheat and rye. Natural levels of AR in rye bran, however, did not affect the volume and porosity of yeast-leavened wheat breads. 2010 Society of Chemical Industry.

Differential Expression of Histone H3.3 Genes and Their Role in Modulating Temperature Stress Response in Caenorhabditis elegans.

Science.gov (United States)

Delaney, Kamila; Mailler, Jonathan; Wenda, Joanna M; Gabus, Caroline; Steiner, Florian A

2018-04-10

Replication-independent variant histones replace canonical histones in nucleosomes and act as important regulators of chromatin function. H3.3 is a major variant of histone H3 that is remarkably conserved across all taxa and is distinguished from canonical H3 by just four key amino acids. Most genomes contain two or more genes expressing H3.3, and complete loss of the protein usually causes sterility or embryonic lethality. Here we investigated the developmental expression pattern of the five Caenorhabditis elegans H3.3 homologues and identified two previously uncharacterized homologues to be restricted to the germ line. We demonstrate an essential role for the conserved histone chaperone HIRA in the nucleosomal loading of all H3.3 variants. This requirement can be bypassed by mutation of the H3.3-specific residues to those found in H3. Analysis of H3.3 knockout mutants revealed a surprising absence of developmental phenotypes. While removal of all H3.3 homologues did not result in lethality, it led to reduced fertility and viability in response to high temperature stress. Our results thus show that H3.3 is non-essential in C. elegans , but is critical for ensuring adequate response to stress. Copyright © 2018, Genetics.

The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

LENUS (Irish Health Repository)

Thornton, Roibeard F

2010-04-23

Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.

A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

Directory of Open Access Journals (Sweden)

Hewitt Jane E

2010-11-01

Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

Directory of Open Access Journals (Sweden)

Kagawa Todd F

2010-04-01

Full Text Available Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.

Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

National Research Council Canada - National Science Library

Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

2004-01-01

.... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

Identification of Salp15 homologues in Ixodes ricinus ticks

NARCIS (Netherlands)

Hovius, J. W. R.; Ramamoorthi, N.; van't Veer, C.; de Groot, K. A.; Nijhof, A. M.; Jongejan, F.; van Dam, A. P.; Fikrig, E.

2007-01-01

The 15-kDa Ixodes scapularis salivary gland protein Salp15 protects Borrelia burgdorferi sensu stricto from antibody-mediated killing and facilitates infection of the mammalian host. In addition, Salp 15 has been shown to inhibit T-cell activation. We determined whether Ixodes ricinus, the major

Some Cholón discourse particles and Quechua homologues

NARCIS (Netherlands)

Alexander-Bakkerus, A.; Romero-Figueroa, A.

2011-01-01

Cholón belongs to a small language family. It was spoken in North Peru in the valley of the Huallaga River. Cholón is an agglutinative SOV language, and it has, amongst other things, some twenty interesting, suffixed discourse particles: adverbial markers, emphasis markers, exclamation markers,

Valerophenone synthase-like chalcone synthase homologues in Humulus lupulus

Czech Academy of Sciences Publication Activity Database

Novák, Petr; Matoušek, Jaroslav; Bříza, Jindřich

2003-01-01

Roč. 46, - (2003), s. 375-381 ISSN 0006-3134 R&D Projects: GA ČR GA521/99/1591 Institutional research plan: CEZ:AV0Z5051902 Keywords : plant genetic Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

Some studies on tar pillets at Veraval coast (Gujarat)

Digital Repository Service at National Institute of Oceanography (India)

Kadam, A.N.

Infrared spectroscopic (IR) analysis indicated that the tar pillets contain saturated hydrocarbons particularly higher homologues of n-paraffins, unsaturated and carbonyl type of polar compounds. Gas chromatographic (GLC) fingerprint pattern...

Virulence Effects and Signaling Partners Modulated by Brucella melitensis Light-sensing Histidine Kinase

Science.gov (United States)

Gourley, Christopher R.

The facultative intracellular pathogen Brucella melitensis utilizes diverse virulence factors. A Brucella light sensing histidine kinase can influence in vitro virulence of the bacteria during intracellular infection. First, we demonstrated that the B. melitensis light sensing kinase (BM-LOV-HK) affects virulence in an IRF-1-/- mouse model of infection. Infection with a Δ BM-LOV-HK strain resulted in less bacterial colonization of IRF-1-/- spleens and extended survivorship compared to mice infected with wild type B. melitensis 16M. Second, using PCR arrays, we observed less expression of innate and adaptive immune system activation markers in ΔBM-LOV-HK infected mouse spleens than wild type B. melitensis 16M infected mouse spleens 6 days after infection. Third, we demonstrated by microarray analysis of B. melitensis that deletion of BM-LOV-HK alters bacterial gene expression. Downregulation of genes involved in control of the general stress response system included the alternative sigma factor RpoE1 and its anti-anti sigma factor PhyR. Conversely, genes involved in flagella production, quorum sensing, and the type IV secretion system (VirB operon) were upregulated in the Δ BM-LOV-HK strain compared to the wild type B. melitensis 16M. Analysis of genes differentially regulated in Δ BM-LOV-HK versus the wild type strain indicated an overlap of 110 genes with data from previous quorum sensing regulator studies of Δ vjbR and/ΔblxR(babR) strains. Also, several predicted RpoE1 binding sites located upstream of genes were differentially regulated in the ΔBM-LOV-HK strain. Our results suggest BM-LOV-HK is important for in vivo Brucella virulence, and reveals that BM-LOV-HK directly or indirect regulates members of the Brucella quorum sensing, type IV secretion, and general stress systems.

Transcriptome analysis of the Brucella abortus BvrR/BvrS two-component regulatory system.

Directory of Open Access Journals (Sweden)

Cristina Viadas

Full Text Available BACKGROUND: The two-component BvrR/BvrS system is essential for Brucella abortus virulence. It was shown previously that its dysfunction alters the expression of some major outer membrane proteins and the pattern of lipid A acylation. To determine the genes regulated by BvrR/BvrS, we performed a whole-genome microarray analysis using B. abortus RNA obtained from wild type and bvrR mutant cells grown in the same conditions. METHODOLOGY/PRINCIPAL FINDINGS: A total of 127 differentially expressed genes were found: 83 were over expressed and 44 were less expressed in the bvrR mutant. Two operons, the phosphotransferase system and the maltose transport system, were down-regulated. Several genes involved in cell envelope or outer membrane biogenesis were differentially expressed: genes for outer membrane proteins (omp25a, omp25d, lipoproteins, LPS and fatty acid biosynthesis, stress response proteins, chaperones, flagellar genes, and twelve genes encoding ABC transport systems. Ten genes related with carbon metabolism (pckA and fumB among others were up-regulated in the bvrR mutant, and denitrification genes (nirK, norC and nosZ were also regulated. Notably, seven transcriptional regulators were affected, including VjbR, ExoR and OmpR that were less expressed in the bvrR mutant. Finally, the expression of eleven genes which have been previously related with Brucella virulence was also altered. CONCLUSIONS/SIGNIFICANCE: All these data corroborate the impact of BvrR/BvrS on cell envelope modulation, confirm that this system controls the carbon and nitrogen metabolism, and suggest a cross-talk among some regulators to adjust the Brucella physiology to the shift expected to occur during the transit from the extracellular to the intracellular niche.

The homodimeric GBS1074 from Streptococcus agalactiae

International Nuclear Information System (INIS)

Shukla, Anshuman; Pallen, Mark; Anthony, Mark; White, Scott A.

2010-01-01

The homodimeric nature of the ESAT-6 homologue GBS1074 and the potential for fibre-like assemblies are revealed by the 2 Å resolution crystal structure. ESAT-6 is a well characterized secreted protein from Mycobacterium tuberculosis and represents the archetype of the WXG100 family of proteins. Genes encoding ESAT-6 homologues have been identified in the genome of the human pathogen Streptococcus agalactiae; one of these genes, esxA, has been cloned and the recombinant protein has been crystallized. In contrast to M. tuberculosis ESAT-6, the crystal structure of GBS1074 reveals a homodimeric structure similar to homologous structures from Staphylococcus aureus and Helicobacter pylori. Intriguingly, GBS1074 forms elongated fibre-like assemblies in the crystal structure

A nucleator arms race: cellular control of actin assembly.

Science.gov (United States)

Campellone, Kenneth G; Welch, Matthew D

2010-04-01

For over a decade, the actin-related protein 2/3 (ARP2/3) complex, a handful of nucleation-promoting factors and formins were the only molecules known to directly nucleate actin filament formation de novo. However, the past several years have seen a surge in the discovery of mammalian proteins with roles in actin nucleation and dynamics. Newly recognized nucleation-promoting factors, such as WASP and SCAR homologue (WASH), WASP homologue associated with actin, membranes and microtubules (WHAMM), and junction-mediating regulatory protein (JMY), stimulate ARP2/3 activity at distinct cellular locations. Formin nucleators with additional biochemical and cellular activities have also been uncovered. Finally, the Spire, cordon-bleu and leiomodin nucleators have revealed new ways of overcoming the kinetic barriers to actin polymerization.

Viral Pseudo Enzymes Activate RIG-I via Deamidation to Evade Cytokine Production

Science.gov (United States)

He, Shanping; Zhao, Jun; Song, Shanshan; He, Xiaojing; Minassian, Arlet; Zhou, Yu; Zhang, Junjie; Brulois, Kevin; Wang, Yuqi; Cabo, Jackson; Zandi, Ebrahim; Liang, Chengyu; Jung, Jae U; Zhang, Xuewu; Feng, Pinghui

2015-01-01

SUMMARY RIG-I is a pattern recognition receptor that senses viral RNA and is crucial for host innate immune defense. Here we describe a mechanism of RIG-I activation through amidotransferase-mediated deamidation. We show that viral homologues of phosphoribosylformyglycinamide synthase (PFAS), although lacking intrinsic enzyme activity, recruit cellular PFAS to deamidate and activate RIG-I. Accordingly, depletion and biochemical inhibition of PFAS impair RIG-I deamidation and concomitant activation. Purified PFAS and viral homologue thereof deamidate RIG-I in vitro. Ultimately, herpesvirus hijacks activated RIG-I to avoid antiviral cytokine production; loss of RIG-I or inhibition of RIG-I deamidation results in elevated cytokine production. Together, these findings demonstrate a surprising mechanism of RIG-I activation that is mediated by an enzyme. PMID:25752576

Isolation and characterization of differentially expressed genes in ...

African Journals Online (AJOL)

USER

Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

Understanding sex determination in the mouse: genetics ...

Indian Academy of Sciences (India)

challenge now is to understand how controlled epigenomic changes effect the now familiar sexually dimorphic transcriptomic profiles of the ... Cattanach, personal communication, April 2015. .... The human homologue, DMRT1, is found on.

Liquid Phase Micro-Extraction of Linear Alkylbenzene Sulfonate Anionic Surfactants in Aqueous Samples

Directory of Open Access Journals (Sweden)

Jan Åke Jönsson

2011-10-01

Full Text Available Hollow fiber liquid phase micro-extraction (LPME of linear alkylbenzene sulfonates (LAS from aqueous samples was studied. Ion pair extraction of C10, C11, C12 and C13 homologues was facilitated with trihexylamine as ion-pairing agent, using di-n-hexylether as solvent for the supported liquid membrane (SLM. Effects of extraction time, acceptor buffer concentration, stirring speed, sample volume, NaCl and humic acids were studied. At 10–50 µg L−1 linear R2-coefficients were 0.99 for C10 and C11 and 0.96 for C12. RSD was typically ~15%. Three observations were especially made. Firstly, LPME for these analytes was unusually slow with maximum enrichment observed after 15–24 h (depending on sample volume. Secondly, the enrichment depended on LAS sample concentration with 35–150 times enrichment below ~150 µg L−1 and 1850–4400 times enrichment at 1 mg L−1. Thirdly, lower homologues were enriched more than higher homologues at low sample concentrations, with reversed conditions at higher concentrations. These observations may be due to the fact that LAS and the amine counter ion themselves influence the mass transfer at the water-SLM interface. The observations on LPME of LAS may aid in LPME application to other compounds with surfactant properties or in surfactant enhanced membrane extraction of other compounds.

The Bioconcentration and Degradation of Nonylphenol and Nonylphenol Polyethoxylates by Chlorella vulgaris

Directory of Open Access Journals (Sweden)

Hong-Wen Sun

2014-01-01

Full Text Available Nonylphenol polyethoxylates (NPnEOs, a major class of nonionic surfactants, can easily enter into aquatic environments through various pathways due to their wide applications, which leads to the extensive existence of their relative stable metabolites, namely nonylphenol (NP and mono- to tri-ethoxylates. This study investigated the bioconcentration and degradation of NP and NPnEO oligomers (n = 1–12 by a green algae, Chlorella vulgaris. Experimental results showed that C. vulgaris can remove NP from water phase efficiently, and bioconcentration and degradation accounted for approximately half of its loss, respectively, with a 48 h BCF (bioconcentration factor of 2.42 × 103. Moreover, C. vulgaris could concentrate and degrade NPnEOs, distribution profiles of the series homologues of the NPnEOs in algae and water phase were quite different from the initial homologue profile. The 48 h BCF of the NPnEO homologues increased with the length of the EO chain. Degradation extent of total NPnEOs by C. vulgaris was 95.7%, and only 1.1% remained in water phase, and the other 3.2% remained in the algal cells. The algae removed the NPnEOs mainly through degradation. Due to rapid degradation, concentrations of the long chain NPnEO homologous in both water (n ≥ 2 and the algal phase (n ≥ 5 was quite low at the end of a 48 h experiment.

Quantifying white matter structural integrity with high-definition fiber tracking in traumatic brain injury.

Science.gov (United States)

Presson, Nora; Krishnaswamy, Deepa; Wagener, Lauren; Bird, William; Jarbo, Kevin; Pathak, Sudhir; Puccio, Ava M; Borasso, Allison; Benso, Steven; Okonkwo, David O; Schneider, Walter

2015-03-01

There is an urgent, unmet demand for definitive biological diagnosis of traumatic brain injury (TBI) to pinpoint the location and extent of damage. We have developed High-Definition Fiber Tracking, a 3 T magnetic resonance imaging-based diffusion spectrum imaging and tractography analysis protocol, to quantify axonal injury in military and civilian TBI patients. A novel analytical methodology quantified white matter integrity in patients with TBI and healthy controls. Forty-one subjects (23 TBI, 18 controls) were scanned with the High-Definition Fiber Tracking diffusion spectrum imaging protocol. After reconstruction, segmentation was used to isolate bilateral hemisphere homologues of eight major tracts. Integrity of segmented tracts was estimated by calculating homologue correlation and tract coverage. Both groups showed high correlations for all tracts. TBI patients showed reduced homologue correlation and tract spread and increased outlier count (correlations>2.32 SD below control mean). On average, 6.5% of tracts in the TBI group were outliers with substantial variability among patients. Number and summed deviation of outlying tracts correlated with initial Glasgow Coma Scale score and 6-month Glasgow Outcome Scale-Extended score. The correlation metric used here can detect heterogeneous damage affecting a low proportion of tracts, presenting a potential mechanism for advancing TBI diagnosis. Reprint & Copyright © 2015 Association of Military Surgeons of the U.S.

Characterization of 3-Aminopropyl Oligosilsesquioxane.

Science.gov (United States)

Dimzon, Ian Ken D; Frömel, Tobias; Knepper, Thomas P

2016-05-03

The synthesis routes in the production of polysilsesquioxanes have largely relied upon in situ formations. This perspective often leads to polymers in which their basic structures including molecular weight and functionality are unknown [ Lichtenhan , J. D. ; et al. Silsesquioxane-siloxane copolymers from polyhedral silsesquioxanes Macromolecules , 1993 , 26 , 2141 - 2142 , http://dx.doi.org/10.1021/ma0060a053 ]. For a better understanding of the polysilsesquioxane properties and applications, there is a need to develop more techniques to enable their chemical characterization. An innovative method was developed to determine the molecular weight distribution (MWD) of an oligosilsesquioxane synthesized in-house from (3-aminopropyl)triethoxysilane. This method, which can be applied to other silsesquioxanes, siloxanes, and similar oligomers and polymers, involved separation using high performance liquid chromatography (HPLC) and detection using mass spectrometry (MS) with electrospray ionization (ESI). The novelty of the method lies on the unique determination of the absolute concentrations of the individual homologues present in the sample formulation. The use of absolute concentrations is necessary in estimating the MWD of the formulation when relative percentage, which is based solely on mass spectral ion intensities, becomes irrelevant due to the disproportionate response factors of the homologues. Determination of absolute concentration requires the use of single-homologue calibration standards. Because of commercial unavailability, these standards were prepared by efficient fractionation of the original formulation.

Reference: 306 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available of the endoreduplication cycle in Arabidopsis requires a plant homologue of archaeal DNA topoisomerase (topo) VI. To further understa...nd how DNA is endoreduplicated and how this process is r

Chlorinated paraffin analysis by gas chromatography Orbitrap high-resolution mass spectrometry: Method performance, investigation of possible interferences and analysis of fish samples.

Science.gov (United States)

Krätschmer, Kerstin; Cojocariu, Cristian; Schächtele, Alexander; Malisch, Rainer; Vetter, Walter

2018-03-02

For decades, high quantities of short-chain chlorinated paraffins (SCCP) and medium-chain chlorinated paraffins (MCCP) have been widely used, for instance as plasticizers or flame retardants, leading to global pollution due to unintentional emissions from products or waste. Due to the high complexity of chlorinated paraffins with several thousand congeners there is no consensus on an analytical procedure for SCCPs and MCCPs in food samples. Amongst the multitude of methods currently in use, high-resolution mass spectrometry is particularly valuable for in-depth studies of homologue patterns. Here we analyse SCCPs and MCCPs with gas chromatography coupled to high-resolution Orbitrap mass spectrometry (GC-Orbitrap-HRMS) operated in full-scan acquisition in electron capture negative ion (ECNI) mode at 60,000 and 120,000 resolution (FWHM, m/z 200, equals roughly 30,000 and 60,000 at 5% peak height). Linear dynamic range, selectivity and sensitivity tests confirmed an excellent linearity in a concentration range of 25-15,000 pg/μL with very low limits of detection (LODs) in the low pg/μL range. Spiking experiments with high levels of native mono- and di-ortho-polychlorinated biphenyls (PCBs) and mixtures of MCCP and SCCP standards did not have a negative impact on isotope ratios of the examined homologues. Besides the [M-Cl] - fragment ions used for quantification, the mass spectra of homologues also featured [M-HCl] - ions whose abundance increased with decreasing chlorination degree. In addition, [M-HCl-Cl] - ions were detected with a relative abundance of 5-10%. Three salmon (Salmo salar) samples farmed in Norway showed a consistent CP homologue pattern which differed both from the CP pattern in a sample from Scottish aquaculture and a wild salmon sample. These measurements produce evidence that discretely different CP patterns may exist in different areas of origin. Our results demonstrate that GC/ECNI-Orbitrap-HRMS is well-suited for the analysis of CPs by

Expressionof Drosophila FOXO regulates growth and can phenocopy starvation

Directory of Open Access Journals (Sweden)

Lockyer Joseph M

2003-07-01

Full Text Available Abstract Background Components of theinsulin signaling pathway are important regulators of growth. TheFOXO (forkhead box, sub-group "O" transcriptionfactors regulate cellular processes under conditions of low levelsof insulin signaling. Studies in mammalian cell culture show thatactivation of FOXO transcription factors causes cell death or cellcycle arrest. The Caenorhabiditis elegans homologue ofFOXO, Daf-16, is required for the formation of dauer larvae in responseto nutritional stress. In addition, FOXO factors have been implicatedin stress resistance and longevity. Results We have identifiedthe Drosophila melanogaster homologue of FOXO (dFOXO,which is conserved in amino acid sequence compared with the mammalianFOXO homologues and Daf-16. Expression of dFOXO during early larvaldevelopment causes inhibition of larval growth and alterations infeeding behavior. Inhibition of larval growth is reversible upondiscontinuation of dFOXO expression. Expression of dFOXO duringthe third larval instar or at low levels during development leadsto the generation of adults that are reduced in size. Analysis ofthe wings and eyes of these small flies indicates that the reductionin size is due to decreases in cell size and cell number. Overexpressionof dFOXO in the developing eye leads to a characteristic phenotypewith reductions in cell size and cell number. This phenotype canbe rescued by co-expression of upstream insulin signaling components,dPI3K and dAkt, however, this rescue is not seen when FOXO is mutatedto a constitutively active form. Conclusions dFOXO is conservedin both sequence and regulatory mechanisms when compared with otherFOXO homologues. The establishment of Drosophila as a model forthe study of FOXO transcription factors should prove beneficialto determining the biological role of these signaling molecules.The alterations in larval development seen upon overexpression ofdFOXO closely mimic the phenotypic effects of starvation, suggestinga

C7L family of poxvirus host range genes inhibits antiviral activities induced by type I interferons and interferon regulatory factor 1.

Science.gov (United States)

Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M; Xiang, Yan

2012-04-01

Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L(-)C7L(-)). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L(-)C7L(-) in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L(-)C7L(-) but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L(-)C7L(-) resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells.

Adenosine triphosphate stimulates Aquifex aeolicus MutL endonuclease activity.

Directory of Open Access Journals (Sweden)

Jerome Mauris

2009-09-01

Full Text Available Human PMS2 (hPMS2 homologues act to nick 5' and 3' to misincorporated nucleotides during mismatch repair in organisms that lack MutH. Mn(++ was previously found to stimulate the endonuclease activity of these homologues. ATP was required for the nicking activity of hPMS2 and yPMS1, but was reported to inhibit bacterial MutL proteins from Thermus thermophilus and Aquifex aeolicus that displayed homology to hPMS2. Mutational analysis has identified the DQHA(X(2E(X(4E motif present in the C-terminus of PMS2 homologues as important for endonuclease activity.We examined the effect ATP had on the Mn(++ induced nicking of supercoiled pBR322 by full-length and mutant A. aeolicus MutL (Aae MutL proteins. Assays were single time point, enzyme titration experiments or reaction time courses. The maximum velocity for MutL nicking was determined to be 1.6+/-0.08x10(-5 s(-1 and 4.2+/-0.3x10(-5 s(-1 in the absence and presence of ATP, respectively. AMPPNP stimulated the nicking activity to a similar extent as ATP. A truncated Aae MutL protein composed of only the C-terminal 123 amino acid residues was found to nick supercoiled DNA. Furthermore, mutations in the conserved C-terminal DQHA(X(2E(X(4E and CPHGRP motifs were shown to abolish Aae MutL endonuclease activity.ATP stimulated the Mn(++ induced endonuclease activity of Aae MutL. Experiments utilizing AMPPNP implied that the stimulation did not require ATP hydrolysis. A mutation in the DQHA(X(2E(X(4E motif of Aae MutL further supported the role of this region in endonclease activity. For the first time, to our knowledge, we demonstrate that changing the histidine residue in the conserved CPHGRP motif abolishes endonucleolytic activity of a hPMS2 homologue. Finally, the C-terminal 123 amino acid residues of Aae MutL were sufficient to display Mn(++ induced nicking activity.

Modelling of the Kinetics of Sulfure Compounds in Desulfurisation Processes Based on Industry Data of Plant

OpenAIRE

Krivtsova, Nadezhda Igorevna; Tataurshikov, A.; Kotkova, Elena

2016-01-01

Modelling of sulfur compounds kinetics was performed, including kinetics of benzothiophene and dibenzothiophene homologues. Modelling is based on experimental data obtained from monitoring of industrial hydrotreating set. Obtained results include kinetic parameters of reactions.

Expedient construction of small molecule macroarrays via sequential palladium- and copper-mediated reactions and their ex situ biological testing.

Science.gov (United States)

Frei, Reto; Breitbach, Anthony S; Blackwell, Helen E

2012-05-01

We report the highly efficient syntheses of a series of focused libraries in the small molecule macroarray format using Suzuki-Miyaura and copper-catalyzed azide-alkyne cycloaddition (or "click") reactions. The libraries were based on stilbene and triazole scaffolds, which are known to have a broad range of biological activities, including quorum-sensing (QS) modulation in bacteria. The library products were generated in parallel on the macroarray in extremely short reaction times (~10-20 min) and isolated in excellent purities. Biological testing of one macroarray library post-cleavage (ex situ) revealed several potent agonists of the QS receptor, LuxR, in Vibrio fischeri. These synthetic agonists, in contrast to others that we have reported, were only active in the presence of the native QS signal in V. fischeri, which is suggestive of a different mode of activity. Notably, the results presented herein showcase the ready compatibility of the macroarray platform with chemical reactions that are commonly utilized in small molecule probe and drug discovery today. As such, this work serves to expand the utility of the small molecule macroarray as a rapid and operationally straightforward approach toward the synthesis and screening of bioactive agents.

A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics.

Science.gov (United States)

Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L

2015-01-15

Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response. Copyright © 2015 Elsevier Inc. All rights reserved.

A common variation of the PTEN gene is associated with peripheral insulin resistance

DEFF Research Database (Denmark)

Grinder-Hansen, L; Ribel-Madsen, R; Wojtaszewski, Jørgen

2016-01-01

. RESULTS: The minor G allele of PTEN rs11202614 was associated with elevated fasting plasma insulin levels and a decreased peripheral glucose disposal rate, but not with the hepatic insulin resistance index or insulin secretion measured as the first-phase insulin response and disposition index. The single...... nucleotide polymorphism was not associated with either PI3K or Akt activities. CONCLUSION: A common PTEN variation is associated with peripheral insulin resistance and subsequent risk of developing T2D. However, the association with insulin resistance is not explained by decreased proximal insulin signalling......AIM: Phosphatase and tensin homologue (PTEN) reduces insulin sensitivity by inhibiting the phosphatidylinositol 3-kinase (PI3K)/v-akt murine thymoma viral oncogene homologue (Akt) pathway. This study investigated how a common single nucleotide polymorphism near PTEN, previously associated...

Structural and cell adhesion properties of zebrafish syndecan-4 are shared with higher vertebrates

DEFF Research Database (Denmark)

Whiteford, James; Ko, Sunggeon; Lee, Weontae

2008-01-01

, but no molecular and cellular studies have been reported. Here it is demonstrated that key functional attributes of syndecan-4 are common to both zebrafish and mammalian homologues. These include glycosaminoglycan substitution, a NXIP motif in the extracellular domain that promotes integrin-mediated cell adhesion......The syndecan proteoglycans are an ancient class of receptor, bearing heparan sulfate chains that interact with numerous potential ligands including growth factors, morphogens, and extracellular matrix molecules. The single syndecan of invertebrates appears not to have cell adhesion roles......, but these have been described for mammalian paralogues, especially syndecan-4. This member is best understood in terms of interactions, signaling, and structure of its cytoplasmic domain. The zebrafish homologue of syndecan-4 has been genetically linked to cell adhesion and migration in zebrafish embryos...

A telencephalospinal projection in the Tegu lizard (Tupinambis teguixin).

Science.gov (United States)

Follett, K A

1989-09-04

Tegu lizards (Tupinambis teguixin) were studied to determine the presence of a homologue of the mammalian corticospinal tract. The sources of telencephalic efferent projections to the spinal cord were determined by evaluating the localization of retrogradely transported horseradish peroxidase applied in the cervical spinal cord. Labeled cells were present in subtelencephalic sites reported previously by other authors and, in addition, were found in the principal sensory and motor nuclei of the trigeminal nerve and in the nucleus of the posterior commissure. A telencephalospinal projection was identified, originating in the ventral caudal telencephalon. Histochemical staining revealed a high concentration of acetylcholinesterase in cells and neuropil in the same area. This tract is suggested to be homologous to the mammalian amygdalospinal tract. No reptilian homologue of the corticospinal tract was identified.

DeepLoc: prediction of protein subcellular localization using deep learning

DEFF Research Database (Denmark)

Almagro Armenteros, Jose Juan; Sønderby, Casper Kaae; Sønderby, Søren Kaae

2017-01-01

The prediction of eukaryotic protein subcellular localization is a well-studied topic in bioinformatics due to its relevance in proteomics research. Many machine learning methods have been successfully applied in this task, but in most of them, predictions rely on annotation of homologues from...... knowledge databases. For novel proteins where no annotated homologues exist, and for predicting the effects of sequence variants, it is desirable to have methods for predicting protein properties from sequence information only. Here, we present a prediction algorithm using deep neural networks to predict...... current state-of-the-art algorithms, including those relying on homology information. The method is available as a web server at http://www.cbs.dtu.dk/services/DeepLoc . Example code is available at https://github.com/JJAlmagro/subcellular_localization . The dataset is available at http...

Vernalization response of Phleum pratense and its relationships to stem lignification and floral transition

DEFF Research Database (Denmark)

Seppänen, Mervi M; Pakarinen, Kirsi; Jokela, Venla

2010-01-01

Background Timothy is a long-day grass species well adapted for cultivation in northern latitudes. It produces elongating tillers not only in spring growth but also later in summer. As the quantity and quality of harvested biomass is dictated by canopy architecture and the proportion of stem......-forming flowering tillers, the regulation of flowering is of great interest in forage grass production. Methods Canopy architecture, stem morphology and freezing tolerance of vernalized timothy were investigated in greenhouse and field experiments. The molecular control of development was examined by analysing......, however, divergent morphology. Vernalization enhanced flowering, and the expression of the VRN1 homologue was elevated when the apex had passed into the reproductive stage. High VRN1 homologue expression was not associated with reduction in freezing tolerance and the expression coincided with increased...

Fulltext PDF

Indian Academy of Sciences (India)

Prakash

hetC homologue in the genome of P. syringae by analysing the genome sequence of ... 1994 Vegetative incompatibility in Neurospora – its effect on horizontal transfer of mitochondrial plasmids and senescence in natural populations; Curr.

Extracellular Matrix Regulations of Membrane Type 1 - Matrix Metalloproteinasis (MT1-MMP) and Matrix Metalloproteinase-2 (MMP-2) in Human Breast Fibroblasts

National Research Council Canada - National Science Library

Harnandez-Barrantes, Sonia

2001-01-01

.... Thus, under certain conditions, TIMP-2 is a positive regulator of MMP activity. TIMP-4, a close homologue of TIMP-2 also binds to pro-MMP- 2 and can potentially participate in pro-MMP-2 activation...

A Novel Tyrosine Kinase Expressed in Breast Tumors

National Research Council Canada - National Science Library

Tyner, Angela

1999-01-01

.... Sik interacts with Sam68 through both its SH3 and SH2 domains. Transfected Sik and Sam68 colocalize to the nucleoplasm of nontransformed NMuMG mammary epithelial cells, while the human homologue of Sik (BRK...

Modelling of the Kinetics of Sulfure Compounds in Desulfurisation Processes Based on Industry Data of Plant

Directory of Open Access Journals (Sweden)

Krivtcova Nadezhda

2016-01-01

Full Text Available Modelling of sulfur compounds kinetics was performed, including kinetics of benzothiophene and dibenzothiophene homologues. Modelling is based on experimental data obtained from monitoring of industrial hydrotreating set. Obtained results include kinetic parameters of reactions.

阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

Institute of Scientific and Technical Information of China (English)

傅玉才; 章家新; 郑晓虹; 刘红

2004-01-01

Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with ＞ 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(＞60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆�

Short-chain chlorinated paraffins in terrestrial bird species inhabiting an e-waste recycling site in South China

International Nuclear Information System (INIS)

Luo, Xiao-Jun; Sun, Yu-Xin; Wu, Jiang-Ping; Chen, She-Jun; Mai, Bi-Xian

2015-01-01

Short-chain chlorinated paraffins (SCCPs) are under review by the Stockholm Convention on Persistent Organic Pollutants. Currently, limited data are available about SCCPs in terrestrial organisms. In the present study, SCCP concentration in the muscles of seven terrestrial bird species (n = 38) inhabiting an e-waste recycling area in South China was determined. This concentration varied from 620 to 17,000 ng/g lipid. Resident birds accumulated significantly higher SCCP concentrations than migratory birds (p < 0.01). Trophic magnification was observed for migratory bird species but not for resident, which was attributed to high heterogeneity of SCCP in e-waste area. Two different homologue group patterns were observed in avian samples. The first pattern was found in five bird species dominated by C 10 and C 11 congeners, while the second was found in the remains, which show rather equal abundance of homologue groups. This may be caused by two sources of SCCPs (local and e-waste) in the study area. - Highlights: • SCCPs in terrestrial bird species from an e-waste area are first reported. • Elevated SCCP level was found as compared with other regions. • Resident birds accumulated significantly higher SCCP levels than migratory birds. • Trophic magnification was observed for migratory but not for resident bird species. • Two homologue patterns were found among seven bird species. - SCCP concentration in terrestrial bird species inhabiting an e-waste site was first reported in this study

Anionic lipids and the cytoskeletal proteins MreB and RodZ define the spatio-temporal distribution and function of membrane stress controller PspA in Escherichia coli.

Science.gov (United States)

Jovanovic, Goran; Mehta, Parul; Ying, Liming; Buck, Martin

2014-11-01

All cell types must maintain the integrity of their membranes. The conserved bacterial membrane-associated protein PspA is a major effector acting upon extracytoplasmic stress and is implicated in protection of the inner membrane of pathogens, formation of biofilms and multi-drug-resistant persister cells. PspA and its homologues in Gram-positive bacteria and archaea protect the cell envelope whilst also supporting thylakoid biogenesis in cyanobacteria and higher plants. In enterobacteria, PspA is a dual function protein negatively regulating the Psp system in the absence of stress and acting as an effector of membrane integrity upon stress. We show that in Escherichia coli the low-order oligomeric PspA regulatory complex associates with cardiolipin-rich, curved polar inner membrane regions. There, cardiolipin and the flotillin 1 homologue YqiK support the PspBC sensors in transducing a membrane stress signal to the PspA-PspF inhibitory complex. After stress perception, PspA high-order oligomeric effector complexes initially assemble in polar membrane regions. Subsequently, the discrete spatial distribution and dynamics of PspA effector(s) in lateral membrane regions depend on the actin homologue MreB and the peptidoglycan machinery protein RodZ. The consequences of loss of cytoplasmic membrane anionic lipids, MreB, RodZ and/or YqiK suggest that the mode of action of the PspA effector is closely associated with cell envelope organization. © 2014 The Authors.

Identification and expression analysis of CYS-A1, CYS-C1, NIT4 genes in rice seedlings exposed to cyanide.

Science.gov (United States)

Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong

2017-09-01

Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.

Evolutionary conservation of plant gibberellin signalling pathway components

Directory of Open Access Journals (Sweden)

Reski Ralf

2007-11-01

Full Text Available Abstract Background: Gibberellins (GA are plant hormones that can regulate germination, elongation growth, and sex determination. They ubiquitously occur in seed plants. The discovery of gibberellin receptors, together with advances in understanding the function of key components of GA signalling in Arabidopsis and rice, reveal a fairly short GA signal transduction route. The pathway essentially consists of GID1 gibberellin receptors that interact with F-box proteins, which in turn regulate degradation of downstream DELLA proteins, suppressors of GA-controlled responses. Results: Arabidopsis sequences of the gibberellin signalling compounds were used to screen databases from a variety of plants, including protists, for homologues, providing indications for the degree of conservation of the pathway. The pathway as such appears completely absent in protists, the moss Physcomitrella patens shares only a limited homology with the Arabidopsis proteins, thus lacking essential characteristics of the classical GA signalling pathway, while the lycophyte Selaginella moellendorffii contains a possible ortholog for each component. The occurrence of classical GA responses can as yet not be linked with the presence of homologues of the signalling pathway. Alignments and display in neighbour joining trees of the GA signalling components confirm the close relationship of gymnosperms, monocotyledonous and dicotyledonous plants, as suggested from previous studies. Conclusion: Homologues of the GA-signalling pathway were mainly found in vascular plants. The GA signalling system may have its evolutionary molecular onset in Physcomitrella patens, where GAs at higher concentrations affect gravitropism and elongation growth.

Concentrations of tocols and γ-oryzanol compounds in rice bran oil obtained by fractional extraction with supercritical carbon dioxide.

Science.gov (United States)

Yoon, Sung Won; Pyo, Young-Gil; Lee, Junsoo; Lee, Jeom-Sig; Kim, Byung Hee; Kim, In-Hwan

2014-01-01

Rice bran oil (RBO) is a good source of several commercially important bioactive phytochemicals, such as tocols (i.e. tocopherols and tocotrienols) and ferulic esters of sterols (i.e. γ-oryzanol). The aims of the present study were to examine the effects of different pressure and temperature combinations on the fractional extraction of RBO using supercritical carbon dioxide (SC-CO2) and to assess the levels of tocols homologues and γ-oryzanol components in the resulting oil fractions. Fractional extraction of rice bran oil was performed using SC-CO2 at either 27.6 or 41.4 MPa and either 40 or 60°C. The effects of the four different pressure and temperature combinations on the levels of seven tocols homologues (α-, β-, γ- and δ-tocopherol and α-, γ- and δ-tocotrienol) and the four major components of γ-oryzanol in the resulting oil fractions were investigated. Superior extraction efficiency was obtained using the higher pressure of 41.4 MPa. The tocols (particularly α-tocopherol and α-tocotrienol) were recovered early in the extraction process, while the γ-oryzanol compounds were obtained in the later stages. With regard to SC-CO2 extraction, tocols are more soluble than γ-oryzanol components, α-tocopherol is the most soluble of the tocols and the four γ-oryzanol components all have similar solubilities. Valuable data on solubilities of tocols homologues in SC-CO2 were provided from present study.

Bacillus licheniformis Contains Two More PerR-Like Proteins in Addition to PerR, Fur, and Zur Orthologues.

Directory of Open Access Journals (Sweden)

Jung-Hoon Kim

Full Text Available The ferric uptake regulator (Fur family proteins include sensors of Fe (Fur, Zn (Zur, and peroxide (PerR. Among Fur family proteins, Fur and Zur are ubiquitous in most prokaryotic organisms, whereas PerR exists mainly in Gram positive bacteria as a functional homologue of OxyR. Gram positive bacteria such as Bacillus subtilis, Listeria monocytogenes and Staphylococcus aureus encode three Fur family proteins: Fur, Zur, and PerR. In this study, we identified five Fur family proteins from B. licheniformis: two novel PerR-like proteins (BL00690 and BL00950 in addition to Fur (BL05249, Zur (BL03703, and PerR (BL00075 homologues. Our data indicate that all of the five B. licheniformis Fur homologues contain a structural Zn2+ site composed of four cysteine residues like many other Fur family proteins. Furthermore, we provide evidence that the PerR-like proteins (BL00690 and BL00950 as well as PerRBL (BL00075, but not FurBL (BL05249 and ZurBL (BL03703, can sense H2O2 by histidine oxidation with different sensitivity. We also show that PerR2 (BL00690 has a PerR-like repressor activity for PerR-regulated genes in vivo. Taken together, our results suggest that B. licheniformis contains three PerR subfamily proteins which can sense H2O2 by histidine oxidation not by cysteine oxidation, in addition to Fur and Zur.

Bacillus licheniformis Contains Two More PerR-Like Proteins in Addition to PerR, Fur, and Zur Orthologues

Science.gov (United States)

Ju, Shin-Yeong; Yang, Yoon-Mo; Ryu, Su-Hyun; Kwon, Yumi; Won, Young-Bin; Lee, Yeh-Eun; Youn, Hwan; Lee, Jin-Won

2016-01-01

The ferric uptake regulator (Fur) family proteins include sensors of Fe (Fur), Zn (Zur), and peroxide (PerR). Among Fur family proteins, Fur and Zur are ubiquitous in most prokaryotic organisms, whereas PerR exists mainly in Gram positive bacteria as a functional homologue of OxyR. Gram positive bacteria such as Bacillus subtilis, Listeria monocytogenes and Staphylococcus aureus encode three Fur family proteins: Fur, Zur, and PerR. In this study, we identified five Fur family proteins from B. licheniformis: two novel PerR-like proteins (BL00690 and BL00950) in addition to Fur (BL05249), Zur (BL03703), and PerR (BL00075) homologues. Our data indicate that all of the five B. licheniformis Fur homologues contain a structural Zn2+ site composed of four cysteine residues like many other Fur family proteins. Furthermore, we provide evidence that the PerR-like proteins (BL00690 and BL00950) as well as PerRBL (BL00075), but not FurBL (BL05249) and ZurBL (BL03703), can sense H2O2 by histidine oxidation with different sensitivity. We also show that PerR2 (BL00690) has a PerR-like repressor activity for PerR-regulated genes in vivo. Taken together, our results suggest that B. licheniformis contains three PerR subfamily proteins which can sense H2O2 by histidine oxidation not by cysteine oxidation, in addition to Fur and Zur. PMID:27176811

VIP and its homologous increase vascular conductance in certain endocrine and exocrine glands

International Nuclear Information System (INIS)

Huffman, L.J.; Connors, J.M.; Hedge, G.A.

1988-01-01

The effects of vasoactive intestinal peptide (VIP) and related structural homologues on tissue vascular conductances were investigated in anesthetized male rats. VIP, peptide histidine isoleucine (PHI), secretin, growth hormone-releasing factor (GHRF), gastric inhibitory peptide (GIP), or saline was infused intravenously over 4 min. Tissue blood flows were measured during this time by use of 141 Ce-labeled microspheres. Circulating thyrotropin (TSH), triiodothyronine (T 3 ), and thyroxine (T 4 ) levels were determined before and at 20 min and 2 h after treatment. Marked increases in thyroid, pancreatic, and salivary gland vascular Cs occurred during peptide infusion with the order of potency correlating with the degree of structural homology to VIP. PHI and secretin produced maximal increases in vascular Cs, which were the same as those obtained with VIP. Circulating TSH, T 3 , and T 4 levels were not different from values in saline-infused rats after peptide treatments that caused striking increases in thyroid vascular C. These observations indicate that the vascular beds of certain endocrine and exocrine glands are responsive to the vasodilatory action of VIP and related homologues with the order of potency corresponding to the degree of structural homology to VIP. These results are also consistent with the proposal that structural homologues of VIP act at the same vascular receptor as VIP. Alternative, the involvement of different vascular receptors, acting through the same mechanism at a level beyond the receptor site, cannot be excluded

Quantitative determination of allergenic 5-alk(en)ylresorcinols in mango (Mangifera indica L.) peel, pulp, and fruit products by high-performance liquid chromatography.

Science.gov (United States)

Knödler, Matthias; Reisenhauer, Katharina; Schieber, Andreas; Carle, Reinhold

2009-05-13

Despite a number of serious case reports of mango dermatitis, no attempts at the identification and quantification of allergenic 5-alk(en)ylresorcinols in mango fruits have so far been made. Therefore, total alk(en)ylresorcinol content and relative homologue composition in 13 mango peel samples and 7 samples of mango pulp were determined by HPLC and LC-MS/MS analyses. Furthermore, mango puree and nectar prepared on pilot plant scale were also analyzed and compared with commercially available thermally preserved products. Depending on cultivar, alk(en)ylresorcinol contents ranged from 79.3 to 1850.5 mg/kg of dry matter (DM) in mango peels and from 4.9 to 187.3 mg/kg of DM in samples of mango pulp. The profile of alk(en)ylresorcinols was found to be highly characteristic, with an average homologue composition of C15:0 (6.1%), C15:1 (1.7%), C17:0 (1.1%), C17:1 (52.5%), C17:2 (33.4%), C17:3 (2.4%), C19:1 (2.1%), and C19:2 (0.8%). Mango puree samples prepared from peeled and unpeeled fruits revealed contents of 3.8 and 12.3 mg/kg of fresh weight, respectively. Content and homologue composition were not significantly affected during puree processing and thermal preservation. In nectar samples prepared from peeled and unpeeled fruits, contents of 1.4 and 4.6 mg/L, respectively, were found.

Quorum Sensing: A Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei

National Research Council Canada - National Science Library

Ulrich, Ricky L; DeShazer, David; Hines, Harry B; Jeddeloh, Jeffrey A

2004-01-01

.... To determine if QS is involved in the virulence of B. mallei, we generated mutations in each putative luxIR homologue and tested the pathogenicities of the derivative strains in aerosol BALB/c mouse and intraperitoneal hamster models...

Quorum Sensing: A transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei

National Research Council Canada - National Science Library

Ulrich, Ricky

2004-01-01

.... To determine if QS is involved in the virulence of B. mallei, we generated mutations in each putative luxIR homologue and tested the pathogenicities of the derivative strains in aerosol BALB/c mouse and intraperitoneal hamster models...

Localization of two mammalian cyclin dependent kinases during mammalian meiosis

NARCIS (Netherlands)

Ashley, T.; Walpita, D.; de rooij, D. G.

2001-01-01

Mammalian meiotic progression, like mitotic cell cycle progression, is regulated by cyclins and cyclin dependent kinases (CDKs). However, the unique requirements of meiosis (homologous synapsis, reciprocal recombination and the dual divisions that segregate first homologues, then sister chromatids)

Lutte chimique contre le Feu bactérien : quelques résultats d'essais

OpenAIRE

Lecomte, Pascal; Larue, P.

1990-01-01

Introduction[br/] 1- Produits homologués[br/] 2- Efficacité et sélectivité[br/] 2.1. Test en contamination artificielle[br/] 2.2. Test en contamination naturelle[br/] 2.3. Sélectivité[br/] Conclusion

ORF Alignment: NT_033777 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NT_033777 gi|24648160 >1mc2A 1 134 1 122 2e-29 ... gb|AAB20876.1| ammodytin L=myotoxi...c phospholipase A2 homologue [Vipera ... ammodytes=European viper, Peptide, 123 aa] ... Length

750-IJBCS-Article-Dr Danho Mathias

African Journals Online (AJOL)

DR GATSING

des extraits de feuilles et de graines de neem (Azadirachta indica) sur le ... insecticide homologué à base de cartap, six traitements avec trois différentes ...... Effects of different neem preparations in comparison to synthetic insecticides on.

GenBank blastx search result: AK107397 [KOME

Lifescience Database Archive (English)

Full Text Available AK107397 002-127-D06 AB052295.1 Brevibacterium fuscum var. dextranlyticum genes for... ABC membrane transporter homologues, putative alpha-glucosidase, isomaltotrio-dextranase precursor, partial and complete cds.|BCT BCT 1e-122 +2 ...

Molecular cloning, sequence analysis and tissue expression of ...

African Journals Online (AJOL)

Proofreader

2017-10-01

Oct 1, 2017 ... p-distance model for amino acid substitutions. A bootstrap .... These were a thymine/cytosine (T/C) SNP and a thymine/adenine (T/A) SNP. ..... Two rat homologues of Drosophila achaete–scute specifically expressed in ...

Linear C32H66 hydrocarbon in the mixed state with C10H22 ...

Indian Academy of Sciences (India)

Unknown

S R Research Laboratory for Studies in Crystallization Phenomena, 10-1-96, ... mixed state with certain shorter chain length homologues (SMOLLENCs), estimated ... Methods. Five hydrocarbons of even carbon numbers, C10, C12, C14, C16 ...

Tar bases in low-temperature coal tar

Energy Technology Data Exchange (ETDEWEB)

Sugiura, S; Ueno, H; Yokoyama, H

1951-01-01

Tar bases were extracted from three fractions, that boil below 260/sup 0/ at 260/sup 0/ to 280/sup 0/, and 280/sup 0/ to 330/sup 0/, respectively, of the low-temperature tar obtained by the carbonization of Ube coal in a Koppers' vertical retort at approximately 750/sup 0/. These were divided, respectively, into three groups, acetate-forming amine, HCl salt-forming bases (I), and CHCl/sub 3/-soluble bases (II), and further fractionally distilled. From the physical and chemical properties of the fractions thus obtained, it was concluded that low-temperature coal tar contained no low boiling pyridine homologues and that, besides higher homologues of pyridine, nonaromatic, more saturated, and less basic compounds of larger atomic weight and smaller refractive index, such as derivatives of pyrrole and indole, also existed as in crude petroleum.

Boron hydride analogues of the fullerenes

International Nuclear Information System (INIS)

Quong, A.A.; Pederson, M.R.; Broughton, J.Q.

1994-01-01

The BH moiety is isoelectronic with C. We have studied the stability of the (BH) 60 analogue of the C 60 fullerene as well as the dual-structure (BH) 32 icosahedron, both of them being putative structures, by performing local-density-functional electronic calculations. To aid in our analysis, we have also studied other homologues of these systems. We find that the latter, i.e., the dual structure, is the more stable although the former is as stable as one of the latter's lower homologues. Boron hydrides, it seems, naturally form the dual structures used in algorithmic optimization of complex fullerene systems. Fully relaxed geometries are reported as well as electron affinities and effective Hubbard U parameters. These systems form very stable anions and we conclude that a search for BH analogues of the C 60 alkali-metal supeconductors might prove very fruitful

Flexibility of cold- and heat-adapted subtilisin-like serine proteinases evaluated with fluorescence quenching and molecular dynamics

DEFF Research Database (Denmark)

Sigtryggsdóttir, Asta Rós; Papaleo, Elena; Thorbjarnardóttir, Sigríður H.

2014-01-01

activity of cold adapted enzymes when compared to homologues from thermophiles, reflects their higher molecular flexibility. To assess a potential difference in molecular flexibility between the two homologous proteinases, we have measured their Trp fluorescence quenching by acrylamide at different......The subtilisin-like serine proteinases, VPR, from a psychrotrophic Vibrio species and aqualysin I (AQUI) from the thermophile Thermus aquaticus, are structural homologues, but differ significantly with respect to stability and catalytic properties. It has been postulated that the higher catalytic...... to Trp (Y191W). A lower quenching effect of acrylamide on the intrinsic fluorescence of the thermophilic AQUI_Y191W was observed at all temperatures measured (10-55°C), suggesting that it possesses a more rigid structure than VPR. The MD analysis (Cα rmsf profiles) showed that even though VPR and AQUI...

Identification of a conserved archaeal RNA polymerase subunit contacted by the basal transcription factor TFB.

Science.gov (United States)

Magill, C P; Jackson, S P; Bell, S D

2001-12-14

Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).

Cloning and expression analysis of a partial LEAFY homologue from ...

African Journals Online (AJOL)

ajl yemi

2011-11-14

Nov 14, 2011 ... 2South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Science, Zhanjiang, Guangdong ... The leaves, stem and fruits of the pineapple plant ... First-strand cDNA was synthesized with M-MLV-.

The Basal Cell Marker p63 and Prostate Stem Cells

National Research Council Canada - National Science Library

Signoretti, Sabina

2002-01-01

...(s) involved in prostate carcinogenesis. The p53-homologue p63 is selectively expressed in the basal cell compartment of a variety of epithelial tissues and p63 deficient mice show severe defects in the development of epithelial organs...

The Basal Cell Marker p63 and Prostate Stem Cells

National Research Council Canada - National Science Library

Signoretti, Sabina

2003-01-01

...(s) involved in prostate carcinogenesis. The p53-homologue p63 is selectively expressed in the basal cell compartment of a variety of epithelial tissues and p63 deficient mice show severe defects in the development of epithelial organs...

The Basal Cell Marker p63 and Prostate Stem Cells

National Research Council Canada - National Science Library

Signoretti, Sabina

2004-01-01

...(s) involved in prostate carcinogenesis. The p53-homologue p63 is selectively expressed in the basal cell compartment of a variety of epithelial tissues and p63 deficient mice show severe defects in the development of epithelial organs...

Abiotic Hydrolysis of Fluorotelomer-Based Polymers as a Source of Perfluorocarboxylates at the Global Scale

Science.gov (United States)

Fluorotelomer-based polymers (FTPs) are the main product of the fluorotelomer industry. For nearly 10 years, whether FTPs degrade to form perfluorooctanoate (PFOA) and perfluorocarboxylate (PFCA) homologues has been vigorously contested. Here we show that circum-neutral abiotic h...

Research Article Molecular cloning and mRNA expression pattern of ...

Indian Academy of Sciences (India)

SAMSUNG

homologue from the brain of Misgurnus anguillicaudatus using homologous cloning and ... developmental processes, including sex determination, embryonic stem cell ..... anguillicaudatus, possibly aiding in unravelling reproductive biology ... significant difference (p < 0.05) between female and male in the same tissue.

Toward an understanding of the molecular mechanisms of barnacle larval settlement: A comparative transcriptomic approach

KAUST Repository

Chen, Zhang-Fan; Matsumura, Kiyotaka; Wang, Hao; Arellano, Shawn M.; Yan, Xingcheng; Alam, Intikhab; Archer, John A.C.; Bajic, Vladimir B.; Qian, Pei-Yuan

2011-01-01

of cyprids; 3) 20 kDa-cement protein homologues were expressed in the cyprid cement gland and probably function during attachment; and 4) receptor tyrosine kinases were expressed higher in cyprid stage and may be involved in signal perception during larval

Pten regulates spindle pole movement through Dlg1-mediated recruitment of Eg5 to centrosomes

NARCIS (Netherlands)

Ree, J.H. van; Nam, H.J.; Jeganathan, K.B.; Kanakkanthara, A.; Deursen, J.M.A. van

2016-01-01

Phosphatase and tensin homologue (Pten) suppresses neoplastic growth by negatively regulating PI(3)K signalling through its phosphatase activity. To gain insight into the actions of non-catalytic Pten domains in normal physiological processes and tumorigenesis, we engineered mice lacking the

Physiological activation of the human cerebral cortex during auditory perception and speech revealed by regional increases in cerebral blood flow

DEFF Research Database (Denmark)

Lassen, N A; Friberg, L

1988-01-01

by measuring regional cerebral blood flow CBF after intracarotid Xenon-133 injection are reviewed with emphasis on tests involving auditory perception and speech, and approach allowing to visualize Wernicke and Broca's areas and their contralateral homologues in vivo. The completely atraumatic tomographic CBF...

Increasing complexity of the bacterial cytoskeleton

DEFF Research Database (Denmark)

Møller-Jensen, Jakob; Löwe, Jan

2005-01-01

Bacteria contain cytoskeletal elements involved in major cellular processes including DNA segregation and cell morphogenesis and division. Distant bacterial homologues of tubulin (FtsZ) and actin (MreB and ParM) not only resemble their eukaryotic counterparts structurally but also show similar...

Evidence of an association between genetic variation of the coactivator PGC-1beta and obesity

DEFF Research Database (Denmark)

Andersen, G; Wegner, L; Yanagisawa, K

2005-01-01

Peroxisome proliferator activated receptor-gamma coactivator-1beta (PGC-1beta) is a recently identified homologue of the tissue specific coactivator PGC-1alpha, a coactivator of transcription factors such as the peroxisome proliferators activated receptors and nuclear respiratory factors. PGC-1...

Synthesis and anticonvulsant activity of novel bicyclic acidic amino acids

DEFF Research Database (Denmark)

Conti, Paola; De Amici, Marco; Joppolo Di Ventimiglia, Samuele

2003-01-01

Bicyclic acidic amino acids (+/-)-6 and (+/-)-7, which are conformationally constrained homologues of glutamic acid, were prepared via a strategy based on a 1,3-dipolar cycloaddition. The new amino acids were tested toward ionotropic and metabotropic glutamate receptor subtypes; both of them...

Pilot-scale bioreactor production and long term stability of feruloyl soy glycerides

Science.gov (United States)

Soybean oil was transesterified with ethyl ferulate at 60 °C using the immobilized lipase Candida antartica lipase B (Novozym 435) to produce a mixture of feruloylated monoacylglycerols and feruloylated diacylglycerols homologues, collectively referred to as feruloylated soy glycerides (FSG). A 1-to...

Hydration of metal β-diketonates and its influence on partition equilibria in solvent extraction

International Nuclear Information System (INIS)

Narbutt, J.

1991-01-01

Studies are reported on the thermodynamics of liquid-liquid partition of beryllium, zinc, chromium and cobalt(3) chelates with acetylacetone, its C 6 and C 7 homologues, and monothioacetylacetone in the system water/aliphatic hydrocarbon. 117 refs., 11 figs., 8 tabs. (author)

In Search of Functional Advantages of Knots in Proteins.

Science.gov (United States)

Dabrowski-Tumanski, Pawel; Stasiak, Andrzej; Sulkowska, Joanna I

2016-01-01

We analysed the structure of deeply knotted proteins representing three unrelated families of knotted proteins. We looked at the correlation between positions of knotted cores in these proteins and such local structural characteristics as the number of intra-chain contacts, structural stability and solvent accessibility. We observed that the knotted cores and especially their borders showed strong enrichment in the number of contacts. These regions showed also increased thermal stability, whereas their solvent accessibility was decreased. Interestingly, the active sites within these knotted proteins preferentially located in the regions with increased number of contacts that also have increased thermal stability and decreased solvent accessibility. Our results suggest that knotting of polypeptide chains provides a favourable environment for the active sites observed in knotted proteins. Some knotted proteins have homologues without a knot. Interestingly, these unknotted homologues form local entanglements that retain structural characteristics of the knotted cores.

Non-essential MCM-related proteins mediate a response to DNA damage in the archaeon Methanococcus maripaludis.

Science.gov (United States)

Walters, Alison D; Chong, James P J

2017-05-01

The single minichromosome maintenance (MCM) protein found in most archaea has been widely studied as a simplified model for the MCM complex that forms the catalytic core of the eukaryotic replicative helicase. Organisms of the order Methanococcales are unusual in possessing multiple MCM homologues. The Methanococcus maripaludis S2 genome encodes four MCM homologues, McmA-McmD. DNA helicase assays reveal that the unwinding activity of the three MCM-like proteins is highly variable despite sequence similarities and suggests additional motifs that influence MCM function are yet to be identified. While the gene encoding McmA could not be deleted, strains harbouring individual deletions of genes encoding each of the other MCMs display phenotypes consistent with these proteins modulating DNA damage responses. M. maripaludis S2 is the first archaeon in which MCM proteins have been shown to influence the DNA damage response.

Fluorescent in-situ hybridization of cattle and sheep chromosomes with cloned human fragile-X DNA

DEFF Research Database (Denmark)

Ali, Ahmd; Thomsen, Preben Dybdahl; Babar, M.E.

2009-01-01

An extensive study on spontaneous and 5-Fluorodeoxyuridine induced fragile sites identified Xq31 in cattle (Bos taurus) and (Xq24, Xq26) in sheep (Ovis aries) in addition to several autosomal fragile sites (under publication). A ZOO-FISH study using three cloned human fragile-X probes with CCG....../CGG(n) trinucleotide repeat sequence was carried out to determine homology between human and bovine fragile-X. The hybridisation results showed only a weak signal on a human chromosome that was not an X with all three fragile site probes. No signals were detected in sheep chromosomes. The signal of all three human...... fragile-X probes on cattle chromosomes was however, medium-prominent sub-centromeric signal on two homologues. BrdU administration in 12 h before harvesting identified these homologues to be chromosome number 5. In addition retrospective slides of cattle and sheep chromosomes used for fragile site studies...

Environmental significance of atmospheric emission resulting from in situ burning of oiled salt marsh

International Nuclear Information System (INIS)

Devai, I.; DeLaune, R.D.; Henry, C.B. Jr.; Roberts, P.O.; Lindau, C.W.

1998-01-01

The environmental significance of atmospheric emissions resulting from in-situ burning used as remediation technique for removal of petroleum hydrocarbons entering Louisiana coastal salt marshes was quantified. Research conducted documented atmospheric pollutants produced and emitted to the atmosphere as the result of burning of oil contaminated wetlands. Samples collected from the smoke plume contained a variety of gaseous sulfur and carbon compounds. Carbonyl sulfide and carbon disulfide were the main volatile sulfur compounds. In contrast, concentrations of sulfur dioxide were almost negligible. Concentrations of methane and carbon dioxide in the smoke plume increased compared to ambient levels. Air samples collected for aromatic hydrocarbons in the smoke plume were dominated by pyrogenic or combustion derived aromatic hydrocarbons. The particulate fraction was dominated by phenanthrene and the C-1 and C-2 alkylated phenanthrene homologues. The vapor fraction was dominated by naphthalene and the C-1 to C-3 naphthalene homologues. (author)

Octadecyltrimethoxysilane functionalized ZnO nanorods as a novel coating for solid-phase microextraction with strong hydrophobic surface.

Science.gov (United States)

Zeng, Jingbin; Liu, Haihong; Chen, Jinmei; Huang, Jianli; Yu, Jianfeng; Wang, Yiru; Chen, Xi

2012-09-21

In this paper, we have, for the first time, proposed an approach by combining self-assembled monolayers (SAMs) and nanomaterials (NMs) for the preparation of novel solid-phase microextraction (SPME) coatings. The self-assembly of octadecyltrimethoxysilane (OTMS) on the surface of ZnO nanorods (ZNRs) was selected as a model system to demonstrate the feasibility of this approach. The functionalization of OTMS on the surface of ZNRs was characterized and confirmed using scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). The OTMS-ZNRs coated fiber exhibited stronger hydrophobicity after functionalization, and its extraction efficiency for non-polar benzene homologues was increased by a factor of 1.5-3.6 when compared to a ZNRs fiber with almost identical thickness and façade. In contrast, the extraction efficiency of the OTMS-ZNRs coated fiber for polar aldehydes was 1.6-4.0-fold lower than that of the ZNRs coated fiber, further indicating its enhanced surface hydrophobicity. The OTMS-ZNRs coated fiber revealed a much higher capacity upon increasing the OTMS layer thickness to 5 μm, leading to a factor of 12.0-13.4 and 1.8-2.5 increase in extraction efficiency for the benzene homologues relative to a ZNRs coated fiber and a commercial PDMS fiber, respectively. The developed HS-SPME-GC method using the OTMS-ZNRs coated fiber was successfully applied to the determination of the benzene homologues in limnetic water samples with recovery ranging from 83 to 113% and relative standard deviations (RSDs) of less than 8%.

Evolution and functional analysis of the Pif97 gene of the Pacific oyster Crassostrea gigas

Directory of Open Access Journals (Sweden)

Xiaotong WANG, Xiaorui SONG, Tong WANG, Qihui ZHU, Guoying MIAO, Yuanxin CHEN, Xiaodong FANG, Huayong QUE, Li LI, Guofan ZHANG

2013-02-01

Full Text Available Mollusc shell matrix proteins (SMPs are important functional components embedded in the shell and play a role in shell formation. A SMP (Pif177 was identified previously from the nacreous layer of the Japanese pearl oyster Pinctada fucata, and its cleavage products (named pfPif97 and pfPif80 proteins were found to bind to the chitin framework and induce aragonite crystal formation and orient the c axis. In this study, a homologue of pfPif177 was cloned from the mantle of the Pacific oyster Crassostrea gigas, containing the homologue of pfPif97 only and not pfPif80. This finding hints at the large divergence in gene structure between the two species. This homologue (cgPif97 shares characteristics with pfPif97, and suggests that the biological functions of these two proteins may be similar. The expression pattern of cgPif97 in different tissues and development stages indicates that it may play an important role in shell formation of the adult oyster. The morphology of the inner shell surface was affected by injected siRNA of cgPif97 and the calcite laths of the shell became thinner and narrower when the siRNA dose increased, suggesting that the cgPif97 gene plays an important role in calcite shell formation in C. gigas. In conclusion, we found evidence that the Pif177 gene evolved very fast but still retains a similar function among species [Current Zoology 59 (1: 109–115, 2013].

The Genetic Basis of Constitutive and Herbivore-Induced ESP-Independent Nitrile Formation in Arabidopsis1[W][OA

Science.gov (United States)

Burow, Meike; Losansky, Anja; Müller, René; Plock, Antje; Kliebenstein, Daniel J.; Wittstock, Ute

2009-01-01

Glucosinolates are a group of thioglucosides that are components of an activated chemical defense found in the Brassicales. Plant tissue damage results in hydrolysis of glucosinolates by endogenous thioglucosidases known as myrosinases. Spontaneous rearrangement of the aglucone yields reactive isothiocyanates that are toxic to many organisms. In the presence of specifier proteins, alternative products, namely epithionitriles, simple nitriles, and thiocyanates with different biological activities, are formed at the expense of isothiocyanates. Recently, simple nitriles were recognized to serve distinct functions in plant-insect interactions. Here, we show that simple nitrile formation in Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 rosette leaves increases in response to herbivory and that this increase is independent of the known epithiospecifier protein (ESP). We combined phylogenetic analysis, a screen of Arabidopsis mutants, recombinant protein characterization, and expression quantitative trait locus mapping to identify a gene encoding a nitrile-specifier protein (NSP) responsible for constitutive and herbivore-induced simple nitrile formation in Columbia-0 rosette leaves. AtNSP1 is one of five Arabidopsis ESP homologues that promote simple nitrile, but not epithionitrile or thiocyanate, formation. Four of these homologues possess one or two lectin-like jacalin domains, which share a common ancestry with the jacalin domains of the putative Arabidopsis myrosinase-binding proteins MBP1 and MBP2. A sixth ESP homologue lacked specifier activity and likely represents the ancestor of the gene family with a different biochemical function. By illuminating the genetic and biochemical bases of simple nitrile formation, our study provides new insights into the evolution of metabolic diversity in a complex plant defense system. PMID:18987211

The genetic basis of constitutive and herbivore-induced ESP-independent nitrile formation in Arabidopsis.

Science.gov (United States)

Burow, Meike; Losansky, Anja; Müller, René; Plock, Antje; Kliebenstein, Daniel J; Wittstock, Ute

2009-01-01

Glucosinolates are a group of thioglucosides that are components of an activated chemical defense found in the Brassicales. Plant tissue damage results in hydrolysis of glucosinolates by endogenous thioglucosidases known as myrosinases. Spontaneous rearrangement of the aglucone yields reactive isothiocyanates that are toxic to many organisms. In the presence of specifier proteins, alternative products, namely epithionitriles, simple nitriles, and thiocyanates with different biological activities, are formed at the expense of isothiocyanates. Recently, simple nitriles were recognized to serve distinct functions in plant-insect interactions. Here, we show that simple nitrile formation in Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 rosette leaves increases in response to herbivory and that this increase is independent of the known epithiospecifier protein (ESP). We combined phylogenetic analysis, a screen of Arabidopsis mutants, recombinant protein characterization, and expression quantitative trait locus mapping to identify a gene encoding a nitrile-specifier protein (NSP) responsible for constitutive and herbivore-induced simple nitrile formation in Columbia-0 rosette leaves. AtNSP1 is one of five Arabidopsis ESP homologues that promote simple nitrile, but not epithionitrile or thiocyanate, formation. Four of these homologues possess one or two lectin-like jacalin domains, which share a common ancestry with the jacalin domains of the putative Arabidopsis myrosinase-binding proteins MBP1 and MBP2. A sixth ESP homologue lacked specifier activity and likely represents the ancestor of the gene family with a different biochemical function. By illuminating the genetic and biochemical bases of simple nitrile formation, our study provides new insights into the evolution of metabolic diversity in a complex plant defense system.

The Spt-Ada-Gcn5 Acetyltransferase (SAGA complex in Aspergillus nidulans.

Directory of Open Access Journals (Sweden)

Paraskevi Georgakopoulos

Full Text Available A mutation screen in Aspergillus nidulans uncovered mutations in the acdX gene that led to altered repression by acetate, but not by glucose. AcdX of A. nidulans is highly conserved with Spt8p of Saccharomyces cerevisiae, and since Spt8p is a component of the Spt-Ada-Gcn5 Acetyltransferase (SAGA complex, the SAGA complex may have a role in acetate repression in A. nidulans. We used a bioinformatic approach to identify genes encoding most members of the SAGA complex in A. nidulans, and a proteomic analysis to confirm that most protein components identified indeed exist as a complex in A. nidulans. No apparent compositional differences were detected in mycelia cultured in acetate compared to glucose medium. The methods used revealed apparent differences between Yeast and A. nidulans in the deubiquitination (DUB module of the complex, which in S. cerevisiae consists of Sgf11p, Sus1p, and Ubp8p. Although a convincing homologue of S. cerevisiae Ubp8p was identified in the A. nidulans genome, there were no apparent homologues for Sus1p and Sgf11p. In addition, when the SAGA complex was purified from A. nidulans, members of the DUB module were not co-purified with the complex, indicating that functional homologues of Sus1p and Sgf11p were not part of the complex. Thus, deubiquitination of H2B-Ub in stress conditions is likely to be regulated differently in A. nidulans compared to S. cerevisiae.

Associations of dietary methyl donor intake with MLH1 promoter hypermethylation and related molecular phenotypes in sporadic colorectal cancer

NARCIS (Netherlands)

Vogel, S. de; Bongaerts, B.W.C.; Wouters, K.A.D.; Kester, A.D.M.; Schouten, L.J.; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Engeland, M. van; Weijenberg, M.P.

2008-01-01

Intake of dietary factors that serve as methyl group donors may influence promoter hypermethylation in colorectal carcinogenesis. We investigated whether dietary folate, vitamin B2 and vitamin B6, methionine and alcohol were associated with mutL homologue 1 (MLH1) hypermethylation and the related

Locked chromophore analogs reveal that photoactive yellow protein regulates biofilm formation in the deep sea bacterium Idiomarina loihiensis

NARCIS (Netherlands)

van der Horst, M.A.; Stalcup, T.P.; Kaledhonkar, S.; Kumauchi, M.; Hara, M.; Xie, A.; Hellingwerf, K.J.; Hoff, W.D.

2009-01-01

Idiomarina loihiensis is a heterotrophic deep sea bacterium with no known photobiology. We show that light suppresses biofilm formation in this organism. The genome of I. loihiensis encodes a single photoreceptor protein: a homologue of photoactive yellow protein (PYP), a blue light receptor with

Functional Analysis of Breast Cancer Susceptibility Gene BRCA2

National Research Council Canada - National Science Library

Wang, Yingcai

1999-01-01

...- specific RecA homologue, but not with XRCC2, Rad51D or the replication Protein (RPA). The specific interaction of BRCA2 and hsDMCl suggests that BRCA2 may be involved in DNA recombination and repair both in germ and somatic cells...

Modulation of N400 in Chronic Non-Fluent Aphasia Using Low Frequency Repetitive Transcranial Magnetic Stimulation (rTMS)

Science.gov (United States)

Barwood, Caroline H. S.; Murdoch, Bruce E.; Whelan, Brooke-Mai; Lloyd, David; Riek, Stephan; O'Sullivan, John D.; Coulthard, Alan; Wong, Andrew

2011-01-01

Low frequency Repetitive Transcranial Magnetic Stimulation (rTMS) has previously been applied to language homologues in non-fluent populations of persons with aphasia yielding significant improvements in behavioral language function up to 43 months post stimulation. The present study aimed to investigate the electrophysiological correlates…

Chasing Great Paths of Helmut “Oxidative Stress” Sies

DEFF Research Database (Denmark)

Majima, H.; Indo, H.; Nakanishi, I.

2016-01-01

Radical Research”. He has clarified our understanding of the causes of chronic developing diseases, and has studied antioxidant factors. In this article, importance of “Oxidative Stress” and our mitochondrial oxidative stress studies; roles of mitochondrial ROS, effects of vitamin E and its homologues...

Single-Molecule Studies of Bacterial Protein Translocation

NARCIS (Netherlands)

Kedrov, Alexej; Kusters, Ilja; Driessen, Arnold J. M.

2013-01-01

In prokaryotes, a large share of the proteins are secreted from the cell through a process that requires their translocation across the cytoplasmic membrane. This process is mediated by the universally conserved Sec system with homologues in the endoplasmic reticulum and thylakoid membranes of

Repression of transcription mediated at a thyroid hormone response element by the v-erb-A oncogene product

DEFF Research Database (Denmark)

Sap, J; Muñoz, A; Schmitt, J

1989-01-01

Several recent observations, such as the identification of the cellular homologue of the v-erb-A oncogene as a thyroid-hormone receptor, have strongly implicated nuclear oncogenes in transcriptional control mechanisms. The v-erb-A oncogene blocks the differentiation of erythroid cells, and changes...

Highlighting of quorum sensing lux genes and their expression in the hydrothermal vent shrimp Rimicaris exoculata ectosymbiontic community. Possible use as biogeographic markers.

Directory of Open Access Journals (Sweden)

Simon Le Bloa

Full Text Available Rimicaris exoculata is a caridean shrimp that dominates the fauna at several hydrothermal vent sites of the Mid-Atlantic Ridge. It has two distinct and stable microbial communities. One of these epibiontic bacterial communities is located in the shrimp gut and has a distribution and role that are poorly understood. The second colonizes its enlarged gill chamber and is involved in host nutrition. It is eliminated after each molt, and has colonization processes reminiscent of those of a biofilm. The presence and expression of genes usually involved in quorum sensing (QS were then studied. At four sites, Rainbow, TAG, Snake Pit and Logatchev, two lux genes were identified in the R. exoculata epibiontic community at different shrimp molt stages and life stages. RT-PCR experiments highlighted lux gene expression activity at TAG, Snake Pit and Rainbow vent sites. Their potential QS activity and their possible roles in epibiont colonization processes are discussed. Moreover, phylogenetic analysis has shown the presence of three clades for luxS (Epsilonproteobacteria and four clades for luxR (Gammaproteobacteria genes, each clade being restricted to a single site. These genes are more divergent than the 16S rRNA one. They could therefore be used as biogeographical genetic markers.

A Lux-like Quorum Sensing System in the Extreme Acidophile Acidithiobacillus ferrooxidans

Directory of Open Access Journals (Sweden)

MARIELLA RIVAS

2005-01-01

Full Text Available The genome of the acidophilic, proteobacterium Acidithiobacillus ferrooxidans, contains linked but divergently oriented genes, termed afeI and afeR, whose predicted protein products are significantly similar to the LuxI and LuxR families of proteins. A possible promoter and Lux box are predicted upstream of afeI. A cloned copy of afeI, expressed in E. coli, encodes an enzyme that catalyzes the production of a diffusible compound identified by gas chromatography and mass spectrometry as an unsubstituted N-acyl homoserine lactone (AHL of chain length C14. This AHL can be detected by a reporter strain of Sinorhizobium meliloti Rm41 suggesting that it is biologically active. The reporter strain also responds to extracts of the supernatant of A. ferrooxidans grown to early stationary phase in sulfur medium indicating that a diffusible AHL is produced by this microorganism. Semi-quantitative RT-PCR experiments indicate that afeI and afeR are expressed maximally in early stationary phase and are more expressed when A. ferrooxidans is grown in sulfur- rather than iron-containing medium. Given the predicted amino acid sequence and functional properties of AfeI and AfeR it is proposed that A. ferrooxidans has a quorum sensing system similar to the LuxI-LuxR paradigm.

CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL

NARCIS (Netherlands)

Bartuzi, Paulina; Billadeau, Daniel D.; Favier, Robert; Rong, Shunxing; Dekker, Daphne; Fedoseienko, Alina; Fieten, Hille; Wijers, Melinde; Levels, Johannes H.; Huijkman, Nicolette; Kloosterhuis, Niels; Van der Molen, Henk; Brufau, Gemma; Groen, Albert K.; Elliott, Alison M.; Kuivenhoven, Jan Albert; Plecko, Barbara; Grangl, Gernot; McGaughran, Julie; Horton, Jay D.; Burstein, Ezra; Hofker, Marten H.; van de Sluis, Bart

2016-01-01

The low-density lipoprotein receptor (LDLR) plays a pivotal role in clearing atherogenic circulating low-density lipoprotein (LDL) cholesterol. Here we show that the COMMD/CCDC22/CCDC93 (CCC) and the Wiskott-Aldrich syndrome protein and SCAR homologue (WASH) complexes are both crucial for endosomal

CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL

NARCIS (Netherlands)

Bartuzi, Paulina; Billadeau, Daniel D.; Favier, Robert; Rong, Shunxing; Dekker, Daphne; Fedoseienko, Alina; Fieten, Hille; Wijers, Melinde; Levels, Johannes H.; Huijkman, Nicolette; Kloosterhuis, Niels; van der Molen, Henk; Brufau, Gemma; Groen, Albert K.; Elliott, Alison M.; Kuivenhoven, Jan Albert; Plecko, Barbara; Grangl, Gernot; McGaughran, Julie; Horton, Jay D.; Burstein, Ezra; Hofker, Marten H.; van de Sluis, Bart

The low-density lipoprotein receptor (LDLR) plays a pivotal role in clearing atherogenic circulating low-density lipoprotein (LDL) cholesterol. Here we show that the COMMD/CCDC22/CCDC93 (CCC) and the Wiskott-Aldrich syndrome protein and SCAR homologue (WASH) complexes are both crucial for endosomal

Targeting of SNAP-23 and SNAP-25 in polarized epithelial cells

NARCIS (Netherlands)

Low, SH; Roche, PA; Anderson, HA; van Ijzendoorn, SCD; Zhang, M; Mostov, KE; Weimbs, T

1998-01-01

SNAP-23 is the ubiquitously expressed homologue of the neuronal SNAP-25, which functions in synaptic vesicle fusion, We have investigated the subcellular localization of SNAP-23 in polarized epithelial cells, In hepatocyte-derived HepG2 cells and in Madin-Darby canine kidney (MDCK) cells, the

Correlation of Mycotoxin Fumonisin B2 Production and Presence of the Fumonisin Biosynthetic Gene fum8 in Aspergillus niger from Grape

Science.gov (United States)

Fumonisins are mycotoxins associated with cancer and several other serious diseases in humans and animals. Production of the mycotoxins has been reported for over two decades in Fusarium species, but has been reported only recently in strains of Aspergillus niger. In addition, a homologue of the f...

Selective inhibition of Sarcocystis neurona calcium-dependent protein kinase 1 for equine protozoal myeloencephalitis therapy

Science.gov (United States)

Sarcocystis neurona is the most frequent cause of Equine Protozoal Myeloencephalitis (EPM), a debilitating neurologic disease of horses that can be difficult to treat. We identified SnCDPK1, the S. neurona homologue of calcium dependent protein kinase 1 (CDPK1), a validated drug target in Toxoplasma...

Identification of a mitochondrial external NADPH dehydrogenase by overexpression in transgenic ¤Nicotiana sylvestris¤

DEFF Research Database (Denmark)

Michalecka, A.M.; Agius, S.C.; Møller, I.M.

2004-01-01

The plant respiratory chain contains a complex setup of non-energy conserving NAD(P)H dehydrogenases, the physiological consequences of which are highly unclear. An expression construct for the potato (Solanum tuberosum L., cv. Desiree) ndb1 gene, a homologue of bacterial and fungal type II NAD...

Ternary mixtures of alkyltriphenylphosphonium bromides (C12 TPB ...

Indian Academy of Sciences (India)

Administrator

Critical Micellar Concentrations (CMCs) by conductometry, but their ternary mixtures produce single ... efficiently quenched pyrene fluorescence; the performances of the homologues in this respect were assessed. Keywords ..... The shape of the amphiphile aggregates ..... Haque M E, Das A R and Moulik S P 1999 J. Colloid.

Efficacité des extraits de neem ( Azadirachta indica ) et de papayer ...

African Journals Online (AJOL)

Efficacité des extraits de neem ( Azadirachta indica ) et de papayer ( Carica papaya ) dans ... Log in or Register to get access to full text downloads. ... non traité, un témoin traité avec un insecticide homologué à base de cartap, six traitements ...

Functional analysis of the ComK protein of Bacillus coagulans

NARCIS (Netherlands)

Kovács, Á.T.; Eckhardt, T.H.; Hartskamp, van M.; Kranenburg, van R.; Kuipers, O.P.

2013-01-01

The genes for DNA uptake and recombination in Bacilli are commonly regulated by the transcriptional factor ComK. We have identified a ComK homologue in Bacillus coagulans, an industrial relevant organism that is recalcitrant for transformation. Introduction of B. coagulans comK gene under its own

Functional Analysis of the ComK Protein of Bacillus coagulans

NARCIS (Netherlands)

Kovacs, Akos; Eckhardt, Thomas; van Kranenburg, Richard; Kuipers, Oscar

2013-01-01

The genes for DNA uptake and recombination in Bacilli are commonly regulated by the transcriptional factor ComK. We have identified a ComK homologue in Bacillus coagulans, an industrial relevant organism that is recalcitrant for transformation. Introduction of B. coagulans comK gene under its own

Glucosinolate diversity within a phylogenetic framework of the tribe Cardamineae (Brassicaceae) unraveled with HPLC-MS/MS and NMR-based analytical distinction of 70 desulfoglucosinolates

DEFF Research Database (Denmark)

Olsen, Carl Erik; Huang, Xiao-Chen; Hansen, Cecilie Ida Cetti

2016-01-01

. This included glucosinolates apparently derived from Met, Phe, Trp, Val/Leu, Ile and higher homologues. Normal side chain elongation and side chain decoration by oxidation or methylation was observed, as well as rare abnormal side chain decoration (hydroxylation of aliphatics at the δ rather than β...

Identification and quantification of 1,3-dimethylbutylamine (DMBA) from Camellia sinensis tea leaves and dietary supplements

Science.gov (United States)

1, 3-Dimethylbutylamine (DMBA), is a CNS stimulant which has recently been identified in multiple dietary supplements and sometimes labeled as a natural constituent of Pouchung tea. DMBA is an homologue of 1,3-dimethylamylamine (DMAA) which the US Food and Drug Administration has attempted to remov...

Regulation of IGF binding protein proteolysis by pregnancy-associated plasma protein-ARegulation of IGF binding protein proteolysis by pregnancy-associated plasma protein-A

DEFF Research Database (Denmark)

Gaidamauskas, Ervinas

During his PhD studies, Ervinas Gaidamauskas researched the proteins pregnancy-associated plasma protein-A (PAPP-A) and its homologue PAPP-A2 in vitro. As suggested by its name, PAPP-A plays an important role in pregnancy and fetal development. Additionally, recent studies indicate a newly...

High levels of Notch signaling down-regulate Numb and Numblike

NARCIS (Netherlands)

Chapman, G.; Liu, L.; Sahlgren, C.; Dahlqvist, C.; Lendahl, U.

2006-01-01

Inhibition of Notch signaling by Numb is critical for many cell fate decisions. In this study, we demonstrate a more complex relationship between Notch and the two vertebrate Numb homologues Numb and Numblike. Although Numb and Numblike at low levels of Notch signaling negatively regulated Notch,

Molecular cloning and characterization of a ToxA-like gene from the maize pathogen Cochliobolus heterostrophus

Science.gov (United States)

ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...

Pharmacology of (S)-homoquisqualic acid and (S)-2-amino-5-phosphonopentanoic acid [(S)-AP5] at cloned metabotropic glutamate receptors

DEFF Research Database (Denmark)

Bräuner-Osborne, Hans; Krogsgaard-Larsen, P

1998-01-01

1 In this study we have determined the pharmacological profile of (S)-quisqualic acid, (S)-2-amino-4-phosphonobutyric acid ((S)-AP4) and their higher homologues (S)-homoquisqualic acid, (S)-2-amino-5-phosphonopentanoic acid ((S)-AP5), respectively, and (R)-AP5 at subtypes of metabotropic (S)-glutamic...... demonstrate that incorporation of an additional carbon atom into the backbone of (S)-glutamic acid and its analogues, to give the corresponding homologues, and replacement of the terminal carboxyl groups by isosteric acidic groups have profound effects on the pharmacological profiles at mGlu receptor subtypes...... acid (mGlu) receptors expressed in Chinese hamster ovary cells. 2 (S)-Quisqualic acid was a potent mGlu1/mGlu5 agonist (EC50 values of 1.1 microM and 0.055 microM, respectively) showing no activity at mGlu2 and weak agonism at mGlu4 (EC50 approximately 1000 microM). 3 (S)-Homoquisqualic acid displayed...

MraZ from Escherichia coli: cloning, purification, crystallization and preliminary X-ray analysis

Energy Technology Data Exchange (ETDEWEB)

Adams, Melanie A.; Udell, Christian M.; Pal, Gour Pada; Jia, Zongchao, E-mail: jia@post.queensu.ca [Department of Biochemistry, Queen’s University, Kingston, Ontario K7L 3N6 (Canada)

2005-04-01

The crystallization and preliminary X-ray diffraction analysis of MraZ, formerly known as hypothetical protein YabB, from Escherichia coli K-12 is presented. The MraZ family of proteins, also referred to as the UPF0040 family, are highly conserved in bacteria and are thought to play a role in cell-wall biosynthesis and cell division. The murein region A (mra) gene cluster encodes MraZ proteins along with a number of other proteins involved in this complex process. To date, there has been no clear functional assignment provided for MraZ proteins and the structure of a homologue from Mycoplasma pneumoniae, MPN314, failed to suggest a molecular function. The b0081 gene from Escherichia coli that encodes the MraZ protein was cloned and the protein was overexpressed, purified and crystallized. This data is presented along with evidence that the E. coli homologue exists in a different oligomeric state to the MPN314 protein.

Overexpression of the essential Sis1 chaperone reduces TDP-43 effects on toxicity and proteolysis

Science.gov (United States)

Park, Sei-Kyoung; Hong, Joo Y.; Arslan, Fatih; Tietsort, Alex; Tank, Elizabeth M. H.; Li, Xingli

2017-01-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease characterized by selective loss of motor neurons with inclusions frequently containing the RNA/DNA binding protein TDP-43. Using a yeast model of ALS exhibiting TDP-43 dependent toxicity, we now show that TDP-43 overexpression dramatically alters cell shape and reduces ubiquitin dependent proteolysis of a reporter construct. Furthermore, we show that an excess of the Hsp40 chaperone, Sis1, reduced TDP-43’s effect on toxicity, cell shape and proteolysis. The strength of these effects was influenced by the presence of the endogenous yeast prion, [PIN+]. Although overexpression of Sis1 altered the TDP-43 aggregation pattern, we did not detect physical association of Sis1 with TDP-43, suggesting the possibility of indirect effects on TDP-43 aggregation. Furthermore, overexpression of the mammalian Sis1 homologue, DNAJB1, relieves TDP-43 mediated toxicity in primary rodent cortical neurons, suggesting that Sis1 and its homologues may have neuroprotective effects in ALS. PMID:28531192

MraZ from Escherichia coli: cloning, purification, crystallization and preliminary X-ray analysis

International Nuclear Information System (INIS)

Adams, Melanie A.; Udell, Christian M.; Pal, Gour Pada; Jia, Zongchao

2005-01-01

The crystallization and preliminary X-ray diffraction analysis of MraZ, formerly known as hypothetical protein YabB, from Escherichia coli K-12 is presented. The MraZ family of proteins, also referred to as the UPF0040 family, are highly conserved in bacteria and are thought to play a role in cell-wall biosynthesis and cell division. The murein region A (mra) gene cluster encodes MraZ proteins along with a number of other proteins involved in this complex process. To date, there has been no clear functional assignment provided for MraZ proteins and the structure of a homologue from Mycoplasma pneumoniae, MPN314, failed to suggest a molecular function. The b0081 gene from Escherichia coli that encodes the MraZ protein was cloned and the protein was overexpressed, purified and crystallized. This data is presented along with evidence that the E. coli homologue exists in a different oligomeric state to the MPN314 protein

Isolation and characterization of CXC receptor genes in a range of elasmobranchs.

Science.gov (United States)

Goostrey, Anna; Jones, Gareth; Secombes, Christopher J

2005-01-01

The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.

Iron metabolism mutant hbd mice have a deletion in Sec15l1, which has homology to a yeast gene for vesicle docking.

Science.gov (United States)

White, Robert A; Boydston, Leigh A; Brookshier, Terri R; McNulty, Steven G; Nsumu, Ndona N; Brewer, Brandon P; Blackmore, Krista

2005-12-01

Defects in iron absorption and utilization lead to iron deficiency and anemia. While iron transport by transferrin receptor-mediated endocytosis is well understood, it is not completely clear how iron is transported from the endosome to the mitochondria where heme is synthesized. We undertook a positional cloning project to identify the causative mutation for the hemoglobin-deficit (hbd) mouse mutant, which suffers from a microcytic, hypochromic anemia apparently due to defective iron transport in the endocytosis cycle. As shown by previous studies, reticulocyte iron accumulation in homozygous hbd/hbd mice is deficient despite normal binding of transferrin to its receptor and normal transferrin uptake in the cell. We have identified a strong candidate gene for hbd, Sec15l1, a homologue to yeast SEC15, which encodes a key protein in vesicle docking. The hbd mice have an exon deletion in Sec15l1, which is the first known mutation of a SEC gene homologue in mammals.

Structure of a thermostable serralysin from Serratia sp. FS14 at 1.1 Å resolution.

Science.gov (United States)

Wu, Dongxia; Ran, Tinting; Wang, Weiwu; Xu, Dongqing

2016-01-01

Serralysin is a well studied metalloprotease, and typical serralysins are not thermostable. The serralysin isolated from Serratia sp. FS14 was found to be thermostable, and in order to reveal the mechanism responsible for its thermostability, the crystal structure of serralysin from Serratia sp. FS14 was solved to a crystallographic R factor of 0.1619 at 1.10 Å resolution. Similar to its homologues, it mainly consists of two domains: an N-terminal catalytic domain and a `parallel β-roll' C-terminal domain. Comparative studies show that the shape of the catalytic active-site cavity is more open owing to the 189-198 loop, with a short 310-helix protruding further from the molecular surface, and that the β-sheets comprising the `parallel β-roll' are longer than those in its homologues. The formation of hydrogen bonds from one of the nonconserved residues (Asn200) to Lys27 may contribute to the thermostability.

Comparing Residue Clusters from Thermophilic and Mesophilic Enzymes Reveals Adaptive Mechanisms.

Science.gov (United States)

Sammond, Deanne W; Kastelowitz, Noah; Himmel, Michael E; Yin, Hang; Crowley, Michael F; Bomble, Yannick J

2016-01-01

Understanding how proteins adapt to function at high temperatures is important for deciphering the energetics that dictate protein stability and folding. While multiple principles important for thermostability have been identified, we lack a unified understanding of how internal protein structural and chemical environment determine qualitative or quantitative impact of evolutionary mutations. In this work we compare equivalent clusters of spatially neighboring residues between paired thermophilic and mesophilic homologues to evaluate adaptations under the selective pressure of high temperature. We find the residue clusters in thermophilic enzymes generally display improved atomic packing compared to mesophilic enzymes, in agreement with previous research. Unlike residue clusters from mesophilic enzymes, however, thermophilic residue clusters do not have significant cavities. In addition, anchor residues found in many clusters are highly conserved with respect to atomic packing between both thermophilic and mesophilic enzymes. Thus the improvements in atomic packing observed in thermophilic homologues are not derived from these anchor residues but from neighboring positions, which may serve to expand optimized protein core regions.

Interpretative approaches to identifying sources of hydrocarbons in complex contaminated environments

International Nuclear Information System (INIS)

Sauer, T.C.; Brown, J.S.; Boehm, P.D.

1993-01-01

Recent advances in analytical instrumental hardware and software have permitted the use of more sophisticated approaches in identifying or fingerprinting sources of hydrocarbons in complex matrix environments. In natural resource damage assessments and contaminated site investigations of both terrestrial and aquatic environments, chemical fingerprinting has become an important interpretative tool. The alkyl homologues of the major polycyclic and heterocyclic aromatic hydrocarbons (e.g., phenanthrenes/anthracenes, dibenzothiophenes, chrysenes) have been found to the most valuable hydrocarbons in differentiating hydrocarbon sources, but there are other hydrocarbon analytes, such as the chemical biomarkers steranes and triterpanes, and alkyl homologues of benzene, and chemical methodologies, such as scanning UV fluorescence, that have been found to be useful in certain environments. This presentation will focus on recent data interpretative approaches for hydrocarbon source identification assessments. Selection of appropriate targets analytes and data quality requirements will be discussed and example cases including the Arabian Gulf War oil spill results will be presented

A Glimpse of the genomic diversity of haloarchaeal tailed viruses

Directory of Open Access Journals (Sweden)

Ana eSencilo

2014-03-01

Full Text Available Tailed viruses are the most common isolates infecting prokaryotic hosts residing hypersaline environments. Archaeal tailed viruses represent only a small portion of all characterized tailed viruses of prokaryotes. But even this small dataset revealed that archaeal tailed viruses have many similarities to their counterparts infecting bacteria, the bacteriophages. Shared functional homologues and similar genome organizations suggested that all microbial tailed viruses have common virion architectural and assembly principles. Recent structural studies have provided evidence justifying this thereby grouping archaeal and bacterial tailed viruses into a single lineage. Currently there are 17 haloarchaeal tailed viruses with entirely sequenced genomes. Nine viruses have at least one close relative among the 17 viruses and, according to the similarities, can be divided into three groups. Two other viruses share some homologues and therefore are distantly related, whereas the rest of the viruses are rather divergent (or singletons. Comparative genomics analysis of these viruses offers a glimpse into the genetic diversity and structure of haloarchaeal tailed virus communities.

EST Table: BY915319 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BY915319 fbpv0592 10/09/28 52 %/103 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 49 %/102 aa FBpp0127246|DanaGF24054-PA 10/08/28 n.h 10/09/1

EST Table: BP124521 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP124521 epV32477 10/09/28 59 %/164 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 55 %/163 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

EST Table: BP123885 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP123885 epV31590 10/09/28 57 %/174 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 55 %/163 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

EST Table: BP125106 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP125106 fbpv0387 10/09/28 58 %/165 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 56 %/165 aa FBpp0212871|DsimGD14469-PA 10/08/28 n.h 10/09/1

EST Table: BP125521 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP125521 fbpv0944 10/09/28 59 %/165 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 56 %/164 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

EST Table: BP125005 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP125005 fbpv0197 10/09/28 58 %/185 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 58 %/173 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

Functional analysis of the conserved transcriptional regulator CfWor1 in Cladosporium fulvum reveals diverse roles in the virulence of plant pathogenic fungi

NARCIS (Netherlands)

Ökmen, B.; Collemare, J.; Griffiths, S.A.; Burgt, van der A.; Cox, R.; Wit, de P.J.G.M.

2014-01-01

Fungal Wor1-like proteins are conserved transcriptional regulators that are reported to regulate the virulence of several plant pathogenic fungi by affecting the expression of virulence genes. Here, we report the functional analysis of CfWor1, the homologue of Wor1 in Cladosporium fulvum. ¿cfwor1

Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

DEFF Research Database (Denmark)

Vorum, H; Liu, X; Madsen, Peder

1998-01-01

By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis

NARCIS (Netherlands)

Giger, Roman J; Wolfer, D P; De Wit, G M; Verhaagen, J

1996-01-01

Semaphorin III/collapsin-1 (semaIII/coll-1) is a chemorepellent that exhibits a repulsive effect on growth cones of dorsal root ganglion neurons. To identify structures that express semaIII/coll-1 in developing mammals, we cloned the rat homologue and performed in situ hybridization on embryonic,

Solid-phase synthesis and pharmacological evaluation of analogues of PhTX-12-A potent and selective nicotinic acetylcholine receptor antagonist

DEFF Research Database (Denmark)

Strømgaard, Kristian; Mellor, Ian R; Andersen, Kim

2002-01-01

Philanthotoxin-12 (PhTX-12) is a novel potent and selective, noncompetitive antagonist of nicotinic acetylcholine receptors (nAChRs). Homologues of PhTX-12 with 7-11 methylene groups between the primary amino group and the aromatic head-group were synthesized using solid-phase methodology. In vitro...

Effect of linguistic experience on the discrimination of Shona lexical ...

African Journals Online (AJOL)

To this effect tone perceptual discrimination was investigated in experiment 1 using minimal pairs of Shona words and their filtered homologues, whereas experiment 2 tested the effect of increasing the number of phonetic contrasts using minimal and non-minimal pairs in Shona words and low-pass filtered stimuli.

Structural and functional studies of a Cu+-ATPase from Legionella pneumophila

DEFF Research Database (Denmark)

Mattle, Daniel

During his studies, Daniel Mattle explored the copper(I) export mechanism of a P-type Cu+ ATPase from Legionella pneumophila – a homologue to the human Cu+ ATPases. Cu+ ATPases are responsible for the homeostatic control of the physiological relevant – but toxic – copper(I) cations. To assess...

Genome-wide pharmacogenetics of antidepressant response in the GENDEP project

DEFF Research Database (Denmark)

Uher, Rudolf; Perroud, Nader; Ng, Mandy Y.M.

2010-01-01

. A set of 72 a priori-selected candidate genes did not show pharmacogenetic associations above a chance level, but an association with response to escitalopram was detected in the interleukin-6 gene, which is a close homologue of IL11. Conclusions: While limited statistical power means that a number...

Immunofluorescence-based screening identifies germ cell associated microRNA 302 as an antagonist to p63 expression

DEFF Research Database (Denmark)

Scheel, Andreas Hans Joachim; Beyer, Ulrike; Agami, Reuven

2009-01-01

The tumor suppressor homologue p63 is required for proper skin and limb development, but specific isoforms of it also act as a "guardian of the germline." To gain insight into the regulation of p63 expression, we performed immunofluorescence-based screening assays. Using a large collection of micro...

Utx Is Required for Proper Induction of Ectoderm and Mesoderm during Differentiation of Embryonic Stem Cells

DEFF Research Database (Denmark)

Morales Torres, Cristina; Laugesen, Anne; Helin, Kristian

2013-01-01

to the establishment of ectoderm and mesoderm in vitro. Interestingly, this contribution is independent of the catalytic activity of Utx. Furthermore, we provide data showing that the Utx homologue, Uty, which is devoid of detectable demethylase activity, and Jmjd3 partly compensate for the loss of Utx. Taken together...

Identification of alkyl dimethylbenzylammonium surfactants in water samples by solid-phase extraction followed by ion trap LC/MS and LC/MS/MS

Science.gov (United States)

Ferrer, I.; Furlong, E.T.

2001-01-01

A novel methodology was developed for the determination of alkyl (C12, C14, and C16) dimethylbenzylammonium chloride (benzalkonium chloride or BAC, Chemical Abstract Service number: 8001-54-5) in water samples. This method is based on solid-phase extraction (SPE) using polymeric cartridges, followed by high-performance liquid chromatography/ion trap mass spectrometry (LC/MS) and tandem mass spectrometry(MS/MS) detection, equipped with an electrospray interface in positive ion mode. Chromatographic separation was achieved for three BAC homologues by using a C18 column and a gradient of acetonitrile/10 millimolar aqueous ammonium formate. Total method recoveries were higher than 71% in different water matrices. The main ions observed by LC/MS were at mass-to-charge ratios (m/z) of 304, 332, and 360, which correspond to the molecular ions of the C12, C14, and C16 alkyl BAC, respectively. The unequivocal structural identification of these compounds in water samples was performed by LC/MS/MS after isolation and subsequent fragmentation of each molecular ion. The main fragmentation observed for the three different homologues corresponded to the loss of the toluyl group in the chemical structure, which leads to the fragment ions at m/z 212, 240, and 268 and a tropylium ion, characteristic of all homologues, at m/z 91. Detection limits for the methodology developed in this work were in the low nanogram-per-liter range. Concentration levels of BAC - ranging from 1.2 to 36.6 micrograms per liter - were found in surface-water samples collected downstream from different wastewater-treatment discharges, thus indicating its input and persistence through the wastewater-treatment process.

Polychlorinated dioxins and furans from the World Trade Center attacks in exterior window films from lower Manhattan in New York City.

Science.gov (United States)

Rayne, Sierra; Ikonomou, Michael G; Butt, Craig M; Diamond, Miriam L; Truong, Jennifer

2005-04-01

Samples of ambient organic films deposited on exterior window surfaces from lower Manhattan and Brooklyn in New York City were collected six weeks after the terrorist attacks at the World Trade Center (WTC) on September 11, 2001 and analyzed for polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/Fs). Total tetra- through octa-CDD/F concentrations in window films within 1 km of the WTC site in lower Manhattan ranged up to 630,000 pg/m2 (estimated as a mass concentration of ca. 1,300,000 pg/ g) and a maximum toxic equivalent (TEQ) concentration of 4700 TEQ/m2 (ca. 10 000 pg TEQ/g). Measurements at a background site 3.5 km away in Brooklyn showed lower concentrations at 130 pg TEQ/m2 (260 pg TEQ/g). Ambient gas-phase PCDD/F concentrations estimated for each site using an equilibrium partitioning model suggested concentrations ranging from ca. 2700 fg-TEQ/m3 near the WTC site to the more typical urban concentration of 20 fg-TEQ/m3 atthe Brooklyn site. Multivariate analyses of 2,3,7,8-substitued congeners and homologue group profiles suggested unique patterns in films near the WTC site compared to that observed at background sites in the study area and in other literature-derived combustion source profiles. Homologue profiles near the WTC site were dominated by tetra-, penta-, and Hexa-CDD/Fs, and 2,3,7,8-substituted profiles contained mostly octa- and hexachlorinated congeners. In comparison, profiles in Brooklyn and near mid-Manhattan exhibited congener and homologue patterns comprised mainly of hepta- and octa-CDDs, similar to that commonly reported in background air and soil.

Different secondary structure elements as scaffolds for protein folding transition states of two homologous four-helix bundles.

Science.gov (United States)

Teilum, Kaare; Thormann, Thorsten; Caterer, Nigel R; Poulsen, Heidi I; Jensen, Peter H; Knudsen, Jens; Kragelund, Birthe B; Poulsen, Flemming M

2005-04-01

Comparison of the folding processes for homologue proteins can provide valuable information about details in the interactions leading to the formation of the folding transition state. Here the folding kinetics of 18 variants of yACBP and 3 variants of bACBP have been studied by Phi-value analysis. In combination with Phi-values from previous work, detailed insight into the transition states for folding of both yACBP and bACBP has been obtained. Of the 16 sequence positions that have been studied in both yACBP and bACBP, 5 (V12, I/L27, Y73, V77, and L80) have high Phi-values and appear to be important for the transition state formation in both homologues. Y31, A34, and A69 have high Phi-values only in yACBP, while F5, A9, and I74 have high Phi-values only in bACBP. Thus, additional interactions between helices A2 and A4 appear to be important for the transition state of yACBP, whereas additional interactions between helices A1 and A4 appear to be important for the transition state of bACBP. To examine whether these differences could be assigned to different packing of the residues in the native state, a solution structure of yACBP was determined by NMR. Small changes in the packing of the hydrophobic side-chains, which strengthen the interactions between helices A2 and A4, are observed in yACBP relative to bACBP. It is suggested that different structure elements serve as scaffolds for the folding of the 2 ACBP homologues. (c) 2005 Wiley-Liss, Inc.

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

Energy Technology Data Exchange (ETDEWEB)

Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F. (Harvard Medical School, Boston, MA (USA))

1988-08-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse

Directory of Open Access Journals (Sweden)

Green Carla B

2001-05-01

Full Text Available Abstract Background Nocturnin was originally identified by differential display as a circadian clock regulated gene with high expression at night in photoreceptors of the African clawed frog, Xenopus laevis. Although encoding a novel protein, the nocturnin cDNA had strong sequence similarity with a C-terminal domain of the yeast transcription factor CCR4, and with mouse and human ESTs. Since its original identification others have cloned mouse and human homologues of nocturnin/CCR4, and we have cloned a full-length cDNA from mouse retina, along with partial cDNAs from human, cow and chicken. The goal of this study was to determine the temporal pattern of nocturnin mRNA expression in multiple tissues of the mouse. Results cDNA sequence analysis revealed a high degree of conservation among vertebrate nocturnin/CCR4 homologues along with a possible homologue in Drosophila. Northern analysis of mRNA in C3H/He and C57/Bl6 mice revealed that the mNoc gene is expressed in a broad range of tissues, with greatest abundance in liver, kidney and testis. mNoc is also expressed in multiple brain regions including suprachiasmatic nucleus and pineal gland. Furthermore, mNoc exhibits circadian rhythmicity of mRNA abundance with peak levels at the time of light offset in the retina, spleen, heart, kidney and liver. Conclusion The widespread expression and rhythmicity of mNoc mRNA parallels the widespread expression of other circadian clock genes in mammalian tissues, and suggests that nocturnin plays an important role in clock function or as a circadian clock effector.

A rigidifying salt-bridge favors the activity of thermophilic enzyme at high temperatures at the expense of low-temperature activity.

Science.gov (United States)

Lam, Sonia Y; Yeung, Rachel C Y; Yu, Tsz-Ha; Sze, Kong-Hung; Wong, Kam-Bo

2011-03-01

Thermophilic enzymes are often less active than their mesophilic homologues at low temperatures. One hypothesis to explain this observation is that the extra stabilizing interactions increase the rigidity of thermophilic enzymes and hence reduce their activity. Here we employed a thermophilic acylphosphatase from Pyrococcus horikoshii and its homologous mesophilic acylphosphatase from human as a model to study how local rigidity of an active-site residue affects the enzymatic activity. Acylphosphatases have a unique structural feature that its conserved active-site arginine residue forms a salt-bridge with the C-terminal carboxyl group only in thermophilic acylphosphatases, but not in mesophilic acylphosphatases. We perturbed the local rigidity of this active-site residue by removing the salt-bridge in the thermophilic acylphosphatase and by introducing the salt-bridge in the mesophilic homologue. The mutagenesis design was confirmed by x-ray crystallography. Removing the salt-bridge in the thermophilic enzyme lowered the activation energy that decreased the activation enthalpy and entropy. Conversely, the introduction of the salt-bridge to the mesophilic homologue increased the activation energy and resulted in increases in both activation enthalpy and entropy. Revealed by molecular dynamics simulations, the unrestrained arginine residue can populate more rotamer conformations, and the loss of this conformational freedom upon the formation of transition state justified the observed reduction in activation entropy. Our results support the conclusion that restricting the active-site flexibility entropically favors the enzymatic activity at high temperatures. However, the accompanying enthalpy-entropy compensation leads to a stronger temperature-dependency of the enzymatic activity, which explains the less active nature of the thermophilic enzymes at low temperatures.

A rigidifying salt-bridge favors the activity of thermophilic enzyme at high temperatures at the expense of low-temperature activity.

Directory of Open Access Journals (Sweden)

Sonia Y Lam

2011-03-01

Full Text Available Thermophilic enzymes are often less active than their mesophilic homologues at low temperatures. One hypothesis to explain this observation is that the extra stabilizing interactions increase the rigidity of thermophilic enzymes and hence reduce their activity. Here we employed a thermophilic acylphosphatase from Pyrococcus horikoshii and its homologous mesophilic acylphosphatase from human as a model to study how local rigidity of an active-site residue affects the enzymatic activity.Acylphosphatases have a unique structural feature that its conserved active-site arginine residue forms a salt-bridge with the C-terminal carboxyl group only in thermophilic acylphosphatases, but not in mesophilic acylphosphatases. We perturbed the local rigidity of this active-site residue by removing the salt-bridge in the thermophilic acylphosphatase and by introducing the salt-bridge in the mesophilic homologue. The mutagenesis design was confirmed by x-ray crystallography. Removing the salt-bridge in the thermophilic enzyme lowered the activation energy that decreased the activation enthalpy and entropy. Conversely, the introduction of the salt-bridge to the mesophilic homologue increased the activation energy and resulted in increases in both activation enthalpy and entropy. Revealed by molecular dynamics simulations, the unrestrained arginine residue can populate more rotamer conformations, and the loss of this conformational freedom upon the formation of transition state justified the observed reduction in activation entropy.Our results support the conclusion that restricting the active-site flexibility entropically favors the enzymatic activity at high temperatures. However, the accompanying enthalpy-entropy compensation leads to a stronger temperature-dependency of the enzymatic activity, which explains the less active nature of the thermophilic enzymes at low temperatures.

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

International Nuclear Information System (INIS)

Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F.

1988-01-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid β precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS

Evolution of neural crest and placodes: amphioxus as a model for the ancestral vertebrate?

Science.gov (United States)

Holland, L. Z.; Holland, N. D.

2001-01-01

Recent studies of protochordates (ascidian tunicates and amphioxus) have given insights into possible ancestors of 2 of the characteristic features of the vertebrate head: neural crest and placodes. The neural crest probably evolved from cells on either side of the neural plate-epidermis boundary in a protochordate ancestral to the vertebrates. In amphioxus, homologues of several vertebrate neural crest marker genes (BMP2/4, Pax3/7, Msx, Dll and Snail) are expressed at the edges of the neural plate and/or adjacent nonneural ectoderm. Some of these markers are also similarly expressed in tunicates. In protochordates, however, these cells, unlike vertebrate neural crest, neither migrate as individuals through embryonic tissues nor differentiate into a wide spectrum of cell types. Therefore, while the protochordate ancestor of the vertebrates probably had the beginnings of a genetic programme for neural crest formation, this programme was augmented in the earliest vertebrates to attain definitive neural crest. Clear homologues of vertebrate placodes are lacking in protochordates. However, both amphioxus and tunicates have ectodermal sensory cells. In tunicates these are all primary neurons, sending axons to the central nervous system, while in amphioxus, the ectodermal sensory cells include both primary neurons and secondary neurons lacking axons. Comparisons of developmental gene expression suggest that the anterior ectoderm in amphioxus may be homologous to the vertebrate olfactory placode, the only vertebrate placode with primary, not secondary, neurons. Similarly, biochemical, morphological and gene expression data suggest that amphioxus and tunicates also have homologues of the adenohypophysis, one of the few vertebrate structures derived from nonneurogenic placodes. In contrast, the origin of the other vertebrate placodes is very uncertain.

Purification and crystallization of Vibrio fischeri CcdB and its complexes with fragments of gyrase and CcdA

International Nuclear Information System (INIS)

De Jonge, Natalie; Buts, Lieven; Vangelooven, Joris; Mine, Natacha; Van Melderen, Laurence; Wyns, Lode; Loris, Remy

2007-01-01

A CcdB homologue from V. fischeri was overexpressed in E. coli and purified. The free protein was crystallized, as were its complexes with fragments of E. coli and V. fischeri gyrase and with the F-plasmid CcdA C-terminal domain. The ccd toxin–antitoxin module from the Escherichia coli F plasmid has a homologue on the Vibrio fischeri integron. The homologue of the toxin (CcdB Vfi ) was crystallized in two different crystal forms. The first form belongs to space group I23 or I2 1 3, with unit-cell parameter a = 84.5 Å, and diffracts to 1.5 Å resolution. The second crystal form belongs to space group C2, with unit-cell parameters a = 58.5, b = 43.6, c = 37.5 Å, β = 110.0°, and diffracts to 1.7 Å resolution. The complex of CcdB Vfi with the GyrA14 Vfi fragment of V. fischeri gyrase crystallizes in space group P2 1 2 1 2 1 , with unit-cell parameters a = 53.5, b = 94.6, c = 58.1 Å, and diffracts to 2.2 Å resolution. The corresponding mixed complex with E. coli GyrA14 Ec crystallizes in space group C2, with unit-cell parameters a = 130.1, b = 90.8, c = 58.1 Å, β = 102.6°, and diffracts to 1.95 Å. Finally, a complex between CcdB Vfi and part of the F-plasmid antitoxin CcdA F crystallizes in space group P2 1 2 1 2 1 , with unit-cell parameters a = 46.9, b = 62.6, c = 82.0 Å, and diffracts to 1.9 Å resolution

Synthesis and pharmacological evaluation of conformationally constrained glutamic acid higher homologues

DEFF Research Database (Denmark)

Tamborini, Lucia; Cullia, Gregorio; Nielsen, Birgitte

2016-01-01

Homologation of glutamic acid chain together with conformational constraint is a commonly used strategy to achieve selectivity towards different types of glutamate receptors. In the present work, starting from two potent and selective unnatural amino acids previously developed by us, we...... investigated the effects on the activity/selectivity profile produced by a further increase in the distance between the amino acidic moiety and the distal carboxylate group. Interestingly, the insertion of an aromatic ring as a spacer produced a low micromolar affinity NMDA ligand that might represent a lead...

Synthesis and pharmacological evaluation of conformationally constrained glutamic acid higher homologues.

Science.gov (United States)

Tamborini, Lucia; Cullia, Gregorio; Nielsen, Birgitte; De Micheli, Carlo; Conti, Paola; Pinto, Andrea

2016-11-15

Homologation of glutamic acid chain together with conformational constraint is a commonly used strategy to achieve selectivity towards different types of glutamate receptors. In the present work, starting from two potent and selective unnatural amino acids previously developed by us, we investigated the effects on the activity/selectivity profile produced by a further increase in the distance between the amino acidic moiety and the distal carboxylate group. Interestingly, the insertion of an aromatic ring as a spacer produced a low micromolar affinity NMDA ligand that might represent a lead for the development of a new class of NMDA antagonists. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ

Directory of Open Access Journals (Sweden)

Dennapa Saeloh

2017-02-01

Full Text Available Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach (in silico, in vitro, and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S- and (R-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states. Calculations of free binding energy showed a higher affinity of FtsZ to (S-rhodomyrtone (−35.92 ± 0.36 kcal mol−1 than the GDP substrate (−23.47 ± 0.25 kcal mol−1 while less affinity was observed in the case of (R-rhodomyrtone (−18.11 ± 0.11 kcal mol−1. In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance.

New Homologues Series of Heterocyclic Schiff Base Ester: Synthesis and Characterization

Directory of Open Access Journals (Sweden)

Yee-Ting Chong

2016-01-01

Full Text Available A homologous series of liquid crystal bearing with heterocyclic thiophene Schiff base ester with alkanoyloxy chain (CH3(CH2nCOO–, where n=4, 6, 8, 10, 12, 14, 16 was successfully synthesized through the modification of some reported methods. The structural information of these compounds was isolated and characterized through some spectroscopic techniques, such as FTIR, 1H, and 13C NMR and elemental analysis. Textural observation was carried out using a polarizing optical microscope (POM over heating and cooling cycles. It was found that all synthesized compounds (3a–g exhibited an enantiotropic nematic phase upon the heating and cooling cycle with high thermal stability. Moreover, a characteristic bar transition texture was observed for compounds 3f and 3g which have shown transition of nematic-to-smectic C phase. This has been further confirmed by obtaining relative phase transition temperature using the differential scanning calorimetry (DSC.

The heme biosynthetic pathway of the obligate Wolbachia endosymbiont of Brugia malayi as a potential anti-filarial drug target.

Directory of Open Access Journals (Sweden)

Bo Wu

2009-07-01

Full Text Available Filarial parasites (e.g., Brugia malayi, Onchocerca volvulus, and Wuchereria bancrofti are causative agents of lymphatic filariasis and onchocerciasis, which are among the most disabling of neglected tropical diseases. There is an urgent need to develop macro-filaricidal drugs, as current anti-filarial chemotherapy (e.g., diethylcarbamazine [DEC], ivermectin and albendazole can interrupt transmission predominantly by killing microfilariae (mf larvae, but is less effective on adult worms, which can live for decades in the human host. All medically relevant human filarial parasites appear to contain an obligate endosymbiotic bacterium, Wolbachia. This alpha-proteobacterial mutualist has been recognized as a potential target for filarial nematode life cycle intervention, as antibiotic treatments of filarial worms harboring Wolbachia result in the loss of worm fertility and viability upon antibiotic treatments both in vitro and in vivo. Human trials have confirmed this approach, although the length of treatments, high doses required and medical counter-indications for young children and pregnant women warrant the identification of additional anti-Wolbachia drugs.Genome sequence analysis indicated that enzymes involved in heme biosynthesis might constitute a potential anti-Wolbachia target set. We tested different heme biosynthetic pathway inhibitors in ex vivo B. malayi viability assays and report a specific effect of N-methyl mesoporphyrin (NMMP, which targets ferrochelatase (FC, the last step. Our phylogenetic analysis indicates evolutionarily significant divergence between Wolbachia heme genes and their human homologues. We therefore undertook the cloning, overexpression and analysis of several enzymes of this pathway alongside their human homologues, and prepared proteins for drug targeting. In vitro enzyme assays revealed a approximately 600-fold difference in drug sensitivities to succinyl acetone (SA between Wolbachia and human 5

Maintaining cell identity

DEFF Research Database (Denmark)

Comet, Itys; Riising, Eva M; Leblanc, Benjamin

2016-01-01

Enhancer of zeste homologue 2 (EZH2), the catalytic subunit of Polycomb repressive complex 2 (PRC2), has attracted broad research attention in the past few years because of its involvement in the development and maintenance of many types of cancer and the use of specific EZH2 inhibitors in clinic...

ALKBH8-mediated formation of a novel diastereomeric pair of wobble nucleosides in mammalian tRNA

DEFF Research Database (Denmark)

van den Born, E.; Vagbo, C. B.; Songe-Moller, L.

2011-01-01

Mammals have nine different homologues (ALKBH1-9) of the Escherichia coli DNA repair demethylase AlkB. ALKBH2 is a genuine DNA repair enzyme, but the in vivo function of the other ALKBH proteins has remained elusive. It was recently shown that ALKBH8 contains an additional transfer RNA ( t...

An extensive microarray analysis of AAL-toxin-induced cell death in Arabidopsis thaliana brings new insights into the complexity of programmed cell death in plants

NARCIS (Netherlands)

Gechev, T.S.; Gadjev, I.Z.; Hille, J.

2004-01-01

A T-DNA knockout of the Arabidopsis homologue of the tomato disease resistance gene Asc was obtained. The asc gene renders plants sensitive to programmed cell death (PCD) triggered by the fungal AAL toxin. To obtain more insights into the nature of AAL-toxin-induced cell death and to identify genes

Expression of EZH2 and Ki-67 in colorectal cancer and associations with treatment response and prognosis

NARCIS (Netherlands)

Fluge, Ø.; Gravdal, K.; Carlsen, E.; Vonen, B.; Kjellevold, K.; Refsum, S.; Lilleng, R.; Eide, T.J.; Halvorsen, T.B.; Tveit, K.M.; Otte, A.P.; Akslen, L.A.; Dahl, O.

2009-01-01

Background: Enhancer of zeste homologue 2 (EZH2) is a member of the Polycomb group of genes that is involved in epigenetic silencing and cell cycle regulation. Methods: We studied EZH2 expression in 409 patients with colorectal cancer stages II and III. The patients were included in a randomised

A new dawn for plant mitochondrial NAD(P)H dehydrogenases

DEFF Research Database (Denmark)

Møller, I.M.

2002-01-01

The expression of complex I and two homologues of bacterial and yeast NADH dehydrogenases, NDA and NDB, have been studied in potato leaf mitochondria. The mRNA level of NDA is completely light dependent and shows a diurnal rhythm with a sharp maximum just after dawn. NDA protein quantity and inte...

Several distinct localization patterns for penicillin-binding proteins in Bacillus subtilis

NARCIS (Netherlands)

Scheffers, Dirk-Jan; Jones, Laura J.F.; Errington, Jeffery

2004-01-01

Bacterial cell shape is determined by a rigid external cell wall. In most non-coccoid bacteria, this shape is also determined by an internal cytoskeleton formed by the actin homologues MreB and/or Mbl. To gain further insights into the topological control of cell wall synthesis in bacteria, we have

Concomitant Craniorachischisis Andomphalocele in a Male Fetus: Prenatal Magnetic Resonance Imaging Findings and Literature Review

Directory of Open Access Journals (Sweden)

Chih-Ping Chen

2009-09-01

Conclusion: Prenatal MRI is able to provide a clear whole-body image of the fetus and its relationship with the placenta. Prenatal MRI is very useful in the differential diagnosis of concomitant craniorachischisis and omphalocele from amniotic band sequence, limb body–wall complex with craniofacial defect and Disorganization human homologue.

AI-2 does not function as a quorum sensing molecule in Campylobacter jejuni during exponential growth in vitro

NARCIS (Netherlands)

Holmes, K.; Tavender, T.J.; Winzer, K.; Wells, J.; Hardie, K.

2009-01-01

Background - Campylobacter jejuni contains a homologue of the luxS gene shown to be responsible for the production of the signalling molecule autoinducer-2 (AI-2) in Vibrio harveyi and Vibrio cholerae. The aim of this study was to determine whether AI-2 acted as a diffusible quorum sensing signal

Feline Lectin Activity Is Critical for the Cellular Entry of Feline Infectious Peritonitis Virus▿

OpenAIRE

Regan, Andrew D.; Ousterout, David G.; Whittaker, Gary R.

2010-01-01

Feline infectious peritonitis is a lethal disease of felids caused by systemic infection with a feline coronavirus. Here, we report identification and analysis of the feline homologue to the human lectin DC-SIGN and show that it is a coreceptor for virulent strains of serotype 1 and serotype 2 feline coronaviruses.

The human E48 antigen, highly homologous to the murine Ly-6 antigen ThB, is a GPI-anchored molecule apparently involved in keratinocyte cell-cell adhesion

NARCIS (Netherlands)

Brakenhoff, R H; Gerretsen, M; Knippels, E M; van Dijk, M.; van Essen, H; Weghuis, D O; Sinke, R J; Snow, G B; van Dongen, G A

The E48 antigen, a putative human homologue of the 20-kD protein present in desmosomal preparations of bovine muzzle, and formerly called desmoglein III (dg4), is a promising target antigen for antibody-based therapy of squamous cell carcinoma in man. To anticipate the effect of high antibody dose

The morphogenesis of the avian Columella auris with special ...

African Journals Online (AJOL)

The columella auris of the ostrich is derived as in the crocodile from three sources; the two upper segments of the hyoid arch (pharyngohyal and epihyal) and a laterohyal component. The latter contributes the homologue of the crocodilian suprastapedial (or lacertilian intercalary) as well as the tympanic process and the ...

Molecular characterization and functional analysis of PR-1-like proteins identified from the wheat head blight fungus Fusarium graminearum

Science.gov (United States)

The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologues are also found in other eukaryotic kingdoms. Studies on non-plant PR-1-like (PR-1L) proteins have been pursued widely in humans/animals but rarely in filamentous ascomycetes. Here we report the ch...

The plant PTS1 receptor : similarities and differences to its human and yeast counterparts

NARCIS (Netherlands)

Wimmer, C; Schmid, Markus; Veenhuis, M; Gietl, C

1998-01-01

Two targeting signals, PTS1 and PTS2, mediate import of proteins into the peroxisomal matrix. We have cloned and sequenced the watermelon (Citrullus vulgaris) cDNA homologue to the PTS1 receptor gene (PEX5). Its gene product, CvPex5p, belongs to the family of tetratricopeptide repeat (TPR)

Large ring polymers align FtsZ polymers for normal septum formation

NARCIS (Netherlands)

Guendogdu, Muhammet E.; Kawai, Yoshikazu; Pavlendova, Nada; Ogasawara, Naotake; Errington, Jeff; Scheffers, Dirk-Jan; Hamoen, Leendert W.; Gündoğdu, Muhammet E.

2011-01-01

Cytokinesis in bacteria is initiated by polymerization of the tubulin homologue FtsZ into a circular structure at midcell, the Z-ring. This structure functions as a scaffold for all other cell division proteins. Several proteins support assembly of the Z-ring, and one such protein, SepF, is required

The regulation of APAF1 expression during development and tumourigenesis

DEFF Research Database (Denmark)

Hickman, E S; Helin, K

2002-01-01

Apoptosis Protease-Activating Factor 1, APAF1, was originally isolated four years ago and shown to be the mammalian homologue of the C. elegans pro-apoptotic ced4 gene. Since then, the expression of APAF1 has been demonstrated to be involved in several cell death pathways, including the induction...

Mirror Neurons, the Representation of Word meaning, and the Foot of the Third Left Frontal Convolution

Science.gov (United States)

de Zubicaray, Greig; Postle, Natasha; McMahon, Katie; Meredith, Matthew; Ashton, Roderick

2010-01-01

Previous neuroimaging research has attempted to demonstrate a preferential involvement of the human mirror neuron system (MNS) in the comprehension of effector-related action word (verb) meanings. These studies have assumed that Broca's area (or Brodmann's area 44) is the homologue of a monkey premotor area (F5) containing mouth and hand mirror…

Human calumenin localizes to the secretory pathway and is secreted to the medium

DEFF Research Database (Denmark)

Vorum, H; Hager, H; Christensen, Birgitte Mønster

1999-01-01

Calumenin belongs to a family of multiple EF-hand proteins that include reticulocalbin, ERC-55, and Cab45. Reticulocalbin and ERC-55 localize to the ER due to a C-terminal HDEL retrieval signal. Cab45 contains a HEEF C-terminal sequence and is localized to the Golgi apparatus. The murine homologue...

Characterization of a chestnut FLORICAULA/LEAFY homologous ...

African Journals Online (AJOL)

Furthermore, the flowering effectiveness of the gene was assessed with transgenic Arabidopsis. CmLFY protein showed a high degree of similarity to PEAFLO (78%), which is a homologue of FLO/LFY from pea. RT-PCR analysis showed that, CmLFY expressed at high levels in inflorescences, but not in young leaves, fruits ...

The POU-er of gene nomenclature

DEFF Research Database (Denmark)

Frankenberg, Stephen R; Frank, Dale; Harland, Richard

2014-01-01

The pluripotency factor POU5F1 (OCT4) is well known as a key regulator of stem cell fate. Homologues of POU5F1 exist throughout vertebrates, but the evolutionary and functional relationships between the various family members have been unclear. The level to which function has been conserved withi...

IDENTIFICATION AND MOLECULAR CLONING OF XENOPUS LAEVIS SP22, A PROTEIN ASSOCIATED WITH FERTILIZATION IN MAMMALS

Science.gov (United States)

ABSTRACTSP22 is a protein that has been characterized in rats where it has been related with fertility. SP22 homologues have been studied in mouse and man and a definitive role for the protein has not been assigned yet. By means of a polyclonal IgG to recombinant rat SP22...

Interactions between the toxin kid of the bacterial parD system and the antitoxins Kis and MazE

NARCIS (Netherlands)

Kamphuis, M.B.; Monti, M.C.; van den Heuvel, R.H.H.; Santos-Sierra, S.; Folkers, G.E.; Lemonnier, M.; Diaz-Orejas, R.; Heck, A.J.R.; Boelens, R.

2007-01-01

The proteins Kid and Kis are the toxin and antitoxin, respectively, encoded by the parD operon of Escherichia coli plasmid R1. Kis prevents the inhibition of E. coli cell growth caused by the RNA cleavage activity of Kid. Overproduction of MazE, the chromosome-encoded homologue of Kis, has been

Doublesex: a conserved downstream gene controlled by diverse ...

Indian Academy of Sciences (India)

The Drosophila doublesex (dsx) gene at the bottom of the sex-determination cascade is the best characterized candidate so far, and is conserved from worms (mab3 of Caenorhabditis elegans) to mammals (Dmrt-1). Studies of dsx homologues from insect species belonging to different orders position them at the bottom of ...

Nuclear electronic equipment for control and monitoring boards. MCH/MENT Recommendations

International Nuclear Information System (INIS)

Roquefort, H.

1975-01-01

The constitution of the group ''Materiel de Controle Homologue - Materiel Electronique Nucleaire pour Tableaux de controle et de commande'' is given. This group has to define, work out, and propose general and particular specifications related to reactor control-board instrumentation. These specifications are useful in France and abroad. Published documents are listed [fr

Behaviour at the indicator scale of the elements Zr, Hf and 104, Nb,Ta and Pa (105) in very complexation media; Comportement a l`echelle des indicateurs des elements Zr, Hf, et 104, Nb, Ta, et Pa (105) en milieux tres complexants

Energy Technology Data Exchange (ETDEWEB)

Monroy Guzman, F. [Institut de Physique Nucleaire, CNRS - IN2P3 Universite Paris Sud, 91406 Orsay Cedex (France)

1997-12-31

In order to determine the chemical properties of the trans-actinide elements of Z = 104 and 105 in aqueous solutions we studied their behaviour to ion exchange resin in different complex media. Due to the very short lifetimes (some tens of seconds) et to the low yield of these elements (a few atoms per irradiation hour) only very fast radiochemical techniques can be used. These severe constraints impose comparative studies of these elements with their most likely homologues to be carried out. The corresponding homologues were the elements of group 4 (Zr and Hf) for the element 104 and the elements of group 5 (Nb and Ta) and also Pa for the element 105. The complexation properties of the elements at indicator scale were determined in the media of HF, NH{sub 4}/HClO{sub 4}, NH{sub 4}SCN/HClO{sub 4}, NH{sub 4}SCN/HF and HCl/HF by ion exchange chromatography. The studies in fluorides media allowed us to identify the complexes in solution and to explain the shape of the experimentally observed sorption curves. The decrease of sorption for higher acid concentration in case of HF/HCl medium was interpreted by formation of chloro-fluoro-complexes. In case of the mixture NH{sub 4}SCN/HF, the particularly pronounced anti-synergic effects were observed and discussed. At the same time studies of the Hf and Ta short-lived isotopes were carried out by means of the RACHEL facility operating by the Orsay Tandem accelerator. These realistic simulations allowed optimization of different production, transportation and separation stages of the trans-actinide elements. The two experiments of 104 element production showed that this element forms in HF very stable anionic complexes similarly to its homologues Zr and Hf. (authors). 181 refs.

Involvement of PlsX and the acyl-phosphate dependent sn-glycerol-3-phosphate acyltransferase PlsY in the initial stage of glycerolipid synthesis in Bacillus subtilis.

Science.gov (United States)

Hara, Yoshinori; Seki, Masahide; Matsuoka, Satoshi; Hara, Hiroshi; Yamashita, Atsushi; Matsumoto, Kouji

2008-12-01

The gene responsible for the first acylation of sn-glycerol-3-phosphate (G3P) in Bacillus subtilis has not yet been determined with certainty. The product of this first acylation, lysophosphatidic acid (LPA), is subsequently acylated again to form phosphatidic acid (PA), the primary precursor to membrane glycerolipids. A novel G3P acyltransferase (GPAT), the gene product of plsY, which uses acyl-phosphate formed by the plsX gene product, has recently been found to synthesize LPA in Streptococcus pneumoniae. We found that in B. subtilis growth arrests after repression of either a plsY homologue or a plsX homologue were overcome by expression of E. coli plsB, which encodes an acyl-acylcarrier protein (acyl-ACP)-dependent GPAT, although in the case of plsX repression a high level of plsB expression was required. B. subtilis has, therefore, a capability to use the acyl-ACP dependent GPAT of PlsB. Simultaneous expression of plsY and plsX suppressed the glycerol requirement of a strict glycerol auxotrophic derivative of the E. coli plsB26 mutant, although either one alone did not. Membrane fractions from B. subtilis cells catalyzed palmitoylphosphate-dependent acylation of [14C]-labeled G3P to synthesize [14C]-labeled LPA, whereas those from DeltaplsY cells did not. The results indicate unequivocally that PlsY is an acyl-phosphate dependent GPAT. Expression of plsX corrected the glycerol auxotrophy of a DeltaygiH (the deleted allele of an E. coli homologue of plsY) derivative of BB26-36 (plsB26 plsX50), suggesting an essential role of plsX other than substrate supply for acyl-phosphate dependent LPA synthesis. Two-hybrid examinations suggested that PlsY is associated with PlsX and that each may exist in multimeric form.

Behaviour at the indicator scale of the elements Zr, Hf and 104, Nb,Ta and Pa (105) in very complexation media; Comportement a l`echelle des indicateurs des elements Zr, Hf, et 104, Nb, Ta, et Pa (105) en milieux tres complexants

Energy Technology Data Exchange (ETDEWEB)

Monroy Guzman, F [Institut de Physique Nucleaire, CNRS - IN2P3 Universite Paris Sud, 91406 Orsay Cedex (France)

1998-12-31

In order to determine the chemical properties of the trans-actinide elements of Z = 104 and 105 in aqueous solutions we studied their behaviour to ion exchange resin in different complex media. Due to the very short lifetimes (some tens of seconds) et to the low yield of these elements (a few atoms per irradiation hour) only very fast radiochemical techniques can be used. These severe constraints impose comparative studies of these elements with their most likely homologues to be carried out. The corresponding homologues were the elements of group 4 (Zr and Hf) for the element 104 and the elements of group 5 (Nb and Ta) and also Pa for the element 105. The complexation properties of the elements at indicator scale were determined in the media of HF, NH{sub 4}/HClO{sub 4}, NH{sub 4}SCN/HClO{sub 4}, NH{sub 4}SCN/HF and HCl/HF by ion exchange chromatography. The studies in fluorides media allowed us to identify the complexes in solution and to explain the shape of the experimentally observed sorption curves. The decrease of sorption for higher acid concentration in case of HF/HCl medium was interpreted by formation of chloro-fluoro-complexes. In case of the mixture NH{sub 4}SCN/HF, the particularly pronounced anti-synergic effects were observed and discussed. At the same time studies of the Hf and Ta short-lived isotopes were carried out by means of the RACHEL facility operating by the Orsay Tandem accelerator. These realistic simulations allowed optimization of different production, transportation and separation stages of the trans-actinide elements. The two experiments of 104 element production showed that this element forms in HF very stable anionic complexes similarly to its homologues Zr and Hf. (authors). 181 refs.

Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.

Directory of Open Access Journals (Sweden)

Bonita J Brewer

2015-12-01

Full Text Available DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs. Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins

Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.

Science.gov (United States)

Brewer, Bonita J; Payen, Celia; Di Rienzi, Sara C; Higgins, Megan M; Ong, Giang; Dunham, Maitreya J; Raghuraman, M K

2015-12-01

DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA)-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial

Purification and crystallization of Vibrio fischeri CcdB and its complexes with fragments of gyrase and CcdA

Energy Technology Data Exchange (ETDEWEB)

De Jonge, Natalie, E-mail: ndejonge@vub.ac.be; Buts, Lieven; Vangelooven, Joris [Department of Molecular and Cellular Interactions, VIB, Pleinlaan 2, 1050 Brussels (Belgium); Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussels (Belgium); Mine, Natacha; Van Melderen, Laurence [Laboratoire de Génétique des Procaryotes, Institut de Biologie et de Médecine, Université Libre de Bruxelles, Gosselies (Belgium); Wyns, Lode; Loris, Remy [Department of Molecular and Cellular Interactions, VIB, Pleinlaan 2, 1050 Brussels (Belgium); Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussels (Belgium)

2007-04-01

A CcdB homologue from V. fischeri was overexpressed in E. coli and purified. The free protein was crystallized, as were its complexes with fragments of E. coli and V. fischeri gyrase and with the F-plasmid CcdA C-terminal domain. The ccd toxin–antitoxin module from the Escherichia coli F plasmid has a homologue on the Vibrio fischeri integron. The homologue of the toxin (CcdB{sub Vfi}) was crystallized in two different crystal forms. The first form belongs to space group I23 or I2{sub 1}3, with unit-cell parameter a = 84.5 Å, and diffracts to 1.5 Å resolution. The second crystal form belongs to space group C2, with unit-cell parameters a = 58.5, b = 43.6, c = 37.5 Å, β = 110.0°, and diffracts to 1.7 Å resolution. The complex of CcdB{sub Vfi} with the GyrA14{sub Vfi} fragment of V. fischeri gyrase crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.5, b = 94.6, c = 58.1 Å, and diffracts to 2.2 Å resolution. The corresponding mixed complex with E. coli GyrA14{sub Ec} crystallizes in space group C2, with unit-cell parameters a = 130.1, b = 90.8, c = 58.1 Å, β = 102.6°, and diffracts to 1.95 Å. Finally, a complex between CcdB{sub Vfi} and part of the F-plasmid antitoxin CcdA{sub F} crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 46.9, b = 62.6, c = 82.0 Å, and diffracts to 1.9 Å resolution.

SEC14 is a specific requirement for secretion of phospholipase B1 and pathogenicity of Cryptococcus neoformans

Science.gov (United States)

Chayakulkeeree, Methee; Johnston, Simon Andrew; Oei, Johanes Bijosono; Lev, Sophie; Williamson, Peter Richard; Wilson, Christabel Frewen; Zuo, Xiaoming; Leal, Ana Lusia; Vainstein, Marilene Henning; Meyer, Wieland; Sorrell, Tania Christine; May, Robin Charles; Djordjevic, Julianne Teresa

2011-01-01

Summary Secreted phospholipase B1 (CnPlb1) is essential for dissemination of Cryptococcus neoformans to the central nervous system (CNS) yet essential components of its secretion machinery remain to be elucidated. Using gene deletion analysis we demonstrate that CnPlb1 secretion is dependent on the CnSEC14 product, CnSec14-1p. CnSec14-1p is a homologue of the phosphatidylinositol transfer protein (PITP) ScSec14p, which is essential for secretion and viability in Saccharomyces cerevisiae. In contrast to CnPlb1, neither laccase 1 (Lac1)-induced melanization within the cell wall nor capsule induction were negatively impacted in CnSEC14-1 deletion mutants (CnΔsec14-1 and CnΔsec14-1CnΔsfh5). Similar to the CnPLB1 deletion mutant (CnΔplb1), CnΔsec14-1 was hypo-virulent in mice and did not disseminate to the CNS by day 14 post infection. Furthermore, macrophage expulsion of live CnΔsec14-1 and CnΔplb1 (vomocytosis) was reduced. Individual deletion of CnSEC14-2, a closely-related CnSEC14-1 homologue, and CnSFH5, a distantly-related SEC fourteen-like homologue, did not abrogate CnPlb1 secretion or virulence. However, reconstitution of CnΔsec14-1 with CnSEC14-1 or CnSEC14-2 restored both phenotypes, consistent with functional genetic redundancy. We conclude that CnPlb1 secretion is SEC14-dependent and that C. neoformans preferentially exports virulence determinants to the cell periphery via distinct pathways. We also demonstrate that CnPlb1 secretion is essential for vomocytosis. PMID:21453402

An immunohistochemical study of the triangular fibrocartilage complex of the wrist: regional variations in cartilage phenotype

Science.gov (United States)

Milz, S; Sicking, B; Sprecher, C M; Putz, R; Benjamin, M

2007-01-01

The triangular fibrocartilage complex (TFCC) transmits load from the wrist to the ulna and stabilizes the distal radioulnar joint. Damage to it is a major cause of wrist pain. Although its basic structure is well established, little is known of its molecular composition. We have analysed the immunohistochemical labelling pattern of the extracellular matrix of the articular disc and the meniscal homologue of the TFCC in nine elderly individuals (age range 69–96 years), using a panel of monoclonal antibodies directed against collagens, glycosaminoglycans, proteoglycans and cartilage oligomeric matrix protein (COMP). Although many of the molecules (types I, III and VI collagen, chondroitin 4 sulphate, dermatan sulphate and keratan sulphate, the oversulphated epitope of chondroitin 6 sulphate, versican and COMP) were found in all parts of the TFCC, aggrecan, link protein and type II collagen were restricted to the articular disc and to entheses. They were thus not a feature of the meniscal homologue. The shift in tissue phenotype within the TFCC, from a fibrocartilaginous articular disc to a more fibrous meniscal homologue, correlates with biomechanical data suggesting that the radial region is stiff and subject to considerable stress concentration. The presence of aggrecan, link protein and type II collagen in the articular disc could explain why the TFCC is destroyed in rheumatoid arthritis, given that it has been suggested that autoimmunity to these antigens results in the destruction of articular cartilage. The differential distribution of aggrecan within the TFCC is likely to be reflected by regional differences in water content and mobility on the radial and ulnar side. This needs to be taken into account in the design of improved MRI protocols for visualizing this ulnocarpal complex of the wrist. PMID:17532798

Functional characterization of viral tumor necrosis factor receptors encoded by cyprinid herpesvirus 3 (CyHV3) genome.

Science.gov (United States)

Yi, Yang; Qi, Hemei; Yuan, Jimin; Wang, Rui; Weng, Shaoping; He, Jianguo; Dong, Chuanfu

2015-08-01

Cyprinid herpesvirus 3 (CyHV3) is a large double-stranded DNA virus of Alloherpesviridae family in the order Herpesvirales. It causes significant morbidity and mortality in common carp and its ornamental koi variety, and threatens the aquaculture industries worldwide. Mimicry of cytokines and cytokine receptors is a particular strategy for large DNA viruses in modulating the host immune response. Here, we report the identification and characterization of two novel viral homologues of tumor necrosis factor receptor (TNFR) encoded by CyHV3-ORF4 and -ORF12, respectively. CyHV3-ORF4 was identified as a homologue of HVEM and CyHV3-ORF12 as a homologue of TNFRSF1. Overexpression of ORF4 and ORF12 in zebrafish embryos results in embryonic lethality, morphological defects and increased apoptosis. Although we failed to identify any interaction between the two vTNFRs and their potential ligands in zebrafish TNF superfamily by yeast two-hybrid system, the expression of some genes in TNF superfamily or TNFR superfamily were mis-regulated in ORF4 or ORF12-overexpressing embryos, especially the death receptor zHDR and its cognate ligand DL1b. Further studies showed that the apoptosis induced by the both CyHV3 vTNFRs is mainly activated through the intrinsic apoptotic pathway and requires the crosstalk between the intrinsic and extrinsic apoptotic pathway. Additionally, using RT-qPCR and Western blot assays, the expression patterns of the both vTNFRs were also analyzed during CyHV3 productive infection. Collectively, this is the first functional study of two unique vTNFRs encoded by a herpesvirus infecting non-mammalian vertebrates, which may provide novel insights into viral immune regulation mechanism and the pathogenesis of CyHV3 infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

TaSYP71, a Qc-SNARE, Contributes to Wheat Resistance against Puccinia striiformis f. sp. tritici

Directory of Open Access Journals (Sweden)

Minjie eLiu

2016-04-01

Full Text Available N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs are involved in plant resistance; however, the role of SYP71 in the regulation of plant–pathogen interactions is not well known. In this study, we characterized a plant-specific SNARE in wheat, TaSYP71, which contains a Qc-SNARE domain. Three homologues are localized on chromosome 1AL, 1BL and 1DL. Using Agrobacterium-mediated transient expression, TaSYP71 was localized to the plasma membrane in Nicotiana benthamiana. Quantitative real-time PCR assays revealed that TaSYP71 homologues was induced by NaCl, H2O2 stress and infection by virulent and avirulent Puccinia striiformis f. sp. tritici (Pst isolates. Heterologous expression of TaSYP71 in Schizosaccharomyces pombe elevated tolerance to H2O2. Meanwhile, H2O2 scavenging gene (TaCAT was downregulated in TaSYP71 silenced plants treated by H2O2 compared to that in control, which indicated that TaSYP71 enhanced tolerance to H2O2 stress possibly by influencing the expression of TaCAT to remove the excessive H2O2 accumulation. When TaSYP71 homologues were all silenced in wheat by the virus-induced gene silencing system, wheat plants were more susceptible to Pst, with larger infection area and more haustoria number, but the necrotic area of wheat mesophyll cells were larger, one possible explanation that minor contribution of resistance to Pst was insufficient to hinder pathogen extension when TaSYP71were silenced, and the necrotic area was enlarged accompanied with the pathogen growth. Of course, later cell death could not be excluded. In addition, the expression of pathogenesis-related genes were down-regulated in TaSYP71 silenced wheat plants. These results together suggest that TaSYP71 play a positive role in wheat defence against Pst.

Effects of UV-B radiation on wax biosynthesis

International Nuclear Information System (INIS)

Barnes, J.; Paul, N.; Percy, K.; Broadbent, P.; McLaughlin, C.; Mullineaux, P.; Creissen, G.; Wellburn, A.

1994-01-01

Two genotypes of tobacco (Nicotiana tabacum L.) were exposed in controlled environment chambers to three levels of biologically effective ultraviolet-B radiation (UV-B BE ; 280-320nm): 0, 4.54 (ambient) and 5.66 (∼ 25% enhancement) kJ m -2 d -1 . After 28 days, the quantity of wax deposited on leaf surfaces was determined gravimetrically; epicuticular wax chemical composition was determined by capillary gas chromatography with homologue assignments confirmed by gas chromatography-mass spectrometry. Leaf wettability was assessed by measuring the contact angle of water droplets placed on leaf surfaces. Tobacco wax consisted of three major hydrocarbon classes: Straight-chain alkanes (C 27 -C 33 ) which comprised ∼ 59% of the hydrocarbon fraction, containing a predominance of odd-chain alkanes with C 31 as the most abundant homologue; branched-chain alkanes (C 25 -C 32 ) which comprised ∼38% of the hydrocarbon fraction with anteiso 3-methyltriacontane (C 30 ) as the predominant homologue; and fatty acids (C 14 -C 18 ) which comprised ∼ 3% of the wax. Exposure to enhanced UV-B radiation reduced the quantity of wax on the adaxial surface of the transgenic mutant, and resulted in marked changes in the chemical composition of the wax on the exposed leaf surface. Enhanced UV-B decreased the quantity of straight-chain alkanes, increased the quantity of branched-chain alkanes and fatty acids, and resulted in shifts toward shorter straight-chain lengths. Furthermore, UV-B-induced changes in wax composition were associated with increased wettability of tobacco leaf surfaces. Overall, the data are consistent with the view that UV-B radiation has a direct and fundamental effect on wax biosynthesis. Relationships between the physico-chemical nature of the leaf surface and sensitivity to UV-B radiation are discussed. (orig.)

The Zygosaccharomyces bailii transcription factor Haa1 is required for acetic acid and copper stress responses suggesting subfunctionalization of the ancestral bifunctional protein Haa1/Cup2.

Science.gov (United States)

Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel

2017-01-13

The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

The structures of nine independent crystals of bitter gourd seed lectin (BGSL), a non-toxic homologue of type II RIPS, and its sugar complexes have been determined. The four-chain, two-fold symmetric, protein is made up of two identical two-chain modules, each consisting of a catalytic chain and a lectin chain, connected ...

Regulation of Mdmx and its role in the p53 pathway

NARCIS (Netherlands)

Meulmeester, Erik

2006-01-01

The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

Isolation and characterisation of a banana CYCD2;1 gene and its ...

African Journals Online (AJOL)

Stimulation of the cell cycle by over-expression of Arabidopsis CyclinD2;1 enhanced growth in tobacco and rice, but not Arabidopsis. To broaden the range of species and to improve an important crop species for developing countries, a CyclinD2;1 homologue was isolated from an East African highland banana cultivar ...

Productivity and biochemical properties of green tea in response to ...

Indian Academy of Sciences (India)

The expression of three homologues of the expansin genes, which regulate plant cell growth, and the CsCHS gene encoding a tea chalcone synthase, which critically regulates the biosynthesis of catechols, were induced in germinal leaves of tea plants following treatment with HpaG1–94 or HpaGXooc. Higher levels of ...

Dpb11/TopBP1 contributes to genomicstability via homologous recombinationand checkpoint signaling

DEFF Research Database (Denmark)

Germann, Susanne Manuela

for recruitment. Also, the chicken homologue TopBP1 colocalizes with RPA1 as well as Rad51 when DNA damage is induced. Previously, dpb11 mutants have been shown to be sensitive to DNA-damaging agents that cause DSBs, DNA alkylation and stalled replication forks. Interestingly, we found the point mutants dpb11-PF...

Soluble and stable heptazethrenebis(dicarboximide) with a singlet open-shell ground state

KAUST Repository

Sun, Zhe; Huang, Kuo-Wei; Wu, Jishan

2011-01-01

A soluble and stable heptazethrene derivative was synthesized and characterized for the first time. This molecule exhibits a singlet biradical character in the ground state, which is the first case among zethrene homologue series. Exceptional stability of this heptazethrenebis(dicarboximide) raises the likelihood of its practical applications in materials science. © 2011 American Chemical Society.

Fate of linear alkylbenzene sulfonate (LAS) in activated sludge plants

NARCIS (Netherlands)

Temmink, B.G.; Klapwijk, A.

2004-01-01

Monitoring data were collected in a pilot-scale municipal activated sludge plant to assess the fate of the C12-homologue of linear alkyl benzene sulfonate (LAS-C12). The pilot-plant was operated at influent LAS-C12 concentrations between 2 and 12 mg/l and at sludge retention times of 10 and 27

Reference: 736 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 736 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u18305482i Negi Juntaro et al. 2008 Mar. Natur...l. CO2 regulator SLAC1 and its homologues are essential for anion homeostasis in plant cells. 7186 483-6 18305482 2008 Mar Nature